Datasets:

ronitHF

/

pubmed-10k

like 0

in spite of the vast advances made by medical science in cancer treatment , infections remain a major cause of morbidity and mortality in patients diagnosed with cancer . the cancer patient is immunocompromised because of the nature of the disease itself and also due to interventions in the form of chemotherapy etc . , in addition , there are usually other associated risk factors for acquiring infection such as long term catheterization , mucositis due to cytotoxic agents , neutropenia , and stem cell transplantation . this increased risk of bacterial infections is further compounded by the rising trends of antibiotic resistance in commonly implicated organisms all over the world . this is particularly true in the case of members of enterobacteriaceae group like escherichia coli and klebsiella pneumoniae and the nonfermenter group of organisms such as acinetobacter spp . in the indian setting . there is already widespread resistance to the cephalosporins as shown by esbl ( extended spectrum -lactamase ) and amp c producers among the enterobacteriaceae . rampant use of antibiotics has unfortunately led to increasing resistance to the carbapenems as well , and this is generally due to carbapenemase production by the organisms . prevalence of metallo - beta - lactamase ( mbl ) producing organisms including new delhi mbl-1 ( ndm-1 ) is also on the rise in india . high rates of methicillin - resistant staphylococcus aureus ( mrsa ) in clinical samples have been noted in one study from north east india . similarly , resistance to the glycopeptide antibiotics such as vancomycin and tiecoplanin among clinical isolates of enterococci is also increasing . empirical treatment of infection in the cancer patient is often arbitrarily attempted by administration of broad spectrum or combination antibiotics until culture , and susceptibility results are available . this could be made more evidence - based if the clinician has adequate information on the spectrum of microorganisms and the antimicrobial susceptibility patterns prevalent in that particular setting . it is possible that these patterns may differ from one geographical region to another and even from one hospital to another . the aim of this study is to document the common organisms isolated in cancer patients and describe their antibiotic susceptibilities . we conducted a 6 month study of all isolates from samples of patients received from medical and surgical oncology units from july 2013 to december 2013 . all relevant samples were collected as per hospital sample collection protocol from various clinical areas ; these included blood , pus / wound swabs , sputum , bronchoalveolar lavage , urine , etc . susceptibility tests were performed as per clinical laboratory standards institute ( clsi , usa ) guidelines 2012 . disc diffusion technique was the default method used for antibiotic susceptibility testing . in brief , lawn cultures of appropriate inoculum of respective organisms were performed in mueller hinton agar ( or mueller - hinton blood agar for fastidious organisms ) and antibiotic discs of required strengths were placed on the surface of the inoculated media and these were then incubated overnight . zones of inhibition were measured the next day and were correlated with clsi interpretive breakpoints to characterize them as sensitive , intermediate , and resistant . for drugs such as colistin for which clsi breakpoints are not available , the european committee on antimicrobial susceptibility testing interpretive breakpoints were used . in the case of other drugs like cefoperazone - sulbactam , cefepime - tazobactam , etc . , interpretive breakpoints were provided by the manufacturer . s. aureus atcc 25923 , e. coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used for quality control . for gram - positive organisms , the antibiotics to be tested and reported were chosen from the following ( depending on the organism isolated ) : penicillin ( 10 units ) , erythromycin ( 15 g ) , clindamycin ( 2 g ) , amoxicillin - clavulanate ( 20/10 g ) , ampicillin ( 10 g ) , cefoxitin ( 30 g ) , ciprofloxacin ( 5 g ) , gentamicin ( 10 g ) , vancomycin ( 30 g / mic ) , teicoplanin ( 30 g ) , linezolid ( 30 g ) , and co - trimoxazole ( 1.25/23.75 g ) . for gram - negative , the antibiotics for respective organisms were chosen from the following : amoxicillin - clavulanate ( 20/10 g ) , ciprofloxacin ( 5 g ) , levofloxacin ( 5 g ) , gentamicin ( 10 g ) , amikacin ( 30 g ) , netilmycin ( 30 g ) , cefuroxime ( 30 g ) , cefoltaxime ( 30 g ) , ceftazidime ( 30 g ) , cefepime ( 30 g ) , cefoperazone - sulbactam ( 75/25 g ) , cefepime - tazobactam ( 30/10 g ) , imipenem ( 10 g ) , and meropenem ( 10 g ) . colistin susceptibility was performed by mic ( minimum inhibitory concentration ) method , with e - test strips . a total of 285 specimens from medical oncology ( 114 ) and surgical oncology services ( 171 ) were cultured . table 1 shows the numbers of various specimens received from medical and surgical oncology services . breakup of specimens received for bacterial culture and sensitivity organism profiles for medical and surgical oncology carbapenem resistance in k. pneumoniae was > 50% . figures 15 provide the detailed antibiotic susceptibility patterns for s. aureus , e. coli , k. pneumoniae , p. aeruginosa , and acinetobacter spp . respectively . staphylococcus aureus susceptibility patterns escherichia coli susceptibility patterns klebsiella pneumoniae susceptibility patterns pseudomonas aeruginosa susceptibility patterns acinetobacter spp . pneumonia and bacteremia are common infections seen in cancer patients followed by a urinary tract , skin and soft tissue and gastrointestinal infections . our study population showed higher numbers of skin and soft tissue infections and lesser numbers of urinary tract infections [ table 1 ] . the greater numbers of stool cultures in our study reflect also the surveillance cultures that are performed for all our bone marrow transplant patients . a wide variety of gram - positive and gram - negative organisms were isolated from clinical samples in our study [ table 2 ] . it is striking to note the high rates of resistance of enetrobacteriaceae particularly e. coli and k. pneumoniae to the third generation cephalosporins ( cefotaxime / ceftazidime ) and also to the -lactam--lactamase inhibitor combinations such as cefoperazone - sulbactam and piperacillin - tazobactam . similar high rates of resistance of these organisms to the third generation cephalosporins have been noted in a multicentric study across karnataka and another study from bhopal . approximately , half of the e. coli and k. pneumoniae isolates in the above studies were esbl producers ; lesser rates were seen in this study suggesting other methods of cephalosporin resistance also playing an important role in our setting . fortunately , more than half of e. coli and p. aeruginosa isolates in our study retained clinically useful susceptibility to aminoglycosides ( gentamicin , amikacin ) and these still have an important role to play in the antibiotic treatment of these organisms in our set up . the rate of carbapenems resistant enterobacteriaceae in the enterobacteriaceae group of organisms particularly e. coli and k. pneumoniae is a worrying factor . it was much higher than a chinese study that showed only 6.6% carbapenem resistance with less than half of them producing the carbapenemases kpc-2 , imp-4 , and ndm-1 . one study has identified ndm-1 from different sites in india , mostly among e. coli and k. pneumoniae and these were highly resistant to all antibiotics except tigecycline and colistin . we did not perform molecular studies to identify the carbapenemases in our setting and were , therefore , unable to characterize them . although the high rate of resistance of p. aeruginosa to piperacillin - tazobactam , amikacin and carbapenems have been described , most isolates in our setting were susceptible to primary antipseudomonals , aminoglycosides , and the carbapenems [ figure 4 ] . the resistance of acinetobacter spp . to aminoglycosides and carbapenems one study from odisha , india showed very high rates of resistance of acinetobacter to ceftazidime ( 93% ) , gentamicin ( 76% ) and meropenem ( 22% ) . k. pneumoniae , and is a cause for concern because there are hardly any antibiotic alternatives left for these patients . we have tested select organisms for older drugs such as chloramphenicol , tetracycline , and chloramphenicol in such cases with limited success . the problem of antibiotic resistance is fortunately not as high among the gram - positive organisms . high rates of methicillin resistance ( manipal [ 54% ] , puducherry [ 72.34% ] , and the emergence of vancomycin intermediate strains of s. aureus have been reported from india . we did not encounter any vancomycin resistance among staphylococci , and mrsa rates have been approximate 41.67% [ figure 1 ] . there is a paucity of studies describing the microbiological profiles and antibiotic susceptibility patterns of organisms isolated from infections in the indian oncology setting and more reports from similar centers would provide greater insights to this very important emerging issue in this patient population . important factors leading to the development of resistance include misuse of antibiotics in clinics and hospitals ; abundant use of antibiotics in animal farms , aquaculture and poultry ; and overuse of anti - infectives and disinfectants . the chennai declaration initiative provides directives and recommendations to tackle the menace of antimicrobial resistance at this level . however , it is also important for every healthcare setting to formulate antibiotic policies based on local antibiotic susceptibility patterns to so that arbitrary use of antibiotics is avoided and resistance is kept to a minimum . there is , in general , a high level of antibiotic resistance among gram - negative bacilli , particularly e. coli , k. pneumoniae and acinetobacter spp . to the cephalosporins , -lactam-lactam inhibitor combinations and carbapenems group of drugs . resistance among gram - positive organisms is not as acute , although the mrsa incidence is increasing .

introduction : this increased risk of bacterial infections in the cancer patient is further compounded by the rising trends of antibiotic resistance in commonly implicated organisms . in the indian setting this is particularly true in case of gram negative bacilli such as escherichia coli , klebsiella pneumoniae and acinetobacter spp . increasing resistance among gram positive organisms is also a matter of concern . the aim of this study was to document the common organisms isolated from bacterial infections in cancer patients and describe their antibiotic susceptibilities.methods:we conducted a 6 month study of all isolates from blood , urine , skin / soft tissue and respiratory samples of patients received from medical and surgical oncology units in our hospital . all samples were processed as per standard microbiology laboratory operating procedures . isolates were identified to species level and susceptibility tests were performed as per clinical laboratory standards institute ( clsi ) guidelines -2012.results : a total of 285 specimens from medical oncology ( 114 ) and surgical oncology services ( 171 ) were cultured . escherichia coli , klebsiella pneumoniae , pseudomonas aeruginosa , staphylococcus aureus and acinetobacter spp . were most commonly encountered . more than half of the acinetobacter strains were resistant to carbapenems . resistance in klebsiella pneumoniae to cephalosporins , fluoroquinolones and carbapenems was > 50% . of the staphylococcus aureus isolates 41.67% were methicillin resistant.conclusion:there is , in general , a high level of antibiotic resistance among gram negative bacilli , particularly e. coli , klebsiella pneumoniae and acinetobacter spp . resistance among gram positives is not as acute , although the mrsa incidence is increasing .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

fibrous dysplasia is not hereditary in nature and it caused by mutation in the gnas1 ( guanine nucleotide binding protein , alpha stimulating activity polypeptide ) gene ( 20q13.2 ) and this gene encodes a g - protein which results in overproduction of camp in the affected tissues . furthermore , there is increased the proliferation of melanocytes thus results in cafe - au - lait spots . fibrous dysplasia has three clinical patterns namely monostotic , polyostotic , craniofacial form . about 3% of lesions associated are with skin pigmentation and hyperfunctioning endocrine disorders known as the mccune albright syndrome . the skull base and proximal metaphysic of femora are two sites most commonly involved . in the skull fd involves skull bases and facial bones . in childhood fd presents as facial asymmetry or a bump , but symmetric expansion of malar prominences and/or frontal bosses may be seen . due to abnormal growth and deformity of craniofacial bones may result in encroachment on cranial nerves . female patients experience increased pain level during pregnancy and during the menstrual cycle because of estrogen receptors found in fd . bianco et al . demonstrated that fd is a disease of bone marrow stromal cells ( bmsc ) . the bmscs form structural framework upon which hematopoiesis occurs in the bone marrow and a subset of bmsc are multipotent stem cells capable of differentiating into multiple cells including osteoblasts , osteocytes , chondrocytes , bone marrow adipocytes and other cells . in fd bmsc differentiate along osteogenic lineage , but differentiation is arrested and instead undergo proliferation giving rise to fibro - osseous masses of tissue . g - protein is central in cell originating pathway leads to the generation of intracellular second messenger , camp / protein kinase a signaling . all mutation in gs alpha identified in association with fd is the 201 position . in > 95% cases arginine is replaced by either cysteine or histidine ( r201c or r201h ) . this result in inhibition of intrinsic gtpase activity of gs alpha protein and it is this aspect that leads to constitutive , ligand - independent generation of intercellular camp . gene amplification techniques such as polymerase chain reaction is now possible to test for genetic mutation in peripheral blood samples . actively formed lesions in adolescents have greatly increased isotope update that corresponds closely to radiographic extent of the lesion . some characteristic feature is bar - shaped pattern , whole - bone involvement and close match between the size of the lesion on radiograph and the size of the area of uptake . the extent of the lesion is visible clearly on computed tomography , and cortical boundary is depicted more clearly than radiograph . the thickness of cortex , endosteal scalloping and periosteal new bone reaction and homogeneity of the poorly mineralized lesional tissue are well demonstrated . delicate trabeculae of immature bone with no osteoblastic rimming enmeshed within a bland fibrous stroma of dysplastic spindle - shaped cells without any cellular features of malignancy . variable number of immature , nonstress oriented , disconnected dysplastic trabeculae floating in a sea of immature mesenchymal cells that have little or no collagen about them . change is noticed . the malignant transformation rate is unknown , but it is likely to be not > 1% . cancer is more likely to occur in polyostotic disease , and most common histological types were osteosarcoma , fibrosarcoma and chondrosarcoma . there are also reports suggesting that the malignant transformation may be more common in mazabraud 's syndrome ( fd in association with intramuscular myxomas ) . the findings in various studies showed that high dose intravenous pamidronate decreases pain and the markers of bone metabolism .

fibrous dysplasia ( fd ) is a benign intramedullary fibro - osseous lesion . fd is a bone developmental anomaly characterized by replacement of normal bone and marrow bone by fibrous tissue . it involves any of the bones as single lesion ( monostotic ) or in multiple bone lesions ( polyostotic ) or all of the skeletal system ( panostotic ) . long bones are most commonly involved , which mostly identified incidentally and clinically appears asymptomatic . clinical , radiographical and histopathological findings will help in confirming the lesion . there are many treatment option available , but still management of fd remains challenging .

Etiology Clinical Features Pathophysiology Diagnosis Malignant Transformation Treatment

a 65-year - old woman was referred to our department because of a recently diagnosed left atrial ( la ) mass . she presented with a five - month history of fever , malaise , and myalgia and had been diagnosed with ventricular septal defect ( vsd ) two years earlier . on physical examination , two - dimensional transthoracic echocardiography showed an la cyst ( 2423 mm ) that was attached to the interatrial septum and detected the trace of blood flow at the margin of the cyst ( fig . 1 ) . the vsd was a small perimembranous type and the pulmonary blood flow to systemic blood flow ratio ( qp / qs ) was 1.2 . the patient underwent surgical treatment . the cystic mass attached to the left side of the interatrial septum was white - pink - yellowish and oval in shape . the cystic mass was widely excised with the atrial septum , leaving the defect in the atrial septum , and the small vsd was closed with two pledgeted sutures without a patch . the defect on the atrial septum was closed with an artificial patch ( polytetraflouroethylene , gore - tex patch ; wl gore & assoc , flagstaff , az , usa ) . histologically , the mass consisted of myxoid cells in abundant loose and myxoid stroma , and the tumor cells were round or polygonal with eosinophilic cytoplasm ( fig . la myxoma is usually a solid , round or polypoid mass without a cystic structure attached to the interatrial septum . the size of the mass ranges from 1 to 15 cm and is usually about 5 to 6 cm . the mass has solid content with a consistency varying according to the amount of collagen it contains . the preoperative diagnosis of a cardiac mass has been enabled by echocardiographic examination . in this case , it was difficult to establish the diagnosis of the mass preoperatively because of its cystic structure without any content . however , we believed that it was not a simple cyst and that surgical excision was needed because she had had constitutional symptoms . myxomas originated from the mesenchymal cells of the septal endocardium and can present as villous , papillary , sessile or pedunculated pattern and were usually divided into round and polypoid type and the majority of them are solid . the types of cystic masses that can appear in la are as follows : myxoma , hydatid cyst , and interatrial septal aneurysm [ 5 - 8 ] . owing to their many structural similarities , it is difficult to establish an accurate diagnosis using preoperative echocardiography . major complications like stroke , rupture , and hemodynamic problems may develop if they are not removed . therefore the surgical excision of an la cyst is reasonable for establishing a definitive diagnosis and preventing sequelae .

cardiac myxomas are the most common primary benign tumors of uncertain etiology . they usually present as polypoid or oval - shaped masses projecting into a heart chamber from the interatrial septum and have a soft , gelatinous consistency without a cystic structure . we report a case of left atrial myxoma with a single cystic form .

CASE REPORT DISCUSSION

between june 2000 and may 2008 , 69 cases of an open reduction and internal fixation with a plate were performed for clavicle midshaft fractures . of them , 41 patients , who could have been followed until bony union was achieved , were reviewed retrospectively . the operative indications were fractures involving 20 mm displacement or shortening , comminuted fractures , fractures with suspected soft tissue interposition that could not be reduced by a closed reduction , open fractures , multiple fractures and fractures with a neurovascular injury . a decision on plate selection was not affected by the indications . in the reconstruction plate group , the mean follow - up period was 13.2 months ( range , 7 to 35 months ) . there were 12 males and 7 females with a mean age of 45.0 years ( range , 22 to 70 years ) . the cause of the injury was a traffic accident in 13 cases , slip down in 3 cases , a sports injury in 1 case , fall down in 1 case and miscellaneous in 1 case . associated injuries were encountered in 15 cases : scapular fracture in 3 cases ( floating shoulder was also noted in 2 of them ) , hemothorax and rib fracture in 2 cases , and acromioclavicular joint dislocation in 1 case . according to robinson 's classification,12 ) the mean interval from injury to operation was 14.4 days ( range , 3 to 44 days ) . in the reconstruction lcp group , the mean follow - up period was 11.9 months ( range , 7 to 24 months ) . there were 17 males and 5 females with an average age of 46.0 years ( range , 19 to 69 years ) . the cause of the injury was a traffic accident in 17 cases , slip down in 3 cases , fall down in 1 case and miscellaneous in 1 case . an associated injury was found in 16 cases : hemothorax and rib fracture in 5 cases , scapular fracture in 3 cases ( floating shoulder was observed in 2 of them ) , and rotator cuff tear in 1 case . the mean interval from injury to surgery was 9.0 days ( range , 1 to 29 days ) ( table 1 ) . a transverse skin incision was made along the superior border of the clavicle under general anesthesia . each plate was contoured to the shape of the clavicle . in the reconstruction lcp group , plate contouring was performed with the locking sleeves inserted into the plate holes to prevent deformation of the holes . to obtain maximum fixation strength , 3 screws were used in the proximal and distal areas , respectively . if necessary , a circlage wire and lag screw were used in cases where fracture reduction could not be achieved due to a severe comminuted fracture with 2 - 3 bone fragments . in cases where severe comminution was observed in the inferior surface of the clavicle , autogenous iliac bone grafting was also performed to avoid nonunion or fixation failure or metal breakage caused by tension . bone grafting was performed in 8 cases in the reconstruction plate group and in 7 cases in the reconstruction lcp group . an arm sling was used for approximately 2 weeks after surgery , and pendulum exercise and active range of motion exercise were then started . for a radiological assessment , the bone union period was compared using radiographic evidence , such as callus formation and trabecular bridging across the fracture site . for the clinical assessment , the quick disability of the arm , shoulder , and hand ( dash ) scores13 ) suggested by the american academy of orthopedic surgeons ( aaos ) between june 2000 and may 2008 , 69 cases of an open reduction and internal fixation with a plate were performed for clavicle midshaft fractures . of them , 41 patients , who could have been followed until bony union was achieved , were reviewed retrospectively . the operative indications were fractures involving 20 mm displacement or shortening , comminuted fractures , fractures with suspected soft tissue interposition that could not be reduced by a closed reduction , open fractures , multiple fractures and fractures with a neurovascular injury . a decision on plate selection was not affected by the indications . in the reconstruction plate group , the mean follow - up period was 13.2 months ( range , 7 to 35 months ) . there were 12 males and 7 females with a mean age of 45.0 years ( range , 22 to 70 years ) . the cause of the injury was a traffic accident in 13 cases , slip down in 3 cases , a sports injury in 1 case , fall down in 1 case and miscellaneous in 1 case . associated injuries were encountered in 15 cases : scapular fracture in 3 cases ( floating shoulder was also noted in 2 of them ) , hemothorax and rib fracture in 2 cases , and acromioclavicular joint dislocation in 1 case . according to robinson 's classification,12 ) the mean interval from injury to operation was 14.4 days ( range , 3 to 44 days ) . in the reconstruction lcp group , the mean follow - up period was 11.9 months ( range , 7 to 24 months ) . there were 17 males and 5 females with an average age of 46.0 years ( range , 19 to 69 years ) . the cause of the injury was a traffic accident in 17 cases , slip down in 3 cases , fall down in 1 case and miscellaneous in 1 case . an associated injury was found in 16 cases : hemothorax and rib fracture in 5 cases , scapular fracture in 3 cases ( floating shoulder was observed in 2 of them ) , and rotator cuff tear in 1 case . the mean interval from injury to surgery was 9.0 days ( range , 1 to 29 days ) ( table 1 ) . a transverse skin incision was made along the superior border of the clavicle under general anesthesia . each plate was contoured to the shape of the clavicle . in the reconstruction lcp group , plate contouring was performed with the locking sleeves inserted into the plate holes to prevent deformation of the holes . to obtain maximum fixation strength , 3 screws were used in the proximal and distal areas , respectively . if necessary , a circlage wire and lag screw were used in cases where fracture reduction could not be achieved due to a severe comminuted fracture with 2 - 3 bone fragments . in cases where severe comminution was observed in the inferior surface of the clavicle , autogenous iliac bone grafting was also performed to avoid nonunion or fixation failure or metal breakage caused by tension . bone grafting was performed in 8 cases in the reconstruction plate group and in 7 cases in the reconstruction lcp group . an arm sling was used for approximately 2 weeks after surgery , and pendulum exercise and active range of motion exercise were then started . for a radiological assessment , the bone union period was compared using radiographic evidence , such as callus formation and trabecular bridging across the fracture site . for the clinical assessment , the quick disability of the arm , shoulder , and hand ( dash ) scores13 ) suggested by the american academy of orthopedic surgeons ( aaos ) the patients ' age , gender , cause of injury , fracture pattern , interval from injury to operation and autogenous bone grafting were no statistically significant difference in the two groups ( p > 0.05 ) . the mean operative time was 102.1 minutes ( range , 70 to 175 minutes ) in the reconstruction group and 99.3 minutes ( range , 40 to 180 minutes ) in the reconstruction lcp group , showing no notable intergroup differences ( p > 0.05 ) . bony union was achieved in all cases after surgery at an average of 14.6 weeks ( range , 8 to 35 weeks ) and 13.2 weeks ( range , 8 to 27 weeks ) in the reconstruction and reconstruction lcp group , respectively , indicating no significant intergroup difference ( p > 0.05 ) . in the clinical assessment , the reconstruction group and reconstruction lcp group showed a mean score of 33.85 ( range , 22.7 to 40.9 points ) and 34.81 points ( range , 22.7 to 81.8 points ) , respectively ( p > 0.05 ) . , there was hypertrophic scarring without pain in 2 cases ( 10.5% ) , limited shoulder motion in 2 cases ( 10.5% ) , painful shoulder in 2 cases ( 10.5% ) , and screw loosening causing neither pain nor functional disability in 3 cases ( 15.8% ) ( fig . , hypertrophic scarring was observed in 4 cases ( 18.2% ) , limited shoulder motion in 1 case ( 4.6% ) and painful shoulder in 1 case ( 4.6% ) , but neither screw loosening nor plate failure were observed ( fig . infection and nonunion was not observed in either group ( table 2 ) ( p > 0.05 ) . most clavicle midshaft fractures are treated conservatively . in 1960 , neer14 ) reported that nonunion occurred only in 3 of the 2,235 patients in whom clavicle midshaft fractures had been treated non - surgically . in 1968 , rowe15 ) reported that nonoperative treatments resulted in nonunion in only 4 out of 566 clavicle midshaft fracture cases , and the surgically treated patients presented with more postoperative complications and nonunion . accordingly , nonoperative treatments have been preferred by many surgeons . however , according to zlowodzki et al.,16 ) nonunion occurred after nonoperative treatments in 6% of 1,145 clavicle midshaft fracture cases and the percentage increased to 15 - 20% particularly in the 159 fracture cases with severe displacement . while only 2% nonunion was noted in the surgically treated cases . in addition , the extent of fragment displacement is closely associated with fracture union12,17 ) and anatomical restoration of the displacement is considered essential for rapid recovery . hence , there has been increasing interest in surgical treatments with open reduction and internal fixation . in particular , operative treatments are performed more often for the treatment of clavicle midshaft fractures due to the increasing instances of severely displaced and comminuted fractures caused by high energy injuries in motor vehicle accidents , industrial accidents and sport injuries.6,7 ) shen et al.11 ) obtained satisfactory outcomes in 94% of the 232 cases by open reduction and plate fixation . in 2007 , the canadian orthopaedic trauma society reported that internal fixation with plates resulted in more rapid union , excellent clinical outcomes , and lower complication rates in 132 patients with displaced clavicle fractures than nonoperative treatments.18 ) the operative methods for the treatment of clavicle midshaft fractures involve intramedullary k - wire fixation or steinmann pin fixation and plate fixation . the procedures using the former two materials result in low resistance to torque , carry risks of pin loosening and infection , and require a long - term fixation period.19,20 ) open reduction and internal fixation with plates , such as sherman plates , dynamic compression plates , and semitubular plates , can be effective in obtaining anatomical reduction , applying direct compression to the fracture site , and producing resistance to torque . however , it is disadvantageous in achieving firm fixation because it is difficult to hold the plates to the clavicle in severely comminuted fracture cases.21 ) in contrast , reconstruction plates can be manipulated to fit the contour of the clavicle and fracture pattern to obtain firm fixation , are lighter and thinner than dynamic compression plates and are durable to multidirectional mechanical stress imposed on the fracture site.11,22 ) on the other hand , penetration of the opposite cortical bone for screw fixation may cause damage to the subclavian artery and firm fixation can be difficult to maintain in osteoporotic patients over 50 years of age.23,24 ) in this study , the use of reconstruction plates did not result in complications , such as subclavian artery in juries and brachial plexus injuries , but 3 cases of screw loosening occurred during the follow - up period . although nonunion , pain , or functional disabilities were not observed in these cases , it is believed that reconstruction lcps could be used as an alterative to reconstruction plates to reduce the number of complications . the advantages of reconstruction lcps include strong fixation due to locking between the screw and plate , and blood supply preservation due to minimal contact between plate and cortical bone.25,26 ) with conventional screws and plates , fracture site stability is provided by friction between the plate and bone cortex . when an lcp is used , an external force is transmitted from the cortical bone through the conically threaded plate hole to the plate because the screw head is locked firmly in the threaded plate hole . therefore , the plate does not need to be compressed onto the cortical bone for stability , which results in good preservation of the blood supply , and the plate thread is also helpful in preventing screw loosening or instability.27,28 ) when lcps are used to treat clavicle midshaft fractures , the risks of injury to the subclavicular artery or brachial plexus can be reduced because fixation can be achieved without the tip of the screw reaching the opposite bone cortex and periosteal stripping can be minimized to promote rapid union.27 ) it is believed that the surgery time can be reduced using lcps because accurate plate contouring is not necessary and periosteal stripping could be minimized using self tapping screws . however , there were no significant differences between the reconstruction plate group and reconstruction lcp group in terms of the union period , surgical time , and quick dash score . nevertheless , a reconstruction lcp can be an effective replacement for a reconstruction plate considering that complications , such as screw loosening and plate failure , were not observed in the reconstruction lcp group . contour of the plates was performed with locking sleeves inserted into screw holes considering the problem of lcps that screw fixation can be weakened if breakage of the screw holes occurs in the plate thread during plate contouring . unfortunately , surgical treatments for clavicle fractures leave distinct scars on the shoulder . ali khan and lucas29 ) suggested in 1978 that patients with clavicle midshaft fractures could suffer from hypertrophic scarring after surgical treatments with plates . six of our patients had hypertrophic scarring after surgery and complained of discomfort in carrying out their daily activities . however , none of them had associated pain or requested cosmetic surgery . however , the patients should be informed of the possible appearance of surgical scars preoperatively and surgical techniques should be improved to address the problem . the conclusions drawn from this analysis can not be generalized because of the small number of cases and that the study design was retrospective . therefore , the efficacy of a reconstruction plate and reconstruction lcp for the treatment of midshaft clavicle fractures should be tested in prospective studies involving a larger number of cases . in conclusion , bony union could be achieved in both the reconstruction and reconstruction lcp groups and the clinical outcomes were satisfactory . overall , operative procedures using reconstruction plate or reconstruction lcp , which can be shaped to match the contour of the clavicle , can be effective in the treatment of clavicle midshaft fractures .

backgroundto compare the outcomes of reconstruction plate and reconstruction locking compression plate ( lcp ) for the treatment of clavicle midshaft fractures.methodsforty one patients with a clavicle midshaft fracture were treated by internal fixation with a reconstruction plate ( 19 patients ) or reconstruction lcp ( 22 patients ) . the clinical and radiological results were evaluated according to the quick disability of the arm , shoulder , and hand ( dash ) score and plain radiographs.resultsthe mean time to union was 14.6 weeks in the reconstruction plate group compared to 13.2 weeks in the reconstruction lcp group ( p > 0.05 ) . the mean score to quick dash was 33.85 points in the reconstruction plate group compared to 34.81 points in the reconstruction lcp group ( p > 0.05 ) . the complications in the reconstruction plate were hypertrophic scarring in 2 cases , painful shoulder in 2 cases , limitation of shoulder motion in 2 cases , and screw loosening in 3 cases . in addition , the complications in the reconstruction lcp group was hypertrophic scarring in 4 cases , painful shoulder in 1 case and a limitation of shoulder motion in 1case ( p > 0.05).conclusionsthis study showed radiologically and clinically satisfactory results in both groups . overall , operative treatment with a reconstruction plate or reconstruction lcp for clavicle shaft fractures can be used to obtain stable fixation .

METHODS Materials Operative Technique and Rehabilitation Assessment of Treatment Outcomes RESULTS DISCUSSION

many diseases of high public health importance , such as type 2 diabetes and metabolic syndrome , are profoundly influenced by obesity status ( 1 ) . however , individuals with a similar body mass index ( bmi ) can exhibit substantially different metabolic profiles for glucose tolerance , lipids , and blood pressure . in the nhanes study , adult population ) exhibit a better metabolic profile than age - adjusted bmi expectations and are categorized as metabolically healthy obese an increase in white adipose tissue ( wat ) mass in response to chronic positive energy imbalance is a defining feature of obesity . however , several structural / histological characteristics and depot - specific ( subcutaneous and visceral ) distributions of adipose tissue differ between metabolically healthy and unhealthy obese individuals ( 4 ) . the location and cellular mechanisms of tissue expansion ( hyperplasia and hypertrophy ) greatly affect the normal physiological function of adipose tissue ( 5 ) . this process may be mechanistically linked to the development of obesity - associated metabolic disorders ( 6;7 ) . we and others have shown significant dysregulation in the adipose tissue transcriptome with obesity ( 811 ) . many genes are correlated with obesity ( bmi ) and adiposity ( % fat mass ) . however , pinpointing which defining genes underlie the heterogeneity of metabolic features among obese individuals and determine metabolically healthy and unhealthy phenotypes remains challenging . the purpose of this study is to identify an adipose tissue transcriptomic signature that may determine metabolic health in obese subjects . defining metabolically healthy and unhealthy obese subjects based on clinical and biochemical characteristics is difficult ( 2;3 ) . thus , we performed unsupervised hierarchical clustering analysis using data from obesity - associated adipose tissue transcripts to first identify comparatively homogenous sub - groups among obese subjects . we hypothesized that these transcriptionally homogenous sub - groups could differ in metabolic characteristics , and that a subset of obesity - associated transcripts in subcutaneous adipose tissue are involved in defining metabolic health in obese subjects . we then performed additional statistical and bioinformatics analyses to compare sub - groups of obese subjects . the sample included a subset ( 30 obese men and women ) from the 170 subjects recruited for the university of arkansas for medical sciences ( uams ) gene expression study ( 8;12 ) . these 30 subjects were all obese ( bmi 30 kg / m ) , non - diabetic , and 40 years old . they had been characterized by frequently sampled intravenous glucose tolerance tests ( fsivgt ) , and genome - wide gene expression data were available from subcutaneous adipose tissue biopsy samples . three additional subjects met the selection criteria mentioned above , but genome wide expression data of acceptable quality were unobtainable for these subjects . methods for recruitment , physical examination , physiological experiments , and obtaining biopsies have been published . in brief , european - american or african - american men and women in general good health , between 19 and 60 years of age , and had a bmi between 19 and 45 kg / m were recruited . all participants had a screening visit , at which time height , weight , and waist and hip circumference were measured ; body fat was determined by dual x - ray absorptiometry ( dxa ) scan ( hologic qdr-4500 ) ; fasting blood samples for lipid measurements were taken ; and a standard 75-g oral glucose tolerance test ( ogtt ) was done . at the second visit , adipose biopsies were obtained from fasting subjects . insulin modified ( 0.03 u / kg ) frequently sampled intravenous glucose tolerance tests ( fsigt ) were performed to determine insulin sensitivity ( si ) and acute insulin response ( airg ) . biopsies were obtained from abdominal subcutaneous fat near the umbilicus under local anesthesia ( lidocaine ) using a bergstrom needle . each biopsy is made by opening the bergstrom needle and applying suction using a 120 ml syringe . samples were rinsed immediately in sterile normal saline , quick - frozen in liquid nitrogen , and stored at 80c for further use . our current study was approved by the institutional review board at wake forest school of medicine . insulin was measured by the uams clinical research center core laboratory using an immuno - chemiluminometric assay ( invitron limited , monmouth , uk ) . plasma triglyceride , total cholesterol , and hdl cholesterol concentrations were measured directly ( at labcorp ) by enzymatic colorimetric methods . total rna was isolated from whole adipose tissue using the rnaeasy lipid tissue mini kit ( qiagen inc - usa , valencia , ca ) . the quantity and quality of the isolated total rna samples were determined by ultraviolet spectrophotometry ( nanodrop , thermo scientific , pittsburgh , pa ) and electrophoresis ( experion nucleic acid analyzer , biorad laboratories , inc . , hercules , ca ) , respectively . high - quality rna with rin ( rna integrity number ) > 8 was used for genome - wide transcriptome analysis . genome - wide transcriptome analysis and initial array processing were done at the center for human genomics core laboratory ( wake forest school of medicine ) using humanht-12 v4 expression beadchip ( illumina , san diego , ca ) whole genome gene expression arrays according to the vendor - recommended standard protocol ( 8) . raw expression intensity was background subtracted and normalized by the average normalization algorithm as implemented in genomestudio gene expression module v1.0 application software ( illumina ) . we performed unsupervised hierarchical clustering to identify homogeneous groups among obese subjects based on adipose tissue transcript expression . a dissimilarity matrix based on pearson s correlation coefficient between each individual was generated using z - score - normalized values for each probe and seriation under multiple fragment heuristics . the hierarchical clustering - based tree and heat map was generated using mcquitty s criteria implemented in permutmatrix version 1.9.3en software ( 13 ) . for the current analysis , we chose a set of 1595 obesity - associated probes ( associated with % fat mass and bmi independent of age , gender and race ) that may define the heterogeneity of metabolic features among obese individuals , based on our previous study ( 8) . to estimate the differences in gluco- and cardio - metabolic phenotypes between the two groups ( two major groups / clusters assigned by unsupervised hierarchical clustering analysis ) , we used nonparametric mann - whitney u - test and univariate analysis of variance , with age , gender , and race as covariates . to identify the transcripts with significantly different expression between the two groups , we utilized nonparametric wilcoxon statistics on normalized data as implemented in statistical analysis for microarray ( sam ) software ( 14 ) . we considered results significant for a false discovery rate ( q value ) 5% , and fold difference between groups of > 1.5 , based on 1000 permutations . additional validation of sam analysis was performed by t - test ( p 0.05 ) on log2 transformed expression data . bioinformatic analysis was performed to investigate the enrichment of differentially expressed genes in known biological pathways or gene ontology ( go ) categories . we performed canonical pathway analysis and interaction network analysis of differentially expressed genes using ingenuity pathway analysis ( ipa ; https://analysis.ingenuity.com , build version : 313398 m ; content version : 18841524 ) . pathways with a corrected p - value ( benjamini and hochberg p - value ) 0.05 were considered significantly enriched in our gene lists . additional annotations of differentially expressed genes were performed by singular enrichment analysis ( sea ) using the david v6.7 functional annotation tool ( http://david.abcc.ncifcrf.gov/)(15 ) . detailed analysis parameters for sea using the functional annotation chart module of david are described elsewhere ( 9 ) . in the sea analysis , a category with a gene count > 5 , an ease score 0.05 ( modified fisher s exact p - value ) , and fdr 5% was considered as a significant threshold . we performed unsupervised hierarchical clustering to identify homogeneous groups among obese subjects based on adipose tissue transcript expression . a dissimilarity matrix based on pearson s correlation coefficient between each individual was generated using z - score - normalized values for each probe and seriation under multiple fragment heuristics . the hierarchical clustering - based tree and heat map was generated using mcquitty s criteria implemented in permutmatrix version 1.9.3en software ( 13 ) . for the current analysis , we chose a set of 1595 obesity - associated probes ( associated with % fat mass and bmi independent of age , gender and race ) that may define the heterogeneity of metabolic features among obese individuals , based on our previous study ( 8) . to estimate the differences in gluco- and cardio - metabolic phenotypes between the two groups ( two major groups / clusters assigned by unsupervised hierarchical clustering analysis ) , we used nonparametric mann - whitney u - test and univariate analysis of variance , with age , gender , and race as covariates . to identify the transcripts with significantly different expression between the two groups , we utilized nonparametric wilcoxon statistics on normalized data as implemented in statistical analysis for microarray ( sam ) software ( 14 ) . we considered results significant for a false discovery rate ( q value ) 5% , and fold difference between groups of > 1.5 , based on 1000 permutations . additional validation of sam analysis was performed by t - test ( p 0.05 ) on log2 transformed expression data . bioinformatic analysis was performed to investigate the enrichment of differentially expressed genes in known biological pathways or gene ontology ( go ) categories . we performed canonical pathway analysis and interaction network analysis of differentially expressed genes using ingenuity pathway analysis ( ipa ; https://analysis.ingenuity.com , build version : 313398 m ; content version : 18841524 ) . pathways with a corrected p - value ( benjamini and hochberg p - value ) 0.05 were considered significantly enriched in our gene lists . additional annotations of differentially expressed genes were performed by singular enrichment analysis ( sea ) using the david v6.7 functional annotation tool ( http://david.abcc.ncifcrf.gov/)(15 ) . detailed analysis parameters for sea using the functional annotation chart module of david are described elsewhere ( 9 ) . in the sea analysis , a category with a gene count > 5 , an ease score 0.05 ( modified fisher s exact p - value ) , and fdr 5% was considered as a significant threshold . white adipose tissue modulates both glucose and lipid homeostasis in humans via its master regulatory role in controlling whole - body lipid flux ( 16 ) . under conditions of chronic energy overload , however , decompensation of this adaptive homeostatic mechanism ( largely regulated by the interaction of genetic and epigenetic factors with dietary components ) may lead to adipose tissue dysfunction and is likely to be the causal link for metabolic abnormalities in a subset of obese subjects . after unsupervised hierarchical clustering of 1595 obesity - associated ( independent of age , gender and race ) transcripts , we classified the 30 obese subjects into two groups of 16 and 14 subjects , respectively ( figure 1a ) . these two groups were not significantly different in bmi . however , group 2 subjects had significantly higher total cholesterol ( p= 0.005 ) , ldl - cholesterol ( p= 0.006 ) , 2h - insulin during ogtt ( p=0.015 ) and lower insulin sensitivity ( si , p= 0.029 ) compared to group 1 ( figure 1b ) . despite similar bmi , obese subjects in group 2 showed poor gluco - and cardio - metabolic phenotype . thus , our study revealed a distinct signature of adipose tissue transcripts that can differentiate obese subjects with comparatively better metabolic health ( group 1 ) from obese subjects with poor metabolic heath ( group 2 ) . group 2 subjects showed higher fat mass ( 43.6 6.7% ) compared to group 1 subjects ( 35.5 6.8% ) , but this difference was not statistically significant after adjustment for age , gender , and race . thus , the observed difference in metabolic characteristics between the two groups can not be attributed to the differences in total adiposity . however , we have not analyzed depot - specific distribution or histological characteristics of white adipose tissue in these subjects . we identified 158 transcripts with 1.5 fold difference in expression between groups 1 and 2 ( supplementary table 1 ) . group 2 had significant up - regulation of 141 genes and down - regulation of 17 genes . highly up - regulated genes included mmp9 ( matrix metallopeptidase 9 ; 4.1 fold , p= 5.6810 ) and spp1 ( secreted phosphoprotein 1 or osteopontin ; 3.2 fold , p= 3.5410 ) ; while the top down - regulated genes included ndrg4 ( n - myc downstream - regulated gene family member 4 , 2.1 fold , p= 7.0110 ) and gins3 ( gins complex subunit 3 ; 1.8 fold , p= 1.5810 ) ( figure 1c ) . two large genome - wide association studies ( gwas ) identified significant association of ecg qt interval ( a quantitative measure of cardiac repolarization ) in human chromosome 16q21 , a genomic interval which includes several candidate genes including ndrg4 and gins3 ( 17;18 ) . ndrg4 knockdown in zebra fish embryos is associated with defective cardiac morphogenesis and function , including weak contractility due to marked reduction in proliferative myocytes ( 19 ) . similarly gins3 / zebra fish embryos show a significant defect in cardiac repolarization ( 20 ) . in our study , the distribution of age and race was not significantly different between groups , but distribution of gender was significant . thus , we compared only women from group 2 ( n= 12 ) and group 1 ( n=7 ) to identify differentially expressed genes . despite the lower statistical power , results remain consistent . of 158 differently expressed genes , 126 were significantly differentially expressed ( p 0.05 ) in the women - only analysis . the fold changes of these genes were strongly correlated between the overall cohort and the women only ( overall vs women - only analysis , r=0.83 , p= 8.7610 ) . thus , the differential expression of genes between groups as identified by unsupervised hierarchical clustering analysis can mainly be attributed to differences in metabolic characteristics of the subjects . transcripts differentially expressed between the two groups were significantly enriched for the functional categories of genes ( table 1 ) . these genes were primarily associated with cardiovascular disease , including peripheral arterial occlusive disease due to atherosclerotic lesions ( enrichment p = 2.8110 ) . the ingenuity knowledge base shows an interaction network of 31 differentially expressed genes involved in different cardiovascular disease - related processes ( figure 1d ) . these differentially expressed genes were also enriched in several canonical pathways involved in immune and inflammatory response , including the complement system ( p= 8.3210 ) , trem1 signaling ( p= 3.0910 ) and il-8 signaling ( p= 3.0910 ) ( table 1 ) . similarly david analysis identified signaling in the immune system ( p= 3.9410 , 21 genes , reactome pathway database ) as the most strongly enriched pathway . stronger upregulation of genes in pathways involved in immune and inflammatory responses , in metabolically unhealthy obese subjects , may be the link between obesity , cardiovascular disease , and type 2 diabetes ( 7 ) . genes in immune and inflammatory response pathway in adipose tissue were associated with insulin resistance ( 9 ) , which could explain the significantly lower insulin sensitivity among group 2 subjects in our study . genes in these pathways may become novel therapeutic targets in preventing obesity - associated diseases . in conclusion , our study provides evidence that the perturbation in the adipose tissue gene expression network may be critical in defining metabolic health , including cardiometabolic phenotypes in obese subjects . further functional studies will be required to define the causal relationship of these genes with cardio- and gluco - metabolic phenotypes in obesity .

obese subjects with a similar body mass index ( bmi ) exhibit substantial heterogeneity in gluco- and cardio - metabolic heath phenotypes . however , defining genes that underlie the heterogeneity of metabolic features among obese individuals and determining metabolically healthy and unhealthy phenotypes remain challenging . we conducted unsupervised hierarchical clustering analysis of subcutaneous adipose tissue transcripts from 30 obese men and women 40 years old . despite similar bmis in all subjects , we found two distinct subgroups , one metabolically healthy ( group 1 ) and one metabolically unhealthy ( group 2 ) . subjects in group 2 showed significantly higher total cholesterol ( p=0.005 ) , ldl cholesterol ( p=0.006 ) , 2h - insulin during ogtt ( p=0.015 ) and lower insulin sensitivity ( si , p=0.029 ) compared to group 1 . we identified significant up - regulation of 141 genes ( e.g. mmp9 and spp1 ) and down - regulation of 17 genes ( e.g. ndrg4 and gins3 ) in group 2 subjects . intriguingly , these differentially expressed transcripts were enriched for genes involved in cardiovascular disease - related processes ( p=2.8110113.741002 ) and pathways involved in immune and inflammatory response ( p=8.321050.04 ) . two down - regulated genes , ndrg4 and gins3 , have been located in a genomic interval associated with cardiac repolarization in published gwass and zebra fish knockout models . our study provides evidence that perturbations in the adipose tissue gene expression network are important in defining metabolic health in obese subjects .

Introduction Subjects and Methods Data Analysis Results and Discussion Supplementary Material

chronic obstructive pulmonary disease ( copd ) is a disease characterized by airflow limitation that is not fully reversible ( 1 ) . copd is a major health problem worldwide , with a high rate of occurrence , and high costs with its management . it is the fourth leading cause of death in the world and the economic burdens associated with copd is ever increasing ( 1 , 2 ) . inhaled cigarette smoke induces lung inflammation by various inflammatory cells , such as neutrophil , macrophage , and cd4 + t cells . a variety of inflammatory mediators , such as protease , matrix metalloproteinase and tumor necrosis factor - alpha , can enhance lung parenchymal destruction , and cause airway remodeling . these inflammatory processes can result airway narrowing and airflow limitation , finally develops copd ( 1 , 3 ) . however , only a small fraction of smokers develops symptomatic copd , suggesting that genetic factors also contribute to the development of copd ( 4 - 6 ) . recently , genome - wide association ( gwa ) studies have identified hundreds of genetic variants influencing the risk of complex human diseases , including copd ( 7 - 9 ) . in addition , these gwa studies have aided our understanding of diverse molecular pathways underlying specific human diseases ( 10 , 11 ) . the 15q25 region that contains the nicotinic acetylcholine receptor alpha subunit 5 and 3 ( chrna5 and chrna3 ) genes was initially identified as a lung cancer susceptibility locus through gwa studies conducted in caucasian populations ( 12 , 13 ) . subsequently , this 15q25 region has been reported to be also associated with risk of copd in gwa studies ( 7 , 14 ) . however , the single nucleotide polymorphisms ( snps ) , rs8034191 and rs1051730 , identified in previous gwa studies for lung cancer and copd in caucasians ( 7 - 14 ) , are extremely rare in asians , according to hapmap data . ( 15 ) reported that these two snps are very rare ( minor allele frequencies < 0.05 ) in chinese populations . notably , they reported that among the snps in the chrna5-chrna3 locus , the rs6495309c > t in the promoter of the chrna3 gene affects the binding ability of the transcriptional factor , oct-1 , resulting in alteration of chrna3 expression , thereby influencing lung cancer risk ( 15 ) . this finding suggests that the rs6495309c > t of chrna3 may be associated with the risk of copd in asian populations . therefore , to verify the role of the rs6495309c > t of chrna3 on the risk of copd , we have carried out a case - control study in a korean population . the patient group ( n = 406 ) consisted of male patients who visited the respiratory center in kyungpook national university hospital ( daegu , korea ) between july 2006 and december 2008 . diagnosis of copd was established by the nhlbi / who global initiative for copd ( gold ) ( 1 ) . the criteria for copd were as follows : chronic respiratory symptoms and signs such as cough and dyspnea ; post - bronchodilator forced expiratory volume at one second ( fev1 ) < 80% of the predicted value , fev1/forced vital capacity ( fvc ) < 70% and fev1 reversibility after inhaling 200 g salbutamol < 12% of the pre - bronchodilator fev1 . the severity of copd was classified by the guidelines of gold in terms of the percentage predicted fev1 : mild ( > 80% ) , moderate ( 50%-80% ) , severe ( 30%-50% ) or very severe ( < 30% ) . control subjects ( n = 394 ) were selected from a pool of healthy men who visited the general health check - up center . the enrollment criteria for the control subjects were as follows : male , age > 45 yr , current or former smoker , no known disease and no history of any disease , and no airflow limitation . all of the cases and controls were ethnic koreans that resided in daegu city , or in the surrounding regions . genotypes of the rs6495309c > t was determined by melting - curve analysis using fluorescence labeled hybridization probes ( lightcycler , roche diagnostic , mannheim , germany ) . a genotype success rate of greater than 99% was achieved using the lightcycler . samples that could not be scored by the lightcycler were re - genotyped by direct sequencing using an abi prism 3700 genetic analyzer ( applied biosystems , foster city , ca , usa ) . all genotyping analyses were performed " blind " with respect to the case / control status to ensure quality control . approximately 10% of the samples were randomly selected to be genotyped again by a different investigator , and the results were 100% concordant with the original analysis . the cases and controls were compared using the student 's t - test for continuous variables , and a chi - squared test for categorical variables . deviations of genotype frequencies among controls from those expected under hardy - weinberg equilibrium were assessed by chi - squared test ( 1 of freedom ) . unconditional logistic regression analyses were used to calculate the odds ratio ( or ) and 95% confidence interval ( ci ) , with adjustment for possible confounders ( age , and pack - years of smoking used as continuous variables ) . in addition to the overall association analysis , we performed a stratified analysis according to age , smoking status , and severity of copd to explore the association between genotypes and the risk of copd in each stratum . a homogeneity test was performed in order to compare the difference between the genotype - related ors of the different groups . all analyses were performed using statistical analysis system for windows , version 9.1 ( sas institute , cary , nc , usa ) . this study was approved by the institutional review board of the kyungpook national university hospital ( approval no . , knuhbio_10 - 1015 ) . the patient group ( n = 406 ) consisted of male patients who visited the respiratory center in kyungpook national university hospital ( daegu , korea ) between july 2006 and december 2008 . diagnosis of copd was established by the nhlbi / who global initiative for copd ( gold ) ( 1 ) . the criteria for copd were as follows : chronic respiratory symptoms and signs such as cough and dyspnea ; post - bronchodilator forced expiratory volume at one second ( fev1 ) < 80% of the predicted value , fev1/forced vital capacity ( fvc ) < 70% and fev1 reversibility after inhaling 200 g salbutamol < 12% of the pre - bronchodilator fev1 . the severity of copd was classified by the guidelines of gold in terms of the percentage predicted fev1 : mild ( > 80% ) , moderate ( 50%-80% ) , severe ( 30%-50% ) or very severe ( < 30% ) . control subjects ( n = 394 ) were selected from a pool of healthy men who visited the general health check - up center . the enrollment criteria for the control subjects were as follows : male , age > 45 yr , current or former smoker , no known disease and no history of any disease , and no airflow limitation . all of the cases and controls were ethnic koreans that resided in daegu city , or in the surrounding regions . genotypes of the rs6495309c > t was determined by melting - curve analysis using fluorescence labeled hybridization probes ( lightcycler , roche diagnostic , mannheim , germany ) . a genotype success rate of greater than 99% was achieved using the lightcycler . samples that could not be scored by the lightcycler were re - genotyped by direct sequencing using an abi prism 3700 genetic analyzer ( applied biosystems , foster city , ca , usa ) . all genotyping analyses were performed " blind " with respect to the case / control status to ensure quality control . approximately 10% of the samples were randomly selected to be genotyped again by a different investigator , and the results were 100% concordant with the original analysis . the cases and controls were compared using the student 's t - test for continuous variables , and a chi - squared test for categorical variables . deviations of genotype frequencies among controls from those expected under hardy - weinberg equilibrium were assessed by chi - squared test ( 1 of freedom ) . unconditional logistic regression analyses were used to calculate the odds ratio ( or ) and 95% confidence interval ( ci ) , with adjustment for possible confounders ( age , and pack - years of smoking used as continuous variables ) . in addition to the overall association analysis , we performed a stratified analysis according to age , smoking status , and severity of copd to explore the association between genotypes and the risk of copd in each stratum . a homogeneity test was performed in order to compare the difference between the genotype - related ors of the different groups . all analyses were performed using statistical analysis system for windows , version 9.1 ( sas institute , cary , nc , usa ) . this study was approved by the institutional review board of the kyungpook national university hospital ( approval no . , knuhbio_10 - 1015 ) . written informed consent age and pack - years of smoking were significantly higher in cases than in controls ( 64.4 7.5 vs 61.9 7.9 yr , p < 0.001 ; and 43.8 21.5 vs 31.7 16.4 pack - yr of smoking , p < 0.001 , respectively ) . the fev1 and the fev1/fvc ratio were significantly lower in the copd group than in the control group ( p < 0.001 , both ) . table 2 shows the genotype distribution of rs6495309c > t among the cases and controls . the genotype distribution of the rs6495309c > t among the controls was in hardy - weinberg equilibrium . the frequency of the variant t allele among the controls was 0.494 , which was comparable with that ( 0.482 ) of healthy chineses ( 15 ) . the distribution of the rs6495309c > t genotypes was significantly different between the cases and controls ( cc , ct , and tt genotypes ; 34.5% , 48.8% , and 16.7% , respectively vs 26.6% , 48.0% , and 25.4% , respectively ; p = 0.004 ) , with the frequency of the variant t allele being significantly lower in the cases than in the controls ( 0.411 vs 0.494 , p = 0.001 ) . the risk of copd decreased as the number of t alleles increased ( ptrend = 0.002 ) , and the tt genotype was associated with a significantly decreased risk of copd when compared to the cc genotype ( adjusted or , 0.50 ; 95% ci , 0.33 - 0.76 ; p = 0.001 ) . individuals with the rs6495309 ct or tt genotype had a 31% ( 95% ci , 0.50 - 0.95 ; p = 0.023 ) decreased risk of copd when compared to those with the rs6495309 cc genotype . the association between the rs6495309c > t genotypes and the risk of copd was further investigated , after stratification according to age , smoking status , and severity of copd ( table 3 ) . the effects of the rs6495309c > t genotype on the risk of copd did not differ significantly between younger- and older - individuals , and former- and current - smokers ( p value of test for homogeneity [ ph ] , both , > 0.05 in all comparisons ) . when stratified by the median pack - years of smoking , the effect of the rs6495309c > t genotype on the risk of copd was more evident in lighter - smokers than in heavier - smokers under dominant model for the variant t allele ( ph = 0.030 ) . when copd cases were categorized by disease severity , the rs6495309 ct , or tt genotype was associated with a significantly decreased risk of moderate to very severe copd ( gold ii - iv ; adjusted or , 0.56 ; 95% ci , 0.39 - 0.80 ; p = 0.001 ) , whereas there was no significant association between the rs6495309c > t genotypes and the risk of mild copd ( gold i ; adjusted or , 1.07 ; 95% ci , 0.69 - 1.65 ; ph = 0.024 ) . in this study we determined the association between the rs6495309c > t polymorphism on the 15q25 region and the risk of copd in a korean population . this finding was in agreement with results of a previous gwa study which was carried out in caucasians ( 7 ) in which the 15q25 region was a copd susceptibility locus , thus providing strong evidence that the 15q25 region may play an important role in the development of copd . this study is the first report of an association between the chran3 rs6495309c > t and the risk of copd in asians . acetylcholine receptors are classified into nicotinic acetylcholine receptors ( nachrs ) and muscarinic receptors , and nachrs are historically classified as neuronal- or muscle - type based on their initial site of identification and composite subunits ( 16 ) . cholinergic parasympathetic activity in the airways induces tracheobronchial smooth muscle contraction and mucous secretion ( 17 , 18 ) . however , there is increasing evidence that non - neuronal cholinergic systems that are found in non - neuronal cells , such as airway inflammatory cells , modulate inflammation of the lung , and thus , contribute to the development of copd ( 19 ) . it has been shown that bronchial epithelial cells , and airway fibroblasts and inflammatory cells express nachrs ( 20 ) . nicotine and nicotine - derived nitrosamines in cigarette smoke triggers the nachrs of inflammatory cells of the lung to release protease and oxidants that are associated with the pathogenesis of copd ( 19 - 21 ) . in addition , it has been demonstrated that the rs6495309 t allele significantly reduces promoter activity , which in turn diminishes chrna3 expression ( 15 ) . therefore , it is plausible that subjects with a lower production of rs6495309 t allele for chrna3 might have a lower inflammatory response to smoking exposure , thus having a decreased susceptibility to copd . the association between the chrna3 rs6495309c > t and risk of copd may be , in part , resulted from the fact that the snp affects nicotinic dependence . it is known that nachrs expressed in the key regions of the brain play an important role in controlling smoking behavior such as nicotine dependence ( 22 - 25 ) . several studies have reported that genetic variants of chromosome 15q25 , including the chrna3 rs6495309c > t , are responsible for tobacco nicotine dependence ( 15 , 25 ) . in the present study , however , there were no significant differences in genotype and allele frequencies according to smoking status and smoking exposure levels ( data not shown ) . although the rs6495309 in the promoter of the chrna3 gene has been reported to be a functional snp , the association of the rs6495309 with copd may be due to linkage disequilibrium ( ld ) with other functional variant(s ) rather than a direct effect of the rs6495309 . in order to identify the variant(s ) that may be in strong ld with the rs6495309 that could be actually responsible for the alteration in copd risk , we screened and estimated the lds of all the potentially functional snps ( with a minor allele frequency 0.05 in asians ) around the chrna5/chrna3 locus including the rs6495309 using the niehs database ( http://manticore.niehs.nih.gov ) . as shown in fig . 1 , four snps ( rs578776 , rs472054 , rs660652 and rs615470 ) were captured . however , none of these four snps were in strong ld with the rs6495309 based on hapmap jpt data of the public database ( http://www.ncbi.nlm.nih.gov/snp ) . this finding suggests that the association observed in the present study may be due to direct effect of the rs6495309 . however , because the four potentially functional snps captured from the database may also affect the risk of copd , future studies of these four snps are also needed to further understand the role of genetic variants in the chrna5/chrna3 locus in determining the risk of copd . in conclusion , this case - control study demonstrates a significant association of the chrna3 rs6495309c > t on chromosome 15q25 with the risk of copd . because this is the first case - control study investigating the association of the chrna3 rs6495309c > t with the risk of copd in asian populations , additional studies are required to confirm our findings .

a genome - wide association study has identified the 15q25 region as being associated with the risk of chronic obstructive pulmonary disease ( copd ) in caucasians . this study intended as a confirmatory assessment of this association in a korean population . the rs6495309c > t polymorphism in the promoter of nicotinic acetylcholine receptor alpha subunit 3 ( chrna3 ) gene was investigated in a case - control study that consisted of 406 patients with copd and 394 healthy control subjects . the rs6495309 ct or tt genotype was associated with a significantly decreased risk of copd when compared to the rs6495309 cc genotype ( adjusted odds ratio = 0.69 , 95% confidence interval = 0.50 - 0.95 , p = 0.023 ) . the effect of the rs6495309c > t on the risk of copd was more evident in moderate to very severe copd than in mild copd under a dominant model for the variant t allele ( p = 0.024 for homogeneity ) . the chrna3 rs6495309c > t polymorphism on chromosome 15q25 is associated with the risk of copd in a korean population .

INTRODUCTION MATERIALS AND METHODS Study population Genotyping Statistical analysis Ethic statement RESULTS DISCUSSION

1 . digital photography is a fundamental art in the day to day practice of a dermatologist . the main issue in most of the clinical photographs is the lack of good , reproducible and consistent digital images . digital photography is a fundamental art in the day to day practice of a dermatologist . but the main issue in most of the clinical photographs is the lack of good , reproducible and consistent digital images . hence we designed an instrument to address all these deficits and provide quality digital images . the lack of consistency of serial photographs is due to variation in : patient positioning , camera angles , lighting anddistance between patient and camera . the instrument which we designed in our workshop is made up of stainless steel and has two parts viz . a fixed and a movable part [ figure 1 ] . the patient comfortably sits on a chair and rests the chin over a cup shaped cushion ( 41 inches from the ground ) which is the fixed part [ figure 2 ] . the movable part is where the digital camera or ideally a slr camera is mounted over a firm stainless steel plate . the camera is kept in position by means of screw ( diameter inch , length inch ) which fits into the socket provided on the undersurface of it . photographs are taken in the same place with the patient 's face against same dark background . the movable part rotates around a central axis so that photographs can be taken at 0 , 45 and 90 [ figure 3 ] with angles marked in the axis . the distance between the patient 's face and camera ( 1 feet ) is constant at all these angles . the distance between the camera and face constant in all angles 90 right , 45 right , 0 front , 45 left , 90 left profile images the device which we designed for perfectly aligned photographs was similar to the omnia imaging station which has a camera column to maintain correct distance through all camera positions , dual intelli flash to provide balanced lighting and match pose image overlay for accurate patient positioning . comparison of features between omnia imaging station and our instrument small inconsistencies with patient positioning can be corrected using image analysis software photoshop adobe cs5 . each photograph is aligned to the previous photograph by manually selecting points of obvious anatomic landmarks [ figure 4 ] . this increases the ability of the observers to confidently track the same lesions in the same place in serial photographs [ figure 5 ] . ( a ) before treatment photograph : yellow dots are the anatomic landmarks chosen for alignment to match those in follow - up photograph . ( c ) without digital alignment : photographs of before treatment and follow - up on overlaying shows mismatching of anatomic landmarks . ( d ) with digital alignment : yellow and red dots are superimposed to exactly match both photographs separation of images after alignment the photo - editing software allows perfect alignment of photographs taken serially without altering color or contours of the lesions . by monitoring the same area over time sequentially , interpretation of changes is made easy [ figure 6 ] . had used serial digital photographs and similar spatial alignment software , the software picture window pro 4.0 ( digital light and color , belmont , ma , usa ) to examine the evolution of facial acne lesions . serial tracking of acne scars before each laser sitting -images are comparable and consistent the applications of digital photography in our field include : tracking serial photographs after cosmetic procedures like peels and lasers , storing patient data , medico - legal proof , discussion in forums andmedical publications . tracking serial photographs after cosmetic procedures like peels and lasers , storing patient data , discussion in forums and medical publications . the digital photography forms the basis of store - and - forward system of teledermatology . the medical images are captured in the referring center and subsequently forwarded to the specialty centre . a proper digital photograph highlighting the representative lesions is essential for a dermatologist to make a reliable diagnosis . it can also be used in the field of dentistry to assess the improvement of facial profile after wearing orthodontic braces . the lack of consistency of serial photographs is due to variation in : patient positioning , camera angles , lighting anddistance between patient and camera . the instrument which we designed in our workshop is made up of stainless steel and has two parts viz . a fixed and a movable part [ figure 1 ] . the patient comfortably sits on a chair and rests the chin over a cup shaped cushion ( 41 inches from the ground ) which is the fixed part [ figure 2 ] . the movable part is where the digital camera or ideally a slr camera is mounted over a firm stainless steel plate . the camera is kept in position by means of screw ( diameter inch , length inch ) which fits into the socket provided on the undersurface of it . photographs are taken in the same place with the patient 's face against same dark background . the movable part rotates around a central axis so that photographs can be taken at 0 , 45 and 90 [ figure 3 ] with angles marked in the axis . the distance between the patient 's face and camera ( 1 feet ) is constant at all these angles . the distance between the camera and face constant in all angles 90 right , 45 right , 0 front , 45 left , 90 left profile images the device which we designed for perfectly aligned photographs was similar to the omnia imaging station which has a camera column to maintain correct distance through all camera positions , dual intelli flash to provide balanced lighting and match pose image overlay for accurate patient positioning . small inconsistencies with patient positioning can be corrected using image analysis software photoshop adobe cs5 . each photograph is aligned to the previous photograph by manually selecting points of obvious anatomic landmarks [ figure 4 ] . this increases the ability of the observers to confidently track the same lesions in the same place in serial photographs [ figure 5 ] . ( a ) before treatment photograph : yellow dots are the anatomic landmarks chosen for alignment to match those in follow - up photograph . ( c ) without digital alignment : photographs of before treatment and follow - up on overlaying shows mismatching of anatomic landmarks . ( d ) with digital alignment : yellow and red dots are superimposed to exactly match both photographs separation of images after alignment the photo - editing software allows perfect alignment of photographs taken serially without altering color or contours of the lesions . by monitoring the same area over time sequentially , interpretation of changes is made easy [ figure 6 ] . had used serial digital photographs and similar spatial alignment software , the software picture window pro 4.0 ( digital light and color , belmont , ma , usa ) to examine the evolution of facial acne lesions . the applications of digital photography in our field include : tracking serial photographs after cosmetic procedures like peels and lasers , storing patient data , medico - legal proof , discussion in forums andmedical publications . tracking serial photographs after cosmetic procedures like peels and lasers , storing patient data , discussion in forums and medical publications . the digital photography forms the basis of store - and - forward system of teledermatology . the medical images are captured in the referring center and subsequently forwarded to the specialty centre . a proper digital photograph highlighting the representative lesions is essential for a dermatologist to make a reliable diagnosis . it can also be used in the field of dentistry to assess the improvement of facial profile after wearing orthodontic braces . digital photography is transforming the specialty of dermatology and standardization of photographs is of prime importance in this era of digital technology . the major limiting factor in a developing country like india is the cost of such sophisticated instruments to provide images of high quality . hence there are always alternatives to get the best out of the resources we have and this device is one kind of it . digital photography along with image analysis will open avenues onto a more detailed view of the patient and their response to treatment . a low - cost instrument has been devised to provide consistent digital facial images that is comparable to the higher end alternatives .

photography has proven to be a valuable tool in the field of dermatology . the major reason for poor photographs is the inability to produce comparable images in the subsequent follow ups . combining digital photography with image processing software analysis brings consistency in tracking serial images . digital photographs were taken with the aid of an instrument which we designed in our workshop to ensure that photographs were taken with identical patient positioning , camera angles and distance . it is of paramount importance in aesthetic dermatology to appreciate even subtle changes after each treatment session which can be achieved by taking consistent digital images .

Introduction Background and Materials Reasons for inconsistent images Photography device Alignment software Uses in dermatology Future directions Conclusion

human immunodeficiency virus ( hiv)/acquired immune deficiency syndrome ( aids ) affects 22.4 million to 28 million people and is responsible for the deaths of 1.4 million in the sub - saharan african countries alone.1 ethiopia is home to approximately 800,000 patients with hiv / aids , and the prevalence of hiv / aids in the general population is estimated to be 1.5%.2 antiretroviral therapy ( art ) has reduced mortality and morbidity from hiv disease , improving the wellbeing of many people living with hiv , and has enabled many hiv - infected parsons to live a longer and healthier life.36 yet if they have sex without a condom , those with higher viral load or low cd4 count before or at the initiation of art have the potential to infect a seronegative sexual partner or may themselves be at risk of acquiring drug - resistant viral strains from a sexual partner who is already infected.7,8 in ethiopia , hiv - positive people face a verity of social , psychological , and health problems that may be caused by various factors . in particular , hiv - positive women and girls suffer a high level of domestic sexual violence and experience pervasive economic , social , and legal discrimination.9 one of the key methods of prevention of hiv / aids transmission is the use of condoms during all types of sexual intercourse . given that unprotected intercourse with a hiv - infected person is a source of transmission , poor use of condoms and other preventive mechanism by those patients will add more to the disease prevalence . although , free condoms are made available by the ethiopian governmental health institutions throughout the country , the emphasis has been on people uninfected with hiv . as a result , data regarding the magnitude of consistent condom use among hiv / aids patients appear to be scarce . therefore , the present study is intended to generate information about the frequency of consistent condom use and the determining factors among adult hiv / aids patients receiving art . the study was conducted at the university of gondar hospital art clinic , located 727 km north - west of the capital city , addis ababa . the university of gondar hospital is one of the oldest health institutions , providing different inpatient and outpatient services for more than 5 million people . the total number of hiv / aids patients who have registered at the art clinic since 2003 is 4,063 . in 2013 , at the time of study , approximately 3,000 active patients were receiving their medication , and 1,372 of them were on art for at least 3 months and were aged above 18 years . a hospital - based , cross - sectional study design was adopted , from april to may 2013 . the data on variables of interest were collected , using an interview guide , among 317 randomly selected subjects . the sample size was calculated from the total population of 1,372 patients who had been treated for at least 3 months and were aged above 18 years , using the formula for estimation of a single proportion . the proportion of consistent condom use was assumed to be 50% since there was no similar previous finding , and the margin of error of estimation was assumed to be 5% , or 0.05 . a total of 13 patients , who came to the clinic without appointment , were unable to communicate , were mentally handicapped , seriously ill , unwilling to participate , or who were aged less than 18 years , were excluded from the study and were replaced with other participants , to reach the final sample size of 317 . a structured interview questionnaire , first prepared in english then translated into the national language , amharic , was used to collect data . then , the questionnaire was back - translated to english from amharic for the data entry . three pharmacists who were not working in that clinic were recruited and trained as data collectors . participants were interviewed in an isolated , private room found close to the art clinic . before the actual data collection , a pretest was conducted with 30 clients who were not included in the main study , in order to standardize the data collections tools . the dependent variable was consistent condom use ( use of condom in every sexual encounter in the last 6 months preceding the study ) , and the independent variables included sociodemographic characteristics , such as age , sex , marital status , religion , residence ( urban / rural ) , employment status ( employed / not employed ) , and duration since art commencement . a binary scale ( yes / no ) was employed to measure the general awareness regarding condom use among hiv / aids patients , based on eight related questions . the number of yes or no answers were considered to examine participants awareness for specific topics related to condom use . participants response as yes or no for a given statement questionnaire was treated separately . the proportion of respondents who said yes or no for single question was discussed instead of how many questions answered . bivariate analysis was carried out to see the association of each independent variable and the dependent variable , and those that had less than a 0.2 level of significance remained in the final models . finally , a stepwise multiple logistic regression analysis technique was carried out ; both adjusted and unadjusted odds ratio ( or ) and corresponding 95% confidence interval ( ci ) were employed to examine associations . ethical clearance was obtained from the university of gondar , and the verbal informed consent of participants was obtained . the study was conducted at the university of gondar hospital art clinic , located 727 km north - west of the capital city , addis ababa . the university of gondar hospital is one of the oldest health institutions , providing different inpatient and outpatient services for more than 5 million people . the total number of hiv / aids patients who have registered at the art clinic since 2003 is 4,063 . in 2013 , at the time of study , approximately 3,000 active patients were receiving their medication , and 1,372 of them were on art for at least 3 months and were aged above 18 years . a hospital - based , cross - sectional study design was adopted , from april to may 2013 . the data on variables of interest were collected , using an interview guide , among 317 randomly selected subjects . the sample size was calculated from the total population of 1,372 patients who had been treated for at least 3 months and were aged above 18 years , using the formula for estimation of a single proportion . the proportion of consistent condom use was assumed to be 50% since there was no similar previous finding , and the margin of error of estimation was assumed to be 5% , or 0.05 . a total of 13 patients , who came to the clinic without appointment , were unable to communicate , were mentally handicapped , seriously ill , unwilling to participate , or who were aged less than 18 years , were excluded from the study and were replaced with other participants , to reach the final sample size of 317 . a structured interview questionnaire , first prepared in english then translated into the national language , amharic , was used to collect data . then , the questionnaire was back - translated to english from amharic for the data entry . three pharmacists who were not working in that clinic were recruited and trained as data collectors . participants were interviewed in an isolated , private room found close to the art clinic . before the actual data collection , a pretest was conducted with 30 clients who were not included in the main study , in order to standardize the data collections tools . the dependent variable was consistent condom use ( use of condom in every sexual encounter in the last 6 months preceding the study ) , and the independent variables included sociodemographic characteristics , such as age , sex , marital status , religion , residence ( urban / rural ) , employment status ( employed / not employed ) , and duration since art commencement . a binary scale ( yes / no ) was employed to measure the general awareness regarding condom use among hiv / aids patients , based on eight related questions . the number of yes or no answers were considered to examine participants awareness for specific topics related to condom use . participants response as yes or no for a given statement questionnaire was treated separately . the proportion of respondents who said yes or no for single question was discussed instead of how many questions answered . the dependent variable was consistent condom use ( use of condom in every sexual encounter in the last 6 months preceding the study ) , and the independent variables included sociodemographic characteristics , such as age , sex , marital status , religion , residence ( urban / rural ) , employment status ( employed / not employed ) , and duration since art commencement . a binary scale ( yes / no ) was employed to measure the general awareness regarding condom use among hiv / aids patients , based on eight related questions . the number of yes or no answers were considered to examine participants awareness for specific topics related to condom use . participants response as yes or no for a given statement questionnaire was treated separately . the proportion of respondents who said yes or no for single question was discussed instead of how many questions answered . bivariate analysis was carried out to see the association of each independent variable and the dependent variable , and those that had less than a 0.2 level of significance remained in the final models . finally , a stepwise multiple logistic regression analysis technique was carried out ; both adjusted and unadjusted odds ratio ( or ) and corresponding 95% confidence interval ( ci ) were employed to examine associations . ethical clearance was obtained from the university of gondar , and the verbal informed consent of participants was obtained . the total study participants were 317 in number , with an age range of 1869 years . the mean age of the study population was 31.4 ( standard deviation [ sd ] 10.5 ) years . more than two - thirds of participants were urban residents 234 ( 73.8% ) , while approximately one - third of the total respondents 118 ( 37.2% ) had completed secondary school , and 54 ( 17% ) participants were illiterate . more than one - third of respondents had been taking their medication for more than 3 years ( table 1 ) . despite that 305 ( 96.2% ) participants had heard about condoms , only just over one - half ( 57.4% ) of the total participants had attended a special awareness session . the majority , 275 ( 86.8% ) , of respondents were aware that condoms generally prevent sexually transmissible diseases , including hiv / aids . additionally , 295 ( 93.1% ) knew that condoms prevent unwanted pregnancies as well . despite that the majority had good awareness about condoms , only 250 ( 78.9% ) of the participants the result showed that the sex , residential area ( urban or rural ) , achieving better educational level , and staying longer on art had a strong association with consistent condom use among the participants . age level , marital status , and religion failed to present a significant difference in the final multivariate analysis ( table 3 ) . the total study participants were 317 in number , with an age range of 1869 years . the mean age of the study population was 31.4 ( standard deviation [ sd ] 10.5 ) years . more than two - thirds of participants were urban residents 234 ( 73.8% ) , while approximately one - third of the total respondents 118 ( 37.2% ) had completed secondary school , and 54 ( 17% ) participants were illiterate . more than one - third of respondents had been taking their medication for more than 3 years ( table 1 ) . despite that 305 ( 96.2% ) participants had heard about condoms , only just over one - half ( 57.4% ) of the total participants had attended a special awareness session . the majority , 275 ( 86.8% ) , of respondents were aware that condoms generally prevent sexually transmissible diseases , including hiv / aids . additionally , 295 ( 93.1% ) knew that condoms prevent unwanted pregnancies as well . despite that the majority had good awareness about condoms , only 250 ( 78.9% ) of the participants the result showed that the sex , residential area ( urban or rural ) , achieving better educational level , and staying longer on art had a strong association with consistent condom use among the participants . age level , marital status , and religion failed to present a significant difference in the final multivariate analysis ( table 3 ) . data regarding consistent use of condoms and factors associated with this among hiv - positive clients in ethiopia appear to be inadequate . however , due to the assumption that hiv - infected individuals do not need condoms since they are already infected , there is paucity of reports regarding the frequency and determinants of consistent condom use in hiv / aids patients . this study , therefore , may provide important information regarding the general patterns of condom use and factors that facilitate or limit condom use among hiv / aids patients receiving art . the findings in this study indicated that 305 ( 96.2% ) respondents had heard of the condom as a preventive method for sexually transmitted diseases and pregnancy ( table 2 ) . this result was higher than that in a study done in uganda which reported 80% . this difference could be ascribed to the time variation , in that the accessibility of information pertaining to condoms is now better than before . previous studies have shown that inconsistent condom use was associated with various behaviors that affect the use of condoms negatively . this may be explained by the theory of planned behavior , which posits that behavioral intentions are determined by attitudes , subjective norms , and perceived control , leading to considerable variation in actual behavior under different circumstances.1012 empirical evidence from studies of high school and university students in south africa similarly found that intention to use a condom was determined by normative beliefs , attitudes , and subjective norms.10 these behavioral factors are believed to be improved through time with the arrival of various mechanisms that inform individuals on the use of consistent condom use . as illustrated in table 3 , consistent condom use was reported by 140 ( 88.6% ) males and 110 ( 69.1% ) females , and the overall regular condom use was 78.9% in 6 months prior to the study . this is almost in agreement with the reported 83% of condom use among hiv - positive heterosexual men and women in guatemala . this is an indication that male sex is a strong predictor of consistent condom use ( or 6.87 ; 95% ci 3.8411.22 ) in the past 6 months . this difference is perhaps due to the fact that men are more exposed to dialogues with friends and or colleagues that increased their awareness on use of condoms.5,6 on the other hand , the above difference could have been due to the fact that females are unable to negotiate condom use during sexual intercourse in most of african countries . additionally , lower condom use among females could be explained by the fact that women are less likely to attend a health education intervention or to participate in associations for people living with hiv / aids , due to cultural differences and home - related duties that leave them too busy.13,14 ntozi et al15 reported that female sex workers use or nonuse of condoms was situational sometimes customers would force them to have sex without condoms or , in other instances , customers paid extra for non - condom use . kibombo et al16 reported that females in uganda had little or no negotiation power when it came to condom use . in most of african countries , women are very disempowered and unable to decide to use condom ; rather , the decision is made by the man . therefore , this is a factor that should be addressed during counseling at the clinic , in order to heighten the negotiation capacity of females and the willingness of male partners to openly discuss condom use with their partners . according to a study conducted in south africa , most of the women reporting condom use were also using another method of contraception ( 94% ) , which indicates condoms were being used by women primarily not for disease prevention.17 participants aged between 31 and 45 years ( or 0.98 ; 95% ci 0.511.29 ) were more likely to practice consistent condom use compared with other age groups . it is not surprising that participants at sexually active age and with some maturity were more likely to have better information concerning condoms than were other groups . participants in the age range of 3145 years may possibly have a greater intention to talk to a partner about a condom , to use it during intercourse , and to say no to sex without a condom . in light of their intentions to protect themselves from unprotected sexual activities , they may more actively participate in condom - related educations.1315 consistent use of condom was significantly different between urban ( or 4.65 ; 95% ci 3.099.11 ) and rural participants . access to information , through media and various health institutions , may contribute to increased general awareness of and the importance of consistent condom use among people who are living in and around towns and cities.14 respondents with an advanced level of education were more likely to report regular use of condoms ( or 8.98 ; 95% ci 5.0614.45 ) compared with those without education . this result is quite similar to that of a study in addis ababa public hospitals and could possibly be due to behavioral changes acquainted through education.18 further , we found that duration of art was a significant predictor of consistent condom use . accordingly , patients who had received art for more than 3 years ( > 36 months ) were more likely to use condoms consistently compared with those on art for shorter duration . this could be due to the effect of more robust hiv prevention programs and counseling among art - experienced patients compared with those who were new to art . it was also found that uptake of condom use increased with time the longer the follow - up period , the higher the prevalence of condom use . this may be a reflection of the fact that continual exposure to secondary prevention messages has a greater impact as time progresses.19,20 this study shows that there are groups of hiv / aids patients who are inconsistent condom users . females , rural dwellers , uneducated groups , and new art users were less likely to use condoms consistently . in light of this , increasing awareness about the importance of using condom can be a powerful means of fostering consistent condom use among patients receiving hiv drug treatment , in order to reduce the transmission . first , the study subjects were recruited from a single referral hospital , which may limit the generalizability of the study . however , this study was able to generate important data on the frequency of consistent condom and possible determinants among patients who are hiv / aids - positive . in this regard , it is the first study to reveal the condom - use status of hiv / aids patients who are on art . finally , another limitation for the study was that the inability to recall past sexual experiences could have caused measurement error .

backgroundhuman immunodeficiency virus ( hiv)/acquired immune deficiency syndrome ( aids ) is one of the greatest public health problems of sub - saharan african countries . consistent condom use , among others , remains the most effective barrier method against hiv transmission . however , existing reports on frequency of consistent condom use have targeted the general public , rather than hiv / aids patients due , to the assumption that condom use is not important in hiv - infected persons . since consistent condom use among hiv / aids patients is vital , to prevent the virus transmission from the infected to noninfected as well as to prevent multiple infections among already infected persons , its frequency and determining factors need to be investigated.methodsa cross - sectional study was conducted from april 2013 to may 2013 among 317 randomly selected patients who were currently taking antiretroviral therapy ( art ) . logistic regressions were performed to examine predictors of consistent condom use.resultsa total of 317 hiv / aids patients who were currently receiving art participated in the study , and the mean age of the study population was 31.4 ( standard deviation [ sd ] 10.5 ) years . overall , 250 ( 78.9% ) participants reported consistent condom use in the past 6 months . of these , 140 ( 88.6% ) were males and 110 ( 69.1% ) females . multivariate analysis indicated that respondents with an advanced level of education were more likely to report regular use of condoms ( odds ratio [ or ] 8.98 ; 95% confidence interval [ ci ] 5.0614.45 ) compared with illiterate participants . being male ( or 6.87 ; 95% ci 3.8411.22 ) , living in or around a town ( or 4.65 ; 95% ci 3.099.11 ) , and taking art for longer time ( or 3.91 ; 95% ci 2.076.25 ) were also positively associated with consistent condom use.conclusionfemales , patients living in rural areas , uneducated groups , and new art users were less likely to use condoms consistently . the importance of consistent condom use should be well - addressed in hiv / aids patients , to prevent transmission and multiple infections of hiv .

Introduction Methods Study area Design and sampling Data collection procedure Variables Data analysis Ethical considerations Results Study population characteristics General awareness about condom use Determinants of consistent condom use Discussion Conclusion

various operative techniques are available for treating lscs , and minimally invasive surgery has recently been proposed including microscopic surgery and endoscopic surgery . in this report , we describe the surgical technique for minimally invasive space shuttle laminotomy ( missl ) using a microscope , for which surgeons must be very well - versed about normal anatomy , especially the anatomy of the ligamentum flavum ( lf ) . first , we describe the normal anatomy of the lf in detail . as mentioned above , it is only possible to conduct missl safely and accurately if the surgeon knows the anatomy of this ligament well . the lf is thick and short and is symmetrical on both the left and right sides . on each side , the lf divides into a medial portion and lateral portion [ figure 1 ] . the upper attachment of the medial portion is to the lower half of the ventral surface of the lamina and the attachment of the lateral portion is to the inferior aspect of the pedicle . the medial portion passes to the back of the next lower lamina and attaches to the upper quarter or so of the dorsal surface of that lamina . the lateral portion passes in front of the zygapophysial joint formed by the two vertebrae that the ligament connects . it attaches to the anterior aspects of the inferior and superior articular processes of this joint and forms its anterior capsule . the most lateral fibers extend along the root of the superior articular process as far as the next lower pedicle to which they are attached . this part of the lateral portion of the lf has continuous fibrous connections with the synovium . it lies just medial to the pars interarticularis and has a root sleeve below it . the dorsal side of the lf has continuous attachments to the ventral part of the interspinous ligaments . ( a ) a normal level of the spine ( b ) medial portion of the ligamentum flavum ( lf ) . the part in pale yellow is the lf under the lamina ( c ) combined medial and lateral portions of the lf ( d ) an axial section of the lf first , we describe the normal anatomy of the lf in detail . as mentioned above , it is only possible to conduct missl safely and accurately if the surgeon knows the anatomy of this ligament well . the lf is thick and short and is symmetrical on both the left and right sides . on each side , the lf divides into a medial portion and lateral portion [ figure 1 ] . the upper attachment of the medial portion is to the lower half of the ventral surface of the lamina and the attachment of the lateral portion is to the inferior aspect of the pedicle . the medial portion passes to the back of the next lower lamina and attaches to the upper quarter or so of the dorsal surface of that lamina . the lateral portion passes in front of the zygapophysial joint formed by the two vertebrae that the ligament connects . it attaches to the anterior aspects of the inferior and superior articular processes of this joint and forms its anterior capsule . the most lateral fibers extend along the root of the superior articular process as far as the next lower pedicle to which they are attached . this part of the lateral portion of the lf has continuous fibrous connections with the synovium . it lies just medial to the pars interarticularis and has a root sleeve below it . the dorsal side of the lf has continuous attachments to the ventral part of the interspinous ligaments . ( a ) a normal level of the spine ( b ) medial portion of the ligamentum flavum ( lf ) . the part in pale yellow is the lf under the lamina ( c ) combined medial and lateral portions of the lf ( d ) an axial section of the lf a 65-year - old male presented with intermittent claudication and came to the hospital with the chief complaint of the sciatic pain in the right lower extremeity . the operation time was 1.5 h. the bleeding during the surgery was no more than 12 ml . the current article describes basic , one - level laminotomy but if necessary , the technique can be applied to multiple levels . we believe that orthodox laminectomy would serve for treating multiple - level sclerosis just as easily as missl ; neither has any associated problem . a recent study has proposed the midline spinous process splitting approach or unilateral approach and bilateral decompression but there is no evidence that these surgical procedures are medically advantageous . skin incisions of 3 cm are usually adequate in the case of one - segmental stenosis . both the rostral and caudal spinous processes of the responsible lesion are opened , and the inferior one - third of the rostral spinous process with the interspinous ligaments is resected until the base of the spinous process . thus , the facet joint is never sacrificed and the multifidus muscles that cover the facet joint capsule can be preserved to the best possible extent . we should mention that for achieving hemostasis , we avoid using monopolar cautery and use only bipolar cautery since it is more precise . although the shape of the facet and width of the spinal canal should be confirmed before the operation , they can be verified on the basis of the diameter of a diamond burr . in terms of the width of the laminotomy for the rostral side lamina against the responsible segment ( if it is level l4 - 5 , then the l4 side lamina is involved ) , about 10 mm is usually adequate . in the case of the caudal side lamina ( if it is level l4 - 5 , the l5-side lamina is involved ) , 16 - 18 mm is adequate . maintaining the width at less than 10 mm on the rostral side can protect the facet joint and its capsule . however , this is not always the case , as l1 - 2 or l2 - 3 is physiologically narrower than l4 - 5 or l5-s1 , and the width becomes narrower toward the rostral side . in addition to decompression of the canal , decompression of the root sleeve is necessary . this part of the operation is performed using a diamond burr of diameter 6.0 mm . although any ragged lf or lf obstructing the operation field may be removed , it is better to preserve the lf as far into the surgery as possible . the bone of lamina is removed by the drill until the dura matter is identified at the terminal of rostral side on midline . therefore , particular care should be taken at this point , since the dura mater emerges suddenly after the laminotomy . the silhouette of the laminotomy resembles a space shuttle [ figure 2 ] and hence , the designation space shuttle laminotomy . the medial side of the inferior facet is drilled off using the burr . while performing the decompression , we used kairison ( a pneumatic kerrison bone punch ; aesculap ag , tuttlingen , baden - wrttemberg , germany ) and conventional kerrison bone punches . kairison can be manipulated with a single hand under the microscope . with this punch , decompression can be performed with ease for not only laminae but also floating soft structures such as ligaments and flava , as these provide strong forces assisted by the compressed air supply in standard operation rooms . during the procedure , it is essential that the operator stand on the opposite side from the side on which the surgery is conducted . while the visual axis of the microscope is inclined , it is pushed forward toward the medial side of superior facet ( the so - called lateral recess ) . as the diamond burr gets closer to the lateral recess , the lf naturally floats . in this situation , the lf should be preserved as far as possible because it can protect the dura mater . the drilling is continued in the direction of the rear fender of the space shuttle . because the most lateral fibers of the lf extend toward the pedicle , the laminotomy can be performed safely . the drilling off toward the rear fender should be continued until the point at which the lf gradually tapers off . at this point , the diamond burr is turned toward the cockpit of the space shuttle [ figure 2c ] where the lf is no longer present . the bone resection area looks like a space shuttle seen from the right side , [ figure 2d ] the anterior side [ figure 2e ] and the oblique side [ figure 2f ] . the postoperative x - ray shows the bone decompression area on x - ray can be seen as if a space shuttle is flying , shown the red in the schema [ figure 2 g and h ] . the operator 's assistant must take care to avoid dural lacerations during drilling off at this point . the procedure is repeated on the reverse side . however , in cases in which the canal is extremely narrow , decompression should not be performed at a stretch on any one side . in such cases , alternating , step - by - step decompression on each side is safer [ figures 37 ] . once one side is completely decompressed , it is easy to decompress the other side . for multiple - level stenosis ( a ) silhouette of space shuttle laminotomy from the dorsal side ( b ) the dotted line shows dome laminotomy of the cock pit of the space shuttle ( c ) drilling off over the lateral portion of the lf using diamond burr . the lf protects the dura mater ( d ) silhouette of space shuttle laminotomy from the lateral side ( e ) axial section of the silhouette of space shuttle laminotomy ( f ) three - dimensional image of space shuttle laminotomy ( g ) the postoperative the lumbar spine x - ray of a - p . the translucent area on the lumbar spine x - ray shows the resection area of the bone to decompress during the surgery that is shown in the red part in the schema ( h ) the resection is shown in red on the postoperative lumbar spine x - ray despite the vertical facet joint , spinal canal decompression could be completed . pre- ( a ) and postoperative computed tomography scans ( b ) the lateral recesses were decompressed completely . pre- ( a ) and postoperative computed tomography scans ( b ) the width of the laminotomy for the rostral side lamina is 10 mm ( arrow ) . pre- ( a ) and postoperative computed tomography scans ( b ) severe osteoarthritis of the facet joint in one case . pre- ( a ) and postoperative computed tomography scans ( b ) severe osteoarthritis of the facet joint in another case . pre- ( a ) and postoperative computed tomography scans ( b ) missl can be described as laminotomy against the caudal side of the lamina . however , in the strictest sense , it is removal of the spinous process of the base of the spinous process against the rostral side of the bone . 0missl , which involves a microsurgical technique , is a safe , complication - free procedure . however , it requires operators to have a good understanding of the anatomy of the lf . the authors have no personal , financial , or institutional interest in any drugs , materials , or devices used . the authors have no personal , financial , or institutional interest in any drugs , materials , or devices used .

study design : technical note.objectives:to show microsurgical technique , considering the meticulous anatomy of the ligamentum flavum ( lf).background : different methods are available for treating lumbar spinal canal stenosis ( lscs ) . a minimally invasive surgery , namely , space shuttle laminotomy , has recently been proposed . here , we describe the surgical method for this novel technique . to conduct this surgery accurately , surgeons must have perfect knowledge of anatomy , especially regarding the lf.materials and methods and results : we use this interlaminectomy technique for all cases of lscs . all patients with lscs recovered from their neurological deficits in shorter hoslital stays than regular laminectomy.conclusion:minimally invasive space shuttle laminotomy ( missl ) , which involves a microsurgical technique , is a safe , complication - free procedure .

INTRODUCTION Background CASE REPORT MATERIALS AND METHODS AND RESULTS CONCLUSION Financial support and sponsorship Conflicts of interest

fibromyalgia ( fm ) is a chronic pain syndrome with symptoms that include widespread pain , fatigue , sleep disruption , and cognitive impairment . fm is estimated to affect 2%8% of the population13 and is often comorbid with related conditions such as irritable bowel syndrome ( ibs ) and chronic fatigue syndrome . it is commonly accepted that fm is associated with abnormalities in central pain processing that result in allodynia and hyperalgesia ; however , the causal or triggering events leading to these abnormalities have not been fully elucidated , nor is there clarity regarding the factors responsible for the numerous symptoms associated with fm . it is generally believed that central sensitization in fm patients does not occur de novo , but is secondary to some combinations of genetic and environmental factors that predispose the patient to this condition.4 physical trauma , infection , emotional distress , endocrine disorders , and immune activation have all been hypothesized as potential triggering phenomena in susceptible patients.4,5 we hypothesized a persistent viral infection , reactivated by stress and other environmental factors , contributes to the systemic changes and symptoms associated with fm . members of the herpes virus family are unique among viruses in that they remain in a dormant state , termed latency , until stress and other environmental conditions result in virus reactivation . during latency , viral genomes are maintained as circular episomes in the nuclei of host cells . upon reactivation , viral proteins are expressed resulting in a productive , lytic infection that can spread within the body and induce an immune response . we hypothesized the recurrent reactivation of a tissue - resident herpes virus in genetically susceptible individuals could lead to abnormalities in the nervous system and hypothalamic pituitary adrenal axis . we further hypothesized that in susceptible patients , these abnormalities could lead to central sensitization and other manifestations of fm . the drugs currently approved for the management of fm , including duloxetine , milnacipran , and pregabalin , are believed to work by modifying central pain processing ; duloxetine and milnacipran via serotonin and norepinephrine reuptake inhibition and pregabalin via modulation of voltage - gated calcium channels . nonsteroidal anti - inflammatory drugs ( nsaids ) and acetaminophen have not been shown to be effective as monotherapies in the treatment of fm pain , but they are nonetheless used by many fm patients , largely to provide an element of analgesia against other peripheral pain generators such as osteoarthritis.68 all of these medications , plus others , have been found to have varying degrees of effectiveness in the management of fm.911 nonetheless , a significant percentage of fm patients continues to experience pain , fatigue , and other symptoms . the therapeutic regimen tested in this study was designed to suppress tissue - resident herpes viruses . the famciclovir + celecoxib combination ( imc-1 ) was intended to provide aggressive antiviral activity against herpes simplex virus 1 ( hsv-1 ) , interrupting the cyclical process of virus reactivation and lytic infection hypothesized to trigger and/or perpetuate the symptoms of fm . the mechanism of action of anti - herpes virus nucleoside analogs such as acyclovir , valacyclovir , and famciclovir is well understood . it is perhaps less well known that cox-2 inhibitors also exhibit anti - herpes virus activity . several herpes viruses , including hsv-1 , are known to significantly upregulate cox-2 , and virally induced upregulation of cox enzymes is important for efficient hsv-1 replication.1217 in addition , researchers have found cox inhibitors are effective in reducing the severity of primary herpes virus lesions and inhibiting reactivation of latent infections.1821 whereas other treatments , such as serotonin / norepinephrine reuptake inhibitors and antiepileptic agents , are oriented toward the treatment of downstream abnormalities in central pain processing,22 we hypothesized that the imc-1 regimen would intervene further upstream in the cascade of events leading to the symptoms of fm . this 16-week , randomized , double - blinded , placebo - controlled study was conducted at 12 outpatient clinical / research centers in the usa . all centers , along with the study protocol , were reviewed and approved by a central institutional review board ( quorum review institutional review board ) , and all patients provided informed consent . the study was conducted in compliance with the declaration of helsinki , consistent with good clinical practice and applicable regulatory requirements . female or male patients , 1870 years of age , who met the 2010 american college of rheumatology ( acr ) preliminary diagnostic criteria for fm were eligible for inclusion . patients were required to have a 24-hour recall average pain score between 40 and 90 inclusive on a 100-mm visual analog scale ( vas ) at the screening visit and a 24-hour recall average pain score between 4 and 9 inclusive on an 11-point numerical rating scale ( nrs ) at the baseline visit . female patients were required to have a negative urine pregnancy test at screening and baseline unless post - menopausal or surgically sterile . female patients of childbearing age were required to utilize an effective birth control method for the duration of the study . patients were required to withdraw and refrain from the use of duloxetine , milnacipran , pregabalin , gabapentin , sodium oxybate , and opioids , and the use of nsaids other than low - dose aspirin was curtailed at the time of randomization . candidates were required to have a negative drug screen for opioids and drugs of abuse prior to randomization . qualified patients with mild to moderate depression were eligible if clinically stable , without risk of suicidal ideation or behavior , and the dose of allowed antidepressants had been stable for at least 3 months prior to screening . a partial summary of the exclusion criteria for the study includes use of celecoxib or famciclovir within 30 days of screening ; treatment with warfarin , lithium , amiodarone , isoniazid , phenytoin , fluconazole , probenecid , or raloxifene ( due to the potential for metabolic interactions with celecoxib or famciclovir ) ; and failed back surgery syndrome , infectious arthritis , rheumatoid arthritis , systemic lupus erythematosus , or other laboratory - confirmed systemic auto - immune disease . the prid-201 study was designed to evaluate the safety and efficacy of a famciclovir + celecoxib combination ( imc-1 ) in the treatment of fm pain . the study included four phases : screening and washout ( 528 days ) , baseline assessment and randomization ( 1 day ) , acute treatment dose ( 1 week ) , and chronic suppressive dose treatment ( 15 weeks ) . after providing informed consent and undergoing screening for eligibility , patients completed a washout of prohibited medications , if necessary , for 528 days prior to randomization ( 1:1 ratio ) at the baseline visit . to ensure balanced assignment of patients across treatment groups at each site , enrolled patients received either an acute treatment dosage of famciclovir + celecoxib or placebo for the first week . imc-1 group patients subsequently received a chronic suppressive dosage of famciclovir + celecoxib for the remaining 15 weeks of the study , whereas placebo - enrolled patients remained on placebo treatment . for blinding purposes , famciclovir and celecoxib were over - encapsulated ; the same filler was used for both active and placebo capsules , and active and placebo study drug supplies were identical in appearance . an early termination ( et ) visit was performed for patients who discontinued study drug for any reason prior to the completion of the week 16 visit . acetaminophen or tramadol was utilized as a rescue for acute exacerbations of pain at the lowest possible dose and for the shortest period of time possible in accordance with the medication - approved product labeling . tramadol usage was not allowed within 48 hours of the weeks 6 and 12 visits or within 7 days prior to the baseline or week 16 visits to avoid compromised pain assessments . efficacy assessments included 24-hour recall average pain score recorded on the 11-point nrs , the revised fibromyalgia impact questionnaire ( fiq - r ) , the patient s global impression of change ( pgic ) questionnaire , the nih patient - reported outcomes measurement information system fatigue inventory ( promis fatigue - sf ) , the multidimensional fatigue inventory ( mfi ) , and the beck depression inventory - ii ( bdi - ii ) . assessments were completed at the baseline and weeks 6 , 12 , and 16 clinic visits . the primary efficacy outcome was response to treatment as assessed by the change from baseline in fm pain . to assess change in fm pain , both the 24-hour recall nrs score and the 7-day recall pain score from the fiq - r were analyzed . the methodology selected to analyze all available pain data , which was recorded at baseline and weeks 6 , 12 , and 16/et , was a mixed model repeated measures ( mmrm ) approach with and without imputation for missing data . mmrm methodology allows analysis of all collected data and can be used with and without imputation strategies to handle missing data . the imputation method utilized for this study was a hybrid baseline observation carried forward ( bocf)/last observation carried forward ( locf ) approach to account for missing data and the reason for the data being missing . secondary efficacy assessments included the pgic , fiq - r , and pain responder analyses . a fm - specific pgic , in which patients rated their overall change in fm from the start of the study , was implemented as an efficacy assessment at weeks 6 , 12 , and 16/et . the pgic used a scale ranging from 1 to 7 with 1=very much improved and 7=very much worse . responders to treatment were calculated based on the proportion of patients who responded with either 1 or 2 on the pgic assessment . patients who did not reach the scheduled week 16 visit and then responded 1 or 2 were considered non - responders for this analysis ( bocf analysis ) . the fiq - r , a fm - specific instrument designed to assess the impact of fm on various aspects of a patient s well - being , was administered at baseline and weeks 6 , 12 , and 16/et . the change from baseline in the total fiq - r score was determined by comparing the baseline fiq - r total score to that determined at subsequent visits . responder analyses of the percentage of patients meeting 30% and 50% reduction in pain scored from baseline was performed utilizing both the 24-hour nrs and the 7-day pain item from the fiq - r . exploratory efficacy variables included the promis fatigue inventory , the mfi , and the bdi - ii , all of which were administered at baseline and subsequent clinic visits . fatigue was measured with the 8-item version of the promis fatigue inventory and the 20-item mfi . scoring of the bdi - ii allowed for the identification of mild , moderate , and severe levels of depressive symptoms and for the quantification of change in status over time . information concerning any adverse events ( aes ) reported by patients or observed by investigators or other staff was collected throughout the study , starting from the time of informed consent . any aes that continued at the time of discontinuation or completion of the study were followed until resolution , until the event was no longer considered clinically significant , or for at least 30 days following the patient s completion or discontinuation from the study . clinical laboratory tests ( hematology , biochemistry , hsv-1 igg , and urinalysis ) were evaluated at screening and weeks 6 and 16/et and processed via a central laboratory . physical examination and general safety assessments were conducted prior to randomization , and vital signs were obtained at each study visit . because this was the first double - blind trial of this famciclovir + celecoxib combination , power calculations to determine sample size based on studies of other agents in a similar patient population , the sponsor elected to assume an improvement in pain scores for the combination arm of 2.4 units , compared to 1.3 for placebo . the intra - subject variability was assumed to be 1.5 and between - subject variability 2.3 . under these assumptions , the sample size necessary to reject the null hypothesis of no difference in change in mean pain scores over 16 weeks with 80% power at the 0.05 significance level was 69 subjects per arm ( 138 subjects total ) . all patients who received at least one dose of study medication were included in the intent - to - treat analyses . all statistical tests were performed by premier research using sas software version 9.1 . for the primary efficacy outcome measures , mean changes from baseline in pain intensity scores ( 24-hour recall pain nrs and 7-day recall pain from fiq - r ) were analyzed using an mmrm approach . the analysis model included the fixed categorical effects of treatment , center , weeks ( 6 , 12 , and 16 ) , and treatment - by - week interaction , as well as the continuous fixed covariate of baseline score . significance tests were based on least - squares mean values using a two - sided p=0.05 ( two - sided 95% confidence intervals ) . secondary efficacy outcome measures were analyzed as follows : the pgic responder analysis used a logistic regression model in which patients with results of very much improved or much improved at endpoint were compared to those with all other results . in this model , any patients with missing data at week 16 were considered non-responders.the total fiq - r score change from baseline was analyzed by the primary mmrm analysis method.pain responder analyses , used to determine the number of patients meeting 30%50% reduction in pain , were calculated using a generalized linear regression curve fit comparing each patient s change in pain from baseline to end using the 24-hour recall nrs and 7-day recall fiq - r pain scores . the pgic responder analysis used a logistic regression model in which patients with results of very much improved or much improved at endpoint were compared to those with all other results . in this model , any patients with missing data at week 16 were considered non - responders . the total fiq - r score change from baseline was analyzed by the primary mmrm analysis method . pain responder analyses , used to determine the number of patients meeting 30%50% reduction in pain , were calculated using a generalized linear regression curve fit comparing each patient s change in pain from baseline to end using the 24-hour recall nrs and 7-day recall fiq - r pain scores . the exploratory endpoints of promis fatigue , bdi - ii , fiq - r domains , and mfi domains were also analyzed with the same mmrm approach that was applied to the primary analysis . this 16-week , randomized , double - blinded , placebo - controlled study was conducted at 12 outpatient clinical / research centers in the usa . all centers , along with the study protocol , were reviewed and approved by a central institutional review board ( quorum review institutional review board ) , and all patients provided informed consent . the study was conducted in compliance with the declaration of helsinki , consistent with good clinical practice and applicable regulatory requirements . female or male patients , 1870 years of age , who met the 2010 american college of rheumatology ( acr ) preliminary diagnostic criteria for fm were eligible for inclusion . patients were required to have a 24-hour recall average pain score between 40 and 90 inclusive on a 100-mm visual analog scale ( vas ) at the screening visit and a 24-hour recall average pain score between 4 and 9 inclusive on an 11-point numerical rating scale ( nrs ) at the baseline visit . female patients were required to have a negative urine pregnancy test at screening and baseline unless post - menopausal or surgically sterile . female patients of childbearing age were required to utilize an effective birth control method for the duration of the study . patients were required to withdraw and refrain from the use of duloxetine , milnacipran , pregabalin , gabapentin , sodium oxybate , and opioids , and the use of nsaids other than low - dose aspirin was curtailed at the time of randomization . candidates were required to have a negative drug screen for opioids and drugs of abuse prior to randomization . qualified patients with mild to moderate depression were eligible if clinically stable , without risk of suicidal ideation or behavior , and the dose of allowed antidepressants had been stable for at least 3 months prior to screening . a partial summary of the exclusion criteria for the study includes use of celecoxib or famciclovir within 30 days of screening ; treatment with warfarin , lithium , amiodarone , isoniazid , phenytoin , fluconazole , probenecid , or raloxifene ( due to the potential for metabolic interactions with celecoxib or famciclovir ) ; and failed back surgery syndrome , infectious arthritis , rheumatoid arthritis , systemic lupus erythematosus , or other laboratory - confirmed systemic auto - immune disease . the prid-201 study was designed to evaluate the safety and efficacy of a famciclovir + celecoxib combination ( imc-1 ) in the treatment of fm pain . the study included four phases : screening and washout ( 528 days ) , baseline assessment and randomization ( 1 day ) , acute treatment dose ( 1 week ) , and chronic suppressive dose treatment ( 15 weeks ) . after providing informed consent and undergoing screening for eligibility , patients completed a washout of prohibited medications , if necessary , for 528 days prior to randomization ( 1:1 ratio ) at the baseline visit . to ensure balanced assignment of patients across treatment groups at each site enrolled patients received either an acute treatment dosage of famciclovir + celecoxib or placebo for the first week . imc-1 group patients subsequently received a chronic suppressive dosage of famciclovir + celecoxib for the remaining 15 weeks of the study , whereas placebo - enrolled patients remained on placebo treatment . for blinding purposes , famciclovir and celecoxib were over - encapsulated ; the same filler was used for both active and placebo capsules , and active and placebo study drug supplies were identical in appearance . an early termination ( et ) visit was performed for patients who discontinued study drug for any reason prior to the completion of the week 16 visit . acetaminophen or tramadol was utilized as a rescue for acute exacerbations of pain at the lowest possible dose and for the shortest period of time possible in accordance with the medication - approved product labeling . tramadol usage was not allowed within 48 hours of the weeks 6 and 12 visits or within 7 days prior to the baseline or week 16 visits to avoid compromised pain assessments . efficacy assessments included 24-hour recall average pain score recorded on the 11-point nrs , the revised fibromyalgia impact questionnaire ( fiq - r ) , the patient s global impression of change ( pgic ) questionnaire , the nih patient - reported outcomes measurement information system fatigue inventory ( promis fatigue - sf ) , the multidimensional fatigue inventory ( mfi ) , and the beck depression inventory - ii ( bdi - ii ) . assessments were completed at the baseline and weeks 6 , 12 , and 16 clinic visits . the primary efficacy outcome was response to treatment as assessed by the change from baseline in fm pain . to assess change in fm pain , both the 24-hour recall nrs score and the 7-day recall pain score from the fiq - r were analyzed . the methodology selected to analyze all available pain data , which was recorded at baseline and weeks 6 , 12 , and 16/et , was a mixed model repeated measures ( mmrm ) approach with and without imputation for missing data . mmrm methodology allows analysis of all collected data and can be used with and without imputation strategies to handle missing data . the imputation method utilized for this study was a hybrid baseline observation carried forward ( bocf)/last observation carried forward ( locf ) approach to account for missing data and the reason for the data being missing . secondary efficacy assessments included the pgic , fiq - r , and pain responder analyses . a fm - specific pgic , in which patients rated their overall change in fm from the start of the study , was implemented as an efficacy assessment at weeks 6 , 12 , and 16/et . the pgic used a scale ranging from 1 to 7 with 1=very much improved and 7=very much worse . responders to treatment were calculated based on the proportion of patients who responded with either 1 or 2 on the pgic assessment . patients who did not reach the scheduled week 16 visit and then responded 1 or 2 were considered non - responders for this analysis ( bocf analysis ) . the fiq - r , a fm - specific instrument designed to assess the impact of fm on various aspects of a patient s well - being , was administered at baseline and weeks 6 , 12 , and 16/et . the change from baseline in the total fiq - r score was determined by comparing the baseline fiq - r total score to that determined at subsequent visits . responder analyses of the percentage of patients meeting 30% and 50% reduction in pain scored from baseline was performed utilizing both the 24-hour nrs and the 7-day pain item from the fiq - r . exploratory efficacy variables included the promis fatigue inventory , the mfi , and the bdi - ii , all of which were administered at baseline and subsequent clinic visits . fatigue was measured with the 8-item version of the promis fatigue inventory and the 20-item mfi . scoring of the bdi - ii allowed for the identification of mild , moderate , and severe levels of depressive symptoms and for the quantification of change in status over time . information concerning any adverse events ( aes ) reported by patients or observed by investigators or other staff was collected throughout the study , starting from the time of informed consent . any aes that continued at the time of discontinuation or completion of the study were followed until resolution , until the event was no longer considered clinically significant , or for at least 30 days following the patient s completion or discontinuation from the study . clinical laboratory tests ( hematology , biochemistry , hsv-1 igg , and urinalysis ) were evaluated at screening and weeks 6 and 16/et and processed via a central laboratory . physical examination and general safety assessments were conducted prior to randomization , and vital signs were obtained at each study visit . because this was the first double - blind trial of this famciclovir + celecoxib combination , power calculations to determine sample size could only be estimated . based on studies of other agents in a similar patient population , the sponsor elected to assume an improvement in pain scores for the combination arm of 2.4 units , compared to 1.3 for placebo . the intra - subject variability was assumed to be 1.5 and between - subject variability 2.3 . under these assumptions , the sample size necessary to reject the null hypothesis of no difference in change in mean pain scores over 16 weeks with 80% power at the 0.05 significance level was 69 subjects per arm ( 138 subjects total ) . all patients who received at least one dose of study medication were included in the intent - to - treat analyses . all statistical tests were performed by premier research using sas software version 9.1 . for the primary efficacy outcome measures , mean changes from baseline in pain intensity scores ( 24-hour recall pain nrs and 7-day recall pain from fiq - r ) were analyzed using an mmrm approach . the analysis model included the fixed categorical effects of treatment , center , weeks ( 6 , 12 , and 16 ) , and treatment - by - week interaction , as well as the continuous fixed covariate of baseline score . significance tests were based on least - squares mean values using a two - sided p=0.05 ( two - sided 95% confidence intervals ) . secondary efficacy outcome measures were analyzed as follows : the pgic responder analysis used a logistic regression model in which patients with results of very much improved or much improved at endpoint were compared to those with all other results . in this model , any patients with missing data at week 16 were considered non-responders.the total fiq - r score change from baseline was analyzed by the primary mmrm analysis method.pain responder analyses , used to determine the number of patients meeting 30%50% reduction in pain , were calculated using a generalized linear regression curve fit comparing each patient s change in pain from baseline to end using the 24-hour recall nrs and 7-day recall fiq - r pain scores . the pgic responder analysis used a logistic regression model in which patients with results of very much improved or much improved at endpoint were compared to those with all other results . in this model , any patients with missing data at week 16 were considered non - responders . the total fiq - r score change from baseline was analyzed by the primary mmrm analysis method . pain responder analyses , used to determine the number of patients meeting 30%50% reduction in pain , were calculated using a generalized linear regression curve fit comparing each patient s change in pain from baseline to end using the 24-hour recall nrs and 7-day recall fiq - r pain scores . the exploratory endpoints of promis fatigue , bdi - ii , fiq - r domains , and mfi domains were also analyzed with the same mmrm approach that was applied to the primary analysis . of the 191 patients screened , 143 entered the study with random assignment to either placebo ( n=74 ) or the imc-1 treatment ( n=69 ; figure 1 ) . completion rates for the 16-week study were 60.8% ( 45 of 74 ) for placebo and 82.6% ( 57 of 69 ) for the imc-1 treatment . patient demographics and baseline clinical characteristics were comparable across both treatment groups ( table 1 ) . the majority of patients were caucasian ( 95.8% ) and female ( 93.7% ) with a mean age of ~49 years . the mean 24-hour recall nrs scores at baseline were 7.1 and 6.5 for patients randomized to placebo or imc-1 treatment , respectively . the mean fiq - r 7-day recall pain scores at baseline were 6.8 and 6.5 for patients randomized to placebo or imc-1 , respectively . duration of fm symptoms ranged from < 1 year t30 years , with a mean duration of 10 years . the primary efficacy endpoint was reduction in pain from baseline and was evaluated at week 16 using the 24-hour recall nrs and 7-day recall fiq - r pain measures ( table 2 ) . analysis of the 24-hour recall nrs with imputation , as well as the 7-day recall pain item with and without imputation showed that patients on the imc-1 treatment experienced a statistically significant greater reduction in pain when compared with placebo . the 24-hour recall pain item , when analyzed without imputation , did not separate from placebo . secondary efficacy assessments included the pgic , fiq - r , and 30% and 50% pain responder analyses ( table 3 ) . the pgic can be viewed as a patient s assessment of overall benefit of therapy . using this measure , the imc-1 treatment group showed significant improvement over placebo with responder rates of 37.7% and 33.3% at weeks 12 and 16 , respectively , versus responder rates of 17.8% and 19.2% at the same visits for the placebo group ( p=0.005 and 0.040 , respectively ) . the fiq - r was designed to be a disease - specific measure of change in several domains important to fm patients . at week 16 , the imc-1 group showed a statistically significant improvement in their fm as measured by the fiq - r total score ( p=0.002 ) , fiq - r functional domain ( p=0.004 ) , fiq - r overall impact domain ( p=0.003 ) , and fiq - r symptoms domain ( p=0.004 ) . responder analyses , used to estimate whether each patient s pain scores met / exceeded a 30% or 50% reduction from baseline , were performed using the 24-hour recall nrs and the 7-day recall fiq - r pain scores from weeks 6 , 12 , and 16 . a statistically significant separation between treatment groups was not observed for the 30% responder analysis using the 24-hour recall nrs pain scores . however , the higher hurdle of 50% pain reduction from baseline showed a significant separation between treatment groups with response rates of 31.3% and 30.3% for imc-1 treatment at weeks 12 and 16 , respectively , and rates of 15.3% and 15.1% for placebo at the same visits ( p=0.018 and 0.009 , respectively ) . using the 7-day recall fiq - r pain measure , the imc-1 treatment group showed significantly improved 30% and 50% responder rates at weeks 12 and 16 , respectively . exploratory efficacy assessments included the promis fatigue inventory , the mfi , and the bdi - ii ( table 4 ) . the promis fatigue short form , developed by the nih promis program , focuses on fatigue related to energy levels and was designed to assess symptom changes in populations irrespective of the underlying condition . the promis fatigue scale showed a statistically significant separation between treatment groups at week 16 ( p=0.001 ) . the older mfi was designed to measure multiple aspects of fatigue including mental fatigue and motivation . over the 16 weeks of the study , the imc-1 group exhibited a 3.34.4 point reduction in total bdi - ii score compared to a 1.21.9 point reduction in the placebo group , with the ranges reflecting the results using different imputation methods for missing data . although the difference between the treatment groups was not statistically significant , the results corroborate the overall improvement observed with imc-1 treatment . the safety and tolerability profile for imc-1 in this first multicenter clinical trial was encouraging , with a lower frequency of aes and a higher completion rate in the imc-1 group as compared to the placebo group . the difference in completion rates was driven by a nearly three - fold higher discontinuation rate in the placebo group secondary to aes ( 16.4% vs. 5.8% , placebo vs. imc-1 ) and therapeutic failure ( 17.2% vs. 6.2% , placebo vs. imc-1 ) . aes reported for the imc-1 group were less severe than those for the placebo group with 31.9% mild , 33.3% moderate , and 7.2% severe for imc-1 versus 19.2% mild , 42.5% moderate , and 16.4% severe for placebo . placebo group patients reported treatment emergent adverse events ( teaes ) in many of the medical dictionary for regulatory activities system organ classes more frequently than imc-1 patients ( table 5 ) . interestingly , gastrointestinal ( gi ) teaes were reported by 42.5% of placebo patients , but by only 29% of imc-1 patients . the low frequency of vascular and cardiac aes was also encouraging given the cox-2 inhibitor component of imc-1 . one imc-1 patient experienced a non - st segment elevation myocardial infarction within a few weeks of randomization ; however , this patient was discovered to have significant coronary artery disease that was considered the most important causal factor . three placebo patients also reported cardiac aes ( angina pectoris , palpitations , and supraventricular extrasystoles ) . consistent with the known safety profile of celecoxib , there was evidence of a slightly higher frequency of teaes related to increase in hepatic enzymes ( lactate dehydrogenase and gamma - glutamyl transferase ) in the imc-1 treatment group . other teaes reported more frequently in imc-1-treated patients also appeared consistent with the known safety profiles of celecoxib and famciclovir . based on the results of this study , there is no evidence for any additional safety signals secondary to the combined use of celecoxib and famciclovir at the doses studied . of the 191 patients screened , 143 entered the study with random assignment to either placebo ( n=74 ) or the imc-1 treatment ( n=69 ; figure 1 ) . completion rates for the 16-week study were 60.8% ( 45 of 74 ) for placebo and 82.6% ( 57 of 69 ) for the imc-1 treatment . patient demographics and baseline clinical characteristics were comparable across both treatment groups ( table 1 ) . the majority of patients were caucasian ( 95.8% ) and female ( 93.7% ) with a mean age of ~49 years . the mean 24-hour recall nrs scores at baseline were 7.1 and 6.5 for patients randomized to placebo or imc-1 treatment , respectively . the mean fiq - r 7-day recall pain scores at baseline were 6.8 and 6.5 for patients randomized to placebo or imc-1 , respectively . duration of fm symptoms ranged from < 1 year t30 years , with a mean duration of 10 years . the primary efficacy endpoint was reduction in pain from baseline and was evaluated at week 16 using the 24-hour recall nrs and 7-day recall fiq - r pain measures ( table 2 ) . analysis of the 24-hour recall nrs with imputation , as well as the 7-day recall pain item with and without imputation showed that patients on the imc-1 treatment experienced a statistically significant greater reduction in pain when compared with placebo . the 24-hour recall pain item , when analyzed without imputation , did not separate from placebo . secondary efficacy assessments included the pgic , fiq - r , and 30% and 50% pain responder analyses ( table 3 ) . the pgic can be viewed as a patient s assessment of overall benefit of therapy . using this measure , the imc-1 treatment group showed significant improvement over placebo with responder rates of 37.7% and 33.3% at weeks 12 and 16 , respectively , versus responder rates of 17.8% and 19.2% at the same visits for the placebo group ( p=0.005 and 0.040 , respectively ) . the fiq - r was designed to be a disease - specific measure of change in several domains important to fm patients . at week 16 , the imc-1 group showed a statistically significant improvement in their fm as measured by the fiq - r total score ( p=0.002 ) , fiq - r functional domain ( p=0.004 ) , fiq - r overall impact domain ( p=0.003 ) , and fiq - r symptoms domain ( p=0.004 ) . responder analyses , used to estimate whether each patient s pain scores met / exceeded a 30% or 50% reduction from baseline , were performed using the 24-hour recall nrs and the 7-day recall fiq - r pain scores from weeks 6 , 12 , and 16 . a statistically significant separation between treatment groups was not observed for the 30% responder analysis using the 24-hour recall nrs pain scores . however , the higher hurdle of 50% pain reduction from baseline showed a significant separation between treatment groups with response rates of 31.3% and 30.3% for imc-1 treatment at weeks 12 and 16 , respectively , and rates of 15.3% and 15.1% for placebo at the same visits ( p=0.018 and 0.009 , respectively ) . using the 7-day recall fiq - r pain measure , the imc-1 treatment group showed significantly improved 30% and 50% responder rates at weeks 12 and 16 , respectively . exploratory efficacy assessments included the promis fatigue inventory , the mfi , and the bdi - ii ( table 4 ) . the promis fatigue short form , developed by the nih promis program , focuses on fatigue related to energy levels and was designed to assess symptom changes in populations irrespective of the underlying condition . the promis fatigue scale showed a statistically significant separation between treatment groups at week 16 ( p=0.001 ) . the older mfi was designed to measure multiple aspects of fatigue including mental fatigue and motivation . the bdi - ii was used as both a safety and efficacy parameter . over the 16 weeks of the study , the imc-1 group exhibited a 3.34.4 point reduction in total bdi - ii score compared to a 1.21.9 point reduction in the placebo group , with the ranges reflecting the results using different imputation methods for missing data . although the difference between the treatment groups was not statistically significant , the results corroborate the overall improvement observed with imc-1 treatment . the safety and tolerability profile for imc-1 in this first multicenter clinical trial was encouraging , with a lower frequency of aes and a higher completion rate in the imc-1 group as compared to the placebo group . the difference in completion rates was driven by a nearly three - fold higher discontinuation rate in the placebo group secondary to aes ( 16.4% vs. 5.8% , placebo vs. imc-1 ) and therapeutic failure ( 17.2% vs. 6.2% , placebo vs. imc-1 ) . aes reported for the imc-1 group were less severe than those for the placebo group with 31.9% mild , 33.3% moderate , and 7.2% severe for imc-1 versus 19.2% mild , 42.5% moderate , and 16.4% severe for placebo . placebo group patients reported treatment emergent adverse events ( teaes ) in many of the medical dictionary for regulatory activities system organ classes more frequently than imc-1 patients ( table 5 ) . interestingly , gastrointestinal ( gi ) teaes were reported by 42.5% of placebo patients , but by only 29% of imc-1 patients . the low frequency of vascular and cardiac aes was also encouraging given the cox-2 inhibitor component of imc-1 . one imc-1 patient experienced a non - st segment elevation myocardial infarction within a few weeks of randomization ; however , this patient was discovered to have significant coronary artery disease that was considered the most important causal factor . three placebo patients also reported cardiac aes ( angina pectoris , palpitations , and supraventricular extrasystoles ) . consistent with the known safety profile of celecoxib , there was evidence of a slightly higher frequency of teaes related to increase in hepatic enzymes ( lactate dehydrogenase and gamma - glutamyl transferase ) in the imc-1 treatment group . other teaes reported more frequently in imc-1-treated patients also appeared consistent with the known safety profiles of celecoxib and famciclovir . based on the results of this study , there is no evidence for any additional safety signals secondary to the combined use of celecoxib and famciclovir at the doses studied . the clinical evidence supporting the drug combination utilized in this study was first derived through care of the lead author s patients with irritable bowel syndrome . a number of chronic gi disorders , including ibs and reflux , are frequently comorbid with fm . ibs patients were initially treated with famciclovir , yet those also placed on celecoxib for arthritis were the patients who demonstrated a dramatic improvement . a number of these patients expressed gratitude that their fibromyalgia symptoms were also reduced with this combination therapy . this clinical experience led to the hypothesis that recurrent reactivation of a tissue - resident herpesvirus in genetically susceptible individuals could contribute to the symptoms of fibromyalgia . at the end of this 16-week trial , famciclovir + celecoxib imc-1 treatment provided a significant improvement in fm pain as compared to placebo and as measured by the fiq - r 7-day recall pain item and 24-hour recall pain score . the pgic has been shown in previous fm studies to be a sensitive measure of clinical benefit . at all study visits , a statistically greater number of the imc-1-treated patients reported meaningful improvement on the pgic when compared to placebo - treated patients . the fiq - r was included in the study as a key secondary endpoint as a measure of disease - specific activity of the therapy . at all follow - up visits , imc-1-treated patients reported higher rates of improvement in the total score of the fiq - r with the contrast at weeks 6 and 16 meeting statistical significance . analysis of the domains that comprises the fiq total score showed that all three individual domains were statistically significant at the primary endpoint . strong support for the efficacy of imc-1 was also found in the lower discontinuation rate of imc-1 relative to placebo ( 17% vs. 39% ) , the lower rates of rescue medication usage among imc-1-treated patients relative to placebo ( 25% vs. 41% ) , a significant reduction in fatigue as measured by the promis fatigue scale , and a trend toward decreased depressive symptomatology as measured by the bdi - ii . one explanation for the promising results of this is the combination effect of the famciclovir and celecoxib components of the imc-1 both of which act to inhibit herpesvirus infections . famciclovir is ultimately converted to penciclovir triphosphate in herpesvirus infected cells and acts through competitive inhibition of the viral dna polymerase and chain termination , reducing viral dna synthesis and replication.23 as mentioned above , many herpesviruses significantly up - regulate cox-2 and to a lesser degree cox-1 . virally - induced up - regulation of cox enzymes is important for efficient viral replication and cox inhibitors exhibit anti - herpetic properties reducing both virus replication during lytic infections as well as the frequency of reactivation of latent infections.1221 the efficacy of this drug combination in treating multiple symptoms of fibromyalgia suggests a persistent nociceptive infection with hsv may contribute to this chronic pain syndrome in some patients . when studied alone as monotherapies in previous investigations , neither an anti - herpesvirus nucleoside analog nor a cox-2 inhibitor was found to be efficacious in the treatment of fibromyalgia,7,24 suggesting when used in concert these two drug classes may act additively and/or synergistically , thereby increasing efficacy . virtually all outcome measures , with the exception of the 24-hour recall nrs pain item when analyzed without imputation for missing data , were statistically significant or strongly trended in favor of imc-1 over placebo . given the modest size of the trial , coupled with the fact that this was the first clinical evaluation of imc-1 in a multicenter trial setting , we conclude that there is evidence of clinical efficacy for the tested famciclovir + celecoxib combination in treating the symptoms of fm .

objectiveinfections and other stressors have been implicated in the development of fibromyalgia . we hypothesized that these stressors could result in recurrent reactivations of latent herpes virus infections , which could lead to the development of fibromyalgia . this study evaluated a famciclovir + celecoxib drug combination ( imc-1 ) , active against suspected herpes virus reactivation and infection , for the treatment of fibromyalgia.methodsa total of 143 fibromyalgia patients were enrolled at 12 sites in a 16-week , double - blinded , placebo - controlled proof - of - concept trial . randomized patients received either imc-1 or placebo in a 1:1 ratio . outcome measures included a 24-hour recall pain numerical rating scale , the revised fibromyalgia impact questionnaire ( fiq - r ) , the patient s global impression of change ( pgic ) questionnaire , the multidimensional fatigue inventory , the nih patient - reported outcomes measurement information system ( promis ) , and the beck depression inventory - ii conducted at baseline and weeks 6 , 12 , and 16 of the study.resultsa significant decrease in fibromyalgia - related pain was observed for patients on imc-1 treatment versus placebo . pgic response rates were significantly improved with imc-1 treatment . overall , patient self - reported functioning , as measured by the fiq - r , was significantly improved . fatigue was also significantly improved as measured by the promis fatigue inventory . the safety profile was encouraging . despite the celecoxib component of imc-1 , gastrointestinal and nervous system treatment emergent adverse events were reported less frequently in the imc-1 group , and study completion rates favored imc-1 treatment.conclusionimc-1 was efficacious and safe in treating symptoms of fibromyalgia , supporting the hypothesis that herpes virus infections may contribute to this syndrome . improved retention rates , decreased adverse event rates , and evidence of efficacy on a broad spectrum of outcome measures are suggestive that imc-1 may represent an effective , novel treatment for fibromyalgia .

Introduction Patients and methods Study overview Entry criteria Study design Outcome measures Safety assessments Sample size Statistical analyses Results Patient disposition Patient demographics and baseline characteristics Efficacy Tolerability and safety Discussion Conclusion

the open window theory implies that there is altered immunity following an acute bout of exercise , which lasts from three to 72 hours after exercise depending on the parameter measured . according to the theory , there is an increased risk of contracting infectious diseases after physical exercise . the j means that individuals engaged in moderate physical activity are at lower risk compared with sedentary individuals . on the other side , excessive volumes of strenuous endurance exercise it is evident that great numbers of molecules encompass the term proinflammatory cytokines . these cytokines are produced very early in the response to multiple stresses and are important by being involved in both innate and acquired immunity . cytokines are characterised as being inducible and belong to different families , including proinflammatory cytokines ( il-1 , il-2 , il-4 , il-6 , il-8 , and tnf ) , which are cytokines that promote systemic inflammation , and anti - inflammatory cytokines ( il-5 , il-6 , and il-10 ) , which refer to the property of a substance that reduces and protects against inflammation . inflammation in excess is detrimental and excessive production and release of tnf and il-1 may lead to pathology . vascular endothelial growth factor ( vegf ) is a signal protein produced by cells that stimulates vasculogenesis and angiogenesis . proinflammatory cytokines like il-1 , il-6 , il-8 , tgf- , and tnf- variably increase vegf expression , depending upon the dose , cell , or tissue type . surgery , trauma , burn , and sepsis induce a pattern of hormonal and immunological responses with the same response profile as that of exercise . earlier studies regarding exercise and effects on immunological parameters indicate that the profiles of proinflammatory and anti - inflammatory cytokine levels are stimulated based on the intensity and duration of the physical exercise [ 8 , 9 ] . long - distance runners , for example , marathon runners , have shown high postexercise levels of il-1 , il-6 , and il-8 after six hours ' endurance exercise [ 911 ] , while there were no changes observed in plasma cytokine levels after a 5-kilometre run . measurements from cycle ergometer and treadmill running show no response of short - term exercise with high and moderate intensity , an increase in il-6 after one - hour cycling at 75% of maximal oxygen consumption ( vo2max ) and three - hours alternating cycling and treadmill running at 6065% of vo2max showed high postexercise values of il-6 , il-1 , and tnf [ 1315 ] . other studies indicate that long - term sleep and energy deficiency lead to immune depression [ 16 , 17 ] . microsphere - based multiplexing bioassay system has , during the last few years , become an important tool in cytokine detection . the assay is performed with great speed and accuracy by making use of hundreds of specially prepared magnetic beads , or microspheres , and is reporting on the contents of the sample . this is in contrast to the classical analysis of cytokine expression patterns , which has been performed by enzyme - linked immunosorbent assays ( elisa ) for each separate analysis . very few studies within the field of exercise immunology have so far used the multiplex technology in cytokine detection in relation to exercise or physical activity executed by healthy people . according to prior reports , we expect in our study that the marathon / half - marathon race and the ranger - training course will lead to immunological responses in the subjects as seen in surgery and sepsis patients . the aim of this study was to examine the secretion of the cytokines il-1 , il-2 , il-4 , il-5 , il-6 , il-8 , il-10 , il-12 , tnf , ifn , gm - csf , and vegf before and after three different trials of physical exercise : the oslo marathon / half - marathon and a military training course of eight days continuous exercise combined with sleep and energy deprivation . both the spontaneous secretion of the cytokines and the lipopolysaccharide- ( lps- ) induced whole blood stimulation of cytokines were examined . fourteen men participating in oslo marathon race ( mean age 40 ; range 2956 ) , eight women ( mean age 36 ; range 2739 ) and eight men ( mean age 34 ; range 3045 ) participating in oslo half - marathon race , and ten physically well - trained male cadets from the norwegian military academy in the age between 21 and 28 years were recruited to this study . the marathon runners were selected based on the previous year 's result list with the criterion that the expected running time should be 3 h 30 min ; the corresponding criterion for the half - marathon runners was 1 h 30 min for men and 1 h 45 min for women . the ranger - training course took place in the eastern part of norway , in a forest area at 500 m altitude . the temperature during the eight days of the course was between 18 and 30c during daytime and between 5 and 15c at night . the cadets were provided nearly no food during the course and approximately 3 hours/8 d sleep was allowed . in the restitution period ( day 9 through day 11 ) , the cadets followed regular sleeping and eating habits as before the course . the subjects were informed about the study and gave their written informed consent for participation . for the marathon runners and the half - marathon runners , blood samples were collected shortly before the race and immediately after the race . for the military cadets , blood samples were collected at the start of the ranger - training course , after 2 , 4 , and 8 days ( end of the ranger - training course ) , and after one ( day 9 ) and three ( day 11 ) days ' recovery . the blood samples from the cadets were taken between 6 and 8 a.m. for all groups , venous blood was sampled into either edta- , na - citrate- , or heparin - anticoagulated vacuum tubes ( becton dickinson , plymouth , uk ) . the blood samples from the ranger - training course were collected in the field , kept on ice , and transported within 60 minutes to the nearest military training camp , terningmoen , where a temporary laboratory was established . the blood samples from the marathon and the half - marathon runners where collected in the start area of the race , kept on ice , and transported within 30 minutes to ullevl university hospital . plasma was separated at 2500 g for 10 minutes and samples were stored at 80c until analysis . to compare the cytokine production capacities of leukocytes , one set of experiments was performed with heparinized whole blood from the half - marathon runners and the ranger - training cadets . the blood samples were stimulated ex vivo with the potent cytokine inducer lipopolysaccharide ( lps ) , 1 g / ml ( working solution ) ( from escherichia coli 026 : b6 , sigma st . louis , mo , usa ) for 6 h at 37c , before storing plasma samples at 80c until analysis . white blood cell ( wbc ) , platelet and erythrocyte counts , haemoglobin , and haematocrit were assessed in edta blood using the technicon h2 system ( bayer corporation , tarrytown , ny , usa ) at the department of medical biochemistry , oslo university hospital , ullevl . plasma levels of individual cytokines ( il-1 , il-6 , il-8 , il-10 , and tnf ) were measured using the quantikine colorimetric sandwich enzyme - linked immunosorbent assays ( elisa ) from r&d , abingdon , uk , according to the manufacturer 's instructions . we used the multiplex bead - based sandwich immunoassay technology ( luminex , austin , tx , usa ) and a human cytokine 12-plex kit ( r&d ) , strictly following the manufacturer 's instructions , to measure the concentration of the following cytokines before and after the marathon race : il-1 , il-2 , il-4 , il-5 , il-6 , il-8 , il-10 , il-12 , tnf , ifn , gm - csf , and vegf . unfortunately , we only had the multiplex bead - based sandwich immunoassay technology ( luminex ) available for the study with the marathon runners . the levels of cytokine release in the half - marathon runners and the cadets from the ranger - training course were therefore measured using the quantikine colorimetric sandwich enzyme - linked immunosorbent assays ( elisa ) . results are given as means and standard errors of the mean ( mean , sem ) . difference within groups ( marathon and half - marathon ) was analysed using two - tailed paired sample t - test . independent sample t - test was used in order to compare men and women within the half - marathon group . since we did not observe any statistically significant differences between the women and men , we have chosen to present the results from the half - marathon runners as one group . paired sample t - test was used to compare results from day 0 to results after 2 , 4 , and 8 days during the ranger - training course , and after day 1 and 3 days recovery . in the ranger - training course the repeated and longitudinal values obtained before , during , and after the period of exercise which made the subjects being their own controls . the total leukocyte counts ( wbc ) ( 10/l ) increased by 3.2-fold ( values before : 5.1 , values after : 16.4 , p < 0.01 ) after the marathon race , 2.4-fold ( values before : 6.3 , values after : 15.2 , p < 0.01 ) after the half - marathon race , and 1.5-fold ( values before : 6.3 , values after : 9.5 , p < 0.01 ) at the end of the ranger - training course ( day 8) . after the ranger - training course , wbc were back to normal values after one - day ( day 9 ) recovery . the increase in wbc was mainly due to a significant increase in neutrophils after both of the marathon races and after the ranger - training course , but monocyte counts were also consistently increased in all three experimental settings . the platelet counts ( 10/l ) increased significantly after both the marathon race ( values before : 194 , values after : 243 , p < 0.01 ) and the half - marathon race ( values before : 255 , values after : 313 , p < 0.05 ) and after eight days at the ranger - training course ( values before : 214 , values after : 265 , p < 0.05 ) . we observed no changes in haemoglobin values after the marathon and the half - marathon races . a slight decrease in haemoglobin values was observed after eight days in the military training course ( p < 0.05 ) , maintained during the whole recovery period . the haematocrit values remained unchanged after the running races , whereas the values were reduced during days 48 of the ranger - training course as well as during the recovery phase . we performed a plain analysis of plasma levels of 12 cytokines in 14 individuals before and after a marathon race . three of these cytokines were heavily increased when comparing pre / post plasma levels : il-6 ( 26-fold increase , p < 0.001 ) , il-10 ( 28-fold increase , p < 0.000 ) , and il-8 ( 11-fold increase , p < 0.001 ) . the other measured cytokines , il-1 , il-2 , il-4 , il-5 , il-12 , tnf , ifn , gm - csf , and vegf , did not change significantly after the marathon race . half - marathon ( table 1 ) . in the half - marathon race we demonstrated significantly increased plasma levels of il-6 ( 40-fold increase , p < 0.001 ) , il-10 ( 10-fold increase , p < 0.001 ) , and il-8 ( 14-fold increase , p < 0.001 ) , whereas il-1 and tnf were unchanged after the race . when examining lps - stimulated cytokine levels , il-6 , il-1 , and tnf were reduced after the race ( il-6 45% reduced , p < 0.001 ; il-1 24% reduced , p < 0.05 ; and tnf 43% reduced , p < 0.001 ) . on the contrary , il-10 and il-8 were further increased when lps stimulation was superposed ; il-10 225% increased , p < 0.01 , and il-8 242% increased , p < 0.001 . ranger - training course ( tables 2 and 3 ) . the subjects of the ranger - training course showed smaller increase than in the half - marathon race with surprisingly highest levels in the postrace recovery period ( table 2 ) . il-1 , il-6 , il-8 , il-10 , and tnf were all significantly increased at some stage during the course . additional investigations including lps stimulation of whole blood showed reduced production capacity for il-1 , il-6 , and tnf , whereas the il-8 and il-10 levels were further increased in a similar manner as after the half - marathon ( table 3 ) . several studies have observed leukocytosis after physical exercise [ 2 , 18 , 19 ] . physical exercise leads to an excessive increase in total number of neutrophils immediately and is followed by a slightly smaller increase a few hours after the exercise . in our study , the blood samples were taken immediately after the exercise and only the initial increase in leukocytes was measured . we observed a 3.2-fold and a 2.4-fold increase in leukocytes after the marathon race and the half - marathon race , respectively . at the end of the ranger - training course ( day 8) , the levels of leukocytes had increased by 1.5-fold . in agreement with former studies we found that the increase in leukocyte counts is primarily due to increase in neutrophils , although monocytes and lymphocytes were increased as well . the first increase in neutrophils is mainly due to release of marginated cells caused by mechanical shear stress and catecholamines . the reason for the different levels of leukocytes in the three exercise trials is probably due to the type and the duration of the activity , and this corresponds to earlier studies [ 23 , 24 ] . acute exercise in healthy individuals has an effect on cytokines and the inflammatory response as well . the intensity , duration , and type of physical exercise can all influence proinflammatory and anti - inflammatory cytokines and thereby influence the susceptibility to inflammatory diseases . [ 4 , 25 ] reported a 2-fold increase in tnf and il-1 after a marathon race , in addition to a nearly 100-fold increase in il-6 values . exercise studies of three hours ' duration performed in laboratories have shown increase in the same parameters . we observed after the marathon and the half - marathon races a 26-fold and a 40-fold increase in il-6 . the magnitude of increase in il-6 is closely related to the duration of the activity , the age of the athlete , the body mass index ( bmi ) , and the physical condition of the person [ 13 , 14 ] . the participants in our trials were moderate to well - trained individuals executing physical exercise of long duration . the half - marathon runners were on average 5 years younger compared to the marathon runners , they run half the distance of a marathon race , and they probably ran the half - marathon race with higher heart rate compared to the level of intensity of the marathon runners . our study did not separately measure the effect of running intensity and running duration on the plasma cytokine levels after marathon and half - marathon running . for the marathon runners we observed 11-fold and 28-fold increase in il-8 and il-10 , respectively , but no change in tnf and il-1. in the half - marathon runners , we observed a 10-fold increase in il-10 and 14-fold increase in il-8 , but as for the marathon race , no changes in il-1 and tnf values were recorded . it seems that tnf and il-1 do not increase exponentially during exercise , which is different when compared to infections . it could be hypothesized that the high levels of the anti - inflammatory cytokines il-6 and il-10 in our study might prevent the production of tnf- and il-1 after the races . il-6 is called an inflammatory responding cytokine described as a proinflammatory cytokine but can also stimulate anti - inflammatory cytokines . il-6 is highly increased during strenuous physical exercise and thus takes part in the control of the inflammatory response to strenuous physical exercise [ 25 , 28 ] . the proinflammatory tnf is known to be inhibited by il-10 and induced by different stressors [ 30 , 31 ] . the values obtained after physical exercise are inconstant related to the variations in duration and intensity of the exercise tasks . in the ranger - training course , there was no increase in il-6 or il-10 during the period of activity , but , surprisingly , a small increase in the recovery phase ( days 9 and 11 ) . il-1 and il-8 showed a small increase during the course and in the recovery period . the boosting of cytokine responses in peripheral blood leukocytes by lps in many ways mimics the initial innate immune response to bacterial infection , lps stimulation showed that the plasma levels of both il-6 , il-1 , and tnf were significantly reduced after the half - marathon race as well as during and after the ranger - training course . who have observed reduced il-6 , il-1 , and tnf- levels in lps - stimulated samples 30 min and 3 h after exercise in half - marathon runners . the observed reduction after the half - marathon race and the ranger - training course may be due to either actually reduced production capacity as a result of exercise or at least a temporary change in the regulatory pathways leading to altered cytokine synthesis and release . in contrast , il-8 and il-10 were boosted both by the exercise itself and after additional lps stimulation . it seems that the anti - inflammatory il-10 production is more triggered in the long - lasting marathon race ( 28-fold increase ) compared with the shorter workload of the half - marathon race ( 10-fold increase ) . furthermore , the il-6 release was more pronounced in the more work - intensive half - marathon than the longer - lasting but less intensive marathon race ( 40-fold versus 26-fold increase ) , possibly being mainly due to a larger release from the muscle mass of the lower extremities . although a similar cytokine profile was registered in the ranger - training course , the magnitude of cytokine increases was not as impressive as for the corresponding marathon races , again possible due to a lesser work load per time unit as well as the lower work intensity . regardless , we have in all three experimental settings demonstrated an increase of proinflammatory and anti - inflammatory cytokines , which in many ways are similar to the cytokine profile , which characterises inflammatory and infectious diseases [ 8 , 27 ] . the balance between proinflammatory and anti - inflammatory cytokines during exercise may lay the ground for potentiation of the inflammatory status by introducing additional coincidental pathogens of both gram - negative and gram - positive origin , which thereby can tilt the balance into overt disease . both lps of gram - negative bacteria and lipoteichoic acid ( lta ) , peptidoglycan , and purified protein derivative ( ppd ) of gram - positive bacteria all have a number of biological activities , including also being potent cytokine inducers [ 35 , 36 ] . most of the studies do only look at the direct immunological responses occurring immediately after different types of physical activity . the very new part in our study is the three days follow - up after the end of the ranger - training course . it may , however , be noted that the training course was performed at a season of the year where the general burden of common cold or influenza - like disease is at a minimum . in conclusion , our study of long - term physical exercise performed in three different trials showed a significant increase in plasma levels of the cytokines il-6 , il-8 , and il-10 , whereas tnf and il-1 levels were unchanged or reduced . open window of altered immunity after long - term physical exercise and which lasts for at least 72 hours after the exercise . the results support the j - curve theory ; athletes are more sensitive to pathogens in the immediate period after intensive physical exercise , probably due to the exercise - induced inflammatory state that can exaggerate the response to coincidentally occurring pathogens .

the open window theory indicates altered immunity 3 to 72 hours after exercise . the j - curve describes the risk of illness in response to exercise . the aim of this study was to examine the secretion of proinflammatory and anti - inflammatory cytokines before and after long - term strenuous exercise . fourteen marathon and 16 half - marathon runners and 10 military cadets participating in a military ranger - training course were recruited to this study . within - subject design was used measuring levels of plasma cytokines before , during , and after exercise . plasma cytokines were measured using luminex multiplex technology and elisa . comparing pre / post plasma levels both the marathon- and the half - marathon runners showed heavily increased levels of il-6 , il-10 , and il-8 ( p < 0.001 ) . lps stimulation among the half - marathon runners decreased the postrace levels of il-6 , il-1b , and tnf by 45% , 24% , and 43% , respectively ( p < 0.01 ) . during the ranger training course the spontaneous and lps - stimulated levels of il-6 , il-8 , il-10 , il-1b , and tnf changed in a similar fashion as in the half - marathon runners although the fluctuations were smaller . our study supports the open window and the j - curve theory ; the immune system is more activated and the subjects are more threatened to infectious pathogens after intensive physical activity and in the period after exercise .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusion

to date , only one study has investigated the association between aging and cancer by an extensive examination of the expression profiling of aging - related genes in various human tumor types . i have identified 3,359 human aging - related genes on the basis of 10 relevant publications ; these genes are involved in the aging of six different tissues : the brain , eye , kidney , muscle , skin , and blood. from these 3,359 genes , i identified 69 aging - related signature genes ( asgs ) that are commonly expressed in multiple tissues . the functional analysis of the 69-gene set revealed two important kegg pathways : pathways in cancer and mapk signaling pathway , both of which are significantly relevant to cancer . the gene ontology ( go ) analysis of the 69 genes identified significant aging - related go terms , including oxidative stress , mitochondrial function , apoptosis and senescence , and dna damage repair . in addition , i obtained 261 human aging - related genes ( hags ) from the human ageing genomic resources website ( http://genomics.senescence.info/genes/allgenes.php ) , which is an important resource that collects hags . within this 261-gene list , for example , fos regulates cell proliferation , differentiation , apoptosis , and transformation , and has been associated with aging and cancer . foxo1 belongs to the forkhead family of transcription factors , which are strongly associated with human longevity and cancer . tp63 encodes a member of the p53 family of transcription factors and has been associated with aging and cancer - related pathology , . i have identified 28 sets of differentially expressed genes by the 28 normal vs. tumor phenotypes class comparisons in 25 human tumor gene expression datasets ; subsequently , i analyzed the overlap between each of these 28 gene sets and each of the aforementioned asgs and hags . table 1 presents several representative genes that are highly overlapping between both classes of datasets , which include not only the aforementioned fos , foxo1 , and tp63 but also certain other genes , such as apod , igf1 and foxm1 that have also been shown to strongly correlate aging with cancer . gene function enrichment analyses suggested that these highly overlapping genes were primarily involved in metabolic process , cell cycle regulation , dna damage response , apoptosis , cell proliferation , and transcriptional regulation . based on these highly overlapping genes , these pathways include pathways in cancer , erbb signaling pathway , mapk signaling pathway , cell cycle , t - cell receptor signaling pathway , mtor signaling pathway , b - cell receptor signaling pathway , p53 signaling pathway , insulin signaling pathway , vegf signaling pathway , and chemokine signaling pathway , among others . ags , aging - related signature genes ; hag , human aging - related genes . i have identified 3,359 human aging - related genes on the basis of 10 relevant publications ; these genes are involved in the aging of six different tissues : the brain , eye , kidney , muscle , skin , and blood. from these 3,359 genes , i identified 69 aging - related signature genes ( asgs ) that are commonly expressed in multiple tissues . the functional analysis of the 69-gene set revealed two important kegg pathways : pathways in cancer and mapk signaling pathway , both of which are significantly relevant to cancer . the gene ontology ( go ) analysis of the 69 genes identified significant aging - related go terms , including oxidative stress , mitochondrial function , apoptosis and senescence , and dna damage repair . in addition , i obtained 261 human aging - related genes ( hags ) from the human ageing genomic resources website ( http://genomics.senescence.info/genes/allgenes.php ) , which is an important resource that collects hags . within this 261-gene list , for example , fos regulates cell proliferation , differentiation , apoptosis , and transformation , and has been associated with aging and cancer . foxo1 belongs to the forkhead family of transcription factors , which are strongly associated with human longevity and cancer . tp63 encodes a member of the p53 family of transcription factors and has been associated with aging and cancer - related pathology , . i have identified 28 sets of differentially expressed genes by the 28 normal vs. tumor phenotypes class comparisons in 25 human tumor gene expression datasets ; subsequently , i analyzed the overlap between each of these 28 gene sets and each of the aforementioned asgs and hags . table 1 presents several representative genes that are highly overlapping between both classes of datasets , which include not only the aforementioned fos , foxo1 , and tp63 but also certain other genes , such as apod , igf1 and foxm1 that have also been shown to strongly correlate aging with cancer . gene function enrichment analyses suggested that these highly overlapping genes were primarily involved in metabolic process , cell cycle regulation , dna damage response , apoptosis , cell proliferation , and transcriptional regulation . based on these highly overlapping genes , these pathways include pathways in cancer , erbb signaling pathway , mapk signaling pathway , cell cycle , t - cell receptor signaling pathway , mtor signaling pathway , b - cell receptor signaling pathway , p53 signaling pathway , insulin signaling pathway , vegf signaling pathway , and chemokine signaling pathway , among others . ags , aging - related signature genes ; hag , human aging - related genes . based on a literature mining approach , i have identified four types of hesc - related molecular signatures : genes , pathways , transcription factors ( tfs ) , and micrornas ( mirnas ) . the gene signatures include 24 hesc - related gene sets involving the targets of three core tfs ( oct4 , sox2 , and nanog ) in hescs , the targets of oncogene c - myc , the targets of the tumor suppressor p53 , and the targets of polycomb group proteins ; these gene sets are essential for controlling the development of hescs . the pathway signatures include 54 hesc - related pathways that essentially belong to developmental signaling pathways such as the wnt , notch , hedgehog , and bmi-1 pathways that are necessary for the regulation of stem cell self - renewal and differentiation . the tf signatures include 189 hesc - related tfs that are primarily involved in the regulation of hesc self - renewal and differentiation . among these tfs , oct4 , sox2 , and nanog have essential roles in the transcriptional control of the regulatory circuitry underlying pluripotency , . the mirna signatures include 114 hesc - related mirnas that have important roles in regulating stem cell self - renewal and differentiation . each number represents the proportion of genes in the corresponding hesc - related gene set that have no less than 10 occurrences in the 72 differentially expressed gene sets identified in tumors . i have analyzed 51 human gene expression datasets involving 23 tumor types and identified differentially expressed genes among either normal vs. tumor or good prognosis vs. poor prognosis phenotype classes . furthermore , i identified important tumor - related pathways , tfs , and mirnas by analyzing gene sets for differential expression among these pre - defined classes . i have identified 72 sets of differentially expressed genes in the 51 cancer - related human gene expression datasets and found considerable overlaps between each of the 72 cancer - related gene sets and each of the 24 hesc - related gene sets . figure 1 presents the proportion of genes in each of the 24 hesc - related gene sets that have no less than 10 occurrences in the 72 cancer - related gene sets and demonstrates that a substantial portion of the hesc - related genes are also related to cancer . the highly overlapping genes are mainly involved in cell cycle regulation , dna damage repair and replication , apoptosis , development and differentiation , cell adhesion , and tf activity . i have identified 68 groups of pathways by 75 class comparisons and survival analyses of the cancer - related datasets and found that 26 hesc - related pathway signatures appeared in at least 8 groups . figure 2 presents the occurrence rate of each of the 26 pathways in the 68 groups of cancer - related pathways . among the highly overlapping pathways between hescs and cancer , the cell cycle pathway and mapk pathway are most prominent . the igf , erk , shh , wnt , prc2 , notch , pten , and tgf pathways are also important signaling pathways that link hescs to cancer . i have identified 73 groups of tfs in the human cancer gene expression datasets . among the 189 hesc - associated tfs figure 3 presents the occurrence rate of each of the 42 tfs in the 73 groups of cancer - related tfs . in fact , myc is an important tf in both hescs and cancer cells, , and its regulatory networks may account for most of the transcriptional similarity between embryonic stem cells ( escs ) and cancer cells . several families of hesc - associated tfs , such as myb , e2f , pax , smad , stat , pou , sp , and gli , were shown to be related to cancer ( figure 3 ) . i have identified 67 groups of mirnas in the cancer datasets . among the 114 hesc - associated mirnas the most frequently identified mirna was mir-29c , which occurred 34 times ( 51 % occurrence rate ) , and the next most common mirna was mir-200b , which occurred 30 times ( 45% occurrence rate ) . figure 4 lists the 50 mirnas for which the occurrence frequency is no less than 20 , indicating that there is a broad range of overlap between sternness mirnas and oncogenic mirnas . certain mirna families , such as the mir-302 family and the mir-200 family , appear to play an important role in the regulation of hescs and tumorigenesis. each number represents the occurrence rate of the corresponding hesc - related pathway in the 68 cancer - related pathway sets . each number represents the occurrence rate of the corresponding hesc - related tf in the 68 cancer - related tf sets . each number represents the occurrence rate of the corresponding hesc - related microrna in the 67 cancer - related microrna sets . in addition to the previously discussed work , several other studies have examined the expression of hesc - associated genes in human cancer , , , , . for instance , murat et al . provided the first clinical evidence for the existence of a glioma stem cell or self - renewal phenotype in the context of the treatment resistance of glioblastoma . santagata et al . explored the expression levels of the esc tfs oct3/4 , nanog , and sox2 in primary and metastatic germ cell tumors ( gcts ) . they confirmed nanog and oct3/4 as sensitive and specific markers for primary seminoma and embryonal carcinoma and demonstrated that nanog was a marker for metastatic gcts . their findings showed that esc tfs were useful in the diagnosis of tumors that were metastatic to the retroperitoneum . identified a subset of hesc - associated transcriptional regulators , including nanog , oct4 , sox2 , and c - myc , that were highly expressed in poorly differentiated tumors . they found a novel link between genes associated with hesc identity and the histopathologic traits of tumors and suggested that these genes might contribute to the stem cell - like phenotypes presented by many tumors . hassan et al . used microarray gene expression analysis to identify gene set enrichment patterns between human lung adenocarcinoma and squamous cell carcinoma . this analysis revealed that an increased expression of the esc gene set and decreased expression of the polycomb target gene set identified poorly differentiated lung adenocarcinoma and that this gene expression signature was associated with markers of poor prognosis and worse overall survival in lung adenocarcinoma . schoenhals et al . compared the expression levels of the pluripotency factors oct4 , sox2 , klf4 , and myc in 40 human tumor types with the levels in the normal tissue counterparts using publicly available gene expression data and found significant overexpression of at least one of these factors in 18 out of the 40 investigated cancer types . furthermore , they found that these genes were associated with tumor progression or poor prognosis . gene expression signatures were associated with tumor malignancies and therefore might be informative molecular predictors for cancer therapy outcomes . based on a literature mining approach , i have identified four types of hesc - related molecular signatures : genes , pathways , transcription factors ( tfs ) , and micrornas ( mirnas ) . the gene signatures include 24 hesc - related gene sets involving the targets of three core tfs ( oct4 , sox2 , and nanog ) in hescs , the targets of oncogene c - myc , the targets of the tumor suppressor p53 , and the targets of polycomb group proteins ; these gene sets are essential for controlling the development of hescs . the pathway signatures include 54 hesc - related pathways that essentially belong to developmental signaling pathways such as the wnt , notch , hedgehog , and bmi-1 pathways that are necessary for the regulation of stem cell self - renewal and differentiation . the tf signatures include 189 hesc - related tfs that are primarily involved in the regulation of hesc self - renewal and differentiation . among these tfs , oct4 , sox2 , and nanog have essential roles in the transcriptional control of the regulatory circuitry underlying pluripotency , . the mirna signatures include 114 hesc - related mirnas that have important roles in regulating stem cell self - renewal and differentiation . each number represents the proportion of genes in the corresponding hesc - related gene set that have no less than 10 occurrences in the 72 differentially expressed gene sets identified in tumors . i have analyzed 51 human gene expression datasets involving 23 tumor types and identified differentially expressed genes among either normal vs. tumor or good prognosis vs. poor prognosis phenotype classes . furthermore , i identified important tumor - related pathways , tfs , and mirnas by analyzing gene sets for differential expression among these pre - defined classes . i have identified 72 sets of differentially expressed genes in the 51 cancer - related human gene expression datasets and found considerable overlaps between each of the 72 cancer - related gene sets and each of the 24 hesc - related gene sets . figure 1 presents the proportion of genes in each of the 24 hesc - related gene sets that have no less than 10 occurrences in the 72 cancer - related gene sets and demonstrates that a substantial portion of the hesc - related genes are also related to cancer . the highly overlapping genes are mainly involved in cell cycle regulation , dna damage repair and replication , apoptosis , development and differentiation , cell adhesion , and tf activity . i have identified 68 groups of pathways by 75 class comparisons and survival analyses of the cancer - related datasets and found that 26 hesc - related pathway signatures appeared in at least 8 groups . figure 2 presents the occurrence rate of each of the 26 pathways in the 68 groups of cancer - related pathways . among the highly overlapping pathways between hescs and cancer , the cell cycle pathway and mapk pathway are most prominent . the igf , erk , shh , wnt , prc2 , notch , pten , and tgf pathways are also important signaling pathways that link hescs to cancer . i have identified 73 groups of tfs in the human cancer gene expression datasets . among the 189 hesc - associated tfs figure 3 presents the occurrence rate of each of the 42 tfs in the 73 groups of cancer - related tfs . in fact , myc is an important tf in both hescs and cancer cells, , and its regulatory networks may account for most of the transcriptional similarity between embryonic stem cells ( escs ) and cancer cells . several families of hesc - associated tfs , such as myb , e2f , pax , smad , stat , pou , sp , and gli , were shown to be related to cancer ( figure 3 ) . i have identified 67 groups of mirnas in the cancer datasets . among the 114 hesc - associated mirnas the most frequently identified mirna was mir-29c , which occurred 34 times ( 51 % occurrence rate ) , and the next most common mirna was mir-200b , which occurred 30 times ( 45% occurrence rate ) . figure 4 lists the 50 mirnas for which the occurrence frequency is no less than 20 , indicating that there is a broad range of overlap between sternness mirnas and oncogenic mirnas . certain mirna families , such as the mir-302 family and the mir-200 family , appear to play an important role in the regulation of hescs and tumorigenesis. each number represents the occurrence rate of the corresponding hesc - related pathway in the 68 cancer - related pathway sets . each number represents the occurrence rate of the corresponding hesc - related tf in the 68 cancer - related tf sets . each number represents the occurrence rate of the corresponding hesc - related microrna in the 67 cancer - related microrna sets . in addition to the previously discussed work , several other studies have examined the expression of hesc - associated genes in human cancer , , , , . for instance , murat et al . provided the first clinical evidence for the existence of a glioma stem cell or self - renewal phenotype in the context of the treatment resistance of glioblastoma . santagata et al . explored the expression levels of the esc tfs oct3/4 , nanog , and sox2 in primary and metastatic germ cell tumors ( gcts ) . they confirmed nanog and oct3/4 as sensitive and specific markers for primary seminoma and embryonal carcinoma and demonstrated that nanog was a marker for metastatic gcts . their findings showed that esc tfs were useful in the diagnosis of tumors that were metastatic to the retroperitoneum . ben - porath et al . identified a subset of hesc - associated transcriptional regulators , including nanog , oct4 , sox2 , and c - myc , that were highly expressed in poorly differentiated tumors . they found a novel link between genes associated with hesc identity and the histopathologic traits of tumors and suggested that these genes might contribute to the stem cell - like phenotypes presented by many tumors . used microarray gene expression analysis to identify gene set enrichment patterns between human lung adenocarcinoma and squamous cell carcinoma . this analysis revealed that an increased expression of the esc gene set and decreased expression of the polycomb target gene set identified poorly differentiated lung adenocarcinoma and that this gene expression signature was associated with markers of poor prognosis and worse overall survival in lung adenocarcinoma . schoenhals et al . compared the expression levels of the pluripotency factors oct4 , sox2 , klf4 , and myc in 40 human tumor types with the levels in the normal tissue counterparts using publicly available gene expression data and found significant overexpression of at least one of these factors in 18 out of the 40 investigated cancer types . furthermore , they found that these genes were associated with tumor progression or poor prognosis . gene expression signatures were associated with tumor malignancies and therefore might be informative molecular predictors for cancer therapy outcomes . two significant aging - related pathways , pathways in cancer and mapk signaling pathway , are also implicated in carcinogenesis . certain critical molecular mechanisms underlie both aging and cancer ; these mechanisms include cell cycle regulation , metabolic process , dna damage response , apoptosis , p53 signaling pathway , immune / inflammatory response , etc . it is worthy of note that the immune / inflammatory response is an important link between aging and cancer , given that the convergent pathways between aging and cancer include multiple pathways that correlate with the immune / inflammatory response , such as t - cell receptor signaling pathway , mtor signaling pathway , b - cell receptor signaling pathway , and chemokine signaling pathway ( see table 5 of reference ) . various hesc - specific characteristics , including genes , pathways , tfs , and mirnas , were often differentially expressed between normal and tumor phenotypes or among cancer subtypes with distinct clinical outcomes . the signaling pathways like the cell cycle , mapk , shh , wnt , prc2 , notch , pten , and tgf pathways , that played an important role in control of the hesc fate were also strongly implicated in the initiation , proliferation , and metastasis of cancer . the hesc - specific tfs like oct4 and c - myc were important in the maintenance of the undifferentiated state of cancer cells . the mirnas that were overexpressed in undifferentiated hescs like mirna-302 and mirna-200 families were also involved in cancerous pathology . the mechanism of cell cycle regulation provides the primary commonality between hescs and cancer cells in that the hesc - associated signatures most frequently identified in tumors are primarily involved in the regulation of cell cycle . the huge amount of available omics data facilitates the investigation of the associations among aging , stem cells , and cancer using the computational biology approach . however , the findings obtained through the computational biology approach are only reliable after they have been experimentally validated . with the development of next - generation sequencing ( ngs ) technology , increasing quantities of cancer - related sequencing data in contrast to microarray methods , ngs can directly determine the cdna sequences and quantify the expression of diverse rna molecules from genomes over a wide range of levels . rna sequencing ( rna - seq ) is useful for studying complex transcriptomes and revealing sequence variations , such as snps , in the transcribed regions . rna - seq has a large dynamic range of expression levels over which transcripts can be detected and is therefore highly accurate for quantifying expression levels . moreover , the bioinformatics investigation of ngs data will provide a promising direction for cancer informatics research .

the emergence of a huge volume of omics data enables a computational approach to the investigation of the biology of cancer . the cancer informatics approach is a useful supplement to the traditional experimental approach . i reviewed several reports that used a bioinformatics approach to analyze the associations among aging , stem cells , and cancer by microarray gene expression profiling . the high expression of aging- or human embryonic stem cell - related molecules in cancer suggests that certain important mechanisms are commonly underlying aging , stem cells , and cancer . these mechanisms are involved in cell cycle regulation , metabolic process , dna damage response , apoptosis , p53 signaling pathway , immune / inflammatory response , and other processes , suggesting that cancer is a developmental and evolutional disease that is strongly related to aging . moreover , these mechanisms demonstrate that the initiation , proliferation , and metastasis of cancer are associated with the deregulation of stem cells . these findings provide insights into the biology of cancer . certainly , the findings that are obtained by the informatics approach should be justified by experimental validation . this review also noted that next - generation sequencing data provide enriched sources for cancer informatics study .

Molecular Associations Between Aging and Cancer Identification of human aging-related genes Expression profiling of human aging-related genes in tumors Molecular Associations Between Stem Cells and Cancer Identification of human stem cell-related molecular signatures Expression profiling of human stem cell-related molecular signatures in tumors Other works identifying common molecular signatures between cancer and stem cells Discussion

alpha-1-antitrypsin ( aat ) deficiency , an autosomal recessive disorder , is caused by inheritance of two severe deficient alleles of serpin 1 ( located on chromosome 14q31 - 32 ) encoding aat . the reactive loop site in the -sheet contains the neutrophil elastase binding site with a methionine residue . the protease inhibitor ( pi)*mm wild - type allele is the most prevalent normal allele and has many variants . the most important pathogenic pi*s and pi*z variants show mutations glu264val and glu342lys , respectively , whereas pi*null variant has no protein production . the patient can be homozygous or compound heterozygous for pathogenic variants . the protein product contains variable amounts of abnormal polymers of aat molecules which retain in the endoplasmic reticulum ( er ) in the liver . these retained abnormal polymers can lead to hepatic cell injury and result in haemorrhagic disease and or cholestasis in infancy and chronic liver disease in childhood or adulthood . in addition , the uninhibited action of the neutrophil elastase in the lungs can cause alveolar damage resulting in emphysema in adulthood . the highest pi*z variant prevalence was recorded in northern and western europe ( mean gene frequency , 0.0140 ) . about 12% of zz infants develop neonatal hepatitis and cholestasis within the first month of life . the presenting symptom in neonates can vary from harmless - looking ( warning ) bleeds or earlier recognised jaundice to cholestasis and full - blown bleeding diathesis with dramatic consequences [ 4 , 6 , 11 ] . to diagnose aat deficiency , three different methods can be used level testing is not specific , phenotyping shows the mutated protein and genotyping detects the common selected mutations . a 4-week - old baby girl was admitted to the neonatology department of our hospital because of respiratory insufficiency , convulsion and a large intracranial bleeding . she was the second child of healthy non - consanguineous parents born after an uneventful pregnancy and delivery at 40-weeks gestational age . vitamin k prophylaxis was given at birth and until hospital administration according to the standard dutch protocols . from birth , she was only breastfed . the mother was instructed to follow a cow milk protein - free diet for herself . in the following weeks , oozing of the umbilical cord and bruising of the palate were noted . both symptoms were reported separately and considered not to be alarming by the different general physicians . nearly 4 weeks after birth she became lethargic , started vomiting and refused breastfeeding . she was referred to the emergency department of the referral hospital . at first , an infection was suspected for which intravenous antibiotics were started . a few hours after admission , she became respiratory insufficient for which she was intubated , ventilated and transported to our university hospital . laboratory results revealed total bilirubin , 85 mol / l ; conjugated bilirubin , 58 mol / l ; asat , 94 u / l ; alat , 40 u / l ; haemoglobin , 4.6 mmol / l ; thrombocytes , 388 10/l ; prothrombin time ( pt ) , > 100 s and partial thromboplastin time ( ptt ) , > 300 s. vitamin k - dependent clotting factors were all below 40% . because factor v and factor viii levels at the same time were 160% and 200% , respectively , clinical vitamin k - dependent bleeding disorder ( vkdbd ) was suspected . vitamin k ( 1 mg ) was given intravenously and within 2-h pt and ptt times , factor v and factor viii levels normalized . ct scan showed large intraventricular bleedings on both sides and a large intraparenchymal bleeding in the left temporal lobe with severe oedema . differential diagnosis for the background pathology leading to cholestasis , liver dysfunction and further vkdbd was biliary atresia , alpha-1-antitrypsin deficiency , cystic fibrosis , inborn error in bile acid synthesis , haematochromatosis , liver pathology such as viral neonatal hepatitis or one of rare autosomal recessive forms of vitamin k - dependent clotting factor deficiency 1 and 2 . both parents gave informed consent for complete autopsy . at brain autopsy , left temporal lobe showed haemorrhage with intraventricular extension . this resulted in increased intracranial pressure and herniation of the cerebellar tonsils . at body autopsy , the gallbladder , the extrahepatic bile ducts and the papilla of vater could be identified and opened . the mucosal lining showed bile staining . with these findings we excluded biliary atresia macroscopically . the new pathologic differential diagnosis for the primary source of the problems leading to vkdbd in this patient was neonatal hepatitis / viral neonatal hepatitis , haematochromatosis or aat deficiency . microscopic examination of the liver displayed acute hepatitis with portal tracts showing a mixed inflammatory reaction with variable destruction of bile ducts and infiltration of the parenchyma . the parenchyma showed individual hepatocyte necrosis with accumulation of waste products , bile and iron in hepatocytes and kupfer cells . among the waste products were fine cytoplasmic granules located especially in the periportal hepatocytes which stained with periodic acid - schiff ( pas ) before and after diastase pretreatment ( fig . 1 ) . these pas ( + ) granules were not abundant enough to diagnose the primary pathology with certainty ; however , suspicion rose on aat deficiency . h & e , 400 the additional immunohistochemical anti - cytokeratin 7 and anti - cytokeratin 19 stainings ( biogenex ) showed focal paucity of the premature and mature bile ducts , respectively . this paucity could be due to periductal inflammation and cholestasis . finally , anti - aat protein staining ( dako , concentration 1/40,000 without antigen retrieval in dako immunostainer ) showed clearly the accumulation of aat protein polymers in the hepatocytes ( fig . 2 ) . 2immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) pcr studies to identify viral agents showed no cytomegalovirus in liver . mutation analysis of serpin 1 was performed by direct sequence analysis of the coding exons ( 25 ; exon 2 split into two ) . primers , containing an m13 tail , used were : exon 2 - 1forward : 5 cacttccacgtggtgtcaatreverse : 5 ggttgagggtacggaggagtexon 2 - 2forward : 5 ttcttctccccagtgagcatreverse : 5 gaatccacgctgaaaagcatexon 3forward : 5 ggaggggactcatggtttctreverse : 5 tagcagtgacccagggatgtexon 4forward : 5 tagtgtgggtggaggacacareverse : 5 cagcctgggtcttcatttgtexon 5forward : 5 gtccacgtgagccttgctreverse : 5 ggaccagctcaacccttctt pcr reactions were performed using standard conditions ( 25-l reaction , containing 100-ng genomic dna ; 2 at 94c , followed by 29 cycles of 30 at 94c , 30 at 60c and 30 at 72c and a final extension of 10 at 72c ) . sequence analysis of exon 5 of serpin 1 showed a homozygous pattern for p.glu342lys in our patient . in agreement with the homozygous pattern , the parents of the patient were heterozygous for this pathogenic mutation . both parents gave informed consent for complete autopsy . at brain autopsy , left temporal lobe showed haemorrhage with intraventricular extension . this resulted in increased intracranial pressure and herniation of the cerebellar tonsils . at body autopsy , the gallbladder , the extrahepatic bile ducts and the papilla of vater could be identified and opened . the mucosal lining showed bile staining . with these findings we excluded biliary atresia macroscopically . the new pathologic differential diagnosis for the primary source of the problems leading to vkdbd in this patient was neonatal hepatitis / viral neonatal hepatitis , haematochromatosis or aat deficiency . microscopic examination of the liver displayed acute hepatitis with portal tracts showing a mixed inflammatory reaction with variable destruction of bile ducts and infiltration of the parenchyma . the parenchyma showed individual hepatocyte necrosis with accumulation of waste products , bile and iron in hepatocytes and kupfer cells . among the waste products were fine cytoplasmic granules located especially in the periportal hepatocytes which stained with periodic acid - schiff ( pas ) before and after diastase pretreatment ( fig . 1 ) . these pas ( + ) granules were not abundant enough to diagnose the primary pathology with certainty ; however , suspicion rose on aat deficiency . h & e , 400 the additional immunohistochemical anti - cytokeratin 7 and anti - cytokeratin 19 stainings ( biogenex ) showed focal paucity of the premature and mature bile ducts , respectively . this paucity could be due to periductal inflammation and cholestasis . finally , anti - aat protein staining ( dako , concentration 1/40,000 without antigen retrieval in dako immunostainer ) showed clearly the accumulation of aat protein polymers in the hepatocytes ( fig . 2 ) . 2immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) both parents gave informed consent for complete autopsy . at brain autopsy , left temporal lobe showed haemorrhage with intraventricular extension . this resulted in increased intracranial pressure and herniation of the cerebellar tonsils . at body autopsy , the gallbladder , the extrahepatic bile ducts and the papilla of vater could be identified and opened . the mucosal lining showed bile staining . with these findings we excluded biliary atresia macroscopically . the new pathologic differential diagnosis for the primary source of the problems leading to vkdbd in this patient was neonatal hepatitis / viral neonatal hepatitis , haematochromatosis or aat deficiency . microscopic examination of the liver displayed acute hepatitis with portal tracts showing a mixed inflammatory reaction with variable destruction of bile ducts and infiltration of the parenchyma . slight fibrosis with septum formation was present . the parenchyma showed individual hepatocyte necrosis with accumulation of waste products , bile and iron in hepatocytes and kupfer cells . among the waste products were fine cytoplasmic granules located especially in the periportal hepatocytes which stained with periodic acid - schiff ( pas ) before and after diastase pretreatment ( fig . 1 ) . these pas ( + ) granules were not abundant enough to diagnose the primary pathology with certainty ; however , suspicion rose on aat deficiency . h & e , 400 the additional immunohistochemical anti - cytokeratin 7 and anti - cytokeratin 19 stainings ( biogenex ) showed focal paucity of the premature and mature bile ducts , respectively finally , anti - aat protein staining ( dako , concentration 1/40,000 without antigen retrieval in dako immunostainer ) showed clearly the accumulation of aat protein polymers in the hepatocytes ( fig . 2 ) . 2immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) immunohistochemical staining showing aat protein deposition in the hepatocyte ( 200 ) pcr studies to identify viral agents showed no cytomegalovirus in liver . additional studies in microbiology showed no growth of bacterial of viral agents . mutation analysis of serpin 1 was performed by direct sequence analysis of the coding exons ( 25 ; exon 2 split into two ) . primers , containing an m13 tail , used were : exon 2 - 1forward : 5 cacttccacgtggtgtcaatreverse : 5 ggttgagggtacggaggagtexon 2 - 2forward : 5 ttcttctccccagtgagcatreverse : 5 gaatccacgctgaaaagcatexon 3forward : 5 ggaggggactcatggtttctreverse : 5 tagcagtgacccagggatgtexon 4forward : 5 tagtgtgggtggaggacacareverse : 5 cagcctgggtcttcatttgtexon 5forward : 5 gtccacgtgagccttgctreverse : 5 ggaccagctcaacccttctt pcr reactions were performed using standard conditions ( 25-l reaction , containing 100-ng genomic dna ; 2 at 94c , followed by 29 cycles of 30 at 94c , 30 at 60c and 30 at 72c and a final extension of 10 at 72c ) . sequence analysis of exon 5 of serpin 1 showed a homozygous pattern for p.glu342lys in our patient . in agreement with the homozygous pattern , the parents of the patient were heterozygous for this pathogenic mutation . alpha-1-antitrypsin ( aat ) deficiency has an incidence of 0.05% and can be caused by homozygosity for pi*z . the mutant z protein can form abnormal polymers of aat within the rough er of hepatocytes . chains of these polymers become interwoven to form insoluble inclusions resulting in reduced levels of this protein in the bloodstream . clinical progression to liver disease is complex , with z allele homozygous neonates developing hepatitis and cholestasis in about 10% of the cases . here , we reported our findings in a 4-week - old female neonate who showed harmless - looking warning bleeds at the age of 2 weeks and cascade of complications leading to her death as a result of intracranial vkdbd under standard vitamin k prophylaxis . although vkdb is described earlier as a complication of aat deficiency in neonates , there are still two important lessons we can learn from this patient . the clinical lesson is the importance of early recognition of the warning bleeds or the cholestasis . it is also reported that adjustment of the standard vitamin k prophylaxis protocols could prevent the complications due to vkdb which also could have been the case in this patient . the diagnostic lesson is to use pathology as an instrument in combination with verifying genotyping to diagnose aat deficiency . this statement contrasts with the earlier studies where the cytoplasmic inclusions were not seen in children younger than 3 years [ 5 , 7 ] or the false - positive results which can be observed with immunohistochemistry in this age group . in conclusion , however , early recognition of the warning bleeds or cholestasis , correct diagnosis using pathology as a diagnostic instrument in addition to the existing methods and adjustment of the standard vitamin k prophylaxis protocols to prevent vkdb complications can be life saving in aat deficiency patients especially in the neonatal period .

alpha-1-antitrypsin ( aat ) deficiency is a rare genetic disorder characterized by hepatitis in neonates , childhood and adulthood ( protease inhibitor ( pi)*zz ) and emphysema with or without hepatitis ( pi*zz)/(pi*ss , sz or null ) in adulthood . we report the case of a female neonate born at 40 weeks of gestation who presented with vitamin k deficiency - related intracranial bleeding and cholestasis of which she died at 28 days of age . at autopsy , the infant was found to have intracranial bleeding , hepatomegaly , and cholestasis with paucity of bile ducts in the liver . small periodic acid - schiff diastase positive intrahepatic granules and positive staining with antibodies against aat protein suggested an aat deficiency . aat is a glycoprotein that has a protease inhibitor function . its deficiency can be the result of various point mutations in serpin 1 located on chromosome 14 . the diagnosis aat deficiency was confirmed by mutation analysis showing the pi*zz genotype in the neonate . in conclusion , aat deficiency is a rare genetic disorder that can lead to a serious bleeding disorder in the neonatal period if not recognised on time . pathological diagnosis together with verifying molecular analysis can be used to identify index patients .

Introduction Case report and results Pathology Autopsy Microscopy Microbiology Molecular analysis Discussion

microencapsulation is a useful method for prolonging drug release from dosage form and reducing adverse effect . recently , dosage forms that can precisely control the release rates and target drugs specific body site have made an enormous impact in the formulation and development of novel drug delivery system . microspheres are one of the multiparticulate delivery systems and are prepared to obtain prolonged or controlled drug delivery , to improve bioavailability or stability and to target drug to specific sites . microspheres can also offer advantages like limiting fluctuation within therapeutic range , reducing side effects , decreasing dosing frequency , and improving patient compliance [ 5 , 6 ] . ethylcellulose ( ec ) that is a hydrophobic and ph - independent polymer has been widely used in the prepared sustained release dosage forms of a water - soluble material [ 710 ] . the substance encapsulated in the microsphere is released under the influence of a specific stimulus at a specified stage . whereas interaction between dissolution media , polymer , and drug is the primary factors in release control [ 12 , 13 ] , various formulation variables influence drug release rate to greater or lesser extent . thus , drug loading [ 14 , 15 ] , drug / polymer ratio [ 1618 ] , and drug particle size have been shown to affect drug release from ec matrices . stavudine is a nucleotide reverse transcriptase inhibitors and primarily used in the treatment of one of the most common chronic disease of the planet , aids . it has short biological half - life 0.81.5 h , and low daily dose of 30 mg is required [ 20 , 21].the frequency of dosing is more . to overcome this problem response surface methodology ( rsm ) is widely practiced approach in the development and optimization of drug delivery devices . based on the principle of design of experiments ( does ) , the methodology encompasses the use of various types of experimental designs , generation of polynomial equations , and mapping of the response over the experimental domain to determine the optimum formulation(s ) [ 2227 ] . the technique requires minimum experimentation and time , thus proving to be far more effective and cost - effective than the conventional methods of formulating dosage forms . the current study aims at developing and optimizing microspheres of stavudine using rsm , as it may prove to be more productive than the conventional systems by virtue of prolongation of drug residence time in gastrointestinal tract . further , microsphere of the drug would involve relatively more economical and less complicated technology vis - - vis many other drug delivery devices . computer - aided optimization technique , using a full factorial design , was employed to investigate the effect of 2 independent variables ( factors ) ( i.e. , the drug - to - polymer ratio and stirring speed ) on particle size , encapsulation efficiency , and drug release . acetone and light liquid paraffin were obtained from ranbaxy fine chemical ltd . , new delhi , india used as dispersion media . microspheres of ethylcellulose were prepared by emulsion solvent diffusion technique , using ec as a polymeric retardant material . polymer was dissolved in 5 ml organic solvent consisting of acetonitrile and dichloromethane ( 1 : 1 ratio ) . the resultant solution was extruded through a syringe ( g 20 ) into the solution of drug in aqueous medium ( 2 ml ) under stirring at 500 rpm using mechanical stirrer ( remi motors , india ) for 5 minutes , to form primary emulsion ( w / o ) . the w / o primary emulsion was slowly added to 50 ml of light liquid paraffin containing 0.5% span-80 , 1% ethylcellulose ( 50 mg ) , 1% w / v magnesium stearate ( 50 mg ) as a tensioactive agent , saturation , and droplet stabilizer in the processing medium , respectively , under stirring in different rpm to form w / o / o multiple emulsion.the whole system was stirred for about 3 h. after stirring process was over , the light liquid paraffin was decanted off and microspheres formed were collected by filtration using ordinary filter paper ( pore size 25 m ) and treated with petroleum ether ( 4060c ) for several times to completely remove the oil . microspheres then air dried at room temperature for 12 h and collected for further studies . the drug - to - polymer ratio and stirring speed were varied in batches f1 to f9 . stavudine was estimated by ultraviolet visible ( uv / vis ) spectrophotometric method ( hitachi , u-1700 , japan ) . aqueous solution of stavudine was prepared in phosphate buffer ( ph 6.8 ) , and absorbance was measured on uv / vis spectrophotometer at 266 nm . the method obeys beer 's law in the concentration range of 5 to 50 g / ml . when a standard drug solution was analyzed repeatedly ( n = 6 ) , the mean error ( accuracy ) and relative standard deviation ( precision ) were found to be 0.7% and 1.2% , respectively . microspheres ( 50 mg ) were crushed in a glass mortar and pastle , and the powdered microsphere were suspended in 50 ml phosphate buffer ( ph 6.8 ) . the resulting mixture was shaken by the magnetic stirrer for 24 h. the solution was filtered , and the filtrate was analyzed for the drug content . the drug entrapment efficiency was calculated using the following formula : ( 1)drug entrapment efficiency = practical drug contenttheoritical drug content100 . particle size of the microspheres was measured by laser light scattering technique ( mastersizer 2000 , malvern , uk ) . the sizes of the completely dried microspheres of different formulations were measured by dry sample technique using dry sample adapter . the completely dried particles were placed on the sample tray with an in - built vacuum , and compressed air system was used to suspend the particles . after measurement of particle size of each sample , the dry sample adopter was cleaned thoroughly to avoid cross contamination . each batch was analyzed in triplicate , but the average values were considered in data analysis . in vitro drug release study of microspheres were carried out using usp xxiv paddle type apparatus ( campbell electronic , mumbai , india ) at 37 1c and at 100 rpm using 900 ml phosphate buffer ( ph 6.8 ) . microsphere equivalent to 50 mg of stavudine were used for the test . at predetermined intervals , 5 ml of aliquots were withdrawn and replaced by the same volume of fresh media . aliquots were filtered through a 0.45 m membrane filter , diluted suitably , and analysed spectrophotometrically . percent of drug dissolve at different time intervals was calculated using lambert - beer 's equation ( y = 0.0463x 0.006 ) describe above . the samples were then filtered through membrane filter ( 0.45 m ) and diluted suitably . the amount of drug present in the solution was then analyzed spectrophotometrically at 225 nm using uv - visible spectrophotometer ( shimadzu , uv-1700 , japan ) . the surface topography of the prepared microspheres was examined by scanning electron microscope ( hitachi , s-3600n , japan ) . the samples were fixed on brass stub using double - sided tape and then gold - coated in vacuum by a sputter coater . a statistical model incorporating interactive and polynomial terms was used to evaluate the responses : ( 2)y = b0+b1x1+b2x2+b12x1 x2+b11x12+b22x22 , where y is the dependent variable , b0 is the arithmetic mean response of the 9 runs . the main effects ( x1 and x2 ) represent the average result of changing one factor at a time from its low to high value . the interaction terms ( x1x2 ) show how the response changes when 2 factors are simultaneously changed . the polynomial terms ( x1 and x2 ) are included to investigate nonlinearity . microspheres of stavudine were prepared by emulsion solvent diffusion technique using ec as a polymer due to its hydrophobicity and release - controlling properties . at first in trial batch , viscosity of the polymer solution is optimized since it is an important factor related to microspheres as reported by lee et al . . polymer concentration of 0.5% , 1% , and 2% w / v were selected for preliminary trials . flake formation was observed when ethylcellulose concentration was used at a level of 0.5% , whereas maximum sphericity was observed at the 1% level . the ethylcellulose solution was found to be too viscous to pass through the syringe when used at the 2% level . therefore , 1% was found to be the optimum concentration for the entire factorial batch . the volume of secondary oil phase is an important factor as related to the formulation of microspheres . the volume of light liquid paraffin to be considered for the factorial batch was selected on the basis of in vitro release study . different volume of light liquid paraffin ( from 20 to 60 ml ) was used in trial batch . as the volume of light liquid paraffin is increased from 20 ml to 50 ml , the in vitro release of stavudine is significantly ( p < .05 ) decreased . on the other hand , insignificant ( p > .05 ) decrease of the in vitro drug release was observed when the light liquid paraffin volume was increased from 50 ml to 60 ml . concentration of span-80 plays an important role in the formulation of microspheres prepared by emulsion solvent diffusion technique . therefore , suitable concentration of span-80 for factorial batch was selected by taking into account their aggregation phenomenon . span-80 in the concentration of 0.5% was found suitable to prevent aggregation of the microspheres . the sem photograph ( figure 1 ) revealed that the drug - loaded microspheres are spherical . microspheres prepared containing higher amount of the polymer ( 1 : 3 drug : polymer ratio ) exhibited smoother surfaces than those prepared taking a lower amount of the polymer ( 1 : 1 and 1 : 2 ) . irregular surfaces and larger sizes of the microspheres were observed for those prepared with a lower amount of the polymer . as the drug - to - polymer ratio was increased , more spherical microspheres with smooth surfaces were obtained as suggested earlier . on the basis of the preliminary trials a 3 full factorial design was employed to study the effect of independent variables ( i.e. , drug - to - polymer ratio [ x1 ] and the stirring speed [ x2 ] ) on dependent variables ( mean particle size , drug entrapment efficiency , and t80% ) . the results depicted in table 1 clearly indicate that all the dependent variables are strongly dependent on the selected independent variables as they show a wide variation among the 9 batches ( b1 to b9 ) . the fitted equations ( full models ) relating the response ( i.e. , mean particle size , drug entrapment efficiency , and t80% ) to the transformed factor the polynomial equations can be used to draw conclusions after considering the magnitude of coefficient and the mathematical sign it carries ( i.e. , positive or negative ) . the high values or correlation coefficient ( table 2 ) for the dependent variables indicate a good fit . mathematical relationship generated using multiple linear regression analysis for the studied variables are expressed as follows : ( 3)mean particle size = 244.38 + 32.83x18.83x21.50x1x2 + 1.67x120.33x22 , ( 4)entrapment efficiency = 59.07 + 8.33x13.50x2 + 0.50x1x2 1.24x12 + 1.26x22 , ( 5)t80%=348.79 + 124.33x119.67x224.00x1x2 + 79.72x1242.28x22 . all the polynomial equations were found to be statistically significant ( p < 0.01 ) , as determined using anova ( table 3 ) , as per the provision of design expert software . particle size analysis of microspheres was found to be in the range of 206290 m ( table 1 ) . results of the equation indicate that the effect of x1 ( drug - to - polymer ratio ) is more significant than x2 ( stirring speed ) . moreover , stirring speed had a negative effect on the particle size ( i.e. , as the stirring speed increased , the particle size decreased ) . as the stirring speed was increased , the size of microdroplet of the emulsion was decreased resulting in the formation of smaller size microparticles . these findings are similar to those reported previously ( 27,28 ) . figures 2(a ) and 2(b ) depict a linear trend of mean particle size in an ascending order with an increase in each variable . it also shows that drug - to - polymer ratio has a comparatively greater influence on the response variables than stirring speed . the drug entrapment efficiency is important variable for assessing the drug loading capacity of microspheres . this parameter is dependent on the process of preparation , physicochemical properties of drug , and formulation variables . the drug entrapment efficiency varied from 47% to 70% and showed good correlation coefficient ( 0.9970 ) . result of equation indicates the effect of x1 ( drug - to - polymer ratio ) is more significant than x2 ( stirring speed ) . moreover , stirring speed had a negative effect on drug entrapment efficiency ( i.e. , the stirring speed increased , the particle size decreased , and thus drug entrapment efficiency decreased ) . as the ratio of drug - to - polymer increased , encapsulation efficiency increased ; this is due to the fact that higher ratio of drug - to - polymer would produce large size droplets with decreased surface area , such that diffusion of drug from such microsphere will be slow , resulting in higher encapsulation efficiency . figures 3(a ) and 3(b ) also exhibit that entrapment efficiency vary in a nonlinear manner , but in ascending pattern with an increase in each variable . . however , the effect of drug - to - polymer seems to be more pronounced as compared to stirring speed . the release profiles of formulations appear to be slow release with negligible burst effect . the formulations with lower levels of drug - to - polymer ratio exhibited higher initial burst in drug release . this could be attributed to the dissolution of drug present initially at the surface of the microspheres . however , the formulations showed little burst effect at higher drug - to - polymer ratio , ratifying better sustenance of drug released . the values of t80% enhanced markedly from 264 minutes , observed a low levels of drug - to - polymer ratio and stirring speed , to as high as 571 minutes , observed at high level of drug - to - polymer ratio and stirring speed . batch f7 exhibited a high t80% of 517 minutes and since it is a promising candidate for achieving drug release up to 12 hrs . the percentage in vitro drug release is highly dependent on drug - to - polymer ratio and stirring speed . results depicted in table 2 indicate that the effect of drug - to - polymer ratio ( x1 ) is more significant than stirring speed ( x2 ) . the stirring speed had a negative effect on t80% because as the stirring speed increased , the particle size of microspheres is increased , resulting in decrease of drug release . on the other hand , as the drug - to - polymer ratio is increased , the drug loading was decreased , resulting in decrease of drug release from microspheres . on the other way , increase in polymer matrix into the microspheres leads to an increased diffusional path length and thereby decreased the overall drug release from microspheres . furthermore , smaller microspheres are formed at lower polymer concentration and have larger surface area exposed to dissolution medium . figures 4(a ) and 4(b ) show that t80% vary in nonlinear fashion , but in ascending pattern with an increase of each variable . the contour plot ( figure 5(b ) ) shows that drug - to - polymer ratio has a comparatively greater influence on the response variable than stirring speed . the optimum formulation was selected based on the criteria of attaining complete and controlled release with highest possible entrapment efficiency . upon the following maximizing criteria were adopted : mean particle size < 300 m , entrapment efficiency > 60% , and t80% > 540 minutes . accordingly , formulation f7 was ranked as best batch . in order to determine the mechanism of drug release from the formulation f7 , the data obtained in vitro release study were fitted to the korsemeyer - peppas model in order to determine the n value of all the formulations was between 0.5 and 1 indicating that the mechanism of drug release was non - fickian type diffusion . sustained drug release in the current study indicates that the hydrophobic matrix microspheres of stavudine , prepared using ec , can successfully be prepared by emulsion solvent diffusion technique . the results of a 3 factorial design revealed that the drug - to - polymer ratio and stirring speed are imperative to acquire sustained release and entrapment efficiency . the microspheres of best batch exhibited mean particle size of 290 m and entrapment efficiency of 70% . the t80% of 571 minutes indicates that the microspheres of stavudine could sustain the release of the drug for more than 12 h.

the aim of the current study was to formulate and optimize the formulation on the basis of in vitro performance of microsphere . a 32 full factorial design was employed to study the effect of independent variables , polymer - to - drug ratio ( x1 ) and stirring speed ( x2 ) , on dependent variables , encapsulation efficiency , particle size , and time to 80% drug release . the best batch exhibited a high entrapment efficiency of 70% and mean particle size 290 m . the drug release was also sustained for more than 12 hours . the study helped in finding the optimum formulation with excellent sustained drug release .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

the multiple - dose pharmacokinetics of fe 999049 have been described , accounting for endogenous follicle - stimulating hormone ( fsh ) levels.exposure to fe 999049 was influenced by body weight , which may be a potential factor for individualised dosing recommendations.endogenous fsh levels were influenced by progesterone and inhibin b levels . this time - varying contribution of endogenous fsh may be important to consider when characterising the pharmacokinetics of recombinant fsh products . follicle - stimulating hormone ( fsh ) is a gonadotropin that is synthesised and secreted by the anterior pituitary gland . the major function of fsh is to regulate the reproductive processes by stimulating the gonads . in females , fsh stimulates follicular development in the ovaries and production of inhibin b , progesterone , and oestrogens by the ovarian follicular granulosa cells . luteinising hormone ( lh ) , another gonadotropin from the anterior pituitary , stimulates the theca cells of the follicles to deliver androgens to the granulosa cells for conversion to oestrogens . it is also responsible for ovulation of the dominant follicle that has reached a fully mature , pre - ovulatory stage . the ovarian hormones promote further follicular development as well as exerting negative and positive feedback loops to the hypothalamus and pituitary affecting the gonadotropin production and secretion . in addition , gonadotropin secretion is stimulated by gonadotropin - releasing hormone ( gnrh ) produced in the hypothalamus . female infertility can be caused by numerous factors at any level , from the hypothalamus to the ovaries and uterus . gonadotropin therapy with either menotropins or recombinant fsh ( rfsh ) preparations can be used for infertility treatment when the cause is not primary ovarian failure , such that the ovaries are still responsive and contain primordial follicles . the purpose of controlled ovarian stimulation with daily administration of gonadotropins prior to assisted reproductive technologies such as in vitro fertilisation ( ivf ) or intracytoplasmic sperm injection ( icsi ) is to obtain an adequate number of oocytes per retrieval , with minimum risks for the patient . an appropriate ovarian response leading to the availability of several embryos makes it possible to select the best one(s ) for transfer . recently , a novel recombinant human fsh ( rhfsh ; fe 999049 , ferring pharmaceuticals a / s ) was expressed for the first time in a human cell line ( per.c6 ; crucell , leiden , the netherlands ) , while existing rfsh preparations in clinical use ( e.g. follitropin- and follitropin- ) are derived from chinese hamster ovary cell lines ( cho ) . previously , in a population pharmacokinetic analysis of first - in - human data after single ascending doses , body weight was identified as a factor that negatively correlates with serum fe 999049 concentration . in the present work , the fe 999049 population pharmacokinetics the influence of body weight on drug exposure was investigated in order to further explore its importance as a factor for individualised fe 999049 dosing . moreover , endogenous fsh levels may vary over time across the target patient group of infertile women , which may be an important aspect to consider in rfsh drug development and when analysing hormone data . the endogenous fsh contribution to the total fsh levels , and the influence of other reproductive hormones on the endogenous fsh levels , were therefore also evaluated in this analysis . data were generated in a randomised , double - blind , active control , multiple - dose trial with the aim of investigating the safety , tolerability , immunogenicity , pharmacokinetics , and pharmacodynamics of fe 999049 in healthy women . the trial was performed according to the helsinki declaration and good clinical practice , and was approved by regulatory authorities and local ethics committees . the trial has been described in more detail in a recent publication comparing the pharmacokinetic and pharmacodynamic properties of fe 999049 and gonal - f ( follitropin- ; emd serono , inc . , briefly , 49 healthy women were administered daily subcutaneous doses of 225 iu rfsh for 7 days ; 24 of the 49 women were treated with fe 999049 and 25 women received gonal - f as an active comparator . prior to the trial ( day 28 and 14 ) , subjects were administered two doses of a gnrh agonist ( lupron depot , 1-month depot ) to downregulate endogenous fsh . blood samples for fsh , inhibin b , estradiol , progesterone , and lh measurements were collected at 60 and 30 min prior to administration of fe 999049 , immediately before administration , and once daily for 15 days . in addition , after administration of the last dose on day 6 and until day 8 , the fsh concentration was measured every 4 h. analysis of serum fsh concentrations was performed at ferring pharmaceuticals a / s using a validated immunoassay based on electrochemiluminescence ( msd sector imager 2400 ) with a lower limit of quantification ( lloq ) of 0.075 g / l . three of the 672 fsh measurements ( 0.4 % ) were below the quantification limit and were excluded from further analysis . the personal demographics and baseline characteristics for the included subjects are listed in table 1 . subjects with missing hormone baseline values were given the median population baseline value . between days 6 and 8 , fsh was measured every 4 h , and the other hormones were measured only once daily , leaving missing hormone values in between . to fill out the extra time points , the last measured hormone values were carried forward.table 1summary of subject characteristicsmean(range)age ( years)31.1(21.538.7)height ( cm)163.5(149.0175.3)weight ( kg)71.5(46.186.6)bmi ( kg / m)26.6(20.828.9)fsh ( g / l)0.211(0.0890.376)e2 ( pg / ml)24.21(7.055.0)lh ( iu / l)0.719(0.11.4)prog ( g / l)0.652(0.081.49)inhb ( pg / ml)22.0(4.089.0)demographics and measured baseline hormone levels for the 24 subjects receiving fe 999049 bmi body mass index , fsh follicle - stimulating hormone , e2 estradiol , lh luteinising hormone , prog progesterone , inhb inhibin b summary of subject characteristics demographics and measured baseline hormone levels for the 24 subjects receiving fe 999049 bmi body mass index , fsh follicle - stimulating hormone , e2 estradiol , lh luteinising hormone , prog progesterone , inhb inhibin b the pharmacokinetic model was developed using nonlinear mixed - effects modelling , where both the population parameters , interindividual variability ( iiv ) , and residual errors are estimated . for parameters with iiv , the ith subject s individual parameter ( i ) is log - normally distributed:1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \theta_{i } = \theta \exp \left ( { \eta_{i } } \right ) $ $ \end{document}i=expiwhere is the typical population parameter and i is the individual random effect from an approximately normal distribution with mean zero and variance for describing the iiv of the parameter . in the model , potential influential factors can be tested for significance as a covariate to explain some of the iiv in a parameter . thus , the set of individual parameters ( i ) is given as a function of the typical population parameters ( ) individual values of the covariates ( ci ) and random effects ( i):2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \vartheta_{i } = g\left ( { \vartheta , { \mathbf{c}}_{i } , \varvec{\eta}_{i } } \right ) $ $ \end{document}i = g,ci,ithe residual errors ( ) are assumed normally distributed with mean zero and variance , and are the unexplained deviations of model predictions from the observations:3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ y_{ij } = f\left ( { t_{ij } , \vartheta_{i } } \right ) + \varepsilon_{ij } $ $ \end{document}yij = ftij,i+ijwhere yij is the observation at time tij and the subscript ij denotes the jth number for subject i. the individual model prediction f ( ) at time tij is calculated from the individual parameters ( i ) . model development was guided by changes in the nonmem objective function value ( ofv ) , precision of parameter estimates , and graphical model goodness - of - fit assessments , including visual predictive checks ( vpc ) . in the vpc , the observed data are compared with model predictions based on 1000 simulated trial datasets using the final model . it displays the observations and the 2.5th , 50th , and 97.5th percentiles of observations , and the 95 % confidence intervals ( ci ) for the corresponding model predictions are plotted . the difference in ofv ( dofv ) between two nested models is approximately chi square - distributed , with degrees of freedom ( df ) equal to the difference in the number of parameters . based on this , the statistical significance for inclusion / exclusion of a model parameter can be judged . a significance level of 0.05 was used for discrimination among nested models and covariate testing , corresponding to a 3.84 change in ofv for 1 df . measurable fsh levels before drug administration indicated that endogenous fsh was not fully suppressed in this trial . the total fsh amount at time t in the central compartment was therefore modelled as the sum of the endogenous fsh and the exogenously administered rhfsh ( fe 999049):4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{fsh}}(t ) = { \text{fsh}}_{\text{en } } \left ( t \right ) { \text { + rhfsh}}\left ( t \right ) $ $ \end{document}fsh(t)=fshent+ rhfsht the endogenous fsh was assumed to have the same elimination rate constant from the central compartment as fe 999049 ; thus , the total fsh is eliminated from the central compartment with rate constant k given by clearance ( cl ) divided by volume of distribution ( v ) . since data are obtained after subcutaneous dosing , the bioavailability ( f ) is not known . the cl and v estimated here are therefore the apparent cl ( cl / f ) and apparent v ( v / f ) . the change in endogenous fsh amount over time in the central compartment was described as a turnover model with a zero - order production rate kin:5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\text{dfsh}}_{\text{en } } \left ( t \right)}}{{{\text{d}}t } } = k_{\text{in } } - k \cdot { \text{fsh}}_{\text{en } } \left ( t \right ) $ $ \end{document}dfshentdt = kin - kfshent at time zero , before rhfsh dosing , the measured concentration in the central compartment is purely endogenous fsh . the endogenous fsh baseline concentrations ( fshbl ) for each subject can therefore be estimated as the initial concentration in the central compartment and is the initial condition for the differential equation for the central compartment fshblv / f , i.e. the individual endogenous fsh amount at baseline . when assuming steady state and hence zero change in the total fsh concentration before dosing , individual values of kin can be calculated from the other estimated parameters and baseline values . one- and two - compartment models were tested for describing the distribution of fe 999049 . a lag - time and transit compartments were investigated for modelling a potential delay in the absorption process . body weight , age , and hormone ( estradiol , inhibin b , progesterone ) values at baseline were tested as potential covariates , explaining some of the iiv in parameter estimates . inhibin b was also tested as a covariate over time since it has a purely inhibitory effect on fsh . the measured hormone levels were assumed to not affect the rhfsh concentration , but only tested as covariates on the endogenous fsh baseline parameter ( fshbl ) . besides a decrease in ofv , the significance of a covariate was also evaluated by looking at the reduction in the iiv , measured as a coefficient of variation ( cv ) for the parameter s random effect . the models were implemented and parameters estimated in nonmem 7.2.0 ( icon development solutions , ellicott city , md , usa ) . data handling and data were generated in a randomised , double - blind , active control , multiple - dose trial with the aim of investigating the safety , tolerability , immunogenicity , pharmacokinetics , and pharmacodynamics of fe 999049 in healthy women . the trial was performed according to the helsinki declaration and good clinical practice , and was approved by regulatory authorities and local ethics committees . the trial has been described in more detail in a recent publication comparing the pharmacokinetic and pharmacodynamic properties of fe 999049 and gonal - f ( follitropin- ; emd serono , inc . , briefly , 49 healthy women were administered daily subcutaneous doses of 225 iu rfsh for 7 days ; 24 of the 49 women were treated with fe 999049 and 25 women received gonal - f as an active comparator . prior to the trial ( day 28 and 14 ) , subjects were administered two doses of a gnrh agonist ( lupron depot , 1-month depot ) to downregulate endogenous fsh . blood samples for fsh , inhibin b , estradiol , progesterone , and lh measurements were collected at 60 and 30 min prior to administration of fe 999049 , immediately before administration , and once daily for 15 days . in addition , after administration of the last dose on day 6 and until day 8 , the fsh concentration was measured every 4 h. analysis of serum fsh concentrations was performed at ferring pharmaceuticals a / s using a validated immunoassay based on electrochemiluminescence ( msd sector imager 2400 ) with a lower limit of quantification ( lloq ) of 0.075 g / l . three of the 672 fsh measurements ( 0.4 % ) were below the quantification limit and were excluded from further analysis . the personal demographics and baseline characteristics for the included subjects are listed in table 1 . subjects with missing hormone baseline values were given the median population baseline value . between days 6 and 8 , fsh was measured every 4 h , and the other hormones were measured only once daily , leaving missing hormone values in between . to fill out the extra time points , the last measured hormone values were carried forward.table 1summary of subject characteristicsmean(range)age ( years)31.1(21.538.7)height ( cm)163.5(149.0175.3)weight ( kg)71.5(46.186.6)bmi ( kg / m)26.6(20.828.9)fsh ( g / l)0.211(0.0890.376)e2 ( pg / ml)24.21(7.055.0)lh ( iu / l)0.719(0.11.4)prog ( g / l)0.652(0.081.49)inhb ( pg / ml)22.0(4.089.0)demographics and measured baseline hormone levels for the 24 subjects receiving fe 999049 bmi body mass index , fsh follicle - stimulating hormone , e2 estradiol , lh luteinising hormone , prog progesterone , inhb inhibin b summary of subject characteristics demographics and measured baseline hormone levels for the 24 subjects receiving fe 999049 bmi body mass index , fsh follicle - stimulating hormone , e2 estradiol , lh luteinising hormone , prog progesterone , inhb inhibin b the pharmacokinetic model was developed using nonlinear mixed - effects modelling , where both the population parameters , interindividual variability ( iiv ) , and residual errors are estimated . for parameters with iiv , the ith subject s individual parameter ( i ) is log - normally distributed:1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \theta_{i } = \theta \exp \left ( { \eta_{i } } \right ) $ $ \end{document}i=expiwhere is the typical population parameter and i is the individual random effect from an approximately normal distribution with mean zero and variance for describing the iiv of the parameter . in the model , potential influential factors can be tested for significance as a covariate to explain some of the iiv in a parameter . thus , the set of individual parameters ( i ) is given as a function of the typical population parameters ( ) individual values of the covariates ( ci ) and random effects ( i):2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \vartheta_{i } = g\left ( { \vartheta , { \mathbf{c}}_{i } , \varvec{\eta}_{i } } \right ) $ $ \end{document}i = g,ci,ithe residual errors ( ) are assumed normally distributed with mean zero and variance , and are the unexplained deviations of model predictions from the observations:3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ y_{ij } = f\left ( { t_{ij } , \vartheta_{i } } \right ) + \varepsilon_{ij } $ $ \end{document}yij = ftij,i+ijwhere yij is the observation at time tij and the subscript ij denotes the jth number for subject i. the individual model prediction f ( ) at time tij is calculated from the individual parameters ( i ) . model development was guided by changes in the nonmem objective function value ( ofv ) , precision of parameter estimates , and graphical model goodness - of - fit assessments , including visual predictive checks ( vpc ) . in the vpc , the observed data are compared with model predictions based on 1000 simulated trial datasets using the final model . it displays the observations and the 2.5th , 50th , and 97.5th percentiles of observations , and the 95 % confidence intervals ( ci ) for the corresponding model predictions are plotted . the difference in ofv ( dofv ) between two nested models is approximately chi square - distributed , with degrees of freedom ( df ) equal to the difference in the number of parameters . based on this , the statistical significance for inclusion / exclusion of a model parameter can be judged . a significance level of 0.05 was used for discrimination among nested models and covariate testing , corresponding to a 3.84 change in ofv for 1 df . measurable fsh levels before drug administration indicated that endogenous fsh was not fully suppressed in this trial . the total fsh amount at time t in the central compartment was therefore modelled as the sum of the endogenous fsh and the exogenously administered rhfsh ( fe 999049):4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{fsh}}(t ) = { \text{fsh}}_{\text{en } } \left ( t \right ) { \text { + rhfsh}}\left ( t \right ) $ $ \end{document}fsh(t)=fshent+ rhfsht the endogenous fsh was assumed to have the same elimination rate constant from the central compartment as fe 999049 ; thus , the total fsh is eliminated from the central compartment with rate constant k given by clearance ( cl ) divided by volume of distribution ( v ) . since data are obtained after subcutaneous dosing , the bioavailability ( f ) is not known . the cl and v estimated here are therefore the apparent cl ( cl / f ) and apparent v ( v / f ) . the change in endogenous fsh amount over time in the central compartment was described as a turnover model with a zero - order production rate kin:5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\text{dfsh}}_{\text{en } } \left ( t \right)}}{{{\text{d}}t } } = k_{\text{in } } - k \cdot { \text{fsh}}_{\text{en } } \left ( t \right ) $ $ \end{document}dfshentdt = kin - kfshent at time zero , before rhfsh dosing , the measured concentration in the central compartment is purely endogenous fsh . the endogenous fsh baseline concentrations ( fshbl ) for each subject can therefore be estimated as the initial concentration in the central compartment and is the initial condition for the differential equation for the central compartment fshblv / f , i.e. the individual endogenous fsh amount at baseline . when assuming steady state and hence zero change in the total fsh concentration before dosing , individual values of kin can be calculated from the other estimated parameters and baseline values . one- and two - compartment models were tested for describing the distribution of fe 999049 . a lag - time and transit compartments were investigated for modelling a potential delay in the absorption process . body weight , age , and hormone ( estradiol , inhibin b , progesterone ) values at baseline were tested as potential covariates , explaining some of the iiv in parameter estimates . inhibin b was also tested as a covariate over time since it has a purely inhibitory effect on fsh . the measured hormone levels were assumed to not affect the rhfsh concentration , but only tested as covariates on the endogenous fsh baseline parameter ( fshbl ) . besides a decrease in ofv , the significance of a covariate was also evaluated by looking at the reduction in the iiv , measured as a coefficient of variation ( cv ) for the parameter s random effect . the models were implemented and parameters estimated in nonmem 7.2.0 ( icon development solutions , ellicott city , md , usa ) . data handling and the fe 999049 absorption was found to be delayed , and a one - compartment transit model best described the process . endogenous fsh contributed significantly to the total fsh concentration in the central compartment . observed inhibin b levels [ inhb(t ) ] suppressed endogenous fsh production rate ( kin ) over time when introduced in the model as a time - varying covariate . the relationship was found to be best described by an inhibitory emax model , also know as an imax function , expressed as a fractional inhibition with complete inhibition possible and a parameter inhbef as the inhibin b concentration giving 50 % inhibition [ see eq . the full compartment model is illustrated in fig . 1 and the corresponding differential equations are as follows : 6\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\text{drhfsh}}_{\text{ds } } \left ( t \right)}}{{{\text{d}}t } } = - k_{\text{tr } } \cdot { \text{rhfsh}}_{\text{ds } } \left ( t \right ) $ $ \end{document}drhfshdstdt =- ktrrhfshdst7\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\text{drhfsh}}_{\text{tr } } \left ( t \right)}}{{{\text{d}}t } } = k_{\text{tr } } \cdot { \text{rhfsh}}_{\text{ds } } \left ( t \right ) - k_{a } \cdot { \text{rhfsh}}_{\text{tr } } \left ( t \right ) $ $ \end{document}drhfshtrtdt = ktrrhfshdst - karhfshtrt8\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\text{dfsh}}\left ( t \right)}}{{{\text{d}}t } } = k_{\text{in } } \cdot \left ( { 1 - \frac{{{\text{inhb}}(t)}}{{{\text{inhb}}(t ) + { \text{inhb}}_{\text{ef } } } } } \right ) + k_{a } \cdot { \text{rhfsh}}_{\text{tr } } \left ( t \right ) - k \cdot { \text{fsh}}\left ( t \right ) $ $ \end{document}dfshtdt = kin1-inhb(t)inhb(t)+inhbef+karhfshtrt - kfshtwhere rhfshds(t ) and rhfshtr(t ) are the fe 999049 amounts at the dosing site and in the transit compartment , respectively , and ktr is the absorption rate from the dosing site to the transit compartment . equation ( 8) describes the change in total fsh amount in the central compartment , with the endogenous fsh contribution as the first term . 1compartment diagram illustrating the pharmacokinetic model for fe 999049 with a contribution of endogenous fsh to the central compartment . fsh follicle - stimulating hormone , rhfsh recombinant human fsh , fsh en ( t ) endogenous fsh amount , inhb(t ) inhibin b level , rhfsh tr ( t ) rhfsh amount in the transit compartment , fsh(t ) total fsh amount in the central compartment , k in endogenous fsh production rate , k tr absorption rate from the dosing site , k a absorption rate from the transit compartment , k elimination rate compartment diagram illustrating the pharmacokinetic model for fe 999049 with a contribution of endogenous fsh to the central compartment . fsh follicle - stimulating hormone , rhfsh recombinant human fsh , fsh en ( t ) endogenous fsh amount , inhb(t ) inhibin b level , rhfsh tr ( t ) rhfsh amount in the transit compartment , fsh(t ) total fsh amount in the central compartment , k in endogenous fsh production rate , k tr absorption rate from the dosing site , k a absorption rate from the transit compartment , k elimination rate iiv was introduced for cl / f , v / f , ktr , and fshbl . the variances of the iiv on cl / f and v / f were positively correlated . body weight was an allometrically scaled covariate at cl / f and v / f , with the power exponents fixed to 0.75 and 1 , respectively . adding body weight as a covariate reduced cv for the unexplained iiv from 18.1 to 15.6 % cv for cl / f , and from 22.0 to 18.4 % cv for v / f . a trend towards lower estimated fsh baseline levels was seen in individuals with higher progesterone baseline levels ( fig . 2 ) . the progesterone baseline effect was confirmed to be a statistically significant covariate when modelled as an inhibitory power function at the fshbl parameter . points are individual - predicted fshbl values and observed progesterone baseline values with a smooth lowess trend line ( broken line ) . the solid line is the power function used in the model describing the typical population relationship for the effect of progesterone baseline at the parameter fshbl . fsh follicle - stimulating hormone , fsh b1 endogenous fsh baseline the relationship between endogenous fsh and progesterone at baseline . points are individual - predicted fshbl values and observed progesterone baseline values with a smooth lowess trend line ( broken line ) . the solid line is the power function used in the model describing the typical population relationship for the effect of progesterone baseline at the parameter fshbl . fsh follicle - stimulating hormone , fsh b1 endogenous fsh baseline a combined additive and proportional error model was used to describe the residual error . the final model parameter estimates are displayed in table 2 . the vpc plot ( fig . 3 ) based on 1000 simulations , shows that the model overall adequately predicts the fsh concentrations over time , with appropriate variation . the model also satisfactorily predicted the individual pharmacokinetic profile for each subject in the trial ( fig . the typical population cl / f and v / f for a 65-kg woman were 0.423 l / h and 24.3 l , respectively , giving an elimination rate of 0.017 h and a terminal half - life of 40 h. when the best model was found in a forward development process , it was checked to see if all the elements were still significant or if the model could be reduced . no reduction was possible since the dofv was a minimum of 7 and up to 78.table 2pharmacokinetic parameter estimatesparameterestimate(rse%)iiv cv%(rse%)shrinkage ( % ) cl / f ( l / h)0.423(3.9)15.6(12.7)1.05v / f ( l)24.30(4.6)18.4(14.4)2.80 k tr ( h)0.329(17.0)83.4(24.1)24.6 k a ( h)0.148(13.2)fshbl ( g / l)0.162(9.1)27.8(16.5)5.51progblef 0.246(34.7)inhbef 100(37.2)typical population parameter estimates obtained from modellingfor cl / f and v / f the value is the typical value for a woman weighing 65 kg rse relative standard error , iiv interindividual variability , cv coefficient of variation , f bioavailability , cl / f apparent clearance , v / f apparent volume of distribution , k tr absorption rate from the dosing site , k a absorption rate from the transit compartment , fsh bl endogenous follicle - stimulating hormone baseline , progbl ef power exponent for progesterone baseline covariate effect , inhb ef inhibin b time - varying covariate effectfig . 3visual predictive check for the final model , showing the individual observed fsh concentrations ( points ) and the 2.5th , 50th , and 97.5th percentiles of observations ( lines ) . the shaded areas are the 95 % confidence intervals for the 2.5th , 50th , and 97.5th percentiles of the simulations . 4individual model fit with observed ( points ) and predicted ( lines ) total fsh concentrations versus time . fsh follicle - stimulating hormonetable 3change in objective function value for reduced modelsremoving df dofvwt at v / f 014.36wt at cl / f 012.61wt at cl / f and v / f 08.91cov ( cl / f , v / f)111.77progesterone effect17.01inhibin b effect178.01the resulting dofv when removing covariates or the correlation between cl / f and v / f [ cov(cl / f , v / f ) ] f bioavailability , cl / f apparent clearance , v / f apparent volume of distribution , wt body weight , df degrees of freedom , dofv difference in objective function value pharmacokinetic parameter estimates typical population parameter estimates obtained from modelling for cl / f and v / f the value is the typical value for a woman weighing 65 kg rse relative standard error , iiv interindividual variability , cv coefficient of variation , f bioavailability , cl / f apparent clearance , v / f apparent volume of distribution , k tr absorption rate from the dosing site , k a absorption rate from the transit compartment , fsh bl endogenous follicle - stimulating hormone baseline , progbl ef power exponent for progesterone baseline covariate effect , inhb ef inhibin b time - varying covariate effect visual predictive check for the final model , showing the individual observed fsh concentrations ( points ) and the 2.5th , 50th , and 97.5th percentiles of observations ( lines ) . the shaded areas are the 95 % confidence intervals for the 2.5th , 50th , and 97.5th percentiles of the simulations . fsh follicle - stimulating hormone individual model fit with observed ( points ) and predicted ( lines ) total fsh concentrations versus time . fsh follicle - stimulating hormone change in objective function value for reduced models the resulting dofv when removing covariates or the correlation between cl / f and v / f [ cov(cl / f , v / f ) ] f bioavailability , cl / f apparent clearance , v / f apparent volume of distribution , wt body weight , df degrees of freedom , dofv difference in objective function value in order to see what difference accounting for endogenous fsh in the model makes , the individual concentration time profiles for the model - predicted endogenous fsh level were compared with when the observed endogenous fsh baseline was assumed to be constant throughout the trial ( fig . furthermore , accounting for inhibin b suppression of the endogenous fsh contribution over time increased the v / f estimate from 18.9 to 24.3 l. not including inhibin b as a covariate in the final model resulted in an increase from 83.4 to 164.9 % cv at ktr.fig . the broken blue line indicates the observed endogenous fsh baseline level when assuming it to be constant throughout the trial , and the solid blue line is the model - predicted endogenous fsh level when accounting for the suppression caused by the observed inhibin b levels ( purple line ) over time , as identified by the model . the broken blue line indicates the observed endogenous fsh baseline level when assuming it to be constant throughout the trial , and the solid blue line is the model - predicted endogenous fsh level when accounting for the suppression caused by the observed inhibin b levels ( purple line ) over time , as identified by the model . the fe 999049 population pharmacokinetics have previously been characterised after single - dose administration using a one - compartment model . in accordance with those results , the current analysis showed that after multiple fe 999049 dosing , the population pharmacokinetics were also best described by a one - compartment model with first - order elimination and absorption through a transit compartment . a correlation between cl / f and v / f was observed , and body weight was an allometrically scaled covariate for both cl / f and v / f . hereby , it was confirmed that lower average steady - state drug exposure in females correlates with higher body weight after repeated doses , which is in agreement with single - dose fe 999049 results . in contrast to the single - dose trial , fsh downregulation in this trial was not complete since a measurable endogenous fsh level was detected before any drug administration . the observed endogenous fsh contributes to total fsh measurements and thereby affects the evaluation of rhfsh concentrations in the trial ; thus , it had to be accounted for in the model . to adjust the model accordingly , it was necessary to add an endogenous supply of fsh to the central compartment for proper prediction of the total fsh concentration . when evaluating the pharmacokinetics of drugs that are naturally occurring substances , data are often baseline corrected in order to get values representing only the exogenously administered drug however , when dealing with hormones , fluctuations from the endogenous baseline value over time may be observed due to various feedback control systems . even with gonadotropin downregulation , the endogenous fsh level will most likely change over time as progesterone , inhibin b , and estradiol exert inhibitory and stimulatory feedback loops at the production and release of gonadotropins . the potential impact of varying endogenous fsh levels at the pharmacokinetic assessment of fe 999049 was tested by incorporating different covariate relationships in the model . before any drug was administered , there was a tendency towards a decreased endogenous fsh baseline with increasing progesterone baseline . a power function for the relation between progesterone baseline and fshbl was shown to be significantly better than using a linear , an exponential , or an imax function . when introduced as a time - varying covariate , inhibin b was found to suppress the endogenous fsh production rate over time , with an imax function being the most significant relationship . when accounting for the inhibitory effect of inhibin b over time , the resulting model - predicted endogenous fsh concentration profiles indicated that the observed fsh baseline is an overestimate of the endogenous fsh level at all time points other than zero ( fig . , the drug concentration would be underestimated if the data were baseline corrected . when multiple covariates and correlations have been added to the model , it is possible that initial significant relations have become redundant and hence can be removed from the model . it was therefore checked whether the model could be reduced . removing any relations resulted in an increase in ofv , and removing body weight from both cl / f and v / f increased ofv less than removing body weight from only one of these parameters , which could be due to the fact that there is a correlation between the two parameters . the population pharmacokinetic parameters estimated with nonlinear mixed - effect modelling for single and multiple doses of fe 999049 are similar . in the modelling of single - dose data , cl / f and v / f for a 65 kg woman were found to be 0.430 l / h and 28.0 l , respectively , with a resulting terminal half - life of 45 h. in this trial , cl / f was 0.423 l / h and v / f was 24.3 l. by incorporating the inhibin b dynamics into the model , and suppressing the endogenous fsh contribution instead of letting the fsh baseline be constant throughout the trial , v / f increased from 18.9 to 24.3 l , suggesting that without proper estimation of endogenous fsh levels over time a bias in v / f may be obtained . the terminal half - life in the current analysis was estimated to be 40 h , thus slightly shorter than the 45 h reported after single - dose administration . the phenomenon of shorter half - life after repeated subcutaneous dosing compared with single administration was also observed using nca - based methods for analysing different fe 999049 datasets , but could not be further explained . the cl / f for other rfsh products has been found to be 0.99 l / h and 0.71 l / h ; thus , our estimated cl / f for fe 999049 is consistently lower . furthermore , the terminal half - life of fe 999049 is longer than reported values in the literature for repeated subcutaneous dosing of rfsh products , which is approximately 24 h [ 3 , 10 ] . in the same studies , a longer terminal half - life has been reported after single subcutaneous dosing ( 34.5 and 27 h ) . one study found a terminal half - life of 59 h after single subcutaneous dosing of 115 iu rfsh ; however , they noted that the estimate was not reliable since the low dose only gave a concentration slightly over baseline . this work shows that when subjects have measurable endogenous fsh levels , total fsh concentration is affected , and the endogenous fsh level varies over time as a consequence of the feedback from ovarian hormones . if not accounting for this in the model , the pharmacokinetic parameter estimates can be biased . the inclusion of endogenous hormones in the model might be even more important in the target patient group since they are likely to have higher endogenous fsh baseline levels as they will not be pituitary downregulated or suppressed . in addition , the variation in endogenous fsh levels over time could be very different between patients due to their different types of infertility , which might affect the reproductive hormone dynamics differently . characterising the endogenous fsh level and considering the hormone dynamics is therefore important as it could have clinical relevance for the dose needed . in summary , this early characterisation of fe 999049 population pharmacokinetics after repeated dosing is in line with previously reported findings of rhfsh population pharmacokinetics after single - dose administration . the results provide a basis for study design and data evaluation considerations in the future development of rfsh products . the standard method of baseline - correcting data for rfsh products has been questioned since the model indicates that endogenous fsh significantly affects the total fsh concentration and varies over time . the multiple - dose fe 999049 population pharmacokinetics were in agreement with results obtained after single - dose administration . it was confirmed that after repeated drug administration , fe 999049 exposure also appears lower in females with a higher body weight . these findings add to the evidence of body weight being an important factor in designing individualised dosing schemes . this analysis indicates that the inclusion of endogenous fsh levels and quantifying the influence of the reproductive hormone dynamics at the endogenous fsh level over time may well be essential for proper estimation of the pharmacokinetic parameters for fsh preparations . the standard method of baseline - correcting data does not account for a variation during the trial and could potentially cause an underestimation of serum drug concentration and hence inaccurate parameter estimation . to better explore and link the time - varying impact of inhibin b on endogenous fsh levels , a more mechanistic modelling approach may be warranted for including indirect delayed response and hormone feedback mechanisms in a pharmacokinetic the relevance of endogenous hormone levels should also be related to other pharmacodynamic and clinical endpoints in order to establish its significance . this work was supported by innovation fund denmark ( industrial phd case number 11 - 117436 ) . trine hyer rose , daniel rshammar , lars erichsen , and lars grundemar are all current or former employees of ferring pharmaceuticals a / s . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 helsinki declaration and its later amendments or comparable ethical standards .

objectivethe aim of this study was to characterise the population pharmacokinetics of fe 999049 , a novel recombinant human follicle - stimulating hormone ( fsh ) , after multiple dosing in healthy women , taking into account endogenous fsh levels and the reproductive hormone dynamics.methodslongitudinal measurements of fsh , luteinising hormone , progesterone , estradiol , and inhibin b levels were collected after repeated subcutaneous dosing with 225 iu of fe 999049 in 24 gonadotropin downregulated healthy women . the fsh data were described using nonlinear mixed - effects modelling.resultsthe measured fsh levels were modelled as a sum of endogenous fsh and fe 999049 . the fe 999049 population pharmacokinetics were best described using a one - compartment model with first - order absorption and elimination , and a transit model for delayed absorption . the apparent clearance and volume of distribution increased with body weight in accordance with an allometrically scaled power exponent of 0.75 and 1 , respectively . endogenous fsh levels were lower in individuals with higher progesterone levels at baseline and were further suppressed over time with increasing inhibin b levels.conclusionsthis characterisation of fe 999049 population pharmacokinetics after repeated dosing is in line with previous findings after single - dose administration . the results provide a basis for study design and data evaluation in the future development of recombinant fsh products , and show it can be of importance to account for endogenous fsh levels and its variation over time for accurate estimation of exogenously administered fsh pharmacokinetic parameters . thus , correcting fsh concentrations by the observed endogenous fsh baseline value at all time points may be incorrect .

Key Points Introduction Methods Clinical Trial Design and Data Pharmacokinetic Modelling Software Results Discussion Conclusions Funding Conflict of interest Ethical approval Informed consent

prognosis of advanced or metastatic pancreatic adenocarcinoma is poor , with a median overall survival between 6.8 and 11 months for all histological types . herein we report a case of a patient treated by the combination of gemcitabine plus oxaliplatin ( gemox regimen ) with a complete radiological response . a 50-year - old male complained of epigastric and right hypochondriac region pain in april 2001 . a ct scan showed multiple cystic tumors in the liver and spleen , a pseudocystic tumor on the pancreatic isthmus and an unlimited mass on the pancreatic corpus and tail with peripancreatic effusion . the octreoscan and tumor marker ca 19.9 concentration were normal . in may 2001 , chemotherapy with gemcitabine 1,000 patient experienced grade 1 urticaria at cycle 4 and grade 2 thrombopenia , justifying a 75% dose reduction at cycle 7 . evaluation after 4 cycles showed partial response with a 50% reduction of the liver and spleen tumors . after 9 cycles , a complete tumor response was obtained . since 2002 , physical examination and biology have remained normal . the initial biopsy was reanalyzed , and the initial diagnosis was confirmed . at the age of 61 years , a localized prostatic adenocarcinoma was diagnosed , treated by radical prostatectomy . in 2013 , a personal and family history of breast cancers ( sister at 34 years , mother at 60 years and the grandmother ) and a bladder cancer ( brother ) led to a genetic consultation with brca1 and brca2 genetic testing . the patient as well as a cousin and his two sons were found to carry a brca2 mutation . in january 2015 , the patient had no clinical symptoms , a sequelary segmentary portal hypertension and well - epithelialized varicose vein on gastroscopy and he was relapse free . the mean age at diagnostic is 60 years , with a male preponderance ( 65% ) . the most common diagnosis is due to mass effect such as abdominal pain , jaundice or weight loss . this tumor is often associated with pancreatic panniculitis ( weber - christian disease ) , perhaps due to high serum lipase concentrations . data on chemosensitivity are only available from case reports . different regimens of chemotherapy ( gemcitabine , lv5fu2 , oxaliplatin , cisplatin , irinotecan , docetaxel and paclitaxel ) were tested alone or in combination . nevertheless , the combination of gemcitabine plus oxaliplatin was not investigated . objective response rates were described with folfirinox , folfox , lv5fu2-gemcitabine , lv5fu2 , weekly paclitaxel and lv5fu2-cisplatin . however , no complete response was observed . acc is associated with a better prognosis than ductal adenocarcinoma at all stages of disease . in metastatic disease , schmidt et al . described a 5-year overall survival rate of 17.2% versus 2.8% for ductal carcinoma . in unresected patients , wisnoski et al . reported an overall survival of 25 versus 3 months . the longest survival observed in the literature was 11 years compared to 14 years in our patient . brca2 mutations are known to be associated with pancreatic cancer , representing 2% of the total pancreatic cancer cases . nowadays , there are ongoing trials testing parp inhibitors that show promising results with regard to platinum - based chemotherapy regimens . we reported the first case of metastatic acc treated with the gemox regimen . despite the lack of study in these patients , a chemotherapy regimen with oxaliplatin seems to be the most effective combination with long survival . in these patients

pancreatic acinar cell carcinoma ( acc ) is a rare entity . herein we present the case of a 50-year - old male patient with an unlimited mass on the pancreatic corpus and tail with peripancreatic effusion and multiple metastases in the liver and spleen . a liver biopsy showed a pancreatic acc . the patient received 9 cycles of gemcitabine plus oxaliplatin ( gemox regimen ) , which had to be stopped because of a persistent grade 2 neuropathy . a ct scan showed complete response after 14 years . at the age of 61 years , a localized prostatic cancer was diagnosed , treated by prostatectomy . the patient carried a brca2 mutation . none of the precedent case reports describe a chemosensibility to the gemox regimen . in spite of the lack of study in these patients , chemotherapy with oxaliplatin seems to be the most effective . long survival can be expected .

Introduction Case Presentation Discussion Statement of Ethics Disclosure Statement

children afflicted with nephrotic syndrome lose proteins to urine , resulting in hypoproteinemia and generalized edema . idiopathic nephrotic syndrome occurs in two or more children out of 100,000 and is the most common chronic glomerular disease in children . many patients have minimal change nephrotic syndrome , and most respond well to steroid therapy , but up to half of them develop frequently relapsing nephrotic syndrome or steroid - dependent nephrotic syndrome ( frns / sdns ) . a total of 1020 % of idiopathic nephrotic syndrome patients show steroid resistance ( steroid - resistant nephrotic syndrome : srns ) , defined as persisting proteinuria after a 4-week course of oral steroids . standard treatments for frns / sdns are immunosuppressive agents , such as cyclophosphamide , chlorambucil , cyclosporine ( cya ) , and levamisole , and cya is often used for treatment of srns [ 35 ] . most affected children are helped by these drugs ; however , some still show complicated clinical courses . a total of 1020 % of children with frns / sdns on cya have frequent relapses [ 6 , 7 ] , and approximately 30 % of childhood srns patients have steroid - sensitive frequent relapses after achievement of complete remission . in addition , cya can cause side effects , especially chronic nephrotoxicity [ 9 , 10 ] , suggesting that cya treatment should be discontinued after its long - term use . however , discontinuing cya almost always results in frequent relapses or steroid dependence , requiring long - term steroid therapies , which also pose a long - term risk to children . collectively , at least 1020 % of children with idiopathic nephrotic syndrome still show frequent relapses or steroid dependence under or after immunosuppressive therapies . we have defined these conditions as complicated frns / sdns . additionally , approximately 23 % of children with idiopathic nephrotic syndrome show resistance for steroids and any immunosuppressive agents , which is defined as refractory srns , posing a high risk of end - stage renal failure ( table 1 ) . therefore , development of new treatments for complicated frns / sdns and for refractory srns is urgently needed.table 1definitions of terms in nephrotic syndromefrequent relapsing nephrotic syndrome ( frns)two or more relapses within 6 months after initial remission or 4 or more relapses within any 12-month periodsteroid - dependent nephrotic syndrome ( sdns)two consecutive relapses during the reduction of steroid therapy or within 2 weeks of discontinuation of steroid therapysteroid - resistant nephrotic syndrome ( srns)when the daily administration of prednisolone at 60 mg / m / day does not lead to remission within 4 weekscomplicated frns / sdns(1 ) diagnosed with frequent relapse ( frns ) or steroid dependence ( sdns ) after completion of immunosuppressive drug therapy ( such as cyclosporine , cyclophosphamide , mizoribine , or mycophenolate mofetil)(2 ) diagnosed with frequent relapse ( frns ) or steroid dependence ( sdns ) during immunosuppressive drug therapy ( such as cyclosporine , cyclophosphamide , mizoribine , or mycophenolate mofetil)(3 ) with a history of steroid resistance and diagnosed with frequent relapse or steroid dependence during or after the completion of immunosuppressive drug therapy ( such as cyclosporine or combination of cyclosporine and methylprednisolone)refractory srnswhen the combination of steroids and immunosuppressive agents including calcineurin inhibitors does not lead to remission definitions of terms in nephrotic syndrome rituximab is a chimeric anti - cd20 monoclonal antibody , which inhibits cd20-mediated b - cell proliferation and differentiation , resulting in depletion of peripheral blood b lymphocytes . this drug was developed for the treatment of b - cell non - hodgkin s lymphoma and is now indicated for the treatment of patients with autoimmune diseases , including rheumatoid arthritis , wegener s granulomatosis , and microscopic polyangiitis [ 11 , 12 ] . in the past 10 years , there have been anecdotal reports of rituximab being effective for nephrotic syndrome . in 2004 , a patient suffering from sdns complicated with idiopathic thrombocytopenic purpura underwent rituximab treatment , resulting in long - term remission of nephrotic syndrome and idiopathic thrombocytopenic purpura . in 2005 , nozu et al . reported that rituximab treatment induced long - term remission in recurrent nephrotic syndrome and posttransplant lymphoproliferative disorder after renal transplantation . however , other reports have shown that none of the patients treated with rituximab achieved remission in recurrent nephrotic syndrome after renal transplantation . reported three complete and two partial remissions in five patients with refractory srns receiving rituximab . although other case reports and case series , as well as the above - mentioned reports , have suggested that rituximab treatment is effective in some patients with refractory srns [ 1924 ] , there is no evidence that rituximab is effective in patients with refractory srns . indeed , magnasco et al . reported the results of an open - label , randomized trial including 31 children with refractory srns who received calcineurin inhibitors and prednisolone , and 16 of them received an additional two rituximab infusions . however , proteinuria remained unchanged in rituximab - treated patients and none of them had partial or complete remission . several case reports and case series , as well as survey studies , have suggested that rituximab is effective for patients with complicated ( difficult to treat ) frns / sdns , allowing discontinuation or reduction steroids and/or immunosuppressants [ 22 , 24 , 2630 ] . treated 46 children with idiopathic nephrotic syndrome maintained in remission with steroids and calcineurin inhibitors ( i.e. , complicated frns / sdns ) with one to five rituximab courses . they found that the 6-month probability of remission was 48 % after the first remission [ 31 ] . reported the effects of rituximab therapy followed by immunosuppression withdrawal on disease recurrence in 30 patients ( including 10 children ) with complicated frns / sdns . in their report , participants received one or two doses of rituximab , and all of them were in remission at 1 year [ 32 ] . conducted an open - label , randomized , controlled trial to examine the short - term effects of rituximab in children with steroid- and calcineurin - dependent nephrotic syndrome ( i.e. , complicated frns / sdns ) . they concluded that rituximab and lower doses of prednisone and calcineurin inhibitors are non - inferior to standard therapy in maintaining short - term remission [ 33 ] . taken together , these findings suggest that rituximab is effective for children with complicated frns / sdns . however , these studies were case reports , case series , retrospective surveys , and single - arm or short - term trials . therefore , well - designed controlled trials are required to establish the value of rituximab in this condition . to evaluate the efficacy and safety of rituximab in childhood - onset complicated frns / sdns , a multicenter , double - blind , randomized , placebo - controlled trial was carried out by the research group of childhood - onset refractory nephrotic syndrome ( rcrns ) in japan ( rcrns01 ) ( clinical trials registry i d : umin000001405 ) . at the same time , an open - label , multicenter , pharmacokinetic trial ( rcrns-02 ) ( clinical trials registry i d : umin000001406 ) was also carried out . these two trials were investigator - initiated clinical trials , which sought to gain approval from the ministry of health , labour and welfare , japan to make rituximab available for patients with childhood - onset complicated frns / sdns . these trials were supported by a health and labor sciences research grant for the large scale clinical trial network project ( cct - b-2001 ) . when patients developed relapse of nephrotic syndrome , they underwent a screening examination and were registered once their eligibility , including steroid sensitivity , was verified . the rituximab group received intravenous rituximab of 375 mg / m body surface area ( maximum 500 mg ) once weekly for 4 weeks , and the placebo group received placebo at the same frequency . prednisolone treatment was gradually discontinued after obtaining remission , and patients were treated with prednisolone when they developed relapses during the study period . tapering of the cya dose was started on day 85 , and the drug was discontinued by day 169 . all of the patients were observed for 1 year , unless the patients dropped out of the study . patients were considered to have treatment failure if ( 1 ) relapse occurred by day 85 , ( 2 ) frns or sdns was diagnosed between day 86 and day 365 , or ( 3 ) steroid resistance was diagnosed during the observation period . the secondary endpoints were time - to - treatment failure , relapse rate , time to frns / sdns , and steroid dose after randomization . a gold standard , double - blind , placebo - controlled trial was adopted because the use of rituximab in treatment of nephrotic syndrome was not yet approved in any country . in the trial , treatment failures were defined , and in the event that patients had treatment failure , the allocation code was urgently disclosed . if patients were allocated to the placebo group , they were able to enter a separately conducted rituximab pharmacokinetic trial ( rcrns02 ) after discontinuation or completion of rcrns01.fig . ns nephrotic syndrome , mmf mycophenolate mofetil , mzb mizoribine , cya cyclosporine study design . ns nephrotic syndrome , mmf mycophenolate mofetil , mzb mizoribine , cya cyclosporine sixty - three patients were screened , and 52 were randomized . twenty - seven patients were allocated to the rituximab group and 25 to the placebo group . twenty - four patients in each group ( total 48 ) received the intervention and were included in the analysis on an intention - to - treat basis . four patients from the rituximab group and 20 from the placebo group had discontinued the intervention , mostly because of treatment failure . however , no patients dropped out of the study before the first relapse ( the primary endpoint ) . all of the patients with treatment failure in the placebo group were enrolled into rcrns02 after discontinuation ( n = 18 ) or completion ( n = 2 ) of rcrns01 . all of the patients were treated with steroids and/or immunosuppressants at relapse immediately before assignment . over 70 % of patients reported side effects from steroid treatment . by the end of the observation period , relapses were reported in 17 patients in the rituximab group and 23 in the placebo group . the 50 % relapse - free period was 267 days [ 95 % confidence interval ( ci ) 223374 days ] in the rituximab group and 101 days ( 95 % ci 70155 days ) in the placebo group . this relapse - free period was significantly longer in the rituximab group than in the placebo group ( hazard ratio [ hr ] = 0.267 , 95 % ci 0.1350.528 , p < 0.0001 ) . treatment failure was reported in 10 patients in the rituximab group and 20 in the placebo group . the time - to - treatment failure was significantly longer in the rituximab group than in the placebo group ( hr = 0.268 , 95 % ci 0.1220.589 , p = 0.0005 ) , and the relapse rate was significantly lower in the rituximab group than in the placebo group ( 1.542 [ 29/18.81 ] vs. 4.171 [ 46/11.03 ] per person - years , hr = 0.370 , 95 % ci 0.2310.591 , p < 0.0001 ) . significantly , fewer patients in the rituximab group experienced frequent relapses or steroid dependence compared with those in the placebo group ( hr = 0.169 , 95 % ci 0.0610.464 , p = 0.0001 ) . the daily steroid dose after randomization in the rituximab group was significantly lower than that in the placebo group ( 9.12 5.88 vs. 20.85 9.28 mg / m / day , p < 0.0001 ) . the majority of adverse events that were reported were mild and no deaths were reported . although the rate of serious adverse events was higher in the rituximab group than in the placebo group ( 42 % [ 10/24 ] vs. 25 % [ 6/24 ] ) , but this difference was not significant ( fisher s exact test , p = 0.3587 ) . mild infusion reactions were reported more frequently in the rituximab group ( 79 % [ 19/24 ] ) than in the placebo group ( 54 % [ 13/24 ] ) , but this difference was not significant ( fisher s exact test , p = 0.1246 ) . no grade 3 or 4 infusion reactions , rituximab is safe and effective , at least for 1 year , for the treatment of childhood - onset , complicated frns / sdns [ 34 ] . based on the results from rcrns01 and rcrns02 , the use of rituximab for patients with complicated frns / sdns was approved , for the first time , by the ministry of health , labour and welfare , japan on august 29 , 2014 . serious adverse events have occurred in only a limited number of these patients , while in the majority of patients , rituximab is safe and well tolerated . however , notably , there have been several reports on serious adverse events related to rituximab . fetal hepatitis by reactivation of hepatitis b virus is also a serious adverse event induced by rituximab . in recent studies of patients with complicated nephrotic syndrome who had been taking rituximab , also reported that respiratory events , such as cough , bronchospasm , and dyspnea , are relatively common as adverse effects of rituximab . sellier - leclerc et al . reported a patient with fulminant myocarditis due to enterovirus who underwent heart transplant surgery . additional severe adverse effects reported in childhood nephrotic syndrome include pneumocystis carinii pneumonia [ 28 , 40 ] and severe immune - mediated ulcerative colitis . although long - term safety data on anti - cd20 therapy are broadly reassuring , a mortality rate of 3 % has been reported in the 3 years following its initiation in patients with a variety of autoimmune diseases , mainly due to infection . the exact pathogenesis of nephrotic syndrome is unknown , but t - cell - mediated immunological abnormalities are thought to play a role . a number of studies have shown that b cells promote t - cell activation , mediate antibody - independent autoimmune damage , and provide co - stimulatory molecules and cytokines , which can sustain t - cell activation in autoimmune diseases [ 4447 ] . this action leads to b - cell depletion , and thus suppression of b - cell t - cell interactions , which might prevent recurrence of nephrotic syndrome . impaired regulatory t ( t - reg ) cell function in patients with minimal change nephrotic syndrome and induction of remission in nephrotic syndrome by t - reg cells have been previously reported [ 4951 ] . rituximab may induce an increase in the number and function of t - reg cells . rituximab - maintained remission in nephrotic syndrome might be due to restoration of t - reg cell function . recently reported that rituximab directly binds to an acid sphingomyelinase - like phosphodiesterase 3b on the cell surface of podocytes , resulting in stability of podocyte structure and function . this may lead to prevention of recurrent focal segmental glomerulosclerosis . whether a similar mechanism functions in complicated frns / sdns remain to be determined . however , this drug does not cure nephrotic syndrome because all of the patients in the rnrns01 trial had relapsed by 19 months [ 34 ] . to extend the relapse - free period , further modification of rituximab therapy , including repeated courses and adjunct immunosuppressive therapies , may be necessary . indeed , a multicenter , double - blind , randomized , placebo - controlled trial to examine the efficacy and safety of mycophenolate mofetil after rituximab therapy for treatment of complicated frns / sdns in children will be started in 2015 in japan . moreover , comparison of the efficacy , safety , and cost - effectiveness of various rituximab dosing regimens and b - cell - driven regimens remains to be examined . further studies are required to examine the long - term effects of rituximab use , particularly in children . a retrospective long - term follow - up study of patients enrolled in rcrns01 and rcrns02 , focusing on clinical courses , treatments after the clinical trial , growth , and late adverse effects , will be carried out soon in japan . at present recently reported that additional rituximab combined with conventional methylprednisolone pulse therapy and immunosuppressive agents is a promising option for overcoming refractory srns . a multicenter , single - arm trial to examine efficacy and safety of rituximab combined with methylprednisolone pulse therapy and immunosuppressive agents

in the past 10 years , many reports have suggested that rituximab , a chimeric anti - cd20 monoclonal antibody , is effective for children with complicated , frequently relapsing or steroid - dependent nephrotic syndrome ( frns / sdns ) . however , those reports were case reports , case series , retrospective surveys , and single - arm or short - term trials . therefore , well - designed controlled trials are required to establish the value of rituximab in this condition . to evaluate the efficacy and safety of rituximab in childhood - onset , complicated frns / sdns , a multicenter , double - blind , randomized , placebo - controlled trial was carried out by the research group of childhood - onset refractory nephrotic syndrome ( rcrns ) in japan ( rcrns01 ) . rcrns01 showed that rituximab is safe and effective for the treatment of childhood - onset , complicated frns / sdns . in 2014 , the use of rituximab for patients with complicated frns / sdns was approved , first in the world , by the ministry of health , labour and welfare , japan .

Introduction Rituximab Treatment for Nephrotic Syndrome A Multicenter, Double-Blind, Randomized, Placebo-Controlled Trial of Rituximab Therapy for Childhood-Onset Complicated FRNS/SDNS Safety of Rituximab Mechanisms of Rituximab in Nephrotic Syndrome Conclusions and Future Perspectives

bipolar disorder is estimated to affect 3%7% of population ( angst 1998 ; kessler et al 2005 ) . numerous us fda - approved treatment options exist for the treatment of manic phase of bipolar disorder , including lithium , valproic acid and all 5 atypical antipsychotics olanzapine , risperidone , quetiapine , ziprasidone and aripiprazole ( gajwani et al 2006 ) . the burden of bipolar disorder arises mostly from the depressed phase for both bipolar i and ii disorder . patients with bipolar i disorder experience depressive symptoms for 3 times longer compared with manic periods and report longer recovery times for depressed phases compared with manic phases of the illness ( hlastala et al 1997 ; judd et al 2002 ) . patients with bipolar ii disorder experience even greater duration and severity of depressive symptoms as compared to hypomanic mood disturbances ( judd et al 2003 ) . bipolar disorder - related morbidity and mortality can be due to suicide attempts and completed suicide . the depressed phase of bipolar disorder is associated with an increased risk of suicide compared with the manic phase of the illness ( leverich et al 2003 ; post et al 2003 ) . bipolar depression is also associated with higher impairments in the psychosocial spheres of family , social and occupational functioning compared with bipolar mania ( calabrese et al 2004 ) . even in the absence of major depressive episode , subsyndromal depressive symptoms ( presence of 2 or more depressive symptoms ) in bipolar disorder are associated with some disability or functional impairment ( altshuler et al 2002 ) . because of the predominance of depressive symptomalogy , the greater time spent in depressive episodes and higher frequency of depressive episodes often leads to a misdiagnosis of bipolar disorder as major depressive disorder . this can lead to patients receiving inadequate or inappropriate treatment such as antidepressant monotherapy . despite the prevalence and impact of depression in bipolar disorder , there are currently only 2 fda - approved agents for its management compared with multiple approved agents for management of bipolar mania . historically , clinicians have commonly employed combination pharmacotherapies for bipolar depression , usually an antidepressant and a mood stabilizer . most of the treatment guidelines limit the exposure of antidepressants to a few months during acute depressive episodes due to concerns that it may precipitate treatment emergent mania or cycle acceleration . tricyclic antidepressants and monoamine oxidase inhibitors confer the highest risk for induction of mania whereas rates for induction of mania with selective serotonin re - uptake inhibitors ( ssris ) are similar to placebo ( goodwin and jamison 1990 ; himmelhock et al 1991 ; peet 1994 ) . the purpose of this paper is to review recent evidence in support of quetiapine monotherapy for the acute treatment of depressive episodes associated with bipolar disorder , as well as the data related to safety and tolerability of this atypical antipsychotic medication in bipolar depressed patients . quetiapine monotherapy was evaluated for efficacy and tolerability for patients with bipolar depression ( bolder ) in two separate trials ( calabrese et al 2005 ; thase et al 2006 ) . both bolder i and ii trials were identical in design . a double - blind , randomized , fixed - dose , placebo - controlled , parallel - group monotherapy design was employed for each study . bolder i was conducted at 39 centers in the us between september 2002 and october 2003 . bolder ii was conducted at 41 centers in the us between june 2004 and august 2005 . there were 21 centers in common between the two trials . compared with prescription of quetiapine in bipolar mania trials where patients were hospitalized and received quetiapine twice a day , the bolder trials enrolled outpatients and quetiapine was administered in once - a - day dosing ( gajwani et al 2006 ) . these trials were designed to examine efficacy of 2 fixed doses of quetiapine , 300 mg and 600 mg per day , compared with placebo , in patients with moderate to severe bipolar depression . the structured clinical interview for diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) was used to confirm diagnosis . prior to study initiation , all raters were trained and certified . as much as possible , each patient s rating was to be performed by the same rater using throughout the study . inclusion criteria allowed outpatients ( aged 1865 years ) who met dsm iv criteria for bipolar i or ii disorder and were experiencing a major depressive episode . patients were required to have hamilton depression rating scale ( hamilton 1960 ) ( ham - d ) 17-item score 20 , a hamilton depression scale item 1 score 2 and young mania rating scale ( young et al 1978 ) score 12 at both screening and randomization . to minimize potential rating inflation of the screening and randomization scores , inclusion criteria were based on initial ham - d score while the primary efficacy measure during the study was based on montgomery - sberg depression rating scale scores ( madrs ) ( montgomery and sberg 1979 ) . the primary efficacy variable was the change in madrs total score from baseline to week 8 . the following secondary outcomes were also measured : the proportion of patients achieving response ( 50% reduction in madrs score from baseline ) , the proportion of patients who achieved remission ( madrs 12 ) and analysis of individual madrs items . exclusion criteria included ( 1 ) diagnosis of an axis i disorder other than bipolar disorder that was the primary focus of treatment within last 6 months , ( 2 ) a current episode of depression that had lasted more than 12 months or less than 4 weeks in duration , ( 3 ) failure to respond to 2 adequate ( 6 weeks ) trial of more than 2 classes of antidepressants during the current episode , and ( 4 ) a current ( within last 12 months of screening ) diagnosis of substance dependence or abuse ( except nicotine ) . patients with significant medical illnesses or patients who currently posed serious risk of suicide or homicide were also excluded . after obtaining written informed consent , patients were randomly assigned to either of the three treatment arms quetiapine 300 mg , quetiapine 600 mg or placebo ( table 1 ) . random assignment was stratified according to bipolar type ( i or ii ) to ensure 2:1 ratio for bipolar diagnosis . lorazepam ( 13 mg / day ) and zolpidem tartarate ( 510 mg at bedtime ) were permitted during the first 3 weeks of randomization but were withheld for 8 hours prior to psychiatric assessment . enrolled patients underwent a washout period for 728 days wherein any prior medications were tapered off and were then treated for 8 weeks in double - blinded fashion . quetiapine was initiated at 50 mg / day and titrated to achieve 300 mg / day by day 4 or 600 mg / day by day 7 . during the bolder i trial , a total of 838 patients were screened and 542 patients with bipolar i ( n = 360 ) or ii ( n = 182 ) were randomly assigned to receive quetiapine 600 mg / day ( n = 180 ) , quetiapine 300 mg / day ( n = 181 ) , or placebo ( n = 180 ) . of the randomized patients , 511 received at least one post baseline assessment and were analyzed for efficacy in the intent to treat analysis . patients baseline madrs scale scores reflected moderate to severe depression ( ~30 ) ( muller et al 2003 ) . the proportion of patients completing the study was 54% in the quetiapine 600 mg / day group , 67% in the quetiapine 300 mg / day group and 59% in the placebo group . the most common reason for withdrawal from the study was adverse events in the quetiapine group ( 26.1% for 600 mg / day and 16% for 300 mg / day ) and lack of efficacy in the placebo group ( 13.3% ) . quetiapine at a daily dose of either 300 mg or 600 mg demonstrated significant improvement in the madrs total scale scores as early as week 1 and at all times thereafter . the mean change in the madrs scale scores from baseline to last assessment was 16.73 in the quetiapine 600 mg / day group , 16.39 in the quetiapine 300 mg / day group compared 10.26 in the placebo group . at final assessment , approximately 58% patients met response criteria in the quetiapine groups compared with 36.1% in the placebo group . remission criteria were met by 52.9% of patients in both quetiapine groups compared with placebo group s 28.4% . on individual madrs item factor analysis , 9 out of 10 depression scale items were significantly improved in the quetiapine 600 mg / day group and 8 out of 10 in the quetiapine 300 mg / day group . both doses of quetiapine were more effective than placebo in reducing suicidal thoughts at final assessment . statistically superior improvement was seen from baseline in madrs total score irrespective of the type of illness ( bipolar i or ii ) or presence of rapid cycling compared with placebo . quetiapine - treated patients also demonstrated statistically significant improvement on the clinical global impression ( cgi ) improvement scale ( much or very much improved was 55.9% for the quetiapine 600 mg / day group , 64% for the quetiapine 300 mg / day group compared with 34.3% on placebo . in the bolder ii trial , a total of 788 patients were screened and 509 patients with bipolar i ( n = 338 ) or bipolar ii ( n = 171 ) disorder were randomly assigned to receive quetiapine 600 mg / day ( n = 169 ) , quetiapine 300 mg / day ( n = 172 ) or placebo ( n = 168 ) . of the randomized patients , 467 received at least one post - baseline assessment and were analyzed for efficacy in the intent - to - treat analysis . patients baseline madrs scale scores reflected moderate to severe depression ( ranged from 29.631.1 ) ( muller et al 2003 ) . the proportion of patients completing the study was 53.3% in the quetiapine 600 mg / day group , 58.7% in the quetiapine 300 mg / day group and 65.5% in the placebo group . the most common reason for withdrawal in the quetiapine - treatment groups was adverse events versus lack of efficacy in the placebo group . quetiapine at either dose led to significantly greater improvement in madrs total score at week 1 and at all times thereafter compared with placebo . the mean change in the madrs scale scores from baseline to last assessment was 16.00 in the quetiapine 600 mg / day group and 16.94 in the quetiapine 300 mg / day group compared with 11.93 in the placebo group . at final assessment , approximately 58.3%60% patients met response criteria in the quetiapine groups compared with 44.7% in the placebo group . remission criteria were met by 51.6%52.3% of patients in both quetiapine groups compared the placebo group s 37.3% . on madrs item analysis in this study , the majority of individual depression scale items significantly improved with both 300 mg and 600 mg quetiapine treatment . both doses of quetiapine were more effective than placebo in reducing suicidal thoughts at final assessment . statistically superior improvement was seen from baseline in madrs total score irrespective of the type of illness ( bipolar i or ii ) or presence of rapid cycling as compared to placebo . quetiapine - treated patients also demonstrated statistically significant improvement on the cgi severity and improvement scale ( much improved or very much improved was reported in 60% of the quetiapine 600 mg / day group , 61.3% of the quetiapine 300 mg / day group and only 38.5% of the placebo ) . bolder i reported the effect size in bipolar i depression to be 1.09 for those patients assigned to the 600 mg / day group and 0.91 for those taking 300 mg / day of quetiapine . the effect size in the bipolar ii subgroup was 0.39 in the 600 mg / day group and 0.28 in the 300 mg / day group . bolder ii reported effect size in bipolar i subgroup to be 0.51 for the 600 mg / day group and 0.67 for the 300 mg / day group . the reported effect size in the bipolar ii subgroup was 0.64 for patients receiving 600 mg / day and 0.56 for patients receiving 300 mg / day of quetiapine . during the bolder i trial , 2 patients attempted suicide , one in each of the quetiapine groups , but no suicides or deaths occurred during the study . the overall rate of study discontinuation due to adverse events was 26.1% ( n = 47 ) in the 600 mg / day group , 16.0% ( n = 29 ) in the 300 mg / day group and 8.8% ( n = 16 ) in the placebo group . the incidence of treatment - emergent mania was low in the quetiapine groups compared with placebo ( 2.2% with 600 mg / day , 3.9% with 300 mg / day and 3.9 % with placebo ) . extrapyramidal adverse events were present in 8.9% of the 600 mg / day group , 6.7% of the 300 mg / day group and 2.2 % of the placebo group . the rate of discontinuation in the quetiapine group due to extrapyramidal symptoms was low ( 1.1%2.8% ) . reported weight gain was as follows : 0.2 kg in the placebo group , 1.0 kg in the 300 mg / day group , 1.6 kg in the 600 mg / day group . significant weight gain as defined by weight gain of 7% from baseline was reported in 1.7% in the placebo group , 8.5% in the 300 mg / day group and 9.0% in the 600 mg / day group . during the bolder ii study , the overall rate of study discontinuation due to adverse events was 11.2% ( n = 19 ) in the 600 mg / day group , 8.1% ( n = 14 ) in the 300 mg / day group and 1.2% ( n = 2 ) in the placebo group . the incidence of treatment - emergent mania was higher in the placebo group than in either of the quetiapine groups ( 3.6% with 600 mg / day , 1.8% with 300 mg / day and 6.6% with placebo ) . extrapyramidal adverse events were present in 10.1% of the 600 mg / day group , 12.3% of the 300 mg / day group and 6.6 % of the placebo group . the rate of discontinuation in the quetiapine group due to extrapyramidal symptoms was low ( 0.6% in the 600 mg / day group ) . reported weight gain was as follows : 0.3 kg in the placebo group , 1.4 kg in the 300 mg / day group , 1.3 kg in the 600 mg / day group . significant weight gain as defined by weight gain of 7% from baseline was reported in 2.8% in placebo group , 3.9% in the 300 mg / day group and 8.6% in the 600 mg / day group . there was no significant change in the fasting blood glucose level from baseline to final assessment . during both bolder i and ii trials , no patient withdrew from the study due to weight gain . there was no significant change in the fasting blood glucose level from baseline to final assessment with quetiapine or placebo treatment and the mean fasting glucose level for all groups remained within the normal range . also , no clinically important differences between groups were reported in both bolder studies in the mean change from baseline for any vital signs , electrocardiograms , hematology , or clinical chemistry parameters . the bolder studies were large scale , multi - center , randomized , placebo - controlled trials that examined the efficacy of quetiapine monotherapy in acute bipolar depression . these were the first large - scale , controlled studies published to date that enrolled patients with both bipolar i and ii disorder and included patients with rapid cycling bipolar disorder . based on the results , quetiapine has demonstrated significant antidepressant efficacy in the depressed phase of bipolar disorder . based on the primary efficacy scale ( madrs ) , improvement was evident from week 1 and maintained for the duration of the study ( 8 weeks ) . in the madrs item analysis , both doses of quetiapine produced a significant and sustained improvement in most of the core symptoms of mood including decrease in suicidal thinking . similarly , significant improvement was observed in patients with bipolar i and ii disorder and in patients with or without rapid cycling . the therapeutic benefit of quetiapine 300 mg / day and 600 mg / day was similar at study end point . the fda has approved the quetiapine 300 mg / day dose in the treatment of bipolar depression . the rate of quetiapine induced treatment - emergent mania was low , 2%4% , and on par with the 4%7% rate observed with placebo . it can be concluded that antidepressant efficacy of quetiapine was not at the expense of treatment - emergent affective switches . a low risk of treatment - emergent affective switches may be one of the strongest advantages offered in the management of bipolar depression . however , it must be noted that in a short treatment trial such as these 8-week depression studies , this placebo - level switch rate applies only to that brief period studied and can not exclude the possibility of switches later during the course of ongoing treatment . this seems less likely with an agent such as quetiapine which is also known to be and is an approved as an antimanic agent . most commonly reported side effects included dry mouth , sedation , somnolence , dizziness and constipation . sedation and somnolence were the commonest cited reason for withdrawal from the study , with most discontinuation occurring in first week . higher drop out rates were observed in the quetiapine 600 mg / day arm compared with quetiapine 300 mg / day arm . weight gain was 1.2 kg in the quetiapine 300 mg arm and 1.5 kg in the quetiapine 600 mg arm , and no patients withdrew from study due to weight gain . a small increase in fasting plasma glucose level was observed in the quetiapine and placebo arms and no patients developed diabetes . the mean change in simpson angus scale ( sas ) and barnes akathisia rating scale ( bars ) was low and generally comparable across the three arms . comparing the two studies overall , higher placebo response rates were seen in the bolder ii trial which resulted in net lower magnitude of response rates for quetiapine versus placebo . the change from baseline madrs was comparable in both quetiapine groups in both bolder i and ii trials . it is possible that physician and patient bias could have artificially elevated the placebo response rates in bolder ii trial , as results from bolder i study were published and widely known at the time the bolder ii trial was being conducted . comparable efficacy was observed in the subpopulation of patients with rapid - cycling bipolar disorder compared with non - rapid - cycling bipolar disorder . limitations of these studies include lack of data on doses other than 300 mg / day or 600 mg / day of quetiapine in bipolar depression . also it is difficult to comment on efficacy of the 600 mg / day dose for patients failing to respond to quetiapine 300 mg / day . it is also unknown if patients not responding to quetiapine 600 mg / day would benefit from any further dose titration . patients at higher risk of suicide were excluded from the study which limits the conclusion of data to acutely suicidal bipolar depressed patients . patients with current alcohol or illicit drug dependence were excluded , hence no conclusion can be drawn about efficacy of quetiapine in dual - diagnosis bipolar disorder . in a similar double - blind , placebo - controlled , 8-week - long trial , 833 adults with bipolar depression ( madrs score of at least 20 ) were randomized to receive placebo ( n = 377 ) ; olanzapine , 520 mg / day ( n = 370 ) ; or olanzapine - fluoxetine combinations , 6 and 25 , 6 and 50 , or 12 and 50 mg / day ( n = 86 ) ( tohen et al 2003 ) . mean modal drug dose for olanzapine monotherapy was 9.7 mg / day and 7.4 mg / day of olanzapine with 39.3 mg / day of fluoxetine for olanzapine - fluoxetine arm . at week 8 , madrs scores were lower than baseline by 11.9 , 15.0 and 18.5 points in the placebo , olanzapine and olanzapine - fluoxetine groups respectively . the therapeutic effect size was 0.32 for olanzapine and 0.68 for olanzapine - fluoxetine combination . the response rates were 30.4% for placebo , 39% for olanzapine monotherapy and 56.1% for olanzapine - fluoxetine combination . olanzapine - fluoxetine was found to be more effective than olanzapine monotherapy and placebo in the treatment of bipolar depression . the mechanism of action by which quetiapine can effectively treat bipolar depression is unknown . this antipsychotic and antimanic agent , now with reported antidepressant effects , is an antagonist at multiple neurotransmitter receptor sites in the brain , including 5ht1a , 5ht2 , d1 , d2 , histamine h1 , alpha-1 and alpha-2 . quetiapine is metabolized by 4 routes , including hydroxylation , sulfoxidation , oxidation and dealkylation . dealkylation generates the primary active metabolite of the parent compound , nor - quetiapine . nor - quetiapine has high affinity and is a potent inhibitor of the noradrenergic transporter ( ki = 35 nm ) , and has partial agonistic activity at the serotonin 5ht1a receptor ( goldstein et al 2007 ) . these findings suggest that quetiapine interacts with 3 principal neuro - transmitter involved in regulation of mood : norepinephrine , serotonin and dopamine . management of bipolar depression is one of the most challenging tasks faced by clinicians and represents one of the greatest unmet needs for our patients . antidepressants are frequently used with mood stabilizers for treatment of bipolar depression , despite limited evidence and concerns about potential increased risk of change in mood polarity ( goodwin and jamison 1990 ; leverich et al 2006 ) . in a recently published study ( sachs et al 2007 ) , effectiveness of antidepressants with mood stabilizers the study was conducted by the systematic treatment enhancement program for bipolar disorder ( step - bd ) , a collaboration sponsored by the national institute of mental health designed to evaluate the effectiveness of treatments for bipolar disorder . 366 patients were enrolled in this 26-week trial which included paroxetine up to 40 mg / day , bupropion extended release up to 375 mg / day added to lithium , valproate , carbamazepine or one of the approved antimanic agents . the results demonstrated that the use of antidepressant medication versus placebo adjunctive to mood stabilizers conferred no benefit . in addition the rates of treatment - emergent affective switch were similar in the antidepressant group and placebo . although this study utilized only paroxetine and bupropion , which limits the generalizability to all other classes of antidepressants , it is the first large - scale study designed to assess effectives of commonly employed antidepressants ( paroxetine and bupropion ) in the management of bipolar depression . further long - term , head - to - head comparison studies are needed fully assess the role of antidepressants versus atypical antipsychotics in the management of bipolar depression . at this stage , quetiapine appears to be the antipsychotic agent for which the evidence is strongest to support its use in the treatment of bipolar depression . when first published , initial findings from bolder i led clinicians to believe that the magnitude of antidepressant efficacy with quetiapine was large , though the confirmatory bolder ii trial indicates that quetiapine s effects are likely to be only moderate . a post - hoc analysis ( cookson et al 2007 ) was recently published on bolder i data which suggested that when translated into clinically meaningful terms , the data indicate that between 4 and 9 patients would have to be treated with quetiapine in order for one additional patient to achieve a response beyond what would be produced by placebo . this illustrates the unmet need that still exists for effective and tolerable antidepressant agents in the management of bipolar depression . given that quetiapine exerts both acute antidepressant and antimanic activity in monotherapy , it may be considered the atypical antipsychotic most representative of a mood stabilizer . a shortcoming when considering the spectrum of quetiapine studies is the lack of maintenance phase data . such studies would address whether antidepressant effects are maintained beyond the acute assessment period and address quetiapine s role in prevention of recurrence of new mood episodes , particularly new episodes of depression . given the rather low response and remission rates with any agent in bipolar depression and the propensity for relapse , newer therapies continue to be needed to bring relief from this most complex illness .

the essential features of bipolar affective disorder involve the cyclical occurrence of high ( manic or hypomanic episodes ) and low mood states . depressive episodes in both bipolar i and ii disorder are more numerous and last for longer duration than either manic or hypomanic episodes . in addition depressive episodes are associated with higher morbidity and mortality . while multiple agents , including all 5 atypical antipsychotics , have demonstrated efficacy and earned us fda indication for manic phase of bipolar illness , the acute treatment of bipolar depression is less well - studied . the first treatment approved by the us fda for acute bipolar depression was the combination of the atypical antipsychotic olanzapine and the antidepressant fluoxetine . recently , quetiapine monotherapy has demonstrated efficacy in the treatment of depressive episodes associated with both bipolar i and ii disorder and has earned us fda indication for the same .

Introduction Study design Results Safety and tolerability Discussion Conclusion

although several techniques have been proposed to achieve consistent and predictable root coverage , by some estimates , the average percentage of covered root surfaces resulting from different procedures performed under varying clinical conditions varies from 56% to 97.8%.[36 ] thus , treatment of buccal recession remains a major challenge to clinicians . many different surgical procedures have been used to achieve root coverage which include pedicle grafts ( lateral sliding or double papillae ) with or without connective tissue grafts , epithelialized autogenous grafts ( free gingival ) , connective tissue grafts , coronally positioned flaps ( cpf ) alone , cpf preceded by a free gingival graft , and cpf with a simultaneous connective tissue graft . each of these techniques results in varying degrees of success and offers a variety of treatments for such defects . the use of subepithelial connective tissue graft ( sctg ) covered by a cpf has shown good predictability . however , it involves a certain degree of discomfort for the patient because of two surgical sites ( palatal donor and recepient sites ) . a study evaluated the treatment of localized gingival recession by cpf ( test ) with or without an sctg ( control ) . the mean root coverage was 98.9% in the test group and 97.1% in the control group . recently , an acellular dermal matrix allograft ( adma ) has been used as a substitute for the keratinized tissue ( kt ) around teeth for the treatment of alveolar ridge deformities and for the root coverage procedures . in vitro and clinical studies suggested that adma is an acellular , non - immunogenic scaffold that heals by repopulation and revascularization , rather than through a granulation process . previous studies compared the results obtained with adma and the sctg for the treatment of gingival recessions . however , a study has shown that the sctg produced a greater mean probing reduction and mean keratinized tissue increase than the adma . hence , the aim of the present study was to clinically evaluate the treatment of gingival recessions ( miller class ii ) by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) . the patients for the clinical trial were selected from department of periodontics , college of dental sciences , davangere , karnataka . informed consent was taken from all the patients after explaining the procedure and the ethical clearance was obtained from the ethical committee of college of dental sciences , davangere , karnataka , india . ten patients with 20 recession defects ( buccal / labial ) , five males and six females , ranging from 20 to 55 years of age ( mean age 37 years ) with a comparable bilateral class ii gingival recession in maxillary anteriors and premolars in each patient were included in this study . the control group consisted of sites treated with cpf alone and the test group consisted of sites treated with adma and cpf . the patients were consecutively selected from the out - patient department ( opd ) of periodontics , college of dental sciences , who visited the department with the complaint of gingival recession at the sites selected for the study . there was soft tissue coronal to the cementoenamel junction ( cej ) in the interproximal regions . all the teeth were vital because none had been treated endodontically and all were asymptomatic and the sites to be treated had no caries or restoration , smokers were excluded from the study . initial therapy included oral hygiene instructions and scaling and root planning . every effort was made to modify habits that may have contributed to the recession defects . no occlusal therapy was performed in any case as occlusal analysis was within normal limits in all cases included in the study . the measurements included recession height ( rh)---measured from cementoenamel junction ( cej ) to free gingival margin ; recession width ( rw)---measured mesiodistally at the cej level ; probing depth ( pd)---measured from gingival margin to the base of the defect ; clinical attachment level ( cal)---calculated as rh + probing depth ; height of the keratinized tissue ( hkt)---measured from the distance between the most apical point of the gingival margin ( gm ) and the mucogingival junction ( mgj ) ; thickness of keratinized tissue ( tkt ) is measured at midpoint location between gingival margin and mucogingival junction , using periodontal probe after anesthetizing , the straight probe was pierced perpendicularly to the mucosal surface , through the soft tissue until a hard surface was felt . later the straight probe was replaced by graduated periodontal probe ( williams probe ) until hard surface was felt and recordings were made and rounded off to the nearest millimeters . the surgical procedure used was the same for the both groups , except that the control group was treated with cpf and the test group was treated with cpf and adma . after obtaining anesthesia , the exposed root surface was planed to eliminate soft tooth structure , undercuts , ridges , plaque , and calculus . the root biomodification was done with a tetracycline solution ( 125 mg tetracycline / ml of saline ) . the incisions were extended mesially and distally as far as necessary to permit coronally positioning a pedicle graft over the defects . two oblique vertical incisions were extended beyond the mgj and a trapezoidal mucoperiosteal flap was raised up to mgj . after this point , a spit thickness flap was extended apically , to release the tension and favor the coronal positioning of the flap . the epithelium on the mesial and distal papillae was scraped to create a bleeding surface for a recipient bed [ figures 14 ] . preoperative view of maxillary left first premolars reflection of partial thickness flap root biomodification is done and recipient bed is prepared in the test group , an acellular dermal matrix allograft was adapted after being aseptically rehydrated in sterile saline , according to manufacturer 's instruction . a template is prepared and the graft was trimmed to a shape and size of template designed to cover the root surface and the adjacent surrounding bone . the basement membrane side was placed adjacent to bone and tooth and connective tissue side was placed facing the flap . the coronal lateral borders of adm were sutured with sling sutures using resorbable sutures ( ethicon 4 - 0 ) [ figures 5 and 6 ] . the flap was coronally positioned and sutured to completely cover the allograft and protected with a non - eugenol dressing . in the control group , the surgical procedures were similar except for the placement of graft . alloderm is sutured over the defect flap is sutured completely covering alloderm routine post - operative instructions were given to both groups . all patients were seen 2 , 4 , 8 , 12 and 24 weeks post - operative . at 2 weeks post - operative , flossing was not restarted in area until 8 - 12 weeks post - operative . at that point , patients were returned to normal brushing . at 24 weeks post - operative , changes in the vertical and horizontal dimensions in both experimental and control groups were analyzed by intragroup comparisons by the paired the results were also ascertained by nonparametric methods like wilcoxon 's test and mann - whitney test whenever measurements were found to be non - normal . the results were presented as mean standard deviation ( sd ) for all the parameters . pre- and post - operative changes and comparison between test and control groups are summarized in [ table 1 ] . pre- and post - operative changes and comparison between test and control groups there was statistical significant reduction in pd , rh , rw and an increase in cal gain , hkt , and tkt for the test group . for the control group statistically significant reduction was seen only in relation to pd , rh and an increase in cal gain where as rw , hkt , tkt were statistically not significant . however , on comparison between the test and control group , only tkt parameter showed statistically significant result , indicating that acellular dermal matrix has significantly contributed to the thickness in the test group . the test group has mean root coverage of 82.2% and the control group has 53% and the difference was found to be statistically significant . the predictability of root coverage in both test and control groups was 80% and 50% , respectively [ table 2 ] . comparison of percentage root coverage ( % ) and predictability in both experimental and control groups it has been accepted that complete root coverage can be achieved in class ii gingival recessions . this type of defect could be treated with many variations of three basic approaches ; ( 1 ) pedicle soft tissue grafts ; ( 2 ) free soft tissue grafts ; and ( 3 ) combinations of the two . among the pedicle grafts , it has many advantages over other surgical procedures used to treat the gingival recessions : it does not require a separate surgical site to obtain a graft , the tissue of the pedicle provides a perfect color / contour match with the surrounding tissue , the procedure is simple to perform , and does not require extended surgical or recovery time . the association of autogenous connective tissue graft with the cpf is also considered predictable ; however , the second surgical site necessary to harvest the autogenous palatal donor tissue is a serious disadvantage due to increased risk of pain and post - operative hemorrhage . therefore , an adma has been used as an alternative source of donor tissue . the material provides an unlimited supply of graft material that could be particularly helpful when treating multiple recession sites . the present study compared treatment of class ii gingival recessions by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) . the experimental design included two treatment groups that differed only by the presence of allograft allowing the evaluation of the influence of the graft in the clinical results . the graft was oriented with the basement membrane toward the root surface based in previous reports showing that the orientation of the material did not affect the treatment outcome . in both the groups statistically significant results was obtained with pd , cal , and rh parameters ; however , between the groups statistical significance was not seen . these results are in correlation with the studies done by various authors.[21315 ] these clinical changes probably represent a combination of new connective tissue attachment in the apical half of the defect and the presence of a long junctional epithelium attachment in the coronal half . however , these changes are probably not large enough to be detected or considered important in most clinical situations . it seems more important that in all cases the final results were esthetically pleasing , functionally adequate , and had a healthy sulcus . the rw and hkt were statistically significant only in test and results between the groups for these parameters were not statistically significant . the possible effect of adm in increasing the amount of keratinized gingiva is not clear . however , it is not known why an increase in the amount of keratinized tissue would occur in defects treated with the acellular dermal matrix . the tkt is measured using transgingival probing , as this method was found to be more reliable , cost effective , and compatible at chair side . the increase in the tkt was statistically significant only in the test group and comparison between groups was also statistically significant . the increase in the thickness might be due to integration of the adma graft membrane with the overlying flap . the role of collagen membranes can not be underestimated or overlooked because collagen membranes can increase tissue thickness via membrane integration . a histologic study of adma - treated areas showed the presence of elastin fibers which implies that the adma was incorporated into the tissue , rather than being exfoliated or absorbed . elastin fibers are found in skin and in an adma , but not in gingival and oral mucosa . . a statistically significant root coverage ( 82.2% ) and predictability ( 80% ) associated with the adm group might be due to the presence of collagen , which forms a major portion of the adm graft extracellular matrix . it was found that collagen stimulates platelet attachment , enhances fibrin linkage , and is chemotactic for fibroblasts . it also inhibits the apical migration of epithelium , allowing undifferentiated mesenchymal cells to repopulate the space and promote regeneration resulting in a stable attachment of the covering flap to the previously denuded root surface , thus preventing subsidence of epithelium . during healing period , the adm graft might have acted as a shock absorber , deflecting the undue forces that otherwise would be transmitted to the fragile maturing fibrin clot on the root surface . adm allograft was found to be a biocompatible , non - allergenic , and did not produce any inflammatory response . from the clinician 's point of view , the adm graft eliminates donor site morbidity , offers unlimited tissue availability , and reduces multiple surgeries . clinically , the handling , trimming , adapting , and suturing of the graft is simple and convenient , and it is significantly superior in effectiveness and efficiency in the treatment of gingival recession compared to cpf alone . it may also provide as a useful substitute for connective tissue graft procedures for root coverage .

the aim of the randomized controlled single blind study is to evaluate the treatment of miller 's class ii gingival recessions by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) . ten patients with 20 sites with maxillary bilateral miller 's class ii facial recession defects were selected randomly into two groups of test ( adma+cpf ) and control ( cpf alone ) group with each group having 10 recession defects to be treated . the clinical parameters included plaque index ( pi ) , gingival index ( gi ) , probing pocket depth ( ppd ) , clinical attachment level ( cal ) , recession height ( rh ) , recession width ( rw ) , height of the keratinized tissue ( hkt ) , and thickness of the keratinized tissue ( tkt ) . these measurements were recorded at baseline and after 6 months post - surgery . statistical analysis was made by the paired t test for intragroup and intergroup comparison was done by the unpaired t test . the percentage of root coverage for both the experimental and control groups were 82.2% and 50% , respectively . the changes from baseline to 6 months were significant in both the groups for pd , cal , and rh ; however , for parameters such as rw , hkt , and tkt significance was seen only in the experimental group . on comparison between two groups , only tkt showed statistically significance . it can be concluded that the amount of root coverage obtained with adma + cpf was superior compared to cpf alone .

Introduction Materials and Methods Results Discussion Conclusion

chemical synthesis remains a cornerstone of the enterprise of preparing small molecule active pharmaceutical ingredients ( apis ) . advances in the field of chemical synthesis continue to be benchmarked by the methods and strategies for the preparation of complex natural products , which , more effectively than any other exercise , expose challenges that still exist in the field . over the last half century , natural product synthesis has continued to be driven by three general motivations : 1 ) to achieve the practical synthesis of highly complex structures for which a synthesis plan is not readily apparent , 2 ) to highlight the power , as well as identify the scope and limitations of a newly developed synthesis method , and 3 ) to facilitate exploration of biological function of the synthetically prepared molecules ( and their derivatives ) . while the latter two motivations have received considerable attention ( especially over the last two decades ) , the former motivation , which has historically served to advance the field , has waned as the notion that any desired molecule can be prepared given enough resources and time , has prevailed . yet , efficient , and versatile syntheses of many complex molecules still have not been realized . this is especially true for molecules that feature polycyclic , highly caged , frameworks for which effective strategic solutions are not immediately obvious . for these architecturally complex skeletons ( e.g. , aconitine , 1 , figure 1a ) , the biosynthetic transformations that lead to these secondary metabolites in nature are often not fully vetted , are low yielding , or can not be efficiently reproduced in the laboratory . , we demonstrate that for a subset of topologically complex and functional group dense secondary metabolites in the diterpenoid alkaloid family ( representative of the aconitine type ; > 700 members ) , the serial application of a concept termed network analysis at the initial stages of synthetic planning has unveiled a unified strategy for their synthesis . this type of analysis has proved unexpectedly enabling by identifying a strategy that is a notable departure from previously established synthesis strategies for related alkaloids . the network analysis approach , first introduced by corey in 1975 , involves strategic bond disconnections of bridged polycycles . despite the emergence of other philosophies , guidelines , and methods for synthesis in the interim four decades total syntheses of weisaconitine d ( 2 ; a c-18 alkaloid ) and liljestrandinine ( 3 ; c-19 ) , as well as the preparation of the skeleton of natural products in the denudatine family ( e.g. , gomandonine , 4 ; c-20 ) reported herein illustrate the power of this type of analysis . beyond their imposing architectures , the diterpenoid alkaloids ( including weisaconitine d and liljestrandinine ) have also gained in prominence as small molecule ligands for voltage - gated na and k ion channels . in some cases , these small molecules may be isoform specific in their interactions with ion channels ( presumably binding at the aconitine binding site ) and therefore hold potential as the basis for novel therapeutics to address myriad channelopathies . for example , the na channel blocker lappaconitine ( allapinin ; 5 ) is already administered as a non - narcotic analgesic drug . however , to better identify the salient features of these molecules that lead to desirable medicinal properties , versatile de novo syntheses are required as they facilitate the synthesis of analogs featuring deep - seated skeletal changes that may not be otherwise efficiently accessed ( e.g. , by a biomimetic pathway or semi - synthesis ) . the application of network analysis to the diterpenoid alkaloids is illustrated in our retrosynthesis of the c-18 diterpenoid alkaloid weisaconitine d ( figure 1b ) . at the heart of this analysis is to minimize , in the retrosynthetic direction , the number of bridged rings , which , in addition to the density of stereochemically disposed functional groups , heightens the complexity of these molecules . targeting the maximally bridged ring ( highlighted in red for perspective iv of 2 ; see box in figure 1b ) possessing five bridgehead atoms ( highlighted in purple ) , for disconnection leads back to 6 , where in the forward sense , a bicyclization / cycloaddition could be applied to forge the bicyclo[3.2.1]framework . in turn , identification of the piperidine ring in 6 as the maximally bridged ring for this compound triggered a retrosynthetic simplification by disconnection of the c19n bond ( see b for atom numbering ) leading back to a bicycle that could be derived from 7 . bicycle 7 was anticipated to be available from diene 8 and dienophile 9 using a diels alder cycloaddition . of note , while alternative diels - alder cycloadditions ( compare c , d and e in figure 1c ) have been deployed in related elegant total syntheses , the serial application of network analysis , along with other considerations , led us to an alternative bond construction . dehydro - hydrindane 7 possesses a variety of strategic synthetic handles that facilitate divergence in the synthetic scheme . similar retrosynthetic analyses can be proffered for the c-19 diterpenoid alkaloid liljestrandinine and for the c-20 alkaloid gomandonine ( see the supporting information , si , for more details ) . however , in these cases , the c4 bridgehead carbon would need to be quaternized , and 7 is suited for this purpose . from our analysis , 7 may also be employed in the syntheses of other diterpenoid alkaloids of the hetidine , hetisine , denudatine , and aconitine type ( > 900 members ) . prior reported syntheses of diterpenoid alkaloids have mainly focused on specific targets ( e.g. , creative syntheses by fukuyama , baran , gin , and wiesner ) , whereas our synthetic plan targets the range of c-18 , c-19 and c-20 diterpenoid alkaloids . our synthesis of weisaconitine d ( figure 2a ) commenced with the cycloaddition of known diene 8 and cyclopentenone derivative 9 , yielding a cycloadduct that upon hydrogenation gives bicyclic ketone 10 ( 70% ; 2 steps ) . vinyl triflate formation and pd(0)-catalyzed cross - coupling with cyanide yields ,-unsaturated nitrile 7 ( 70% ; 2 steps ) , which served as a substrate for a rh - catalyzed conjugate addition with in situ generated lithium boronate 11 , to afford 12 in 60% yield . this conjugate addition step , which required careful optimization , provides a modular way to introduce the guaiacol derivative with high diastereocontrol and sets the stage to access various oxidation patterns on the c / d bicycle of the diterpenoid alkaloids by using other differently substituted arenes . selective reduction of the ester group of 12 ( in the presence of the cyano group ) with red - al and reoxidation of the resulting alcohol group to the aldehyde using the dess - martin periodinane reagent gives 13 . at this stage , wittig olefination of the aldehyde group and hydration of the nitrile group using the conditions of chang provides carboxamide 14 . hofmann rearrangement of the amide group and attendant trapping of the intermediate isocyanate with methanol , followed by fluoride - mediated cleavage of the tbs group gives 15 . activation of the primary hydroxyl as the mesylate and exposure to kotbu effects alkylation to forge the c19n bond and fashion the piperidine ring of 16 to complete the aef rings ( see a , figure 1b , for ring labeling ) of the c-18 diterpenoid alkaloids . in preparation for the installation of the bcd rings , the mom group of 16 was removed and the resulting phenol subjected to oxidative dearomatization to afford 17 . dienone 17 smoothly undergoes intramolecular diels alder cycloaddition upon heating to 150 c to provide 18 , which is the core framework of the c-20 denudatine type diterpenoid alkaloids ( e.g. , gomandonine , 4 ) , bearing a bicyclo[2.2.2 ] moiety . the structure of this polycycle was secured by x - ray crystallographic analysis of benzoylated derivative 24 ( figure 2b ) . in preparation for the transformation of the bicyclo[2.2.2 ] structural motif to the bicyclo[3.2.1 ] framework characteristic of the aconitine - type c-18 and c-19 alkaloids , the carbonyl group of 18 was reduced stereoselectively ( presumably steered away from torsional strain with the -disposed methoxy group of the dimethylketal ) , and the ketal hydrolyzed to unveil -ketol 19 . protection ( mom ) of the secondary hydroxyl of 19 and diastereoselective reduction of the ketone group provides alcohol 20 . at this juncture , in preparation for a wagner - meerwein type rearrangement in accordance with the precedent of wiesner and wang , the alcohol group of 20 was activated by triflation and upon subjection of the triflate to dbu and dmso , hexacycle 21 was isolated in 55% yield over the two steps . in principle , while two isomeric allylic alcohols could result from the wagner - meerwein rearrangement , 21 is computed to be the more stable of the two ( by 8.7 kcal / mol ( gas phase ) and 8.4 kcal / mol ( dmso ) using dft / m06-l/6 - 311g(d , p ) ; see the si for more details ) presumably because it does not possess a strained bridgehead double bond . several tactics were then explored to achieve a formal hydro - methoxylation of the c15c16 double bond . these included the use of methanol in the presence of various protic and -acids to activate the double bond , hydroboration ( both inter and intramolecular directed by the secondary hydroxyl at c14 of 21 following mom cleavage ) , and variants of the hydration method of mukaiyama and isayama . in the end , the successful route to install the requisite methoxy group at c16 of 21 required the use of an epoxide intermediate . thus , hydroxyl - directed epoxidation of the c15c16 olefin group of 21 from the -face using m - cpba ( see cylview of 25 , figure 2b ) and ethylation of the tertiary hydroxyl yielded 22 ( 76% over 2 steps ) . regioselective reductive opening of the epoxide using the conditions of cuerva and oltra gave a -disposed secondary alcohol group that was methylated to furnish 23 ( 66% over 2 steps ) . with the oxygenation of the d - ring of weisaconitine d secured , all that remained was to install the ethyl group on the piperidine nitrogen and to remove the mom group to complete the synthesis . these tasks were accomplished in three steps entailing removal of the methoxycarbonyl ( moc ) group of 23 ( using koh ) , acylation of the resulting secondary amine group ( using ac2o ) , reduction of the acetamide ( using lialh4 ) and finally treatment with acid ( in the same pot ) to remove the mom group . the total synthesis of weisaconitine d was achieved in 29 total steps from diene 8 and dienophile 9 . one key challenge that remains unmet in the previous syntheses of c-18 , c-19 , and c-20 diterpenoid alkaloids is how to achieve modular functionalization of the c4 position of the shared carbon framework . here , we demonstrate that alcohol 15 , a derivative of hydrindene 7 , can be utilized in the synthesis of the c-19 diterpenoid alkaloid liljestrandinine , which possesses a methoxymethylene group at c4 ( figure 3a ) . the primary hydroxyl of 15 was first oxidized using swern conditions to the corresponding aldehyde ( not shown ) . various attempts to alkylate the aldehyde enolate ( as well as the enolates of related 6,5-bicycles ) proved unfruitful and resulted in either non - specific decomposition or the addition of the electrophile from the undesired -face ( presumably due to developing syn - pentane interactions of the electrophile with the angular vinyl group ) . ultimately , it was found that an aldol - cannizzaro sequence on the intermediate aldehyde , effected using koh and formaldehyde , furnishes a geminal bis - methylene diol which was functionalized as the bis - mesylate ( see 27 ) , where the c4 stereocenter is ablated . at this stage , in accord with the precedent of wiesner , alkylation of the carbamate nitrogen was accomplished with kotbu to forge the piperidine ring and reconstitute the c4 stereocenter ( see 27 ) . displacement of the remaining mesylate group with methoxide , reinstallation of the nitrogen protecting moc group ( which is partially cleaved during the methoxide displacement ) and removal of the mom group provides 28 . phenol 28 was advanced to an intermediate analogous to 21 ( 8 steps ) and then to liljestrandinine using a sequence analogous to that described for 23 2 ( 3 steps ; see the si for details ) . overall , the synthesis of liljestrandinine proceeds in 29 steps from diene 8 and dienophile 9 . the chemical syntheses of weisaconitine d and liljestrandinine described here rely on subsequent diastereoselective installation of all stereocenters from the four contiguous stereocenters that are introduced in the diels alder reaction between diene 8 and dienophile 9 . as such , a catalytic , enantioselective , diels alder cycloaddition would enable enantioselective access to the natural products . in this regard , initial attempts to render the cycloaddition between 8 and 9 enantioselective with the aid of chiral , non - racemic , lewis acid catalysts ( e.g. , using the method of mezzetti ) resulted in low enantioselectivity and non - specific decomposition ( primarily of diene 8 under the acidic conditions ) . ultimately , success was attained using 29 ( for which we have developed a new , scalable , synthesis ; see the si ) as a dienophile . this dienophile has enhanced reactivity because of an added intramolecular h - bond , as well as a more highly organized transition state ( see 30 for a model ) that places the enantio - discriminating substituents ( e.g. , the t - butyl group of the bis - oxazoline ligand ) proximal to the reacting dienophile double bond . in the event , a 68% yield of cycloadduct 31 ( 92% ee ; > 20:1 d.r . ; see cylview ) was obtained using the conditions described in figure 3b . furthermore , 31 is easily converted to 32 , which intercepts the racemic syntheses described in figures 2 and 3a . finally , our iterative application of corey s network analysis approach to initiating a strategy for the syntheses of weisaconitine d and liljestrandinine has inspired us to develop general ways to conduct such analyses . past implementations of network analysis in retrosynthesis , especially in the identification of the maximally bridged ring , have been carried out in a probabilistic manner , which invariably heightens the risk of errors . to overcome this shortcoming , we have developed a web - based deterministic graphing program that permits the identification of the maximally bridged ring ( or rings ) for any molecule using the chemistry development kit ( cdk ) software library ( see figure 4a for the output of a test set ; see the si for more details ) . the algorithm we have developed for this purpose is guaranteed to identify the maximally bridged ring each time it is run . the program allows control of several criteria ( e.g. , the number of atoms that comprise the maximally bridged ring or that span bridging atoms in the maximally bridged ring ) . the program outputs the maximally bridged ring or in the case of ties ( e.g. , for nominine and arcutinidine in figure 4a ) , all maximally bridged rings . while many considerations are taken into account in retrosynthetic analyses of topologically complex molecules , the role of network analysis can often unlock novel strategic disconnections . for example , consider the denudatine core ( figure 4b ) , which contains three rings that each possesses four bridgehead atoms . by focusing on these rings for disconnection , maximum retrosynthetic simplification ( i.e. , removal of bridging chains and fused rings ) is achieved in the least amount of steps with our approach ( see f ) . a retrosynthetic analysis of the aconite framework , informed by network analysis ( figure 4c ) suggests that disconnections represented by i would provide maximum simplification . these latter strategic disconnections , which guided our approach to the syntheses of weisaconitine d and liljestrandinine , also indicate that a direct bicyclization to construct the bicyclo[3.2.1 ] moiety would provide the maximum benefit . efforts to achieve this type of bicyclization are the subject of our ongoing studies . the creation of this web - based program should further facilitate the use of network analysis in developing retrosyntheses of other architecturally complex molecules and enable the identification of an efficient path to their syntheses . the application of network analysis to the diterpenoid alkaloids is illustrated in our retrosynthesis of the c-18 diterpenoid alkaloid weisaconitine d ( figure 1b ) . at the heart of this analysis is to minimize , in the retrosynthetic direction , the number of bridged rings , which , in addition to the density of stereochemically disposed functional groups , heightens the complexity of these molecules . targeting the maximally bridged ring ( highlighted in red for perspective iv of 2 ; see box in figure 1b ) possessing five bridgehead atoms ( highlighted in purple ) , for disconnection leads back to 6 , where in the forward sense , a bicyclization / cycloaddition could be applied to forge the bicyclo[3.2.1]framework . in turn , identification of the piperidine ring in 6 as the maximally bridged ring for this compound triggered a retrosynthetic simplification by disconnection of the c19n bond ( see b for atom numbering ) leading back to a bicycle that could be derived from 7 . bicycle 7 was anticipated to be available from diene 8 and dienophile 9 using a diels alder cycloaddition . of note , while alternative diels - alder cycloadditions ( compare c , d and e in figure 1c ) have been deployed in related elegant total syntheses , the serial application of network analysis , along with other considerations , led us to an alternative bond construction . dehydro - hydrindane 7 possesses a variety of strategic synthetic handles that facilitate divergence in the synthetic scheme . similar retrosynthetic analyses can be proffered for the c-19 diterpenoid alkaloid liljestrandinine and for the c-20 alkaloid gomandonine ( see the supporting information , si , for more details ) . however , in these cases , the c4 bridgehead carbon would need to be quaternized , and 7 is suited for this purpose . from our analysis , 7 may also be employed in the syntheses of other diterpenoid alkaloids of the hetidine , hetisine , denudatine , and aconitine type ( > 900 members ) . prior reported syntheses of diterpenoid alkaloids have mainly focused on specific targets ( e.g. , creative syntheses by fukuyama , baran , gin , and wiesner ) , whereas our synthetic plan targets the range of c-18 , c-19 and c-20 diterpenoid alkaloids . our synthesis of weisaconitine d ( figure 2a ) commenced with the cycloaddition of known diene 8 and cyclopentenone derivative 9 , yielding a cycloadduct that upon hydrogenation gives bicyclic ketone 10 ( 70% ; 2 steps ) . vinyl triflate formation and pd(0)-catalyzed cross - coupling with cyanide yields ,-unsaturated nitrile 7 ( 70% ; 2 steps ) , which served as a substrate for a rh - catalyzed conjugate addition with in situ generated lithium boronate 11 , to afford 12 in 60% yield . this conjugate addition step , which required careful optimization , provides a modular way to introduce the guaiacol derivative with high diastereocontrol and sets the stage to access various oxidation patterns on the c / d bicycle of the diterpenoid alkaloids by using other differently substituted arenes . selective reduction of the ester group of 12 ( in the presence of the cyano group ) with red - al and reoxidation of the resulting alcohol group to the aldehyde using the dess - martin periodinane reagent gives 13 . at this stage , wittig olefination of the aldehyde group and hydration of the nitrile group using the conditions of chang provides carboxamide 14 . hofmann rearrangement of the amide group and attendant trapping of the intermediate isocyanate with methanol , followed by fluoride - mediated cleavage of the tbs group gives 15 . activation of the primary hydroxyl as the mesylate and exposure to kotbu effects alkylation to forge the c19n bond and fashion the piperidine ring of 16 to complete the aef rings ( see a , figure 1b , for ring labeling ) of the c-18 diterpenoid alkaloids . in preparation for the installation of the bcd rings , the mom group of 16 was removed and the resulting phenol subjected to oxidative dearomatization to afford 17 . dienone 17 smoothly undergoes intramolecular diels alder cycloaddition upon heating to 150 c to provide 18 , which is the core framework of the c-20 denudatine type diterpenoid alkaloids ( e.g. , gomandonine , 4 ) , bearing a bicyclo[2.2.2 ] moiety . the structure of this polycycle was secured by x - ray crystallographic analysis of benzoylated derivative 24 ( figure 2b ) . in preparation for the transformation of the bicyclo[2.2.2 ] structural motif to the bicyclo[3.2.1 ] framework characteristic of the aconitine - type c-18 and c-19 alkaloids , the carbonyl group of 18 was reduced stereoselectively ( presumably steered away from torsional strain with the -disposed methoxy group of the dimethylketal ) , and the ketal hydrolyzed to unveil -ketol 19 . protection ( mom ) of the secondary hydroxyl of 19 and diastereoselective reduction of the ketone group provides alcohol 20 . at this juncture , in preparation for a wagner - meerwein type rearrangement in accordance with the precedent of wiesner and wang , the alcohol group of 20 was activated by triflation and upon subjection of the triflate to dbu and dmso , hexacycle 21 was isolated in 55% yield over the two steps . in principle , while two isomeric allylic alcohols could result from the wagner - meerwein rearrangement , 21 is computed to be the more stable of the two ( by 8.7 kcal / mol ( gas phase ) and 8.4 kcal / mol ( dmso ) using dft / m06-l/6 - 311g(d , p ) ; see the si for more details ) presumably because it does not possess a strained bridgehead double bond . several tactics were then explored to achieve a formal hydro - methoxylation of the c15c16 double bond . these included the use of methanol in the presence of various protic and -acids to activate the double bond , hydroboration ( both inter and intramolecular directed by the secondary hydroxyl at c14 of 21 following mom cleavage ) , and variants of the hydration method of mukaiyama and isayama . in the end , the successful route to install the requisite methoxy group at c16 of 21 required the use of an epoxide intermediate . thus , hydroxyl - directed epoxidation of the c15c16 olefin group of 21 from the -face using m - cpba ( see cylview of 25 , figure 2b ) and ethylation of the tertiary hydroxyl yielded 22 ( 76% over 2 steps ) . regioselective reductive opening of the epoxide using the conditions of cuerva and oltra gave a -disposed secondary alcohol group that was methylated to furnish 23 ( 66% over 2 steps ) . with the oxygenation of the d - ring of weisaconitine d secured , all that remained was to install the ethyl group on the piperidine nitrogen and to remove the mom group to complete the synthesis . these tasks were accomplished in three steps entailing removal of the methoxycarbonyl ( moc ) group of 23 ( using koh ) , acylation of the resulting secondary amine group ( using ac2o ) , reduction of the acetamide ( using lialh4 ) and finally treatment with acid ( in the same pot ) to remove the mom group . the total synthesis of weisaconitine d was achieved in 29 total steps from diene 8 and dienophile 9 . one key challenge that remains unmet in the previous syntheses of c-18 , c-19 , and c-20 diterpenoid alkaloids is how to achieve modular functionalization of the c4 position of the shared carbon framework . here , we demonstrate that alcohol 15 , a derivative of hydrindene 7 , can be utilized in the synthesis of the c-19 diterpenoid alkaloid liljestrandinine , which possesses a methoxymethylene group at c4 ( figure 3a ) . the primary hydroxyl of 15 was first oxidized using swern conditions to the corresponding aldehyde ( not shown ) . various attempts to alkylate the aldehyde enolate ( as well as the enolates of related 6,5-bicycles ) proved unfruitful and resulted in either non - specific decomposition or the addition of the electrophile from the undesired -face ( presumably due to developing syn - pentane interactions of the electrophile with the angular vinyl group ) . ultimately , it was found that an aldol - cannizzaro sequence on the intermediate aldehyde , effected using koh and formaldehyde , furnishes a geminal bis - methylene diol which was functionalized as the bis - mesylate ( see 27 ) , where the c4 stereocenter is ablated . at this stage , in accord with the precedent of wiesner , alkylation of the carbamate nitrogen was accomplished with kotbu to forge the piperidine ring and reconstitute the c4 stereocenter ( see 27 ) . displacement of the remaining mesylate group with methoxide , reinstallation of the nitrogen protecting moc group ( which is partially cleaved during the methoxide displacement ) and removal of the mom group provides 28 . phenol 28 was advanced to an intermediate analogous to 21 ( 8 steps ) and then to liljestrandinine using a sequence analogous to that described for 23 2 ( 3 steps ; see the si for details ) . overall , the synthesis of liljestrandinine proceeds in 29 steps from diene 8 and dienophile 9 . the chemical syntheses of weisaconitine d and liljestrandinine described here rely on subsequent diastereoselective installation of all stereocenters from the four contiguous stereocenters that are introduced in the diels alder reaction between diene 8 and dienophile 9 . as such , a catalytic , enantioselective , diels alder cycloaddition would enable enantioselective access to the natural products . in this regard , initial attempts to render the cycloaddition between 8 and 9 enantioselective with the aid of chiral , non - racemic , lewis acid catalysts ( e.g. , using the method of mezzetti ) resulted in low enantioselectivity and non - specific decomposition ( primarily of diene 8 under the acidic conditions ) . ultimately , success was attained using 29 ( for which we have developed a new , scalable , synthesis ; see the si ) as a dienophile . this dienophile has enhanced reactivity because of an added intramolecular h - bond , as well as a more highly organized transition state ( see 30 for a model ) that places the enantio - discriminating substituents ( e.g. , the t - butyl group of the bis - oxazoline ligand ) proximal to the reacting dienophile double bond . in the event , a 68% yield of cycloadduct 31 ( 92% ee ; > 20:1 d.r . ; see cylview ) was obtained using the conditions described in figure 3b . furthermore , 31 is easily converted to 32 , which intercepts the racemic syntheses described in figures 2 and 3a . finally , our iterative application of corey s network analysis approach to initiating a strategy for the syntheses of weisaconitine d and liljestrandinine has inspired us to develop general ways to conduct such analyses . past implementations of network analysis in retrosynthesis , especially in the identification of the maximally bridged ring , have been carried out in a probabilistic manner , which invariably heightens the risk of errors . to overcome this shortcoming , we have developed a web - based deterministic graphing program that permits the identification of the maximally bridged ring ( or rings ) for any molecule using the chemistry development kit ( cdk ) software library ( see figure 4a for the output of a test set ; see the si for more details ) . the algorithm we have developed for this purpose is guaranteed to identify the maximally bridged ring each time it is run . the program allows control of several criteria ( e.g. , the number of atoms that comprise the maximally bridged ring or that span bridging atoms in the maximally bridged ring ) . the program outputs the maximally bridged ring or in the case of ties ( e.g. , for nominine and arcutinidine in figure 4a ) , all maximally bridged rings . while many considerations are taken into account in retrosynthetic analyses of topologically complex molecules , the role of network analysis can often unlock novel strategic disconnections . for example , consider the denudatine core ( figure 4b ) , which contains three rings that each possesses four bridgehead atoms . by focusing on these rings for disconnection , maximum retrosynthetic simplification ( i.e. , removal of bridging chains and fused rings ) is achieved in the least amount of steps with our approach ( see f ) . a retrosynthetic analysis of the aconite framework , informed by network analysis ( figure 4c ) suggests that disconnections represented by i would provide maximum simplification . these latter strategic disconnections , which guided our approach to the syntheses of weisaconitine d and liljestrandinine , also indicate that a direct bicyclization to construct the bicyclo[3.2.1 ] moiety would provide the maximum benefit . efforts to achieve this type of bicyclization are the subject of our ongoing studies . the creation of this web - based program should further facilitate the use of network analysis in developing retrosyntheses of other architecturally complex molecules and enable the identification of an efficient path to their syntheses . in sum , our preparation of the denudatine core and total syntheses of weisaconitine d and liljestrandinine presented herein reaffirm the utility of complex molecule synthesis as a driver for the implementation of chemical synthesis strategies that advance the field . our approach offers a plan for the synthesis of a subset of c-18 and c-19 diterpenoid alkaloids and sets the stage to access related secondary metabolites including those in the c-20 family . the web - based deterministic graphing program developed to analyze these topologically complex molecules , which builds on the work of corey , should find utility beyond this initial intent and may prove valuable in the analysis and synthesis of other architecturally challenging molecules ( http://www.cadrerl.com/maxbridge ) .

general strategies for the chemical synthesis of organic compounds , especially of architecturally complex natural products , are not easily identified . here , we present a method to establish a strategy for such syntheses , which begins with a process termed network analysis. this exercise , along with other considerations , has been used to identify a versatile synthetic intermediate that facilitated syntheses of the diterpenoid alkaloids weisaconitine d and liljestrandinine , as well as the core of gomandonine . the diterpenoid alkaloids comprise some of the most architecturally complex and functional group dense secondary metabolites ever isolated . for these reasons , they present a significant challenge for chemical synthesis . the synthesis approach described herein is a notable departure from other strategies adopted for the syntheses of related structures and affords not only the targeted natural products , but also intermediates and derivatives in the three subfamilies of diterpenoid alkaloids ( i.e. , c-18 , c-19 , and c-20 ) , providing the first unified synthetic strategy to these natural products . this work validates the utility of network analysis as a starting point for identifying strategies for the syntheses of architecturally complex secondary metabolites . an easily accessible web - based graphing program has been developed for this purpose .

Introduction Results and Discussion Network analysis as a starting point in retrosynthesis Syntheses of weisaconitine D and liljestrandinine An enantioselective Diels-Alder cycloaddition A web-based network analysis program Conclusion Supplementary Material

a series of experiments is described in which operant methodology is used to study the effects of drugs on " learning . " emphasis is placed on the technique of repeated acquisition as a behavioral baseline for studying this type of transition state . in this technique , each subject is required to learn a new discrimination each session . multiple - schedule procedures are also described in which acquisition is compared to a " performance " task , where the discrimination is the same each session . the learning baseline is more sensitive to the disruptive effects of a variety of drugs ( e.g. , cocaine , d - amphetamine , haloperidol ) than is the performance baseline . this general finding obtains across procedural variations and species ( pigeons and monkeys ) . the potential usefulness of these procedures for studying both acute and chronic behavioral toxicity is discussed.imagesfigure 8.figure 9 .

Images

there is a strong inverse relationship between plasma high density lipoprotein ( hdl ) level and the risk of developing coronary artery disease ( cad ) . the major role of hdl is the reverse cholesterol transport , which leads to cholesterol movement from peripheral tissue and vessel wall to the liver . anti - inflammatory , antioxidant , anticoagulant , and profibrinolytic actions of hdl are among other functions that may contribute further to its ability to protect against cad . hdl particles are heterogeneous in their composition , structure , and size . several methods such as immunoaffinity chromatography , ultracentrifugation . electron microscopy . and nuclear magnetic resonance ( nmr ) have been used to isolate and characterize hdl subfractions and at least five subfractions of hdl with sizes of 7.3 - 13 nm have been identified . one of the best known anti - inflammatory and antioxidant functions of hdl is its ability to inhibit the oxidation of low - density lipoprotein ( ldl ) . hdl exerts its inhibitory effects on oxidative modification of ldl , in part , by its related enzyme paraoxonase-1 ( pon1 ) which can hydrolyze lactones , and several non - physiological substrates , such as aryl esters and organophosphates . pon1 is transported in plasma as a component of hdl , and many studies have also shown that pon1 inhibits ldl oxidation in vitro . hdl facilitates the secretion of the pon1 by the liver , stabilizes the enzyme , and provides a hydrophobic environment which is needed for pon1 function . in return there is a wide inter - individual variation in pon1 activity and concentrations due to variation in pon1 gene , and also , because of the influences of lifestyle factors such as smoking , alcohol consumption , etc . a study of populations with high prevalence of atherosclerosis suggested that pon1 could influence hdl concentrations in patients with familial hypercholesterolemia . it has been demonstrated that pon1 is present in small dense subclasses of hdl particles including apolipoprotein a - i ( apo a - i ) and apolipoprotein j. investigations have also indicated that there is a relationship between pon1 activity and hdl size with cad risk . , the protective role of hdl against cad seems to be a complicated and multi - factorial procedure that depends on the hdl particle size , number , composition , distribution , and its related enzymes such as pon1 . the aim of this study was to investigate the associations between hdl mean particle size and serum pon1 activity in relation to serum hdl - c levels in healthy subjects . for this study , 140 healthy men between 20 and 50 years of age from isfahan area were recruited to isfahan cardiovascular research center between june and september 2010 . all subjects were healthy , non - smoking , non - obese [ body mass index ( bmi ) 30 ] , and non - diabetic [ fasting blood sugar ( fbs ) 110 mg / dl ] volunteers , without familiar hypercholesterolemia and any sign of cardiovascular or inflammatory diseases , and no one was taking lipid - modifying medication . all participants were interviewed and a checklist relating to their age , medical history , and lifestyle information was completed . all participants signed an informed consent document approved by the isfahan university of medical sciences medical ethics committee . this study was funded by grant number 188140 from isfahan university of medical sciences , isfahan , iran . weight was measured while subjects were minimally clothed without shoes and height was measured in a standing position . waist circumference ( wc ) was measured at the narrowest level and that of hip at the maximal level over light clothing , using a tape measure . waist hip ratio ( whr ) was calculated as wc divided by hip circumference . to avoid subjective error , blood samples ( 20 ml ) were collected by venopuncture after 12 - 14 h fasting . a 100 l aliquot of serum was stored at 80c until the measurement of serum pon1 activity . hdl - c and ldl - c were determined by direct enzymatic procedures ; fbs , total cholesterol ( tc ) , and triglyceride ( tg ) were measured by enzymatic methods ; and apo a - i and apolipoprotein b-100 ( apo b-100 ) were measured by immunoturbidometric methods using an automated analyzer ( hitachi 902 , kyoto , japan ) and commercial kits ( diasys diagnosis , holzheim , germany ) . pon1 activity was measured using 2 mm paraoxon ( diethyl p - nitrophenyl phosphate , sigma chemical co. , st . louis , mo , usa ) as the substrate in 100 mm tris buffer ( ph 8.0 ) containing 2 mm of cacl2 . aliquots of 40 l of serum were added to 500 l of substrate medium and the initial rate of hydrolysis ( generation of p - nitrophenol ) was monitored at 412 nm , using a continuously recording spectrophotometer ( uv 3100 , shimadzu , kyoto , japan ) over a period of 2 min . a pon1 activity of 1 unit / l was defined as 1 mol of p - nitrophenol formed per minute . the molar extinction coefficient of p - nitrophenol was taken at 17,000 m / cm . all assays were performed in duplicate at 25c . the within - assay coefficient of variation ( cv ) for 10 separate measurements was 2.9% and between - assay cv for 10 separate measurements during 20 days was 3.6% . for hdl separation ( 1.063 g / cm < < 1.21 g / cm ) , polyallomer ultracentrifuge tubes with 8.9-ml capacity ( optiseal , beckman / coulter , fullerton , ca , usa ) were first taken with 5.9 ml of serum sample and the sample was overlaid with 3 ml of solution a [ containing 0.195 mmol nacl , 0.62 mmol naoh , 0.01% ( w / v ) ethylenediaminetetraacetic acid disodium salt ( edta - na2 ) , d = 1.006 g / ml ] in order to make discontinuous density gradient . the tubes were centrifuged in a beckman coulter optima l-100 xp ultracentrifuge equipped with a type 90ti fixed angle rotor at 60,000 rpm for 6 h at 16c , acceleration:5 and deceleration:7 . after centrifugation , the very low density lipoprotein ( vldl ) fraction ( the white layer at the supernatant ) accompanied by 3 ml of the upper layer solution in tubes was removed and residual content of tubes was mixed with 3 ml of solution b ( containing 24.8 g nabr in 100 ml of solution a ) . the tubes were centrifuged at 60,000 rpm for 12 h at 16c , acceleration:9 and deceleration:7 . after centrifugation , the ldl fraction ( appearing as a yellow - orange band at the supernatant ) accompanied by 3 ml of the upper solution was removed . the residual content of tubes was mixed with 3 ml of solution c ( containing 78.32 g of nabr in 100 ml of solution a ) and centrifuged for another 12 h at 16c , acceleration:9 and deceleration:7 . after centrifugation , the hdl fraction appearing as a yellow band at the supernatant was collected carefully and stored at 80c until further analysis . the protein concentration of the hdl fractions was determined according to a modified lowry method . a zetasizer nano zs instrument ( malvern , worcestershire , uk ) with a 532-nm green laser beam was used for the study . the scattered light was collected by detector at an angle of 173 using non - invasive back - scatter ( nibs ) technology and directed to a correlator . the data were analyzed by zetasizer software ( dts , nano series , version 5.02 , malvern ) and size information was reported as the z - average by intensity . all measurements were performed at 25c in duplicate with automatic duration measurements . in order to determine the suitable solvent with the best reproducibility prior to commencing the measurements , six different solvents [ including distilled water , normal saline , and 0.2 m phosphate buffer containing 0.1% ( w / v ) edta - na2 at three different ph values of 5.6 , 7.4 , and 8.3 ] hourly measurements of size were made over a period of 5 h and the results were compared . consequently , 0.2 m phosphate buffer at ph of 7.4 containing 0.1% ( w / v ) edta - na2 was selected as the most repeatable dispersant with the lowest aggregation index . in order to measure hdl mean particle size by dynamic light scattering ( dls ) methodology , isolated hdl samples were mixed gently with 1 ml of dispersant ( at a final protein concentration of 250 g / ml ) and passed through a syringe filter ( millipore cellulose acetate membrane , 30 mm , 0.2 m pore size ) prior to injection into a disposable polystyrene cell ( malvern ) in order to remove dust particles and were then subjected to size determination . viscosity and refractive index ( ri ) of water as the dispersant were applied to standard operating protocol ( sop ) prior to size determination . the accuracy of size measurements was examined using standard size nanoparticles [ gold nanoparticles , 20 nm , 0.01% ( w / v ) aqueous solution , nanocs inc . , new york , ny , usa ] under the same experimental conditions and the results were matched with the diameter quoted by the manufacturer . the within - assay cv for 10 measurements was 1.2% and between - assay cv for 8 measurements was 3.1% . the detection limit of the assay for zetasizer instrument used in the present study was 0.3 nm to 10 m . in order to calculate the ratio of hdl2 to hdl3 , the accumulative percentage of particles with sizes larger than 8.2 nm was divided to the accumulative percentage of particles with sizes smaller than 8.2 nm . statistical analyses were performed using spss 16.0 ( spss , chicago , il , usa ) . before analyses , subjects were divided into three groups based on their serum hdl - c levels [ group 1 ( n = 49 ) : hdl 39 mg / dl ; group 2 ( n = 46 ) : 39 > hdl 49 mg / dl ; group 3 ( n = 45 ) : hdl > 49 mg / dl ] , and variables that were not normally distributed ( i.e. tg , apo a - i and apo b-100 ) were subjected to natural log transformation . quantitative parameters were compared between groups by analysis of variance ( anova ) except for pon1 and hdl2/hdl3 that were analyzed by a nonparametric kruskal - wallis test and data were expressed as means sd . spearman 's rho correlation coefficient analysis was used to calculate the correlation between variables that were not normally distributed ( i.e. serum pon1 activity ) . for this study , 140 healthy men between 20 and 50 years of age from isfahan area were recruited to isfahan cardiovascular research center between june and september 2010 . all subjects were healthy , non - smoking , non - obese [ body mass index ( bmi ) 30 ] , and non - diabetic [ fasting blood sugar ( fbs ) 110 mg / dl ] volunteers , without familiar hypercholesterolemia and any sign of cardiovascular or inflammatory diseases , and no one was taking lipid - modifying medication . all participants were interviewed and a checklist relating to their age , medical history , and lifestyle information was completed . all participants signed an informed consent document approved by the isfahan university of medical sciences medical ethics committee . this study was funded by grant number 188140 from isfahan university of medical sciences , isfahan , iran . weight was measured while subjects were minimally clothed without shoes and height was measured in a standing position . waist circumference ( wc ) was measured at the narrowest level and that of hip at the maximal level over light clothing , using a tape measure . waist hip ratio ( whr ) was calculated as wc divided by hip circumference . to avoid subjective error , blood samples ( 20 ml ) were collected by venopuncture after 12 - 14 h fasting . a 100 l aliquot of serum was stored at 80c until the measurement of serum pon1 activity . hdl - c and ldl - c were determined by direct enzymatic procedures ; fbs , total cholesterol ( tc ) , and triglyceride ( tg ) were measured by enzymatic methods ; and apo a - i and apolipoprotein b-100 ( apo b-100 ) were measured by immunoturbidometric methods using an automated analyzer ( hitachi 902 , kyoto , japan ) and commercial kits ( diasys diagnosis , holzheim , germany ) . pon1 activity was measured using 2 mm paraoxon ( diethyl p - nitrophenyl phosphate , sigma chemical co. , st . louis , mo , usa ) as the substrate in 100 mm tris buffer ( ph 8.0 ) containing 2 mm of cacl2 . aliquots of 40 l of serum were added to 500 l of substrate medium and the initial rate of hydrolysis ( generation of p - nitrophenol ) was monitored at 412 nm , using a continuously recording spectrophotometer ( uv 3100 , shimadzu , kyoto , japan ) over a period of 2 min . a pon1 activity of 1 unit / l was defined as 1 mol of p - nitrophenol formed per minute . the molar extinction coefficient of p - nitrophenol was taken at 17,000 m / cm . all assays were performed in duplicate at 25c . the within - assay coefficient of variation ( cv ) for 10 separate measurements was 2.9% and between - assay cv for 10 separate measurements during 20 days was 3.6% . for hdl separation ( 1.063 g / cm < < 1.21 g / cm ) , polyallomer ultracentrifuge tubes with 8.9-ml capacity ( optiseal , beckman / coulter , fullerton , ca , usa ) were first taken with 5.9 ml of serum sample and the sample was overlaid with 3 ml of solution a [ containing 0.195 mmol nacl , 0.62 mmol naoh , 0.01% ( w / v ) ethylenediaminetetraacetic acid disodium salt ( edta - na2 ) , d = 1.006 g / ml ] in order to make discontinuous density gradient . the tubes were centrifuged in a beckman coulter optima l-100 xp ultracentrifuge equipped with a type 90ti fixed angle rotor at 60,000 rpm for 6 h at 16c , acceleration:5 and deceleration:7 . after centrifugation , the very low density lipoprotein ( vldl ) fraction ( the white layer at the supernatant ) accompanied by 3 ml of the upper layer solution in tubes was removed and residual content of tubes was mixed with 3 ml of solution b ( containing 24.8 g nabr in 100 ml of solution a ) . the tubes were centrifuged at 60,000 rpm for 12 h at 16c , acceleration:9 and deceleration:7 . after centrifugation , the ldl fraction ( appearing as a yellow - orange band at the supernatant ) accompanied by 3 ml of the upper solution was removed . the residual content of tubes was mixed with 3 ml of solution c ( containing 78.32 g of nabr in 100 ml of solution a ) and centrifuged for another 12 h at 16c , acceleration:9 and deceleration:7 . after centrifugation , the hdl fraction appearing as a yellow band at the supernatant was collected carefully and stored at 80c until further analysis . the protein concentration of the hdl fractions was determined according to a modified lowry method . a zetasizer nano zs instrument ( malvern , worcestershire , uk ) with a 532-nm green laser beam was used for the study . the scattered light was collected by detector at an angle of 173 using non - invasive back - scatter ( nibs ) technology and directed to a correlator . the data were analyzed by zetasizer software ( dts , nano series , version 5.02 , malvern ) and size information was reported as the z - average by intensity . all measurements were performed at 25c in duplicate with automatic duration measurements . in order to determine the suitable solvent with the best reproducibility prior to commencing the measurements , six different solvents [ including distilled water , normal saline , and 0.2 m phosphate buffer containing 0.1% ( w / v ) edta - na2 at three different ph values of 5.6 , 7.4 , and 8.3 ] were used as the hdl dispersant . hourly measurements of size were made over a period of 5 h and the results were compared . consequently , 0.2 m phosphate buffer at ph of 7.4 containing 0.1% ( w / v ) edta - na2 was selected as the most repeatable dispersant with the lowest aggregation index . in order to measure hdl mean particle size by dynamic light scattering ( dls ) methodology , isolated hdl samples were mixed gently with 1 ml of dispersant ( at a final protein concentration of 250 g / ml ) and passed through a syringe filter ( millipore cellulose acetate membrane , 30 mm , 0.2 m pore size ) prior to injection into a disposable polystyrene cell ( malvern ) in order to remove dust particles and were then subjected to size determination . viscosity and refractive index ( ri ) of water as the dispersant were applied to standard operating protocol ( sop ) prior to size determination . the accuracy of size measurements was examined using standard size nanoparticles [ gold nanoparticles , 20 nm , 0.01% ( w / v ) aqueous solution , nanocs inc . , new york , ny , usa ] under the same experimental conditions and the results were matched with the diameter quoted by the manufacturer . the within - assay cv for 10 measurements was 1.2% and between - assay cv for 8 measurements was 3.1% . the detection limit of the assay for zetasizer instrument used in the present study was 0.3 nm to 10 m . in order to calculate the ratio of hdl2 to hdl3 , the accumulative percentage of particles with sizes larger than 8.2 nm was divided to the accumulative percentage of particles with sizes smaller than 8.2 nm . statistical analyses were performed using spss 16.0 ( spss , chicago , il , usa ) . before analyses , subjects were divided into three groups based on their serum hdl - c levels [ group 1 ( n = 49 ) : hdl 39 mg / dl ; group 2 ( n = 46 ) : 39 > hdl 49 mg / dl ; group 3 ( n = 45 ) : hdl > 49 mg / dl ] , and variables that were not normally distributed ( i.e. tg , apo a - i and apo b-100 ) were subjected to natural log transformation . quantitative parameters were compared between groups by analysis of variance ( anova ) except for pon1 and hdl2/hdl3 that were analyzed by a nonparametric kruskal - wallis test and data were expressed as means sd . spearman 's rho correlation coefficient analysis was used to calculate the correlation between variables that were not normally distributed ( i.e. serum pon1 activity ) . all subjects in the three groups were age matched . as seen in table 1 , the mean bmi value in group 3 subjects was lower compared with that in group 1 ( p = 0.002 ) . whr in groups 2 and 3 was lower compared with that in group 1 ( p < 0.05 and p = 0.001 , respectively ) . there was a significant difference in the mean tg values among the three groups ( groups 1 and 2 , p < 0.001 ; groups 2 and 3 , p = 0.002 ; and groups 1 and 3 , p < 0.001 ) , with group 3 having the lowest values . tc was higher in group 3 compared with those in groups 1 and 2 ( p = 0.003 and p = 0.002 , respectively ) . apo a - i was also significantly higher in groups 2 and 3 in parallel with the increasing serum hdl - c levels . the serum pon1 activity level was lower in group 3 compared with those in groups 2 and 1 ( p = 0.023 and p = 0.004 , respectively ) , whereas it was comparable in groups 1 and 2 . pon1 activity adjusted for the hdl level ( pon1/hdl - c ) was also significantly lower in group 3 compared with those in groups 1 and 2 of our study ( p < 0.001 ) and lower in group 2 compared with that in group 1 ( p = 0.01 ) . the mean hdl particle size and hdl2/hdl3 ratio was higher in the high hdl - c group compared with those in group 2 ( p = 0.003 and p = 0.001 , respectively ) and group 1 ( p < 0.001 and p < 0.001 , respectively ) . the hdl2/hdl3 ratio also correlated with hdl - c levels in groups 1 and 2 . there were no significant differences in blood pressure , fbs , ldl - c , and apo b-100 levels among the three groups . clinical characteristics of the study participants correlations between hdl - c , hdl mean particle size , hdl2/hdl3 ratio , and serum pon1 activity with anthropometric indices and clinical biomarkers are shown in table 2 . serum hdl - c levels were positively correlated with tc , apo a - i , and ldl - c levels , and were negatively correlated with bmi , whr , and tg ( p < 0.01 ) . hdl mean particle size and hdl2/hdl3 ratio were negatively correlated with bmi ( p < 0.01 ) , whr , and serum tg levels ( p < 0.05 and p < 0.01 , respectively ) , and were positively correlated with serum hdl - c levels ( p < 0.01 ) . results in table 2 also indicate a significant negative correlation between serum pon1 activity and serum hdl - c levels ( p < 0.01 ) and apo a - i ( p < 0.05 ) , and a significant positive correlation with whr ( p < 0.05 ) . bivariate correlations between clinical biomarkers and hdl mean size , hdl2/hdl2 ratio , and pon1 activity in all subject figure 1 shows individual correlations of serum pon1 activity with serum hdl - c level , hdl mean particle size , and hdl2/hdl3 ratio . as indicated , serum pon1 activity was negatively correlated with serum hdl - c level ( r = 0.25 , p = 0.003 ) , hdl mean particle size ( r = 0.22 , p 0.008 ) , and hdl2/hdl3 ratio ( r = 0.23 , p = 0.007 ) . there was also a strong positive correlation between serum hdl - c level and hdl mean particle size ( r = 0.45 , p < 0.001 ) [ figure 2 ] . correlations between serum pon1 activities with serum hdl - c levels , hdl mean particle size , and hdl2/hdl3 ratio correlations between hdl mean particle size and serum hdl - c levels the present study describes the correlation between hdl mean particle size and serum pon1 activity and their relationship with anthropometric indices and lipid profile in healthy male subjects . we found a significant negative correlation between serum pon1 activity and hdl mean particle size in all subjects . these findings are in accordance with kontush 's investigation which demonstrated that small hdl3 particles posse higher pon1 activity than large hdl2 particles . nishio 's investigation on the susceptibility of hdl subfractions to copper - mediated oxidation indicated that hdl2 is more susceptible to oxidation than hdl3 . it is conceivable that this protective effect is mediated by pon1 activity being higher in small hdl3 particles compared with large hdl2 particles . there is increasing evidence suggesting that pon1 makes a central contribution to the antioxidant capacity of hdl . however , hasselwander 's investigation has indicated that reduction in arylesterase activity of paraoxonase had no effect on the hdl ability to inhibit ldl oxidation in patients on regular hemodialysis . moreover , it has been demonstrated that hdl also exerts inhibitory effects on ldl oxidation , which are independent of paraoxonase activity . several independent studies have indicated that the concentration and activity of pon1 are decreased in cad patients . mackness et al . in a prospective study reported a reverse relationship between pon1 activity and cad risk in men , whereas in another prospective investigation on healthy middle - aged men , troughton et al . did not find any effect of pon1 paraoxonase activity on coronary heart disease ( chd ) outcomes . furthermore , van himbergen et al . have reported that in a general population of dutch women , increased pon1 paraoxonase activity was a risk factor for cardiovascular outcomes instead of being protective . our findings have indicated that serum pon1 activity in subjects with high hdl - c levels ( group 3 of our study ) is significantly decreased in comparison with subjects with medium and low hdl - c levels . this finding is in contradiction with a majority of investigations demonstrating that high pon1 levels and high pon1 activity contribute to increased levels of hdl - c . in many examples of hdl deficiency , such as tangier disease and fish eye disease , serum pon1 is significantly diminished , but in other hdl deficiencies , this is not always the case . blatter et al . have reported a positive correlation between pon1 activity and hdl - c levels in control subjects and cad patients . they also demonstrated a significant decrease in pon1 concentration and its arylesterase and paraoxonase activities in cad patients in comparison with control subjects . in addition , pon1 levels and activity could be modified by lifestyle determinants such as smoking , vitamin c and e consumption , and alcohol intake . the contribution of pon1 genotypes to hdl - c levels was described by van himbergen et al . who investigated on a population with familial hypercholesterolemia . they described that 55 l , 192 r , 107c , and 907 g variants of the l55 m , q192r , 107c / t , and 907 g / c polymorphisms predicted increased hdl - c levels . they also indicated that like the pon1 genotypes , pon1 levels and paraoxonase , diazoxonase , and arylesterase activities also contributed to increased hdl - c levels . in our study , a strong positive correlation was found between serum hdl - c levels with hdl mean particle size and hdl2/hdl3 ratio . a similar direct relationship between hdl particle size and serum hdl - c levels has been reported by others . decreased serum pon1 activity parallel to increased serum hdl - c levels observed in the present study may be a result of increased hdl particle size and the ratio of hdl2/hdl3 , and consequently , decrease in the small dense hdl particles . in other words , changes in hdl subspecies distribution could explain the reduced activity of serum pon1 . indicated that serum pon1 activity was decreased in chronic renal failure patients under maintenance hemodialysis . they explained that reduction in pon1 activity was the consequence of the change in hdl subspecies distribution . they found that the pon1 enzyme activity on hdl was almost totally expressed by the hdl3 subspecies fraction . the levels of small hdl3 b and hdl3 c ( 7.3 - 8.2 nm ) were directly correlated with cad severity , whereas the levels of intermediate hdl3 a and hdl2 a ( 8.2 - 10 nm ) and large hdl2 b ( 10 - 13 nm ) were inversely correlated with cad severity . small dense hdl3 has been shown to exert more powerful antioxidative , protective effects against ldl oxidation compared with the large hdl2 subfraction . as ox - ldl is the most atherogenic form of modified ldl , this protective role of hdl3 particles is very important . results of the anthropometric determinations in our study have indicated a reverse relationship between hdl mean particle size with bmi and whr and a direct relationship between pon1 activity and these anthropometric indices . because of the effects of female sex hormones such as estrogen and estradiol on lipid profile and pon1 activity and alterations of these hormones during menstrual cycles in women , in the present study we investigated only healthy male subjects ; our results need to be verified in women . it is also recommended to determine the relationship between hdl mean particle size and pon1 activity in cad patients in comparison with healthy subjects . in conclusion , our results indicate that there is negative correlation between hdl mean particle size and serum pon1 activity in healthy iranian male subjects . an inverse correlation also exists between hdl mean particle size and anthropometric indices , whereas plasma pon1 activity is directly correlated with them . considering the complicated role of hdl in cad prevention and its heterogeneous nature , further characterization of hdl subclasses , including particle size and its associated enzymes such as pon1 , may be helpful for better understanding of cad risks and prognosis and also may help to design therapeutic protocols toward beneficial modifications of hdl characteristics .

background : high density lipoprotein ( hdl ) particles are heterogeneous in composition , structure , size , and may differ in conferring protection against cardiovascular disease . hdl associated enzyme , paraoxonase-1 ( pon1 ) , has an important role in attenuation of atherogenic low density lipoprotein ( ldl ) oxidation . the aim of this study was to investigate the associations between hdl particle size and pon1 activity in relation to serum hdl cholesterol ( hdl - c ) levels.materials and methods : one hundred and forty healthy subjects contributed to this study . hdl was separated by sequential ultracentrifugation and its size was estimated by dynamic light scattering . paraoxonase activity was measured spectrophotometrically using paraoxon as substrate.results:results of this study showed that pon1 activity had negative correlations with hdl mean particle size ( r = 0.22 , p < 01 ) , hdl2/hdl3 ratio , and serum hdl - c levels ( r = 0.25 , p < 0.01 ) . hdl mean particle size and hdl2/hdl3 ratio had negative correlation with body mass index ( bmi ) , waist hip ratio ( whr ) , and serum triglyceride ( tg ) levels , and positive correlation with serum hdl - c levels . serum hdl - c levels had significant positive correlations with age , total cholesterol ( tc ) , and apolipoprotein a - i ( apo a - i ) and significant negative correlation with bmi , whr , and tg.conclusion:based on the results of this study , determination of hdl mean particle size beside the serum pon1 activity may help to better understand the cad risks , pathogenesis , and prognosis , and may also help to design therapeutic protocols toward beneficial modifications of hdl characteristics .

INTRODUCTION MATERIALS AND METHODS Subjects Anthropometric measurements Biochemical analysis Serum PON1 activity HDL separation HDL mean size determination HDL Statistical analysis RESULTS DISCUSSION CONCLUSION

tissue perfusion measurement from iodinated contrast agent enhancement on ct scans was first proposed by axel in 1980 ; this was based on earlier developments by meier and zierler for measuring blood flow and blood volume . at that time , the ct - based measurements were strictly limited to research because of the low speeds and narrow coverage of the existing ct scanners . however , the introduction of perfusion ct ( pct ) helped expand the utility of ct significantly since it could now provide capillary level hemodynamic information . within about a decade , perfusion imaging techniques were also adopted in mr [ 35 ] . with the advent of helical scanners and faster rotating gantries ( 0.330.5 s / rotation ) in conjunction with multidetector geometries which provide larger coverage , pct has now become part of the routine screening for many diseases . given the existing developments in perfusion imaging , the purpose of this paper is to focus on a detailed derivation of the theoretical model for deconvolution - based perfusion measurement . while the main equation of this model is well known , its derivation is spread over several publications . we therefore first present a summary of the derivation , with the aim of fully explaining the parameters and the underlying assumptions that are made . based on the main equation of the theoretical model , we also present a guideline for the algorithmic implementation of the deconvolution - based perfusion measurement . we discuss robust numerical deconvolution and discuss topics related to data pre - processing , providing references to the literature for each of the special topics . the overall aim of this paper is to provide an understanding of the underlying assumptions of the theoretical model and to show how the ( simplified ) model can be robustly implemented for clinical image analysis . perfusion imaging is most widely used in acute stroke and oncology . when used in diagnosis of stroke , the purpose of perfusion imaging is to identify the extent of affected tissue and to delineate the ischemic tissue that can be reperfused . in oncology , perfusion imaging helps to identify angiogenetic tumors that alter the local tissue perfusion due to generation of neovasculature . perfusion measurements are increasingly being used for assessment , staging , and monitoring posttherapy [ 6 , 7 ] . figure 1 shows common parameter maps based on a brain perfusion ct exam ( somatom definition as+ , siemens ag , healthcare sector , forchheim , germany ) of a 69-year - old male stroke patient . the patient presented to the hospital with an acute high - grade hemiparesis on the right side . the time - to - peak ( ttp ) image shows a large lesion that illustrates the maximum affected tissue . in addition , the cerebral blood flow ( cbf ) , cerebral blood volume ( cbv ) , and mean transit time ( mtt ) images exhibit perfusion deficits in a smaller brain territory . in general , these perfusion ct maps are interpreted appropriately in order to guide the recanalization procedure of the occluded vessel . blood flow is critical to the functionality of any organ since it provides the essential nutrients and oxygen . in case of flow disruption , the body autoregulates the flow and pressure either by altering blood flow or volume or both . in the brain , there are some fairly well - defined thresholds for the cerebral blood flow in normal , reversibly damaged , and necrotic tissue . the normal value for the cerebral blood flow is between 50 and 60 ml/100 g / min for grey matter . the average value decreases with age and is about 2 to 3 times lower in white matter compared to grey matter . any reduction in normal perfusion pressure results in vasodilation and hence an increase in blood volume and transit times . as the perfusion pressure falls lower , compensatory vasodilation is unable to offset the deficit . when this value falls below 20 ml/100 g / min ( for grey matter ) , synaptic transmission ceases to function . when the flow is below 810 ml/100 g / min , the cell membrane pumps fail , causing irreversible damage to the cells . in the acute stroke setting , conventional ct has been the imaging modality of choice for ruling out intracerebral hemorrhages ( ich ) . however , overall the sensitivity of ct for stroke detection is 6065% [ 10 , 11 ] . for ischemic stroke , which represents about 85% of all stroke cases , the inclusion of pct along with ct angiography ( cta ) can identify the subtle abnormalities in the cerebral tissue that can be missed on the noncontrast agent - enhanced scans . most commonly , the perfusion scan consists of imaging one or two slices at the level of the basal ganglia . this allows inclusion of the branches of the carotid artery that are typically thrombosed . after approximately 710 s following an intravenous injection of iodinated contrast agent , continuous scanning is performed for about 50 s. table toggling techniques are sometimes used to increase the coverage . the temporal scans are reconstructed and one of several approaches can be used to calculate the perfusion parameters . in animal studies , the product of ct cerebral blood volume ( cbv ) and flow ( cbf ) from ct measurements was found to have sensitivity of 90.6% and specificity of 93.3% ( compared with histological measurements ) for discerning ischemic and oligemic tissue . one study that compared stroke diagnosis using ct perfusion plus angiography , against mri , found good correlation and no significant prognosis differences . typical pct scans add approximately 5 or less additional minutes to the scan time with around a 50 ml bolus of additional iodinated contrast agent . with regards to the x - ray dose in pct , depending on the parameters , the effective dose is estimated to be between 1.2 msv and 3.4 msv . this is in the same range as the effective dose of a standard cerebral ct , which is reported to deliver about 2.5 msv to the patient . the gold standard for perfusion ct has been imaging with stable xenon as the contrast agent [ 7 , 15 ] . this method involves inhalation of a mixture of stable xenon gas and oxygen followed by ct scanning . because of the high atomic number of xenon , it serves as a radio - opaque contrast agent as it diffuses into the blood and neurons in a well - balanced manner . it has been proven to be accurate in quantifying perfusion by comparing the results with those obtained using radio - labeled microspheres . noncontrast agent - enhanced perfusion imaging usually uses spin labeling of blood entering the imaging volume . this method is less commonly used because of the increased sensitivity to motion and related artifacts and low signal in case of slow flow . gadolinium - based tracers such as gd - dtpa are more commonly used for measuring perfusion derived from changes in the local susceptibility . both spin echo ( se ) and gre sequences are most frequently used because they provide a better contrast - to - noise ratio for imaging of the contrast agent compared to se sequences [ 1719 ] . however , gre sequences have the disadvantage of disproportionately weighting the contribution of the contrast agent in relatively large vessels , whereas se sequences provide a more accurate assessment of blood flow through vessels of all sizes . after the 710 s interval that the gadolinium contrast agent takes to reach the brain following the intravenous injection , the signal in the cerebral tissue dips . the signal changes are most significant over about 15 s during which the change in t2 * or equivalently the change in the associated relaxation rate r2 * is monitored . note that this also requires that the contrast agent is intravascular . rapid imaging ( interval less than 2 s ) is required for accurate measurement of perfusion parameters . the aim of this section is to provide a compact outline of both some elementary as well as practically relevant theory of perfusion estimation based on previous work . in particular , we will introduce a theoretical physiological model of tissue perfusion for intravascular tracer systems and present the derivation of a deconvolution - based mathematical approach for the estimation of diagnostically important perfusion parameters . in addition , we will briefly describe alternative methods that do not require deconvolution . for computing the tissue perfusion , we assume a physiological model of the blood supply to the tissue . figure 2 shows this model that consists of a volume of interest vvoi covering the organ - specific parenchyma , the interstitial space , and the capillary bed . the volumes of the parenchyma and the interstitial space are denoted by vvoi * , while the volume of the capillary bed is referred to as vcap . the entire volume of interest vvoi = vvoi * + vcap shall be supplied with blood by a single arterial inlet and correspondingly drained by a single venous outlet . in general the transit time t it needs to pass through the capillary bed depends on the chosen path . once a contrast agent bolus has been injected , it enters the volume vvoi under consideration via the arterial inlet and is then diluted into the capillary bed . the local contrast agent concentrations cart(t ) and cven(t ) are measured directly adjacent to the capillary bed on the arterial and venous sides , respectively . furthermore , the average contrast agent concentration cvoi(t ) within the volume of interest can also be measured . in perfusion ct , an iodinated contrast agent is used whereas , in perfusion mr , the measured signal difference is created by a paramagnetic contrast agent based on gadolinium ( gd ) ( see section 2.2 ) . the contrast agent concentration is defined as mass of iodinated contrast agent per volume ( unit : g / ml ) or amount of gd - based contrast agent per volume ( unit : mol / ml ) , respectively . for the following analysis , we assume the contrast agent concentration to be measured as mass per volume , which can easily be related to amount per volume . figure 3 illustrates typical time - concentration curves cart(t ) , cvoi(t ) , and cven(t ) that may be measured in brain tissue , for example . for the sake of simplicity note that the ( average ) enhancement within the volume of interest is commonly more than an order of magnitude below the enhancements of the feeding artery and the draining vein . an additional important assumption is that the contrast agent remains in the intravascular space . for our case of cerebral perfusion , it should therefore not cross the blood - brain barrier ( bbb ) . as a consequence , this means that all contrast agents entering from the arterial inlet will eventually leave the volume of interest at the venous outlet . a breakdown of the bbb may occur in tumor patients , in stroke patients , and in patients that suffer from inflammations or infections , for example . in these cases , the methods presented in this paper may lead to inaccurate perfusion estimates and particularly to an overestimation of the blood volume [ 21 , 22 ] . note that there exist other modelling approaches which do not assume that the contrast agent remains in the intravascular space . these models can be used for measuring tumor perfusion , for example [ 6 , 20 , 23 ] . finally , we suppose that the contrast agent mixes perfectly with the blood and that the physical properties of the blood ( its flow behavior , in particular ) are not influenced by the contrast agent . as we will see , only knowledge of the functions cart(t ) and cvoi(t ) is needed to compute the blood flow within the volume under consideration . in practice , the function cart(t)also known as the arterial input function ( aif)is not measured directly at the respective volume of interest , but in a larger feeding artery in order to achieve a reasonable signal - to - noise ratio ( snr ) ( see section 4.1 ) . as a first diagnostically relevant perfusion parameter , the mean transit time ( mtt ) of the volume under consideration is defined as the first moment of the probability density function h(t ) of the transit times , that is , furthermore , the residue ( or residual ) function r(t)compare represents an intermediate quantity of interest and is defined as ( 2)r(t)={10th()d,for t0,0,for t<0 . the ( dimensionless ) residue function thus quantifies the relative amount of contrast agent that is still inside the volume vvoi of interest at time t after an ( idealized ) delta - shaped contrast agent bolus has entered the volume at the arterial inlet at time t = 0 ; that is , cart(t ) = (t ) . due to the various transit times within the capillary bed , the contrast agent will not leave the volume instantaneously , but gradually over time . in particular , this means that the residue function decreases continuously from r(0 ) = 1 to 0 . figure 4 shows typical examples of a distribution function h(t ) of transit times as well as the corresponding residue function r(t ) . in this example , the function h(t ) is modeled by a gamma distribution . using the parameters defined in table 1 , the accumulated masses of contrast agent that have entered and left the volume of interest during the time interval [ 0 , t ] , denoted as mc , voi , in(t ) and mc , voi , out(t ) , respectively , can be expressed as ( 3)mc , voi , in(t)=f0tcart()d,mc , voi , out(t)=f0tcven()d. the volume flow f is assumed to be constant over time . the contrast agent concentrations cart(t ) and cven(t ) at the arterial inlet and the venous outlet , respectively , are time - dependent functions which we assume to be 0 for t < 0 . these functions primarily depend on the parameters of the contrast agent injection and the patient 's cardiac cycle . we can compute the mass mc , voi(t ) of a contrast agent within the volume of interest at time t using the principle of conservation of mass as ( 4)mc , voi(t)=mc , voi , in(t)mc , voi , out(t)=f0t(cart()cven())d. the contrast agent concentration cven(t ) at the venous outlet can be computed from the contrast agent concentration cart(t ) at the arterial inlet by convolving it with the probability density function h(t ) . we therefore obtain ( 5)cven(t)=+cart()h(t)d. note that throughout this paper , all integrals with infinite integration endpoints shall be interpreted as the limit of the integral when the respective endpoint approaches . using ( 5 ) , we can rewrite ( 4 ) , by applying the delta function (t ) , as ( 6)mc , voi(t)=f0t(+cart()()d+cart()h()d)d. changing the order of integration and rearranging this equation leads to ( 7)mc , voi(t)=f+cart()(0t(()h())d)d. by applying the substitution = , recalling that , for t 0 , we have ( 8)r(t)=10th()d=0t(()h())d , and considering that h(t ) = 0 for t < 0 , we obtain ( 9)0t(()h())d = t(()h())d=r(t ) . equation ( 7 ) thus eventually reads ( 10)mc , voi(t)=f+cart()r(t)d. we introduce the cerebral blood flow ( cbf ) as the blood volume flow normalized by the mass of the volume vvoi , ( 11)cbf = fvvoivoi . inserting this definition into ( 10 ) yields ( 12)mc , voi(t)vvoi = cbfvoi+cart()r(t)d. according to table 1 , we define the contrast agent concentration cvoi(t ) within the volume vvoi of interest as ( 13)cvoi(t)=mc , voi(t)vvoi , which finally leads to the following formulation of the indicator - dilution theory , ( 14)cvoi(t)=cbfvoi+cart()r(t)d=cbfvoi(cartr)(t ) , where denotes the convolution operator as usual , see also [ 21 , 26 ] . a historical overview of the development of the indicator - dilution theory with numerous references to mathematical aspects can be found in . note that the solution of ( 14 ) with respect to cbf and other clinically important perfusion parameters will be discussed in section 3.3 . from a physiological point of view , it would be more meaningful to normalize cbf by the mass of the volume vvoi*. this volume vvoi * contains the mass of the parenchyma ( and the interstitium ) only . in that case , cbf would be a local measure for the blood volume flow per mass of parenchyma ( and interstitium ) that actually requires blood supply for oxygen and nutrient delivery . in ( 11 ) , however , the volume vvoi also contains the mass of the blood - filled capillary bed itself . another aspect to consider is that the mean density voi of the volume , which influences the cbf value , actually depends on the ( varying ) mass of the contrast agent in the capillary bed . the alternative definition of cbf , ( 15)cbf=fvvoivoi , would then lead to a corresponding alternative formulation of the indicator - dilution theory , ( 16)cvoi(t)=cbfvoi(cartr)(t ) . from a practical perspective , however , it is more convenient to use the definition of cbf given by ( 11 ) , see section 4.1 . the derivation of the indicator - dilution theory in this section was focused on brain perfusion imaging . this theoretical model can be used in stroke patients if the bbb is intact compare section 3.1but it is not suited for semi - permeable tumors , for example . with slight adaptations , this theoretical model can also be applied in other applications of perfusion imaging such as pulmonary perfusion imaging . see for detailed discussions . a discussion of models in hepatic and renal perfusion imaging is given in [ 29 , 30 ] , respectively . in the context of perfusion measurement , the term recirculation refers to the physiological phenomenon that , due to the patient 's cardiac activity , the contrast agent passes through the volume under consideration multiple times . it can easily be shown , however , that there is no need to correct for recirculation when deconvolution methods are applied to determine perfusion parameters . in ( 14 ) , the variables cart(t ) and cvoi(t ) can be measured and have known values whereas the values of cbf , r(t ) , and voi are unknown . in order to compute cbf as well as other diagnostically relevant tissue perfusion parameters , we first need to introduce an intermediate variable , the flow - scaled residue function k(t ) , ( 17)k(t)=cbfvoir(t ) , which is given in units of 1/s and can be determined directly from the measured data cart(t ) and cvoi(t ) . using ( 17 ) , ( 14 ) can be written as ( 18)cvoi(t)=(cartk)(t ) . hence , k(t ) can be obtained from the measured data cart(t ) and cvoi(t ) using a deconvolution method . since a fundamental property of the residue function r(t ) is r(0 ) = max ( r(t ) ) = 1 , we may then determine cbf as ( 19)cbf=1voimax ( k(t ) ) . using max ( k(t ) ) instead of k(0 ) has particular practical advantages that will be discussed in detail in section 4.1 . the flow - scaled residue function k(t ) can further be used to determine the mtt parameter of the tissue volume under consideration . from ( 2 ) , it follows that , for t > 0 , we have ( 20)dr(t)dt=h(t ) . equation ( 1 ) can thus be rewritten , and then using integration by parts and ( 17 ) and ( 19 ) , we obtain ( 21)mtt=0 ( dr()d)d=0r()dlim (r()|0)=0r()d=1max ( k())0k()d. note that we have assumed that there is a constant t > 0 such that r(t ) = 0 for t > t. this assumption ensures that ( 22)lim (r()|0)=lim (r())=0 . the cerebral blood volume ( cbv ) corresponding to the tissue volume vvoi represents another diagnostically relevant perfusion parameter and is defined as ( 23)cbv = vcapvoivvoi . it quantifies the blood volume normalized by the mass of vvoi and is typically measured in units of ml/100 g. the quantity cbv can be computed from the parameters cbf and mtt using the central volume theorem [ 22 , 26 ] , according to which ( 24)cbf = cbvmtt holds for the perfused volume of interest . interestingly , this theorem has been recognized for a long time and is already found in a historical publication from 1893 . it states that the perfusion parameters cbv and cbf corresponding to the volume vvoi of interest are related by the respective temporal parameter mtt that quantifies the mean time that a blood cell needs to pass through its capillary bed . with ( 19 ) and ( 21 ) , it follows from ( 24 ) that ( 25)cbv = mttcbf=1voi0k()d , which demonstrates that the cbv parameter can be derived from the flow - scaled residue function k(t ) as well . a healthy human brain exhibits a cbv of about 4 ml/100 g for grey matter and a cbv of about 2 ml/100 g for white matter . note that the definition of cbv that corresponds to the alternative definition of cbf in is ( 26)cbv=vcapvoivvoi. accordingly , this alternative definition relates the blood volume to the mass of the parenchyma ( and the interstitium ) only and explicitly omits the mass of the capillary bed itself . furthermore , there are references in the literature that suggest measuring the blood volume in units of ml / ml . this alternative dimensionless quantity may therefore be considered as a measure of blood ( or vascular ) volume fraction . when relating the volume vcap of the capillary bed to the entire volume vvoi of interest , a typical average ratio of about 4% will result for the human brain . we refer to for both technical and clinical details . for the sake of completeness , this section will briefly cover two alternative approaches for cbv and cbf estimation that are practical and relevant , and that do not involve deconvolution operations . nondeconvolution - based methods for estimating perfusion parameters are also referred to as direct measurement - based approaches . firstly , there is an alternative method to compute the blood volume of the tissue volume under consideration . this approach assumes that the average contrast agent concentration cvoi(t ) in the tissue volume can be related to the average contrast agent concentration ccap(t ) in the capillary bed by ( 27)cvoi(t)=(voicbv)ccap(t ) . according to the principle of conservation of mass , it follows that ( 28)mc , tot = f0cart()d=f0ccap()d=f0cven()d , where mc , tot is the total mass of contrast agent that has passed through the volume of interest . this results in an alternative expression for cbv , ( 29)cbv=1voi0cvoi()d0cart()d=1voi0cvoi()d0cven()d. hence , assuming a suitable correction for contrast agent recirculation [ 1 , 34 ] , cbv can be estimated from the integrals of either cvoi(t ) and cart(t ) or cvoi(t ) and cven(t ) over time . see for details and further references with a particular focus on mr perfusion measurements . it is argued in that , particularly for the case of ct perfusion imaging of the brain , a physiologically reasonable approximation to ( 29 ) is given by ( 30)cbv=[cvoi(t)]max [ cven(t)]max , which avoids the computation of the integrals over time and only requires the maximum values of cvoi(t ) and cven(t ) . secondly , there is a nondeconvolution - based approach to estimate the blood flow of the tissue volume under consideration ; the maximum slope method [ 22 , 34 ] . the derivation of this method is based on ( 4 ) and further assumes for simplicity 's sake that there is no venous outflow from the tissue volume under consideration during the time of observation ; that is , ( 31)mc , voi(t)=mc , voi , in(t)=f0tcart()d. recalling the cbf definition compare ( 11)and that mc , voi(t ) = cvoi(t ) vvoi , we obtain ( 32)cvoi(t)=voicbf0tcart()d. taking the derivative of ( 32 ) yields ( 33)dcvoi(t)dt=voicbfcart(t ) , and since ( 33 ) must hold for all t , the blood flow is given by ( 34)[dcvoi(t)dt]max = voicbf[cart(t)]max , which means that cbf can be estimated by dividing the maximum slope of the tissue time - concentration curve cvoi(t ) , shown as an example in figure 5 , by the maximum value of the contrast agent concentration cart(t ) in the feeding artery . an advantage of the maximum slope method is the shorter overall acquisition time . as a downside , however , it requires a faster contrast agent bolus injection rate in order to approximately fulfill the no - venous - outflow condition . a more comprehensive discussion of the maximum slope method and a comparison with the deconvolution method is presented in . according to , the clinical results based on these two approaches are generally of comparably high quality in ct imaging applications . however , in cases with insufficient data quality ( e.g. , in terms of noise , contrast agent concentration , bolus shape ) , deconvolution - based methods may lead to superior results . moreover , violation of the aforementioned no - venous - outflow condition may yield incorrect perfusion estimates when the maximum slope method is employed . this can happen for penumbral regions of the brain which characterize the tissue at risk after an ischemic stroke . besides the aforementioned quantities cbv , cbf , and mtt , there are additional perfusion parameters such as the time - to - peak ( ttp ) of the time - concentration curve , the maximum contrast agent concentration cmax , as well as the first moment ( fm ) of the time - concentration curve , for example . the first moment can be computed by projecting the centroid of the area under the curve ( auc ) of the time - concentration curve onto the time axis . the remaining parameter bolus arrival time ( bat ) will be explained in section 4.1 . in practical measurements , the time point t = 0 represents the start of the scanning . a detailed description and analysis of these additional quantities a comparison of several perfusion parameters and their clinical impact on the treatment of stroke patients is given in . in summary , table 2 covers the most common diagnostically relevant perfusion parameters and shows how they can be determined employing deconvolution - based and nondeconvolution - based methods . in principle , the central volume theorem compare ( 24)may also be used to numerically estimate the mtt from the parameters cbf and cbv when the latter have been computed using nondeconvolution - based algorithms . however , the authors are not aware of any reference that describes the application of this approach in clinical practice . this section is devoted to the practical computer implementation of algorithms for perfusion image analysis . first , we will discuss the necessary adaptations of the theoretical model from section 3 that are needed for its application to data from real ct and mr scanners . afterwards , we will describe commonly used algebraic deconvolution methods and also give an overview of alternative approaches . we will motivate the need for suitable regularization and discuss the influence of the regularization parameter on the resulting perfusion estimates . for the sake of completeness , we will also address techniques for the pre - processing of the acquired perfusion data . in section 3.1 we have assumed that we can measure the average contrast agent concentration cvoi(t ) corresponding to a volume vvoi under consideration which is supplied by one single capillary bed only . furthermore , we have supposed that we can measure the contrast agent concentration cart(t ) locally at the arterial inlet into the capillary bed . however , real ct and mr scanners are characterized by limited spatial ( and contrast ) resolution and , in reality , one can not rely on these two aforementioned assumptions . we will thus introduce two major adaptations of the physiological model which are necessary once it is to be applied to data from real scanners . first , during a standard ct and mr perfusion exam , a volume of interest is scanned and the data is reconstructed on a grid of regularly spaced voxels . in the object domain , each voxel volume vvox ( vvox vvoi ) contains numerous capillary beds as well as arterioles and venules that supply and drain these capillary beds , respectively . for the particular case when the volume vvox is located completely within a larger artery or vein , there are of course no capillary beds located within vvox . the measured signal ( x - ray attenuation or mr relaxation rate ) in a voxel is thus a combination of the signals from both the capillary beds as well as the arterial and venous vessels . the perfusion parameters that are computed from the voxel 's time - concentration curve are therefore not true parameters of the capillary perfusion . if no larger artery or vein is located inside the volume vvox , we may adapt the model introduced in section 3.1 as follows : the measured time - concentration curve cvoi(t ) refers to the average perfusion from the arterioles through the capillary beds to the venules found in vvox . , it is not possible to locally measure the concentration at the arterial inlet into the volume vvox . instead , it is common practice that a global arterial input function ( aif ) is chosen in a large arterial vessel . in brain perfusion imaging , for example this approach leads to a traveling time of the contrast agent bolus from where the aif is measured to the location of the tissue volume where cvoi(t ) is measured . it appears as a widening of the shape of the bolus that is caused during the flow from the remote aif location to the measurement site of cvoi(t ) . first , the curve cvoi(t ) does not start to rise at the same time point as cart(t ) starts to rise . the difference between these two time points can be defined as the bolus arrival time ( bat ) , which may be considered as an additional perfusion parameter . alternatively , the bat can be defined as the time interval between the start of the scanning and the time when cvoi(t ) begins to rise , see figure 5 . the results obtained with this alternative definition differ from the results obtained with the first definition by a constant value only . second , the flow - scaled residue function k(t ) is equal to 0 from t = 0 to t = bat . in addition , due to the bolus dispersion , k(t ) will not rise instantaneously to its maximum at t = bat , but it will have a finite rise time . the time - to - maximum ( tmax ) of the flow - scaled residue function , defined as ( 35)tmax = arg max t(k(t ) ) , has also been suggested as an additional perfusion parameter [ 41 , 42 ] . since the function k(t ) can be 0 at t = 0 ( due to bolus delay ) , it is reasonable and recommended to estimate cbf as the maximum of k(t)compare ( 19)and not as the value of k(t ) at time t = 0 . bolus delay and dispersion may lead to an underestimation of cbf . in order to correct for bolus delay and dispersion several methods the use of local arterial input functions could also reduce the effect of bolus dispersion , see section 4.5.6 . on the other hand , new perfusion parameters ( bat , tmax ) are motivated by these two effects and can be defined accordingly . they represent perfusion characteristics related to the flow of the contrast agent bolus from the selected feeding artery to the respective tissue site , see again figure 5 . in this section , we will discuss the robust numerical solution of the main equation of the indicator - dilution theory(18)by means of algebraic deconvolution methods . we will introduce the discretization of ( 18 ) and show that its solution without regularization leads to nonphysiological results . we will explain and motivate suitable regularization approaches by a singular value decomposition - based analysis . to illustrate the mathematical concepts , we will provide examples using the time - attenuation curves art(tj ) and voi(tj ) shown in figure 6 that were extracted from a real perfusion ct scan . we assume that the measured time - attenuation curves can be converted to time - concentration curves using a constant of proportionality of 1 g / ml / hu . details about the conversion , also discussing perfusion mr data , will be explained in section 4.5.4 . in practice , the time - concentration curves cart(t ) and cvoi(t ) are sampled at discrete time points . we denote these time points as tj = ( j 1 ) t with j = 1 , , n. a typical value of the sampling period t is 1 s , for example . we can discretize ( 18 ) as ( 36)cvoi(tj)=0cart()k(tj)dti=1ncart(ti)k(tji+1 ) , see . we assume that the values of cart(t ) can be neglected for t > nt . since k(t ) = 0 for t < 0 , the end summation index could also be set to j instead of n. by rewriting this expression using matrix - vector notation , we obtain ( 37)t(cart(t1)00cart(t2)cart(t1)0cart(tn)cart(tn1)cart(t1 ) ) ( k(t1)k(t2)k(tn ) ) = ( cvoi(t1)cvoi(t2)cvoi(tn ) ) , or shortly ( 38)ak = c , where t and cart(tj ) are contained in the matrix a , and k(tj ) and cvoi(tj ) represent the entries of the vectors k and c , respectively . for example , it was suggested in [ 47 , 48 ] to use a discretization method with a block - circulant matrix a in order to reduce the influence of the bolus delay . a standard approach to solve ( 37 ) for k is to use the singular value decomposition ( svd ) of a. for a matrix a with r = rank ( a ) linearly independent rows and columns , it is defined as ( 39)a = uvt=i=1ruiivit , where u = [ u1 , , ur ] and v = [ v1 , , vr ] are unique orthogonal matrices composed of the left and right singular vectors ui and vi , respectively . the number of rows and columns in a that only contain zeros is determined by the number nlz of leading zeros in the series cart(tj ) , j = 1 , , n. therefore , a has rank r n nlz . after the subtraction of the baseline , it may happen that the first entry cart(t1 ) is zero , see section 4.5.4 , and that a thus becomes rank - deficient . the diagonal matrix = diag ( 1 , , r ) contains the singular values i in nonincreasing order 1 2 r > 0 . the least - squares solution kls of ( 38 ) using the svd of a is given by ( 40)kls=i=1ruitcivi , see again . note that the unique vector kls is referred to as least - squares solution since determining it from ( 40 ) is equivalent to minimizing the squared euclidean residual norm of the linear systems given by ( 37 ) and ( 38 ) ; that is , ( 41)kls = arg min kn(||akc||22 ) . however , the least - square solution kls does not represent a suitable solution of ( 38 ) if the matrix a is ill - conditioned . it can be shown that a matrix a with a structure as shown in ( 37 ) or ( a.3 ) , also known as a toeplitz matrix , is in fact ill conditioned [ 50 , 51 ] . in that case , a small change in c ( e.g. , due to projection noise ) can cause a large change in kls . the rate at which a change in c influences the solution kls is roughly proportional to the condition number of a , defined as 1/r . as an example , figure 7 shows the solution kls of the example data from figure 6 . it is obvious that this solution has nothing in common with the real physiological behavior of the flow - scaled residue function . in order to get a better understanding of why kls is not a meaningful solution and to motivate the regularization approach we use the data shown in figure 6 to obtain a and c. figure 8 represents a plot of the absolute values of the expressions ( uic)/i that occur in ( 40 ) . these factors weight the right singular vectors vi of a. it is known from numerical analysis that the discrete picard condition represents a means to analyze discrete ill - conditioned problems [ 50 , 51 ] . this condition is violated , if the expressions uic do not decay faster , on average , than the singular values i until a threshold value is reached where the singular values level off . the reader is referred to for a more detailed explanation of the discrete picard condition and its relation to the picard condition from which it is derived . a usual reason for the violation of the discrete picard condition is noise in the measured data that the matrix a is based on . we can see that the discrete picard condition is actually violated in the example shown in figure 8 . consequently , the absolute values of the ratios ( uic)/i which represent the weighting factors of the right singular vectors vi become very large . to obtain a numerically stable result , the filter should suppress the influences of small singular values i or , equivalently , the influences of high absolute values of the weighting factors ( uic)/i . the regularized solution k , where is a regularization parameter , is given by ( 42)k=i=1r(f,iuitci)vi . firstly , the filter factors f,i correspond to the truncated singular value decomposition ( tsvd ) approach and are defined with a sharp threshold at , ( 43)f,i ( tsvd)={0,for i<,1,for i. secondly , the filter factors f,i are based on the tikhonov regularization approach and characterized by a smooth weighting function centered around , ( 44)f,i ( tikh)=i2i2+2 . the ( absolute ) regularization parameter is usually computed relative to the maximum singular value 1 , that is , ( 45)=rel 1 . the relative regularization parameter rel is supposed to lie in the interval between 0 and 1 . in order to illustrate the tikhonov filter factors , figure 9 shows a plot of the function f = /( + ) which is unlike ( 44)defined for a continuous range of . for determining f , we assumed 1 = 1 . it can be seen that , for increasing ( i.e. , stronger regularization ) , the values of f decrease for all . interestingly , the solution k of ( 38 ) using the filter factors f,i is equivalent to minimizing the weighted sum of the squared euclidean residual norm ||ak c||2 and the squared euclidean solution norm ||k||2 ; that is , ( 46)k(tikh)=arg min kn(||akc||22+2||k||22 ) . the solution for rel = 0.3 can in fact be interpreted as a flow - scaled residue function in the presence of bolus delay and dispersion , compare section 4.1 . figure 10(b ) illustrates a plot of max ( k ) , which is proportional to cbf ( see section 3.3 and table 2 ) , as a function of rel . apparently , cbf depends on the choice of regularization parameter . choosing an optimal regularization parameter that will lead to physiologically reasonable estimates will be discussed in section 4.4 . the algebraic deconvolution approach from section 4.2 is very commonly applied to analyze perfusion data . yet , deconvolution problems arise in many other applications , and numerous alternative algorithms to solve these problems have been developed . in this section , we provide a brief overview of alternative deconvolution approaches that have also been applied to perfusion data . the fourier transform represents a standard method to solve deconvolution problems , and it has also been evaluated to analyze perfusion data [ 45 , 5557 ] . interestingly , the fourier transform - based deconvolution approach is mathematically equivalent to the svd - based deconvolution approach with a block - circulant matrix a , compare the appendix [ 47 , 5860 ] . however , results obtained with svd - based and ft - based deconvolution can be different because the chosen regularization approaches for these two methods are usually not equivalent . the regularization in the context of the fourier - based deconvolution approach can be implemented by means of a modified wiener filter , for example . the reader is referred to [ 60 , 61 ] for a detailed analysis of the equivalence of svd - based and fourier - based regularization approaches . in contrast to the model - independent deconvolution approaches also model - dependent approaches exist . for example , in [ 45 , 62 ] a decaying exponential function was used which makes the deconvolution more stable since it reduces the degrees of freedom of the residue function . however , if the underlaying residue function is different from the model the perfusion parameters may not be estimated correctly . an iterative deconvolution algorithm based on maximum likelihood expectation maximization ( ml - em ) algorithm was proposed in . the svd - based deconvolution approach , which is available in several software packages [ 6769 ] , is comparably simple to implement and can be considered as the current standard method in perfusion image analysis . figure 10(b ) demonstrated that ( the maximum of ) the solution k depends on the regularization parameter rel . consequently , the computed perfusion values which can be derived from k according to table 2vary for different rel . as an example , the cbf value will be underestimated systematically for large rel . this approach is often used in practice , and a typical value in brain perfusion ct is , for example , rel = 0.2 . however , there exist more sophisticated approaches as well to determine the values rel independently for each voxel position . since the required amount of regularization depends roughly on the signal - to - noise ratio ( snr ) , these approaches can be more flexible when the snr is spatially variant . in [ 45 , 47 , 48 ] , an oscillation index ( oi ) was defined to determine the intensity of oscillations of the flow - scaled residue function . the regularization can then be varied until the oi value falls below a certain threshold . the l - curve criterion represents a model - independent method to determine ( and rel ) [ 31 , 71 , 72 ] . the l - curve is defined by a double logarithmic plot of the squared euclidean norm ||k||2 of the solution versus the squared euclidean norm ||ak the optimal regularization parameter opt can be found at the location of the characteristic corner point of the l - curve . another method to determine an appropriate regularization parameter is generalized cross - validation as described in [ 50 , 73 ] . an implementation of the l - curve method and the generalized cross - validation can be found in . furthermore , a parameter estimation method that uses a priori knowledge of the behavior of the residue function was proposed in . reported that two manufacturers applied a fixed threshold value rel in their perfusion analysis software . unfortunately , the clinical use of methods with adaptive threshold values is rarely described in the current literature . this section gives an overview of pre - processing techniques that can be applied in order to enhance the quality of the estimated perfusion parameters . pre - processing occurs prior to the deconvolution step which may be implemented as described in section 4.2 . a simple , yet mandatory , pre - processing step consists of the conversion to contrast agent concentration values , see section 4.5.4 . further pre - processing steps are used to enhance the image quality ( e.g. , noise reduction ) and to correct for artifacts ( e.g. , motion correction , partial volume correction ) and specific properties of the blood ( e.g. , correction of differences in hematocrit ) . there are also pre - processing steps that can optimize the analysis of the perfusion value maps ( e.g. , segmentation of certain anatomic structures ) and the application workflow ( e.g. , automated aif estimation ) . the order of the pre - processing steps presented in this section can act as a guideline for their practical implementation . finally , this overview can not include all details regarding suitable pre - processing steps . patient motion ( e.g. , due to head movement or breathing ) can result in a sudden change of the attenuation values at the fixed ( stationary ) voxel positions . since this change in the attenuation value is caused by motion and not by contrast agent flow , the computed perfusion values can be severely biased . a practical approach for motion correction is to register all time frames of the reconstructed data set onto the first time frame . a 3d registration should be used because it can also correct motion that occurs perpendicular to the orientation of the reconstructed slices . conversely , in abdominal perfusion imaging , a non - rigid registration may be better suited to compensate for the deformations due to breathing . as an alternative to registration , use of groupwise motion correction based on an optimization of a global cost function has been suggested . these approaches may be used for perfusion mr data as well since both types of data typically consist of t2 * -weighted epi images . however , the dynamic signal changes are relatively higher in dsc - mr data when compared to fmri data in particular during the contrast agent bolus passage which must be taken into account when adapting fmri - based motion correction algorithms to dsc - mr data . a related issue is streak artifact in reconstructed perfusion ct images that are caused by patient motion that occurs while the projection data corresponding to a single time frame is acquired . in perfusion mr images , ghosting artifacts can arise if the patient moves during the data acquisition . these kinds of artifact can not be corrected by inter - frame motion correction . instead , dedicated reconstruction algorithms would be required . as a practical alternative , time frames that exhibit severe reconstruction artifacts may simply be removed from the data set ( i.e. , from the series of successive time frames ) , which corresponds to the elimination of invalid sampling points of the voxel - specific time - concentration curves . in the course of a perfusion exam , the measured signal in tissue that is caused by the contrast agent flow can be very low . for the case of perfusion ct , for example , tissue enhancements of less than 10 hu are measured . hence , noise in the reconstructed images can be of a similar order of magnitude as the signal in tissue itself . consequently , noise reduction should be taken into consideration in order to improve the accuracy of the estimated perfusion parameters . noise reduction can be implemented as a spatial smoothing of the data . using a basic approach , each time frame can be filtered independently of the other time frames , and linear isotropic filters ( e.g. , based on a gaussian filter kernel ) may be applied . alternatively , anisotropic filters that preserve edges and avoid blurring of large vessels can also be employed . both linear and nonlinear filtering in the temporal dimension that is , between successive time frames represent further methods for noise reduction . it should be noted , however , that the regularization during the deconvolution step is equivalent to linear filtering in the temporal domain . recently , sophisticated 4d filtering techniques have been proposed that perform filtering in both the spatial and the temporal dimension and that are optimized for perfusion data [ 81 , 82 ] . fitting of the time - concentration curves to a model function such as a gamma - variate function is also a means for noise reduction . a segmentation of certain anatomic structures in the reconstructed data set can optimize the perfusion image analysis [ 69 , 83 ] . for example , the time - concentration curves could then be analyzed only in regions of interest where blood flow is actually expected . other regions such as air , bone , cerebrospinal fluid ( csf ) , and calcifications can be neglected . a segmentation and the subsequent removal of vessels is useful in order to optimize the quantitative analysis of perfusion parameters in tissue . such a vessel segmentation can be performed prior to the deconvolution step , but it can also be implemented as a postprocessing step as described in . neither for the case of ct imaging nor for the case of mr imaging can the time - concentration curves cart(t ) and cvoi(t ) be measured directly . instead , the measurement is a superposition of the signal from the tissue itself and the contrast agent . since the deconvolution approach presented in section 4.2 expects that the functions cart(tj ) and cvoi(tj ) only refer to the signal caused by the contrast agent , furthermore , the measured signal must be converted to a contrast agent concentration value . in perfusion ct , it is assumed that the ( underlying ) contrast agent concentration value is proportional to the ( measured ) x - ray attenuation value [ 86 , 87 ] . since deconvolution is a linear operation , the constant of proportionality does not influence the computed flow - scaled residue function . it can also be seen that the additional perfusion parameters from section 3.5 are independent of this constant . therefore , this constant is usually set to kct = 1 g / ml / hu for the sake of simplicity . the baseline value 0 can be computed as the mean of (tj ) during the b acquired time frames before the contrast agent bolus arrives in the arterial input function . the conversion formula from an attenuation value (tj ) ( corresponding to a particular voxel ) into the respective contrast agent concentration value c(tj ) then reads as ( 47)c(tj)=kct((tj+b1)0),0=1b i=1b (ti ) . in perfusion mr , however , the contrast agent concentration value is not proportional to the received signal s(tj ) ( in one voxel ) . instead , it can be determined using the following formula : ( 48)c(tj)=kmrteln ( s(tj+b1)s0),s0=1b i=1b s(ti ) , see . here , kmr is a constant of proportionality which with a similar argument as for kct can have a norm of 1 and te is the echo time of the mr sequence . it must be noted , however , that the constant kmr can be different for blood and tissue due to differences in t2 * relaxivities [ 37 , 88 ] . furthermore , studies have shown that fully oxygenated blood , for example , demonstrates a nonlinear relationship between the measured difference in t2 * relaxation rate and contrast agent concentration . note that if only one time frame is considered as the baseline ( i.e. , if b = 1 ) , then c(0 ) = 0 , and the matrix a defined by ( 37 ) and ( 38 ) will be rank deficient , compare section 4.2 . hematocrit ( hct ) is a value that describes the proportion of the blood that consists of red blood cells . consequently , the proportion of the plasma in the blood , given by the difference ( 1-hct ) , has a higher value in capillaries than in arteries . since the contrast agent is distributed in the plasma only , the amount of plasma has a direct influence on the measured hounsfield value or mr relaxation rate . if the hct difference is not corrected , it may bias the absolute quantification of the contrast agent concentration . a constant dimensionless correction factor , derived from the known hct values in arteries and capillaries ( often set to = 0.73 ) has been proposed [ 22 , 85 ] . the measured time - concentration curve cvoi(t ) is then multiplied with to avoid the bias due to different hct values . the total time for the perfusion image analysis can be shortened and the analysis can be made user independent by an automated estimation of the arterial input function . an interesting alternative approach is to estimate several local aifs , which would be better suited to the theoretical model that was introduced in section 3 [ 9496 ] . for example , partial volume effects compare section 4.5.7can be more severe when compared to choosing one global aif in a larger vessel . perfusion analysis using local aifs is actually investigated in and the authors state that it produced more useful cbf maps . besides the arterial input function cart(t ) knowledge about the venous outflow function could be used to automatically correct for partial volume effects which are described next . due to limited spatial resolution in reconstructed perfusion ct and mr data , this effect can lead to an underestimation of the aif and consequently to incorrect perfusion values . to correct for partial volume effects in the aif , commonly , the peak concentration value within a larger venous vessel or the area under the curve of a large venous vessel is used to rescale the aif . we have presented an overview of algorithms for the estimation of the most prominent perfusion parameters from ct or mr measurements that play an essential role in the assessment of flow altering diseases such as stroke , for example . in particular , we have emphasized the class of deconvolution - based methods that result from the application of the indicator - dilution theory , which is also derived in detail . the robust numerical solution of the resulting system of linear equations represents the second major topic of this paper . we have included a detailed discussion regarding the application of the singular value decomposition method as well as the practically relevant introduction of a suitable regularization technique in order to avoid physiologically unrealistic behavior of the estimated solution . since this paper is intended to provide an introduction both to the underlying theory and to implementation - relevant aspects , we have provided a survey of preprocessing techniques that should be considered when designing a clinically useful tool for ct or mr perfusion analysis . the novel contribution of this paper is to present the fundamental model , the mathematical deconvolution with regularization , and the practical pre - processing steps in one place . for a thorough understanding of perfusion image analysis , knowledge of all of these aspects is important and we have elaborated several links between these topics .

deconvolution - based analysis of ct and mr brain perfusion data is widely used in clinical practice and it is still a topic of ongoing research activities . in this paper , we present a comprehensive derivation and explanation of the underlying physiological model for intravascular tracer systems . we also discuss practical details that are needed to properly implement algorithms for perfusion analysis . our description of the practical computer implementation is focused on the most frequently employed algebraic deconvolution methods based on the singular value decomposition . in particular , we further discuss the need for regularization in order to obtain physiologically reasonable results . we include an overview of relevant preprocessing steps and provide numerous references to the literature . we cover both ct and mr brain perfusion imaging in this paper because they share many common aspects . the combination of both the theoretical as well as the practical aspects of perfusion analysis explicitly emphasizes the simplifications to the underlying physiological model that are necessary in order to apply it to measured data acquired with current ct and mr scanners .

1. Introduction 2. Clinical Applications of Perfusion Imaging 3. Theoretical Model 4. Practical Implementation 5. Summary

fake drugs and active pharmaceutical ingredients most often originate in evolving industrial economies especially developing countries before entering the global market . trafficking in counterfeit drugs has become one of the fastest growing immoral businesses . improved technological capabilities have enabled counterfeiters to produce packaging that looks good enough to deceive legitimate wholesalers and retailers . world health organization ( who ) defines a counterfeit drug as one that is deliberately and fraudulently mislabeled with respect to identity and/or source . counterfeiting can apply to both branded and generic products , and counterfeit products may include products with the correct ingredients or with the wrong ingredients , without active ingredients , with insufficient active ingredients , or with fake packaging . who defines a substandard drug as one which does not intentionally have incorrect packaging , but may have the incorrect quantity or ratio of ingredients . counterfeiting of drugs as a problem was first alluded at the who conference of experts on the rational use of the drugs held in nairobi in 1985 . today , the manufacturing of substandard and fake drugs is an extensive and under - reported problem . describing the extent of counterfeiting is difficult as the variety of information sources makes compiling statistics a difficult task ; however , the most important sources of data on counterfeits are who and international medical products anti - counterfeiting taskforce ( impact ) as the who 's organization for the fight against counterfeit drugs . the estimates given by impact differentiate between developed countries , where less than 1% of the drugs sold are counterfeit , and some less - developed countries where the number is around 10% . for some of these countries in parts of asia , the estimates go further up above 30% . a much higher prevalence can be found for drugs bought from illicit internet pharmacies , where up to 50% of the sold medicines are assumed to be fakes even in developed countries . a survey on the extent of counterfeit medicines in india was carried out by sear pharma forum in association with searo , who in 2007 , which stated the extent of counterfeit suspects was around 3.1% . government and health care workers jointly have an obligation to provide the society with solutions to the problems of counterfeit medicine . health care workers are not only the most important source of information about proper pharmacotherapy , but also play a crucial role in detecting and preventing the distribution of counterfeit medicine . thus , the present study was conducted to assess the knowledge , attitude , and practice of doctors and medical storekeepers regarding counterfeit medication in western india . the present study was a descriptive , cross - sectional , questionnaire study conducted in september 2014 . the questionnaire for doctors consisted of 12 close - ended questions and the one for medical storekeepers had 13 questions ( 12 close - ended and 1 open - ended questions ) . the initial set of questions was designed to assess the knowledge of the participants , the next set to assess their attitude , and the last set was designed to assess their practice regarding counterfeit medication . the questionnaire was designed to be completed in approximately 5 min . prior to being finalized , the questionnaire was pilot - tested on a group of 30 dental practitioners and 30 medical wholesale distributors to ensure its clarity and validity . ethical clearance was obtained from the institutional review board and a verbal consent was obtained from all the participants . all registered doctors and medical storekeepers who agreed to fill the questionnaire were included in the study . a list of all registered medical and dental practitioners ( up to 20132014 ) was obtained from their respective associations . there were a total of 3567 medical practitioners and 590 dental practitioners in jaipur city . hundred members from each group were included in the study through simple random sampling . for medical wholesale distributors , 100 medical stores were randomly identified in different areas of the city and the head of the store was asked to fill the questionnaire . analyzing the results of the participants for the knowledge , attitude , and practice questions , scores of 1 and zero the differences among participants based on their age , years of professional life , years of any institutional attachment , and qualification were analyzed using analysis of variance ( anova ) test and anova with post - hoc test . a list of all registered medical and dental practitioners ( up to 20132014 ) was obtained from their respective associations . there were a total of 3567 medical practitioners and 590 dental practitioners in jaipur city . hundred members from each group were included in the study through simple random sampling . for medical wholesale distributors , 100 medical stores were randomly identified in different areas of the city and the head of the store was asked to fill the questionnaire . analyzing the results of the participants for the knowledge , attitude , and practice questions , scores of 1 and zero were assigned to true and false answers , respectively . the differences among participants based on their age , years of professional life , years of any institutional attachment , and qualification were analyzed using analysis of variance ( anova ) test and anova with post - hoc test . in the present study , a total of 300 participants which included 100 dental practitioners , 100 medical practitioners , and 100 medical wholesale distributors were surveyed . the data concerning knowledge about counterfeit drugs showed that only 22% of the participants knew about counterfeit drugs . seventy - one percent of the participants believed that unregistered pharmacies are the most common source of procuring these drugs . thirty - six percent of the participants stated that they can not distinguish between genuine and fake drugs . around sixty - six percent of the participants eighty - one percent of the participants stated that they warn the patients about not to buy medicines from unknown sources , which reflects their practice behaviors . knowledge , attitude , and practice of the participants were compared with their qualification , age , work experience , and their place of practice . figure 1 depicts the comparison of knowledge , attitude and practice of all the participants . socio - demographic background of the participants comparison of knowledge , attitude , and practice of participants with age , work experience , and place of practice comparison of knowledge , attitude , and practice among the participants . the present study reveals that knowledge about counterfeit medicines was less among the study participants when compared to a study conducted by khan et al . in 2011 , which reflects the need to increase the awareness about counterfeit medicines . the results of the present study were in contrast with the results of a study conducted by shahverdi et al . in 2012 in which majority of the participants had the knowledge about distinguishing original and counterfeit medicines . on comparison this can be attributed to the fact that dental practitioners are limited to prescribing only a handful number of drugs in their daily practice compared to medical practitioners , which reduces their awareness about these medicines . the present study also revealed that none of the medical storekeepers had knowledge about the drug testing laboratories in india and also did not have an authorized degree , which might be a reason for their lesser awareness about the counterfeit drugs . drug control department , together with the government should implement strict laws and carry out inspections to protect the supply of pharmaceutical products from the intrusion of counterfeit medicines . online availability and shopping is the most common source of counterfeit medicines , but majority of the participants in the present study had no information about purchasing of these medicines online . this is in agreement with the study conducted by binkowska - bury et al . in 2008 - 2009 . if this lack of awareness continues in future , it will contribute toward an increase of counterfeit medicine trade in the city . therefore , the phenomenon of counterfeit medicine should be inculcated in educational programs aimed at health care workers . adequate training by the government as well as by the relevant agencies in detection of counterfeit drugs should be implemented in practice . in affirmation with the study by shahverdi et al . in 2012 , this can be attributed to the fact that as an individual grows older , he becomes more responsible for the society and becomes ethically stronger . on comparing the attitude , the present study showed that dental practitioners had a better attitude toward counterfeit medicines and least scores were shown by the medical storekeepers . medical storekeepers are less aware of the threats posed by counterfeit medicines to patients health as compared to the doctors , which can be thought as the reason as to why they preferred the use of counterfeit drugs in cases of shortage which was asked to them in the questionnaire . in these situations , there is an intense need to orient and sensitize storekeepers to the issues of counterfeit medicines . the present study also showed a close relationship between good practice and increase in age and work experience , which was in contrast to the study conducted by shahverdi et al . in 2012 . medical storekeepers were found to exhibit best practice behaviors among the study participants and the worst behavior was shown by dental practitioners in the present study . this can be due to the fact that medical storekeepers are more aware and are in contact with the drug authorities which makes it more feasible for them to report of any encounters with counterfeit drugs . if this lack of awareness about the drug regulatory authorities continues in the future among doctors , it will contribute toward an increase of counterfeit medicines in the city . anti - counterfeit measures need to be incorporated into a set of guidelines to be developed for the doctors and medical storekeepers . majority of the participants in the present study warned the patients about not to purchase medicines from an unknown source , which was in contrast to the results of a study conducted in 2008 - 2009 by binkowska - bury et al . , though the present study was in affirmation with its finding that majority of the participants did not know the procedure for reporting about suspicious medicines . these findings suggest that there is a great need for training doctors and medical storekeepers in the field of counterfeit . it can be understood that because of market competition , storekeepers try to find shortcuts to avoid taxes and make quick money . in this vicious circle , even the doctors are involved in getting commissions or favors such as free holiday trips from illegal sources to bring their medicines in the supply chain . this chain needs to be broken by strict vigilance by the drug control department . unless this chain is broken , the poor patients who tend to buy these spurious medicines at low cost not only suffer from health losses but also are at long - term financial loss . the present study reveals that knowledge about counterfeit medicines was less among the study participants when compared to a study conducted by khan et al . in 2011 , which reflects the need to increase the awareness about counterfeit medicines . the results of the present study were in contrast with the results of a study conducted by shahverdi et al . in 2012 in which majority of the participants had the knowledge about distinguishing original and counterfeit medicines . on comparison this can be attributed to the fact that dental practitioners are limited to prescribing only a handful number of drugs in their daily practice compared to medical practitioners , which reduces their awareness about these medicines . the present study also revealed that none of the medical storekeepers had knowledge about the drug testing laboratories in india and also did not have an authorized degree , which might be a reason for their lesser awareness about the counterfeit drugs . drug control department , together with the government should implement strict laws and carry out inspections to protect the supply of pharmaceutical products from the intrusion of counterfeit medicines . online availability and shopping is the most common source of counterfeit medicines , but majority of the participants in the present study had no information about purchasing of these medicines online . this is in agreement with the study conducted by binkowska - bury et al . in 2008 - 2009 . if this lack of awareness continues in future , it will contribute toward an increase of counterfeit medicine trade in the city . therefore , the phenomenon of counterfeit medicine should be inculcated in educational programs aimed at health care workers . adequate training by the government as well as by the relevant agencies in detection of counterfeit drugs should be implemented in practice . in affirmation with the study by shahverdi et al . in 2012 , the present study showed that increasing age resulted in improvement of the attitude . this can be attributed to the fact that as an individual grows older , he becomes more responsible for the society and becomes ethically stronger . on comparing the attitude , the present study showed that dental practitioners had a better attitude toward counterfeit medicines and least scores were shown by the medical storekeepers . medical storekeepers are less aware of the threats posed by counterfeit medicines to patients health as compared to the doctors , which can be thought as the reason as to why they preferred the use of counterfeit drugs in cases of shortage which was asked to them in the questionnaire . in these situations , there is an intense need to orient and sensitize storekeepers to the issues of counterfeit medicines . the present study also showed a close relationship between good practice and increase in age and work experience , which was in contrast to the study conducted by shahverdi et al . in 2012 . medical storekeepers were found to exhibit best practice behaviors among the study participants and the worst behavior was shown by dental practitioners in the present study . this can be due to the fact that medical storekeepers are more aware and are in contact with the drug authorities which makes it more feasible for them to report of any encounters with counterfeit drugs . if this lack of awareness about the drug regulatory authorities continues in the future among doctors , it will contribute toward an increase of counterfeit medicines in the city . anti - counterfeit measures need to be incorporated into a set of guidelines to be developed for the doctors and medical storekeepers . majority of the participants in the present study warned the patients about not to purchase medicines from an unknown source , which was in contrast to the results of a study conducted in 2008 - 2009 by binkowska - bury et al . , though the present study was in affirmation with its finding that majority of the participants did not know the procedure for reporting about suspicious medicines . these findings suggest that there is a great need for training doctors and medical storekeepers in the field of counterfeit . it can be understood that because of market competition , storekeepers try to find shortcuts to avoid taxes and make quick money . in this vicious circle , even the doctors are involved in getting commissions or favors such as free holiday trips from illegal sources to bring their medicines in the supply chain . unless this chain is broken , the poor patients who tend to buy these spurious medicines at low cost not only suffer from health losses but also are at long - term financial loss . in conclusion , the findings from this study extend the understanding of the knowledge , attitudes , and practice regarding counterfeit drugs among doctors and medical storekeepers and they point out the need for designing and implementing continuing educational programs among them . this training should be teaching them how to identify these drugs and how to inform the responsible authorities about counterfeit drug suppliers . the findings also suggest the need for enforcement of vigilant laws on the unauthorized medical storekeepers .

background : fake drugs and active pharmaceutical ingredients most often originate in emerging industrial economies before entering the global market . health care workers play a crucial role in detecting and preventing the distribution of counterfeit medicines.aim:the present study was conducted to assess the knowledge , attitude , and practice of doctors and medicine wholesale distributors regarding counterfeit medication in western india.materials and methods : a cross - sectional questionnaire survey was conducted among 300 participants consisting of 100 medical practitioners , 100 dental practitioners , and 100 medical storekeepers.results:it was observed that medical practitioners had more knowledge , followed by medical storekeepers and dental practitioners ( mean 2.82 , 2.52 , and 2.37 , respectively ) . dental practitioners had the best attitude , followed by medical practitioners and wholesale distributors ( mean 1.77 , 1.76 , and 1.55 , respectively ) . best practice behaviors were observed in medical storekeepers followed by medical practitioners and dental practitioners ( mean 1.46 , 1.29 , and 1.12 , respectively).conclusion : the study points out the need for designing and implementing continuing educational programs and enforcement of vigilant laws .

INTRODUCTION MATERIALS AND METHODS Study sample Statistical analysis RESULTS DISCUSSION Knowledge Attitude Practice CONCLUSION

oral squamous cell carcinoma ( oscc ) accounts for more than 90% of all oral cancers and is the sixth most common type of cancer in the world . the 5-year survival rate of oscc has not improved much over the past 2 decades . in china , evidence has shown that the risk of morbidity for oscc patients is still high and that oscc tends to occur among younger patients . the prognostic value of the traditional tnm system is widely regarded as inadequate in patients with oscc . advances in understanding of the molecular mechanisms underlying oscc have led to an ever - increasing number of molecular markers shown to be related to the behavior of this disease . however , little clear evidence has been provided on the prognostic relevance of these markers . in addition , there is an increased necessity for identification and standardization of sensitive and accurate biomarkers that can identify oscc patients with a poor prognosis . mature mirnas are small ( 2021 nucleotides in length ) endogenous noncoding rnas that regulate the expression of over 50% of human genes at the post - transcriptional level guided by partial complementarities to specific sequences in their target messenger rna . mirnas is indispensable for a variety of basic biological and pathological processes , and mirna signatures are closely correlated with human diseases . deregulations of microrna have been reported in various cancers , and have been showed to play important roles in cancer initiation and progression [ 811 ] . distinct mirna expression profiles in oscc in comparison with matched healthy controls have been demonstrated , indicating mirnas may participate in oscc tumorigenesis . recently , various studies have shown that microrna-1246 ( mir-1246 ) plays a crucial role in regulation of cancer cell biological functions such as proliferation , invasion , and metastasis . in addition , overexpression of mir-1246 has been found in several types of cancers such as liver cancer , pancreatic cancer , and colorectal carcinoma . however , data on the expression of mir-1246 in oscc and its clinical impact on patient survival remain scarce . in the present study we aimed to evaluate the clinical significance of mir-1246 expression in oscc . in addition , the relationship between mir-1246 expression and clinicopathological characters was analyzed and the impact of mir-1246 expression on the prognosis of oscc patients was estimated . this study was approved by the research ethics committee of the second affiliated hospital of nanchang university . written informed consent was obtained from all patients . the selection criteria for patients with oscc were : ( 1 ) histological confirmation of oscc and ( 2 ) no prior history of other cancers . all patients were diagnosed and treated at the second affiliated hospital of nanchang university from march 2009 to june 2014 . tumor stage was classified according to the 7 edition of the classification of malignant tumors of the american joint committee on cancer . tumor grade was classified following the who ( 2005 ) criteria . by last follow - up , 37 patients had died from the disease and the duration of follow - up was 60 months . for qrt - pcr , 106 pairs of fresh oscc and matched adjacent normal tissue specimens were collected from patients who underwent surgery in the second affiliated hospital of nanchang university . the oral squamous cell carcinoma cell lines ( scc25 and cal27 ) were maintained in dulbecco s modified eagle s medium ( gibco , grand island , ny , usa ) containing 10% fetal calf serum ( gibco ) , 100 u / l penicillin , and 10 mg / l streptomycin . hok16e6e7 cells , a human immortalized oral keratinocyte cell line , were cultured in keratinocyte growth medium containing 0.15 mm calcium and supplemented with epidermal growth factor ( gibco ) . total rna was extracted from frozen tissues using trizol ( takara , dalian , china ) according to the manufacturer s instructions . briefly , 2 ug of rna was added to rt reaction , and the cdna served as the template for amplification of pcr with sequence - specific primers ( sangon biotech , shanghai , china ) using sybr primescript mirna rt - pcr kit ( takara ) in the stratagene mx3000p real - time pcr system ( agilent technologies , la jolla , ca , usa ) . the fold change between tumor tissues and noncancerous samples for mir-1246 was calculated with the 2 method . the expression levels of mir-1246 in hok16e6e7 , scc25 , and cal27 were detected using the same method . the normality of data distribution was checked using the shapiro - wilk normality test ( no significant differences from a normal distribution were detected ; p=0.264 ) . the comparison of the expression level of mir-1246 in tissues and cell lines was performed using two - sample student s t - test . the correlation between the expression of mir-1246 and clinicopathological characters was assessed with chi - square test . the overall survival was analyzed by log - rank test , and survival curves were plotted . the univariate cox regression was performed on each clinical covariate to examine its influence on patient survival . a wald statistic of p<0.05 was used as the criterion for inclusion in final multivariate models . multivariate analysis for prognostic factors statistical analysis was performed using spss version 21.0 software ( chicago , il , usa ) and sigmaplot12.5 ( systat software inc . this study was approved by the research ethics committee of the second affiliated hospital of nanchang university . written informed consent was obtained from all patients . the selection criteria for patients with oscc were : ( 1 ) histological confirmation of oscc and ( 2 ) no prior history of other cancers . all patients were diagnosed and treated at the second affiliated hospital of nanchang university from march 2009 to june 2014 . tumor stage was classified according to the 7 edition of the classification of malignant tumors of the american joint committee on cancer . tumor grade was classified following the who ( 2005 ) criteria . by last follow - up , 37 patients had died from the disease and the duration of follow - up was 60 months . for qrt - pcr , 106 pairs of fresh oscc and matched adjacent normal tissue specimens were collected from patients who underwent surgery in the second affiliated hospital of nanchang university . the oral squamous cell carcinoma cell lines ( scc25 and cal27 ) were maintained in dulbecco s modified eagle s medium ( gibco , grand island , ny , usa ) containing 10% fetal calf serum ( gibco ) , 100 u / l penicillin , and 10 mg / l streptomycin . hok16e6e7 cells , a human immortalized oral keratinocyte cell line , were cultured in keratinocyte growth medium containing 0.15 mm calcium and supplemented with epidermal growth factor ( gibco ) . total rna was extracted from frozen tissues using trizol ( takara , dalian , china ) according to the manufacturer s instructions . briefly , 2 ug of rna was added to rt reaction , and the cdna served as the template for amplification of pcr with sequence - specific primers ( sangon biotech , shanghai , china ) using sybr primescript mirna rt - pcr kit ( takara ) in the stratagene mx3000p real - time pcr system ( agilent technologies , la jolla , ca , usa ) . the fold change between tumor tissues and noncancerous samples for mir-1246 was calculated with the 2 method . the expression levels of mir-1246 in hok16e6e7 , scc25 , and cal27 were detected using the same method . the normality of data distribution was checked using the shapiro - wilk normality test ( no significant differences from a normal distribution were detected ; p=0.264 ) . the comparison of the expression level of mir-1246 in tissues and cell lines was performed using two - sample student s t - test . the correlation between the expression of mir-1246 and clinicopathological characters was assessed with chi - square test . the overall survival was analyzed by log - rank test , and survival curves were plotted . the univariate cox regression was performed on each clinical covariate to examine its influence on patient survival . a wald statistic of p<0.05 was used as the criterion for inclusion in final multivariate models . multivariate analysis for prognostic factors statistical analysis was performed using spss version 21.0 software ( chicago , il , usa ) and sigmaplot12.5 ( systat software inc . we examined mir-1246 expression in 106 pairs of oscc tissues and the neighboring healthy controls by qrt - pcr . mir-1246 was expressed significantly higher in tumor tissues compared with corresponding noncancerous tissues ( p<0.01 ; 3.470.78 vs. 1.000.54 ; figure 1 ) . similarly , the mir-1246 expression level in oscc cell lines cal27 ( p<0.01 ; 1.820.12 vs. 1.000.06 ; figure 2 ) and scc25 ( p<0.01 ; 4.150.35 vs. 1.000.06 ; figure 2 ) vastly increased compared to the control cell line . the mean mir-1246 expression level of all oscc was 3.47 , which is utilized to divide oscc patients into 2 groups . forty - nine specimens were assigned to the high - expression group ( equal to or higher than 3.47 ) and the remaining 57 specimens were assigned to the low - expression group ( less than 3.47 ) . the relationship between the relative mir-1246 expression levels and clinicopathological features of oscc are shown in table 1 . there was no correlation between the relative mir-1246 expression levels and age , sex distribution , tumor location , tumor size , local recurrence , or distant organ metastasis ( p>0.05 ) , but the relative mir-1246 expression levels were significantly positively correlated with tnm stage ( p=0.005 ) , nodal status ( p=0.015 ) , and tumor grade ( p=0.002 ) . kaplan - meier analysis showed that patients with higher levels of mir-1246 had significantly poorer survival than patients with lower mir-1246 expression levels ( p=0.002 ; 55.11% vs. 81.71% ; mean survival time 56.401.58 vs. 42.842.63 ; figure 2 ) . a cox proportional hazard regression model was developed to evaluate the association between the potential prognostic markers and overall survival at multivariate level . the variables , including mir-1246 expression , nodal status , tnm stage , tumor grade , and local recurrence , were selected in the final multivariate model because their wald test p values were less than the generally used criterion of 0.05 . the results revealed that mir-1246 expression ( p=0.036 ; hr=2.82 ; 95% ci=1.077.43 ) , tnm stage ( p=0.003 ; hr=2.97 ; 95% ci=1.466.05 ) and tumor grade ( p=0.006 ; hr=3.04 ; 95% ci=1.376.74 ) were independent prognostic parameters for oscc ( table 2 ) . we examined mir-1246 expression in 106 pairs of oscc tissues and the neighboring healthy controls by qrt - pcr . mir-1246 was expressed significantly higher in tumor tissues compared with corresponding noncancerous tissues ( p<0.01 ; 3.470.78 vs. 1.000.54 ; figure 1 ) . similarly , the mir-1246 expression level in oscc cell lines cal27 ( p<0.01 ; 1.820.12 vs. 1.000.06 ; figure 2 ) and scc25 ( p<0.01 ; 4.150.35 vs. 1.000.06 ; figure 2 ) vastly increased compared to the control cell line . the mean mir-1246 expression level of all oscc was 3.47 , which is utilized to divide oscc patients into 2 groups . forty - nine specimens were assigned to the high - expression group ( equal to or higher than 3.47 ) and the remaining 57 specimens were assigned to the low - expression group ( less than 3.47 ) . the relationship between the relative mir-1246 expression levels and clinicopathological features of oscc are shown in table 1 . there was no correlation between the relative mir-1246 expression levels and age , sex distribution , tumor location , tumor size , local recurrence , or distant organ metastasis ( p>0.05 ) , but the relative mir-1246 expression levels were significantly positively correlated with tnm stage ( p=0.005 ) , nodal status ( p=0.015 ) , and tumor grade ( p=0.002 ) . kaplan - meier analysis showed that patients with higher levels of mir-1246 had significantly poorer survival than patients with lower mir-1246 expression levels ( p=0.002 ; 55.11% vs. 81.71% ; mean survival time 56.401.58 vs. 42.842.63 ; figure 2 ) . a cox proportional hazard regression model was developed to evaluate the association between the potential prognostic markers and overall survival at multivariate level . the variables , including mir-1246 expression , nodal status , tnm stage , tumor grade , and local recurrence , were selected in the final multivariate model because their wald test p values were less than the generally used criterion of 0.05 . the results revealed that mir-1246 expression ( p=0.036 ; hr=2.82 ; 95% ci=1.077.43 ) , tnm stage ( p=0.003 ; hr=2.97 ; 95% ci=1.466.05 ) and tumor grade ( p=0.006 ; hr=3.04 ; 95% ci=1.376.74 ) were independent prognostic parameters for oscc ( table 2 ) . oscc are cancers of the mucosal surfaces of the lips , floor of mouth , oral tongue , buccal mucosa , lower and upper gingiva , hard palate , and retromolar trigone . it is becoming a serious and growing problem in many parts of the world because patients with oscc often have disfigurement , loss of ability to eat and speak , and poor quality of life , especially in advanced cases . clinicopathological parameters such as tumor grade of differentiation and clinical stage have been used to evaluate the progression of oscc but their sensitivity is relatively low . therefore , finding novel effective biomarkers is of great significance for improving the outcome of oscc therapy . the expression levels of mirnas are often changed in many cancers , resulting in abnormal increases or decreases [ 1921 ] . these alterations play an important role in almost all facets of cancer development and progression . some mirnas families have been shown to be involved in epithelial - to - mesenchymal transition , which is an important component of cancer metastasis . thus , mirnas are not only regarded as potential markers for cancer diagnosis , but also might serve as potential therapeutic targets by manipulating mirna levels to enhance current cancer therapy outcomes . investigating the correlation between mirna expression profiles and the prognosis of patients with oscc may be beneficial to understanding the underlying molecular mechanisms involved in the cancer progression and enabling the identification of novel targets for oscc treatment . in the present study , mir-1246 expression was shown to be correlated with advanced clinical stage , lymph node metastases , and histological grade , suggesting that mir-1246 might be involved in the carcinogenesis and metastasis of oscc . in addition , we revealed that patients with a higher expression of mir-1246 tended to have much lower survival rates than patients with lower mir-1246 expression , indicating that high mir-1246 level is a potential biomarker for predicting the poor prognosis of oscc . consistent with our study results , overexpression of mir-1246 has been observed in multiple tumor types , suggesting its important role in tumorigenesis . della vittoria scarpati found that the expression level of mir-1246 is enhanced by about 2-fold in colorectal tumor tissue in comparison with stromal tissue . there was no statistical difference between liver cancer and mir-1246 expression level , probably due to the small clinical sample of patients . however , the high expression of mir-1246 combined with low expression of cell adhesion molecule 1 ( cadm1 ) was shown to be a risk factor for early - stage liver cancer . a higher level of mir-1246 expression was correlated with a shorter survival time in patients with pancreatic cancer . used mirna expression profiles to find the difference between mirna expressed in cancer tissues and that in normal tissues . mir-1246 was shown to be significantly up - regulated by 12.01-fold and 9.37-fold in colorectal and pancreatic cancers compared to healthy controls , respectively . some studies have explored the exact molecular mechanism of mir-1246 in cancer development and progression . cancer stem cells have been shown to be closely related with tumor initiation , progression , radioresistance , and chemotherapy resistance . hasegawa found that mir-1246 could increase tumor - initiating potential and maintain cancer stem cell - like properties via ccng2 in pancreatic cancer . mir-1246 has also been shown to specifically target the 3-utr of cadm1 and down - regulate its expression , which leads to enhancing migration and invasion capacity of hepatocellular carcinoma cell lines . enhanced mir-1246 expression can promote cervical cancer cell proliferation , invasion , and migration by suppression of its target gene , thrombospondin 2 ; suggesting that mir-1246 may be closely related with cervical cancer tumorigenesis and progression . however , conflicting results about the expression level of mir-1246 were reported in esophageal squamous cell carcinoma ( escc ) . fu found that mir-1246 was increased in escc tissues , while another study showed that the expression level of mir-1246 was similar between escc tissues and normal controls . further large - scale investigations are needed to address conflicting findings on the expression level of mir-1246 in escc . in addition to the overexpression of mir-1246 in various cancer tissues , mir-1246 is significantly enhanced in serum derived from nude mice implanted with primary human pancreatic ductal adenocarcinoma . moreover , serum mir-1246 has been showed to be up - regulated in patients with early - stage cervical squamous cell carcinoma , indicating that serum mir-1246 may be a promising biomarker for early detection of cervical squamous cell carcinoma . also , serum mir-1246 was significantly higher in primary colorectal cancer patients . recent studies suggest that mir-1246 might also serve as a potential drug target or a biomarker to predict the risk of drug resistance and radioresistance . also , mir-1246 has been reported to be involved in promoting radioresistance of cervical cancer cells . these findings suggest the possibility of a novel method to improve oscc therapy by targeting mir-1246 . in conclusion , the expression level of mir-1246 was increased in oscc tissues and cell lines and it was correlated with tnm stage , nodal status , and tumor grade . in addition , high mir-1246 expression was associated with poorer survival and served as an independent prognostic factor in patients with oscc , suggesting that mir-1246 may be a promising prognostic biomarker for oscc . however , the relatively small sample of this study is a limitation ; a larger sample size would definitely be desirable with longer follow - up to firmly establish the diagnostic value of mir-1246 in oscc . in addition , further studies are needed to elucidate the role of mir-1246 in oscc at the cellular level .

backgroundmicrornas ( mirnas ) are small , non - coding rnas that may function as oncogenes or tumor suppressors . previous studies have shown that the expression level of mir-1246 was enhanced in multiple types of cancers . however , the expression of mir-1246 in human oral squamous cell carcinoma ( oscc ) and its prognostic values remain unclear.material/methodsquantitative reverse - transcriptase polymerase chain reaction ( qrt - pcr ) was used to analyze the expression of mir-1246 in 106 pairs of matched normal and tumor tissue samples . the chi - square test was used to examine the associations between mir-1246 expression and the clinicopathological characters . the survival curves were constructed by the kaplan - meier method . the influence of each clinical variable on survival was examined by the cox multivariate regression analysis.resultsthe expression level of mir-1246 was significantly higher in tumor tissues and oral cancer cell lines than in normal controls ( p<0.01 ) . high expression of mir-1246 was found to significantly correlate with nodal status ( p=0.015 ) , tnm stage ( p=0.005 ) , and tumor grade ( p=0.002 ) . enhanced mir-1246 correlated significantly with patient survival ( p<0.01 ) . in multivariate analysis , we found that mir-1246 expression was an independent prognostic factor of poor patient survival ( p= 0.036 ; hr=2.82 ; 95% ci=1.077.43).conclusionshigh mir-1246 expression is associated with poor prognosis in oscc and may serve as a novel prognostic marker in oscc .

Background Material and Methods Patients and samples Cell culture qRT-PCR Statistical analysis Results Overexpression of miR-1246 in OSCC Tissues and cancer cell lines by qRT-PCR The Relationship between miR-1246 expression levels and clinicopathological features High-level expression of miR-1246 predicts poor prognosis in OSCC patients Discussion Conclusions

to report the case of a patient with a damaged haptic of an acrylic intraocular lens ( iol ) after transscleral iol fixation . he had undergone phacoemulsification / aspiration and iol implantation 3 years previously and iol repositioning with transscleral fixation 2 years before the initial visit . his visual acuity was 0.3 in the left eye due to corneal edema caused by a foreign body , i.e. , the severed haptic tip of the single - piece acrylic iol , which was surgically removed . the surface of the tip of the haptic suggested that the monofilament suture thread had exerted continuous force across the haptic . foldable intraocular lenses ( iols ) have recently replaced polymethylmethacrylate iols for use in transscleral fixation surgery and standard cataract surgery because they can be implanted through a small incision . favorable outcomes with sutured acrylic iols have been reported [ 1 , 2 , 3 , 4 , 5 , 6 ] . however , various postoperative complications associated with suturing foldable iols have also been discussed , since they are not designed for transscleral suturing [ 1 , 6 , 7 , 8 , 9 , 10 , 11 ] . we report a case with a damaged haptic of a single - piece acrylic iol 2 years after transscleral fixation . a 40-year - old man was referred with sudden visual loss in his left eye ( le ) in october 2010 . informed consent was obtained , and the treatment protocol has been approved by the local committee of the national tokyo medical center . in 2007 , he underwent phacoemulsification and iol implantation for a cataract in the le . iol subluxation occurred in 2008 , and the patient underwent a repositioning surgery , with suturing of the iol transsclerally without iol exchange . detailed information of these two surgeries performed prior to the initial visit to our institute was unavailable ; the underlying pathogenesis of the cataract and iol subluxation was unknown . at the initial examination in our clinic , best - corrected visual acuity ( bcva ) was 0.3 with correction of 3.75/2.25 180 in the le . slit - lamp examination showed prominent corneal stromal edema from 2 to 7 o'clock ( fig . gonioscopy showed a foreign body at the bottom of the anterior chamber touching the corneal epithelium ( fig . the foreign body was thought to be the distant tip of a haptic of a single - piece acrylic iol . postoperatively , the corneal condition , presumably resulting from the foreign body , recovered gradually within 2 months and the edema resolved ; the endothelial cell count was 1,744 cells / mm , and the bcva was 1.0 with correction of 2.25/2.00 180 . during the postoperative comprehensive ophthalmologic examination , the iol was seen to be slightly tilted and mobile and one of the haptics was damaged ; otherwise , no abnormality was seen in the fundus or posterior chamber . an iol exchange was performed combined with 25-gauge pars plana 3-port vitrectomy in february 2011 . intraoperatively , the sutured side of the iol was observed with scleral indentation ; the haptic was sutured firmly at the appropriate position ( 10 o'clock ) in the ciliary sulcus . the opposite haptic was severed at the point where it was supposed to have been sutured . the suture was resected with vitreous scissors , and the iol was removed through a scleral tunnel . a new acrylic iol designed for a suturing procedure ( ya-65bb , hoya corp . ) was implanted using the standard transscleral fixation procedure ; ya-65bb has the largest diameter of 13 mm with pmma haptics which have bulbs on the haptic tips to affix the suture . the bcva improved to 1.2 with correction of cylinder of 2.00 135 , 1 month later . the tip of the haptic extracted previously was part of the explanted iol , which was identified as a single - piece acrylic lens ( acrysof sa60at , alcon laboratories ) . the damaged site of the haptic was directly opposite the point at which the other maintained haptic was sutured but slightly proximal to the optic ( fig . the detailed observation of each fragment revealed that the two parts fit together perfectly with no other parts of the iol missing . the surfaces of the severed portions were relatively smooth and flat with numerous tiny fissures ( fig . a thin monofilament suture thread was also seen adhering to the proximal aspect of the severed haptic ( fig . the distance between the site of the damage and the point of the suture on the other side was 10.5 mm . transscleral fixation is a desirable method to implant iols in eyes with inadequate capsular support . along with the trend toward small - incision surgery , foldable iols have become a favorable alternative to transscleral fixation [ 1 , 2 , 3 , 4 , 5 , 6 ] . transscleral fixation has also been performed during surgery to reposition dislocated iols , using two major methods : externalizing the haptics through a clear corneal incision and tying a looped suture intraocularly using the cow hitch - knot technique [ 7 , 8 , 10 , 13 , 14 ] . these procedures do not require an incision for an iol exchange , since the dislocated iol is suture - fixated again [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 13 , 14 ] , which possibly reduces the risk of postoperative astigmatism or loss of corneal endothelium [ 8 , 13 , 14 ] . possible complications associated with transscleral fixation of foldable iols have also been discussed previously , i.e. , iol decentration , tilt , rotation or luxation , slippage of the suture thread off the haptic , and damage to the haptic [ 1 , 6 , 7 , 8 , 9 , 10 , 11 ] . these complications are thought to result from the characteristic design and material of foldable iol haptics , e.g. , the absence of an eyelet or bulb to affix the suture , instability of the haptic - optic junction , and softness of the jelly - like material . the haptic of the single - piece acrylic iol implanted in the current case was very soft , which may be the reason it was damaged . the diameter of the iol is additionally crucial to minimize stress on the single - piece acrylic iol that is sutured . based on published data , the diameter of the posterior chamber at the level of the ciliary sulcus can be estimated to range from about 10 to 12 mm . in the current case , the largest diameter of the damaged iol was 13 mm , which seems sufficient to provide stability after suture fixation . if the distance between the two sutured parts was less than the diameter of the posterior chamber , the thin monofilament suture would induce continuous force across the haptic and gradually slice the jelly - like material of the haptic of a single - piece acrylic iol . this hypothesis is supported by the tiny fissures on the relatively smooth surfaces of the cross - sections with the adherent suture thread . while unpredictable complications can arise from inappropriate choices of a foldable iol , foldable iols are advantageous even in suture fixation . attention should be paid to the iol design and material even during primary cataract surgery , and the possible complications of suturing those iols should also be considered ; the complications may occur later , as there would be no chance to exchange the iol during repositioning surgery with transscleral fixation . in addition , surgeons performing an iol repositioning procedure should evaluate the design and material of the previously implanted iol , and plan to exchange the iols when needed . development of foldable iols suitable for both primary cataract surgery and transscleral fixation should solve this problem .

purposeto report the case of a patient with a damaged haptic of an acrylic intraocular lens ( iol ) after transscleral iol fixation.methodsthis is a retrospective and descriptive case report.resultsa 40-year - old man presented with sudden visual loss in the left eye . he had undergone phacoemulsification / aspiration and iol implantation 3 years previously and iol repositioning with transscleral fixation 2 years before the initial visit . his visual acuity was 0.3 in the left eye due to corneal edema caused by a foreign body , i.e. , the severed haptic tip of the single - piece acrylic iol , which was surgically removed . the iol itself was tilted and therefore explanted . the surface of the tip of the haptic suggested that the monofilament suture thread had exerted continuous force across the haptic.conclusionsthe haptics of acrylic iols can be damaged after transscleral fixation .

Purpose Methods Results Conclusions Introduction Case Report Discussion Disclosure Statement

ocular trauma has been a common reason of visual morbidity , which causes heavy psychological and economic burden to victims and society [ 13 ] . in the united states , there are approximately 2.5 million cases of eye trauma every year . ocular trauma includes mechanical eye injury ( open globe injury and closed globe injury ) and nonmechanical eye injury . it may have been caused by the rupture of the lens capsule or zonular ligament , the disorder of lens metabolism , or the oscillation of lens cortex caused by collision . the occurrence of traumatic cataract could be observed immediately or several years after eye injury . the shape of traumatic cataract may be total , local , rosette , or swollen or other irregular shapes . the location of the opacity may be at anterior or posterior cortex or the capsule . 's study group that aims to predict the visual outcome of traumatic eyes , which has showed a predictable value for different types of ocular trauma [ 810 ] . and recently some researchers have reported that the ots can indicate the final vision for traumatic cataract patients [ 11 , 12 ] . has ots also been effective for traumatic cataract cases in central china ? to answer this question , we retrospectively reviewed the medical records of traumatic cataract in our hospital in the last five years and analyzed the data . the medical records of traumatic cataract patients who received cataract surgery in our ophthalmic center from 2010 to 2014 were reviewed . the retrieved information included age , gender , profession , causative agent , type of injury , initial visual acuity ( va ) after injury , diagnosis , treatment , and final va ( the best corrected va at the last follow - up ) . the diagnosis and classification of ocular trauma in this paper are based on the birmingham eye trauma terminology ( bett ) which is a standardized ocular trauma definition and classification system for mechanical eye injuries [ 1315 ] . the eye wound location was defined by the ocular trauma classification group : zone i , injuries limited to the cornea ; zone ii , injuries confined to the anterior 5 mm of the sclera ; and zone iii , injuries involving more than 5 mm posteriorly from the limbus . the causative agents were divided into sharp metal items ( knife , scissors , forks , etc . ) , blunt injury ( fist , stone , toy , etc . ) , animal ( bite , hit , strip , etc . ) , electrical injury , chemical injury , and others . based on the injury condition , the cataract removal was performed in four different ways : phacoemulsification , extracapsular cataract extraction ( ecce ) not phacoemulsification , intracapsular extraction , or lensectomy . the intraocular lens ( iol ) might be implanted in the capsular bag , in the anterior chamber ( iris - clipped or placed on the lens capsule ) , or fixed in the ciliary sulcus . the iol may be implanted at the first stage or second stage . during the surgery , the combined procedures include wound closure , tissue repair , foreign body removal , or vitreous or retinal operation . the patients were followed up at 1 week , 1 month , 6 months , and 12 months postoperatively . for the enrolled patients , the follow - up was at least 6 months . at each follow - up , the corrected va was recorded . the eyes were examined by slit - lamp microscope and direct ophthalmoscope . sometimes , an additional examination , like b - ultrasonography , ct , or mri , was needed . the posterior capsular opacity was observed in some patients during follow - up , which could be treated by capsulotomy with laser or scissors . the ocular trauma score ( ots ) was first introduced by kuhn et al . in 2002 , which is a simplified system for standardized assessment and visual prognosis associated with eye injury . the raw points of variables of each patient were calculated , summated , and categorized to different groups . the potential va was compared with the actual va ; then , the sensitivity and the specificity of ots in each category were calculated . the data were analyzed with spss software , version 17.0 ( spss , inc . , all values in our study were two - sided , and a value of less than 0.05 was considered statistically significant . this study has reviewed the medical data of 480 cases of traumatic cataract from 2011 to 2014 . there were 324 males and 156 females ( x = 117.6 , p < 0.01 ) . the age of patients ranged from 2 months to 83 years with an average of 41.5 19.3 years . the average age is 40.9 17.7 for males and 42.1 16.8 for females . there were 98 cases ( 20.4% ) under 14 years old and 41 cases ( 8.5% ) under 5 years old . the professions were 191 peasants ( 39.8% ) , 165 workers ( 34.4% ) , 78 students ( 16.3% ) , and 46 cases ( 9.6% ) of other professions ( x = 159.0 , p < 0.01 ) in our study . the causative agents included sharp agents ( 324 cases , 67.5% ) , blunt agents ( 82 cases , 17.1% ) , animal ( 29 cases , 6.0% ) , electricity ( 12 cases , 2.5% ) , chemicals ( 28 cases , 5.8% ) , and others ( 5 cases , 1.0% ) ( x = 1126.4 , p < 0.01 ) . there were 437 cases ( 91.0% ) of mechanical injury and 43 cases ( 9.0% ) nonmechanical injuries ( x = 646.8 , p < 0.01 ) . in mechanical injury , there were open globe injury ( 354 cases , 73.8% ) and closed globe injury ( 83 cases , 17.3% ) ( x = 336.1 , p < 0.01 ) . among the open globe injuries , there were 255 cases ( 72.0% ) , 74 cases ( 20.9% ) , and 25 cases ( 7.1% ) with wound at zone i , zone ii , and zone iii ( x = 373.1 , p < 0.01 ) . in nonmechanical injuries , there were chemical injury ( 28 cases , 5.8% ) , electrical injury ( 12 cases , 2.5% ) , and other types ( 3 cases , 0.6% ) ( x = 33.6 , p < 0.01 ) . the cataract phacoemulsification was performed in 62 cases ( 12.9% ) , ecce was performed on 247 eyes ( 51.5% ) , cataract intracapsular extraction was performed on 123 eyes ( 25.6% ) , and lensectomy was performed on 48 eyes ( 10.0% ) ( x = 274.3 , p < 0.01 ) . the iol was implanted in the capsule ( 177 eyes , 36.9% ) and in the ciliary sulcus ( 242 eyes , 50.4% ) or clipped at the iris ( 32 eyes , 6.7% ) ( x = 379.5 , p < 0.01 ) . there was no iol implantation in 29 cases ( 6.0% ) . there were wound closure ( 356 eyes , 74.2% ) , pupillary formation ( 95 eyes , 19.8% ) , antiglaucoma surgery ( 87 eyes , 18.1% ) , vitreous surgery ( 56 eyes , 11.7% ) , retinal surgery ( 49 eyes , 10.2% ) , and others ( 92 eyes , 19.2% ) . there were 75 eyes ( 16.2% ) with initial va of > 20/60 and 305 eyes ( 65.6% ) with final va of > 20/60 ( x = 235.0 , p < 0.01 ) . the initial va was positively associated with final va ( r = 0.93 , p < 0.01 ) . for different professions , the final va of > 20/60 was in 122 eyes ( 64.2% ) in peasants , 110 eyes ( 67.1% ) in workers , 55 eyes ( 66.2% ) and 51 eyes ( 66.2% ) in students , and 22 eyes ( 62.9% ) in other professions ( x = 0.45 , p = 0.93 ) . the final visual outcomes among different types were significantly different ( x = 27.6 , p < 0.01 ) . the final va of closed globe injury was better than that of open globe injury ( x = 10.1 , p < 0.01 ) . in open globe injury , the final va of > 20/60 was found in 128 eyes ( 37.5% ) in zone i , 26 eyes ( 7.6% ) in zone ii , and 2 eyes ( 0.6% ) in zone iii . the eyes with wound in zone i had better vision ( x = 22.7 , p < 0.01 ) than in other zones . the patients with phacoemulsification had better va than those with other procedures ( x = 92.3 , p < 0.01 ) . the results of final vision with different iol implantation procedures were shown in table 5 . the actual and calculated ots of each patient were summated and analyzed . and the sensitivity and specificity were calculated and shown in table 6 . the sensitivities of ots predicting the va at nlp , lp / hm , and 20/40 were 100% . this study has three parts : clinical features of traumatic cataract patients in central china , factors associated with visual outcome , and predictive value of ots . shah et al . reported that the average age was 27 years [ 6 , 11 ] in india and serna - ojeda et al . reported that it was 46 years in mexico . in our study , the ratio of males to females is about 2.1 : 1 , different from other reports with ratio 3 : 1 [ 16 , 17 ] . in other researches , these percentages vary from 65.2% to 80% [ 6 , 11 , 16 , 18 , 19 ] . in our study , only 12.9% underwent phacoemulsification , which is much lower than the 96.3% reported by other researches . this is because of the economic reason , to save money for patients . in our study , 's report , 28% of the patients had hypertension complications after traumatic cataract . in our present study , 65.5% of the eyes achieved a final va of > 20/60 and 49.8% of the eyes obtained va of 20/40 . shah et al . reported that 54.3% of cases obtained va of > 20/60 and 31% of cases obtained va of 20/40 . after treatment , the final va was much better than the initial va statistically in our results . treatment for traumatic cataract is different from senile cataract although most cataract procedure steps were similar . first , the wound should be treated before the cataract in open globe injury , like eyelid , corneal or scleral wound , and lacrimal apparatus injury . second , the traumatic cataract operation always is more complicated than the traditional cataract operation . in some cases , the posterior capsular rupture was much more common in traumatic cataract surgery than in conventional cataract operation . as kuhn reported , traumatic cataract procedure is an individualized , consciously made decision regarding what to do and when and how to do it to achieve the best possible outcomes . the possible factors which may influence the final va were initial va , injury type , wound location , cataract removal procedure , and the way of iol implantation . the initial va was also the predictor for visual outcome in open and closed globe injuries [ 1 , 2 ] . ( 2 ) the final va of open globe injury was better than that of closed globe injury . ( 3 ) the location of the wound in open globe injury will influence the vision . this is because the retina is located at the posterior part of the eyeball , which is the vital part for visual message transition . ( 4 ) the patients who underwent different cataract removal procedures had different visual outcomes . phacoemulsification usually needed better operational conditions , like stable anterior chamber , complete capsular bag , and sufficiently strong suspensory ligament . for patients with broken capsule , ecce or other methods iol implanted in the capsule is the ideal position for vision . for patients without complete or enough capsules , reported that ots may provide prognostic information in deadly weapon - related open globe injuries . unal et al . reported that ots provided reliable information about the prognosis of deadly weapon - related open globe injuries with intraocular foreign bodies . uysal et al . reported that ots might provide prognostic information in children with open globe injuries . ots also had a good predictive value in firework - related eye injuries and closed globe injuries . about the predictive value of ots on traumatic cataract in children , zhu et al . have reported that ots has a high ability to predict visual outcome for pediatric traumatic cataract following penetrating ocular trauma . shah et al . also reported that ots was a reliable predictor of the final vision of pediatric traumatic cataract . there was only one reference that mentioned the value in traumatic cataract in adults and children . shah reported that ots was found as a reliable tool to predict visual outcome in traumatic cataracts 6 weeks postoperatively . our paper has observed the long term of final va of cases to evaluate the predictive value of ots for traumatic cataract patients in long - term follow - up . and the ots had high predictive sensitivity and high specificity for traumatic cataract patients in the long term . in conclusion , our paper has found five factors influencing the final va : initial va , injury type , wound location , cataract removal procedure , and iol implantation method . the ots has high sensitivity and specificity for predicting visual outcome of traumatic cataract patients in long - term follow - up .

purpose . to investigate the prognostic factors for visual outcome in traumatic cataract patients . methods . the demographic features of traumatic cataract patients in central china were studied . the factors that might influence the visual outcome were analyzed . the sensitivity and specificity of ots ( ocular trauma score ) in predicting va were calculated . results . the study enrolled 480 cases . 65.5% of patients achieved va at > 20/60 . the factors associated with the final va were initial va , injury type , wound location , the way of cataract removal , and iol implantation . the sensitivities of ots in predicting the va at nlp ( nonlight perception ) , lp / hm ( light perception / hand motion ) , and 20/40 were 100% . the specificity of ots to predict the final va at 1/200 - 19/200 and 20/200 - 20/50 was 100% . conclusion . the prognostic factors were initial va , injury type , wound location , cataract removal procedure , and the way of iol implantation . the ots has good sensitivity and specificity in predicting visual outcome in traumatic cataract patients in long follow - up .

1. Introduction 2. Methods and Patients 3. Results 4. Discussion

epstein barr virus ( ebv ) is a gamma - herpesvirus with a 172-kb dna genome , which infects more than 90% of world population . ebv is a successful virus that utilizes normal b cell biology to infect , persist , and replicate in b cells ( thorley - lawson , 2001 ; thorley - lawson and gross , 2004 ) . ebv predominantly infects resting b lymphocytes through complement receptor 2 ( cd21 ) in vitro ( for a review of ebv biology , young and rickinson , 2004 ) . primary infection of ebv may cause short term proliferation of b cells in human hosts . the infection is usually self - limited and controlled by the strongly elevated t cell immune response . if the infection occurs in adolescence or adulthood , up to 50% t cells in the host can be specific to the virus , which may cause the clinical symptom of infectious mononucleosis ( i m ) . ebv then persists latently in the host within long - life memory b cells . during latency , up to eight ebv encoded proteins and several non - coding rnas are expressed . these include two ebv encoded small rnas ( eber1 and eber2 ) , nuclear antigens , and membrane proteins . ebv nuclear antigen 1 ( ebna-1 ) binds to the latent viral dna replication origin and maintains the viral genome in the ebv positive cells after cell division ( yates et al . , 1985 ) . ebna-2 interacts with a dna binding protein cbf1 through mimicking notch signaling pathway , blocks differentiation , and allows cell proliferation ( ling et al . two ebv latent membrane proteins ( lmps ) adopt the signaling pathways involved in b cell activation and differentiation to sustain the long - life of ebv positive cells . both lmp1 and lmp2a are multiple membrane - spanning proteins that function as constitutive active receptors independent of ligand binding ( gires et al . , 1997 ) . on one hand , the carboxyl terminus of lmp1 contains consensus tumor - necrosis - factor - receptor - associated factor ( traf)-binding domains and interacts with multiple members , in a b cell activation molecule cd40 mimicking pattern that can activate stat , jnk , and nf-b pathways and lead to b cell survival and growth . on the other hand , lmp2a contains immunoreceptor tyrosine - based activation motifs ( itams ) and associates with lyn kinase , and lmp2a can then replace the survival signal provided by b cell receptor ( bcr ; caldwell et al . , 1998 ) . overall , the ebv - infected nave b cell blasts proliferate in a way that resembles the antigen - activated blasts ( thorley - lawson and mann , 1985 ) . however , different from terminally differentiated plasma cells that eventually undergo apoptosis , these ebv positive cells follow the path of b cell differentiation into memory b cells through migration into germinal center ( gc ; thorley - lawson , 2001 ) . four different types of latency programs were defined according to the expression profile of ebv latent genes . these memory cells do not express ebna-1 or other latent proteins ( referred as latency 0 ) under normal condition , but only express ebna-1 when cells are dividing ( hochberg et al . , 2004 ) . in vitro , the ebv transformed lymphoblastoid cell line ( lcl ) with all eight viral latent proteins , ebv encoded small rna ( ebers ) , and bamhi a transcripts can be continuously propagated . ebna-1 , ebna-2 , ebna-3a , ebna - lp , and lmp1 are required for this transformation process ( kutok and wang , 2006 ) . because of the strong immunogenicity of ebv latent proteins , the lcl - like viral gene expression pattern ( type iii latency ) , can only be observed in immunocompromised patients in vivo . alternatively , ebv positive burkitt 's lymphoma ( bl ) cells express only ebna-1 and ebv encoded rnas ( type i latency ) , whereas cells with type ii latency expressing also lmp1 and lmp2 are observed in hodgkin 's disease ( hd ) . the above mentioned information indicates that after primary infection , a subset of ebv positive b cells survive and emerge into the memory compartment . these cells can go for limited expansion or extrafollicular proliferation and sustain in the host for a longtime . in addition to b cell , ebv also infects epithelial cells and maybe some t cells . ebv is also highly associated with several neoplastic diseases , such as endemic bl , t cell lymphoma , nasopharyngeal carcinoma ( npc ) , hd , and immunoblastic lymphomas in immunocompromised patients ( young and rickinson , 2004 ) . viral genomes or subsets of viral gene products can be detected in the tumor tissues , and antibody levels are usually elevated in patients sera . though not fully illustrated , recent knowledge provides some hints to the ebv associated disease mechanisms . the ebv associated bl ( endemic bl in tropic africa ) demonstrates that the complex interaction of ebv with b cells predisposes the development of bl ( for reviews , brady et al . , 2008 ; thorley - lawson and allday , 2008 ) . malaria infection in endemic region is considered as another co - factor for the development of bl . ebv - negative bl also occurred in other area , and myc - translocation to ig locus is the most critical feature observed in both sporadic and endemic bls . the translocation is highly dependent on the enzyme activity of aid ( activation - induced cytidine deaminase ; muramatsu et al . aid is highly expressed in gc to provide the class switch and hypermutation of ig variable region . after translocation , the activated myc on one hand can lead to cell growth and proliferation , but myc also leads to p53 and bim dependent apoptosis . effects of ebv proteins may prevent b cells from myc induced apoptosis , thus sustain the survival of these memory b cells . the malaria infection may represent a chronic antigenic stimulation with repeated opportunistic infections that can promote more ebv - infected cells to become memory cells . it is still not clear whether chronic b cell antigen stimulation can link to the prolonged or atypical expression of aid , and lead to the higher frequency of myc - translocation ( thorley - lawson and allday , 2008 ) . hodgkin 's lymphoma ( hl ) is characterized by the presence of a minority of malignant hodgkin / reed sternberg ( hrs ) cells among a background of non - neoplastic b and t cells ( for a review , kapatai and murray , 2007 ) . a complex cytokine cross - talk among hrs cells and neighboring cells may provide proliferative and anti - apoptotic signals for tumor cell growth . according to the who classification , hl can be divided into two major types : classical and nodular lymphocyte predominant hl ( harris et al . , 1999 ) . nevertheless , ebv positive and negative hls share similar morphological patterns , while different signaling pathways are involved in the pathogenesis . ebv positive hrs cells display type ii latency gene expression profile with ebers , ebna-1 , lmp1 and lmp2 , and bamhi a rightward transcripts ( barts ) . the lack of expression of functional surface immunoglobulin is the hall mark of classical hl . but because of the clonally rearranged immunoglobulin genes identified in hrs cell , the b cell origin of hl under normal situation , antigen - activated b cells go to gc for somatic hypermutation to generate high affinity bcrs , and those cells with unfavorable mutations will be eliminated through fas - mediated apoptosis . the current scenario for hl is that the expression of ebv genes may prevent the apoptosis of cells with certain mutations and promote them into hrs cells ( kapatai and murray , 2007 ) . it has been a longtime question why ebv only causes these malignant diseases within a small portion of infected population . recent studies further indicated that ebv infection may regulate cd8 nkt development in the host ; and the failure of cd8 nkt conversion may contribute to disease development in some cases ( he et al . , 2010 ) . nkt cells are unconventional t cells that are cd1d - restricted , lipid antigen - reactive , immune regulatory t lymphocytes . nkt cells can produce a broad range of cytokines upon antigen stimulation within minutes to hours . different subsets of nkt are involved in regulating cell - mediated immunity to various infectious organisms , cancer , allergy , and autoimmune diseases . it is still unclear why such a small subset of t cells [ t cell receptor ( tcr)- v14-j18 ] can have such broad influence . most notably , nkt cell numbers vary substantially between individuals ( from undetectable to over 3% of blood lymphocytes ) . this may be either the result of differences in intrathymic development , migration efficiency or the maintenance , or expansion in peripheral blood ( for a review , godfrey et al . , 2010 ) . generally speaking , type i nkt cells can mediate strong antitumor responses on -galcer - induced ifn- and drive t cells into th1-bias . type ii nkt cells suppress tumor immunity through il-13 secretion ( berzofsky and terabe , 2008 ) . it is therefore attractive to study the nkt population variation in different diseases and ask how the nkt population could be manipulated . a recent study revealed that the frequencies of regulatory cd8 nkt , but not cd4 nkt cells , in ebv associated hl and npc patients are much lower than that in healthy ebv carriers ( yuling et al . , 2009 ) . in the human - thymus - sever combined immunodeficient ( hu - thy - scid ) chimera mouse model , the authors further demonstrated that ebv promotes the generation of ifn--biased ebv specific cd8 nkt cells , which can suppress tumorigenesis by ebv associated malignancies in vivo ( xiao et al . to further illustrate the interplay between ebv and nkt development , the same group demonstrated that the average frequency of total and cd8 nkt cells in peripheral blood mononuclear cells ( pbmcs ) of healthy ebv latent individuals is significantly higher than that in patients with acute ebv i m or hl , and in ebv - negative normal control subjects . ebv challenge induced a population of nkt precursors develops and differentiates into mature cd8 nkt cells in the thymus and liver of human - thymus / liver - scid chimera mouse model . these cd8 nkt cells produce more perforin and are cd8 positive , similar to that detected on cd8 nkt cells in pbmcs from healthy latent ebv - infected subjects and i m patients at 1 year post - onset . the authors proposed that thymic ebv - infected dendritic cells and il-7 may regulate the cd8 nkt development process . it clearly demonstrated that ebv can induce differential cd4 versus cd8 lineage commitment , in addition to known classical endogenous elements ( he et al . , 2010 ) . thus the distinctive subsets of cd4 and cd8 nkt cells in ebv - infected individuals may differentially modify the pathogenesis of ebv . alternatively , it may be possible that the biased nkt will affect the specific individual 's response to later infections or malignant diseases . keeping the above observation in mind , we may check possible mechanisms involved in ebv associated autoimmune diseases , such as systemic lupus erythematosus ( sle ) and rheumatoid arthritis ( ra ; for a review , toussirot and roudier , 2008 ) . both sle and ra are complex disorders with a genetic background , as suggested by familial cases . patients of both diseases have higher titers of anti - ebv antibodies , impaired t cell responses to ebv antigens and higher viral load in pbmcs ( james et al . , 2001 ; alanine rich sequences and cellular nuclear antigens were identified ( vaughan et al . , 1995 ) . a proposed disease mechanism is the interplay between genetic predisposition and ebv infection leads to the development of cross reacting autoantibodies , and later the non - cross - reactive antibodies against autoepitopes ( toussirot and roudier , 2008 ) . in addition to sle and ra , multiple sclerosis ( ms ) is another ebv associated chronic inflammatory disease with repetitive damages of myelin sheet in the central nervous system ( cns ) . ms is a disease that also has been linked to genetic and environmental factors ( for a review , compston and coles , 2008 ) . based on the geographic distribution , ms was proposed to be a rare disease that caused by a common infection . the most promising data suggesting ebv as the viral factor is that the risk of ms is 20 times higher among people who have contracted i m , as compared with seronegative individuals ( ascherio and munger , 2007 ) . in a large scale follow - up study for ms development in us military , the risk of ms increased with elevated levels of serum antibodies to ebna complex and less strongly to vca igg . some of the serum antibody levels were elevated even 5 years before disease development ( levin et al . , 2005 ; compston and coles , 2008 ) . detection of ebv specific antibodies in ms patients also showed a highly correlation in other studies . however because ebv is highly prevalent in healthy population , it has been a long - term debate on the role of ebv as the etiology agent of ms . the detection of ebv dna or viral proteins by different groups then gave controversial results , which may be due to different samples included or the sensitivities of assays employed ( lunemann and munz , 2009 ) . recent detection of ebv markers in the postmortem brain tissue from patients with secondary progressive phase of ms thus provide a clue for the pathogenic contribution of ebv to ms patients . ( 2007 ) demonstrated that almost 100% of the early onset ms cases with the secondary progressive phase contain dysregulated ebv infected plasma cells in ms brains . lmps were regularly detected in ms brains , whereas viral lytic proteins were only detected in ectopic b cell follicles and acute lesions . notably , activated cd8 t cells with membrane associated perforin staining were observed at sites of major accumulation of ebv - infected cells , suggesting t cell cytotoxicity toward ebv positive plasma cells ( serafini et al . , 2007 ) . further study of the intrathecal b cells indicated that these cells are cd27 antigen - experienced cells and with the co - expression of lmp1 and 2a . moreover , lmp2a positive cells also express b cell - activating factor of the tumor - necrosis factor family ( baff ) , suggesting these cells are responsible for persistent intrathecal synthesis of oligoclonal antibodies . the ebv positive cell pattern is very similar to the ectopic follicles observed in the tonsil of healthy ebv carriers . the disease model of ms was proposed by the authors that through the proliferative , anti - apoptotic , and b cell activation signals provided by ebv latent proteins , ebv may promote the intracerebral expansion and maturation of b cells and form ectopic lymphoid follicles . it also explains that the oligoclonal igg in the csf and brain tissue is synthesized persistently by ebv positive b cells ( serafini et al . , 2010 ) . there are still remaining questions . why are the ebv positive b cells homing to brain ? other possibilities for the contribution of ebv in ms are also proposed by other groups . the idea is that virus positive cells may be few , but these cells may induce enough pro - inflammatory cytokine production and lead to the development of disease . for example , ebv was demonstrated to infect primary human brain microvessel endothelial cells in vitro ( casiraghi et al . , 2011 ) . the infection also leads to increased production of several pro - inflammatory mediators , such as ccl-5 and icam-1 , which may promote adhesion of leukocytes to the endothelium . it is likely that the entry of autoreactive t cells may follow a breach of the blood brain barrier ( bbb ) and lead to cns lesions in ms . it explains why viral and myelin - specific lymphocytes and macrophages infiltrate into ms brains , and interferon - beta treatment may prevent ms relapse through blocking virus replication and subsequent production of cytokines ( casiraghi et al . , 2011 ) . alternatively , another recent study focused on the development of cd8 cytotoxic t cells observed in ms patients ( ji et al . the authors used a major histocompatibility complex ( mhc ) class i - restricted tcr transgenic model that generates cd8 myelin basic protein ( mbp ) specific t cells to study the break of cd8 t cell tolerance and induction of cns autoimmunity . the results indicate that viral infection triggers the activation of cd8 t cells bearing dual tcrs in the experimental animals , suggesting these t cells may contribute to cns autoimmune diseases ( ji et al . , 2010 ; ransohoff , 2010 ) . indeed , dual - receptor tcrs are present in humans and proposed to enhance antiviral defense . the second receptor could be against myelin in a small subset of individuals , which may be associated with specific mhc ii subtypes . it is possible that reinfection or reactivation of the specific virus may activate the t cell antiviral memory and also the anti - myelin activity ( ransohoff , 2010 ) . the question then is why infection of ebv , but not other viruses , links to the development of ms . we may then think again the stimulatory effect of ebv on nkt development , regarding the viral modulation on immune system ( he et al . it was previously known that the infection of hiv or htlv-1 may result in a decrease in nkt cells ( lin et al . , 2005 ; azakami et al . , 2009 it thus indicates that various viral infections may have different impacts on the development of host immune response , and ebv may be a very unique virus . from an evolution point of view , it is plausible that ebv may serve certain roles to help immune system development in most population . the ebv associated diseases may be rare events resulting from host genetic variations , which let the host immune system be modified by ebv in a bias manner . the disease statuses may develop upon the stimulation of combinatory environmental factors such as other infectious agents , which may activate ebv replication at the same time . in other words , these ebv associated diseases may be due to the differential immune modulation ability of ebv in people with different genetic background , rather than a direct pathogenic effect of ebv gene products . taken together , multi - factorial study designs including genetic factors , individual variations of subsets of regulatory immune cells , and environmental factors such as different infections are required for understanding the pathogenic mechanism of ebv associated diseases in the future . the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

host immune system is designed ( or evolved ) to fight against different pathogens . many viruses infect the immune cells for the propagation of new progenies , thus the infection may modulate the host immune homeostasis . it has been more than 45 years since the discovery of epstein barr virus ( ebv ) from a burkitt 's lymphoma derived cell line . the ability of ebv to transform primary b cells in vitro leads to the suggestion for its oncogenic potential . however , except the clear understanding of the role of ebv in post - transplantation lymphoproliferative disease , it remains ambiguous why such a ubiquitous virus causes malignant diseases only in a very small subset of individuals . possible explanation is that ebv may cooperate with other environmental and host genetic factors and lead to the development of ebv associated neoplastic diseases . in addition to infecting b cells , recent studies revealed that ebv may impact host immune system more broadly than previously thought , for example the development of regulatory nkt subsets . instead of an intensive review , this article aims to provide a linkage to recent advances on the interplay between ebv and host immune system and to inspire further studies on ebv related diseases , especially autoimmune diseases .

EpsteinBarr Virus EBV and its Associated Malignant Diseases EBV and NKT Cell Development EBV and Autoimmune Diseases Conflict of Interest Statement

non - diabetic kidney disease in patients with diabetes is identified in biopsy - based studies with frequencies ranging 1060% [ 13 ] . indications for kidney biopsy in patients with diabetes are the presence of features atypical for diabetic nephropathy ( dn ) ; glomerular haematuria , acute kidney deterioration or severe proteinuria [ 2 , 3 ] . membranous nephropathy ( mn ) and iga nephropathy ( igan ) , superimposed on dn , are most prevalent in communities with a relatively high incident of disease , respectively [ 1 , 2 ] . mn alongside of dn can present with severe proteinuria and progress quickly to dialysis - dependent end - stage kidney disease ( eskd ) . concomitant anti - glomerular basement membrane ( gbm ) glomerulonephritis ( gn ) and dn is rare , with poor kidney outcomes reported [ 58 ] . the simultaneous or sequential occurrence of anti - gbm gn and mn is well recognized . however , this is the first report of concurrent seronegative anti - gbm gn , mn and dn . a 22-year - old caucasian male with type 1 diabetes mellitus ( t1 dm ) , presented with acute kidney injury ( aki ) , serum creatinine ( scr ) 387 mol / l and nephrotic syndrome ( timed urinary protein excretion 14 g / day , serum albumin 23 g / l ( 3550 g / l ) , underwent a diagnostic kidney biopsy . clinical assessment 1 year prior indicated minimal proteinuria ( albumin - to - creatinine ratio 1.5 mg / mmol ) and normal kidney function ( egfr > 90 ml / min/1.73 m ) at that time . antineutrophil cytoplasmic , extractable nuclear antigen ( ena ) and anti - gbm antibodies were undetected . urine studies showed protein - to - creatinine ratio 1.133 g / mmol , dysmorphic erythrocytes ( > 1000 10/l ) and lipiduria . the patient weighed 100 kg and had smoked 10 cigarettes per day for the past 7 years . there was no history of retinopathy or hypertension , illicit or non - steroidal anti - inflammatory drug use or alcohol dependence . he had been commenced on frusemide and irbesartan / hydrochlorothiazide 3 weeks earlier to treat oedema . the kidney biopsy demonstrated a focal segmental necrotizing gn with cellular and fibrocellular crescents involving 29 of 40 glomeruli ; another 6 glomeruli were sclerosed . there was moderate interstitial fibrosis and tubular atrophy with a patchy interstitial mixed chronic inflammatory cell infiltrate ( see figures 1a and b and 2a and b ) . weaker anti - albumin staining localized in a linear fashion to the gbm , bowman 's capsule ( bc ) and tubular basement membrane ( tbm ) staining ( figure 3a and b ) . under oil immersion ( 1000 magnification ) , a dual pattern of linear and granular glomerular peripheral capillary wall staining was seen . electron microscopy showed stage 1 mn with small subepithelial electron - dense immune - type deposits with early gbm spike formation ( figure 5a and b ) . the overall diagnosis was that of anti - gbm gn and stage 1 mn superimposed on class iii dn with kimmelstiel wilson lesions . ( b ) this glomerulus shows segmental necrosis ( arrow ) and large cellular crescent ( asterisk ) . ( b ) this glomerulus shows a large cellular crescent ( arrows ) . periodic acid silver stain . ( b ) in contrast , albumin shows strong staining of gbm , bc and tbm . c ) direct immunofluorescence at a higher magnification shows a dual pattern of igg immunofluorescence with linear gbm staining together with granular staining on the outside or urinary space aspect of the gbm ( arrows ) . images ( b ) and ( c ) were acquired on a nikon a1rsi confocal microscope with a z - slice of 0.6 m . 5.(a and b ) transmission electron microscopy shows gbm thickening with small subepithelial electron - dense deposits ( arrows ) with early gbm spike formation ( double arrows ) . original magnification 10 000 . ( b ) this glomerulus shows segmental necrosis ( arrow ) and large cellular crescent ( asterisk ) . ( b ) this glomerulus shows a large cellular crescent ( arrows ) . periodic acid silver stain . ( b ) in contrast , albumin shows strong staining of gbm , bc and tbm . ( a c ) direct immunofluorescence at a higher magnification shows a dual pattern of igg immunofluorescence with linear gbm staining together with granular staining on the outside or urinary space aspect of the gbm ( arrows ) . images ( b ) and ( c ) were acquired on a nikon a1rsi confocal microscope with a z - slice of 0.6 m . ( a and b ) transmission electron microscopy shows gbm thickening with small subepithelial electron - dense deposits ( arrows ) with early gbm spike formation ( double arrows ) . the simultaneous diagnosis of seronegative anti - gbm gn , mn and dn was consistent with clinical presentation of proteinuria , haematuria and aki , although unexpected , as anti - gbm antibody serology was negative ( orgentec , mainz , germany ) . the patient 's human leucocyte antigens ( hla ) were : a1 , 24 ; b8 , 39 ; dr4 , 16 . screening for serum anti - secretory phospholipase a2 receptor ( pla2r ) antibodies was not detected using an indirect immunofluorescence test ( euroimmun ag , lubeck , germany ) . in addition , pla2r was not detected by immunofluorescence in the paraffin - embedded kidney biopsy using anti - rabbit pla2r antibody ( atlas antibodies ) . treatment included corticosteroids ( 3 intravenous methylprednisolone 1 g / day then 75 mg / day oral prednisolone ) , oral cyclophosphamide ( 2 mg / kg / day ) after fertility protection measures and 10 alternate - daily plasmapheresis treatments ( 3 l volume exchanges , replacement albumin 4% ) . he was discharged with mildly improved stable kidney function , with scr 253 one week later , he developed small - volume haemoptysis that settled with oral antibiotics , cessation of smoking and cyclophosphamide reduction ( 1.5 mg / kg / day ) . prednisolone 60 mg / day was continued in light of further deterioration in kidney function , with scr 383 mol / l and worsening proteinuria at 19 g / day . another nine alternate - daily plasmapheresis treatments were initiated once neutropaenia resolved , attempting to salvage kidney function . his clinical course was complicated by h. zoster reactivation ( t7 dermatome ) that resolved with valaciclovir treatment . progressive renal disease and inability to monitor disease activity serologically led to a repeat kidney biopsy , which showed segmental sclerotic lesions and fibrous crescents in 13 of 22 glomeruli and another 3 glomeruli sclerosed . immunofluorescence showed a strong dual pattern of staining for igg as described in the first biopsy ( not illustrated ) . the overall diagnosis of the subsequent biopsy was inactive anti - gbm gn and mn superimposed on dn . persistent strong linear gbm staining for igg despite lack of active lesions in this biopsy . the patient commenced maintenance haemodialysis 14 weeks after initial presentation when refractory fluid overload ensued , coupled with no renal recovery . currently , 5 months after presentation , he is training for home haemodialysis and suitability for combined kidney this is an unusual report of the simultaneous diagnosis in a kidney biopsy of seronegative anti - gbm gn , mn and dn . kidney biopsy was undertaken in this patient with longstanding diabetes and clinical renal parameters not typical of dn . pulmonary involvement from anti - gbm disease was uncertain , as haemoptysis was minimal , settled with antibiotics and occurred in the context of smoking and recent immunosuppression . . anti - gbm kidney disease , characteristically a rapidly progressive crescentic gn associated with pulmonary haemorrhage and circulating anti - gbm antibodies directed against the nc1 domain of type iv collagen 3 chain ( 3(iv)nc1 ) , is commonly diagnosed through a combination of clinical , histological and serological findings . seronegative anti - gbm disease occurs in 23% of cases , where antibodies not detected by elisa methods are found with other biosensor techniques . jia et al . suggest that circulating anti - gbm antibodies undetectable by elisa may recognize cryptic and highly conformation - dependent epitopes restricted on 3(iv)nc1 . however , the gold standard for anti - gbm gn diagnosis is strong linear gbm histological staining for igg . occurrence of crescentic gn with dn is uncommon , with five previous reports of anti - gbm gn superimposed on dn [ 58 ] , and only one subject recovered kidney function . poor prognostic factors for kidney recovery described in anti - gbm gn include oligoanuria , scr > 600 mol / l , high serum anti - gbm antibodies ( elisa ) levels and a high percentage of crescents on biopsy . in biopsy - based studies , mn is a relatively common non - diabetic kidney pathology in diabetic populations [ 1 , 2 ] . though , severe proteinuria as biopsy indication suggests selection bias , as an autopsy study investigating kidney pathology in diabetes demonstrated no mn cases and only one igan in 210 subjects . outcomes in those with combined mn and dn are poor , both contributing to worsening proteinuria and acceleration of kidney injury . conversely , associations between mn and anti - gbm gn are well recognized , and were first described in 1974 . two recent reviews identified 30 cases , sequential occurrence in one - third ( either anti - gbm gn following mn or vice versa ) , and simultaneous diagnosis in the remainder [ 9 , 20 ] . reported outcomes varied with kidney recovery in one - third , progression to eskd in the majority and death in four patients . some have speculated that initial alteration in basement membrane permeability allows further disruption leading to heightened immune system exposure and development of additional disease [ 9 , 21 ] . seronegative anti - gbm gn and mn have not been reported together , although seronegativity itself is rare . anti - gbm disease is one of the few human autoimmune diseases where the autoantigen is known with multiple hla - positive associations , namely hla - dr15 and hla - dr4 [ 23 , 24 ] . hla typing in our patient was positive for hla - dr4 and -dr16 but negative for -dr15 . more recently , primary mn has been linked with the hla - dqa1 allele on chromosome 6p21 , and pla2r identified as a major autoantigen . circulating autoantibodies against m - type pla2r in the podocyte are present in 70% of idiopathic mn patients . serum pla2r antibody was negative in this patient and pla2r was not detected in the glomeruli on biopsy . rather secondary mn subsequent to gbm / podocyte injury caused by anti - gbm gn and/or dn is postulated . t1 dm , long considered a chronic autoimmune disease , results from anti - islet autoimmunity developing in genetically susceptible individuals , where major susceptibility loci map to hla - drb1 and hla - dqb1 , also located on chromosome 6p21 . immunological tolerance mechanisms prevent these diseases in healthy individuals and occurrence of all three in our patient suggests such tolerance may have broken down . the biopsy shows weak to moderate linear staining of gbm , bc and tbm for igg and albumin . however , in this case , there was very strong linear gbm staining for igg with negligible staining in bc and tbm , a pattern diagnostic of anti - gbm gn . in contrast , albumin showed diffuse moderate staining of gbm , bc and tbm ( illustrated in figure 3a ) . with triple pathology , kidney recovery seemed unlikely despite reasonable prognostic markers at presentation , scr < 600 mol / l and urine output > 2 l / day . subsequent complications , neutropaenia and opportunistic infection , in the setting of worsening histology with less overall activity , resulted in immunosuppression cessation and dialysis commencement , with a view to future combined kidney pancreas transplantation . the kidney biopsy in glomerular disease is invaluable , providing diagnosis and important disease information whilst aiding management decisions . despite advances with serological testing , this case continues to illustrate the importance of the biopsy . such as in this instance , kidney biopsies of patients with diabetes , particularly those with clinical features not typical of dn , may reveal other potentially treatable kidney pathology .

in diabetic patients with acute kidney injury ( aki ) , kidney biopsy often reveals non - diabetic kidney pathology . this case describes a patient with known type 1 diabetes who presented with aki , nephrotic syndrome and haematuria . combination pathology of seronegative anti - glomerular basement membrane antibody - mediated glomerulonephritis ( anti - gbm gn ) , membranous nephropathy ( mn ) and diabetic nephropathy ( dn ) was demonstrated . strong linear gbm igg - staining on biopsy with crescentic gn and clinical aki led to a diagnosis of anti - gbm gn , although serum antibodies were not detectable . features of dn , kimmelstiel wilson nodules and albumin staining were also present , along with features of mn , such as subepithelial deposits on electron microscopy . despite treatment with immunosuppression and plasmapheresis , there was no recovery of kidney function . coexisting anti - gbm gn and mn is well recognized , but the concurrent diagnosis with dn has not been described .

Background Case report Discussion Conflict of interest statement

dna fragments were cleaned - up , end - repaired , a - tailed , and ligated with methylated paired - end adapters ( purchased from atdbio ) . see supplementary information for details . in house generated wgbs libraries were aligned using maq in bisulfite mode to the hg19/grch37 reference assembly . subsequently , cpg methylation calls were made using custom software , excluding duplicate , low quality reads as well as reads with more than 10% mismatches . methylation ratios of individual cpgs were modeled using a beta - binomial model estimating parameters from the number of methylated and total reads overlapping a given cpg , incorporating replicates . only cpgs covered by 5 reads were considered for further analysis . cpg cluster differential methylation was determined by pooling cpg level methylation differences using a random effects model . cpg cluster methylation specificity was determined using the jensen - shannon divergence of a cpg cluster s methylation level distribution across all samples and a reference distribution representing either of the two extremes : completely unmethylated or fully methylated . in silico identified cpg islands were defined by genomic regions of at least 700bp length , an cpg observed vs. expected ratio of greater than 0.6 and a gc content greater or equal than 0.5 . for the snp analysis , we obtained the ceph snp set from uscs . gwas snps were retrieved from the gwas catalog , while most of the gwas snp grouping was taken from maurano et al .. for tfbs analysis , we retrieved peak files from the encode projects and collapsed replicates . dna fragments were cleaned - up , end - repaired , a - tailed , and ligated with methylated paired - end adapters ( purchased from atdbio ) . in house generated wgbs libraries were aligned using maq in bisulfite mode to the hg19/grch37 reference assembly . subsequently , cpg methylation calls were made using custom software , excluding duplicate , low quality reads as well as reads with more than 10% mismatches . methylation ratios of individual cpgs were modeled using a beta - binomial model estimating parameters from the number of methylated and total reads overlapping a given cpg , incorporating replicates . only cpgs covered by 5 reads were considered for further analysis . cpg cluster differential methylation was determined by pooling cpg level methylation differences using a random effects model . cpg cluster methylation specificity was determined using the jensen - shannon divergence of a cpg cluster s methylation level distribution across all samples and a reference distribution representing either of the two extremes : completely unmethylated or fully methylated . in silico identified cpg islands were defined by genomic regions of at least 700bp length , an cpg observed vs. expected ratio of greater than 0.6 and a gc content greater or equal than 0.5 . for the snp analysis gwas snps were retrieved from the gwas catalog , while most of the gwas snp grouping was taken from maurano et al .. for tfbs analysis , we retrieved peak files from the encode projects and collapsed replicates .

dna methylation is a defining feature of mammalian cellular identity and essential for normal development1,2 . most cell types , except germ cells and pre - implantation embryos35 , display relatively stable dna methylation patterns with 7080% of all cpgs being methylated6 . despite recent advances we still have a too limited understanding of when , where and how many cpgs participate in genomic regulation . here we report the in depth analysis of 42 whole genome bisulfite sequencing ( wgbs ) data sets across 30 diverse human cell and tissue types . we observe dynamic regulation for only 21.8% of autosomal cpgs within a normal developmental context , a majority of which are distal to transcription start sites . these dynamic cpgs co - localize with gene regulatory elements , particularly enhancers and transcription factor binding sites ( tfbs ) , which allow identification of key lineage specific regulators . in addition , differentially methylated regions ( dmrs ) often harbor snps associated with cell type related diseases as determined by gwas . the results also highlight the general inefficiency of wgbs as 7080% of the sequencing reads across these data sets provided little or no relevant information regarding cpg methylation . to further demonstrate the utility of our dmr set , we use it to classify unknown samples and identify representative signature regions that recapitulate major dna methylation dynamics . in summary , although in theory every cpg can change its methylation state , our results suggest that only a fraction does so as part of coordinated regulatory programs . therefore our selected dmrs can serve as a starting point to help guide novel , more effective reduced representation approaches to capture the most informative fraction of cpgs as well as further pinpoint putative regulatory elements .

Methods Summary Biological materials and sequencing libraries Data processing and analysis Supplementary Material

a thorough medline - based search was performed with mesh words , such as nephrogenic systemic fibrosis / nephrogenic fibrosing dermopathy , gadolinium , renal failure . a relationship between exposure to gadolinium - based contrast agents and nsf was suggested in 2006 . clinically , nsf mimics scleromyxedema , but tends to lack paraproteinemia , facial involvement or inflammatory cells , on histology . the term nephrogenic fibrosing dermopathy ( nfd ) has been replaced by nephrogenic systemic fibrosis, after it was shown that the fibrotic process is not only limited to the dermis but can also involve the underlying fascia , muscles , diaphragm , breast , myocardium and rete testis.[46 ] although rare , nfd should be considered as a differential diagnosis in patients on hemodialysis , with indurated skin lesions along with other conditions like scleromyxedema , scleroderma , eosinophilic fasciitis or toxic syndromes . the purpose of this article is to give the reader a clear but concise , evidence of nsf relevant to the present level of available information . hypothesized pathway for increased collagen deposition in nsf / nfd nephrogenic systemic fibrosis is a disorder primarily affecting middle - aged adults , although there is no racial or sex predilection for this disorder . it is chiefly seen in patients of chronic kidney disease , those on hemodialysis and those who have had a history of exposure to gadolinium - based contrast media . many endogenous as well as exogenous factors have been implicated in the causation of nsf . endogenous factors include thrombotic events , hypercoaguable states ( antiphospholipid antibody syndrome , anticardiolipin antibody ) , chronic hepatitis c infection , anasarca , and calciphylaxis . exogenous factors that are hypothesized to initiate the process of this disorder are erythropoietin , surgical intervention , vascular procedures , peritoneal dialysis , hemodialysis , and the use of gadolinium chelate contrast media during imaging studies . a putative role of endothelial cell damage and toxic substances is proposed , but it is yet to be established . since nsf occurs chiefly in the setting of chronic renal disease patients on dialysis or in renal transplant patients it is important for us to have a brief look into the pathophysiology of renal failure and its various laboratory parameters . chronic kidney disease is defined as either kidney damage or a gfr of less than 60 ml / min/1.73 m for more than three months . classification of chronic kidney disease based on decreasing glomerular filtration rate : in individuals with normal kidney function gadolinium rapidly distributes between the plasma and the tissue fluids . it has a half - life of approximately two hours and is cleared from the body via the kidney through glomerular filtration with a clearance varying from 1.1 to 1.6 ml / kg / min . more than 95% of the injected dose is eliminated in four to six half - lives and less than 3% is eliminated in the stool . in patients with advanced kidney failure ( stage 5 ) , the pharmacokinetics of the gadolinium complexes are altered . due to their relatively low molecular weight ( 500 kilodalton ) , small volume of distribution ( 0.28 l / kg ) and low protein binding , they are easily removed by hemodialysis , but not by peritoneal dialysis . in patients who have renal failure , the half - life of gadolinium is increased substantially ( up to 120 hours ) . hemodialysis is known to decrease the half - life of gadolinium and can prevent risk of nsf in renal failure patients exposed to contrast agents . gadolinium is a contrast medication that is used very frequently in magnetic resonance imaging studies like magnetic resonance angiography ( mr - angiography ) . two agents , namely , gadodiamide and gadopentetate dimeglumine are gadolinium chelate contrast agents routinely used for contrast enhancement . gadodiamide is a non - ionic chelate of gadolinium ( less stable compound ) and undergoes transmetallation with endogenous ions like iron , copper or zinc . transmetallation of gadolinium chelate leads to the release of free gadolinium through the replacement of gadolinium within the chelate molecule by body cations such as zinc or copper . of the two contrast media used , gadodiamide is more notorious for causing nsf due to the above - mentioned reasons . free gadolinium ions are less soluble and have a tendency to precipitate into different tissues through direct interaction with the cation - binding sites on the cellular membranes and extracellular matrix ( ecm ) , or through microembolization in an aggregate form . this explains the presence of deposits in the skin and soft tissues of patients who have had prior exposure to this contrast material . renal insufficiency leads to abnormal accumulation of ions in the body fluids and tissues ; these ions can combine with gadolinium and form insoluble conjugates . deposition of such complexes can lead to the activation of resident dermal fibroblastic cells , ultimately leading to excess accumulation of collagen and extracellular ground matrix ( mucin ) . the pathogenic mechanism involves cd45ro+ / cd34 + / collagen i positive circulatory fibrocytes that are recruited by the skin , yielding fibrosis . cd34 is a specific marker for adult hematopoietic stem cells , suggesting that these spindle fibroblast - like cells ( called fibrocytes ) may be circulating and derived from the bone marrow . these circulating fibrocytes are aberrantly targeted to the dermis , which causes a local release of a profibrotic cytokine - like transforming growth factor ( tgf)-1 . the dermis shows infiltration by cd68 + / xiiia+ dendritic cells , which release profibrotic cytokines . skin biopsy specimen of patients with nsf shows increased expression of the transforming growth factor ( tgf)-1 messenger rna and decorin messenger rna , which plays an important role in collagen metabolism . decorin has a major role in collagen fibrillogenesis , growth factor modulation , fibrocyte differentiation , and direct regulation of cellular growth . some authors have noted increased levels of serum procollagen iii peptide ( piiip ) in patients of nsf . the serum piiip level reflects the degree of tissue fibrosis in various fibrotic diseases and is used routinely to evaluate liver fibrosis in patients with psoriasis treated with methotrexate . the cutaneous lesions of nsf usually develop over a short period in most cases the lag time after gadolinium exposure is two weeks and subsequently assume a chronic , unremitting course . the distribution is often symmetrical , commonly involving the lower extremities , up to the knees , and the upper extremities up to the elbows [ figure 2 ] . the skin is characterized by a lumpy , nodular thickening with a tendency to form indurated irregular plaques with amoeboid projections . the affected areas and subcutaneous tissues are extremely hard , woody , and can be slightly warm to the touch . the joints underlying the nsf lesions are usually involved in a deep fibrotic process , causing severe flexion contractures ( particularly hands , wrists , ankles , and knees ) , with substantial loss of range of motion and significant disability . the condition rapidly follows a downhill trend ( even if treated ) and the patient becomes wheelchair bound , with loss of ambulation . even if no specific diagnostic test is available , the detection in the right clinical context ( renal failure ) of the characteristic skin changes , with unremarkable laboratory findings , is adequate to prompt a reasonable suspicion for nsf . ill - defined , shiny - pigmented patch on both the thighs skin thickness can be measured with the help of the modified rodnan skin thickness ( mrss ) score . imaging , and in particular mri ( without contrast ) , can be very helpful to define the extension of the deep fibrosing process and the presence of calcifications . an increased t1 signal is often present within the muscles underlying the affected surfaces , suggesting the presence of atrophy and fat degeneration . in addition , fat suppression protocols ( e.g. , fat - suppressed fast t2 weighted sequences ) can reveal the presence of fascial and muscular edema , particularly during the early phase of the disease . different from systemic sclerosis ( ssc ) , in nsf , the serological markers for autoimmunity are absent and nail - fold capillary microscopy examination is normal . the body distribution can be similar to systemic sclerosis ( i.e. , hands can be fully involved ) , but the face is usually spared . few authors have proposed a classification system for nsf depending on the clinical setting and prognosis [ table 2 ] . differential diagnosis of sclerosing / fibrosing skin disorder has been tabulated [ table 3 ] . possibility of nsf should be kept in mind in patients of kidney disease with impaired drug clearance and having sclerotic skin changes . investigations that could support the diagnosis of nephrogenic systemic fibrosis in the background of an appropriate clinical setting deep incision biopsy of the involved skin including the muscle is necessary to demonstrate the findings of nsf on histopathology . . thickened collagen bundles are deposited haphazardly in the dermis which are separated by large clefts and surrounded by numerous fibroblast - like ( spindle ) cells [ figure 3a and 3b ] . cd34 is a marker for adult hematopoietic stem cells , indicating that these cells are derived from bone marrow and are abnormally targeted to the dermis . note in a : a bluish staining mucin in the interstitium and the cleft formation between the collagen bundles diagnosis of nsf is straightforward in the presence of typical skin changes in the background of renal failure . to date , imatinib mesylate was useful in few cases , where it selectively inhibited signaling mediated by c - abl , c - kit , and the platelet - derived growth factor receptor [ figure 1 ] . the condition is refractory to oral corticosteroids and immunosuppressive agents like cyclophosphamide ( cytoxan ) , azathioprine , and mycophenolate mofetil . it is very strange to note that nsf develops or progresses rapidly in renal transplant patients despite the fact that they are on potent antigraft rejection regimes ( i.e. , prednisolone , cyclosporine , tacrolimus or sirolimus ) . long - term treatment with extracorporeal photopheresis in treating nsf is yet not clear pending placebo - controlled randomized studies . in patients with pre - existing end - stage renal ( esrd ) disease undergoing hemodialysis and exposed to gadolinium , at least three hemodialysis sessions should be performed to facilitate clearing of the gadolinium ; with the first session to be started within three hours of the contrast exposure . high - dose intravenous immunoglobulin was used by a few authors with partial improvement in skin tightness and joint mobility . it is proposed that intravenous immunoglobulin exerts an inhibitory effect on the circulating factor ( paraprotein ) which may have a stimulatory effect on the fibroblast . few reports have documented success with photodynamic therapy ( pdt ) , with the lipophilic agent methyl aminolaevulinate , in nfd . the pdt with hem - prodrug induces matrix metalloproteinases in fibroblasts and a reduction of collagen synthesis in the dermis . tran and colleagues have reported moderate success with uv - a1 therapy for nsf in four patients . nephrogenic systemic fibrosis is a potentially devastating disorder and is associated with suffering and poor quality of life in ill - fated renal failure patients . a thorough knowledge regarding this curious disorder will go a long way in the rational management of patients and will help the physicians to provide palliative treatment until the advent of a breakthrough in the discovery of drugs that will halt the process of aberrant fibrosis .

nephrogenic systemic fibrosis ( nsf ) is a relatively new fibrosing disorder which has caught the attention of various specialities in the past decade . nsf is an extremely disabling and often painful condition , affecting up to 13% of the individuals with chronic kidney disease . the administration of a gadolinium chelate contrast agent has been reported to induce the development of nsf , particularly in patients who have acute or chronic renal disease with a glomerular filtration rate ( gfr ) lower than 30-ml / min/1.73 m2 and in those with acute renal insufficiency . mass spectroscopy studies have demonstrated particles of gadolinium in the lesional tissue . the exact pathogenesis of this curious sclerosing condition is unknown . the role of the aberrant targeting of circulating fibrocytes to the peripheral tissues and viscera has been hypothesized . nsf has distinct clinicopathological features in the setting of renal failure and needs to be looked upon as a new entity on the block . the condition is characterized by irregular indurated plaques , with amoeba - like projections and islands of sparing , chiefly on the trunk and extremities . flexion contractures of fingers , knees , and elbow joints are known to occur in advanced cases of nsf . the course is frequently associated with painful episodes and loss of ambulation . histopathology shows haphazard arrangement of thickened bundles of collagen , varying amount of mucin , and increased population of fibroblast - like cells in the dermis . immunohistochemistry shows increased deposition of type - i procollagen and cd 34 + cells having fibroblastic activity . the condition is refractory to treatment with corticosteroids and immunosuppressive agents . various modalities of therapy such as uva1 phototherapy , imatinib mesylate , photodynamic therapy , plasmapheresis , extracorporeal photochemotherapy , and high - dose intravenous immunoglobulin have shown a moderate degree of improvement in skin thickness scores . a prudent option is restoration of renal function to normalcy via renal transplantation but to date the outcome of renal transplantation is unknown .

INTRODUCTION ETIOPATHOGENESIS [ CLINICAL FEATURES DIFFERENTIAL DIAGNOSIS LABORATORY TOOLS HISTOPATHOLOGY MANAGEMENT CONCLUSION

the neural adaptations to training that contribute to performance improvements depend on the type and duration of training . for example , learning to juggle daily for six weeks leads to structural changes in white matter density that persist for four weeks following cessation of training . shorter periods of training ( 30 mins ) also lead to neural changes , but these changes are less enduring . irrespective of the duration and type of training , motor learning can be divided into fast and slow learning phases , but the time involved in acquiring the performance gains in the different phases of learning is very much task specific . fast learning occurs after a single session of training , whilst slow learning occurs after several sessions , and involves off - line consolidation . the relatively short time course involved in inducing training - related changes in cortical activity with fast learning makes these types of protocols particularly suitable for studying the neural adaptations to training , and is the type of learning involved in the present study . the neural changes associated with training also vary considerably between individuals . some of the factors that influence an individual 's neural response to training include genetic polymorphisms ( e.g. , brain - derived neurotrophic factor ) [ 5 , 6 ] , attention , and age . a key goal of neurorehabilitation research is to understand the mechanisms involved in mediating the effectiveness of training , thereby allowing for better targeted interventions . in this context , although repetitive training of tasks or movements is most obviously associated with rehabilitation for motor disorders , such as those induced by stroke , it also forms the basis of several rehabilitation interventions in cognitive neuropsychology , such as anxiety and depression . the development of various noninvasive brain stimulation techniques , such as transcranial magnetic stimulation , has provided the opportunity to more effectively probe neural adaptation to training in humans . furthermore , experimental paradigms now exist that can induce changes in human cortex that modify neural pathways in a similar way to motor training . these paradigms involve either direct cortical stimulation [ 1214 ] , a combination of both peripheral and cortical stimulation [ 1517 ] , or repetitive peripheral stimulation [ 18 , 19 ] . when targeted to the motor cortex , the same ( or at least spatially very similar ) circuits are modulated with these experimental paradigms as with repetitive motor training [ 2 , 2022 ] . furthermore , the factors that are important in modulating training - related changes in performance ( e.g. , genetics , attention , and age ) also influence how the brain responds to the various noninvasive brain stimulation techniques ( e.g. , [ 8 , 23 , 24 ] ) . time of day is one factor that has recently been shown to influence the magnitude of experimentally - induced neuroplasticity in human motor cortex . using one such technique ( paired associative stimulation ; pas ) to induce plasticity within the human motor cortex , neuroplasticity induction was shown to be more effective and reproducible when experiments were performed in the afternoon or evening compared with the morning . the time of day modulation of neuroplasticity induction is due , at least in part , to changes in circulating cortisol levels . this finding suggests that neurorehabilitation of motor function should be more effective if carried out in the afternoon , but the effect of time of day on training - induced neuroplasticity has not been investigated . we hypothesised that if the neural circuits that drive neuroplastic change following pas are similar to those altered during motor training , then improvements in motor performance and training - induced neuroplasticity will be greater in the evening compared with the morning . we also predicted that these differences will be associated with changes in circulating cortisol levels . twenty - two right - handed participants ( aged 1937 years ; 10 females ) completed the study , which was approved by the university of adelaide human research ethics committee . all participants had no known history of neurological conditions and gave written informed consent to participate in the study . each participant attended two separate experimental sessions , once in the morning ( 8 am ) and once in the evening ( 8 pm ) . the experimental sessions were separated by at least one week , and the order was randomised . surface electromyographic ( emg ) recordings were made from left abductor pollicis brevis ( apb ) muscle . emg signals were amplified ( 1000 ) , filtered ( 20500 hz ) , and digitized ( 2000 hz ) using a ced 1401 interface ( cambridge electronic design ) and stored on computer for off - line analysis . acceleration recordings were made from the left thumb using a dual - axis accelerometer ( adxl311 analog devices inc . , ma , usa ) . the accelerometer was affixed to a splint that was taped to the second phalanx of the thumb , with its axes aligned to record abduction and flexion about the joint . acceleration signals were amplified ( 3 ) , filtered ( low pass 50 hz ) , digitized ( 2000 hz ) using a ced 1401 interface , and stored on a computer for off - line analysis . participants were provided with visual feedback about abduction and flexion acceleration for each trial and were encouraged to minimise flexion movements throughout the experiment . the mt task involved rapid abduction of the thumb and has been previously described [ 2 , 17 ] . the left hand was placed in a device that constrained the left forearm in mid - range supination and maintained the wrist in ~45 degrees extension . the left shoulder was kept in a neutral position ( slight external rotation ) , and the elbow was flexed at ~90 degrees . the device allowed movement of the thumb in all planes . the mt task consisted of repeated abduction of the left thumb at maximal acceleration , paced by an auditory tone ( 1000 hz tone , 100 ms duration ) once every 2 seconds for 30 minutes . participants were provided with performance feedback that consisted of visual display of maximum thumb acceleration on a computer screen for each trial , as well as verbal encouragement throughout the mt task . such a training task has been shown to demonstrate features of motor learning such as long - term improvement in performance [ 20 , 27 ] and the ability to interact with factors that influence learning [ 2 , 20 , 21 ] . it has , therefore , been used by several groups [ 2 , 17 , 20 , 21 , 27 ] as a model of ( fast ) motor learning . to quantify the effect of the mt task on motor performance , ten trials of maximal left thumb abduction acceleration were obtained prior to and following the mt task . in order for participants to familiarise themselves with the required task , they were allowed a few ( < 5 ) practice trials of the thumb abduction task at the start of the first experimental session only . all participants completed a tms safety screen and were excluded if there was a family history of epilepsy , were taking any neuroactive drugs , or had undergone neurosurgery . monophasic tms was applied through a figure - of - eight coil ( outer diameter of each wing 90 mm ) which was connected to a magstim 200 magnetic stimulator ( magstim , whitland , dyfed , uk ) . the coil was held tangentially to the skull with the handle pointing backwards and laterally at an angle of 45 to the sagittal plane at the optimal scalp site to evoke a motor evoked potential ( mep ) in the relaxed apb muscle of the left hand . with this coil placement , current flow the optimal scalp position was marked with a pen , and the coil was held by hand , with the position continually checked during tms . prior to mt , the tms intensity required to produce meps with a peak - to - peak amplitude of between 0.5 and 1.0 mv was determined ( sipre ) . ten meps using sipre were obtained prior to mt ( 0.2 hz ) , and then again following mt . the cortical excitability data were obtained immediately prior to the maximum thumb abduction acceleration data for both before and after mt . motor performance was assessed by measuring maximum left thumb abduction acceleration prior to ( pre - mt ) and five minutes following mt ( post - mt ) . there was no restriction on the frequency of thumb acceleration trials during the pre - mt and post - mt assessment periods . maximum thumb acceleration data were collected during the mt task and later analysed for rate of improvement in thumb acceleration and standard deviation of thumb acceleration during training ( see section 2.7 ) . cortical excitability was assessed by measuring mean peak - to - peak amplitude of the apb mep at rest . it was calculated by averaging the individual peak - to - peak amplitudes of meps elicited by 10 tms ( 0.2 s , intensity sipre ) delivered immediately prior to ( pre - mt ) and five minutes following mt ( post - mt ) . saliva samples were collected from each participant prior to commencement of mt and at the end of each experiment . saliva was frozen at 20c until assayed . on the day of assay , the saliva samples were thawed and centrifuged . twenty - five l of saliva was assayed in duplicate for cortisol by elisa ( hs - cortisol ; salimetrics , llc , state college , pa , u.s.a . ) . separate two - way repeated measures analyses of variance ( anovas ) were performed on thumb acceleration and apb mep amplitude with within - subject factors intervention ( two levels : pre - mt and post - mt ) and time of day ( two levels : am and pm ) . to investigate changes in thumb acceleration during the mt task , data were divided into six separate five - minute epochs ( 05 mins , 510 mins , 1015 mins , 1520 mins , 2025 mins , and 2530 mins ) . mean apb acceleration and the standard deviation ( sd ) of apb acceleration were calculated for the separate epochs . separate two - way repeated measures anovas were performed on the mean thumb acceleration and sd data with within - subject factors epoch ( six levels : 05 mins , 510 mins , 1015 mins , 1520 mins , 2025 mins , and 2530 mins ) , and time of day . a two - way repeated measures anova was performed on salivary cortisol concentration with within - subject factors intervention and time of day . linear regression analysis was used to assess a relationship between salivary cortisol concentration and changes in motor performance with training ( max . acceleration pre - mt ) and change in cortical excitability ( apb mep facilitation : post - mt mep amplitude / pre - mt mep amplitude ) . the salivary cortisol concentration data were log transformed to improve homoscedasticity . the strength of the relationship was quantified by the coefficient of determination ( r ) . for all analyses , p < 0.05 was chosen as the significance level , and unless stated otherwise , all group data are reported as mean sem . a two - way anova revealed that mt significantly increased maximum thumb acceleration by 28% ( f1,21 = 22.61 , p < 0.001 ; see figure 1 ) , but mt was not influenced by time of day ( f1,21 = 0.284 , p = 0.599 ) . in addition , there was no significant interaction between intervention and time of day ( f1,21 = 1.543 ) indicating that the improvement in thumb acceleration following training was independent of time of day . with 22 participants , an effect size of 0.241 ( partial = 0.055 ) and with an error of 0.05 , the power to detect an effect was 0.74 . two - way repeated measures anova revealed a significant effect of epoch ( f5,105 = 13.01 , p < 0.001 ) . post - hoc analysis revealed that mean maximum acceleration during the 05 minutes epoch was significantly less than at the 1015 minutes ( p = 0.003 ) , 1520 minutes ( p < 0.001 ) , 2025 minutes ( p mean maximum acceleration during the 510 minutes epoch was significantly less than during the 1520 minutes ( p < 0.001 ) , 2025 minutes ( p mean maximum acceleration during the 1015 minutes epoch was significantly less than during the 2025 minutes ( p = 0.002 ) epoch . motor performance during the mt task was not influenced by time of day ( f1,105 = 0.885 ) . the interaction term epoch time of day was not significant ( f5,105 = 1.322 ) , indicating that the improvement in performance during the mt task was independent of time of day . the variability of maximum thumb acceleration data during the mt task is shown in figure 2(b ) . two - way repeated measures anova revealed no significant effect of epoch on the standard deviation of maximum thumb acceleration data during the mt task ( f5,105 = 1.026 , p > 0.05 ) . the sd of acceleration during the mt task was not influenced by time of day ( f1,105 = 0.003 , p > 0.05 ) . the interaction term epoch time of day was also not significant ( f5,105 = 0 . tms intensity that was used to evoke test meps was 5% higher in the evening ( 73.6 2.8% mso ) compared with the morning ( 70.4 2.4% mso ) ( paired t - test , p = 0.037 ) . despite a time of day difference in test tms intensity , pre - mt apb mep amplitudes were not significantly different between groups ( am = 0.65 0.07 mv ; pm = 0.67 0.07 mv ; paired t - test ) . two - way anova revealed a significant effect of motor training on mep amplitude ( intervention effect : f1,21 = 4.463 , p = 0.047 ) . there was no effect of time of day on mep amplitude ( f1,21 = 0.165 , p = 0.688 ) . in addition , there was no significant interaction between intervention and time of day ( f1,21 = 0.086 ) indicating that the increase in mep amplitude following mt was independent of time of day . with 22 participants , an effect size of 0.222 ( partial = 0.047 ) and with an error of 0.05 , the power to detect an effect was 0.66 . linear regression analysis between the changes in motor performance ( acceleration ) with training and the extent of apb mep facilitation associated with training showed no significant relationship ( r < 0.01 ) . as expected , salivary cortisol concentration was significantly greater in the morning compared with evening experiments ( f1,21 = 52.633 , p < 0.001 ) . additionally , salivary cortisol concentration was significantly less following mt ( f1,21 = 8.737 , p = 0.008 ) . the interaction term time of day intervention was also significant ( f1,21 = 7.477 , p = 0.012 . post - hoc analysis revealed a significant reduction in salivary cortisol concentration following mt in the morning but not the evening experiments ( p = 0.001 ) . salivary cortisol concentration data are shown in figure 5 . since salivary cortisol concentration significantly reduced over the time it took to perform the mt task in the morning , the pre - mt and post - mt salivary cortisol concentrations were averaged to provide a value that reflects the mean circulating cortisol level during mt . this was used in the linear regression analysis of the association between salivary cortisol concentration and both motor performance and the extent of apb mep facilitation . there was no significant relationship neither between motor performance and the ( log of ) average salivary cortisol concentration ( r = 0.005 ; figure 6(a ) ) nor between the extent of apb mep facilitation and the ( log of ) average salivary cortisol concentration ( r = 0.016 ; figure 6(b ) ) . the principal finding from the present study was that the ballistic motor training task induced changes in motor performance and corticospinal excitability , but these changes were not influenced by time of day or circulating cortisol levels . repeated maximal left thumb abduction for 30 minutes increased motor performance ( indicated by an increase in maximal acceleration of thumb abduction ) and induced an increase in corticomotor excitability of a thumb muscle used in the task ( measured as an increase in apb mep amplitude ) . however , the magnitude of the changes in both motor performance and cortical excitability were similar in the morning and evening sessions . the present study was motivated by earlier research which showed that the effectiveness of plasticity induced in human motor cortex using paired associative stimulation is influenced by the time of day , with neuroplasticity induced more effectively in the evening compared with the morning [ 25 , 26 ] . in addition , the effects induced with pas were abolished when salivary cortisol levels were pharmacologically elevated , suggesting that cortisol levels mediate the effectiveness of pas . the pas paradigm , initially described by stefan et al . , repeatedly pairs a peripheral electrical stimulus with a later cortical ( tms ) stimulus delivered to the contralateral motor region . the change in cortical excitability induced with pas is believed to represent associative plasticity induced in motor cortex [ 15 , 29 ] . this form of plasticity shares many similarities with use - dependent plasticity that occurs following training [ 2 , 2022 ] . for example , both forms of plasticity are thought to involve long - term potentiation - like changes in synaptic efficacy [ 15 , 30 ] . furthermore , pas and motor learning interact in a homeostatic metaplasticity manner [ 2 , 2022 ] . therefore , the present study sought to investigate whether use - dependent plasticity , induced following a period of motor training , is similarly influenced by the time of day of training . performance of several motor tasks have been shown to be dependent on time of day . for example , force discrimination , muscle strength , and performance of a basic motor flicking and serial response task are all influenced by time of day . however , none of these studies examined whether the learning of these tasks was influenced by time of day . our results suggest that training - related improvements in motor performance ( figure 1 ) and cortical excitability ( figure 3 ) following motor training are neither influenced by the time of day nor by diurnal changes in circulating cortisol levels ( figure 6 ) . although no time of day differences in motor performance were reported following completion of the mt task , perhaps the rate of improvement in performance during the mt task was different in the morning and evening experiments . that is , although the magnitude of the improvement in motor performance was similar in morning and evening experiments , the improvement in performance in the evening experiments may have occurred more rapidly . mcdonnell and ridding demonstrated that there were differences in the rate , rather than the overall magnitude , of improvement in a grooved pegboard task following afferent stimulation . analysis of the thumb acceleration data during the mt task revealed that motor performance improved significantly during the mt task , but the time - course of improvement in performance was similar in the morning and evening experiments ( figure 2(a ) ) . selective attention is important in modulating the effectiveness of neuroplasticity induced with tms [ 23 , 37 ] . if subjects were not consistently attending to the training task , we would expect to see greater trial - to - trial variability in thumb acceleration . we do not think that time of day differences in attention to the task influenced our results as there were no significant differences in the trial - to - trial variability of task performance for training conducted in the morning versus evening sessions ( figure 2(b ) ) . there is good evidence that motor training increases cortical excitability in motor regions of the brain . for example , long - term learning of a sequential finger - thumb opposition task induces focal increases in blood flow to the primary motor cortex when participants perform the trained movements , as assessed with functional magnetic resonance imaging . moreover , a repetitive sequential finger training task , which improves motor performance ( evidenced by reduced errors ) , results in an expansion of motor cortical maps of the practicing muscles . using a repetitive ballistic pinch training task , muellbacher et al . also demonstrated an improvement in motor performance following the training task , and showed that the improvement in performance was associated with changes in cortical excitability assessed with tms . several other studies have demonstrated such a relationship between cortical excitability and performance [ 37 , 40 , 41 ] . since training - related changes in cortical excitability appear related to changes in motor performance , several studies have investigated whether an experimentally - induced increase in cortical excitability will influence motor performance . some studies have demonstrated a change in motor performance of the contralateral and ipsilateral hands [ 43 , 44 ] following rtms . however , there have also been reports that an rtms - induced increase in cortical excitability does not produce a change in motor performance [ 45 , 46 ] . when the time course of changes in these two variables ( cortical excitability and motor performance ) was assessed following motor training . muellbacher et al . reported that whilst performance improvements remained 30 days after training , motor cortical excitability had returned to baseline . one possible explanation may be that the training - related neuroplastic change induced in the motor cortex , as evidenced by an increase in cortical excitability , may represent an early stage of motor learning and that consolidation of that memory occurs in a remote area of the cortex . also , individuals with a polymorphism in brain - derived neurotrophic factor , a gene known to be important in mediating neuroplastic change show performance improvements following training , but do not show any training - related change in cortical excitability as assessed with tms . our results , showing no significant correlation between training - related changes in thumb acceleration and mep amplitude , further support the notion that the interaction between performance improvements following training and changes in cortical excitability assessed with tms is complex . we , therefore , contend that although similar neural circuits are activated and subsequently modified by motor training and various rtms paradigms ( including pas ) , they are ( a ) not identical and/or ( b ) are differentially sensitive to inputs from other cortical / subcortical structures . the current experimental design does not allow us to distinguish between these options , but this could be addressed in future studies . the results of the present study suggest that time of day , and circadian variation in circulating cortisol levels , do not influence the effectiveness of short - term motor training . an important caveat of the present findings is that we do report a null effect . a power analysis undertaken on the acceleration and mep data revealed that both data sets were somewhat under - powered ( power = 0.74 and 0.66 , resp . ) . with increased power , achieved by testing more participants , we could state with more confidence whether a time of day effect actually exists . however , we consider a time of day influence on performance and cortical excitability unlikely as the p value obtained for the critical time of day analyses for both performance ( p = 0.599 ) and cortical excitability ( p = 0.688 ) suggest that there is a high likelihood that time of day does not influence motor learning . in any case , our results suggest that the influence of time of day on motor learning is subtle , at best . this finding has implications in the cognitive domain , particularly when treatment or training involves a repetitive , use - dependent form of learning . specifically , the results suggest that performance improvements should occur equally effective and irrespective of the time of day that training is undertaken . however , it is becoming increasingly common to augment repetitive ( motor ) training with repetitive peripheral and/or cortical stimulation paradigms [ 4851 ] . prior activation of targeted neural circuits with such paradigms may offer a way of priming cortical circuits , making them more receptive to subsequent training . we suggest that in these instances factors that influence the effectiveness of tms - induced plasticity may , albeit indirectly , influence the effectiveness of subsequent training . [ 25 , 26 ] that time of day , and circulating cortisol levels , influence the effectiveness of tms - induced plasticity in the motor cortex may be important . in conclusion , a repetitive ballistic mt task improves motor performance and increases motor cortical excitability that outlasts the training period . however , the magnitude of these changes is not influenced neither by the time of day nor by physiological variations in endogenous salivary cortisol concentration . these findings are of importance to clinicians and researchers using therapies reliant on use - dependent plasticity to improve function . they suggest that the magnitude of improvements seen with repetitive training tasks is similar for training conducted in the morning and evening .

repetitive performance of a task can result in learning . the neural mechanisms underpinning such use - dependent plasticity are influenced by several neuromodulators . variations in neuromodulator levels may contribute to the variability in performance outcomes following training . circulating levels of the neuromodulator cortisol change throughout the day . high cortisol levels inhibit neuroplasticity induced with a transcranial magnetic stimulation ( tms ) paradigm that has similarities to use - dependent plasticity . the present study investigated whether performance changes following a motor training task are modulated by time of day and/or changes in endogenous cortisol levels . motor training involving 30 minutes of repeated maximum left thumb abduction was undertaken by twenty - two participants twice , once in the morning ( 8 am ) and once in the evening ( 8 pm ) on separate occasions . saliva was assayed for cortisol concentration . motor performance , quantified by measuring maximum left thumb abduction acceleration , significantly increased by 28% following training . neuroplastic changes in corticomotor excitability of abductor pollicis brevis , quantified with tms , increased significantly by 23% following training . training - related motor performance improvements and neuroplasticity were unaffected by time of day and salivary cortisol concentration . although similar neural elements and processes contribute to motor learning , training - induced neuroplasticity , and tms - induced neuroplasticity , our findings suggest that the influence of time of day and cortisol differs for these three interventions .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

cachexia is a wasting syndrome for which descriptions may be found as far as 2000 years ago , and is a consequence of cancer and other diseases , such as chronic obstructive lung disease , multiple sclerosis , congestive heart failure , tuberculosis , and aids , among others , with a high impact on quality of life . in this review , we focus primarily on cancer cachexia , which affects approximately half of all patients with cancer . in advanced stages the condition compromises the responsiveness to cancer treatment and represents , per se , the direct cause of death of up to 20% of all patients . the syndrome is characterized by unintentional significant reduction in body weight and , among other symptoms , reduced energy intake , fatigue , systemic inflammation , and metabolic abnormalities are frequently reported . despite the long search for etiologic factors underlying cachexia , and the fact that many scientific efforts have been devoted to its understanding , researchers agree that we are still a long way from knowing the whole truth about the exact mechanisms behind its etiology , which makes it very hard to diagnose and treat the syndrome , frustrating physicians and patients . the most widely accepted hypothesis is that cachexia would appear as the result of tumor - host interactions ( figure 1 ) , being deeply related to the increase and release of proinflammatory factors ( figure 2 ) [ 8 , 9 ] . marked weight loss is the central symptom in many of the proposed diagnostic criteria [ 1012 ] . in 2011 , the syndrome would thus develop through three different and specific stages : precachexia , when anorexia and metabolic changes may be observed before weight loss ; cachexia itself , with a weight loss 5% or bmi 20 and weight loss 2% or sarcopenia and weight loss > 2% and often reduced food intake and systemic inflammation ; and , finally , refractory cachexia , in which survival expectance usually does not exceed three months . in the wasting scenario in cancer cachexia neuroendocrine changes play an important part , provoking early satiety and aversion to food and leading to undernutrition . these , combined with diminished food absorption and hypermetabolism , lead to a negative energy balance [ 14 , 15 ] and contribute to the loss of mass , specially of adipose tissue and of skeletal muscle . nevertheless , peripheral tissues are highly affected by cachexia even before the presence of anorexia . thus , the loss of adipose tissue and skeletal muscle mass precedes any decrease in food intake , which at the initial period of wasting can be normal or even increased [ 17 , 18 ] . these tissues exhibit impaired homeostasis and altered metabolism , resulting in increased lipolysis in the adipose tissue and augmented proteolysis in the skeletal muscle . the white adipose tissue seems to be importantly adding to the inflammatory status in cachexia . several studies showed that circulating levels of cytokines are altered in cachectic patients [ 1922 ] . these cytokines elicit an inflammatory response in the adipose tissue , which then releases chemoattractant proteins , which in turn will recruit immune cells from the blood stream ; these cells infiltrate the tissue , provoking further release of proinflammatory mediators . as a consequence , lipolysis is activated , causing adipocytes and immune cells to secrete , in a vicious cycle , proinflammatory mediators such as tumor necrosis factor ( tnf - alpha ) , interleukin- ( il- ) 1 , interferon - gamma ( inf - gamma ) , and il-6 . these cytokines may reach other tissues through the circulation and are associated with increased muscle catabolism and reduced muscle protein synthesis . on the other hand , this organ responds by increasing the uptake of these substrates , which , ultimately , may lead to the onset of steatosis and the induction of acute phase protein secretion . recently , changes in metabolism and in aspects of the inflammatory response have been found to be modulated by mirnas , which are small noncoding rnas of approximately 1925 nucleotides ( nt ) , known to be regulatory molecules for some of the most important levels of genome function , including chromatin structure , chromosome segregation , transcription , rna processing , rna stability , and translation . these molecules are widely found in organisms including plants , nematodes , fruit flies , and mammals and are highly conserved among evolution . mirna biogenesis involves the transcription of genomic dna by rna polymerase ii to produce primary mirna transcripts ( pri - mirna ) . in sequence , the drosha - dgcr8 rnase complex initiates mirna maturation through the cleavage of a stem loop into the primary transcript . this generates a 60- to 70-nucleotide - long mirna precursor , the pre - mirna , characterized by the presence of an overhang of 2 - 3 nucleotides , still in the nucleus . the newly produced pre - mirna is then transported to the cytoplasm by exportin5 and processed to a double - stranded rna molecule of about 19 to 25 nucleotides in length by yet another enzyme , the dicer . once incorporated into the effector complex mirisc ( mirna - induced silencing complex ) , one strand of the recently produced rna molecule remains as a mature mirna [ 26 , 27 ] , while the other strand may be either degraded , incorporated into another mirisc , or exported to the periphery by exosomes to exert its effects in a paracrine or endocrine way [ 28 , 29 ] . the complex mirisc , together with the recently incorporated mature mirna , acts directly on the mrna to repress the translation of target genes by cleavage ( perfect or near - perfect binding ) or by forming a hairpin in the 3utr , through imperfect base pairing . the binding site may also not be in the 3utr , but in the orf or 5utr region of the target . according to the mirbase , over 6,000 mirna genes were identified in more than 223 known species , including viruses , plants , fungi , and animals . in humans , computational analysis estimates that more than 50% of human protein - coding genes are putatively regulated by mirnas . the expression of mirnas is highly dependent on tissue type , metabolic status , and presence of disease . several studies describe mirnas as important regulators of biological processes as cellular differentiation , proliferation , tissue development , and cell - type specific function and homeostasis . nowadays , an increased number of diseases have been found to be associated with altered mirnas expression [ 3436 ] . several mirnas have been studied and confirmed as having a role in inflammatory processes in peripheral tissues such as adipose tissue and muscle . moreover , there is strong evidence that mirnas would function as an effective system that regulates the magnitude of inflammatory responses , by displaying effects on cellular development and aspects of cellular function . mirnas such as mir-1 , mir-133a , mir133-b , mir-206 , mir-208 , mir208b , mir486 , and mir-499 are part of this group and are associated with cell growth and differentiation , stress responsiveness , and protection against apoptosis [ 39 , 40 ] . muscle protein degradation in cachexia is mainly mediated by the ubiquitin proteasome system , which is induced through the activation of e3 ligases , atrogin-1/mafbx , and murf-1 . the forkhead box o ( foxo ) signaling pathway participates in this process by the induction of the transcription of e3 ubiquitin ligases and has three members in skeletal muscle ( foxo1 , foxo3 , and foxo4 ) . muscle - specific overexpression of these proteins is described as sufficient to cause skeletal muscle atrophy in vivo ; and inhibition of foxo transcription activity prevents muscle fiber atrophy during cachexia . xu and colleagues verified that the mirna-486 decreases foxo1 protein expression and promotes foxo1 phosphorylation to suppress e3 ubiquitin ligases , presenting an excellent candidate for future studies on the mechanisms of regulation of muscle atrophy by mirnas in cachexia . mir-206 and mir-21 were also recently described as having a role in muscle wasting in catabolic conditions . mir-21 has been already confirmed as being produced and exported from tumor cells of rodent and humans and uptaken by the skeletal muscle , in exosomes . the effect of this process is the onset of proteolysis through toll - like receptor 7 signaling , in a jnk dependent manner . moreover , the detection of aberrant mirna expression in body fluids , that is , blood , urine , and saliva , opens ways to explore these molecules as diagnostic and prognostic tools for cancer cachexia . mirnas are also known to play a major role in the regulation of the transcription of several genes involved with key aspects of white adipose tissue metabolism . to date , one study involving cachectic patients , white adipose tissue , and mirna profile is available in the literature . in this study , mir-378 is strongly involved with catecholamine - stimulated lipolysis in adipocytes and modulates the expression of key lipolytic proteins such as lipe , plin1 , and pnpla2 . no information is available in the literature about mirnas expression and the modulation of inflammation in the white adipose tissue in specific wasting conditions . however , xie et al . , 2009 , demonstrated that a chronic inflammatory environment characterized by high cytokine concentration may , per se , change mirna pattern expression in the white adipose tissue , both in cultured differentiated adipocytes and in rodent models . potential mirna candidates for studies regarding adipose tissue inflammation and cachexia would be mir-155 , mir-146a , mir-21 , and mir-9 , whose expression is induced by the activation of innate immune system through toll - like receptors . considering that mirnas are known to regulate the expression of genes involved in several types of diseases as cancer and autoimmune disorders [ 34 , 35 ] and play a pivotal role in the regulation of inflammatory responses , the study of mirnas in cachexia is a promising field of research , and patients could benefit not only from the development of new targets for treatments , but also from earlier diagnosis . the discovery of noncoding rnas and the improvement of molecular biology techniques have changed the concept that inflammation could be understood and explained by the study of signaling pathways and by the contribution of specific proteins . knowledge on the regulation of gene and protein expression has changed profoundly , and mirnas are nowadays established as pivotal components of the signaling networks that modulate inflammatory processes , leading to wasting conditions such as cachexia . based on such evidence , we propose that mirnas participation in the onset and maintenance of cachexia should be added to the study of the syndrome ( figure 3 ) .

cancer cachexia is a paraneoplastic syndrome compromising quality of life and survival , mainly characterized by involuntary weight loss , fatigue , and systemic inflammation . the syndrome is described as a result of tumor - host interactions characterized by an inflammatory response by the host to the presence of the tumor . indeed , systemic inflammation is considered a pivotal feature in cachexia progression and maintenance . cytokines are intimately related to chronic systemic inflammation and the mechanisms underlying the release of these factors are not totally elucidated , the etiology of cachexia being still not fully understood . therefore , the understanding of cachexia - related mechanisms , as well as the establishment of markers for the syndrome , is very relevant . micrornas ( mirnas ) are a class of noncoding rnas interfering with gene regulation . different mirna expression profiles are associated with different diseases and inflammatory processes . mirnas modulate adipose and skeletal muscle tissue metabolism in cancer cachexia and also tumor and tissue derived inflammation . therefore , we propose a possible role for mirnas in the modulation of the host inflammatory response during cachexia . moreover , the establishment of a robust body of evidence in regard to mirnas and the mechanisms underlying cachexia is mandatory , and shall contribute to the improvement of its diagnosis and treatment .

1. Introduction 2. Cachexia Definition and Main Symptoms 3. Cachexia and Peripheral Tissues 4. miRNAs 5. miRNAs, Peripheral Tissues, Cachexia, and Inflammation 6. Conclusion

-aminobutyric acid ( gaba ) is the major inhibitory neurotransmitter in the central nervous system ( cns ) , playing a key role in the balance between inhibitory and excitatory circuits [ 1 , 2 ] . therefore , it is not surprising that dysfunctions in the gabaergic system lead to pathological conditions including hypokinetic diseases such as parkinson 's disease ( pd ) , and hyperkinetic diseases , such as huntington 's disease ( hd ) , when disruption of the gabaergic system occurs in the basal ganglia [ 35 ] . epilepsy , a pathology characterized by uncontrolled hyperactivity , is also tightly linked to deficits in gaba levels , as well as alterations in its synthesis , secretion , and reuptake , or reductions in the number of gabaergic interneurons [ 68 ] . almost 25 years ago , it was already postulated that controlling gaba delivery to specific brain areas should benefit each of these diseases [ 9 , 10 ] . cell transplantation is a powerful tool to introduce a new source of gaba and may allow reconstitution of neural circuits in the diseased brain [ 11 , 12 ] . to be successful , grafted cells should possess the ability to disperse through affected areas and differentiate into fully mature neurons expressing appropriate neurotransmitters , in this case gaba . ideally , these cells should also functionally integrate and modulate circuitry activity in the damaged host brain ; for instance , affecting its plasticity . , several transplantation assays with different gaba - producing cell types have been performed with disparate success in animal models of diseases . many cell types were partially successful in reverting some of the pathological anomalies observed in the grafted models . however , some of them presented important drawbacks , such as their poor tissue distribution , transient effect , maybe due to decreased gaba release over time [ 1315 ] , or in the case of es cells , the lack of safety due to potential generation of teratocarcinomas [ 16 , 17 ] . in the last decade , a better comprehension of how and where the cortical and hippocampal interneurons originate has led to use their neuronal precursors in transplantation [ 18 , 19 ] . we currently know that most of the gabaergic interneurons in the cortex and hippocampus are mainly generated in two regions of the subcortical telencephalon , known as the caudal and medial ganglionic eminence ( cge and mge ) , from where they migrate tangentially to their final destination in the cerebral cortex [ 1922 ] . in the last years , several groups have reported regenerative works using these mge - derived gabaergic precursors , with striking results [ 2328 ] . at present , they represent the most promising cell - based therapeutic alternative for gaba - related diseases . in this paper , we will summarize the main regenerative approaches using gabaergic grafts for the treatment of epilepsy and neurodegenerative disorders . these include the use of different sources of gabaergic precursors , with a special emphasis in the mge - derived cells , and their transplant in several model organisms of disease . in addition , we will also describe the implications of the gabaergic grafts on the modulation of synaptic activity and circuitry plasticity of the host . epileptic seizures reflect a hyperexcitation in the brain , which is attributed to an imbalance between inhibitory and excitatory networks . given the close relationship between gaba and epilepsy [ 6 , 8 ] , antiepileptic drugs ( aed ) targeting the gabaergic system are traditionally the preferred treatment , presenting an acceptable efficacy [ 29 , 30 ] . however , up to a third of patients continue to experience seizures on maximal tolerated drug therapy [ 31 , 32 ] . refractory epilepsy remains a large clinical problem , since surgical resection is only appropriate for a minority of patients [ 33 , 34 ] . in the last decades , cell - based therapies using gabaergic grafts have emerged as an alternative treatment for epilepsy , since they may restore the lost equilibrium by cellular replacement of the missing / altered inhibitory neurons or modulating the hyperactive excitatory system [ 3537 ] . the therapeutic strategies are multiple : general secretion of gaba , by the grafted cells to increase the seizure threshold , or specifically located in the focus of epilepsy and/or the areas responsible for seizure transmission to block it ; direct replacement of malfunctioning or lost inhibitory interneurons ; interaction of the transplanted gabaergic cells with activating system to modulate its plasticity , and levels of activity ; finally , rewiring of aberrant excitatory fibers , such as mossy fiber in temporal lobe epilepsy ( tle ) , towards inhibitory gabaergic cells . according to these strategies , several gabaergic cell types , with different origins and characteristics , have been assayed in animal models of epilepsy to evaluate their therapeutic potential . in the following sections , we describe in detail the most representative cell types and assays . a first therapeutic approach for epilepsy includes transplantation of fetal precursors from different brain regions , and cells genetically modified to produce and secrete gaba were transplanted into the hippocampus or in regions implicated in seizure generalization [ 9 , 1315 , 3841 ] . transplanted embryonic cerebellar and cortical tissue , rich in gaba or norepinephrine neurons , in the amygdala - kindled rat model of epilepsy . transplantation into the deep prepiriform area transiently raised seizure thresholds , showing for the first time that cell transplantation could be valuable for epilepsy treatment . previously , isacson et al . had already shown that transplantation of gabaergic cells from striatal primordia significantly ameliorates the lesion - induced locomotor hyperactivity in the ibotenic acid rat model of hd . these seminal works strongly suggested that intracerebral grafting of inhibitory neurons may be an adequate strategy for seizure suppression . following this strategy , several groups isolated cells from the late striatal primordial ( e14 - 15 in rats ) , to transplant them in regions thought to be critically involved in seizure propagation , such as the substantia nigra , as an effective means of permanently blocking seizure generalization in different models of epilepsy , mainly kindled rats [ 13 , 14 , 3840 ] . all the kindling studies reported significant increase in afterdischarge thresholds and marked reduction in seizure severity compared with pretransplantation values [ 13 , 17 , 42 ] . in drug - induced models of epilepsy , these cells also suppressed the development of motor - limbic seizures and reduced the mortality rate [ 3840 ] . however , the seizure - suppressing effect of gabaergic grafts was transient , likely due to progressive reductions in gaba levels . for this reason , it was attempted the development of immortalized glial and neuronal cell lines genetically engineered to produce gaba [ 3739 , 43 , 44 ] . the ability to generate self - renewing clonal populations of transplantable gaba - producing cells provides an unlimited cell source and a good level of control on gaba production . gaba - producing cell lines demonstrated the ability to retard the development of seizures and block the expression of established seizures in kindling , kainic acid , and pilocarpine models of epilepsy [ 3739 , 43 , 44 ] . the use of the sv40 large t oncogene for their immortalization raises concerns about tumorigenicity [ 38 , 39 ] . in addition , in the host brain , a strong tissue reaction was reported including graft rejection , massive infiltration of inflammatory immune cells , and gliosis . besides the concerns of tumorigenicity and immunogenicity , a major problem was the inability to sustain long - term effects due to the lack of survival or integration of the graft - derived cells . to date , there is no report of engineered neuronal cells becoming fully differentiated and integrated into the seizure circuit of the host . this lack of integration may limit access to trophic factors and thus reduce the survival potential of these cells , and as a consequence , their mediated effects are transient . the establishment of techniques that allow the isolation and culture of embryonic stem cells ( escs ) , and neuronal stem cells ( nscs ) from fetal and adult brain tissue , provided new sources of gabaergic cells for treating epilepsy to the scientific community [ 45 , 46 ] . escs are isolated from the inner cell mass of the developing blastocyst and retain the ability to generate every cell type present in the body , including neurons [ 47 , 48 ] . nscs show a more restricted ability to generate only those cell types that constitute the nervous system ; neurons , astrocytes , and oligodendrocytes . nscs can be expanded in culture using mitogens , mainly bfgf and egf , which keep them in an undifferentiated state , forming floating cell aggregates , named neurospheres [ 50 , 51 ] . both cell types , escs and nscs , are very promising in terms of providing an infinite supply of donor cells for neuropathological condition treatments . an additional advantage is the possibility to direct their differentiation toward specific cell types , in this case gabaergic neurons . in fact , default differentiation pathway for many sc lines in culture seems to be the gabaergic lineage [ 52 , 53 ] . despite these interesting properties , few studies report on the use of esc and nsc in animal models of epilepsy [ 45 , 46 ] . reported that esc - derived neuronal precursors ( esnps ) transplanted into the hippocampi of both control and pilocarpine - treated rats were able to generate action potentials and expressed voltage - gated na and k currents , as well as hyperpolarization - activated currents . anyway , electrophysiological activity and action potentials were lower than those in host neurons , typical of immature cells and suggesting an incomplete maturation process . indeed , the grafted cells formed big clusters , and there was no evidence of cell type - specific differentiation one month after the transplant . in addition , no obvious difference was found between the functional properties of the transplanted cells in sham control and in pilocarpine - treated rats , and no improvement was described in the symptoms or electrophysiological activity of the epileptic rats after the transplants . in contrast , carpentino et al . reported that grafted esnp into the normal and kainic acid - treated mice partially migrated and differentiated towards neuroblasts and dentate granule neurons , or oligodendrocytes and astrocytes , depending on the brain area where they were finally located . however , some cells grafted in mice not subjected to seizures displayed a marked tendency to form tumors , and this effect was more pronounced in the dentate gyrus than in the fimbria . this suggested that seizures induce molecular changes that promote region - specific neural differentiation and suppress tumor formation . finally , effects on the epileptic condition of the mice after esnp transplantation were not reported , as well . more recently , shindo et al . optimized a method to induce differentiation of gabaergic neurons from esnp , and transplanted them into kindled epileptic mice to analyze a possible morphological and functional recovery . this was likely due to gaba production of transplanted cells , since histological analysis showed a high percentage of cells expressing gad67 . however , the morphology and cluster formation of the grafted cells suggest a lack of integration in the host circuitry . from these reports , it is evident that the use of esc in epilepsy treatment needs to be improved . safer conditions to avoid tumorigenicity are necessary , and percentage and quality of differentiation toward gabaergic neurons should be increased . improving the differentiation protocols from esc and generating cell lines that are strongly committed to specific neural lineages in culture prior to grafting might be helpful . several groups are working with this idea and have reported advances in the generation of gabaergic interneurons from esc with high efficiency in vitro and a good degree of functionality in vivo . they can be isolated from fetal or adult brain regions already committed in the generation of certain types of neurons ; moreover , they prevent ethical issues and do not form tumors ; and they could potentially be harvested in culture for prolonged periods , as neurospheres , to be used as a source of donor tissue for grafting [ 4951 ] . have isolated and cultured nsc from two fetal regions of the rat and grafted them in epileptic models . in a succession of reports using e19 hippocampal grafts or cultured nsc from this region [ 5965 ] , they reported the ability of this precursors to give rise to both hippocampal pyramidal - like neurons and interneurons in the host brain . however , barely more than 50% of transplanted neurospheres became differentiated cells , showing mainly an astrocyte phenotype and only in a small proportion a neuronal one . integration of the transplanted cells was also poor ; they form big clusters interfering with the normal hippocampal morphology . however , grafts located in or near the degenerated ca3 cell layer established commissural projections with the contralateral hippocampus . in addition , they revealed the capability of these grafts to restore disrupted hippocampal mossy fiber circuitry by attracting host mossy fibers sufficient to suppress the development of aberrant circuitry in hippocampus . the graft - induced long - term suppression of aberrant sprouting may provide a new avenue for amelioration of hyperexcitability . similarly to the previous reports , the shetty 's group transplanted striatal nscs in the hippocampus of adult rats after status epilepticus induced by kainic acid . the cells , pretreated with fibroblast growth factor-2 and caspase inhibitors , presented a good survival rate but limited ability to migrate , remaining close to the injection site . nonetheless , a small percentage of these cells differentiated into gabaergic neurons and were able to reduce the seizure frequency in the kainic acid model of tle . human nsc have been also tested in the pilocarpine - induced rat model of tle . they differentiated into cells that were positive for gabaergic ( 26% ) , glutamatergic ( 2% ) , or astrocytic ( 21% ) markers . grafted cells reduced the amplitude of extracellular field excitatory postsynaptic potentials in the hippocampal ca1 , decreased the percentage of pilocarpine rats that developed spontaneous seizures , and declined both seizure frequency and severity . as mentioned in the introduction , in the last decade , the origin of cortical and hippocampal gabaergic interneurons has been elucidated [ 1922 ] . located in a restricted region of the ventral telencephalon known as the mge and cge , these precursors migrate long distances to cover the neocortex and hippocampal primordial where they complete their differentiation . in theory , these precursors should be good candidates for treating gaba - related diseases , since they are already committed to interneurons and migrate naturally long distance covering the brain parenchyma . they should overcome the difficulties presented by other sources of cells and achieve higher levels of inhibition or modulate the excitatory activity in the host . to verify this possibility , our group grafted fresh isolated , with no other manipulation , mge - derived precursors into the neonatal normal brain . mge - derived cells gave rise to neurons that migrated , embracing wide areas of the cortical plate , striatum , and the hippocampus . more than 70% of the grafted cells differentiated into fully mature gabaergic interneurons , demonstrated by the expression of molecular markers such as calcium binding proteins . more importantly , electrophysiological analysis demonstrated these cells were able to integrate into the local circuits and make functional synapses with existing neurons , influencing the level of gaba - mediated synaptic inhibition . this was the first time that full mature electrophysiological activity and modulation of the host activity by gabaergic grafts was demonstrated . these observations strongly suggested the complete maturation of the grafted cells and its suitability for cell - based antiepileptic therapies . in the following years , several groups tested these mge - derived cells in different animal models of epilepsy . as proof of principle for a cell replacement therapy after lost or reductions in gabaergic neurons , our group grafted mge - derived cells into a mouse model with a disinhibited brain environment caused by specific ablation of interneurons . this was achieved by intrahippocampal microinjection of the neurotoxic saporin conjugated with an analog of substance p ( ssp - sap ) , that selectively targets and eliminates the gabaergic interneurons expressing the substance p receptor , neurokinin-1 ( nk-1 ) . this experimental approach helped to address whether mge - derived interneurons can integrate under neuropathological conditions and not only increase but also restore deficits in the inhibitory synaptic function as consequence of reductions in the number of gabaergic neurons . the specific gabaergic ablation leads to reductions in gaba - mediated synaptic inhibition , hyperexcitability , and increased susceptibility to pentylenetetrazol - induced seizures ( ptz ) , similarly to other models with reductions in interneurons [ 6870 ] . mge - derived cells in ssp - sap - treated mice repopulate the hippocampal ablated zone with cells expressing molecular markers of mature interneurons . similar to transplants in normal neonatal brain , the grafted mge - derived cells migrated long distance covering the whole ablation area and acquired a fully mature morphology two months after transplantation with good survival rates ( ~25% ) . immunohistochemical analysis revealed that more than 60% of graft - derived cells expressed gaba and specific molecular markers for mature interneuron subpopulations . interestingly , electrophysiological analysis showed a restoration of the postsynaptic inhibitory current kinetics on ca1 pyramidal cells of ablated hippocampus after transplant , and more importantly , this was associated with reduction in seizure severity and decrease in postseizure mortality induced by ptz consistent with an enhancement of gabaergic inhibition after cell transplantation . this is logical , since we have verified mge - derived cell survival more than 1 year after the transplant and , importantly , tumor formation was never detected . mge - derived cells are able not only to replace a loss of gabaergic neurons and reduce the mortality to ptz - induced seizures , but also they show an intrinsic antiepileptogenic activity . baraban et al . grafted mge - derived cells into neonatal kv1.1 mutant mice , characterized by the lack of voltage - activated k channel , kv1.1 . these mice exhibit a high frequency of behavioural and electrographic seizures few weeks after birth . gaba - mediated synaptic and extrasynaptic inhibition onto host brain pyramidal neurons was significantly increased after bilateral transplant , and significant reductions in the total number , duration , and frequency of spontaneous electrographic seizures were observed . these findings suggest that mge - derived interneurons could prevent and ameliorate abnormal excitability in infants . this is an interesting possibility , since mge grafts may block generalization of seizures and improve life conditions in the patients . we have confirmed the anticonvulsant ability of these cells by maximum electroconvulsive shock ( mes ) assay after grafting in neonatal mice . two months after transplantation in postnatal day 3 mice , mge - grafted cells were able to protect against clonic seizures induced by mes , and a 5-fold reduction in the mortality rate was observed . this data strongly suggests that mge grafts block the generalization of the seizures and allow a better control of the transition between tonic and clonic seizures . if we consider the mge - grafts as a new aed , they perform better in mes assay than many aeds already commercially available in the clinic . however , before thinking of a clinical application of this cell type , some technical problems should be eliminated for instance , the limiting number of cells available for transplantation . mge cells , cultured as neurospheres , have also been tested in the kainic acid model of tle . however , the interaction of mge precursors with mitogens in culture seems to modify importantly their behaviour and neuronal commitment . mge neurospheres gave rise mainly to astrocytes and only in a small proportion to gabaergic cells after transplantation . nonetheless , these cells grafted into the hippocampi of adult rats restrained spontaneous recurrent motor seizures , with no improvement of the cognitive function . authors suggested that expression of gdnf by more than 50% of the grafted cells may underlie the therapeutic effect of mge - nsc grafts , given the role in seizure suppression of this neurotrophic factor . taken together all these works , we have a scenario where mge - derived cells are the most promising source of gabaergic neurons for cell - based therapies . however , before clinical application , we should continue studying the possible implication of the interaction of new grafted cells with those from the host ; their modulation of synaptic activity , maybe by modifying neuronal plasticity ; the possible consequences on behaviour . however , we should have in mind that epilepsy etiology is multiple , and in consequence not all of the epilepsies should response equally to mge - derived interneuron grafts . certain types of gabaergic interneurons together with aberrantly behaving excitatory pyramidal neurons in the subicular region of the hippocampus can precipitate epileptic seizures instead to stop them . in keeping with this idea , it has been also reported a role of gaba - mediated signaling in ictogenesis , contributing to epileptiform synchronization that lead to the generation of electrographic ictal events in the cingulated cortex and limbic areas of the brain [ 74 , 75 ] . therefore , grafting of certain subclass of gaba - producing cells in a wrong location in some epilepsy types may lead to seizure exacerbation . before clinical application , we should continue exploring the effects of the grafts on several animal models of epilepsy with different etiologies ; study the possible implication of the interaction of new grafted cells with those from the host ; their modulation of synaptic activity , maybe by modifying neuronal plasticity and the possible consequences on behaviour . pd is triggered by the loss of mesencephalic dopaminergic neurons localized in the substantia nigra pars compacta ( snpc ) . this cellular loss eliminates dopaminergic projections to the striatum and their supply of dopamine which modulates striatal - dependent extrapyramidal motor behaviour . therefore , pd patients experience motor dysfunctions including tremor , rigidity , bradykinesia , and postural instability . alleviation of motor symptoms is obtained by the administration of the dopamine precursor l - dopa ; however , its prolonged use over years induces the development of severe side effects known as dyskinesia ( abnormal involuntary movements ) that only in part are mitigated by different regimens of pharmacological coadiuvants . in addition , many attempts of gene and cell - based therapies are in progress to establish treatments that can be complementary and additive to the standard pharmacological approach . in particular , a gene therapy approach has been developed to deliver the glutamic acid decarboxylase ( gad ) gene , catalysing the synthesis of gaba , directly into neurons of the subthalamic nucleus . in pd , activity of the subthalamic nucleus ( stn ) is increased mainly because of reduced gabaergic input from the globus pallidus . interestingly , the focal delivery of gad in the stn contributed to reducing its overactivity leading to an amelioration of the clinical neurological symptoms . safety and tolerability of this gene therapy protocol has been demonstrated in a phase i trial although with a reduced number of patients and over a limited period of time ( 1 year ) . thus , promoting gabaergic neuronal activity in specific nuclei can contribute in restoring a balance in the basal ganglia neuronal outflow controlling the extrapyramidal motor system . in addition to these approaches , the clinical impact of cell replacement has been evaluated in animals and humans over the last two decades . these approaches are aimed to reconstitute a local dopaminergic network capable of a feedback controlled dopamine release upon delivering of dopaminergic neurons in the affected striatal compartment . a similar procedure has been pioneered in humans using cellular grafts of fetal nigral tissues [ 7880 ] . this approach led to some important symptomatic improvements , however , often associated with the development of extremely severe dyskinesia . these side effects are probably due to the high heterogeneity of the grafted tissue containing only a minimal fraction of dopaminergic precursors ( 5% ) in an overall population of different cell types including serotonergic and gabaergic neurons [ 82 , 83 ] . recently , an alternative strategy of cell transplantation has been validated in a pd animal model . this is based on transplanting gabaergic precursors isolated from the embryonic mge / cge into the adult striatum . at first glance , this approach introducing inhibitory neurons in a tissue already deprived of dopamine might seem counterintuitive . however , thinking of pd as an activity outflow unbalance among different striatal neuronal networks , this methodology finds a strong rationale . noteworthy , e14.5 mge / cge cells injected into a single site were able to migrate throughout the striatal tissue , but not beyond it . the extent of migration is similar to that described for these cells upon transplantation into the adult cortex ( see above ) . mge / cge gabaergic neuronal precursors have a tendency to actively disperse within different adult brain tissues , and this represents a strong attractive feature for an efficient cell - based therapy . however , this should not be considered of general rule , since the same cells grafted in the subthalamic nucleus are unable to migrate from the injection site . possibly , this is the case since cortex and striatum , contrary to thalamic areas , are the forebrain regions which are normally colonized by these cells during embryogenesis and might retain some molecular or structural cues that allow this behaviour even in adulthood . are these cells able subsequently to survive , mature , and integrate in the host striatal tissue ? martnez - cerdeo and colleagues found that despite the great majority of the mge / cge - transplanted cells which were lost after 1 year from transplantation , 1% of them survived and presented morphological and functional features of mature interneurons of the three major subtypes , namely , calretinin+ , therefore , only a minimal fraction of mge - transplanted cells are able to survive for long time in the striatal tissues and this probably reflects the need for establishing stable and functional connections with the host neuronal network for promoting their survival . remarkably , even though the transplanted interneurons accounted for only about 5% of the total endogenous gabaergic neuronal population , they were sufficient to elicit a significant motor and behavioural recovery in the 6-hydroxydopamine - lesioned rats . the authors revealed the integration of the grafted interneurons by showing the formation of de novo synapses with the host neurons , and hence , they suggest that it is the graft - mediated reorganization of the basal ganglia network that fosters the functional recovery observed . in fact , the striatum is the key centre of the extrapyramidal tract which controls thalamic efferents to the motor cortical regions . this circuitry is organized in two main neuronal assemblies known as the direct and the indirect pathways . the second restrains thalamic activity and is connecting striatum - internal and -external globus pallidus and thalamus . hence , these two pathways converge to the thalamus as their final target centre and regulate its activity by playing reciprocal opposing functions . in pd , first , it reduces the activity of the direct pathway while promoting the indirect pathway creating an upraised inhibitory outflow to the thalamus . one plausible mechanism by which mge - transplanted cells promote a symptomatic relief in pd animals is to restore a balance in the total output of these two pathways over the thalamus by preferentially inhibiting the indirect pathway . although this explanation needs more experimental evidences , nonetheless these studies reveal how a small transplanted population of interneurons has the capability to modulate the plasticity of long - ranging and complex neuronal circuitry and restore a functional unbalance between related neuronal systems . recently , similar cell transplantations of embryonic mge gabaergic precursor cells have been carried out in a mouse model of stroke . focal ischemia in cortical and nearby striatal areas was produced by middle cerebral artery occlusion , and embryonic mge cells were transplanted in multiple sites in adjoining regions . noteworthy , mge - transplanted animals improved in their locomotion and motor coordination with a significant improvement in both tests respect to sham - injected controls . similar to previous studies , embryonic mge cells developed in fully mature neurons featuring spontaneous action potentials and connecting to host neurons . however , the amount of mge grafted cells that differentiated into mature neurons after 4 weeks from transplantation were only a limited fraction accounting for 20% of the total . surprisingly , the rest of the cells resulted negatively for astrocyte or oligodendrocyte markers indicating that the transplanted cells remain blocked to a progenitor state unable to complete the differentiation in any cell lineage . this is in striking contrast with the differentiation behavior of grafted mge cells in the other disease murine models previously described . nonetheless , the authors noted that the mge cell grafting stimulates axonal reorganization of the host tissue . in fact , the axonal sprouting and neurite reorganization in the injured site was strongly increased after cell transplantation . these results suggest that grafted mge neurons might stimulate endogenous repairing mechanisms or formation of alternative neuronal assemblies to support the functions of the lost tissue . to which extent exogenous mge cells can trigger neuronal rewiring and plasticity of the host tissue remains to be better exemplified . to be noted , also mge cell graftings in pd animal models induced some changes in the host tissue as for instance the re - expression of the calcium - binding proteins calretinin and calbindin by host striatal cells nearby the transplantation site . the changes might also be promoted by all sorts of trophic factors released by the grafted gaba neuronal precursors that can stimulate neuritogenesis or synaptic connections . although many questions remain unanswered , transplantation of embryonic mge gabaergic cells has resulted surprisingly effectively in promoting clinical improvements in animal models for different chronic or acute neurological disorders . these results call for a better understanding of the cellular and molecular mechanisms by which the mge grafts can promote this positive outcome . one of them may be the increased delivery of gaba neurotransmitter . to date , direct biochemical measure of gaba concentrations after mge - derived grafting has not been reported . however , patch clamp analysis of spontaneous postsynaptic inhibitory currents in projection neurons of the grafted area strongly suggests a direct effect on their frequency and amplitude , mediated specifically by presynaptic gaba delivery from the transplanted cells [ 18 , 28 ] . one other mechanism may be secondary to release of trophic factors by the grafted cells . gdnf has been reported to be secreted by the astrocytes cotransplanted with the mge cells , what improve epileptic condition . we can not discard the delivery of some other neurotrophic factors that stimulate endogenous repairing mechanisms , or even neurogenesis , as mentioned above . further efforts should be devoted to decipher the multiple mechanisms implicated in the functional outcomes mediated by gabaergic cell transplants , including modulation of endogenous plasticity . cortical circuits are sensitive to experience during well - defined intervals of early postnatal development called critical periods [ 87 , 88 ] . after the critical period , plasticity is reduced or absent . monocular deprivation ( md ) is a classic model of experience - dependent plasticity . in the mammalian binocular visual cortex , neurons are activated to different degrees by visual stimuli presented to one eye or the other , a property called ocular dominance ( od ) . if vision is normal for both eyes during development , the majority of visual cortical neurons are binocular . if one eye is occluded during development , visual cortical neurons become dominated by the nondeprived eye . this change in od is taken as a sensitive index of plasticity of visual connections . od plasticity is particularly high during a critical period of postnatal development and declines with age [ 89 , 90 ] . accumulating evidence supports a pivotal role for late - developing excitation versus inhibition circuit balance in the initiation of sensitive periods . for example , the onset of visual cortical plasticity is delayed by genetic disruption of gaba synthesis [ 91 , 92 ] . conversely , the application of benzodiazepines or other treatments that accelerate gaba circuit function triggers premature plasticity . therefore , the onset of od plasticity is triggered by the establishment of a functional network of inhibitory synaptic transmission . southwell and colleagues asked whether transplantation of mge gabaergic precursors could be sufficient to trigger a plasticity respond in the host cortex . in mice , od plasticity reaches a peak in the fourth postnatal week , when cortical inhibitory neurons are 3335 days old . thus , the authors transplanted e13.5 mouse mge gabaergic precursors in perinatal or early - postnatal brains and ascertained the induction of visual plasticity in the host brains . grafted mge cells differentiated into gabaergic interneurons with a great efficiency and only 0.2% of them developed morphology of astrocytes . remarkably , the cellular graftings were able to successfully trigger visual plasticity in the host . however , this induction was achieved only for a short period of time which correlated with the age of the transplanted cells . in fact , transplantation was effective when the cells were 3335 days while soon later at 4346 days old the same cells failed to trigger the same effect . therefore , the cellular age of the transplanted population strictly determines the effects on cortical plasticity . the introduction of a supplemental amount of inhibitory interneurons would suggest that an increased inhibitory tone is the trigger for such neural rejuvenation . however , this is not the case since pharmacological enhancement of inhibition does not induce similar effects . the answer is rooted probably in the nature of the synaptic contacts established by grafted interneurons with the host neuronal circuitry . indeed , transplanted inhibitory neurons form weak but numerous synaptic connections with neighbouring excitatory neurons in the host brain . thus , these new connections are believed not to simply raise the general inhibitory tone , but rather to promote an overall reorganization of the cortical circuitry by introducing a new set of weak inhibitory synapses . this pattern of newly established synaptic contacts represent an ideal biological substrate capable of enhancing the hebbian plasticity mechanisms during the critical period . it is noteworthy that the grafted interneurons promote plasticity only when they reach a cellular age comparable to that of the endogenous counterpart during the critical period . this data strongly suggest that plasticity is successfully initiated by a cell - autonomous program endowed in interneuron progenitors which is minimally influenced by the age of the host tissue . these findings open a new scenario where cell transplantation might be effective in reprogramming neural activity up to triggering plasticity processes . nonetheless , a number of questions need to be answered to understand the safety and efficacy of this procedure . for instance , ( i ) whether transplantations of interneurons are able to induce visual plasticity even in the adulthood , ( ii ) if the grafted animals display any neuronal misbehaviour at later stages triggered by the action of the transplanted cells , ( iii ) if plasticity is promoted by a specific class of interneurons , and ( iv ) the assessment of the minimal number of cells to be grafted for inducing brain plasticity . although the transplanted - induced plasticity lasts for few days , this might be sufficient to trigger long - lasting neural circuitry reorganization . on this view , this procedure opens the exciting opportunity to induce or facilitate the restoration of normal function in injured or degenerative disorders . future studies are warranted to assess the regenerative potential of this approach in the developing and adult - diseased brains . considering the findings described above , mge gabaergic neurons exhibit properties well suited for therapeutic applications in seizures and other neuropsychiatric and neurodegenerative diseases . however , to explore such possibility , it is necessary to identify a renewable source for these cells compatible with their preclinical exploitation . an interesting possibility is generating these cells from in vitro differentiation of embryonic or somatic neural stem cells ( escs and nscs , resp . ) . nscs can be isolated from mouse and human neural tissues and can be propagated for long time in cultures as neurospheres or in adhesive conditions [ 97100 ] . upon differentiation , nscs generate a mixed population of gabaergic and glutamatergic neurons , whose ratio is dependent on specific growth culture and differentiation conditions [ 97 , 101 ] . in fact , after prolonged time in culture , they retain only in part the molecular regional code identity of the area from which they originate and result generally resistant to be coaxed to other neuronal subtypes [ 102104 ] . in contrast , numerous results have shown how escs can be converted efficiently in various neuronal subtypes . in particular , some procedures have been recently proposed for directing esc differentiation into cortical gabaergic interneurons . in an elegant set of experiments , danjo and colleagues refined the timing and concentrations of sonic hedgehog ( shh ) stimulation for inducing escs neural ventralization and generating either lge or mge progenitors . in the latter case , esc - derived mge progenitors displayed the ability to migrate and distribute into the developing cortex generating gabaergic interneurons . interestingly , the authors further showed how a diverse source of fgf signalling can alternatively select for an mge- or cge - derived gabaergic cell fate . these results set the experimental conditions to generate different subtypes of cortical gabaergic interneurons with specific electrophysiological and connectivity properties . further , a different study showed the ability of esc - derived mge progenitors to complete their maturation once transplanted in vivo generating functional cells with physiological and neurochemical characteristic of gabaergic cortical interneurons . these findings lay the ground for testing the potential of esc - derived gabaergic interneurons to treat preclinical model of neurological disorders upon direct cell transplantation .

numerous neurological disorders are caused by a dysfunction of the gabaergic system that impairs or either stimulates its inhibitory action over its neuronal targets . pharmacological drugs have generally been proved very effective in restoring its normal function , but their lack of any sort of spatial or cell type specificity has created some limitations in their use . in the last decades , cell - based therapies using gabaergic neuronal grafts have emerged as a promising treatment , since they may restore the lost equilibrium by cellular replacement of the missing / altered inhibitory neurons or modulating the hyperactive excitatory system . in particular , the discovery that embryonic ganglionic eminence - derived gabaergic precursors are able to disperse and integrate in large areas of the host tissue after grafting has provided a strong rationale for exploiting their use for the treatment of diseased brains . gabaergic neuronal transplantation not only is efficacious to restore normal gabaergic activities but can also trigger or sustain high neuronal plasticity by promoting the general reorganization of local neuronal circuits adding new synaptic connections . these results cast new light on dynamics and plasticity of adult neuronal assemblies and their associated functions disclosing new therapeutic opportunities for the near future .

1. Introduction 2. GABAergic Cell Therapy for Epilepsy 3. GABAergic Grafts for Parkinson's Disease (PD) and Stroke 4. MGE GABAergic Cellular Grafts Induce Cortical Plasticity 5. New Sources for MGE GABAergic Neurons

depression is a common mental health problem in older adults , not only affecting mood but also leading to functional decline in those affected . it reduces quality of life and well - being , and increases the risk of disability , suicide , and mortality . moreover , it has a significant impact on families and health care organizations.1 the world health organization projects that depression could become the single highest contributor to the global disease burden by 2030.2 management of depression in older adults is critical , and strategies to prevent and reduce depressive symptoms are urgently needed . physical activity , being a noninvasive and low - risk behavior , is an alternative or complementary intervention that can be used to prevent and treat depressive symptoms.3,4 physical activity ( pa ) is defined as any bodily movement produced by skeletal muscles that results in energy expenditure , and can be categorized as occupational , sporting , conditioning , household , or other activity.5 it is generally considered an effective intervention for decreasing the prevalence of depressive symptoms and promote their remission.613 however , this conclusion is based mainly on results from studies in the general population6,7 or in special populations such as adolescents,8 postnatal women,9 menopausal women,10 immigrants,11 and patients with certain conditions such as type 2 diabetes or obesity undergoing bariatric surgery,12,13 all of whom are likely to derive a benefit . in older adults , whose ability and practice for pa is age - related decline,14 it is controversial about whether changed patterns of pa ( eg , intensity weakens , duration shortens , or frequency reduces ) are still effective to maintain mental health.4 there are some evidence in support of , as follows . firstly , cross - sectional studies have found an inverse correlation between pa and symptoms of depression in older adults,1517 and agree that engaging in more pa is associated with a lower risk of such symptoms . a nonclinical study by salguero et al in 436 older spanish people aged 6098 years concluded that pa was related to both the physical and mental components of health - related quality of life and the risk of depressive symptoms ( odds ratio [ or ] 0.155 , p<0.01).15 another nonclinical study in the usa , conducted as part of the national social life , health and aging project in 1,349 older people aged 6585 years , showed that pa in later life was correlated inversely with symptoms of depression ( r=0.30 , p<0.001).16 a nonclinical study in 2,727 older subjects ( 65 years ) from the taiwan national health interview survey by chen et al established that leisure time pa was associated with fewer depressive symptoms . compared with participants expending 2,000 + kcal / week on pa during leisure time , the risk of experiencing depressive symptoms was significantly higher in those expending 1999 kcal / week ( or 2.06 , p<0.01 ) and 0 kcal / week ( or 3.72 , p<0.001).17 secondly , many longitudinal studies have confirmed that engaging in pa can reduce the incidence of depressive symptoms in older adults , as well as ameliorate these symptoms or increase the likelihood of their remission.1820 lucas et al conducted a prospective , 10-year clinical and nonclinical study in 49,821 older american women aged 5075 years , and found that higher levels of pa were associated with a lower incidence of depression , and the multivariate relative risk comparing the highest level ( 90 minutes / day ) with the lowest level ( < 10 minutes / day ) of pa was 0.80 ( p<0.001).18 ku et al conducted an 11-year , nonclinical follow - up study in 1,160 older taiwanese adults aged 67 years from the taiwan s health and living status of the elderly survey , and found that initial levels of pa were negatively associated with changes in depressive symptoms ( =0.34 , p<0.05).19 however , the conclusions of longitudinal studies are not always consistent . a 2-year nonclinical follow - up study by walker et al in 909 older australians aged 6074 years reported that pa did not decrease depressive symptoms at any point in time ( f=1.65 , p=0.177).20 thirdly , interventional trials have confirmed that pa is effective in reducing depressive symptoms or enhancing the effect of antidepressant medication in older adults.2125 pereira et al conducted a randomized controlled nonclinical trial in 451 older brazilian women aged 6589 years , and found a significant difference in pre - intervention and post - intervention geriatric depression scale scores in both muscle strength exercise and aerobic exercise ( f=38.18 , p=0.001 ) , indicating that the effects of both exercise protocols were comparable with regard to decreasing depressive symptoms ( f=1.76 , p=0.185).21 other research , such as a nonclinical study by lincoln et al in older american patients with diabetes ( n=58 , 65 years , f=20.38 , p<0.0001)22 and another by williams and tappen in older american patients with alzheimer s disease ( n=45 , 71101 years , f=3.26 , p=0.0492)23 also demonstrated a positive effect of pa training on depressive symptoms . in addition , a nonclinical study of qigong by tsang et al ( n=82 , 65 years , f=2.619 , p=0.041)24 in chinese hong kong and a clinical study of tai chi by lavretsky et al ( n=112 , 60 years , f=2.26 , p<0.05)25 in american patients with major depression were demonstrated to have the same effects . with advances in research on the antidepressant effects of pa , the potential for its use as a treatment for depression is being increasingly recognized . however , there were still challenging results of studies questioning the effects of pa . an important nonclinical randomized controlled trial in the uk published recently in the lancet showed no statistically significant benefit of pa on depression in 891 elderly care home residents aged 65 years ( or 0.76 , p>0.05 ) , and concluded that moderately intense exercise did not reduce depressive symptoms.26 lastly , there have been some positive systematic review findings and guideline recommendations made regarding pa for health purposes in the aged population.2731 a systematic review by bridle et al of the effect of exercise on depressive symptoms in older adults concluded that : for older people who present with clinically meaningful symptoms of depression , prescribing structured exercise tailored to individual ability will reduce depression severity.27 guidelines from the american college of sports medicine and the american heart association on pa for older adults recommend : a minimum of 30 minutes on 5 days each week for moderate - intensity aerobic pa , or a minimum of 20 minutes on 3 days each week for vigorous - intensity aerobic pa.28 in korea , the recommendation from the national council of sports for pa is at least 30 minutes of at least moderate activity on three or more days a week.29 most recommendations reached a consensus that at least moderate - intensity pa has a positive effect on general health . however , a nonclinical study by loprinzi in 708 american older adults ( aged 65 years ) found that both light ( or 0.80 , p=0.01 ) and moderate to vigorous ( or 0.78 , p=0.01 ) intensity pa were inversely associated with depression , and confirmed that even light - intensity pa can have a positive effect on depressive symptoms.30 a systematic review of pa and prevention of depression by mammen highlighted that there is promising evidence that any level of pa , including low levels ( eg , walking up to 150 minutes / weeks ) , can prevent future depression , with study population samples ranging in age from 11 to 100 years.31 to summarize , in spite of the challenge of some studies showing a moderate at best or no statistically significant effect of pa on depression in older adults,26 pa is expected to becoming accepted as a low - risk and highly cost - effective intervention for depressive symptoms . pa could be promoted as a public health strategy to modify depressive symptoms in later life . the usa and europe have undertaken a number of epidemiological and experimental investigations of pa and depressive symptoms in the elderly.15,16,18,22,23,25,26,28,30 korea,29,32 japan,33,34 and taiwan17,19 have also increased their research efforts in this area . however , such studies in the people s republic of china are lacking . to address this gap in the literature , we performed a study in a large cohort of older chinese veterans to investigate the relationship between pa and depressive symptoms in a nationally representative epidemiological project with adjustment for a comprehensive range of confounders . a cross - sectional study was conducted from 2009 to 2011 in 277 military communities located in 18 cities nationwide across the people s republic of china , as a part of the chinese veteran clinical research project investigating chronic noncommunicable diseases in older chinese veterans.35 the study was approved by the ethics committee of the chinese pla general hospital ( 07bjz04 ) , and by the ethical review boards in each of the participating districts . veterans aged 60 years who had lived continuously in the community for at least 1 month and agreed to participate in the survey were enrolled . the cvcr protocol is described in detail elsewhere.35 this paper only describes the methods used to investigate pa and depressive symptoms . a two - stage , stratified , cluster sampling approach was applied . a structured questionnaire was used during a routine , door - to - door census . in the first stage , information on sociodemographics ( age , sex , ethnicity , education , marital status , region of residence , living status ) , lifestyle ( pa , hobbies and interests , smoking , alcohol consumption , daily care , participation in social activity ) , adverse experiences ( negative life events , electromagnetic field exposure ) , and medical conditions ( self - rated health , chronic disease , cognitive function ) was collected . in the second stage , depression status was evaluated using the center for epidemiological studies depression scale ( ces - d ) . the data were obtained directly from subjects if they were cognitively intact or from an informant , who was usually a closely related caregiver , with respect to the subject s condition when the subject was cognitively impaired . the level of self - reported depressive symptoms was measured using the chinese version of the ces - d , which has been evaluated for reliability and validity36 and extensively utilized in epidemiological surveys in the chinese population.3739 the ces - d is a 20-item self - reported instrument , comprising 16 negative affect and four positive affect items , such as i felt depressed , participants were asked about the number of days on which they experienced every effect item during the previous week . respondents reported the frequency of occurrence of each negative affect item on a four - point scale : 0 ( rarely or none of the time ; less than 1 day ) , 1 ( some of the time ; 12 days ) , 2 ( much or a moderate amount of the time ; 34 days ) , or 3 ( most or all of the time ; 57 days ) . higher scores on the ces - d indicate more depressive symptoms . a standardized ces - d score of 15 is considered normal , a score 20 indicates definitive depressive symptoms , and a score > 15 and < 20 indicates possible depressive symptoms . in our study , cases with depressive symptoms included both definitive and possible ones . questions about participation in leisure activities , including pa and participation in social activities , as well as hobbies and interests , were introduced into the structured questionnaire . information on pa was self - reported using a one - year pa questionnaire , which was self - administered and convenient to use,34,40,41 and generally eliminated the influence of season and weather as well as temporary inpatient stays or accident - related events . subjects or their caregivers were asked to respond to whether or not the subject regularly participated in any sport or exercise activities in the last one year with a yes if they partook in pa lasting 30 minutes a day on 3 days a week ( active ) , otherwise as no ( inactive ) . the intensity of pa was identified with self - sensations during pa , both of which were accordant . these included a self - detected increase in heart rate , respiration rate , sweating , and muscle fatigue . 60% to 80% of maximal heart rate ( 220 actual age ) , indicates moderate - intensity pa . according to the above , each type of pa was rated as light intensity ( self - reported slightly increased heart rate and respiration rate , insignificant sweating , no perceived muscle fatigue , and actual heart rate < 60% of maximal heart rate during pa ) or moderate - vigorous intensity ( marked increase in heart rate and respiration rate , significant sweating , perceived muscle fatigue , and actual heart rate 60% of maximal heart rate during pa ) . if a participant only engaged in light - intensity pa , they were categorized as light intensity . if a participant engaged in both light and moderate vigorous intensity pa , or only engaged in moderate - vigorous intensity pa , they were categorized as moderate - vigorous intensity . hobbies and interests were selected from a list , including calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creative writing , watching television / listening to the radio , and playing cards / mahjong . smoking was defined as continuous or cumulative smoking of at least one cigarette a day for more than 6 months during life . negative life events that may affect mental state were elicited , including combat experience , persecution in the chinese cultural revolution , bereavement , and economic hardship . occupational electromagnetic field exposure was sought by questioning for a history of working with radar , communications , missiles , or electricity . self - rated health was evaluated by a standardized multichoice question , how would you rate your health on a three - point scale ( good , moderate , or poor ) . chronic diseases were identified by trained researchers , using a combination of clinical assessment , self - reporting , and medical chart review and were recorded as yes or no . cognitive function was assessed using a comprehensive test battery , and classified as cognitively normal , mild cognitive impairment , or dementia , according to neuropsychological test scores , such as mini - mental state examination , montreal cognitive assessment , and ability to perform activity of daily living . all data were double - entered and verified in epidata ( version 3.1 , the epidata association , odense , denmark ) . descriptive statistics were used to characterize the sample . in univariate analyses ( unadjusted model ) , pearson s chi - squared test , correction for continuity , or fisher s exact probability test were performed as appropriate to calculate the associations for categorical variables , including that between pa and depressive symptoms , to identify underlying correlates . multivariate logistic regression was used to adjust for any of the factors that reached a p - value 0.20 in univariate analyses , to control for possible confounding effects . a univariate general linear model was used , with ces - d score as the dependent variable , age as the covariate , and the aforementioned categorized factors as independent variables , while adjusting for potential confounders . all statistical analyses were performed using statistical package for the social sciences version 18.0 ( spss inc . , a cross - sectional study was conducted from 2009 to 2011 in 277 military communities located in 18 cities nationwide across the people s republic of china , as a part of the chinese veteran clinical research project investigating chronic noncommunicable diseases in older chinese veterans.35 the study was approved by the ethics committee of the chinese pla general hospital ( 07bjz04 ) , and by the ethical review boards in each of the participating districts . veterans aged 60 years who had lived continuously in the community for at least 1 month and agreed to participate in the survey were enrolled . the cvcr protocol is described in detail elsewhere.35 this paper only describes the methods used to investigate pa and depressive symptoms . a two - stage , stratified , cluster sampling approach was applied . a structured questionnaire was used during a routine , door - to - door census . in the first stage , information on sociodemographics ( age , sex , ethnicity , education , marital status , region of residence , living status ) , lifestyle ( pa , hobbies and interests , smoking , alcohol consumption , daily care , participation in social activity ) , adverse experiences ( negative life events , electromagnetic field exposure ) , and medical conditions ( self - rated health , chronic disease , cognitive function ) was collected . in the second stage , depression status was evaluated using the center for epidemiological studies depression scale ( ces - d ) . the data were obtained directly from subjects if they were cognitively intact or from an informant , who was usually a closely related caregiver , with respect to the subject s condition when the subject was cognitively impaired . the level of self - reported depressive symptoms was measured using the chinese version of the ces - d , which has been evaluated for reliability and validity36 and extensively utilized in epidemiological surveys in the chinese population.3739 the ces - d is a 20-item self - reported instrument , comprising 16 negative affect and four positive affect items , such as i felt depressed , participants were asked about the number of days on which they experienced every effect item during the previous week . respondents reported the frequency of occurrence of each negative affect item on a four - point scale : 0 ( rarely or none of the time ; less than 1 day ) , 1 ( some of the time ; 12 days ) , 2 ( much or a moderate amount of the time ; 34 days ) , or 3 ( most or all of the time ; 57 days ) . higher scores on the ces - d indicate more depressive symptoms . a standardized ces - d score of 15 is considered normal , a score 20 indicates definitive depressive symptoms , and a score > 15 and < 20 indicates possible depressive symptoms . in our study , cases with depressive symptoms included both definitive and possible ones . questions about participation in leisure activities , including pa and participation in social activities , as well as hobbies and interests , were introduced into the structured questionnaire . information on pa was self - reported using a one - year pa questionnaire , which was self - administered and convenient to use,34,40,41 and generally eliminated the influence of season and weather as well as temporary inpatient stays or accident - related events . subjects or their caregivers were asked to respond to whether or not the subject regularly participated in any sport or exercise activities in the last one year with a yes if they partook in pa lasting 30 minutes a day on 3 days a week ( active ) , otherwise as no ( inactive ) . the intensity of pa was identified with self - sensations during pa , both of which were accordant . these included a self - detected increase in heart rate , respiration rate , sweating , and muscle fatigue . 60% to 80% of maximal heart rate ( 220 actual age ) , indicates moderate - intensity pa . according to the above , each type of pa was rated as light intensity ( self - reported slightly increased heart rate and respiration rate , insignificant sweating , no perceived muscle fatigue , and actual heart rate < 60% of maximal heart rate during pa ) or moderate - vigorous intensity ( marked increase in heart rate and respiration rate , significant sweating , perceived muscle fatigue , and actual heart rate 60% of maximal heart rate during pa ) . if a participant only engaged in light - intensity pa , they were categorized as light intensity . if a participant engaged in both light and moderate vigorous intensity pa , or only engaged in moderate - vigorous intensity pa , they were categorized as moderate - vigorous intensity . hobbies and interests were selected from a list , including calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creative writing , watching television / listening to the radio , and playing cards / mahjong . smoking was defined as continuous or cumulative smoking of at least one cigarette a day for more than 6 months during life . daily care requirement and social participation were recorded as yes or no . negative life events that may affect mental state were elicited , including combat experience , persecution in the chinese cultural revolution , bereavement , and economic hardship . occupational electromagnetic field exposure was sought by questioning for a history of working with radar , communications , missiles , or electricity . self - rated health was evaluated by a standardized multichoice question , how would you rate your health on a three - point scale ( good , moderate , or poor ) . chronic diseases were identified by trained researchers , using a combination of clinical assessment , self - reporting , and medical chart review and were recorded as yes or no . cognitive function was assessed using a comprehensive test battery , and classified as cognitively normal , mild cognitive impairment , or dementia , according to neuropsychological test scores , such as mini - mental state examination , montreal cognitive assessment , and ability to perform activity of daily living . the level of self - reported depressive symptoms was measured using the chinese version of the ces - d , which has been evaluated for reliability and validity36 and extensively utilized in epidemiological surveys in the chinese population.3739 the ces - d is a 20-item self - reported instrument , comprising 16 negative affect and four positive affect items , such as i felt depressed , participants were asked about the number of days on which they experienced every effect item during the previous week . respondents reported the frequency of occurrence of each negative affect item on a four - point scale : 0 ( rarely or none of the time ; less than 1 day ) , 1 ( some of the time ; 12 days ) , 2 ( much or a moderate amount of the time ; 34 days ) , or 3 ( most or all of the time ; 57 days ) . the four positive affect items were reversed when using the four - point scale . higher scores on the ces - d indicate more depressive symptoms . a standardized ces - d score of 15 is considered normal , a score 20 indicates definitive depressive symptoms , and a score > 15 and < 20 indicates possible depressive symptoms . in our study , cases with depressive symptoms included both definitive and possible ones . questions about participation in leisure activities , including pa and participation in social activities , as well as hobbies and interests , were introduced into the structured questionnaire . information on pa was self - reported using a one - year pa questionnaire , which was self - administered and convenient to use,34,40,41 and generally eliminated the influence of season and weather as well as temporary inpatient stays or accident - related events . subjects or their caregivers were asked to respond to whether or not the subject regularly participated in any sport or exercise activities in the last one year with a yes if they partook in pa lasting 30 minutes a day on 3 days a week ( active ) , otherwise as no ( inactive ) . the intensity of pa was identified with self - sensations during pa , both of which were accordant . these included a self - detected increase in heart rate , respiration rate , sweating , and muscle fatigue . 60% to 80% of maximal heart rate ( 220 actual age ) , indicates moderate - intensity pa . according to the above , each type of pa was rated as light intensity ( self - reported slightly increased heart rate and respiration rate , insignificant sweating , no perceived muscle fatigue , and actual heart rate < 60% of maximal heart rate during pa ) or moderate - vigorous intensity ( marked increase in heart rate and respiration rate , significant sweating , perceived muscle fatigue , and actual heart rate 60% of maximal heart rate during pa ) . if a participant only engaged in light - intensity pa , they were categorized as light intensity . if a participant engaged in both light and moderate vigorous intensity pa , or only engaged in moderate - vigorous intensity pa , they were categorized as moderate - vigorous intensity . subjects were canvassed directly for their sociodemographic data . hobbies and interests were selected from a list , including calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creative writing , watching television / listening to the radio , and playing cards / mahjong . smoking was defined as continuous or cumulative smoking of at least one cigarette a day for more than 6 months during life . daily care requirement and social participation were recorded as yes or no . negative life events that may affect mental state were elicited , including combat experience , persecution in the chinese cultural revolution , bereavement , and economic hardship . occupational electromagnetic field exposure was sought by questioning for a history of working with radar , communications , missiles , or electricity . self - rated health was evaluated by a standardized multichoice question , how would you rate your health on a three - point scale ( good , moderate , or poor ) . chronic diseases were identified by trained researchers , using a combination of clinical assessment , self - reporting , and medical chart review and were recorded as yes or no . cognitive function was assessed using a comprehensive test battery , and classified as cognitively normal , mild cognitive impairment , or dementia , according to neuropsychological test scores , such as mini - mental state examination , montreal cognitive assessment , and ability to perform activity of daily living . all data were double - entered and verified in epidata ( version 3.1 , the epidata association , odense , denmark ) . descriptive statistics were used to characterize the sample . in univariate analyses ( unadjusted model ) , pearson s chi - squared test , correction for continuity , or fisher s exact probability test were performed as appropriate to calculate the associations for categorical variables , including that between pa and depressive symptoms , to identify underlying correlates . multivariate logistic regression was used to adjust for any of the factors that reached a p - value 0.20 in univariate analyses , to control for possible confounding effects . a univariate general linear model was used , with ces - d score as the dependent variable , age as the covariate , and the aforementioned categorized factors as independent variables , while adjusting for potential confounders . all statistical analyses were performed using statistical package for the social sciences version 18.0 ( spss inc . , 8,742 had data available for analysis of depressive symptoms , giving a response rate of 90.35% . the median age was 82.29 ( interquartile range 80.2584.60 ) years , and ranged from 60 to 105 years . the sample comprised predominantly the oldest old ( 80 years , 70.7% ) , males ( 95.7% ) , people of han ethnicity ( 97.9% ) , the more higher educated ( secondary or above education , 60.6% ) , married and remarried ( 86.2% ) , those living in the eastern part of the people s republic of china ( 70.7% ) , and those living with family / other ( 97.1% ) . a greater proportion of the sample participated in pa ( 85.3% ) , with hobbies and interests of reading ( 92.0% ) and watching television / listening to radio ( 94.7% ) , were never smokers ( 57.5% ) , never drinkers ( 52.6% ) , did not require assistance with self - care ( 85.9% ) , did not actively participate in social activities ( 60.4% ) , had good self - rated health ( 55.2% ) , and had not experienced negative life events ( 84.6% ) or electromagnetic field exposure ( 90.9% ) . the most common chronic diseases were prostatic hyperplasia ( 77.3% ) , coronary heart disease ( 68.8% ) , hypertension ( 67.3% ) , and cataract ( 56.3% ) . almost half the sample ( 49.1% ) had some degree of cognitive decline . the overall prevalence of depressive symptoms in the sample was 6.74% ( 95% confidence interval 6.247.24 ) , which is notably lower than the 40.3% ( 95% confidence interval 38.741.8 ) reported previously for the general older chinese population.39 sensitivity analyses were performed to examine the influence of missing data , and little s missing completely at random test indicated that the missing pattern was random ( p>0.05 ) and would be negligible . with regard to leisure time pa , the participants engaged predominantly in light - intensity pa ( 81.84% ) , such as walking , biking , dancing , gardening , gate ball , billiards , qigong , and tai chi . a few participants engaged in moderate - vigorous - intensity pa ( 18.16% ) , such as running , jogging , swimming , tennis , ping pong ball , and working out at the gym . many variables were found as to be potentially associated with depressive symptoms in older veterans , and ten were demonstrated to be independently associated with depressive symptoms in adjusted analyses with multivariate logistic regression , as shown in table 2 . with regard to the main focus of this study , in an unadjusted model with univariate analyses , pa ( defined as 90 minutes a week ) was significantly associated with a decreased likelihood of depressive symptoms ( 5.43% versus 18.83% , p<0.0001 ) . after adjusted analyses with multivariate logistic regression for controlling confounders , pa was still inversely associated with depressive symptoms , and was the only independent protective factor identified in this study ( or 0.57 , 95% confidence interval 0.440.72 , p<0.0001 ) . the risk of prevalent depressive symptoms among subjects who were physically active ( pa 90 minutes a week ) was decreased by 43% when compared with those who were physically inactive ( pa < 90 minutes a week ) . moreover , there was a significant difference in ces - d scores between the physically active and inactive groups of pa in the univariate general linear model ( f=59.07 , p<0.0001 ) , as shown in table 3 . in contrast , hobbies and interests as calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creative writing , watching television / listening to the radio , and playing cards / mahjong , all categorized as relatively sedentary behavior , were not associated with a decrease in depressive symptoms in unadjusted or adjusted analyses ( see table 2 ) . there were no significant difference in ces - d scores between groups with these hobbies and interests and those without in the univariate general linear model ( see table 3 ) . 8,742 had data available for analysis of depressive symptoms , giving a response rate of 90.35% . the median age was 82.29 ( interquartile range 80.2584.60 ) years , and ranged from 60 to 105 years . the sample comprised predominantly the oldest old ( 80 years , 70.7% ) , males ( 95.7% ) , people of han ethnicity ( 97.9% ) , the more higher educated ( secondary or above education , 60.6% ) , married and remarried ( 86.2% ) , those living in the eastern part of the people s republic of china ( 70.7% ) , and those living with family / other ( 97.1% ) . a greater proportion of the sample participated in pa ( 85.3% ) , with hobbies and interests of reading ( 92.0% ) and watching television / listening to radio ( 94.7% ) , were never smokers ( 57.5% ) , never drinkers ( 52.6% ) , did not require assistance with self - care ( 85.9% ) , did not actively participate in social activities ( 60.4% ) , had good self - rated health ( 55.2% ) , and had not experienced negative life events ( 84.6% ) or electromagnetic field exposure ( 90.9% ) . the most common chronic diseases were prostatic hyperplasia ( 77.3% ) , coronary heart disease ( 68.8% ) , hypertension ( 67.3% ) , and cataract ( 56.3% ) . almost half the sample ( 49.1% ) had some degree of cognitive decline . the overall prevalence of depressive symptoms in the sample was 6.74% ( 95% confidence interval 6.247.24 ) , which is notably lower than the 40.3% ( 95% confidence interval 38.741.8 ) reported previously for the general older chinese population.39 sensitivity analyses were performed to examine the influence of missing data , and little s missing completely at random test indicated that the missing pattern was random ( p>0.05 ) and would be negligible . with regard to leisure time pa , the participants engaged predominantly in light - intensity pa ( 81.84% ) , such as walking , biking , dancing , gardening , gate ball , billiards , qigong , and tai chi . a few participants engaged in moderate - vigorous - intensity pa ( 18.16% ) , such as running , jogging , swimming , tennis , ping pong ball , and working out at the gym . many variables were found as to be potentially associated with depressive symptoms in older veterans , and ten were demonstrated to be independently associated with depressive symptoms in adjusted analyses with multivariate logistic regression , as shown in table 2 . with regard to the main focus of this study , in an unadjusted model with univariate analyses , pa ( defined as 90 minutes a week ) was significantly associated with a decreased likelihood of depressive symptoms ( 5.43% versus 18.83% , p<0.0001 ) . after adjusted analyses with multivariate logistic regression for controlling confounders , pa was still inversely associated with depressive symptoms , and was the only independent protective factor identified in this study ( or 0.57 , 95% confidence interval 0.440.72 , p<0.0001 ) . the risk of prevalent depressive symptoms among subjects who were physically active ( pa 90 minutes a week ) was decreased by 43% when compared with those who were physically inactive ( pa < 90 minutes a week ) . moreover , there was a significant difference in ces - d scores between the physically active and inactive groups of pa in the univariate general linear model ( f=59.07 , p<0.0001 ) , as shown in table 3 . in contrast , hobbies and interests as calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creative writing , watching television / listening to the radio , and playing cards / mahjong , all categorized as relatively sedentary behavior , were not associated with a decrease in depressive symptoms in unadjusted or adjusted analyses ( see table 2 ) . there were no significant difference in ces - d scores between groups with these hobbies and interests and those without in the univariate general linear model ( see table 3 ) . the results of this study confirm and extend previous research by demonstrating an inverse relationship between pa and depressive symptoms in a large cohort of older chinese veterans . various correlations with depressive symptoms were sought , and pa was found to the only factor protecting against symptoms of depression . even after controlling for a range of confounders , such as age , sex , variations in lifestyle , negative life events , the most common chronic diseases , and level of cognitive function , the relationship between pa and depressive symptoms remained significant ( or 0.57 , 95% confidence interval 0.440.72 , p<0.0001 ) . the independent protective effect of pa on depressive symptoms was far stronger than any of the other healthy lifestyle components , such as the above - mentioned hobbies and interests , social participation , not smoking , and abstaining from alcohol , which were not found to be associated with decreased depressive symptoms . the median ( interquartile range ) age of the sample was 82.29 ( 80.2584.60 ) , making it highly representative of older - old people , and even the oldest - old . there was an indication that the antidepressant effect of pa also extended to the oldest - old , although many researchers thought it difficult to get positive result of pa antidepressant effect in the oldest - old.4 the majority of study participants engaged in light pa ; active pa was defined as 90 minutes a week , so pa in this study would have been mainly light intensity . it was shown that light - intensity pa was probably also protective against depressive symptoms , even though the guidelines for pa in older adults mainly recommend pa of at least moderate intensity . the mechanisms that may account for the inverse association between pa and depressive symptoms are not completely understood , but there are several plausible hypotheses . the neurobiological hypothesis suggests that pa may stimulate synthesis , release , and metabolism of serotonin and -endorphins , increase neurotransmission of norepinephrine , attenuate the response of hypothalamic - pituitary - adrenal axis to reduce levels of cortisol , a stress hormone , stimulate growth of new nerve cells in the hippocampus , and regulate cerebral blood flow , to modify the biochemical and neuroanatomical changes that occur with depression.4244 the psychological hypothesis suggests that pa may provide a sense of enjoyment and achievement , provide more opportunities for social interaction , provide a distraction from worries and negative thoughts , enhance self - confidence , self - esteem , and self - determination , and improve self - efficacy.42,45,46 further , it should also be considered that pa for older adults yields benefits that extend beyond depression , such as maintenance of functional independence , which might in turn contribute to less likelihood of depression . factors such as functional independence are generally considered to be a mediator between pa and depression , and could help us to investigate potential mechanisms that may account for the effect of pa on depression . a majority of the sample participated in active pa ( 85.3% ) , which was encouraging . this may reflect the predominance of men in the sample , who usually do less housework and spend more time outdoors than women . another important driver of pa in this age group is the social support received from veterans communities , such as health education , and provision of accessible places and convenient facilities for pa , which spurs people into action . as demonstrated by previous studies , although the trend of pa is usually downward with advancing age in older adults,14 pa has been generally considered to have an inverse correlation with depressive symptoms and to be effective in reduce the risk of such symptoms.15,20 our study found similarly encouraging evidence . both with and without adjustment , there was a decreased risk of prevalent depressive symptoms in physically active subjects compared with their physically inactive counterparts . moreover , of all the factors independently associated with depressive symptoms , we found that pa was the only protective one , even in the oldest - old and when of light intensity . thus , differences in the ability to engage in pa ( eg , very old age , requiring assistance with self - care , multiple comorbidities , and cognitive dysfunction are likely to hamper the ability to perform pa ) did not appear to explain the difference in depressive symptoms between physically active elderly and physically inactive elderly . social support has been demonstrated to be advantageous in improving mental health in the older population , and may be a confounder.16,47 all our older veterans enjoy chinese military welfare and are generally provided with optimal health care and social support , including free medicine , regular physical examinations , health management , better social insurance , a good socioeconomic level , good housing , and convenient facilities . there was almost no difference in social support between our physically active and inactive subjects , so the influence of social support on the relationship between pa and depressive symptoms is likely to be negligible . it is suggested that any difference may result from physiological and psychological differences derived from pa , or from other pleasurable pursuits available to physically active subjects . the level of social support was not measured , and some pleasurable activities were not considered , and these need to be studied further . it is often questioned whether pa has a beneficial effect on depressive symptoms in the oldest - old . a paper by steffens published in the lancet pointed out that the lack of consistency of results across studies on this topic results at least in part from the difference in mean age between samples.4 a study sample with a mean age < 75 years is more representative of younger old people , and is likely to yield a significant result ; however , a study sample with a mean age of > 80 years often fails to do so . our sample had a median age of 82.29 years , so mostly represented the oldest - old . however , we obtained a surprising result , in that pa was found to protect against depressive symptoms even in the oldest - old . the distinctive condition was inferred to result from the large sample size of the oldest - old ( 6,069 , 70.7% ) making relatively weak statistical effect more powerful . most recommendations have reached a consensus that moderate - vigorous - intensity pa has a generally beneficial effect on health.28,29 in this study , light - intensity pa , such as walking , was more popular among subjects , and was also shown to be achievable for depressive symptoms . the effect of light - intensity pa in older adults was a distinctive finding and has not been fully studied , except for one study conducted by loprinzi that found light - intensity pa was inversely associated with depressive symptoms in older american adults.30 another finding that supervised low - intensity exercise was more effective in reducing depressive symptoms than moderate - intensity or high - intensity exercise in a meta - analysis of outcomes of pa interventions among healthy adults48 also does not support the common contention that insufficient pa intensity was the reason for poor outcomes.28 it has been hypothesized that moderate - intensity to vigorous - intensity pa is required for general health ( as per the recommendations ) , whereas light - intensity pa is probably enough for mental health . further , light - intensity pa may elicit immediate positive feelings that may not be as apparent with more vigorous pa.3 this deserves more investigation , and if confirmed , promotion of light - intensity pa may be more practical for older adults . it is stressed that hobbies and interests such as calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creating writing , listening to the radio , and playing cards were not found to have an association with depressive symptoms in this study , although they were thought to be good for maintaining mental health . it is speculated these pastimes are sedentary behaviors , so have poorer physiological effects compared with pa . multi - tasking ( eg , listening to the radio while walking , performing stretches while watching television , going outdoors for painting or photography , visiting exhibitions of calligraphy or collectibles , going to the library or reading room to read , going to a senior center or community center to play cards ) is suggested for the elderly to decrease their sedentary behavior and increase pa at the same time , which should be feasible for older adults . here we report the first and largest national epidemiological study in the older chinese population that explores the relationship between pa and depressive symptoms , and its results are encouraging . the major strengths of this study are its large sample size and high response rate , resulting in good statistical power . another of its unique characteristics of significantly predominant proportion and absolute number of the oldest - old and the light - intensity pa patterns provided stronger evidence to pa protective effect on depressive symptoms in the two special conditions . first , pa was not measured with a high - quality assessment , so that it may be relatively less reliable . this should be done using either an objective measure ( eg , monitor , accelerometer , pedometer ) or a more specific questionnaire ( eg , the community healthy activities model program for seniors questionnaire,49 the international physical activity questionnaire,50 the global physical activity questionnaire51 ) , all of which result in a quantified level of pa . in this study , pa was categorized as being of light intensity in general , instead of accurate calculation of its energy expenditure . some other studies have reported the level of pa as estimation of energy expenditure in metabolic equivalents of task,52,53 or classified it as the low , moderate , or high intensity according to the total pa score shown as continuous variable . the second limitation of this study concerns its design ; as with other self - reported questionnaire surveys , there is the possibility of recall and reporting bias . given the cross - sectional nature of our study , causality between pa or other factors and depressive symptoms could not be inferred . other variables that may be possible confounders need to be further explored in a future study . because of the widely differing sociodemographic backgrounds between older veterans and the general population of older adults , the generalizability of our study findings to the aged population in general is uncertain . the results of this study confirm and extend previous research by demonstrating an inverse relationship between pa and depressive symptoms in a large cohort of older chinese veterans . various correlations with depressive symptoms were sought , and pa was found to the only factor protecting against symptoms of depression . even after controlling for a range of confounders , such as age , sex , variations in lifestyle , negative life events , the most common chronic diseases , and level of cognitive function , the relationship between pa and depressive symptoms remained significant ( or 0.57 , 95% confidence interval 0.440.72 , p<0.0001 ) . the independent protective effect of pa on depressive symptoms was far stronger than any of the other healthy lifestyle components , such as the above - mentioned hobbies and interests , social participation , not smoking , and abstaining from alcohol , which were not found to be associated with decreased depressive symptoms . the median ( interquartile range ) age of the sample was 82.29 ( 80.2584.60 ) , making it highly representative of older - old people , and even the oldest - old . there was an indication that the antidepressant effect of pa also extended to the oldest - old , although many researchers thought it difficult to get positive result of pa antidepressant effect in the oldest - old.4 the majority of study participants engaged in light pa ; active pa was defined as 90 minutes a week , so pa in this study would have been mainly light intensity . it was shown that light - intensity pa was probably also protective against depressive symptoms , even though the guidelines for pa in older adults mainly recommend pa of at least moderate intensity . the mechanisms that may account for the inverse association between pa and depressive symptoms are not completely understood , but there are several plausible hypotheses . the neurobiological hypothesis suggests that pa may stimulate synthesis , release , and metabolism of serotonin and -endorphins , increase neurotransmission of norepinephrine , attenuate the response of hypothalamic - pituitary - adrenal axis to reduce levels of cortisol , a stress hormone , stimulate growth of new nerve cells in the hippocampus , and regulate cerebral blood flow , to modify the biochemical and neuroanatomical changes that occur with depression.4244 the psychological hypothesis suggests that pa may provide a sense of enjoyment and achievement , provide more opportunities for social interaction , provide a distraction from worries and negative thoughts , enhance self - confidence , self - esteem , and self - determination , and improve self - efficacy.42,45,46 further , it should also be considered that pa for older adults yields benefits that extend beyond depression , such as maintenance of functional independence , which might in turn contribute to less likelihood of depression . factors such as functional independence are generally considered to be a mediator between pa and depression , and could help us to investigate potential mechanisms that may account for the effect of pa on depression . a majority of the sample participated in active pa ( 85.3% ) , which was encouraging . this may reflect the predominance of men in the sample , who usually do less housework and spend more time outdoors than women . another important driver of pa in this age group is the social support received from veterans communities , such as health education , and provision of accessible places and convenient facilities for pa , which spurs people into action . as demonstrated by previous studies , although the trend of pa is usually downward with advancing age in older adults,14 pa has been generally considered to have an inverse correlation with depressive symptoms and to be effective in reduce the risk of such symptoms.15,20 our study found similarly encouraging evidence . both with and without adjustment , there was a decreased risk of prevalent depressive symptoms in physically active subjects compared with their physically inactive counterparts . moreover , of all the factors independently associated with depressive symptoms , we found that pa was the only protective one , even in the oldest - old and when of light intensity . thus , differences in the ability to engage in pa ( eg , very old age , requiring assistance with self - care , multiple comorbidities , and cognitive dysfunction are likely to hamper the ability to perform pa ) did not appear to explain the difference in depressive symptoms between physically active elderly and physically inactive elderly . social support has been demonstrated to be advantageous in improving mental health in the older population , and may be a confounder.16,47 all our older veterans enjoy chinese military welfare and are generally provided with optimal health care and social support , including free medicine , regular physical examinations , health management , better social insurance , a good socioeconomic level , good housing , and convenient facilities . there was almost no difference in social support between our physically active and inactive subjects , so the influence of social support on the relationship between pa and depressive symptoms is likely to be negligible . it is suggested that any difference may result from physiological and psychological differences derived from pa , or from other pleasurable pursuits available to physically active subjects . the level of social support was not measured , and some pleasurable activities were not considered , and these need to be studied further . it is often questioned whether pa has a beneficial effect on depressive symptoms in the oldest - old . a paper by steffens published in the lancet pointed out that the lack of consistency of results across studies on this topic results at least in part from the difference in mean age between samples.4 a study sample with a mean age < 75 years is more representative of younger old people , and is likely to yield a significant result ; however , a study sample with a mean age of > 80 years often fails to do so . our sample had a median age of 82.29 years , so mostly represented the oldest - old . however , we obtained a surprising result , in that pa was found to protect against depressive symptoms even in the oldest - old . the distinctive condition was inferred to result from the large sample size of the oldest - old ( 6,069 , 70.7% ) making relatively weak statistical effect more powerful . most recommendations have reached a consensus that moderate - vigorous - intensity pa has a generally beneficial effect on health.28,29 in this study , light - intensity pa , such as walking , was more popular among subjects , and was also shown to be achievable for depressive symptoms . the effect of light - intensity pa in older adults was a distinctive finding and has not been fully studied , except for one study conducted by loprinzi that found light - intensity pa was inversely associated with depressive symptoms in older american adults.30 another finding that supervised low - intensity exercise was more effective in reducing depressive symptoms than moderate - intensity or high - intensity exercise in a meta - analysis of outcomes of pa interventions among healthy adults48 also does not support the common contention that insufficient pa intensity was the reason for poor outcomes.28 it has been hypothesized that moderate - intensity to vigorous - intensity pa is required for general health ( as per the recommendations ) , whereas light - intensity pa is probably enough for mental health . further , light - intensity pa may elicit immediate positive feelings that may not be as apparent with more vigorous pa.3 this deserves more investigation , and if confirmed , promotion of light - intensity pa may be more practical for older adults . it is stressed that hobbies and interests such as calligraphy , painting , photography , collectibles , rearing animals , handcrafts , reading , writing a diary , creating writing , listening to the radio , and playing cards were not found to have an association with depressive symptoms in this study , although they were thought to be good for maintaining mental health . it is speculated these pastimes are sedentary behaviors , so have poorer physiological effects compared with pa . multi - tasking ( eg , listening to the radio while walking , performing stretches while watching television , going outdoors for painting or photography , visiting exhibitions of calligraphy or collectibles , going to the library or reading room to read , going to a senior center or community center to play cards ) is suggested for the elderly to decrease their sedentary behavior and increase pa at the same time , which should be feasible for older adults . here we report the first and largest national epidemiological study in the older chinese population that explores the relationship between pa and depressive symptoms , and its results are encouraging . the major strengths of this study are its large sample size and high response rate , resulting in good statistical power . another of its unique characteristics of significantly predominant proportion and absolute number of the oldest - old and the light - intensity pa patterns provided stronger evidence to pa protective effect on depressive symptoms in the two special conditions . first , pa was not measured with a high - quality assessment , so that it may be relatively less reliable . this should be done using either an objective measure ( eg , monitor , accelerometer , pedometer ) or a more specific questionnaire ( eg , the community healthy activities model program for seniors questionnaire,49 the international physical activity questionnaire,50 the global physical activity questionnaire51 ) , all of which result in a quantified level of pa . in this study , pa was categorized as being of light intensity in general , instead of accurate calculation of its energy expenditure . some other studies have reported the level of pa as estimation of energy expenditure in metabolic equivalents of task,52,53 or classified it as the low , moderate , or high intensity according to the total pa score shown as continuous variable . the second limitation of this study concerns its design ; as with other self - reported questionnaire surveys , there is the possibility of recall and reporting bias . given the cross - sectional nature of our study , causality between pa or other factors and depressive symptoms could not be inferred . other variables that may be possible confounders need to be further explored in a future study . because of the widely differing sociodemographic backgrounds between older veterans and the general population of older adults , the generalizability of our study findings to the aged population in general is uncertain . this nationally epidemiological study demonstrated an inverse relationship between pa and depressive symptoms in a large cohort of older chinese veterans living in the community . of all the variables studied , pa was found to be the only independent factor protecting against depressive symptoms , after controlling for a range of confounders . it also indicated that the antidepressant effect of pa probably extended to the oldest - old , and the light - intensity pa was probably available for the same protective effect . although there are some limitations to this research , the findings are encouraging and could provide useful information for further intervention protocols to prevent or reduce depressive symptoms in older chinese veterans living in the community . in particular , it might inspire research concerning the impact of light - intensity pa on depressive symptoms in the oldest - old . the conclusion can not be extended beyond the study population , but it highlights a direction for further research . pa may be a good way of preventing and treating depressive symptoms and be of great importance in reducing the burden on public health .

backgroundphysical activity is generally considered to be effective in reducing the prevalence of depression and promoting remission of its symptoms . however , large - scale epidemiological research on this issue is lacking in older chinese adults . we performed a nationwide epidemiological survey to determine the relationship between physical activity and depressive symptoms in older chinese veterans in the community , with adjustment for potential confounders.methodsa cross - sectional study was conducted in a representative sample of 9,676 community - dwelling older chinese veterans . depressive symptoms were identified using the center for epidemiological studies depression scale . physical activity was self - reported using a one - year physical activity questionnaire . information about covariates was obtained by questionnaire - based interview . relationships between study variables and symptoms of depression were estimated using unadjusted and adjusted analyses.resultsthe median age was 82.29 ( interquartile range 80.2584.60 ) years . in total , 81.84% of the study participants engaged in physical activity that was predominantly light in intensity . in unadjusted analyses , physical activity was associated with a significantly decreased likelihood of depressive symptoms ( 5.43% versus 18.83% , p<0.0001 ) . multivariate logistic regression with adjustment and controlling for confounders , physical activity was still inversely associated with depressive symptoms and was the only independent protective factor ( odds ratio 0.57 , 95% confidence interval 0.440.72 , p<0.0001 ) among the associated factors in this study . in a univariate general linear model , there was a significant difference in center for epidemiological studies depression scale score between subjects participating in active physical activity and those who did not ( f=59.07 , p<0.0001).conclusionthis study found an inverse relationship between physical activity and symptoms of depression in older chinese veterans in the community . it was also indicated that the antidepressant effect of physical activity probably extended to the oldest - old , and the light - intensity physical activity was probably available for the same protective effect . this information could be used to devise further interventions to prevent or ameliorate symptoms of depression .

Introduction Subjects and methods Study design Participants and procedure Measurement of depressive symptoms Assessment of physical activity Covariates Statistical analyses Results Description of sample Physical activity and depressive symptoms Discussion Key findings Mechanisms and analyses Strengths and limitations Conclusion

the mutans streptococci group ( msg ) belong to the viridans group streptococci ( vgs ) and form an important part of the normal oral flora [ 1 , 2 ] . although the vgs are generally nonpathogenic , they have attracted attention due to their ability to act as reservoirs for antibiotic resistance genes and to transfer these troublesome traits to classically pathogenic bacteria including streptococcus pneumoniae and streptococcus pyogenes . while a number of recent studies [ 4 , 5 ] have investigated the susceptibility patterns of the vgs to various antimicrobial agents , only a few studies have reported antimicrobial sensitivity of vgs from sub - saharan africa even though antibiotic abuse is widespread in the region . more specifically , it has been observed that cotrimoxazole ( sxt ) prophylaxis selects for resistance in infectious streptococci [ 8 , 9 ] . however , information on the effects of sxt prophylaxis on commensal bacteria which are not the drug targets is still scarce , particularly in sub - saharan africa bearing a heavy burden of human immunodeficiency virus infection / acquired immunodeficiency syndrome ( hiv / aids ) and where a large proportion of the patients routinely take sxt as prophylaxis against pneumocystis jiroveci pneumonia . the msg includes seven species of which streptococcus mutans and streptococcus sobrinus infect human populations . as the principal causative agents of dental caries ( tooth decay ) and related odontogenic pyogenic infections , the msg is commonly referred to as cariogenic bacteria . they are also implicated in causing extra - oral infections , particularly subacute bacterial endocarditis in patients with defective or prosthetic valves [ 12 , 13 ] . assessment of antibiotic susceptibility and characterisation of the mechanisms of the resistance of the msg is increasingly important not only because these bacteria are the leading cause of dental and serious extra - oral infections but also because they can carry and transfer antibiotic resistance genes to typically pathogenic microbes . additionally , to our knowledge the mechanism of streptococcus mutans and streptococcus sobrinus resistance to cotrimoxazole has not been characterised . here , we have evaluated the selection of antibiotic resistance by sxt prophylaxis and characterised the mechanism of streptococcus mutans and streptococcus sobrinus resistance to sxt . the bacteria were isolated from saliva of patients attending mulago hospital dental clinic and the aids support organization ( taso ) clinic in kampala , uganda . this study was conducted in taso clinic and mulago hospital dental clinic located in kampala , uganda . taso is a nongovernmental hiv / aids care clinic that attends to about 100 patients daily who regularly take sxt as prophylaxis . it has a dental clinic which daily offers treatment to about 50 outpatients whose hiv sero - status is undetermined and is not taking sxt as prophylaxis . this was a cross - sectional study of patients ( n = 204 ) from taso clinic who were routinely taking sxt as prophylaxis ( prophylaxis group ) and another group of patients ( n = 171 ) from mulago dental clinic that were not taking sxt as prophylaxis ( nonprophylaxis group ) . to increase chances of isolating msg , the patients were selected on condition that they had at least one tooth with dental caries confirmed by clinical examination . demographic data and information on use of antibiotics in the previous three months were obtained from patients ' interview and medical records . permission to carry out this study was obtained from makerere university school of medicine research and ethics committee and the uganda national council of science and technology . written consent was sought and obtained from each study subject consistent with the helsinki declaration relating to the conduct of research on human subjects . all the selected patients ( n = 375 ) donated saliva specimens for the study . at least 1 h following the patient 's meal , 2 ml of whole saliva was collected in a sterile falcon tube ( sarstedt , austria ) , and within 1 h of being collected , the specimen were transported to the department of biochemistry , makerere university college of health sciences for analysis . each specimen was diluted 1 : 100 in physiological saline ( chemtrec , usa ) and 100 l of the diluted sample was cultured on plates containing modified hlr - s medium for selective isolation of msg . the plates were incubated at 37c for 48 h in an atmosphere of 5% carbon dioxide . one presumptive colony of msg was picked and streaked on chocolate agar plates ( biomrieux , france ) , supplemented with 5% sheep blood and polyvitex ( biomrieux , france ) . the colonies from chocolate agar were identified by morphology , gram staining , haemolysis on blood agar medium ( biomrieux , france ) , catalase test , and susceptibility to optochin . subsequent differentiation of the bacteria was done by biochemical tests [ 2 , 17 ] and confirmed by polymerase chain reaction ( pcr ) genotyping of the glycosyl transferase ( gtf ) gene . after confirmation of the bacterial species by pcr , susceptibility to amoxicillin and cotrimoxazole was evaluated using e - test ( ab biodisk , sweden ) whereas susceptibility to ceftriaxone , erythromycin , tetracycline , and chloramphenicol was assessed by the kirby bauer disc diffusion method ( biomrieux , france ) . the break points criteria for streptococcal species other than streptococcus pneumoniae established by the clsi were used for all the antibiotics studied except for cotrimoxazole in which the break points established by the swedish reference group for antibiotics were adopted . bacteria from one colony were resuspended in trypticase soy broth ( biomrieux , france ) and incubated at 37c for 24 h in an atmosphere of 5% carbon dioxide . bacterial dna from the cultured streptococci was then extracted using a modified protocol of the wizard genomic dna purification kit ( promega , usa ) . sequences of the primers used in pcr confirmation of bacterial species were as previously described . in this procedure , a dna fragment ( 517 bp ) of the gtfb gene of streptococcus mutans or a longer fragment ( 712 bp ) of the gtfi gene of streptococcus sobrinus was amplified . briefly , each pcr mixture of 20 l contained dreamtaq green buffer ( fermentas , lithuania ) , 100 m each of datp , dttp , dgtp , and dctp , 0.5 m oligonucleotide primers ( both gtfb - f , -r and gtfi - f , -r ) , 1.25 u of dreamtaq polymerase ( fermentas , lithuania ) , and 0.5 to 1 nanogram of template dna . the pcr conditions comprised 30 cycles of denaturation at 95c for 30 s , annealing at 59c for 30 s , and extension at 72c for 1 min . the amplified products were separated by electrophoresis in 0.8% agarose gels ( sigma , belgium ) and stained with ethidium bromide ( bdh , uk ) . the dependent variable ( sxt prophylaxis use ) was categorized as 1 = yes and 2 = no . binary logistic regression analyses were used to estimate the magnitude of the risk of bacteria in developing drug resistance in the prophylaxis and nonprophylaxis groups . the 95% confidence intervals were generated around all odds ratios ( or ) to determine the significance of predictor variables . dna from a number of isolates was sequenced using the bigdye terminator labelled cycle sequencing kit ( applied biosystems ) and an abi prism 310 genetic analyzer ( applied biosystems ) in uppsala university sweden . the results of the fola and folp gene sequence analysis were compared with database sequences of s. mutans ua 159 and nn2025 using the blast programme at ncbi . additionally , the folp gene of isolate 797 was compared to a number of organisms using the multiple sequence alignment program clustalw at the european bioinformatics institute database . the folp gene of strain 797 was amplified using primers mdhpssph and mdhpsbam ( table 1 ) where recognition sequences for the restriction enzymes sphi and bamhi were engineered into the forward and reverse amplification primers , respectively . the resulting pcr product was digested with these two enzymes together with the plasmid vector puc19 . after ligation of pcr product and vector using the rapid ligation kit ( fermentas , lithuania ) , the resulting plasmid was used to transform competent cells of e. coli dh5. after verification of the plasmid construction , it was introduced into the e. coli knock - out strain c600folp . no full genome sequence of s. sobrinus is available , but the sequence of the closely related species s. downei was recently added to the databases . thus , primers were designed to match the s. downei sequence as shown in table 1 . pcr was performed with an annealing temperature of 45c ; otherwise , the pcr conditions were as described previously . sequencing reactions and analysis were as described previously . when cultivated in the lab , s. mutans strain 797 showed stable resistance to sulfamethoxazole but susceptibility to trimethoprim ( tp ) . the strain was cultivated in isosensitest broth ( isb ) ( oxoid , uk ) with a low concentration ( 2 g / ml ) of tp , where growth was very weak . from this culture , the bacteria were inoculated into tubes containing isb with 5 g / ml of tp and from this culture subsequently reinoculated into isb with 10 g / ml of tp . from the latter two cultures , bacteria were streaked onto isosensitest agar ( isa ) plates ( oxoid , uk ) containing 10 g / ml of tp . bacteria from both tubes grew on the selective plates and were called 797 ( 5 ) and 797 ( 10 ) , respectively . bacteria strains 797(10 ) and 797 were inoculated in the 2 ml of brain heart infusion ( bhi ) ( biomrieux , france ) in the following proportions : tube 1 , 100 l 797(10 ) ; tube 2 , 10 l 797(10 ) + 90 l 797 ; tube 3 , 50 l 797(10 ) + 50 l 797 ; tube 4 , 90 l 797(10 ) + 10 l 797 ; and tube 5 , 100 l 797 . additionally , 100 l of 797(10 ) and 797 diluted 10 times was spread on isa plates ( oxoid , uk ) in order to get individual colonies , which was counted to identify the initial proportions . the five cultures were then incubated overnight at 37c in a 5% co2 atmosphere . at a 6 hourly interval : 0 , 6 , 12 , 18 , and 24 hours , 10 l of bacteria was removed from each test tube and diluted 100 times in bhi broth ( biomrieux , france ) . one hundred l of the dilutions was then spread on isa plates ( oxoid , uk ) and incubated overnight at 37 degrees in a 5% co2 atmosphere . the following day , individual colonies were picked and inoculated on isa plates ( oxoid , uk ) with and without trimethoprim 10 g / ml . this experiment was done three times and the averages of the proportion of resistant to susceptible colonies grown on the isa plates were counted and plotted against time . based on culture and gtf genotyping , 31.4% ( n = 64 ) of the patients ' specimens had msg strains . thirty six ( 56% ) of the strains were s. mutans and 28 ( 44% ) were s. sobrinus . there were no statistically significant differences in the resistance pattern of the various antibiotics between s. sobrinus and s. mutans ( p > 0.05 ) ; thus the data were pooled . cotrimoxazole showed the highest resistance ( 54.7% ) , while amoxicillin had the lowest resistance ( 1.6% , table 2 ) . the risk of developing resistance to sxt in the prophylaxis group was 6.59 times higher than that in the nonprophylaxis group ( p < 0.05 , table 2 ) . for other antibiotics , there were no significant differences in resistance rates between the two study groups . the risk of developing multidrug resistance ( mdr ) , that is , resistance to more than 2 drugs in the prophylaxis group , was 1.42 times higher than that in the nonprophylaxis group . however , the difference was not statistically significant ( 95% ci : 0.553.71 , table 3 ) . based on the individual components of sxt ( sulfamethoxazole and trimethoprim ) , most ( 95% ) of the isolates in the prophylaxis group showed resistance to sulfamethoxazole , while 61% of resistance was towards trimethoprim . in the nonprophylaxis group , 51% ( n = 87 ) of the patients had positive growth of msg bacteria . according to gtf genotyping , 37 ( 43% ) of the strains were streptococcus mutans and 47 ( 54% ) were streptococcus sobrinus while 3 ( 3.4% ) of the specimens contained both species . the most prevalent resistance was associated with tetracycline ( 35.7% ) , while the least resistance was found with erythromycin ( 3.6% , table 2 ) . sequence analysis of the fola gene from s. mutans as compared to the database sequences ua159 and nn2025 revealed no point mutations irrespective of the susceptibility status of the strain . it was originally isolated as a trimethoprim ( tp ) resistant strain but lost the resistance upon subculturing in the lab . further application of trimethoprim selective pressure on the strain in the lab led to its rapid development of resistance to trimethoprim . when the two lab isolates 797 ( 5 ) and 797 ( 10 ) were derived and selected on 5 g / ml and 10 g / ml of trimethoprim , respectively , the full nucleotide sequence for the thya , a gene coding for a putative transporter , and fola genes were determined including the upstream sequence of thya , but no single nucleotide change was detected in this region . based on the lab - derived tp resistant strains in competition experiments with the original 797 , the tp susceptible isolate 797 was found to be more fit than the tp resistant 797(10 ) ( figure 1 ) . the tp susceptible isolate outgrew the resistant strain over a 24-hour period even when added in a minority proportion . sequence analysis of the folp gene for 797 revealed four point mutations in positions at a46 v , e 80 k , q122 h , and s146 g when compared to the database sequence of strain nn 2025 . however , in comparison with the other published sequence from ua 159 , only position s146 g differed in 797 . further comparison of dhps from isolate 797 with dhps from other sulfonamide resistant organisms ( figure 2 ) showed that the differences occur outside of previously characterised mutation determining positions . sequence determinations from a number of other isolates showed ten different patterns of changed amino acids ( figure 3 ) . when the folp gene from 797 was cloned in the puc19 vector , it was shown to express dhps in e. coli by transformation of the knock - out strain c600folp . the 797 strain readily grew on 0.1 mm sulfamethoxazole , but the cloned folp gene only allowed growth on 0.02 mm sulfamethoxazole . no genomic sequence of s sobrinus was available and it was initially difficult to get the full folp sequence of the isolates , which was finally resolved by designing primers flanking the folp gene of s. downei with a sequence similar to that of s sobrinus . variants of isolate 7(0 ) showing different response to sulfamethoxazole had exactly the same sequence for folp and the upstream region . the sequence intervening the genes fole ( coding for gtp cyclohydrolase ) and folp is almost 100 bp longer in s. sobrinus than in s. downei ( figures 4 and 5 ) . the intervening sequence shows no similarity to any sequence in databases and seems thus to be unique to s. sobrinus ( figure 5 ) . the folp and fola gene sequences of s. sobrinus together with the folp sequences of different variants of s. mutans prepared in this study have been submitted to the european nucleotide archive with accession numbers he 599533 to he 599539 . viridans group streptococci resistant to antibiotics have increasingly been reported over the past decade [ 4 , 5 ] , while studies on antibiotic resistance of mutans streptococcus group are few [ 23 , 24 ] . in the present study , cariogenic mutans streptococci ( streptococcus mutans and streptococcus sobrinus ) were isolated from patients attending dental and hiv / aids care clinics in kampala , uganda , where studies on drug resistance in the commensal flora are scarce , but with a reported increased use of antibiotics . the most striking result is the very distinct selection of sxt resistant bacteria in the prophylaxis group , while resistances to other antibiotics were not significantly different between the two groups . recently , wiln et al . reported cotrimoxazole resistance in viridans streptococci from the throat flora and found a 100% frequency of resistance . however , isolates of streptococcus mutans and streptococcus sobrinus were not included in that previous study . in the present study , the low level of resistance ( 15.5% ) found in samples from the nonprophylaxis group might be explained by the different sxt selective pressure in the different environments and that the cariogenic bacteria produce biofilms , a protective mechanism that renders the bacteria to survive antibiotic exposure . however , the significantly higher level of resistance found in the prophylaxis group ( 54.7% ) shows that selective forces act on the oral and throat flora . the differences in resistance level may instead be explained better by differences in the way the throat commensal flora develop resistance to sxt . there may also be other limits in the genetic transfer among the oral compared to the throat flora . when the nonmutans viridans streptococci resistance mechanism to sxt was analysed , it was easily identified as due to mutational changes in the target enzymes dihydropteroate synthase ( dhps ) and dihydrofolate reductase ( dhfr ) as well as genetic transfer between different streptococcal species . however , findings from sequencing of folp and fola genes from resistant msg in the present study ( figures 25 ) do not suggest mutational changes in the dhfr enzyme , nor any genetic transfer of resistance determinants from the other viridians group streptococci to s. mutans or s. sobrinus . the lack of changes in the fola gene suggests a different mechanism of resistance to trimethoprim , probably due to gene amplification as has been noted in s. agalatiae . on the other hand , the folp gene of streptococcus mutans 797 showed four point mutations in comparison with nn2025 ( figure 2 ) and one in comparison with ua159 . comparison of the positions of these mutations with resistance determining mutations in other organisms ( figure 2 ) shows that they mainly occur in less conserved parts of the protein and differ quite substantially in positions compared to previously described resistance conferring mutations [ 22 , 25 , 2830 ] . further sequencing of other s. mutans isolates showed much more polymorphism ( figure 3 ) and it is evident that the s. mutans dhps can vary quite substantially without any obvious relation in resistance to sulfamethoxazole . the lack of evidence for horizontal transfer of resistance genes from related streptococci is quite striking . during isolation of the cariogenic bacteria , it was very common to find other commensal streptococcal species , for example , s. sanguinis , s. parasanguinis , and s. salivarius in the same isolate . in a few instances we amplified fola and folp genes from these other commensal species and found the expected resistance conferring mutations described in the previous study . while the resistance conferring variants of fola and folp are freely disseminated among most oral streptococcal strains , there seems to be some barrier that limits transfer of resistance to the cariogenic bacteria . streptococcus sobrinus is quite different from s. mutans in terms of dna sequence for the genes we studied , but also in this case the sulfa - trimethoprim resistance seems not to be linked to sequence differences in fola and folp . the sequences of these genes show high similarity between s. sobrinus and s. downei ( figure 5 ) , and in few cases we detected s. downei sequences in the samples . the striking difference between the two bacteria is the intergenic region between fole and folp ( figure 4 ) . this may need to be explored further regarding its relation to expression of folp and hence to resistance . however , during cultivation , we obtained s. sobrinus strains with varying degrees of sulfa and tp susceptibilities , but no changes were noted in this region . despite the protective effect of cotrimoxazole prophylaxis in hiv / aids patients from opportunistic infections and malaria , the present study found the drug to select for resistance among the mutans streptococci similar to what has been reported in other commensals like escherichia coli . looking at other individual resistances rates , there are only a few studies that specifically describe streptococcus mutans or s. sobrinus . a study from india showed resistance levels of 2030% for tetracycline , amoxicillin , and erythromycin . in the present study , resistance of mutans streptococci to tetracycline was 35.7% , which is obviously a worrisome finding because of the modest cost and easy availability of the drug in uganda . resistance to amoxicillin , ceftriaxone , and chloramphenicol was found in 1.2% , 32.1% , and 6% , respectively , of the isolates ( table 2 ) . our observed resistance may be attributed to selection of resistant organisms in the study area similar to the finding in india , given the prevailing high rate of antibiotic use in the two countries . coresistance ( resistance to more than one antibiotic ) or the event where microbes acquire resistance to multiple antibiotics in tandem is extremely troublesome and has previously been noted . although we found a slightly higher prevalence of multidrug resistance in the prophylaxis as compared to the nonprophylaxis group ( table 3 ) , the difference was not statistically significant . this could partly be explained not only by the fact that most of the antibiotics in the present study are not frequently used in the hiv / aids patients but also by the difference between the mechanisms of action of these antibiotics and cotrimoxazole . updated information on antibiotic resistance such as reported in the present study helps to inform antibiotic drug policy makers to design strategies for effective prophylaxis against and treatment of bacterial infections . in the present study , it has been found that cotrimoxazole prophylaxis selects for cognate antibiotic resistance in oral bacteria . there was a high rate of resistance of streptococcus mutans and streptococcus sobrinus to tetracycline and ceftriaxone in the studied ugandan patients independent of sxt prophylaxis . genetic transfer in the folate pathway genes does not seem to be the mechanism of resistance acquisition .

the selection of antibiotic resistance by cotrimoxazole prophylaxis was evaluated , and we characterized the mechanism of cotrimoxazole resistance in streptococcus mutans and streptococcus sobrinus . in vitro susceptibility to six antibiotics was evaluated on 64 mutans streptococci group ( msg ) isolates from a cotrimoxazole prophylaxis group and compared to 84 msg isolates from a nonprophylaxis group . the fola and folp genes were sequenced and compared with reference sequences at ncbi . only resistance to cotrimoxazole was significantly higher in the prophylaxis group ( 54.7% versus 15.5% , or = 6.59 , 95% ci : 2.8915.3 , p < 0.05 ) . resistance to amoxicillin , ceftriaxone , chloramphenicol , erythromycin , and tetracycline was 1.4% , 25.5% , 6.2% , 6.5% , and 29.6% of the isolates , respectively . considerable polymorphisms were found in the folp gene in s. mutans , but this could not be linked to sulfonamide drug resistance . no variation was seen in folp or fola genes of s. sobrinus . genetic transfer of folate pathway genes seems unlikely in these isolates .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

intestinal motor alterations are associated with clinical symptoms such as diarrhea , constipation , and abdominal pain . studies demonstrated that visceral hypersensitivity and persistently altered intestinal muscle dysfunction existed in mice infected with trichinella spiralis [ 1 , 2 ] . in fact , the adaptive response to intestinal parasites has been suggested as a paradigmatic defense response of the intestine against external pathogens . for these reasons , experimental parasite infection has been commonly used as model to understand pathogenesis of intestinal dysfunction [ 35 ] . the immune changes in trichinella spiralis infection appear to be t helper ( th ) cell dependent , as have been shown to be prevented by cyclosporine . according to their capability of producing cytokines , th cells were classified as three distinct subsets , th1 , th2 , and th17 . characteristically , th1-type cells produce interleukin ( il)-12 and ifn- ; th2-type cells synthesize il-4 , il-5 , il-6 , il-9 , and il-10 . th17-type cells , newly discovered subset of cd4 + effort t cells , produce il-17 distinctively . although studies have been performed on the roles of th2 cells and related cytokines in intestinal dysfunction during infection of trichinella spiralis [ 7 , 8 ] , it is unknown about the functionality of th17 in this process . previously , tgf-1 has been commonly considered as an anti - inflammatory cytokine but now found to be critical in the differentiation of th17 cells . recent work by d. yen showed that il-23 stimulated th17 to generate the proinflammatory mediator il-17 , which is important to maintain the chronic intestinal inflammation . the aim of this study is to analyze the roles of th17 cells and related cytokines in gut dysfunction in mice infected with trichinella spiralis . studies were performed on male inbred national institute of health ( nih ) mice obtained from the institution of biological product ( wuhan , china ) and used between 6 and 8 weeks of age . mice were bred in an accredited facility at the institute for animal health maintained at 23 - 24c in temperature and a light - dark cycle of 12 - 12 h ( lights on at 7 am ) . trichinella spiralis cultures were originated in the department of parasitology at the university of huazhong science and technique . larvae of trichinella spiralis were obtained from the rats infected for more than 30 days . the muscles containing the encysted larvae were finely minced and digested in 0.5% pepsin a ( sigma - aldrich ) and 0.5% of hcl at 37c for 5 houres . the isolated infective larvae were washed several times with 0.85% nacl and suspended in 2% of agar ( sigma - aldrich ) . mice were infected by the oral administration of 300 larvae in 0.2 ml of agar following a modified method described by wheatcroft j nih mice were sacrificed at 2 weeks , 8 weeks , and 12 weeks pi . following studies were conducted at each time point : histological changes of jejunum were observed ; the jejunal smooth muscle contractility was investigated in response to acetylcholine ; the levels of il-17 , il-23 , and tgf-1 and the proportions of th17 cells subset in jejunum were also analyzed . samples of jejunum were obtained , fixed for 48 houres in 10% neutral buffered formalin , embedded in paraffin , cut into 5 um sections , and stained with hematoxylin - eosin ( h&e ) according to standard procedures . . a 10 cm segment of the jejunum was detached from mesenterium and placed in sterile hanks ' balanced salt solution . strips were teased along the natural line of cleavage from the longitudinal smooth muscle and then transferred to culture dishes with medium 199 ( invitrogen ) supplemented with penicillin ( 100 units / ml)/streptomycin ( 100 ug / ml , gibco ) and l - glutamine ( 200 m , invitrogen ) . the culture dishes were incubated at 37c in an atmosphere of 95% air and 5% co2 . jejunum longitudinal muscle was preincubated with or without il-17 ( 0.1 - 10 ng / ml , peprotech ) for 2 days . freshly isolated smooth muscle strips were prepared as described above but not under sterile conditions . longitudinal muscle strips were cut by 3 mm 10 mm and then placed in 10 ml organ bath containing warm ( 37c ) oxygenated ( 95% o2 , 5% co2 ) krebs solution . the upper end of each strip was attached to an isometric force transducer ( fort-10 , wpi , usa ) , which was connected to an amplifier . the digitized data were collected by a computer equipped with acqknowledge 3.7.1 software ( biopac system , usa ) . after an equilibration period of 60 minutes with flushing in every 15 minutes at a load of 0.25 g , the length muscle strips were stretched by load increments of 0.25 g exposed to 10 m ach . the degree of applied tension producing the maximum response to ach was identified as optional tension . the area under curve ( auc ; gs ) was measured in time intervals of 5 min after ach addition . the response in different groups was quantified by calculating the auc when muscles were stretched by application of optional tension . the epithelium was removed by incubation with 1 mm dtt ( sigma - aldrich ) and 1 mm edta ( sigma - aldrich ) in rpmi 1640 medium supplemented with 5% fcs at 37c for 30 min with gently shaking . after repeating this step twice , the tissue was cut into smaller pieces and then digested with 1 mg / ml collagenase d ( roch ) at 37c for 90 min . lamina propria cells were harvested by discontinuous 40/70 percoll gradient ( amersham biosciences ) . cells obtained from dissection of lamina propria were incubated for 4 h with 50 ng / ml pma ( alexis ) , 750 ng / ml ionomycin ( sigma - aldrich ) , and 10 mg / ml brefeldin a ( biolegend ) in a tissue culture incubator at 37c . after surfaces staining with the phycoerythrin - conjugated antimouse cd4 antibody ( biolegend ) , the cells were fixed and permeabilized with fixation / permeabilization solution ( biolegend ) . then the cells were stained intracellularly with allophycocyanin - conjugated antimouse il-17 antibody ( biolegend ) . samples were acquired on a lsr ii ( bd biosciences ) and data were analyzed by facsdiva software ( bd biosciences ) . a total of 80 g of protein lysates derived from jejunal tissue samples were loaded on 15% sds - page gels . membranes were probed overnight at 4c with antibodies against il-17a ( r&d system ) , tgf-1 ( biovision ) , il-23p19 ( santa cruz ) , or -actin ( pierce ) antibodies , followed by the appropriate species - specific horseradish peroxidase conjugate ( pierce ) and developing in the supersignal west pico substrate ( pierce ) . statistical significance was calculated with the kruskal - wallis or mann - whitney test as appropriate using spss 11.0 software . the correlation between gut contraction and expression of il-17 was analyzed using spearman 's rho - test . at 2 weeks pi , h&e staining of the jejunum showed hyperemia , swelling , and decrease in villus height . an intense inflammatory response with mixed infiltration of neutrophil cells , eosinophil cells , and lymphocytes affecting the mucosal and submucosal layers there was no discernible inflammation presented in the gut at 8 and 12 weeks pi ( figure 1 ) . increased contractile responses to ach were noted in longitudinal muscle strips from 2 weeks to 12 weeks pi in the t. spiralis infected mice ( figure 2 ) . at 2 weeks after infection , the auc in the infected mice was significantly increased over control when maximum response was generated by longitudinal muscle response to ach ( 1.63 0.19 gs versus 1.34 0.18 gs , p = .026 ) . longitudinal muscle contraction response kept higher at 8 weeks pi ( 1.60 0.17 gs versus control , p = .041 ) and 12 weeks pi ( f 0.10 gs versus control , p = .026 ) . in jejunum , a significant proportional increase was observed for il-17 producing cells in the infected mice at 2 weeks pi compared with controls ( 9.13 2.73 versus 3.78 1.97 , p < .01 ) and normalized at 8 weeks ( 5.38 1.37 ) and 12 weeks ( 4.68 1.48 ) ( figure 3 ) . il-17 is the key cytokine secreted by th17 cells characteristically . to explore whether th17 cells take effect during infection , we analyzed the content of il-17 in jejunum at various time points . the results showed that the expression of il-17 was significantly elevated ( p < .01 ) at 2 weeks pi and turned to normal thereafter ( figure 4 ) . though studies have showed that tgf-1 and il-23 take part in the differentiation and expansion of th17 cells [ 9 , 10 ] , but it is not clear whether tgf-1 and il-23 are involved in the inflammation in mice infected with trichinella spiralis , so the levels of these two cytokines in the gut were studied at each time point . in jejunum , a higher level of tgf-1 in infected mice was noted at 2 weeks pi compared with uninfected mice ( 0.31 0.03 versus 0.17 0.05 , p < .01 ) , and normalized at 8 and 12 weeks pi ( 0.26 0.07 and 0.24 0.07 , resp . ) ( figure 4 ) . the expressions of il-23 in the jejunum at 2 , 8 , and 12 weeks pi were 0.16 0.02 , 0.14 0.04 , and 0.11 0.03 , respectively , and no significant changes were found compared with control during infection ( figure 4 ) . to explore whether the jejunum hypercontractility in the infected mice was affected by the expression of il-17 , the relationship of jejunal muscle contraction and expression of il-17 was analyzed . we found that the expression of il-17 in jejunum was correlated significantly with jejunum longitudinal muscle contraction ( r = 0.773 , p = .039 ) at 2 weeks pi ( figure 5 ) , while the correlations could not be observed at 8 or 12 weeks pi . to determine the effect of il-17 on muscle contractility , jejunum longitudinal muscle isolated from normal mice was preincubated with il-17 ( 0.110 ng / ml ) for 2 days and then stimulated by 10 m ach . in the presence of il-17 , contractions elicited by ach were enhanced in a concentration - dependent manner . the concentration dependence of il-17 indicated that 0.1 and 1 ng / ml il-17induced less increase of contractile forces in jejunum longitudinal smooth muscles cultured for 2 days , while 10 ng / ml il-17 promoted the contractile significantly ( figure 6 ) . a number of parasite infections in rodents cause intestinal inflammation , such as trichinella spiralis . during a relatively brief intestine stage for 1 - 2 weeks , adult female worms release newborn larvae that rapidly enter mesenteric venule , disseminate throughout the host , and eventually enter skeletal muscle to encyst at about 1 month pi , which is known as muscle stage . in our study , histology investigation showed that the presence of adult worms and larvae in the jejunal mucosa cause a severe inflammatory response at 2 weeks pi , which persists until eviction of the parasite . after the larvae transferred to skeletal muscle , no discernible inflammation was presented at 8 and 12 weeks pi . parasites have provided excellent models for studying the intestine dysfunction during and after infection of pathogens . intestinal muscle hypercontractility can be observed at the early stage of infection and last for a long time after intestinal inflammation recovered [ 1 , 2 ] . previous studies performed on nih swiss mice showed that contractile response of jejunum longitudinal muscle strips was remarkably increased during acute trichinella spiralis infection . by 21 days postinfection , the adult worms leave the host and the acute inflammation normalizes , but functional alterations of the small intestine persist for at least a further 21 days . in our study , the nih mice were used , which are genetically closely related to but not identical to the nih swiss mice and behave immunologically very similarly to the nih swiss mice . it should be recognized that we not only have proven that nih mice infected with trichinella spiralis showed the similar motility abnormalities which others have demonstrated using this model in nih swiss mice but also have proven that the hypercontractility lasted for 12 weeks pi . recent studies demonstrated that altered intestinal motility in infected mice was associated with the increased t cell in gut , which can be reversed by a corticosteroid treatment . t cells also mediate the hypercontractile state of muscle during trichinella spiralis infection [ 17 , 18 ] . furthermore , reports show that th2 cytokines can induce muscle hypercontractility by a direct action on smooth muscle cell , while data about th17 cells are not available . we analyzed the proportion of th17 cells isolated from mucosal lamina propria and the expression of il-17 in jejunum in mice infected with trichinella spiralis . the results showed that the proportion of th17 cells and the level of il-17 were increased at 2 weeks pi compared with the controls and recovered at 8 weeks pi . meanwhile , we found that the expression of il-17 correlated with the jejunal smooth muscle contraction at 2 weeks pi , which implied that the hypercontractility of intestine smooth muscle was affected by the content of il-17 in intestine . to confirm the effect of il-17 on muscle contraction , we investigated the jejunum longitudinal smooth muscle contractility preincubated with or without il-17 . similar finding was observed in another study that il-17 also has a role in airway hypersensitivity responses , such as asthma and chronic obstructive pulmonary disease [ 19 , 20 ] , which are associated with the increased number of neutrophils and linked to il-17 . but how il-17 alerts smooth muscle contraction , by regulating excitation - contraction coupling , by inducing other cytokines , or by other means ? the mechanism underlying the influence of il-17 on the contractility of intestine smooth muscle in mice during infection needs to be further investigated . it should be noted that the jejunal hyper contractility lasted for 12 week pi when il-17 had normalized , which suggested that other cytokines or cells might work in this period of time . weinstock jv reported that helminth infection down - regulates il-17 production by lamina propria mononuclear cells ( lpmcs ) and mesenteric lymph node cells at 2 weeks pi . in our study , increased number of th17 and content of il-17 in jejunum were observed at 2 weeks pi and normalized thereafter . it has been shown that the time course during infection varies in different pathogen strains of mice and using different doses of larvae [ 22 , 23 ] . this study used c57bl/6 mice infected with 150 h. polygyrus , while our study used nih mice infected with 300 t. spiralis . polarization of t cells subset can be influenced by several factors , including the cytokine microenvironment , differential antigen processing , and antigen characteristics . tgf-1 is a pleiotropic cytokine made by multiple cells types , which has been in the spotlight because of its emerging roles in the differentiation of th17 cells from naive t cells . tgf-1 not only has a critical function as an antagonist of th1 development affecting ifn- as well as t - bet , but also interferes with th2 differentiation , thus allowing the diversion to il-17 t cell differentiation . in our study , the level of tgf-1 in jejunum was increased at 2 weeks pi , in accompany with the upregulating of il-17 and th17 cells and then recovered at 8 weeks pi . the results showed that th17 cells might be induced by tgf-1 but not sustained during trichinella spiralis infection . il-23 is expressed in the intestine in various models of intestinal inflammation [ 27 , 28 ] , which could act by reinforcing the th17 response to form il-23-th17 axis in colitis , although it is not required during the differentiation of th17 . we also observed the change of il-23 expression in the jejunum of the trichinella spiralis infected mice at different time points . it is interesting that there was no significant change in the level of il-23 in the jejunum of infected mice , which indicated that the function of il-23 in nematode infection is not as important as it does in intestine inflammation induced by il-10 knockout or pathogenic cd4 t - cell transfer . in summary , the present study demonstrated that th17 cells influenced the intestine smooth muscle contractility during intestinal infection with trichinella spiralis . tgf-1 might induce differentiating of th17 cells during infection , while il-23 was not involved in this process . these results not only have implications for host defense against nematodes but also may have broader implications for clinical gastroenterology .

trichinella spiralis infection in rodents is a well - known model of intestinal inflammation associated with hypermotility . our aim was to elucidate if th17 cells were involved in the development of gastrointestinal hypermotility in this experimental model . intestinal inflammation was observed by hematoxylin - eosin ( he ) staining . jejunal smooth muscle contractility was investigated in response to acetylcholine ( ach ) . the effects of il-17 on jejunum smooth muscle contractility were explored . flow cytometry was used to analyze the proportion of th17 cells in jejunum . the levels of il-17 , il-23 , and tgf-1 in jejunum were measured by western blot . our results showed that the inflammation in jejunum was severe at 2 weeks postinfection ( pi ) , which was not discernible at 8 weeks pi . jejunal smooth muscle contractility was increased at 2 weeks pi and kept higher at 12 weeks pi . the proportion of th17 cells and the expression of il-17 were upregulated in jejunum at 2 weeks pi and normalized at 8 weeks pi . when jejunual smooth muscle strips were cultured with il-17 , contractions elicited by ach were enhanced in a concentration - dependent manner . our data suggest that th17 cells are increased during acute infection with trichinella spiralis and il-17 may contribute to jejunal muscle contractility in mice .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

a mylab 30 gold ( esaote , genova , italy ) and a linear probe ( la435 : 6 - 18 mhz , esaote , genova , italy ) were used as the ultrasonographic equipment . performed in the intensive care unit ( icu ) , a blanket was placed under the calf of the patient in order to maintain dorsosacral position . a pad was placed beneath the shoulders for support in order to maintain a neutral position of the head or to prevent extension or flexion of the head . 1 mg / kg of ketamine was injected before the procedure for sedation , and after confirming sedation , the patient 's head was rotated to the side opposite to the site of the procedure . a linear probe applied with non - sterilized ultrasonographic gel ( aquasonic , parker , new jersey , usa ) was placed in the cricothyroid membrane area to transectionally scan and confirm the anatomic structures of the internal jugular vein and carotid arteries before the procedure . the probe was then moved towards the patient 's legs to confirm the merging of the internal jugular vein and the subclavian vein , clavicle , and pleural line . after confirmation of these anatomic structures , the site of the procedure was sterilely draped with 2% povidone iodine and covered with a sterile spread . 1 to 2 ml of 2% lidocaine was locally injected into the site of the procedure . a sterilized gel ( aquasonic , parker , new jersey , usa ) was applied to the probe and covered with a sterilized ultrasonographic drape . if the size of the subclavian vein identified through the probe was smaller than 2 mm , a 4 french catheter was used . if larger , a 5 french catheter ( pediatric two - lumen central venous catheterization set , arrow international , pennsylvania , usa ) was used ( fig . the internal jugular vein , carotid artery , subclavian vein , the clavicle and its shadow were identified by transectionally scanning , as done previously before sterile draping . the needle was inserted while targeting the confluence of the internal jugular vein and the subclavian vein . after positioning the needle tip within the vessel , blood was aspirated in order to confirm its location , and a guide wire was inserted following typical catheterization procedures ( fig . the internal carotid area was checked with the probe to see whether the catheter entered the internal jugular vein . after confirming no entry into the internal jugular vein , the catheter was fixed to the skin ( fig . catheterization was carried out in the operating room ( or ) , and the patient was first put under general anesthesia and placed in a trendelenburg position . an identical method was used in a total of 11 pediatric patients . demographic and procedural information ages ranged from 2 days to 24 months , weighing 1,120 g to 12.4 kg , with height ranging from 34.2 cm to 91.7 cm . 3 procedures were carried out in the icu , 5 in the or , 2 in the neonatal intensive care unit ( nicu ) , and 1 in the ward . most were successful at the first attempt , although one patient carried out in the or was successful upon the second attempt . a single attempt was defined as introducer - needle insertion into the skin , advancement into the vein , and blood aspiration . the number of attempts was increased if blood was not aspirated or the catheter insertion was unsuccessful despite aspiration , such that the introducer needle needed to be reinserted . complications such as incorrect catheter location , arterial puncture , pneumothorax , or hemothorax did not occur in any patients . the first patient in whom we ultrasonographically placed a subclavian vein catheter was a female pediatric patient weighing 5,150 g , born premature and being treated for a respiratory - related disease for over twelve months in the nicu and icu . anesthesiology was consulted because many attempts of subclavian vein catheterization by cardiovascular and pediatric surgeons were unsuccessful , causing multiple hematomas and making of the anatomic landmark difficult . there are a considerably large number of reports on ultrasound - guided central line placement in adult patients , but few on pediatric patients , for whom most procedures are carried out on the internal jugular vein . the only successful report of pediatric ultrasonographic - guided subclavian approach is by pirotte et al . . the success rates of central venous catheterization through anatomic landmarks are high in adult and pediatric patients , but failure rates are as high as 35% , along with delayed management of complications such as arterial puncture , formation of arteriovenous fistula , pneumothorax , and nerve injury , thus encouraging the use of an ultrasonograph during internal jugular vein catheterization . however , because there is no definite evidence on the efficacy of ultrasound - guided subclavian vein catheterization , it is difficult to make a positive conclusion . there are barely any cases considering ultrasound - guided subclavian vein catheterization in pediatric patients , although one case using a 25 mm linear probe through the supraclavicular fossa to access the axillary vein , or supraclavicularly to access the venous confluence has been reported . however , for this particular case , it is difficult to say that a genuine central venous line was placed because the axillary vein was accessed . also , a prolonged period of catheter placement in the supraclavicular fossa is prone to infection , because the catheter insertion point is close to the patients ' mouth , thus causing management issues . it is possible for the procedure to be carried out not only on the right side but also the left side , but a right - handed practitioner may be prone to difficulties , thus making handedness a problem . pirotte and veyckemans are the only ones to report a case of ultrasound - guided subclavian vein catheterization through an infraclavicular approach in pediatric patients . however , because a 25 mm hockey stick probe ( hsp ) was used , anatomical structures were detectable in real - time in small children . however , in larger children , this is not possible , and the needle has to be inserted after confirming the subclavian vein is limited to the clavicular area by marking the skin , making it difficult to observe the entire process . on the other hand , a 40 mm linear probe was used in the current cases rather than the 25 mm hsp that pirotte et al . used , making it possible to precisely observe not only the subclavian vein but other surrounding structures in children weighing over 10 kg , as well as premature infants weighing approximately 1 kg , while being able to observe the entire process of central venous catheterization . this method was successful on its first attempt in 10 out of 11 patients , and resulted in no complications regarding insertion . due to its larger scanning range than the 25 mm hsp , the 40 mm probe provided more accurate scanning images of the surrounding structures , despite the posterior acoustic shadowing due to the clavicle . in conclusion , if the method proposed here is carried out by a skilled anesthesiologist who is familiar with subclavian vein catheterization in pediatric central venous catheterization , ultrasound - guided central venous catheter insertion can be useful for premature infants , whose anatomical structures are difficult to identify , as well as relatively larger infants weighing over 10 kg , without any major complications . however , because this case was not a planned prospective study , more research is needed to prove its superiority to catheterization by anatomical indications .

central venous catheterization ( cvc ) can be difficult , especially with pediatric patients in critical care . accessing the subclavian vein ( scv ) can cause serious complications , including pneumothorax , arterial puncture , and hemothorax . recently , the ultrasonographic ( usg ) technique has gained popularity , but its efficiency is not yet confirmed . subclavian venous catheterization ( scvc ) through the supraclavicular approach ( sca ) with usg or accessing the brachiocephalic vein through the infraclavicular approach ( ica ) has been reported in the past . a useful technique is reported that involves the use of a 40 mm probe rather than the usual 25 mm probe in order to confirm the location of the needle while successfully performing subclavian venous catheterization in pediatric patients weighing 1.1 kg to 15.0 kg .

Case Report Discussion

worldwide , the estimated number of persons living with the human immunodeficiency virus ( hiv ) in 2007 was 33.2 million.1 sub - saharan africa remains the most affected by the global acquired immunodeficiency syndrome ( aids ) pandemic ; more than two - thirds ( 68% ) of all people living with hiv are in this region . also , more than three - quarters of aids deaths in 2007 occurred in sub - saharan africa . the first aids case in nigeria was reported in 1986 . at the end of 2006 , the prevalence hiv / aids in nigeria was estimated to be 4.4%.2 untreated hiv infections usually progresses to aids . thus , individuals affected by hiv are more likely to develop long term complications of hiv / aids including cardiovascular ( cv ) complications . the introduction of highly active antiretroviral therapy ( haart ) in the mid to late 1990s dramatically reduced hiv - associated morbidity and mortality in treated patients , so that they no longer inevitably succumb to opportunistic infections.34 the increasing accessibility of antiretroviral drugs in resource poor countries has led to a significant reduction in morbidity and mortality . there is growing concern that the metabolic complications associated with hiv and antiretroviral therapy may lead to an increased risk for cv diseases.56 following the introduction of haart , studies reporting treatment related side - effects such as hyperlipidaemia , fat redistribution , insulin resistance and high blood pressure began to appear in the literature . some of these complications are also components of metabolic syndrome , which constitute a cv disease risk in the general population . studies have reported higher prevalence of metabolic syndrome among hiv positive patients on haart than in hiv negatives.78 several studies on cv risk factors among hiv / aids patients on haart have been reported in the western literatures but there is paucity of information on this subject in sub - saharan africa , which has the greatest hiv / aids burden and increasing access to haart . identification of these risk factors and appropriate intervention where necessary would allow assessment of impact of haart on cv risk . this study aimed to evaluate the cv risks profile of hiv / aids patients at a health facility in kano , nigeria . our objectives were to compare cv risk factors burden among haart - treated and haart - nave subjects . this was a cross - sectional study carried out at the hiv specialty clinic of aminu kano teaching hospital ( akth ) , between may and august 2009 . group 1 included hiv positive patients attending hiv specialty clinic who had been receiving haart for at least 6 months . the control group ( group 2 ) comprised age and sex matched hiv positive patients who had indication for haart but had not commenced , either because they are on a waiting list or they are undergoing investigations before commencing haart . we excluded patients less than 18-years - old , those on haart for less than 6 months , pregnant and lactating women , those with documented hypertension , diabetes and dyslipidaemia before commencing haart , terminally ill patients and those who declined consent . group 1 patients were recruited during their routine follow up while group 2 patients were recruited during their initial visit . haart was defined as a combination of at least three classes of antiretroviral drugs , namely protease inhibitors ( pis ) , non - nucleoside reverse transcriptase inhibitors ( nnrtis ) and nucleoside reverse transcriptase inhibitors ( nrtis ) , one of which was a pi or an nnrti or a triple combination of ( nrtis ) . informed consent was obtained from each patient and the study protocol conforms to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by the akth ethics committee . history was obtained and thorough physical examination performed including measurement of blood pressure , palpation of pulses and anthropometry . height was measured with a stadiometer with the patients standing erect on a flat surface without shoes or headgear . weight was recorded in kilograms using a standard weighing scale on a firm horizontal surface with patients wearing light clothing . twelve lead surface electrocardiogram ( ecg ) will recorded for all patients in the ecg laboratory of akth using schiller ecg machine in the standard fashion . body mass index ( bmi ) and waist - hip ratio were calculated using the standard formulae . venous blood was taken after a 10 hour overnight fast for the determination of fasting blood glucose ( fbg ) , lipid profile and uric acid . hypertension was identified when the average of two blood pressure ( bp ) measurements was equal to or greater than 140/90 mmhg . diabetes mellitus ( dm ) and impaired fasting glycaemia ( ifg ) were defined using the american diabetes association ( ada)9 guidelines as follows : dm - fasting plasma glucose 126 mmg / dl ( 7 mmol / l ) or random plasma glucose of 200 mg / dl ( 11.1 mmol / l ) and ifg - fasting plasma glucose ( 6.0 - 6.9 dyslipidaemia and metabolic syndrome were defined using the national cholesterol education programme ( ncep ) adult treatment panel ( atp ) iii guidelines.10 obesity was defined with the bmi using the world health organisation ( who ) classification.11 patients were said to have increased waist circumference ( wc ) according to the ncep atp iii guidelines : 102 cm for males and 88 cm for females , and waist hip ratio ( whr ) was said to be abnormal if > 0.9 for men and > 0.85 for females . left ventricular hypertrophy ( lvh ) was assessed using the lyon - sokolow criteria.12 data analysis was performed using the statistical package for the social sciences ( spss ) , version 16.0 . analysis of continuous variables was carried out using the procedures of descriptive statistics and later , to identify any differences we used student 's t test . continuous variables were analysed with descriptive statistics and compared using student 's t - tests . categorical variables were analysed using contingency tables involving chi - square ( ) tests to identify statistical differences between the groups . the relationship between haart and cv risk profile was determined using logistic regression analysis . for all statistical test p < data analysis was performed using the statistical package for the social sciences ( spss ) , version 16.0 . analysis of continuous variables was carried out using the procedures of descriptive statistics and later , to identify any differences we used student 's t test . continuous variables were analysed with descriptive statistics and compared using student 's t - tests . categorical variables were analysed using contingency tables involving chi - square ( ) tests to identify statistical differences between the groups . the relationship between haart and cv risk profile was determined using logistic regression analysis . for all statistical test p < two hundred subjects were studied ; 100 were on haart ( group 1 ) and the other 100 ( group 2 ) were haart - naive . participants age ranged from 20 to 50 years while their mean age was 32.5 7.55 years . the corresponding age range for group 1 and group 2 were 20 to 50 years and 20 to 48 years while the mean ages were 32.81 7.63 years and 32.36 7.50 years , respectively ( t = 0.421 , p = 0.675 ) . sixty - four percent of the respondents ( n = 128 ) were aged between 20 and 34 years . only 21.5% ( 43 ) of the respondents were above the age of 40 years . the proportions of females were 54% and 52% in group 1 and group 2 , respectively . the duration of hiv diagnosis ranged from < 1 year to 12 years for group 1 and about 99% of them were diagnosed more than 1 year ago . for those in group 2 , duration of hiv diagnosis was from a month to 6 years ; about 76% were diagnosed less than a year ago . all the subjects on treatment ( group 1 ) were on a backbone of either lamivudine ( 3tc ) 78% or emtricitavine ( ftc ) 22% which are essentially similar drugs . fifty - four percent were on zidovudine based ( azt ) , while 23% each were on stavudine ( d4 t ) or tenoforvir - based regimens ( tdf ) . ninety percent of them were on nevirapine ( nvp ) as the third agent in the haart , 9% on effaviranz ( efv ) , only a single participant was on lopinavir ( lpvr ) . types of haart regimen among group 1 respondents 3tc lamivudine ; ftc emtricitavine ; azt zidovudine ; d4 t stavudine ; tdf tenoforvir ; nvp nevirapine ; efv effaviranz ; lpvr ritonovir boosted lopinavir table 1 shows the baseline clinical and laboratory parameters of the study subjects . the proportions of cv risk factors in the 2 groups are shown in table 2 . hypertension was documented among 17% and 2% among groups 1 and 2 subjects respectively ( p < 0.001 ) . among the hypertensives in group 1 , seven were on stavudine based , six on zidovudine based and four on tenoforvir - based regimens . hypertension was predicted by increased bmi ( or 3.69 , 95% ci 5.75 - 280.68 ) and longer the duration on haart ( or 1.37 , 95% ci : 1.12 - 5.57 ) . hypercholesterolaemia was found among 31% of the subjects in group 1 and 7% among subjects in group 2 ( p < 0.001 ) . the prevalence of metabolic syndrome among group 1 and 2 were 21% and 9% , respectively ( p = 0.017 ) . of the 21% of group 1 with metabolic syndrome 9% , 7% and 5% were on zidovudine , satavudine and tenoforvir - based regimens . eleven percent of group 1 and 2% of group 2 were obese ( p = 0.018 ) . thirty - four percent and 28% , respectively , were overweight ( p = 0.359 ) . there was statistically significant increase in bmi with increasing age ( or-0.964 , 95% ci : 1.016 - 6.217 ) , but no significant association was seen between increase in bmi and type or duration of haart . clinical and laboratory characteristics of the subjects proportion of cardiovascular disease risk factors and metabolic syndrome in the two groups this study found a significantly higher burden of some cv disease risk factors ( viz : hypertension , hypercholesterolaemia , obesity and metabolic syndrome ) among haart - treated hiv patients than their haart - nave counterparts . trends in published research findings on this subject have shown a mixture of association and lack of association between haart use and cv risks . gazzaruso et al . , compared the prevalence of hypertension among 287 hiv positive patients receiving haart to 287 age- and gender - matched controls in relation to the metabolic syndrome , they found an increased prevalence of hypertension ( 34.2% vs 11.9% ) and metabolic syndrome ( 33.1% vs 2.4% ) , in the patients on haart.13 in contrast , bergensen et al.,14 compared the prevalence of hypertension in hiv - infected patients naive to haart , those receiving haart and hiv - negative controls . similarly , a kenyan study found no difference in the prevalence of hypertension between hiv positive subjects on haart and those who were haart naive.15 the finding of a significant difference in the prevalence of hypertension in our study might be as a result of muscle wasting and dehydration in the untreated patients . some workers have observed that in untreated patients , systolic bp ( sbp ) is reduced progressively in hiv infection.16 additionally , it has been postulated that untreated hiv disease may tend to lower bp , while normalisation of immune status and suppression of hiv replication with potent antiretroviral combinations elevate bp.17 whether continued treatment with haart results in an increased incidence of hypertension or a normalisation of bp from untreated disease is unknown . in our study sbp correlated with waist - to - hip ratio , which is a marker metabolic syndrome and is associated with haart use . the chances of having hypertension in this study were predicted by increasing bmi and longer duration of haart . increasing bmi has been shown to be a predictor of hypertension among patients on haart by other investigators.1819 also , seaberg et al . , found the duration of haart to be a predictor of hypertension . in their study , the prevalences of systolic and diastolic hypertension were found to be non - significantly different between patients who had received haart for less than 2 years and hiv - negative controls.20 however , our study suggests that haart predisposes to development of high blood pressure in patients who had treatment for 6 months or longer . it is important to note that the fairly high prevalence of hypertension ( 25 - 35% among adults ) among the general population in the study area implies that exposure to haart may be unmasking a pre - existing predisposition and may not be a direct cause . the finding of hypercholesterolaemia is similar to previous findings of manuthu et al . , who found prevalences of elevated total cholesterol ( tc ) to be 39.2% and 10% among haart - treated and haart - nave subjects.15 in this study , the prevalence of hypertriglyceridaemia was not statistically different between the two groups . this is concordant with the findings of manuthu et al.15 the high prevalence of low high density lipoprotein cholesterol ( hdl - c ) among haart - nave subjects may be as a result altered lipid metabolism which is known to occur in association with hiv infection . an earlier publication by riddler et al . , suggested that hiv seroconversion resulted in reductions in total cholesterol , low - density lipoprotein cholesterol ( ldl - c ) , and hdl - c levels and that initiation of haart increased both tc and ldl - c levels but not hdl - c.21 some studies suggest that effavirenz usage is associated with the development of increased tc levels , largely due to beneficial increases in hdl levels.22 ninety - nine percent of the subjects on haart arm of this study were on non - nucleoside reverse transcriptase inhibitors ( nnrti ) . this class of anti - retroviral ( arvs ) was shown to raise hdl - c level substantially as immunological status improves which may provide a potential long term beneficial effect on cv risk profile.22 this finding suggests that nnrtis could have beneficial effects on lipids profile in addition to reducing viral replication and improving immunological status . there was higher prevalence of obesity ( bmi > 30 kg / m ) and increased wc among subjects that were on haart . this contrast the findings from data collection on adverse events of anti - hiv drugs ( d : a : d ) study were haart - nave subjects tended to be obese compared with haart - treated subjects.23 lipodystrophy with lipoatrophy might have contributed to this finding in dad study . additionally , this disparity may be partially explained by malnutrition , opportunistic infections like tuberculosis and the mode of presentations of our patients where presentation is usually late with aids - defining illness such as the hiv wasting syndrome . we found no statistically significant difference between the prevalence of dm in the two groups . our finding of a 3% prevalence of dm among haart recipients is comparable with the 2.5% reported in the dad study . while it is still unclear if hiv increases the risk of insulin resistance , factors attributed to this association include use of pis , which have been found to induce insulin resistance over a short treatment course.24 the overall prevalence of metabolic syndrome in our study was 15% . this was similar to the 17% prevalence of metabolic syndrome among spanish hiv positives subjects.7 metabolic syndrome was higher among subjects who were on haart compared to haart naive subjects . several studies have estimated the prevalence of metabolic syndrome among hiv - positive haart recipients . reported prevalences have ranged from 14% to 25%.2526 while some workers reported metabolic syndrome prevalence was similar to that of control groups , others reported it to be higher among haart recipients.26 jacobson et al . , noted specific anthropometric limitations to the metabolic syndrome definitions when applied to hiv - infected haart recipients.27 wcs were lower in hiv - infected haart recipients compared with the uninfected population despite similar prevalence rates for metabolic syndrome.28 as such metabolic syndrome definitions may not be sufficiently sensitive for hiv - infected haart recipients . metabolic syndrome in hiv - infected haart recipients likely represents the synergy of drug effects on glucose and lipid metabolism , hiv / drug - induced impairment of adipose tissue function , underlying genetic predisposition to metabolic disease and lifestyle factors.7 while most classes of arv drugs used in haart could increase cv risk , the effect is mostly seen with regimens containing pis . the fact that only one patient in this study had a pi containing regimen may suggest that the effect of haart on the risk factors could have been underestimated . the comparison done was mainly between stavudine , tenoforvir and zidovudine , which are all nrtis . despite this , the study result has shown that non pi - containing haart regimens , which are mostly used in sub - saharan africa also significantly , affect the cv risk factors . this study showed that exposure to haart whilst improving the immune status of patients , predispose them to development of hypertension , dyslipidaemia and metabolic syndrome . thus , there is need for cv risk factors assessment before initiation of haart followed by periodic monitoring while on the treatment . this will ensure prompt detection and management of cv risk factors and the prevention of cv events .

background : highly active antiretroviral therapy ( haart ) has become more accessible to human immunodeficiency virus infection / acquired immunodeficiency syndrome ( hiv / aids ) patients worldwide . there is growing concern that the metabolic complications associated with hiv and haart may increase cardiovascular risk and lead to cardiovascular diseases . we , therefore , set out to describe the cardiovascular risk profile of hiv / aids patients receiving haart at a health facility in northern part of nigeria.materials and methods : this cross - sectional study was conducted at the aminu kano teaching hospital , kano , nigeria . consenting patients , who had been receiving haart , were compared with age and sex matched haart - naive subjects . questionnaire interview , electrocardiography , anthropometric and blood pressure measurements were conducted under standard conditions . blood samples were obtained for the determination of plasma glucose , uric acid and lipid levels.results:two hundred subjects were studied , 100 were on haart ( group 1 ) and the other 100 ( group 2 ) were haart - naive . subjects mean age for all the participants was 32.5 ( 7.6 ) years . the prevalence of hypertension was 17% in group 1 and 2% in group 2 ( p < 0.001 ) . similarly , 11% and 21% of group 1 subjects were obese or had metabolic syndrome compared with 2% and 9% of group 2 patients ( p < 0.05 for both).conclusion : haart treatment was associated with significantly higher prevalences of hypertension , obesity and metabolic syndrome .

INTRODUCTION MATERIALS AND METHODS Statistical analysis RESULTS DISCUSSION CONCLUSION

in the last few years , numerous new dental restorative materials have been introduced in response to an increasing demand for esthetic and biocompatible materials . the high - strength all - ceramic materials that are currently used in dentistry consist of alumina , zirconia , pressed , castable or machinable glass ceramics . several developments have taken place in these areas resulting in the production of ceramic materials for clinical use . these include the aluminous porcelain crown ( vitadur , vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ) , the non shrink ceramic crown ( cerestore , johnson and johnson , east windsor , nj , usa ) , the castable mica glass - ceramic crown ( dicor , caulk / dentsply , milford , de , usa ) and the leucite - reinforced glass ceramics ( ips empress , ivoclar vivadent , schaan , liechtenstein ) . all these all - ceramic systems exhibit low flexural strengths ( 100 - 150 mpa ) , which make them at risk of failure when used for the construction of either posterior crowns or fixed partial dentures . due to the relatively low strength of the early types of ceramics employed in the conventional porcelain jacket crowns , an alumina - reinforced porcelain core material was developed by mclean for the fabrication of such crowns . a veneer porcelain placed on a core containing approximately 50% fused alumina crystals , compared to the conventional feldspathic porcelain level of about 19% , resulted in a dental ceramic with flexural strength from 100 to 130 mpa . the popularity of high - strength ceramic systems is increasing , and the range of their clinical indications is expanding constantly . lithium disilicate ceramics ( ips empress 2 , ivoclar vivadent , schaan , liechtenstein ) , infiltrated alumina ceramic ( in - ceram alumina , vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ; turkom - cera fused alumina , turkom - ceramic ( m ) sdn . puchong , selangor , malaysia ) , densely sintered aluminum oxide ceramic ( procera ) , and zirconium oxide ceramic ( procera allzirkon , nobel biocare , gteborg , sweden ; lava , 3 m espe , st . paul , mn , usa ) are popular high - strength ceramic materials that offer favorable esthetic characteristics , mechanical properties and biocompatibility . in - ceram alumina has a high strength ceramic core fabricated through the slip - casting technique . a slurry of densely packed al2o3 ( 8082 wt% ) is applied and sintered to a refractory die at 1120c for 10 h. this produces a porous skeleton of alumina particles which is infiltrated with a low - viscosity glass in a second firing at 1100c for 4 h. this system is conventionally used as a core material in conjunction with a more translucent ceramic to enhance esthetic properties . advances in dental ceramics include the introduction of a high - strength all - ceramic core material ( turkom - cera ) containing primarily aluminum oxide ( 99.98% ) . a stone die is covered by a 0.1-mm - thick red plastic foil and dipped in the turkom - cera alumina gel ( 99.98% ) following the manufacturer 's instructions . after drying of the alumina gel , the coping with the red plastic foil is removed from the stone die and sintered for 5 min at 1150c . the sintered coping is crystal hardened in a second firing process using turkom - cera crystal powder for 30 min at 1150c . like all other infiltration ceramics , this core is then veneered with porcelain adjusted to have the correct coefficient of thermal expansion ( 6.5 - 7.2 ) . many ceramics are currently available and marketed for use as dental crown and bridge materials . it has not been ascertain whether the properties of the newer dental materials enable their clinical use to be extended to crowns and bridges in the posterior region . the maximum biting forces that may occur in the posterior area vary between 300 and 880 n. therefore , it is important for the posterior restorations to be able to withstand the maximum biting forces created in this region . although long - term clinical studies constitute the ultimate basis on which to reliably predict the long - term performance of such restorations , several physical and mechanical properties are essential to support the correct indication of these materials . because of different compositions and manufacturing techniques , dental ceramics vary in their physical and mechanical properties . one important property is the strength of the materials , and specially the flexural strength , because of the brittle nature of ceramics . therefore , the aim of this study was to evaluate the flexural strength of turkom - cera compared to two other all - ceramic materials . three different types of ceramic materials , turkom - cera [ ( turkom - ceramic ( m ) sdn . puchong , selangor , malaysia ) ] , in - ceram ( vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ) and vitadur - n ( vita zahnfabrik ) were used in this study . perspex split mold with five circular openings of 16 mm diameter and 2 mm thickness was used for the preparation of the turkom - cera disc specimens . the turkom - cera alumina gel was mixed to an optimum consistency and placed into the disc - shaped perspex mold . the turkom - cera alumina gel was left in the mold for 24 h. after drying of the alumina gel , the discs were taken from the mold and fired ( sintered ) in the furnace ( ivoclar vivadent , programat p300 , ivoclar vivadent ag , schaan , liechtenstein ) for 5 min at 1150c . the turkom - cera crystal powder was mixed with water and the sintered discs were crystal - hardened in a second firing process in the same furnace for 30 min at 1150c . a total of 10 turkom - cera discs ( 16 mm diameter and 2 mm thickness ) were fabricated . perspex split mold with an open top and bottom 5 circular openings ( 16 mm diameter and 2 mm thickness ) was used for the preparation of the in - ceram disc specimens . the mold was rested and secured on a base made from gypsum die material ( densite , shofu inc . , the in - ceram alumina slip was prepared by mixing in - ceram alumina powder with in - ceram mixing fluid and additive supplied by the manufacturer . the slip was poured into the mold and dried for 24 h. after drying , the in - ceram alumina discs were taken from the mold and fired using the in - ceramat furnace ( vita zahnfabrik ) for 6 h at 120c and 4 h at 1120c . the in - ceram glass powder was mixed with water and the sintered in - ceram alumina discs were glass - infiltrated in a second firing process in the same furnace for 30 min at 200c and 4 h at 1100c . a total of 10 in - ceram discs ( 16 mm diameter and 2 mm thickness ) were fabricated . according to the results of a preliminary study , vitadur - n porcelain discs of initial diameter 18 mm shrunk to 15.5 - 16 mm in diameter when fired . therefore , a brass split mold with five circular openings of 18 mm diameter was used for the preparation of the vitadur - n disc specimens . vitadur - n aluminous core porcelain powder was mixed with vita modeling liquid p to an optimum slurry consistency . the slurry was placed into the disc - shaped brass mold and vibrated to reduce air bubbles . a brass compactor was also machined and used to condense the slurry into the mold in order to obtain flat surface . the condensed slurry was left in the mold for 30 min and excess liquid was blotted away with absorbent tissue . a layer of vita modisol ( vita zahnfabrik ) separating medium was applied to the mold before the porcelain mixture was poured to facilitate removal of the set porcelain without any distortion . the disc specimens were then fired according to the manufacturer 's recommendation in a multimat - touch vacuum furnace ( dentsply , dreieich , hessen , germany ) . the furnace was programmed to give a temperature of 1120c for 60 s under vacuum followed by a further 60 s at atmospheric pressure . a total of 10 vitadur - n aluminous core porcelain discs with 15.5 - 16 mm diameter were fabricated . in order to meet the exact requirements of the biaxial testing protocol recommended by iso ( 1995 ) , all specimens were subsequently grinded to a parallel shape using the grinder / polisher machine ( metaserv 2000 , buehler , coventry , west midlands , uk ) . a custom made specimen holder made from aluminum was designed and used for the grinding purpose . eight specimens were fixed into the specimen holder using modeling wax ( figure 1 ) . the initial grinding was performed under running water using a diamond grinding disc with a grain size of 70 m , followed by fine - grinding using a grain size of 30 m . after that , the specimens were polished with a 15 m diamond polishing paste on a polishing cloth for two min . they were then rinsed thoroughly with running water for 20 s and dried in air . specimens mounted in the specimen holder in compliance with iso ( 1995 ) , the specimens were trimmed to 1.20.2 mm in thickness with parallelism of 0.05 mm measured using the digital caliper ( mitutoyo corp , tokyo , japan ) . piston - on - three - ball test was used for the testing . in order to carry out the test , a loading pin and mounting jig were designed and used with the instron testing machine ( instron 4302 , instron corporation , england ) . the mounting jig had a circular opening of 16 mm in diameter with three depressions positioned at equal distances from each other ( 120 apart ) and 5 mm from the center forming a tripod . these depressions were the sites for the 3.2 mm stainless steel ball bearing supports . the specimens were placed in the mounting jig which ensured the same relation between the supports and the applied load for all specimens . the 1.6 mm diameter loading pin was mounted to the crosshead of the instron testing machine and applied the load at the center of each specimen ( figure 2 ) . the test was carried out at a crosshead speed of 0.5 mm / min . the definitive fracture load was recorded for each specimen and the biaxial flexural strength was calculated from the following equation : biaxial flexural strength=-0.238 7p(x - y)/d ; x=(1+v)ln(r2/r3)+[(1-v)/2](r2/r3 ) ; y=(1+v)[1+ln(r1/r3)2]+(1-v)(r1/r3)2 , where p is the total load causing fracture ( n ) , v is poisson 's ratio ( 0.25 ) , r1 is the radius of the support circle ( 5.0 mm ) , r2 is the radius of the loaded area ( 0.8 mm ) , r3 is the radius of the specimen ( 8 mm ) , d is the specimen thickness at the origin of fracture ( mm ) . specimen during testing in the universal testing machine the results of the study were statistically analyzed with the spss software ( v. 11.5.0 for windows , spss , chicago , il , usa ) using levene 's test and dunnett 's t3 post - hoc test at a preset significance level of 5% to determine if significant differences between tests groups were related to the ceramic material used for each group . three different types of ceramic materials , turkom - cera [ ( turkom - ceramic ( m ) sdn . puchong , selangor , malaysia ) ] , in - ceram ( vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ) and vitadur - n ( vita zahnfabrik ) were used in this study . perspex split mold with five circular openings of 16 mm diameter and 2 mm thickness was used for the preparation of the turkom - cera disc specimens . the turkom - cera alumina gel was mixed to an optimum consistency and placed into the disc - shaped perspex mold . the turkom - cera alumina gel was left in the mold for 24 h. after drying of the alumina gel , the discs were taken from the mold and fired ( sintered ) in the furnace ( ivoclar vivadent , programat p300 , ivoclar vivadent ag , schaan , liechtenstein ) for 5 min at 1150c . the turkom - cera crystal powder was mixed with water and the sintered discs were crystal - hardened in a second firing process in the same furnace for 30 min at 1150c . a total of 10 turkom - cera discs ( 16 mm diameter and 2 mm thickness ) were fabricated . perspex split mold with an open top and bottom 5 circular openings ( 16 mm diameter and 2 mm thickness ) was used for the preparation of the in - ceram disc specimens . the mold was rested and secured on a base made from gypsum die material ( densite , shofu inc . , the in - ceram alumina slip was prepared by mixing in - ceram alumina powder with in - ceram mixing fluid and additive supplied by the manufacturer . the slip was poured into the mold and dried for 24 h. after drying , the in - ceram alumina discs were taken from the mold and fired using the in - ceramat furnace ( vita zahnfabrik ) for 6 h at 120c and 4 h at 1120c . the in - ceram glass powder was mixed with water and the sintered in - ceram alumina discs were glass - infiltrated in a second firing process in the same furnace for 30 min at 200c and 4 h at 1100c . a total of 10 in - ceram discs ( 16 mm diameter and 2 mm thickness ) were fabricated . according to the results of a preliminary study , vitadur - n porcelain discs of initial diameter 18 mm shrunk to 15.5 - 16 mm in diameter when fired . therefore , a brass split mold with five circular openings of 18 mm diameter was used for the preparation of the vitadur - n disc specimens . vitadur - n aluminous core porcelain powder was mixed with vita modeling liquid p to an optimum slurry consistency . the slurry was placed into the disc - shaped brass mold and vibrated to reduce air bubbles . a brass compactor was also machined and used to condense the slurry into the mold in order to obtain flat surface . the condensed slurry was left in the mold for 30 min and excess liquid was blotted away with absorbent tissue . a layer of vita modisol ( vita zahnfabrik ) separating medium was applied to the mold before the porcelain mixture was poured to facilitate removal of the set porcelain without any distortion . the disc specimens were then fired according to the manufacturer 's recommendation in a multimat - touch vacuum furnace ( dentsply , dreieich , hessen , germany ) . the furnace was programmed to give a temperature of 1120c for 60 s under vacuum followed by a further 60 s at atmospheric pressure . a total of 10 vitadur - n aluminous core porcelain discs with 15.5 - 16 mm diameter were fabricated . in order to meet the exact requirements of the biaxial testing protocol recommended by iso ( 1995 ) , all specimens were subsequently grinded to a parallel shape using the grinder / polisher machine ( metaserv 2000 , buehler , coventry , west midlands , uk ) . a custom made specimen holder made from aluminum was designed and used for the grinding purpose . eight specimens were fixed into the specimen holder using modeling wax ( figure 1 ) . the initial grinding was performed under running water using a diamond grinding disc with a grain size of 70 m , followed by fine - grinding using a grain size of 30 m . after that , the specimens were polished with a 15 m diamond polishing paste on a polishing cloth for two min . they were then rinsed thoroughly with running water for 20 s and dried in air . specimens mounted in the specimen holder in compliance with iso ( 1995 ) , the specimens were trimmed to 1.20.2 mm in thickness with parallelism of 0.05 mm measured using the digital caliper ( mitutoyo corp , tokyo , japan ) . piston - on - three - ball test was used for the testing . in order to carry out the test , a loading pin and mounting jig were designed and used with the instron testing machine ( instron 4302 , instron corporation , england ) . the mounting jig had a circular opening of 16 mm in diameter with three depressions positioned at equal distances from each other ( 120 apart ) and 5 mm from the center forming a tripod . these depressions were the sites for the 3.2 mm stainless steel ball bearing supports . the specimens were placed in the mounting jig which ensured the same relation between the supports and the applied load for all specimens . the 1.6 mm diameter loading pin was mounted to the crosshead of the instron testing machine and applied the load at the center of each specimen ( figure 2 ) . the test was carried out at a crosshead speed of 0.5 mm / min . the definitive fracture load was recorded for each specimen and the biaxial flexural strength was calculated from the following equation : biaxial flexural strength=-0.238 7p(x - y)/d ; x=(1+v)ln(r2/r3)+[(1-v)/2](r2/r3 ) ; y=(1+v)[1+ln(r1/r3)2]+(1-v)(r1/r3)2 , where p is the total load causing fracture ( n ) , v is poisson 's ratio ( 0.25 ) , r1 is the radius of the support circle ( 5.0 mm ) , r2 is the radius of the loaded area ( 0.8 mm ) , r3 is the radius of the specimen ( 8 mm ) , d is the specimen thickness at the origin of fracture ( mm ) . the results of the study were statistically analyzed with the spss software ( v. 11.5.0 for windows , spss , chicago , il , usa ) using levene 's test and dunnett 's t3 post - hoc test at a preset significance level of 5% to determine if significant differences between tests groups were related to the ceramic material used for each group . the objective was to test if the mean biaxial flexural strengths of turkom - cera , in - ceram and vitadur - n differ from each other . the mean biaxial flexural strength and standard deviation of ten specimens were calculated for each of the three groups tested ( table 1 ) . because of violation of the assumption of homogeneous variances ( levene 's statistic=13.212 , p<0.05 ) , multiple comparisons were performed with dunnett 's t3 post - hoc test at a pre - set significance level of 5% ( table 2 ) . mean and standard deviation ( sd ) of biaxial flexural strength of the three groups multiple comparisons between the three all - ceramic systems tested based on observed means , the mean difference is significant at the 0.05 level the mean biaxial flexural strength values for turkom - cera ( 506.887.01 mpa ) , in - ceram ( 347.428.83 mpa ) and vitadur - n ( 128.712.72 mpa ) differed significantly from each other ( table 2 ) ( p<0.05 ) . strength is an important mechanical property that can assist in predicting the performance of brittle materials . the uniaxial flexural strength tests , including three - point , and four - point bending tests , and biaxial bending tests are the most commonly applied methods for evaluating the strength of dental restorations . for uniaxial flexural strength tests , the principal stress on the lower surfaces of the specimens is tensile , and it is usually responsible for crack initiation in brittle materials . however , undesirable edge fracture , which can increase the variance of the failure stress value , might occur . the method adapted in this study was the one recommended by iso(1995 ) since the test standardizes specimen thickness , diameter , shape and roughness . in addition , the measurement of the strength of brittle materials under biaxial flexural strength conditions rather than uniaxial flexural strength is often considered more reliable because the maximum tensile stresses occur within the central loading area and edge failures are eliminated . therefore , the biaxial flexural test gave less variation in the strength data . according to iso(1995 ) , the biaxial flexural strength is determined by support of a disc specimen on three metal spheres positioned at equal distances from each other and from the center of the disc . the load is applied to the center of the opposite surface by a flat piston . furthermore , the flat surface of the test specimen can be easily controlled by conventional metallographic polishing methods and typical dental finishing techniques . different researchers have studied the biaxial flexural strength of in - ceram core using the same methods as the current study . the biaxial flexural strength of in - ceram has been found to be 337.5 mpa on the average . the mean biaxial flexural strength value for in - ceram ( 347.4 mpa ) obtained in the present study is in agreement with this result . the biaxial flexural strength of vitadur - n core material has been investigated using the same methods as the current study and found to vary from 141.2 to 155 mpa . the mean biaxial flexural strength value for vitadur - n ( 128.7 mpa ) achieved in the current study is in agreement with these results . the higher flexural strength obtained with turkom - cera and in - ceram may be attributed to the followings : 1 . decrease of the total porosity by initial firing ( sintering ) of turkom - cera alumina gel and in - ceram alumina slip ; 2 . the alumina particles increase the strength of the material and limit potential sites for crack propagation ; 3 . prevention of the growth of cracks by crack bridging , as the crystals and glass powders in combination with alumina may bridge the opening created by a crack after the crack front passes ; 4 . compressive stresses , which further improve the strength , are also introduced due to the differences in the coefficient of thermal expansion of the alumina and crystals / glass . despite the high strength reported with high alumina - based ceramics , they are susceptible to fatigue failure that can considerably reduce their strength over time . in this study , therefore , further studies are highly recommended to evaluate the fracture analysis and fatigue behavior of new dental ceramics . in this study , the biaxial flexural strength of three all - ceramic core materials was tested in vitro . the new high - strength all - ceramic core material containing primarily aluminum oxide had significantly higher flexural strength ( 506.887.01 mpa ) than the other ceramic core materials ( in - ceram : 347.428.83 mpa and vitadur n : 128.712.72 mpa ) . this study was supported by a grant ( p019/2006c ) ; university of malaya , kuala lumpur , malaysia . the authors thank turkom - ceramic ( m ) sdn bhd , puchong , selangor , malaysia for supplying the materials used for the preparation of turkom - cera specimens .

advances in all - ceramic systems have established predictable means of providing metal - free aesthetic and biocompatible materials . these materials must have sufficient strength to be a practical treatment alternative for the fabrication of crowns and fixed partial dentures.objectivesthe aim of this study was to compare the biaxial flexural strength of three core ceramic materials . material and methodsthree groups of 10 disc - shaped specimens ( 16 mm diameter x 1.2 mm thickness - in accordance with iso-6872 , 1995 ) were made from the following ceramic materials : turkom - cera fused alumina [ ( turkom - ceramic ( m ) sdn bhd , puchong , selangor , malaysia ) ] , in - ceram ( vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ) and vitadur - n ( vita zahnfabrik , bad sckingen , baden - wrttemberg , germany ) , which were sintered according to the manufacturer 's recommendations . the specimens were subjected to biaxial flexural strength test in a universal testing machine at a crosshead speed of 0.5 mm / min . the definitive fracture load was recorded for each specimen and the biaxial flexural strength was calculated from an equation in accordance with iso-6872 . resultsthe mean biaxial flexural strength values were : turkom - cera : 506.887.01 mpa , in - ceram : 347.428.83 mpa and vitadur - n : 128.712.72 mpa . the results were analyzed by the levene 's test and dunnett 's t3 post - hoc test ( spss software v11.5.0 for windows , spss , chicago , il , usa ) at a preset significance level of 5% because of unequal group variances ( p<0.001 ) . there was statistically significant difference between the three core ceramics ( p<0.05 ) . turkom - cera showed the highest biaxial flexural strength , followed by in - ceram and vitadur - n . conclusionsturkom - cera core had significantly higher flexural strength than in - ceram and vitadur - n ceramic core materials .

INTRODUCTION MATERIAL AND METHODS Materials Preparation of disc-shaped specimens Grinding of specimens Biaxial flexural strength testing Statistical analysis RESULTS DISCUSSION CONCLUSION ACKNOWLEDGEMENTS

hepatocellular cancer is the fifth most common cancer worldwide and is the fifth leading cause of cancer death in males in the usa . although cancer incidence in the usa is generally decreasing , hcc is one of a few cancers that is increasing in incidence and death rate [ 1 , 2 ] . the best treatment for long - term disease - free survival with hepatocellular cancer is liver transplantation . those who qualify for liver transplant must have localized disease , not amenable to surgical resection , and access to donor livers . because of limited donor livers , criteria have been developed to transplant those patients with hcc who have the best prognosis . the recommended criteria include tumor characteristics specifically milan criteria with a single tumor less than 5 cm or 3 tumors all less than 3 cm and without evidence of vascular invasion or extrahepatic spread of tumor [ 3 , 4 ] . there are also other criteria for liver transplant that relate to the presence of other medical comorbidities , psychosocial factors , and the ability to finance the transplant procedure . some of the latter criteria vary from center to center , but all centers aim to transplant those patients who are a reasonable operative risk and who demonstrate adequate compliance , psychosocial support , and financial means to deal with the immunosuppressive regimens and possible side effects of transplant . overall , hcc is being identified at earlier stages , and survival is improving as more cases are diagnosed and treated at early stages . however , disparities in liver transplant for all causes and disparities in treatment for hcc have been reported . specifically , females have been reported to be disadvantaged in terms of overall liver transplant rates . african americans and asian / pacific islanders are less likely to receive a liver transplant for hcc than white patients . differences in access to liver transplant have also been reported depending on insurance status , geography , and income status [ 810 ] . the purpose of this study is to delve more deeply into the reason for disparities in access to liver transplant for patients with hcc . in particular we wanted to determine if there were certain factors that were important in these disparities , including educational background , occupation , insurance status , and proximity to the transplant center . this is a retrospective analysis of 749 hcc cases referred to a group of surgeons ( lw ) who specialize in hepatobiliary surgery . this group is affiliated with hawaii 's only clinic dedicated to liver diseases , the only liver transplant center in the state and the only referral center for liver diseases and surgery for american territories of the pacific basin ( including american samoa , guam , saipan , and the marshall islands ) . in addition , a number of patients were foreign nationals from asian countries , including china , japan , korea , and the philippines , who sought medical care in the usa . hcc was diagnosed histologically by percutaneous biopsy , liver biopsy at the time of surgery , or examination of the resected liver . before 2010 , according to the united network for organ sharing policy regarding transplant for hcc , patients without histologic confirmation were included if they had a history of chronic liver disease and a mass at least 2 cm in size seen on two imaging studies ( ultrasound , ct scan , or mri ) and one of the following : ( 1 ) a vascular blush seen on ct scan or mri , ( 2 ) alpha fetoprotein ( afp ) > 200 ng / ml , or ( 3 ) an arteriogram confirming the tumor . since 2010 and consistent with the american association for the study of liver disease ( aasld ) guidelines , patients without histologic confirmation were included if they had a contrast enhanced study that demonstrated a tumor larger than 1 cm with hypervascularity in the arterial phase and washout in the portal vein or delayed phase . if the findings were not typical , then a second contrast - enhanced study or biopsy was used to confirm the diagnosis [ 4 , 11 ] . information on demographics , medical history , laboratory results , tumor characteristics , treatment , and survival data was collected via a clinical interview . demographic data included age , sex , birthplace , and the patient 's self - reported ethnicity . ethnicity was categorized as white , patients who did not fit into one of these categories or were of mixed ethnicity were subsequently classified as other . patients of mixed race with 50% pacific islander ethnicity were categorized as pacific islander . measured height and weight were used to determine body mass index ( bmi ) . those that reported that they successfully completed the general educational development test ( ged ) were recorded as having finished high school or 13 years of education . we did not have access to information as to whether english was the primary language spoken ; however hawaii has about 25.5% of households in which english is not the primary language spoken compared to 20.1% for the remainder of the usa . white collar including professional , semiprofessional , administrative , and salaried workers , blue collar denoting those who perform manual labor , service workers , and none . none also included those patients who were on disability , retired , homemakers , unemployed but looking for work and those who had never been employed . cases in which there was no information on years of education or current occupation were eliminated from this study ; thus only 575 cases of the 749 were included . ( any type of state government assisted programs ) , or none . ten patients were referred from the veterans administration ( va ) solely for liver transplant evaluation and were not included in the analysis of insurance status . all other treatments for hcc within the va system were conducted by their center 's staff oncologists and surgeons . each patient had zip code of residence noted , and based on this information , they were categorized into oahu versus the island of oahu includes honolulu , the state 's capital and largest metropolitan city and the location of the only dedicated liver transplant and treatment facility . median income was not available in 48 patients with missing residential addresses or unavailable zip code income data.the second method used highest level of education attained to estimate income based on 2010 us income by education data . treatments included liver resection , transplantation , systemic chemotherapy , and ablative therapies ( including radiofrequency ablation , cryosurgery , transarterial chemoembolization , and percutaneous ethanol injection ) . liver resection was considered in child 's a patients and early child 's b patients ( child 's turcotte - pugh score of 7 , without any evidence of ascites or encephalopathy ) . liver transplants were considered in patients who were unresectable but met milan criteria ( single tumor less than 5 cm or 2 to 3 tumors , each less than 3 cm ) . liver transplant was also performed in patients who underwent resection but had a recurrence more than six months after surgery , provided the recurrent tumor met milan criteria , and there was no disease progression while awaiting transplant . since 2007 , liver transplant was considered in single tumors less than 6.5 cm that were downstaged to meet milan criteria . the majority of patients on the transplant list underwent either percutaneous radiofrequency ablation or transarterial chemoembolization while waiting for a donor . these groups were analyzed by age , gender , ethnicity , education ( finished high school versus did not finish high school ) , median income , and insurance status . these groups were analyzed in more detail in terms of factors which might affect access to transplant including morbid obesity , tumor size > 5 cm , and tumor outside milan criteria which were contraindication at this transplant center . all analyses were performed using spss statistical software . from the database of 749 patients , comparisons for transplant versus no liver transplant ( in patients clinically eligible for transplant ) were compared using the chi square test . factors associated with and transplant were evaluated using unconditional logistic regression to calculate crude and age - adjusted odds ratios ( or ) and 95% confidence intervals ( ci ) . a total of 575 hcc patients were evaluated including 436 males and 139 females , with mean age being 61.2 years . racial distribution was as follows : asian350 , white119 , pacific islander86 , mixed ( more than 2 races)7 , hispanic6 , black4 , and other3 . the 20 patients identified as mixed , hispanic , black , and other were excluded from analysis of race to small numbers . birthplace was primarily in the usa ( 341 patients ) , but 195 were born in an asian country , 27 were born in a pacific island nation ( or us territory ) , and 3 patients were born elsewhere . overall , most patients had some type of medical insurance , including private insurance300 , medicare167 , medicaid92 , and veterans administration ( va ) insurance10 . of the 398 patients in whom educational background was recorded , 316 ( 79.3% ) completed high school or higher education . overall tumor characteristics included the following distribution by stage : i342 patients , ii8 patients , iii139 patients , and iv12 patients . more patients had the largest tumor 5 cm or larger ( 320 patients ) compared to those with largest tumor less than 5 cm ( 241 patients ) . of the 575 patients in the cohort , 258 ( 44.9% ) met milan criteria . of the 575 patients , 521 had a chronic liver disease or viral hepatitis , and 54 had no underlying disease for which screening could have been recommended or performed . etiology of hcc varied by race with hepatitis b related hcc predominant in asians and hepatitis c in whites ( table 1 ) . eight patients had hcc found incidentally on the explanted liver at the time of transplant and were excluded from the analysis of screening versus nonscreening . patients who underwent liver transplant for hcc were more likely to be younger in age and male ( table 2 ) . liver transplant patients were also more likely to have finished high school and have private insurance . patients with no listed occupation ( unemployed , disabled , currently not working ) were less likely to receive a transplant . median income as estimated by both zip code and education level was significantly higher in patients who underwent liver transplant . patients who underwent liver transplant for hcc had higher median income based on zip code ( $ 54,383 versus $ 49,383 , p = 0.046 ) and based on self - reported education level ( $ 48,948 versus $ 38,800 , p = 0.002 ) . factors of race , education , insurance , and occupation were then analyzed as to how they may affect the main criteria contraindicating liver transplant for hcc which include tumor size > 5 cm , bmi > 35 , and outside milan criteria ( table 3 ) . level of education and type of insurance did not seem to affect the presence of these criteria . in terms of race , pacific islanders were more likely to have tumor size larger than 5 cm when compared to whites . pacific islanders also had significantly more patients ( 20.7% ) with bmi > 35 compared to whites ( 6.4% ) and asians ( 4.7% ) . with unconditional logistic regression , the only factors that affected access to transplant include age > 60 years ( p < 0.001 ) and insurance status ( p = 0.001 ) . it is not a great surprise that there are disparities in access to liver transplant for hcc . with the limited donor livers , expense , and the need for criteria to select patients , herein lies the problem of access to liver transplant . identifying tumors that meet milan criteria can be difficult as hcc is generally not symptomatic until advanced stages of liver disease or cancer are present . the best way to identify tumors at earlier stage would be to identify the population at risk those with viral hepatitis or some type of cirrhosis and screen them for hcc . thus access to liver transplant for hcc is intimately related to a patient 's access to health care and screening for hcc . the scientific registry of transplant recipients ( srtr ) data ( n = 79 , 998 ) showed that females had a lower transplant rate in both the pre - meld ( 9% , p < 0.0001 ) and meld eras ( 14% , p < 0.0001 ) and that there was substantial geographic variation in these sex - based differences . in a separate study , this group determined that african americans and asians had similar liver transplant rates compared to whites , but hispanics had an 8% lower transplant rate compared to whites , and subgroups of asian candidates with higher meld scores had a 46% lower transplant rate [ 6 , 16 ] . differences in transplant may also be due to timing of referral to a transplant center as several studies have demonstrated that african americans and ethnic minorities had delayed referral or higher meld score at the time of referral [ 1719 ] . other factors affecting transplant access include insurance status and distance from the transplant center [ 2022 ] . studies have also demonstrated differences in access to care and survival in patients with hcc . in reviewing the california cancer registry with 12,148 hcc cases , african american and hispanic patients were less likely than white patients to undergo liver transplant for hcc , and those with lower socioeconomic status and no private insurance were less likely to receive surgery of any type . those in the highest socioeconomic quintile were four times more likely to receive a liver transplant than the lowest quintile . mathur et al . in reviewing the seer hcc data showed that there were still racial disparities in survival even when considering early stage hcc . blacks had persistently poor survival even after accounting for differences in stage and use of invasive therapy . the seer data also showed that asians / pacific islanders had better 5-year survival ( 23% ) when compared to whites ( 18% ) , hispanics ( 15% ) , or blacks ( 12% ) . our study demonstrates that there are differences in access to liver transplant by age , gender , ethnicity , insurance , level of education , median income , and occupation , but with the multivariate analysis , insurance status and age appeared to be the most important . proximity to a transplant center that requires travel to another island did not seem to affect access . in particular , the pacific islanders underwent fewer liver transplants compared to whites and asians . in trying to determine factors that may account for this , we demonstrate that fewer pacific islanders had their hcc found on screening , and more of them had tumors larger than 5 cm which may have disqualified them ; however the same proportion of their hcc did meet milan criteria . morbid obesity ( bmi > 35 ) is a relative contraindication to liver transplant at our center , and more pacific islanders had bmi > 35 compared to whites and asians , which may have contributed to the fewer transplants performed in this ethnic group . since high bmi has been associated with lower socioeconomic status , our relative contraindication of bmi > 35 may have contributed to the low transplant rate in those with lower socioeconomic status . however with multinomial regression , the most important factors in determining transplant access included age and insurance status . this study is somewhat limited as it is a single center study in a primarily asian population . however , larger studies with administrative databases such as the medicare database and the unos / srtr will not have information on patient 's educational background , occupation , and proximity to transplant centers . large single center studies or collaborations with individual centers will be necessary to truly investigate cultural and psychosocial barriers to care . asians and pacific islanders are frequently combined in most us studies , when our study clearly shows that there are differences in access to hcc screening and transplant in these two groups . it will be difficult to overcome some of the barriers to liver transplant access in hcc primarily because limited donor livers drive the need for strict criteria . patients must have enough of an understanding of their disease to demonstrate compliance with posttransplant care which may exclude some patients with limited education . patients must also be able to finance such an expensive therapy which likely limits the treatment to those with medical insurance , an occupation that provides medical insurance or some other financial means . we have demonstrated that there are differences in socioeconomic factors such as age , gender , ethnicity , and educational background that affect whether a patient had their liver cancer found with screening or underwent transplant . we need to better educate the community on liver disease and to better identify hcc at an earlier stage with surveillance , especially in pacific islanders , so more patients can qualify for some type of therapy , including liver transplant .

objective . the incidence / death rate of hepatocellular cancer ( hcc ) is increasing in america , and it is unclear if access to care contributes to this increase . design / patients . 575 hcc cases were reviewed for demographics , education , and tumor size . main outcome measures . endpoints to determine access to hcc care included whether an eligible patient underwent liver transplantation . results . transplant patients versus those not transplanted were younger ( 55.7 versus 61.8 yrs , p < 0.001 ) , males ( 89.3% versus 74.4% , p = 0.013 ) , and having completed high school ( 10.1% versus 1.2% , p = 0.016 ) . there were differences in transplant by ethnicity , insurance , and occupation . transplant patients with hcc had higher median income via census classification ( $ 54,383 versus $ 49,383 , p = 0.046 ) and self - reported income ( $ 48,948 versus $ 38,800 , p = 0.002 ) . differences in access may be related to exclusion criteria for liver transplant , as pacific islanders were more likely to have tumor size larger than 5 cm compared to whites and have bmi > 35 ( 20.7% ) compared to whites ( 6.4% ) and asians ( 4.7% ) . conclusions . ethnic differences in access to transplant are associated with socioeconomic status and factors that can disqualify patients ( advanced disease / morbid obesity ) . efforts to overcome educational barriers and screening for hcc could improve access to transplant .

1. Introduction 2. Methods and Materials 3. Results 4. Discussion 5. Conclusions

in the last two decades , magnetic resonance imaging ( mri ) has become an indispensable tool used to diagnose , treat and monitor gynecological cancers [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] . the increasing access to mri in radiation oncology departments , and its superior soft tissue contrast have favored it over other imaging modalities that have dominated cancer imaging for many years , such as ultrasound ( us ) and computed tomography ( ct ) . the significant improvement in target / organ delineation offered by volumetric mr images can lead to improved treatment planning and delivery , better local control , and recently reported , higher survival rates [ 7 , 8 , 9 , 10 , 11 , 14 , 16 , 17 ] . however , mri also comes with its own technical and logistical challenges such as increased cost , sophisticated patient care workflow , geometric imperfections , patient - related distortions , and its restrictive compatibility with magnetic materials [ 1 , 4 , 14 , 18 , 19 , 20 , 21 , 22 ] . the latter concern is particularly important for mri - guided brachytherapy in which metallic objects , such as cervical applicators and titanium needles are used . metal objects induce artefacts in the acquired mr images , which can degrade the quality of the image and/or its clinical usability [ 1 , 5 , 19 , 2324 , 25 , 26 , 27 ] . consequently , this might affect the potential improvement in the treatment planning expected from integrating mri into the workflow . it is therefore important to understand the fundamentals of metal artefacts and their potential effect on brachytherapy treatment in order to maximize the benefits from mri and enhance the treatment outcome . the purpose of this review is to summarize the consequences of using metal objects in brachytherapy treatment and explain the rationale behind the expected artefacts , as well as the recent efforts to evaluate and/or overcome them . we will focus on cervical cancer , which constitutes a major application for mri - guided brachytherapy . metal objects do not produce detectable signal in conventional mr images ( i.e. , they show up as signal voids ) . nevertheless , when they are introduced into a static field , they can potentially interact differently than human tissue . the type of interaction can range from minor artefact in the acquired mr image to serious safety hazards as a result of strong translational forces and torques induced in the object . in order to quantitatively describe the response of a material to the magnetic field , the concept of magnetic susceptibility must be introduced : the volume susceptibility of a material is dimensionless and usually referred to by , where 0 is often used for the susceptibility of water ( 0 = 9.05 ppm ) . the induced forces and torques of materials with < 10,000 ppm are usually manageable ; nevertheless , they must be tested before mri use . it is important here to notice that the level of compatibility / safety of a material with mri is determined based on multiple aspects and tests other than straightforward susceptibility values [ 28 , 29 ] . the susceptibility values of common materials used in brachytherapy are summarized in table 1 . susceptibilities of water , tissue , and selected materials [ 25 , 44 , 49 , 68 ] peek polyether ether ketone , ntp normal temperature [ 20oc ] and pressure [ 101.325 kpa ] when a material is exposed to an external magnetic field it becomes magnetized ; its magnetization is proportional to the magnetic susceptibility of the material and the strength of the applied magnetic field at the point where the material is placed . mathematically this can be expressed by : where m is the induced magnetization , is its susceptibility and h is the applied magnetic field . intuitively , when a foreign object is inserted in the region of mr magnetic field , it changes the resultant magnetization . for instance , if a needle is inserted during cervical brachytherapy treatment , it will induce a change in the magnetization proportional to the change in the susceptibility such that = needle tissue . therefore , from mr perspective , needles with the same susceptibility as the surrounding tissue would be ideal for such applications rather than needles with zero susceptibility . in practice , however , all the metal objects used in brachytherapy applications are paramagnetic and have larger susceptibilities than that of human tissues . once magnetized , the object produces a magnetic field that opposes the applied field and hence distort the initial magnetization . this distortion also varies with the shape and orientation of the object with respect to the main field , b0 . as mr image acquisition relies mainly on predetermined magnetic field variations , these metal - induced distortions in the magnetic field will consequently induce artefacts in the received image , as described next . in order to understand the significance of metal artefacts in brachytherapy applications , it is important to grasp the mr principles lying behind such distortions . the objects placed within the static magnetic field exhibit a magnetization along the direction of the main field ( b0 ) . once a radiofrequency pulse is applied , this magnetization vector is tilted towards the transverse plane , and starts to exhibit a special type of rotation around the main field called , precession . gradient fields are used to spatially encode the magnetization by slightly changing the precession rates as a function of position . one might then conclude that the presence of a foreign object , disturbing the initial magnetization , would consequently result in unexpected precession rates around that object , causing distortion in the decoded image . a simple analogy is to imagine the process of tuning a radio station from transmitted radio - waves . if there is a distortion in either the receiving or the transmission processes , one might either lose the intended station , hear multiple stations at the same time , or hear a wrong station . in terms of mri artefacts , this is analogous to signal loss , signal pile - up , or geometric distortions , all of which will be collectively defined here as displacements artefacts . for instance , when a 2d slice is selected , the radiofrequency pulse is applied with certain bandwidth around a particular resonant frequency that corresponds to a particular slice position . when distortions in the magnetic field exist , the excited slice will no longer represent the desired image position and signal from various slice positions could either accumulate or not get excited , causing signal pile - up or signal loss . likewise , during the signal readout each location is expected to be mapped to a resonant frequency and the presence of unexpected magnetic field variations can cause geometric distortions , signal pile - up , or signal loss effects . in addition to displacements artefacts , signal loss also occurs from the rapid dephasing of spins ( t2 * decay ) around the metal objects ; i.e. , loss of signal coherence within each voxel causing rapid signal decay . another problem is the failure of some fat suppression techniques that rely on the homogeneity of the magnetic field . mapping these artefacts to a brachytherapy application , such as using a titanium applicator , one might expect : 1 ) the location of the tandem on the mr image might not represent its exact physical location inside the patient in relation to the adjacent organs ; 2 ) signal pile - up and signal loss will occur remarkably around the applicator . the extent of these artefacts will depend on the acquisition parameters , the magnetic field strength , as well as the shape and the orientation of the applicator with respect to the main field . failing to accurately localize the applicator leads to erroneous identification of the source position during treatment delivery . accuracy of delivered dose depends on the geometrical accuracy of the source position relative to the target and organs at risk ( oars ) [ 19 , 24 , 27 ] . it has been long established that target coverage and oar sparing is strongly correlated with clinical outcomes . hence , applicator displacements or mislocalization can lead to dosimetric errors , which in turn compromise the care for patients [ 19 , 24 , 26 , 32 , 33 , 34 ] . errors in localizing the applicator can be also reflected as uncertainties in the reconstruction process . this results in uncertainties in the dose volume histogram ( dvh ) parameters for tumor and oars . reconstruction uncertainties will be added to other sources of uncertainties in mr - guided workflow such as contouring uncertainties , inter- and intra - fraction variabilities , etc . have studied possible systematic uncertainties in applicator reconstruction by simulating shifts in the applicator position ( in the order of 2 mm ) [ 24 , 26 ] . they concluded that dvh parameters will deviate less than 10% for 90% of the patients if systematic uncertainties were avoided . have recently performed a study to simulate the dosimetric impact of applicator displacements as well as the uncertainties of reconstruction . they concluded that in order to avoid more than 10% change in the prescribed doses , applicator displacements and its reconstruction uncertainties should not exceed 1.5 mm and 3 mm , respectively . in another study , 2 mm displacements in the anterior - posterior direction were found to have significant dosimetric changes . the dosimetric consequences of applicator shifts in pdr ir was studied by deleeuw et al . . they found that applicator shifts have larger dosimetric impact on oars compared to the target . findings , which concluded that rectum and bladder are the most sensitive organs to reconstruction offsets , with d2 cm variations were 5 1%/mm offset in the anterior - posterior direction , where 90% of the patients have changes < 6%/mm [ 24 , 26 ] . nevertheless , it is worth noting that dwell position uncertainty from reconstruction and source positioning for one intracavitary brachytherapy fraction was estimated in some studies to be 4% for either oars ( d2 cm ) or the target ( d90 ) . it is well known that mri is the preferred tool for target definition in gyn applications , especially following gec - estro gynecological workgroup recommendations [ 18 , 19 , 35 , 36 ] . however , when metal applicators / needles are used in mri - only workflow , it is important also to identify the extent and the significance of the artefacts as it pertains to the accuracy of applicator reconstruction and the influence on target delineation processes . this need became more prominent when titanium applicators were introduced for mr - guided intracavitary brachytherapy treatment . titanium applicators are used because they offer greater strength with smaller diameter ( 3.2 mm ) than plastic applicators . on the other hand , titanium has higher susceptibility than human tissue ( = 190 ppm ) , and the resultant artefacts can be a concern in clinical practice . in particular , displacements artefacts , as described above , could present an obstacle for accurate applicator reconstruction if the apparent location of the applicator tip on the image was shifted from its actual location or if the entire applicator position was misregistered with respect to the adjacent anatomy . this is particularly a concern at high field strength 3.0 t. in addition , signal pile - up and signal loss could lead to erroneous localization of needles / applicators tip . previous effort was made to characterize the artefacts of titanium applicators on 1.5 t and 3.0 t , as well as to optimize its visualization for accurate reconstruction [ 37 , 38 , 39 , 40 ] . phantoms and in vivo results have demonstrated that it is feasible to reconstruct the titanium applicator at 1.5 t with a mean inter - observer variability of < 1 mm [ 1 , 37 , 40 ] ( figure1 ) . artefacts could be significantly larger on 3.0 t ( up to 7 mm for 2d t2w fast spin - echo ) , and careful implementation of the mri - only planning was strongly recommended [ 1 , 27 , 39 ] . if diffusion - weighted imaging ( dwi ) is to be acquired while titanium applicator is in situ , careful interpretations of the images should be then performed , as signal - pile up / loss can affect the resultant apparent diffusion coefficient ( adc ) maps . the feasibility of dwi on 3.0 t with the titanium applicator in place is questionable . coronal ( top row ) and transversal ( bottom row ) images showing the titanium applicator in the phantom on computed tomography ( ct ) images ( a and e ) , in phantom on t1-weighted magnetic resonance ( mr ) images ( b and f ) , patient t1-weighted mr images ( c and g ) , and patient t2-weighted mr images ( d and h ) scanned at 1.5 t. the line on ( b ) shows the position of the applicator tip according to tip position found in the ct image ( a ) . the arrows in ( f and g ) indicate the artifact used for determining the rotation of the ring recently , tungsten - based tandem applicators have been introduced for high - dose - rate ( hdr ) intracavitary cervical cancer brachytherapy to achieve more conformal dose distribution to non - symmetrical target volumes so called direction modulated brachytherapy ( dmbt ) [ 41 , 42 , 43 ] . this new tandem applicator is designed to have 6 peripheral holes instead of a single central channel used in conventional tandems . tungsten alloy ( > 90% tungsten ) was chosen for its high physical density ( = 18.0 g / cm ) , allowing better oar dose sparing than titanium or plastic . luckily , its susceptibility value is relatively closer to human tissue than that of titanium ( i.e. , = 90 ppm [ 25 , 44 ] ) . preliminary results on phantoms have shown that it produces minimal in - plane artefacts on 1.5 t ( 0.5 mm ) and 3.0 t ( figure 2 ) [ 45 , 46 , 47 , 48 ] . a potential advantage of this new applicator is that it has a tip cap manufactured from peek , which has similar susceptibility to water ( = 0.3 ppm ) . however , this state - of - the - art technology is still developing and commercial tps reconstruction libraries are not yet available . further clinical validation is essential to confirm the preliminary findings , particularly in patient studies . a ) shows a plastic radial - fiducial with 4 rods used to visually evaluate the spatial shift mounted on a prototype of the tungsten - based dmbt tandem applicator . the scan was performed in water doped with mncl2 using four sequences at 3.0 t. c ) t2w - fse : t2-weighted fast spin - echo , d ) pdw - fse : proton density weighted fast spin - echo , e ) t1w - fse : t1-weighted fast spin - echo , and f ) t1w - ge : t1 weighted gradient echo interstitial titanium needles are also another place where metal artefacts can be seen . in contrast to conventional plastic needles , titanium needles do not bend inside the patient and often result in better implants [ 19 , 37 , 39 ] . due to the absence of metal artefacts , plastic needles are a better choice for mri , however their trajectory can not be easily predicted within the patients when they bend . on the other hand , the induced artefacts around titanium needles explain the reluctance of adopting them in clinical practice in place of plastic ones , particularly for mri - only planning . computed tomography is a better choice to reconstruct titanium needle trajectory , as it can provide a better defined path compared to conventional t2w - mri [ 19 , 37 ] . displacements artefacts as well as signal fluctuations ( e.g. , pile - up ) around the titanium needle can render its localization challenging , which adds a potential source of uncertainty in calculating dvh parameters [ 26 , 50 ] . it might be worth noting that the impact of reconstruction uncertainty for combined interstitial - intracavitary applicator ( plastic ) was found to be similar to those from tandem - ring applicator except for the sigmoid where interstitial case has slightly larger impact . nevertheless , signal pile - up from metal needles and applicators could be beneficial in identifying their location in some cases . for instance , haack et al . utilized the artefacts to guide the reconstruction process of the titanium applicator , while petit et al . employed 3d spoiled gradient - echo ( spgr ) in order to distinguish the applicator from the surrounding tissue . kapur et al . also benefited from the artefacts surrounding the needles to identify them using a 3d fat - suppressed balanced ssfp sequence . is to use a dedicated pulse sequence to locate the center of the magnetic field disturbance of the hdr sources , and hence allowing a real - time mr - tracking of the sources . the technique was initially implemented to locate prostate permanent seeds implants [ 53 , 54 ] , but was recently modified to locate hdr sources . for instance , it requires an mr - compatible afterloader , which is not yet commercially available , in addition to the specific technical requirements ( pulse sequence , post - processing , etc . ) that are not yet available at all centers / vendors . while gec - estro guidelines for gyn recommend conventional 2d - t2w fast spin - echo ( fse ) for target and oar delineation with specific parameters [ 18 , 19 ] , the recommendations did not highlight optimal mr parameters in terms of applicator reconstruction . isotropic 3d sequences , however , were recommended as they would allow free reformatting of the slices in any plane during image interpretation . one option for 3d imaging is the 3d t2w fse with variable flip angle , which has been successfully applied in diagnostic applications [ 55 , 56 , 5758 ] . a potential aim could be to replace the conventional 2d fse with one 3d sequence for both target / oar delineation and applicator reconstruction . for instance , 3d fast - recovery fse was previously used for this purpose . however , a serious challenge for such approach is the difference in relative tissue contrast in 3d sequences , compared to the conventional contrast provided by 2d sequences , regularly used by clinicians . it is important to notice here that the methodology of assessing the extent of artefacts of titanium applicator and the accuracy of its reconstruction varied remarkably between groups , particularly from mr imaging perspective . for instance , while some studies highlighted the proton - density fse sequence to provide better visibility of the applicator [ 2 , 38 ] , t1w gradient - echo was selected as a favorable sequence to visualize the applicator in other studies . petit et al . , on the other hand , have used proton - density spoiled gradient - recalled - echo in evaluating the visibility of the titanium rotterdam applicator . sequences also varied between 2d and 3d [ 1 , 37 , 39 , 40 , 59 ] . additionally , the slice thickness used in these studies varied between 1 and 5 mm [ 27 , 37 , 39 , 40 , 60 ] ; this affects the level of the out - of - plane artefacts , and consequently the uncertainties of the reconstruction in the slice direction , as well as the snr of the images on which the reconstruction is performed . studies also differ in whether or not mri - markers are used to guide the reconstruction process [ 1 , 2 , 19 , 37 , 38 , 39 , 40 , 61 ] . advanced pulse sequences to correct for metal artefacts have been developed in the mri community particularly for diagnostic purposes near metallic implants [ 62 , 63 , 64 , 65 , 66 ] . warner et al . have explored various metal - artefact reduction techniques for brachytherapy planning and concluded that semac was more efficient than the other methods . while there is not yet an optimal standard sequence to visualize the applicator , there is a clear practical consensus that t2w sequence is suboptimal for applicator reconstruction compared to other clinical sequences that have shorter echo - time ( te ) such as proton - density fse or t1w fse . the last decade has seen an increasing interest in understanding technical and clinical challenges accompanying the usage of metal applicators and needles in gynecological brachytherapy . titanium needles and applicators are preferred over plastic as they offer greater strength at smaller diameters . tungsten offers an additional advantage , as it allows for non - symmetrical dose distribution , with specific tandem designs , owing to its higher physical density . however , due to the difference in magnetic susceptibilities , the induced metal - artefacts render the accurate localization of metal objects more challenging in mri - only planning . phantom and clinical studies demonstrated that conventional 2d t2w fse is suboptimal in localizing the applicators / needles , particularly when thick slices ( 4 mm ) are acquired . sequences with shorter echo - time ( te ) such as pdw have provided better visibility necessary for applicators reconstruction . fse - based sequences have the advantage over gradient - echo ( gre ) sequences of overcoming much of the signal loss occurring from the signal dephasing ( incoherence ) that is seen around the metal object . however , 3d fse acquisitions are substantially lengthy , compared to 3d gre - based sequences that can cover the whole imaging volume in 5 minutes . 3d fse with variable flip angle sequence in a reasonable scan time ( 10 min ) [ 18 , 56 , 58 , 59 ] . higher readout bandwidth and higher spatial resolution can reduce geometric and in - plane distortions induced by metal objects . the use of thin slices also reduces the distortions in the slice direction . however , this will also result in lower snr , particularly at low field strength ( e.g. , 1.5 t ) . multiple averages can be then acquired to compensate for snr loss . given the existing variety of pulse sequences for metal - artefacts reduction , the absence of a dedicated sequence for brachytherapy applications is a witness of the still - existing gap between mri and radiation oncology communities . current metal - artefacts reduction techniques need yet to be explored and adopted for brachytherapy needs , such as applicator reconstruction . larger cohort studies to explore the dosimetric impact of the metal artefacts with clinical sequences may be also needed to resolve the clinical concerns regarding the regular usage of metallic applicators / needles .

the importance of assessing the metal - induced artefacts in magnetic resonance imaging ( mri)-guided brachytherapy is growing along with the increasing interest of integrating mri into the treatment procedure of cervical cancer . examples of metal objects in use include intracavitary cervical applicators and interstitial needles . the induced artefacts increase the uncertainties in the clinical workflow and can be a potential obstacle for the accurate delivery of the treatment . overcoming this problem necessitates a good understanding of its originating sources . several efforts are recorded in the literature to quantify the extent of such artefacts , in phantoms and in clinical practice . here , we elaborate on the origin of metal - induced artefacts in the light of brachytherapy applications , while summarizing recent efforts that have been made to assess and overcome the induced distortions .

Purpose Technical aspects: why do we expect artefacts? Technical aspects: image distortions Clinical significance: dosimetric impact Metal applicators and needles Imaging sequences for applicator reconstruction Summary, recommendations, and future perspectives Disclosure

most commonly , they present with genital ambiguity . however , the phenotype may vary from normal female to normal male appearance . here , we are describing a case of 46 xy ovotesticular dsd who presented as primary amenorrhea . the index case , a 21-year - old female came to gynecology opd with complaint of primary amenorrhea ( pubarche : 15 yrs and thelarche : 18 yrs ) . general physical examination was within normal limits ( no features suggestive of hypothyroidism , cushing 's syndrome , or acromegaly ) . external genitalia examination revealed clitoromegaly ( 5 cm ) , separate vagina , and urethra openings . she was born out of non - consanguineous marriage and ante - natal history was not contributory . there was no similar complaint in the family . in view of primary amenorrhea with clitoromegaly , serum total testosterone , lh , fsh , 17-oh progesterone , dheas , thyroid profile , and prolactin were measured . all of the above hormone investigations were normal except raised serum total testosterone [ 4.78 ng / ml ( 0.15 to 0.81 ) ] , lh [ 20 miu / ml ( 0.80 to 7.6 ) ] , and fsh [ 30 miu / ml ( 0.7 to 11.1 ) ] . ultrasound pelvis revealed hypoplastic uterus ( 4.8 cm 1.65 cm 0.847 cm ) and bilateral ill - defined gonad like structures high up in pelvis . at this point of time , mosaic turner 's syndrome ( 45 x/46 xy ) was kept as the first possibility . but the karyotype revealed 46 xy , so the clinical diagnosis was changed to partial gonadal dysgenesis . anthropometry revealed : height : 168 cm , weight : 75 kg , bmi : 26.60 kg/ m , upper segment : 74 cm , lower segment : 94 cm , and arm span : 180 cm . hormone investigations revealed a decrease in serum total testosterone from 4.78 to 0.93 ng/ ml and a further increase in gonadotrophins ( lh : 31.4 miu / ml and fsh : 53.3 miu/ ml ) . intra - operatively , vaginal length was 10 cm , cervix and uterus were hypoplastic with b / l normal fallopian tubes in situ , left side showed tubular gonad and right side had spherical gonad . histopathology of left and right gonad revealed ovarian follicle with flattened cuboidal lining epithelium [ figure 1 ] and hyalinized seminiferous tubules with leydig cells [ figure 2 ] , respectively . , she was started on estrogen replacement and the plan was to add progesterone after breakthrough bleeding . left gonad showing ovarian follicles ( h and e , 20 ) right gonad showing seminiferous tubule ( h and e , 40 ) the disorders of sex development ( dsd ) is an uncommon disorder with an incidence of 1:4500 to 1:5000 live births . true hermaphrodite ( ovotesticular dsd ) is responsible for 4% to 10% of cases of dsd , but this is the most common type of intersex disorder among south african blacks . the frequency of different karyotype found among true hermaphrodite are 46 xx ( 60% ) , 46 xx/46 xy ( 30% ) , and 46 xy ( < 10% ) . in a study by bhansali et al . from a tertiary care center in india , only one case of 46 xy ovotesticular dsd was detected among seven true hermaphrodite patients over 10 years . patients with ovotesticular dsd are classified according to the type and location of the gonads . lateral cases ( 20% ) have a testis on one side and an ovary on the other . bilateral cases ( 30% ) have testicular and ovarian tissue present bilaterally , usually as ovotestis . unilateral cases ( 50% ) have an ovotestis present on one side and an ovary or testis on the other . the ovary is more frequently found on the left side , whereas the testis is found more often on the right like in our patient ( lateral variety of ovotesticular dsd ) . a majority of true hermaphrodite patients present with genital ambiguity with or without palpable gonads and most of them are reared as males . however , the appearance of external genitalia varies from normal female with mild clitoromegaly to normal male . this feature is suggestive of more severe dysgenesis of gonad and is also supported by the presence of mullerian structures adjacent to testicular tissue ( rt . an unusual feature of this patient was the absence of hirsutism in spite of increased serum testosterone level and clitoromegaly . this can be explained by the differential sensitivity of pilo - sebaceous units ( psus ) to serum androgen in different patients . another interesting finding in our patient was the progressive decrease in functional testicular tissue over time ( a decrease in serum testosterone from 4.78 to 0.93 ng / ml with mild regression of clitoromegaly over 3 years ) . similar reports have been described in the literature . because of this phenomenon , the gonads which were initially visible in ultrasound could not be localized in mri after 3 years . the important issue related to intra - abdominal testicular tissue is the risk of development of gonadal tumor , e.g. gonadoblastoma . the risk is more in case of gonadal dysgenetic syndromes compared to true hermaphrodite ( 15% to 35% vs. 02% to 04% ) . as the true hermaphrodite is itself a rare disease and most of the cases have 46 xx karyotype , the exact risk of development of gonadal tumor among 46 xy ovotesticular dsd ( e.g. the index case ) is not known . in most of the patients with true hermaphrodite , however , it is important to retain at least the ovarian tissue in case of true hermaphrodite patients with uterus as few cases with successful pregnancy are there in the literature . in summary , true hermaphrodite should be kept as one of the differential diagnosis of primary amenorrhea particularly in the presence of hyperandrogenism . not all patients develop cutaneous manifestations of androgen excess , e.g. hirsutism because of differential sensitivity to androgens . detailed physical examination and step - wise investigations including karyotype will pick up these cases . various factors including the possible diagnosis ( gonadal dysgenesis vs. true hermaphrodite ) , presence of y - chromosome , sex of rearing and the scope of fertility should be taken into consideration before doing gonadectomy .

true hermaphrodite is one of the rare variety of disorders of sex development . most of them are genotypically females ( 46 xx ) and present as under virilized males . features of hyperandrogenism are present in those reared as females . the commonest histological variety of gonad found in them is ovotestis , which is at risk for malignancy . we report a girl with 46 xy true hermaphrodite without ovotestis presenting as primary amenorrhea and isolated clitoromegaly in the absence of any other features of virilization .

I C D

nowadays it is obvious that the disease can be divided into two groups by its pathogenesis and clinical features : the nodular lymphocyte predominant ( nlp ) and the classic subtypes . due to the development of diagnostics and the prognosis - based risk - adopted treatment strategies , the exact etiology of the disease is still unknown , however , is not uniform since genetic features , viral infections , and other factors such as different lifestyle habits can contribute to the development of the disease . the so - called two - disease hypothesis , which proposes that the hl seen in the younger group is infectious in nature whereas that in the older persons has causes similar to other types of lymphomas . the incidence of hl shows differences worldwide , it is more frequent in developed countries , most common in north america , and less frequent in asia . data from mid-1990s reported an increasing prevalence among young adults in developing countries and stagnant incidence in western countries . in the usa from 1974 to 1996 , the incidence of the disease was stagnant among white females , only decreased among white males ; meanwhile , a definite increase of incidence can be found among black females . until 1985 an increase after dropping can be found among black males . as compared to the incidence of hl in the european union in 2002 ( males : 2.5/100000 , females : 1.9/100000 ) , in hungary the disease is less frequent among males while is minimally more frequent among females ( males : 2.1/100000 , females : 2.1/100000 ) . among the twenty - five countries of the european union ( data not known in romania and bulgaria ) , hungary is ranked the sixth place in the incidence of the disease among females and the twenty - second place among males . in 2002 worldwide , the hl was the most frequent among males in yemen , the less frequent in egypt , and , additionally , less frequent than the average in hungary . pattern 1 , seen in developing countries and in patients of low socioeconomic status , shows an early childhood peak and a second peak around the age of fifty , with tumors predominantly of classical mixed cellularity ( cmc ) and classical lymphocyte depletion ( cld ) subtypes with ebv positivity . pattern 3 , seen in developed countries and in patients of high socioeconomic status , shows a bimodal age group pattern with a peak incidence among young adults with tumors mainly of classical nodular sclerosis ( cns ) subtype with ebv negativity . pattern 2 , seen in countries with transitional economies , has an early childhood peak and a second ( female ) decade peak with equal frequencies of the cmc and cns subtypes [ 1 , 2 ] . considering the socioeconomic changes in hungary , the authors regarded them as worthwhile to investigate , whether the pathological or clinical nature and the treat worth of hl have changed in the past decades . the clinical data of 439 hl patients treated at the university of debrecen , medical and health science center , institute for internal medicine , 3rd department of medicine from 01/01/1980 until the 12/31/2008 were processed in a division of calendar periods of approximately ten years ( first period : 19801989 , second period : 19901999 , third period : 20002008 ) . identification of histological subtypes was done according to rye 's classification , recently according to real / who classification . clinical staging was done according to the ann arbor classification and later with its cotswold 's modification . the prognosis of the patients was given according to the eortc recommendation in early stage . in case of advanced - stage patients in advanced - stage disease , we considered the prognosis to be favourable , when the ips value was 03 , and unfavourable if it was at least 4 . the therapy of the patients occurred due to the current therapeutic protocols ( radiotherapy , chemotherapy , or combined radio- and chemotherapy ) . primary polychemotherapy was dominantly cv(o)pp ( cyclophosphamide , vinblastine ( vincristine ) , procarbazine , prednisone ) until 1991 , then copp / abv ( cyclophosphamide , vincristine , procarbazine , prednisone / adriamycin , bleomycin , vinblastine ) from 1991 , recently abvd ( adriamycin , bleomycin , vinblastine , dacarbazine ) from 1999 . salvage protocols were mainly beacopp ( bleomycin , etoposide , adriamycin , cyclophosphamide , vincristine , procarbazine , prednisone ) , dhap ( dexamethasone , cytarabin , cisplatin ) , and cep ( ccnu , etoposide , chlorambucil , prednisone ) . the irradiation consisted of extended - field , mantle - field , converse y , ( sub)total nodal- or involved - field radiotherapy initially with telecobalt machine , then from 2000 with linear accelerator . high - dose treatment and autolog hematopoietic stem cell transplantation were also accessible for treating relapsed or primary resistant patients from the 1990s . survival data were analysed using the kaplan - meier method by spss15 computer software . for the statistical analyses a total of 439 hl patients were treated primarily during the investigated period of 29 years . male- to female - ratio decreased to 1.05 recently , instead of male predominance until now . the mean and median age was decreasing ( table 1 ) . investigating the age of the patients , the age group pattern of the first period is unimodal , with one incidence peak between 30 and 39 years of age . the first incidence peak of this pattern can be found between 20 and 29 ( like nowadays ) , the second peak between 40 and 49 in the second period , and between 50 and 59 in the third period ( figure 1 ) . the number of hl patients with classic mixed cellularity histological subtype was decreasing after a temporary increase ( 43.7% , 58.23% , 42.6% , p = 0.0098 ( it is only significant in the second period ) ) . the classic nodular sclerosis subtype shows a increasing tendency ( 25% , 27.32% , 34.78% , p = 0.1734 ) . classical lymphocyte predominant subtype ( clp ) was decreasing ( 17.1% , 7.57% , 5.21% , p = 0.0038 ) . the number of classical lymphocyte depletion ( cld ) subtype was decreasing significantly also ( 14.2% , 6.19% , 6.06% , p = 0.0181 ) , nodular lymphocyte predominant ( nlp ) histological subtype can be seen only in the past decade , when the real / who classification was used ( figure 2 ) . we found that the first incidence peak of the age group pattern is created predominantly by cns ; meanwhile , the second incidence peak is created by cmc histological subtype ( figures 3(a ) and 3(b ) ) . investigating the histological subtypes according to the sexual distribution , we found that cmc subtype is predominant among males in every period , its ratio is much lower among females , and in the third period cns subtype became predominant . among males the cmc subtype , meanwhile among females the cns subtype , is the most common in the third period . the incidence of clp and cld subtypes decreased ; cld shows a slight increase in the third period again . furthermore , nlp subtypes have been diagnosed in the last periods with an incidence of 6.08% ( figure 4 ) . comparing the early- ( first - second ) and advanced- ( third - fourth ) stage disease , we found an increased ratio of early - stage disease , and the difference was statistically significant . the increase comes on one hand from the significant growth of the number of second stage patients ( 25.8% , 26.35% , 49.56% , p < 0.0001 ) and on the other hand from the significant reduction of the number of third stage patients ( 53.4% , 50.67% , 20% , p < 0.0001 ) . nowadays half of the patients is diagnosed in the second stage of the disease ( figure 5 ) . from the first symptom ( lymphadenomegaly and/or complain ) until the diagnosis of the disease lasted an average 6.2 months in the first period . in the second period we found that 45.59% of the early - stage patients and 28.26% of the advanced - stage patients were concerned to be in the unfavourable prognostic group . the 5-year overall survival was 59.7% , 77.4% , and recently 90.5% ( p < 0.001 ) , and the 10-year overall survival data were also progressing : 44.1% , 70.6% and 90.5% ( prognosed survival ) in the last decade ( figure 6 ) . during the investigated period , more than 60% of them were diagnosed in the first period ; they died predominantly of hodgkin 's lymphoma . the mortality coming from the basic disease was decreasing after this time ( in the second period the basic disease mortality reduced into half ) , the remaining patients died of infection , second tumor , cardiopulmonary failure , and other factors ( e.g. , accidents ) in nearly the same ratio . comparing to the others , in the last period the mortality became minimal with still the predominance of the basic disease ( figure 7 ) . the incidence of hl was the greatest in north america ( male : 3.2/100000 , female : 2.4/100000 ) , the smallest in east asia ( male : 0.3/100000 , female : 0.1/100000 ) , in central and eastern europe ? ? ? both males and females : 2.3/100000 in 2002 . data of hungary from 2000 to 2003 reports an average incidence of 2.02/100000 among males and 1.59/100000 among females , but estimating hungarian data , the fact must be considered that probably not every case was reported . hence , the incidence of the disease can be considered average , both on the whole and due to sexual distribution . our current trial is not representative ; hence , estimating incidence is not possible . in hungary 9 trials dealed with data of hl patients ( table 2 ) . the duration of these trials differs significantly from each other ( 1 year to 22 years [ 13 , 19 ] ) ; furthermore , these trials show great variability due to geographic differences ( data from whole hungary [ 14 , 20 ] to investigate patients from only one county [ 13 , 15 ] ) . hence , exacting comparison and drawing conclusions is not possible , and attention can be attracted to further comprehensive trials . investigating sexual distribution generally male predominance was found ; three trials found slight female predominance [ 12 , 14 , 15 ] . this ratio came from the female predominance in the cns subtype in kelnyi et al . estimating the results of ivnyi et al . is hard , because among the diagnosed 86 patients only 66 patients ' data were processed during their investigated period . the mean age is around 40 in every trial ( 35.841.7 years ) and shows a persistent slight decrease . the most common histological subtype except for one trial presented countrywise data , whereas cns was found to be the most common subtype during the investigated period of 4 years ( between 2000 and 2003 ) . both uni- and bimodal age group patterns were found ; the incidence peak in young adults around twenties was present everywhere . b symptoms were present unequivocally , more than half of the patients in every trial . the majority of the patients were diagnosed in the advanced stage , but it is hope worthy that both a trial in the current decade ( 20002003 countrywise data ) and our investigation 's last period reports the diagnosis in early stage . between 1960 and 1997 in scandinavian countries , in india , and in north america , the increase of the incidence of hl was found among teenagers and young adults . this increase was found rather among females and was primarily linked to the cns subtype . in elderly rather a decreasing tendency was found , which was explained by the development of diagnostical methods . a trial between 1984 and 1993 in the united kingdom found the decrease of the incidence in both sexes , in every age groups , except for males between 1 and 24 . investigating seven european countries no changes was found in the incidence between 1985 and 1992 . in our current study , the authors found the decrease of the number of patients , although the last period was one year shorter . the male / female ratio decreased as well , currently the number of male and female patients is almost equal . although the reason of this phenomenon is unknown , but shows similarity to the mentioned international data above . whereas we found a unimodal age group pattern in the first two periods , nowadays a bimodal age group pattern can be seen , with an incidence peak in young adults ( 2029 years ) and another in elderly ( 5059 years ) , likewise to developed countries the fact that not all patients especially the elderly were treated in oncohematological centers can play a role in the explanation of the previously observed unimodal age group pattern . hence , reporting the disease to the hungarian hodgkin 's disease work group did not occur every time . we found the significant decrease of the cmc subtype and the increase of the cns subtype ( not significantly ) . in the last period the incidence peak of young adults is created by the cns subtype ; meanwhile , the other incidence peak among elderly is created by the cmc subtype . due to the introduction of the who 's histological classification since 2000 , the number of patients with clp subtype decreased and with the new subtype , the nlp increased . the number of patients in the advanced stage decreased significantly , parallel with the significant increase of early - stage patients . nowadays every second patient is diagnosed in stage two in the last decades the number of patients in stage three was decreasing continuously ; accordingly , the number of stage two and early - stage patients were increasing continuously . this tendency suits with international authors ' observation [ 24 , 25 ] . beyond the developing diagnostic methods ( immunohistochemical examinations , developing imaging methods , like using pet / ct routinely ) , the patients ' awareness ( thanks to media , internet ) and the highly educated workers in basic medical attendance can also play a role in the backstage of this phenomenon . hence , the patients are treated earlier . since , the patients are diagnosed in earlier stages , their chance to survive and their quality of life are continuously progressing , because of the lower dose and less toxic treatment at their case . accordingly , the overall survive progressed . according to international data , the 10-year overall survival of hl patients is 7585% [ 20 , 26 ] , which are similar to our results . 5-year overall survival progressed , because of better treatment based on prognostic factors and better supportation . the decrease of mortality especially the mortality because of the basic disease can be explained by developing treating methods as well . the mortality because of the basic disease fall to the half between the first and the second periods and fall to the third between second and third periods . due to the more toxic polichemotherapy and extended - field , greater - dose irradiation used in the previous periods , only further follow can decide , whether how much can new treatment methods reduce these factors of mortality . investigating hl patients in the same geographical localisation in different periods gives an opportunity to observe the effects of different factors ( e.g. , viral infection , socioeconomic changes ) on the characteristics of the disease . based on our results , it can be established that the clinical pathological features of hodgkin lymphoma are changing in hungary . we found the pattern to be characteristic to the developed countries out of the three epidemiologic patterns . the population is infected ( e.g. , ebv ) fewer times . beside the changes of these immunological features , these facts and comprehensive ( countrywise or different geographical locations ) epidemiological trials can help in questing for the reasons , the treatment , and the survival of the disease .

introduction . hodgkin lymphoma shows a well - known geographic pattern , but temporal changes have been found recently as well . patients and methods . 439 hodgkin lymphoma patients ' clinicopathological and treatment data were processed in calendar periods of approximately ten years . the patients were treated at our department from 1980 until the end of 2008 . results . the first period ( 198089 ) contained 177 patients , the second ( 199099 ) 147 , and the third ( 200008 ) 115 hodgkin lymphoma patients . the mean age of the patients was 40.1 , 35.9 , and 36.8 years in order . the male / female ratio : 1.42 , 1.45 , 1.05 in order . contrary - wise a unimodal age group pattern could have been seen with an incidence peak between 30 and 39 in the past decades . the incidence of classical mixed cellularity histological subtype is decreasing ( 43.7% , 58.23% , 42.6% , p = 0.0098 ( it is only significant in the second period ) ) ; classical nodular sclerosis shows an increasing tendency ( 25% , 27.32% , 34.78% , p = 0.1734 ) . the first incidence peak is predominantly created by classical nodular sclerosis , meanwhile the second peak by classical mixed cellularity . the number of early - stage patients ( 59.12% ) is beyond the advanced stage ( 40% ) in the last decade . meanwhile , the number of second - stage patients was increasing ( 25.8% , 26.35% , 49.56% p < 0.0001 ) and of patients in third stage was decreasing ( 53.4 % , 50.67% , 20% p < 0.0001 ) . the 5- and 10-year overall survival data were progressing : 59.7 % , 77.4 % , and 90.5 % and 44.1 % , 70.6 % and 90.5 % ( expected survival ) in the last decade . conclusions . changes can be explained by the altered nature of hodgkin lymphoma , the changes in socioeconomic status and the development of diagnostic and therapy methods .

1. Introduction 2. Patients and Methods 3. Results 4. Conclusion

inflammatory bowel disease ( ibd ) comprises of two major disease entities : crohn 's disease ( cd ) and ulcerative colitis . therefore , determination of inflammatory state is crucial for the assessment of disease activity and for the optimized therapy . however , no simple diagnostic tool for monitoring intestinal inflammation is available . among diverse diagnostic imaging modalities , computed tomography ( ct ) and magnetic resonance ( mr ) techniques have been optimized , over the last decade , for small bowel imaging with increasing role in the evaluation of small bowel diseases , especially cd . this article introduces the current status of ct enterography ( cte)/mr enterography ( mre ) in evaluation of ibd , especially focusing on the assessment of disease activity in cd , and also discusses the current technical issue as well as comparative diagnostic performance . in ibd patients , primary role of conventional ct is to evaluate extraenteric manifestation and complications , such as fistulas , abscess , and bowel obstruction . with the improved resolution of multidetector ct , cte has become an important method of choice for evaluating small bowel diseases ; determination of disease activity as well as the extent and severity of inflamed bowel.1,2 on cte , ct findings indicative of active inflammation include bowel wall thickening ( thickness of > 3 mm ) , mural stratification , mural hyperenhancement , increased attenuation in the perienteric fat , and engorged vasa recta ( comb sign)(fig . 1).1,3 mural thickening is the most frequently observed ct finding in cd ( up to 82% of patients ) but not specific to disease activity.4 mural stratification means the bowel wall layers ( a trilaminar pattern ) on contrast enhanced cte by edematous bowel wall thickening . this feature is not specific to cd , however.5 mural enhancement , most of all , is the most sensitive indicator of disease activity.5 it has also been reported that the degree of bowel wall enhancement correlates with the severity of inflammation.6,7 increased attenuation of mesenteric fat is often seen in active cd . this ct feature , as well as comb sign , is the most specific sign of disease activity and correlates with the level of c - reactive protein.7 other ct findings that might be seen in inactive longstanding cd include submucosal fat deposition , sacculation , fibrofatty proliferation , and fibrotic strictures.3 many researchers have mentioned positive correlation between cte findings and clinical / biochemical markers of disease activity , such as cd activity index ( cdai ) , c - reactive protein , and erythrocyte sedimentation rate , respectively , but the clinical relevance of these images is still controversial.7,8 major negative concern of cte is the use of ionizing radiation . many of cd patients are young , and because of their chronic disease , they may have to undergo lifetime repeated imaging examinations . the efforts should be made to reduce radiation dose in these patients by minimizing ct examination , dose reduction ( using the dose modulation option or advanced reconstruction techniques ) , or considering other diagnostic imaging modalities such as mre . over the last decade , the improved spatial and temporal resolution of mr images , combined with the use of large volumes of oral contrast agents to provide bowel distension , allowed the evaluation of bowel wall contrast enhancement , wall thickening and edema , which are useful findings for the assessment of cd activity.9 with increasing awareness on the risk of radiation exposure , global interest in mr imaging has increased owing to its excellent soft tissue contrast , direct multiplanar imaging capability and lack of ionizing radiation . mre , these days , plays an important role in the evaluation of small bowel disorders.10 in recent prospective studies , mre was found to have similar accuracy , area under the receiver operating characteristic curve and sensitivity for detecting active inflammation in cd compared with cte.11 - 13 in addition , mre has the potential advantage of providing functional and quantitative information about bowel wall ( e.g. , diffusion , perfusion , motility ) that can not be obtained by ct . mr findings of actively inflamed small intestine are similar to ct findings indicative of active cd ; mural hyperenhancement ( fig . 2 ) , mural thickening ( thickness of > 3 mm ) , increased t2 signal in the bowel wall , mural stratification , adjacent fat stranding ( streaky decreased signal within the mesenteric fat on non - fat - suppressed t2 weighted images ) , and " comb sign . " among them , mural thickening , increased enhancement , and increased t2 signal are the most common findings in active cd ( 77.8% to 100%).14 sempere et al.15 compared magnetic resonance imaging ( mri ) findings of bowel wall thickening and enhancement in patients with active and quiescent cd , and found significant correlation between the degree of enhancement and thickening compared with cdai . koh et al.16 reported a sensitivity of 91% and a specificity of 71% for active cd with mre , whereas using the cdai the sensitivity was 92% and specificity 28% in the same study . in some cd patients with strictures , it is important to distinguish between inflammatory stricture and chronic fibrotic stricture , as obstruction and spasm in active cd may be relieved by medical treatment whereas chronic strictures may require surgical intervention . mre can provide useful information in this setting by differentiating between chronic fibrotic stricture by depicting fat - halo sign ( a low signal in submucosal layer produced by fat hypertrophy and fibrosis of the submucosa in chronic ibd ) and inflammatory stricture ( an intermediate low signal ring produced by submucosal edema).15,17 fibrotic strictures have been also reported to demonstrate irregular mural enhancement.18 in the evaluation of extramural complications , higher contrast resolution of mri makes it more suitable for the detection of fistulae and abscesses than ct.19,20 mre can provide an excellent depiction and staging of perianal fistulas , which are common complications in cd.21 - 24 moreover , mre can be combined with dedicated perianal imaging to provide a comprehensive evaluation of overall disease activity . recently , diffusion weighted imaging ( dwi ) and quantitative dynamic contrast enhanced mri ( dce - mri ) have been investigated in the assessment of bowel inflammation in cd.14,25 - 28 preliminary results from initial studies appear promising despite their study limitations such as small sample size or an imperfect reference standard . according to oto et al.14 research , dce - mri and dwi can provide so reliable quantitative measures of small bowel inflammation that these imaging tools differentiate actively inflamed bowel segments from normal bowel in cd . dwi provides better sensitivity compared with dce - mri , and combination of apparent diffusion coefficient and volume transfer constant ( k ) parameters for analysis can potentially improve specificity . these results reflect that actively inflamed small bowel segments in cd demonstrate increased perfusion and restricted diffusion . although these new emerging techniques appear promising , more cumulative data through prospective large series is necessary to establish their diagnostic role in clinical practice . using fluoroscopic examination such as enteroclysis or small bowel follow through ( sbft ) as reference standards , the sensitivity of cte for active cd had been estimated to be over 85%.29,30 using endoscopic or surgical findings as a reference standard , the sensitivity of cte and mre for active inflammation has been estimated to be 77% to 92%.16,31 - 33 our data revealed that cte , mre , and sbft are equally accurate for detecting active cd of the small bowel . cte and mre were equally as accurate for identification of active cd of the small bowel ( sensitivity of cte vs. mre , 89% vs. 83% ; specificity of cte vs. mre , 80% vs. 100% ) . and also , the sensitivity values of cte and mre ( 100% ) for detection of extraenteric complications were significantly higher than those of sbft ( 32% to 37% ) ( p<0.001).11 prospective comparison of mre and cte by siddiki et al.13 shows relatively same sensitivity in detection of active small bowel cd ( 90.5% of mre , 95.2% of cte ) . until now , the available data concerning accuracy of mre in detecting disease activity is less than cte . however , although image quality is still better with ct , early results of mre are encouraging because of a similar sensitivity and diagnostic effectiveness.11,13,34 motion artifacts from small bowel motility are more severe with mre,34 but the use of antiperistaltic agent reduces blurring and artifacts related to bowel motility.35 in prospective comparative trials between mre and capsule endoscopy ( ce),33 sensitivities of ce and cte in detecting active cd show similar results ( 82% to 83% ) , but cte shows higher specificity ( 89% for cte , 53% for ce ) . umschaden et al.36 addressed that , in 24% of the patients , mre demonstrated abnormalities not seen at ce , whereas another study detected 70% or more abnormalities with mre as compared with ce.37 on the other hand , the feasibility of labeled - leukocyte scintigraphy in detecting active inflammation of cd has been evaluated . tc - hexamethylpropyleneamine oxime is a commonly used agent because of its greater availability , better image quality and lower radiation dose.38 - 41 according to some researches , the sensitivity and specificity of leukocyte - labeled scintigraphy has been reported to range between 76% to 94.7% and 77.8% to 93.3% , respectively.12 recent studies on 18f - fluorodeoxyglucose positron emission tomography ( fdg - pet ) in assessing active cd reveals lower specificity values for mri.42 the usefulness of pet in differentiating between active and indolent cd is still unclear . nowadays , cross - sectional imaging modalities , such as cte and mre , are particularly suited to evaluate small bowel diseases . it is well known that cte and mre can provide excellent assessment of disease activity as well as the macroscopic features , extramural abnormalities , and complications of small intestine in patients with cd . early mucosal lesions ( such as aphthoid lesions ) , however , are not accurately visualized on ct or mri , making them less suitable as a first - line examination for suspected early disease . therefore , until now , cte appears to be more cost - effective in the long - term assessment and follow - up of patients , especially those with established cd . although mre is being used more frequently because of the advantage of lack of radiation , some limitation of mre such as high cost , longer examination time , and slightly inferior spatial resolution than cte , hardly makes it the initial imaging modality of choice in many adult patients . so far , the preference of mre versus cte seems to be geographical and based on expertise and public policy . emerging functional imaging techniques like dwi or dce - mri look promising in assessment and monitoring of disease activity in cd , but further prospective studies are needed .

today , cross - sectional imaging modalities , such as computed tomography enterography ( cte ) and magnetic resonance enterography ( mre ) , are particularly suited to evaluate small bowel diseases , especially crohn 's disease ( cd ) . it is well known that cte / mre can provide excellent assessment of disease activity as well as the macroscopic features , extramural abnormalities , and complications of the small intestine in patients with cd . in general , cte is considered as the first - line modality for the evaluation of suspected inflammatory bowel disease and for long - term assessment or follow - up of these patients . because of the advantage of lack of radiation , mre is being used more frequently , especially in children or young patients with cd .

INTRODUCTION CTE MRE DIAGNOSTIC PERFORMANCE OF CTE/MRE CONCLUSIONS

up to 35% of patients do not respond to currently available antidepressants , with high nonremission rates , and residual symptoms commonly persist.4 a better understanding of the mechanisms associated with psd is needed to direct the search for additional or adjunctive therapies . a relationship between elevations in peripheral proinflammatory cytokines and depression has been suggested in many cross - sectional studies.5 many cytokines , particularly ifn , il-6 , il-1 , and tnf , upregulate the indoleamine 2,3-dioxygenase enzyme in multiple central and peripheral cell types , which catalyzes the rate - limiting step in the synthesis of kynurenine ( kyn ) from tryptophan ( trp ) , thereby increasing their ratio ( k / t ) in blood.6,7 changes in both the k / t ratio and concentrations of kyn and its metabolites have been demonstrated cross - sectionally in stroke.8 these changes have also been associated with major depressive disorder ( mdd)912 and depressive symptoms in patients with cardiovascular disease.13 the further metabolism of kyn into excitotoxic metabolites , which are elevated centrally in mdd postmortem , has been suggested to contribute to neurodegeneration in ischemia and depressive disorders.12,14 a peripheral inflammatory response is observed post - stroke , due to a complex cascade of cytokine signals released from both innate and adaptive immune cells , including macrophages , neutrophils , and t - helper cells.15,16 clinically , inflammatory status can be surveyed by considering relative concentrations of pro- and anti - inflammatory cytokines , eg , the anti - inflammatory cytokine il-10 is produced by regulatory t cells , which drop precipitously poststroke.16 il-10 concentrations are often increased in tandem with proinflammatory cytokine concentrations in healthy individuals , but this relationship is lost in mdd,17 where pro- versus anti - inflammatory cytokine imbalances have been found.1720 pro- to anti - inflammatory cytokine imbalances have also been associated with poorer outcomes poststroke , in agreement with the neuroprotective properties of regulatory t cells and il-10 in animal ischemia models.2125 therefore , in the present study , the ratios of proinflammatory cytokines with il-10 were explored in addition to cytokine concentrations . while psychosocial , genetic , and physical disability correlates of psd have been identified , relationships between inflammatory markers and psd have not been consistently observed.2628 although some studies have described relationships between cytokines and fatigue or sickness - like behavior,26,28,29 rather than severe psd per se , few studies have taken into account that different contributing factors may underlie severe and mild psd strata . therefore , the present study examined relationships between the k / t ratio and symptoms of depression in patients poststroke and explored relationships between ratios of pro - to anti - inflammatory cytokines with depressive symptoms . the study also examined possible relationships between cytokines and specific symptoms to account for qualitative differences between patients in depressive symptoms post - stroke . we hypothesized that the k / t ratio ( primary ) and concentrations of other inflammatory markers would differ between subjects with mild , moderate , and severe depressive symptoms in a poststroke population . this cross - sectional observational study recruited participants admitted to acute care regional stroke centers in toronto , on , canada . consecutive patients meeting national institute of neurological and communicative disorders and stroke30 and world health organization monica ( multinational monitoring of trends and determinants in cardiovascular disease)31 criteria for stroke were invited to participate in this study . patients were recruited from sunnybrook health sciences centre ( toronto , on , canada ) and three additional regional stroke centers ( toronto rehabilitation institute , st john s rehabilitation centre , and baycrest hospital ) . all patients were referred to the primary study site at sunnybrook for uniform assessment by the same study personnel . the study was approved by local research ethics boards from each institution , and all participants provided written informed consent . acute ischemic infarcts were verified from computed tomography or magnetic resonance imaging reports performed at admission for all patients . exclusion criteria were : prestroke diagnosis of dementia or significant cognitive impairment ( mini - mental state examination [ mmse ] score 24 ) , primary hemorrhagic stroke , decreased level of consciousness , severe aphasia or dysarthria , significant acute medical or neurological illness other than stroke , and the presence of a premorbid axis i psychiatric disorder other than depression . histories of major depression or stroke were permitted and controlled for in statistical analyses as needed . severity of depressive symptoms was assessed using the center for epidemiological studies depression ( ces - d ) scale.32 the ces - d scale is a self - report instrument that was used in the national institutes of neurological communicative disorders stroke data bank,33 and previously validated in stroke patients using a structured psychiatric interview . the ces - d scale has been shown to have high concurrent validity with other depression measures in stroke patients ( both observer - reported and self - reported),34 and has been used specifically as a measure of psd.3437 ces - d scale scores have also been dichotomized : a score 16 was highly predictive of clinical depression ( sensitivity 86% , specificity 90% , positive predictive value 80%),38 and a score of 16 or greater has been considered a valid and reliable indicator of psd.39 the ces - d scale was administered to the participant in the presence of trained research personnel , with assistance if necessary . the mmse40 was selected as a cognitive screening instrument to exclude significant cognitive dysfunction ( mmse score 24 ) , because it is brief , widely used , and validated in acute care settings.41 stroke severity was assessed using the national institutes of health stroke scale ( nihss),42 either completed by clinicians upon patient admission or extracted from the medical chart using a standardized method.43 for patients with an available clinical computed tomography scan , stroke lesions were traced and lesion locations and volumes recorded . patient demographics , risk factors , comorbidities , and concurrent medications were obtained from hospital charts and by patient interview . fasting blood was collected via venipuncture in sst vacutainer ( bd , franklin lakes , nj , usa ) tubes at 7.30 am 30 minutes on the morning after the clinical assessments were conducted . blood samples were centrifuged at 1,000 g for 10 minutes at 4c , and serum was separated and stored at 80c until it was assayed ( sunnybrook health sciences centre ) . trp and kyn concentrations were determined by high - performance liquid chromatography ( hplc ) , as described previously.44,45 trp was measured by isocratic reverse - phase hplc without derivatization or fluorescence detection . for kyn , after centrifugation , the concentration of l - kyn in the supernatant was measured by hplc with ultraviolet detection at 258 nm . the mobile phase consisted of 9% acetonitrile in 0.05 m potassium phosphate monobasic , pumped through a reverse - phase 5 m octadecyl column of 2504.6 mm ( symmetry ; waters , milford , ma , usa ) . for those participants who provided enough sample , analyses of serum cytokines il-6 , il-10 , ifn , tnf , il-1 and il-18 were performed using a multiplex suspension bead - array immunoassay ( luminex , austin , tx , usa ) . cytokine concentrations were calculated from the median fluorescence intensities using the luminex analyzer based on standard curve data obtained using the serially diluted cytokine standards provided in kits ( biosource , burlington , on , usa ) . assay sensitivities were 0.2 pg / ml for il-10 , 1.0 pg / ml for ifn , 0.09 pg / ml for tnf , 0.057 pg / ml for il-1 , 0.1 pg / ml for il-6 , and 12.5 pg / ml for il-18 . for initial descriptive analyses , relationships between ces - d scale total tertiles and serum concentration of kyn , trp , k / t ratio , lesion volumes , and clinical and demographic covariates were compared . to test the primary hypothesis , a univariate analysis of covariance ( ancova ) model was performed to assess differences in the k / t ratio between low , intermediate , and highest ces - d scale tertiles , where all important covariates from initial descriptive analyses were included . nihss score , age , sex , and history of depression were chosen as covariates a priori , since these were identified previously as independent predictors of psd2,46 and antidepressant use due to associations with depressive symptoms and immune markers.19,20,47 age in particular has been found to be positively correlated with the k / t ratio,48 pro- and anti - inflammatory cytokines , and depression scores.2 ces - d scale tertiles were chosen to best model the hypothesis that elevated k / t might manifest as mild depressive symptoms . since serum cytokine concentrations below the limits of detectability indicate low serum concentrations , values returned below detectable limits were imputed at the lower limit of detectability for that analyte : 0.2 pmol / l for il-10 , 1.00 0.09 pmol / l for tnf , and 0.06 pmol / l for il-1. serum assays and stroke - lesion volumes were log - transformed to maintain a normal distribution . for calculating proinflammatory cytokine to il-10 ratios , they were calculated with raw values and log - transformed afterwards . associations between immune imbalance and psd were investigated using individual cytokine concentrations and the ratios of pro- to anti - inflammatory cytokines as exploratory outcomes in all patients for whom these data were available . ancova models were performed to determine which serum cytokines or cytokine ratios were significantly elevated across ces - d scale tertiles . which depressive symptoms were associated with the k / t ratio , or serum cytokines or their ratios , bivariate spearman s correlations were conducted between each ces - d scale item and the k / t ratio , as well as the significant serum cytokine ratios from previous analyses . possible heterogeneity due to histories of depression or antidepressant use were also explored in post hoc analyses . all statistical analyses were performed using spss software ( version 20 ; ibm , armonk , ny , usa ) . . a sample size of at least 84 , divided into three groups , provides a power of 80% to detect the minimum effect size that was observed previously in a cardiovascular population13 with a two - sided -value of 0.05 . this cross - sectional observational study recruited participants admitted to acute care regional stroke centers in toronto , on , canada . consecutive patients meeting national institute of neurological and communicative disorders and stroke30 and world health organization monica ( multinational monitoring of trends and determinants in cardiovascular disease)31 criteria for stroke were invited to participate in this study . patients were recruited from sunnybrook health sciences centre ( toronto , on , canada ) and three additional regional stroke centers ( toronto rehabilitation institute , st john s rehabilitation centre , and baycrest hospital ) . all patients were referred to the primary study site at sunnybrook for uniform assessment by the same study personnel . the study was approved by local research ethics boards from each institution , and all participants provided written informed consent . acute ischemic infarcts were verified from computed tomography or magnetic resonance imaging reports performed at admission for all patients . exclusion criteria were : prestroke diagnosis of dementia or significant cognitive impairment ( mini - mental state examination [ mmse ] score 24 ) , primary hemorrhagic stroke , decreased level of consciousness , severe aphasia or dysarthria , significant acute medical or neurological illness other than stroke , and the presence of a premorbid axis i psychiatric disorder other than depression . histories of major depression or stroke were permitted and controlled for in statistical analyses as needed . severity of depressive symptoms was assessed using the center for epidemiological studies depression ( ces - d ) scale.32 the ces - d scale is a self - report instrument that was used in the national institutes of neurological communicative disorders stroke data bank,33 and previously validated in stroke patients using a structured psychiatric interview . the ces - d scale has been shown to have high concurrent validity with other depression measures in stroke patients ( both observer - reported and self - reported),34 and has been used specifically as a measure of psd.3437 ces - d scale scores have also been dichotomized : a score 16 was highly predictive of clinical depression ( sensitivity 86% , specificity 90% , positive predictive value 80%),38 and a score of 16 or greater has been considered a valid and reliable indicator of psd.39 the ces - d scale was administered to the participant in the presence of trained research personnel , with assistance if necessary . the mmse40 was selected as a cognitive screening instrument to exclude significant cognitive dysfunction ( mmse score 24 ) , because it is brief , widely used , and validated in acute care settings.41 stroke severity was assessed using the national institutes of health stroke scale ( nihss),42 either completed by clinicians upon patient admission or extracted from the medical chart using a standardized method.43 for patients with an available clinical computed tomography scan , stroke lesions were traced and lesion locations and volumes recorded . patient demographics , risk factors , comorbidities , and concurrent medications were obtained from hospital charts and by patient interview . fasting blood was collected via venipuncture in sst vacutainer ( bd , franklin lakes , nj , usa ) tubes at 7.30 am 30 minutes on the morning after the clinical assessments were conducted . blood samples were centrifuged at 1,000 g for 10 minutes at 4c , and serum was separated and stored at 80c until it was assayed ( sunnybrook health sciences centre ) . trp and kyn concentrations were determined by high - performance liquid chromatography ( hplc ) , as described previously.44,45 trp was measured by isocratic reverse - phase hplc without derivatization or fluorescence detection . for kyn , after centrifugation , the concentration of l - kyn in the supernatant was measured by hplc with ultraviolet detection at 258 nm . the mobile phase consisted of 9% acetonitrile in 0.05 m potassium phosphate monobasic , pumped through a reverse - phase 5 m octadecyl column of 2504.6 mm ( symmetry ; waters , milford , ma , usa ) . for those participants who provided enough sample , analyses of serum cytokines il-6 , il-10 , ifn , tnf , il-1 and il-18 were performed using a multiplex suspension bead - array immunoassay ( luminex , austin , tx , usa ) . cytokine concentrations were calculated from the median fluorescence intensities using the luminex analyzer based on standard curve data obtained using the serially diluted cytokine standards provided in kits ( biosource , burlington , on , usa ) . assay sensitivities were 0.2 pg / ml for il-10 , 1.0 pg / ml for ifn , 0.09 pg / ml for tnf , 0.057 pg / ml for il-1 , 0.1 pg / ml for il-6 , and 12.5 pg / ml for il-18 . for initial descriptive analyses , relationships between ces - d scale total tertiles and serum concentration of kyn , trp , k / t ratio , lesion volumes , and clinical and demographic covariates were compared . to test the primary hypothesis , a univariate analysis of covariance ( ancova ) model was performed to assess differences in the k / t ratio between low , intermediate , and highest ces - d scale tertiles , where all important covariates from initial descriptive analyses were included . nihss score , age , sex , and history of depression were chosen as covariates a priori , since these were identified previously as independent predictors of psd2,46 and antidepressant use due to associations with depressive symptoms and immune markers.19,20,47 age in particular has been found to be positively correlated with the k / t ratio,48 pro- and anti - inflammatory cytokines , and depression scores.2 ces - d scale tertiles were chosen to best model the hypothesis that elevated k / t might manifest as mild depressive symptoms . since serum cytokine concentrations below the limits of detectability indicate low serum concentrations , values returned below detectable limits were imputed at the lower limit of detectability for that analyte : 0.2 pmol / l for il-10 , 1.00 pmol / l for ifn , 0.09 pmol / l for tnf , and 0.06 pmol / l for il-1. serum assays and stroke - lesion volumes were log - transformed to maintain a normal distribution . for calculating proinflammatory cytokine to il-10 ratios associations between immune imbalance and psd were investigated using individual cytokine concentrations and the ratios of pro- to anti - inflammatory cytokines as exploratory outcomes in all patients for whom these data were available . ancova models were performed to determine which serum cytokines or cytokine ratios were significantly elevated across ces - d scale tertiles . which depressive symptoms were associated with the k / t ratio , or serum cytokines or their ratios , bivariate spearman s correlations were conducted between each ces - d scale item and the k / t ratio , as well as the significant serum cytokine ratios from previous analyses . possible heterogeneity due to histories of depression or antidepressant use were also explored in post hoc analyses . all statistical analyses were performed using spss software ( version 20 ; ibm , armonk , ny , usa ) . a sample size of at least 84 , divided into three groups , provides a power of 80% to detect the minimum effect size that was observed previously in a cardiovascular population13 with a two - sided -value of 0.05 . a total of 382 post - ischemic stroke patients were screened for the study , of whom 138 patients were carefully selected who met inclusion criteria and did not meet any criterion for exclusion . a total of 86 patients ( mean age 71.714.2 years , 47.7% female ) who agreed to participate and for whom sufficient serum samples were obtained were included in this analysis . demographics and clinical characteristics of each tertile are presented in table 1 . ces - d scale scores ranged from 0 to 48 , with a mean standard deviation ces - d scale score of 13.511.5 . based on 33rd and 66th percentile ces - d scale scores , ces - d scale tertile ranges were 06 , 716 , and 1748 , respectively . of all demographic and clinical characteristics , only smoking ( current ) and hypertension differed between ces - d scale tertiles . as continuous variables , only nihss score ( r=0.25 , p=0.02 ) and age ( r=0.23 , p=0.04 ) were associated with ces - d scale scores . kyn , trp , and k / t ratio assay results are reported in table 2 . the k / t ratio did not differ between ces - d scale tertiles ( f2,76=0.04 , p=0.96 ; see figure 1 ) in a model controlling for nihss score ( f1,76=1.12 , p=0.28 ) , age ( f1,76=4.84 , p=0.03 ) , sex ( f1,76=0.15 , p=0.70 ) , history of depression ( f1,76=3.19 , p=0.08 ) , antidepressant use ( f1,76=0.22 , p=0.64 ) , hypertension ( f1,76=1.39 , p=0.24 ) , and smoking ( f1,76=4.54 , p=0.04 ) . neither kyn ( f2,76=0.054 , p=0.96 ) nor trp ( f2,76=0.44 , p=0.64 ) concentrations individually differed between ces - d scale tertiles ; however , trp was significantly lower in patients with a history of depression ( f2,76=5.43 , p=0.022 ) and in older subjects ( f1,76=6.48 , p=0.013 ) . cytokines were assayed in the 53 patients who provided sufficient serum for analysis , and results are reported in table 2 . this subset of patients did not differ from patients who did not provide sufficient serum with respect to age , sex , depression history , hypertension , or other comorbidities ( all p>0.05 ) . of these immunological markers , all kyn , trp , k / t ratio , il-6 , and il-18 levels were within detectable range . imputations were made for 21% of il-1 , 27% of tnf , 60% of il-10 , and 5.1% of ifn samples . comparison of serum concentrations of il-6 , il-10 , il-18 , ifn , tnf , and il-1 , and their ratios with il-10 across ces - d scale tertiles are shown in table 3 . of the individual cytokines , ratios of il-18/il-10 , ifn/il-10 and il-1/il-10 were also significantly different between ces - d scale tertiles . post hoc tests revealed that serum il-18/il-10 ( p=0.046 ) , ifn/il-10 ( p=0.025 ) , and il-1/il-10 ( p=0.019 ) ( figure 2 ) were elevated in the middle ces - d scale tertile compared to the first ces - d scale tertile . post hoc analyses of specific depressive symptoms suggested that serum ratios of il-18/il-10 ( =0.28 , p=0.04 ) and il-1/il-10 ( =0.43 , p=0.001 ) , as well as il-1 ( =0.29 , p=0.04 ) were significantly associated with ces - d scale item 7 ( everything was an effort ) . however , this association was not found with k / t ratios ( =0.044 , p=0.69 ) . the ifn/il-10 ratio was associated with ces - d scale items 11 ( restless sleeping , =0.35 , p=0.01 ) and 17 ( crying spells , =0.29 , p=0.04 ) . the il-18/il-10 ratio was also associated with ces - d scale item 17 ( =0.29 , p=0.04 ) . il-1 was associated with ces - d scale item 15 ( people were unfriendly , =0.30 , p=0.03 ) . in antidepressant free - patients ( n=80 ) , k / t ratios did not differ between ces - d scale tertiles ( f2,79=1.49 , p=0.19 ) . in those with cytokine assays ( n=47 ) , ratios of il-1/il-10 ( f2,46=4.87 , p=0.01 ) , ifn/il-10 ( f2,46=3.83 , p=0.03 ) and il-1 concentrations ( f2,46=4.41 , p=0.02 ) remained different between tertiles , and there remained a trend for il-18/il-10 ( f2,46=3.01 , p=0.06 ) . in patients without a premorbid history of depression ( n=80 ) , k / t ratios did not differ between ces - d scale tertiles ( f2,79=0.41 , p=0.67 ) . in those with cytokine assays ( n=51 ) , ratios of ifn/il-10 ( f2,50=3.87 , p=0.03 ) , il-18/il-10 ( f2,50=3.35 , p=0.04 ) , il-1/il-10 ( f2,50=4.26 , p=0.02 ) , and il-1 concentrations ( f2,50=4.01 , p=0.03 ) remained different between tertiles . to facilitate comparison of our results with other studies , we repeated the main analyses using an established clinically important ces - d scale cutoff of 16 . k / t ratios did not differ between groups ( f1=2.05 , p=0.15 ) in a model adjusted as per the main analysis . a total of 382 post - ischemic stroke patients were screened for the study , of whom 138 patients were carefully selected who met inclusion criteria and did not meet any criterion for exclusion . a total of 86 patients ( mean age 71.714.2 years , 47.7% female ) who agreed to participate and for whom sufficient serum samples were obtained were included in this analysis . demographics and clinical characteristics of each tertile are presented in table 1 . ces - d scale scores ranged from 0 to 48 , with a mean standard deviation ces - d scale score of 13.511.5 . based on 33rd and 66th percentile ces - d scale scores , ces - d scale tertile ranges were 06 , 716 , and 1748 , respectively . of all demographic and clinical characteristics , only smoking ( current ) and hypertension differed between ces - d scale tertiles . as continuous variables , only nihss score ( r=0.25 , p=0.02 ) and age ( r=0.23 , p=0.04 ) were associated with ces - d scale scores . kyn , trp , and k / t ratio assay results are reported in table 2 . the k / t ratio did not differ between ces - d scale tertiles ( f2,76=0.04 , p=0.96 ; see figure 1 ) in a model controlling for nihss score ( f1,76=1.12 , p=0.28 ) , age ( f1,76=4.84 , p=0.03 ) , sex ( f1,76=0.15 , p=0.70 ) , history of depression ( f1,76=3.19 , p=0.08 ) , antidepressant use ( f1,76=0.22 , p=0.64 ) , hypertension ( f1,76=1.39 , p=0.24 ) , and smoking ( f1,76=4.54 , p=0.04 ) . neither kyn ( f2,76=0.054 , p=0.96 ) nor trp ( f2,76=0.44 , p=0.64 ) concentrations individually differed between ces - d scale tertiles ; however , trp was significantly lower in patients with a history of depression ( f2,76=5.43 , p=0.022 ) and in older subjects ( f1,76=6.48 , p=0.013 ) . cytokines were assayed in the 53 patients who provided sufficient serum for analysis , and results are reported in table 2 . this subset of patients did not differ from patients who did not provide sufficient serum with respect to age , sex , depression history , hypertension , or other comorbidities ( all p>0.05 ) . of these immunological markers , all kyn , trp , k / t ratio , il-6 , and il-18 levels were within detectable range . imputations were made for 21% of il-1 , 27% of tnf , 60% of il-10 , and 5.1% of ifn samples . comparison of serum concentrations of il-6 , il-10 , il-18 , ifn , tnf , and il-1 , and their ratios with il-10 across ces - d scale tertiles are shown in table 3 . of the individual cytokines , only il-1 concentrations differed significantly between ces - d scale tertiles . ratios of il-18/il-10 , ifn/il-10 and il-1/il-10 were also significantly different between ces - d scale tertiles . post hoc tests revealed that serum il-18/il-10 ( p=0.046 ) , ifn/il-10 ( p=0.025 ) , and il-1/il-10 ( p=0.019 ) ( figure 2 ) were elevated in the middle ces - d scale tertile compared to the first ces - d scale tertile . post hoc analyses of specific depressive symptoms suggested that serum ratios of il-18/il-10 ( =0.28 , p=0.04 ) and il-1/il-10 ( =0.43 , p=0.001 ) , as well as il-1 ( =0.29 , p=0.04 ) were significantly associated with ces - d scale item 7 ( everything was an effort ) . however , this association was not found with k / t ratios ( =0.044 , p=0.69 ) . the ifn/il-10 ratio was associated with ces - d scale items 11 ( restless sleeping , =0.35 , p=0.01 ) and 17 ( crying spells , =0.29 , p=0.04 ) . the il-18/il-10 ratio was also associated with ces - d scale item 17 ( =0.29 , p=0.04 ) . il-1 was associated with ces - d scale item 15 ( people were unfriendly free - patients ( n=80 ) , k / t ratios did not differ between ces - d scale tertiles ( f2,79=1.49 , p=0.19 ) . in those with cytokine assays ( n=47 ) , ratios of il-1/il-10 ( f2,46=4.87 , p=0.01 ) , ifn/il-10 ( f2,46=3.83 , p=0.03 ) and il-1 concentrations ( f2,46=4.41 , p=0.02 ) remained different between tertiles , and there remained a trend for il-18/il-10 ( f2,46=3.01 , p=0.06 ) . in patients without a premorbid history of depression ( n=80 ) , k / t ratios did not differ between ces - d scale tertiles ( f2,79=0.41 , p=0.67 ) . in those with cytokine assays ( n=51 ) , ratios of ifn/il-10 ( f2,50=3.87 , p=0.03 ) , il-18/il-10 ( f2,50=3.35 , p=0.04 ) , il-1/il-10 ( f2,50=4.26 , p=0.02 ) , and il-1 concentrations ( f2,50=4.01 , p=0.03 ) remained different between tertiles . to facilitate comparison of our results with other studies , we repeated the main analyses using an established clinically important ces - d scale cutoff of 16 . k / t ratios did not differ between groups ( f1=2.05 , p=0.15 ) in a model adjusted as per the main analysis . in this study , no relationship was identified between the k / t ratio and ces - d scale scores . this finding was maintained after excluding those with antidepressant use or a history of depression . in the context of mdd , both positive1012 and negative findings with kyn metabolism have been reported.4951 as replicated in this study , a recent meta - analysis found disability to be among the most significant predictors of psd,2 suggesting a minor role for immunological contributions . however , the present findings should be interpreted in light of other known properties of the kyn pathway and additional observations . for instance , whereas the production of quino - linic acid and its intermediates by kyn monooxygenase in microglia may induce oxidative stress and excitotoxicity,14 kyn catabolism into kynurenic acid by kyn aminotransferase ii in astrocytes may be neuroprotective.52 therefore , the production of both neurotoxic and neuroprotective metabolites when in balance may have no net effect on depressive symptoms.10,53 immunoregulatory effects of kyn may curb neuroinflammation,54 resulting in the neuroprotective properties observed in ischemia models,55 which might obscure deleterious roles of kyn metabolites.54,55 therefore , while the present study establishes that the peripheral k / t ratio is not a psd biomarker , it does not preclude possible roles of kyn or its metabolites in the brain . in the present study , higher k / t ratios and lower trp concentrations were associated with older age . trp concentrations were lower in subjects with a history of depression , although kyn concentrations were not different . therefore , the present study replicates the relationship between low trp and depressive diathesis seen in other populations , but does not provide evidence to support a role for kyn synthesis in this relationship . mean k / t ratios in the present study ( 78 mol / mmol ) and another stroke study8 were higher than those previously reported in mdd patients ( 25 mol / mmol)10 or in coronary artery disease patients ( 40 mol / mmol ) , where depressive symptoms measured by the ces - d scale were associated with the k / t ratio.13 marked elevations in the k / t ratio poststroke may be above the levels associated with depressive symptoms and instead indicative of other poststroke sequelae.8,56,57 relationships between cytokines ( ie , il-1 ) and cytokine ratios ( il-18/il-10 , il-1/il-10 , and ifn/il-10 ) with depressive symptoms were identified in agreement with some24,26,27,29 but not all previous studies.22,24,25 these exploratory results suggest that the risk of mild psd symptoms might be better characterized by inflammatory imbalance ; il-1 and the immunologic ratios studied tended to be highest in the intermediate depressive symptoms tertile . these inverted u - shaped curves would be consistent with animal data , in which inflammatory activity produces sickness behaviors that sometimes transition into a more severe syndrome reminiscent of human depression.58 the disagreement between studies that dichotomized patients into depressed or nondepressed categories may be partly explained by the heterogeneity in the presentation of depressive episodes poststroke ; the present post hoc analyses agree with previous studies,28,29,59 suggesting that somatic symptoms ( ie , fatigue and sleep disturbance ) may be associated with immune dysregulation , in addition to some core affective symptoms ( ie , sadness , crying , and negative social bias ) . clinically , cytokines have been associated with post - stroke fatigue but not depression per se.28,29 our exploratory finding that cytokine ratios ( il-18/il-10 and il-1/il-10 ) as well as il-1 were most consistently associated with ces - d scale item 7 ( everything was an effort ) rather than mood items are consistent with this . this item , either with or without the inertia item ( could not get going ) , has been operationalized to measure fatigue.60,61 a recent study examined fatigue more specifically in patients poststroke , finding relationships with trp availability and a kyn metabolite , but also finding no relationship with psd.62 taken together , the results suggest a potential relationship between inflammatory cascades and fatigue and milder depressive symptoms , which may be qualitatively different from mdd . as a possible limitation , inflammatory markers were not assessed in the acute phase of stroke and examined prospectively , which may have revealed different relationships ; however , previous reports suggest that elevations in kyn and its metabolites persist for weeks to years following stroke or traumatic brain injury,8,63 and the present findings suggest that elevations in other inflammatory markers are relevant to depressive symptoms in the subacute phase . these positive findings suggest that it would have been possible to observe a relationship if the k / t ratio was related to psd . although the ces - d scale is not a diagnostic instrument , the aim of this study was to characterize the relationship between the k / t ratio and depressive symptoms , for which the ces - d scale has been validated . moreover , exploratory findings support the hypothesis that there may be nonlinear immunological relationships with depressive symptoms , suggesting the utility of nondichotomous assessment . while kyn and some kyn metabolites can cross the blood brain barrier,64 peripheral blood concentrations may not represent central concentrations and kyn metabolites were not assayed ; however , peripheral kyn has been correlated with cerebrospinal fluid kyn and quinolinic acid concentrations65 and with post - stroke sequelae,8,57 justifying its exploration as a biomarker for psd . finally , the main finding of the present study does not support the primary hypothesis , and the positive findings reported were based on exploratory and post hoc analyses in a subgroup of patients without correction for multiple comparisons . although the relationship between cytokines and fatigue was determined based on a ces - d scale item , the validity of this item has been established,60,61 and the results concur with those of other studies that used more nuanced fatigue assessments.28,29 although the exploratory results do not provide rigorous evidence , they are confluent with extant literature and provide an impetus for appropriately powered replicative and/or prospective studies . k / t ratios were not associated with depressive symptoms in the acute phase following an ischemic infarct , although associations between depressive symptoms and disability and vascular risk factors were confirmed , and relationships between serum trp concentrations and histories of depression and age were found . exploratory analyses suggested that inflammatory activity was associated with mild moderate but not with severe depressive symptoms . prospective studies might clarify relationships between immune imbalance and the evolution of depressive symptoms poststroke .

background and purposedepression is a commonly occurring and persistent sequel of stroke affecting approximately 29% of patients . an immunological hypothesis has been put forward , and synthesis of kynurenine from tryptophan has been proposed to link inflammatory activity with neurotoxicity and neurotransmitter dysfunction . this study assessed the relationship between peripheral blood kynurenine and poststroke depressive symptoms.patients and methodsthis was a multisite cross - sectional observational cohort study of patients with ischemic stroke . depressive symptoms were assessed using the center for epidemiological studies depression ( ces - d ) scale and divided into high , medium , and low depressive symptom tertiles . concentrations of kynurenine and tryptophan were assayed from fasting serum samples , and the kynurenine / tryptophan ratio was compared between tertiles . serum cytokine concentrations were assayed in a subgroup of patients , and the ratio of proinflammatory ( il-6 , il-18 , ifn , tnf , il-1 ) to anti - inflammatory ( il-10 ) cytokines compared.nlm identifiernct00254020.resultsin these patients ( n=86 , 52.3% male , mean age 71.714.2 years ) , there were no differences in kynurenine / tryptophan ratios between ces - d scale tertiles ( f2,76=0.04 , p=0.96 ) controlling for relevant covariates . for cytokines ( n=53 ) , serum il-1 concentrations ( f2,52=3.55 , p=0.037 ) and serum ratios of il-18/il-10 ( f2,52=3.30 , p=0.046 ) , ifn/il-10 ( f2,52=4.02 , p=0.025 ) , and il-1/il-10 ( f2,52=4.34 , p=0.019 ) were elevated in the middle ces - d tertile . post hoc analyses suggested that serum ratios of il-18/il-10 ( =0.28 , p=0.04 ) , and il-1/il-10 ( =0.43 , p=0.001 ) , as well as il-1 ( =0.29 , p=0.04 ) , were significantly associated with fatigue.conclusionperipheral kynurenine / tryptophan ratios were not associated with depressive symptoms in a poststroke population . however , in exploratory analyses a proinflammatory bias was identified specifically in patients with mild depressive symptoms and associated with poststroke fatigue , suggesting an avenue for future research .

Introduction Patients and methods Participants Assessments Blood sampling and serum analyses Statistical analysis Sample size Results Patient characteristics K/T ratio and depressive symptoms Cytokine concentrations and ratios Post hoc analyses Discussion Conclusion

arginine metabolism to nitric oxide ( no ) via nitric oxide synthase or to ornithine via arginase is an important biological pathway ( see fig . no has many important functions , including regulating vascular tone and facilitating cell - mediated cytotoxicity , and ornithine is the immediate precursor of polyamines , which are important in cell proliferation . in addition to competition for the substrate , l - arginine , there are other interactions between the two pathways of arginine metabolism , such as the inhibition of arginase by n - hydroxy - l - arginine , an intermediate in no biosynthesis . arginine pathway . l - arginine is metabolized either by nitric oxide synthase to n - hydroxy - l - arginine and no , or by arginase to ornithine and urea . n - hydroxy - l - arginine inhibits arginase , and no inhibits ornithine decarboxylase . under different experimental conditions , on the other hand , polyamines appear to be necessary for the proliferation of neoplastic cells , and polyamine depletion results in tumor growth arrest . inducible nitric oxide synthase ( inos ) catalyzes the production of no , which contributes to the antitumor activity of activated macrophages . inos expression is induced by cytokines , primarily the pro - inflammatory cytokine rifn- which may be produced by certain t - lymphocytes and natural killer ( nk ) cells that are important in adaptive and innate immune responses , respectively . in addition , rifn-(rifn ) can have a direct antiproliferative effect on tumor cell lines in vitro , including a number of ovarian cancer cell lines [ 13 - 15 ] . this antiproliferative activity in some experimental systems depends on the catabolism of another amino acid , l - tryptophan , by indoleamine 2,3-dioxygenase ( ido ) . the antitumor activity of rifn- , administered either intraperitoneally or systemically , has also been observed in clinical trials involving epithelial ovarian carcinoma ( eoc ) . in this study , we examined l - arginine metabolism in eoc cell lines and the effect of rifn- on arginase activity . arginase expression varied among eoc cell lines . in some cell lines , rifn- reduced arginase activity and expression ; however , no direct relationship between arginase activity and the growth inhibitory effects of rifn- was observed . l - n - monomethyl arginine citrate ( nmma ) was obtained from cayman chemical company ( ann arbor , mi ) n - hydroxy - l - arginine was obtained from alexis ( carlsbad , ca ) . ornithine , putrescine , and spermidine were obtained from sigma ( st . louis , mo ) . the 2774 cell line was originally isolated from an ovarian cancer patient in the laboratory of dr . the nmp-1 cell line is a moderately platinum - resistant tumor cell line developed from the parental ovcar3 line by in vitro incubation of the cell with increasing cisplatin concentrations and subsequent passage in the nude mouse in the laboratory of dr . the hey line was originally derived from a human ovarian cancer xenograft , and is characterized by moderate resistance to cisplatin . the 2008 cell line and its platinum - resistant subline , 2008.c13 , were obtained from dr . caov3and skov3 , which overexpress her2/neu , were obtained from american type culture collection ( manassas , va ) . all cell lines were grown in rpmi 1640 ( gibco , grand island , ny ) supplemented with 10% fetal calf serum ( sigma ) at 37c in 5% co2 . briefly , 5 10cells were obtained by trypsinization and washed twice with phosphate - buffered saline ( pbs , gibco ) . to each sample , 50 ml of 0.1% triton x-100 ( curtin - matheson , houston , tx ) containing 5 g pepstatin , 5 g aprotinin , and 5 g of antipain ( sigma ) were added , and the samples were shaken for 1 hour at room temperature . an aliquot was then taken for the determination of protein content , 50 l of 10 mm manganese chloride ( sigma ) in 50 mm tris - hcl ( fisher , fair lawn , nj ) , ph 7.5 , were then added to the sample and the samples were incubated for 10 minutes at 55c . afterwards , 25 l of the sample was transferred to eppendorf tubes , 25 l of 0.5 m arginine ( sigma ) , ph 9.7 , was added , and the mixture was incubated at 37c . after 1 hour , the reaction was stopped by 400 l of acid mixture ( sulfuric acid , phosphoric acid , and water 1:3:7 ) , 25 l of 9% -isonitrosopropiophenone in ethanol ( sigma ) , was added and the samples were heated at 100c for 1 hour . after 10 minutes in the dark , optic density at 540 nm was determined using a microplate reader . a calibration curve was prepared using increasing concentrations of urea ( curtin - matheson ) . in certain experiments , nmma , an inos inhibitor , was added to study a possible role of inos induction in the suppression of arginase activity by rifn-. the protein content of each sample was measured using a bicinchoninic acid method with a commercial kit ( pierce , rockford , il ) according the manufacturer 's instructions . the expression of ki-67 , a marker of proliferation , on cultured eoc cell lines was evaluated by immunocytochemistry . briefly , cytospin preparations of cultured eoc cell lines were fixed with acetone at room temperature and air - dried . after blocking with 0.3% hydrogen peroxide in methanol the slides were then incubated with ki-67 mouse anti - human monoclonal antibody ( pharmingen , san diego , ca ) for 1 hour . the slides were washed twice with pbs and then incubated with a biotin - conjugated secondary antibody for 1 hour at room temperature . after two washes with pbs , the slides were stained using an avidin - biotin - peroxidase complex staining kit ( vector laboratories , burlingame , ca ) following the manufacturer 's instructions . after counterstaining with hematoxylin qs h-3404 ( vector ) , the proportion of positively stained cells was measured . the rna extraction was performed using trizol ( invitrogen life technologies , carlsbad , ca ) . the expression of inos , arginase i , and arginase ii in ovarian cancer cells treated with and without ifn- was examined using a reverse transcription - polymerase chain reaction ( rt - pcr ) . reverse transcription was performed using 15 g of total rna diluted in 11.5 l of diethylpyrocarbamate - treated water . one microliter of random primers ( gibco ) were added to each rna sample in a sterile pcr tube . , the samples were chilled on ice , and 4 l of first - strand buffer ( gibco ) , 2 l of 0.1 m dtt ( gibco ) , 1 l of rnse inhibitor ( roche , mannheim , germany ) and 0.5 l of 25 mm dntp ( gibco ) were added to each sample . the samples were then incubated for 10 minutes at 25c and 2 minutes at 42c . one microliter of reverse transcriptase ( superscript ii , gibco ) was then added , and the reaction was continued at 42c for another 45 minutes . the reaction was then stopped by heating the tubes at 95c for 5 minutes , and the complementary dna ( cdna ) obtained was stored at -20c until needed for further analysis . the following primers were used ( gibco ) : inos sense 5'-catggcttgcccctggaagtttct-3 ' , antisense 5'-cctctatggtgccatcgggcatc-3 ' ; arginase i sense 5'-ctctaagggacagcctcgagga-3 ' , antisense 5'-tgggttcacttccatgatatcta-3 ' ; arginase ii sense 5'-atgtccctaaggggcagcctctcgcgt-3 ' , antisense 5'-cacagctgtagccatctgacacagctc-3 ' ; ido sense 5'-cctgacttatgagaacatggacgt-3 ' , antisense 5'-atacaccagaccgtctgatagctg-3 ' ; -actin sense , 5'-gttgctatccaggctgtgc-3 ' , and antisense , 5'-gcatcctgtcggcaatgc-3 ' . the amplification was performed in 25 l of reaction mixture containing primers , 1 l dimethyl sulfoxide ( sigma ) , pcr buffer , 0.2 mm dntp , 1.5 mm magnesium chloride , and 5 u taq dna polymerase ( gibco ) under amplification conditions described previously . the final pcr product was loaded on a 1.5 % agarose gel , separated by electrophoresis , and visualized using ethidium bromide staining under ultraviolet light . the expected sizes of the amplified fragments were : inos , 747 base pairs ( bp ) ; arginase i , 794 bp ; arginase ii , 342 bp ; ido,321 bp ; gapdh , 558 bp ; and -actin , 567 bp . the semi - quantitative measurement of transcript expression was analyzed using a scion image tool . the relative arbitrary units of transcript expression were normalized using the value of -actin . briefly , 5000 cells were seeded into flat - bottom 96-well plates ( becton dickinson , franklin lakes , nj ) and incubated with the agent of interest in rpmi 1640 supplemented with 10% fetal calf serum for 72 hours . for the last 16 hours , the cells were pulsed with 50 l of [ h]thymidine ( 10 ci / ml , specific activity 185 bq / mmol , amersham , piscataway , nj ) . the cells were washed 3 times with phosphate - buffered saline ( gibco ) , and subsequently lysed with 150 l of 0.1 m sodium hydroxide ( curtin matheson ) . the lysate was subsequently transferred to 3 ml scintillation liquid ( safety - solve , research products international , mount prospect , il ) , and radioactivity was determined using a winspectral liquid scintillation counter ( ef&g wallac , turku , finland ) . the percentage of cytostasis for each treatment was calculated using the formula : ( cpmcontrol cells - cpmtreated cells ) 100/cpmcontrol cells . in certain experiments , the polyamines ( ornithine , putrescine and spermidine ) were added to study the effect of polyamines on rifn--induced cytostasis . n - hydroxy - l - arginine , an arginase inhibitor , was added to study the effect of arginase suppression on the proliferation of eoc cell lines . l - n - monomethyl arginine citrate ( nmma ) was obtained from cayman chemical company ( ann arbor , mi ) n - hydroxy - l - arginine was obtained from alexis ( carlsbad , ca ) . ornithine , putrescine , and spermidine were obtained from sigma ( st . louis , mo ) . the 2774 cell line was originally isolated from an ovarian cancer patient in the laboratory of dr . the nmp-1 cell line is a moderately platinum - resistant tumor cell line developed from the parental ovcar3 line by in vitro incubation of the cell with increasing cisplatin concentrations and subsequent passage in the nude mouse in the laboratory of dr . the hey line was originally derived from a human ovarian cancer xenograft , and is characterized by moderate resistance to cisplatin . the 2008 cell line and its platinum - resistant subline , 2008.c13 , were obtained from dr . caov3and skov3 , which overexpress her2/neu , were obtained from american type culture collection ( manassas , va ) . all cell lines were grown in rpmi 1640 ( gibco , grand island , ny ) supplemented with 10% fetal calf serum ( sigma ) at 37c in 5% co2 . briefly , 5 10cells were obtained by trypsinization and washed twice with phosphate - buffered saline ( pbs , gibco ) . to each sample , 50 ml of 0.1% triton x-100 ( curtin - matheson , houston , tx ) containing 5 g pepstatin , 5 g aprotinin , and 5 g of antipain ( sigma ) were added , and the samples were shaken for 1 hour at room temperature . an aliquot was then taken for the determination of protein content , 50 l of 10 mm manganese chloride ( sigma ) in 50 mm tris - hcl ( fisher , fair lawn , nj ) , ph 7.5 , were then added to the sample and the samples were incubated for 10 minutes at 55c . afterwards , 25 l of the sample was transferred to eppendorf tubes , 25 l of 0.5 m arginine ( sigma ) , ph 9.7 , was added , and the mixture was incubated at 37c . after 1 hour , the reaction was stopped by 400 l of acid mixture ( sulfuric acid , phosphoric acid , and water 1:3:7 ) , 25 l of 9% -isonitrosopropiophenone in ethanol ( sigma ) , was added and the samples were heated at 100c for 1 hour . after 10 minutes in the dark , optic density at 540 nm was determined using a microplate reader . a calibration curve was prepared using increasing concentrations of urea ( curtin - matheson ) . in certain experiments , nmma , an inos inhibitor , was added to study a possible role of inos induction in the suppression of arginase activity by rifn-. the protein content of each sample was measured using a bicinchoninic acid method with a commercial kit ( pierce , rockford , il ) according the manufacturer 's instructions . the expression of ki-67 , a marker of proliferation , on cultured eoc cell lines was evaluated by immunocytochemistry . briefly , cytospin preparations of cultured eoc cell lines were fixed with acetone at room temperature and air - dried . after blocking with 0.3% hydrogen peroxide in methanol the slides were then incubated with ki-67 mouse anti - human monoclonal antibody ( pharmingen , san diego , ca ) for 1 hour . the slides were washed twice with pbs and then incubated with a biotin - conjugated secondary antibody for 1 hour at room temperature . after two washes with pbs , the slides were stained using an avidin - biotin - peroxidase complex staining kit ( vector laboratories , burlingame , ca ) following the manufacturer 's instructions . after counterstaining with hematoxylin qs h-3404 ( vector ) , the proportion of positively stained cells was measured . the rna extraction was performed using trizol ( invitrogen life technologies , carlsbad , ca ) . the expression of inos , arginase i , and arginase ii in ovarian cancer cells treated with and without ifn- was examined using a reverse transcription - polymerase chain reaction ( rt - pcr ) . reverse transcription was performed using 15 g of total rna diluted in 11.5 l of diethylpyrocarbamate - treated water . one microliter of random primers ( gibco ) were added to each rna sample in a sterile pcr tube . , the samples were chilled on ice , and 4 l of first - strand buffer ( gibco ) , 2 l of 0.1 m dtt ( gibco ) , 1 l of rnse inhibitor ( roche , mannheim , germany ) and 0.5 l of 25 mm dntp ( gibco ) were added to each sample . the samples were then incubated for 10 minutes at 25c and 2 minutes at 42c . one microliter of reverse transcriptase ( superscript ii , gibco ) was then added , and the reaction was continued at 42c for another 45 minutes . the reaction was then stopped by heating the tubes at 95c for 5 minutes , and the complementary dna ( cdna ) obtained was stored at -20c until needed for further analysis . the following primers were used ( gibco ) : inos sense 5'-catggcttgcccctggaagtttct-3 ' , antisense 5'-cctctatggtgccatcgggcatc-3 ' ; arginase i sense 5'-ctctaagggacagcctcgagga-3 ' , antisense 5'-tgggttcacttccatgatatcta-3 ' ; arginase ii sense 5'-atgtccctaaggggcagcctctcgcgt-3 ' , antisense 5'-cacagctgtagccatctgacacagctc-3 ' ; ido sense 5'-cctgacttatgagaacatggacgt-3 ' , antisense 5'-atacaccagaccgtctgatagctg-3 ' ; -actin sense , 5'-gttgctatccaggctgtgc-3 ' , and antisense , 5'-gcatcctgtcggcaatgc-3 ' . the amplification was performed in 25 l of reaction mixture containing primers , 1 l dimethyl sulfoxide ( sigma ) , pcr buffer , 0.2 mm dntp , 1.5 mm magnesium chloride , and 5 u taq dna polymerase ( gibco ) under amplification conditions described previously . the final pcr product was loaded on a 1.5 % agarose gel , separated by electrophoresis , and visualized using ethidium bromide staining under ultraviolet light . the expected sizes of the amplified fragments were : inos , 747 base pairs ( bp ) ; arginase i , 794 bp ; arginase ii , 342 bp ; ido,321 bp ; gapdh , 558 bp ; and -actin , 567 bp . the semi - quantitative measurement of transcript expression was analyzed using a scion image tool . briefly , 5000 cells were seeded into flat - bottom 96-well plates ( becton dickinson , franklin lakes , nj ) and incubated with the agent of interest in rpmi 1640 supplemented with 10% fetal calf serum for 72 hours . for the last 16 hours , the cells were pulsed with 50 l of [ h]thymidine ( 10 ci / ml , specific activity 185 bq / mmol , amersham , piscataway , nj ) . the cells were washed 3 times with phosphate - buffered saline ( gibco ) , and subsequently lysed with 150 l of 0.1 m sodium hydroxide ( curtin matheson ) . the lysate was subsequently transferred to 3 ml scintillation liquid ( safety - solve , research products international , mount prospect , il ) , and radioactivity was determined using a winspectral liquid scintillation counter ( ef&g wallac , turku , finland ) . the percentage of cytostasis for each treatment was calculated using the formula : ( cpmcontrol cells - cpmtreated cells ) 100/cpmcontrol cells . in certain experiments , the polyamines ( ornithine , putrescine and spermidine ) were added to study the effect of polyamines on rifn--induced cytostasis . n - hydroxy - l - arginine , an arginase inhibitor , was added to study the effect of arginase suppression on the proliferation of eoc cell lines . arginase activity varied among eoc cell lines . there was no apparent relationship between the expression of arginase activity in eoc tumor cell lines and the expression of the ki-67 antigen . arginase activity was lower ( less than 0.2 g urea per mg protein ) in 3 eoc cell lines hey , skov3 , and ovcar3 and higher in 2774 , caov3 , nmp-1 , and 2008 , and in its platinum - resistant subline , 2008.c13 ( table 1 ) . arginase activity was also higher in the nmp-1 cell line , the cisplatin - resistant subline of ovcar3 . arginase activity decreased markedly after treatment of 2774 , nmp-1 , and caov3 cells with rifn-. in contrast , rifn- treatment leads to an increase of arginase activity in 2008 and its cisplatin - resistant subline 2008.c13 . inos expression was examined because n - hydroxy - l - arginine and no produced by the activity of this enzyme are known inhibitors of arginase activity . however , the addition of nmma , an inos inhibitor did not abolish rifn--induced changes in arginase activity ( table 2 ) , which is consistent with the rt - pcr data showing an absence of inos expression . analysis of mrna transcripts from all 6 eoc cell lines shows that arginase ii was the enzyme responsible for the arginase activity ( fig . treatment of the cell cultures with rifn- did not increase arginase ii transcript expression in any of the 6 cell lines tested . 2a and 2b ) , was increased by more than two - fold in 5 of the 6 ovarian cancer cell lines treated with ifn- ( fig . in contrast to arginase ii and ido , arginase i and inos were not detected in any of these cell lines when cultured in medium alone or with rifn- ( data not shown ) . expression of arginase ii ( a ) and ido ( b ) in eoc cell lines . rna was extracted and rt - pcr performed as described in materials and methods . shown are the results obtained for hey cells treated with rifn- ( lane 1 ) , control untreated hey cells ( lane 2 ) , ovcar3 cells treated with rifn- ( lane 3 ) , control ovcar3 cells ( lane 4 ) , caov3 cells treated with rifn- ( lane 5 ) , control caov3 cells ( lane 6 ) , skov3 cells treated with ifn- ( lane 7 ) , control skov3 cells ( lane 8) , 2008.13 treated with rifn- ( lane 9 ) , control 2008.c13 cells ( lane 10 ) , 2008 cells treated with rifn- ( lane 11 ) , control 2008 cells ( lane 12 ) . arginase activity in eoc cell lines the percentage of ki-67 was determined by immunocytochemistry , and the expression of arginase ii was examined by rt - pcr as described in materials and methods . arginase activity and growth inhibition were determined after 72 hours of incubation with control medium or rifn- and are representative of 4 independent experiments . effect of n - methyl - l - arginine on inhibition of arginase activity by rifn- the cells were incubated with control medium , rifn- , and/or nmma for 72 hours and processed as described in materials and methods . rifn- produced significant growth inhibition in 7 of 8 cell lines examined , the exception being skov3 , a cell line with negligible arginase activity ( table 1 ) . since the growth - inhibitory activity of rifn- in certain eoc lines appeared to be accompanied with arginase inhibition , and since formation of ornithine from arginine catalyzed by arginase represents the first step in the synthesis of polyamines , we hypothesized the inhibition of arginase activity might be at least partly responsible for the growth - inhibitory effects of rifn- on eoc cell lines . however , the addition of polyamines , ornithine , putrescine , or spermidine did not abolish the growth - inhibitory activity of rifn- ( fig . , there was no interference with growth inhibition by rifn- in eoc cell lines after treatment with n - hydroxy - l - arginine , an arginase inhibitor . cytostatic activity of ifn- , n - hydroxy - l - arginine and the effect of polyamines on ifn--induced cytostasis . nmp-1 cells were seeded at 10cells / well into 96-well plates in rpmi 1640 with 10% fetal calf serum and cultured overnight . the next day , the cells were washed with phosphate buffered salines , and the medium was replaced with a low - arginine , serum - free medium ( 5% bovine serum albumin , 1.5% iscove 's modified dulbecco 's medium [ gibco ] , 0.2% glucose , 0.01% magnesium sulfate , 0.016% calcium chloride , transferrin 5.5 g / ml , and insulin 4 g / ml in hank 's balanced salt medium [ gibco ] , ph 7.4 ) alone or with rifn- ( 500 u / ml ) . the arginine concentration of this medium was 6 m , lower than plasma concentration ( normal range , 50126 m . after another 24 hours , rifn- ( 500 u / ml ) , n - hydroxy - l - arginine ( 250 m ) , or rifn- plus ornithine ( 1 mm ) , putrescine ( 1 mm ) , or spermidine ( 0.5 mm ) was added . the cells were then pulsed with [ h ] thymidine and incubated for another 24 hours . similar results were observed with other eoc cell lines and when experiments were done with rpmi 1640 supplemented with 10% fetal calf serum . this study has shown that eoc cell lines have variable levels of arginase activity , which was also observed in cell lines with elevated levels of the ki-67 proliferation marker . among the cell lines examined , caov3 and 2008 are considered platinum - sensitive , skov3 and 2774 are moderately sensitive , and hey , 2008.c13 and nmp-1 are platinum - resistant . elevated arginase activity was observed in both platinum - sensitive 2008 cells and the platinum - resistant subline , 2008.c13 , and it was substantially higher in nmp-1 cells than in the parental line , ovcar3 , both platinum - resistant . although arginase activity was higher in 2008.c13 and nmp-1 cells , platinum - sensitive cell lines , e.g. , caov3 , exhibited elevated arginase activity , while some platinum - resistant lines , e.g. , hey , showed reduced arginase activity . it therefore appears that there is no direct association between arginase activity and platinum - resistance . inos expression was not detected in any of the 8 cell lines examined , even after treatment with rifn-. in contrast , ido transcripts were expressed by 5 of the 6 eoc lines treated with rifn-. these results showing no inos expression differ from other reported findings in human tumor cell lines , including eoc [ 28,30 - 32 ] . inos has been previously detected in some eoc lines but was absent in other cell lines , such as the 2774 cell line . inos expression was detected in ad10 , a doxorubicin - resistant subline , but not in the parental a2780 eoc line . in another study , inos activity was detected after ovcar3 cells in vitro were treated with a combination of rifn- , interleukin-1 , and tumor necrosis factor- . in our experiments , rifn- was not combined with other cytokines , which may explain the lack of expression of inos . treatment of the eoc cell lines with rifn- produced different effects on arginase activity , with inhibition of arginase activity in 3 cell lines , 2774 , nmp-1 , and caov3 . rifn- induces inos , and n - hydroxy - l - arginine , an intermediate in no synthesis by inos , is a potent inhibitor of arginase . in addition , no inhibits ornithine decarboxylase in the caco-2 colon cancer cell line . however , inos was not detected by rt - pcr after eoc cells were treated with rifn- , and the addition of nmma did not abolish the inhibition of arginase activity by rifn- , making it unlikely that the simultaneous induction of inos could be responsible for the inhibition of arginase activity in the cell lines . the mechanism(s ) of arginase inhibition by rifn- have still to be elucidated . from the present data , regulation of arginase activity by rifn- at the transcriptional level . there could be different regulatory effects operating in different cell lines , as shown by the results of our experiments . future experiments could address the mechanism of transcriptional regulation of arginase ii by rifn-. in contrast to the effects of rifn- on arginase ii transcript expression , treatment with rifn- increased or induced the expression of ido . this is in agreement with other reports on the effects of rifn- on various tumor cell lines , including eoc . consistent with an increase in the expression of ido , it has been shown that , at least in some experimental systems , the depletion of l - tryptophan is responsible for the antiproliferative activity of rifn- , and rifn--mediated growth inhibition could be reversed by adding l - tryptophan . the depletion of l - tryptophan is also thought to be responsible for the growth - inhibitory activity of rifn- in certain in vivo models . however , l - tryptophan depletion is not the only mechanism responsible for the antiproliferative activity of rifn- . metabolites resulting from l - tryptophan catabolism by ido ( e.g. kynurenine , 3-hydroxy - kynurenine , or picolinic acid ) , may also exhibit antitumor activity . in our experiments , the growth - inhibitory activity of rifn- was sometimes , but not always accompanied by the inhibition of arginase activity . formation of ornithine from l - arginine catalyzed by arginase is the first step in the synthesis of polyamines . the induction of stat1 and p21mediates growth inhibition by rifn- , and p21is involved in growth inhibition induced by polyamine depletion . in addition , the inhibition of arginase activity by n - hydroxy - l - arginine causes growth inhibition in breast cancer cell line mda - mb-468 and colon adenocarcinoma cell line caco-2 . we therefore hypothesized that the inhibition of arginase activity might represent another mechanism , at least partly , responsible for the growth - inhibitory effects of rifn- on eoc cell lines . experiments in a medium rich in arginine and at arginine concentrations significantly lower than physiological levels , however , do not support this hypothesis . although rifn- treatment results in a decreased transport of polyamines , supraphysiologic concentrations of polyamines used in the current experiments would be expected to compensate for a decrease in the range of 50% that was reported earlier . in addition , no growth - inhibition could be induced by n - hydroxy - l - arginine . thus , the decreased production of ornithine induced by rifn- in tumor cells probably does not result in a lowering of polyamine concentrations that would affect the proliferation of the cultured eoc tumor cells . this is in agreement with the experimental data that demonstrate that ornithine in tumor - bearing animals is largely produced in the liver but not in tumor tissues . in addition , rifn- had significant growth inhibitory effects and actually increased , rather than decreased , arginase activity in the 2008 and 2008.c13 cell lines . arginase i , a cytosolic enzyme , is expressed mostly in the liver , in contrast to arginase ii , which is located in the mitochondria . this difference in subcellular localization of the two isoenzymes determines whether ornithine produced by arginase is more likely to be metabolized by ornithine decarboxylase ( a cytosolic enzyme ) to polyamines or by ornithine aminotransferase ( a mitochondrial enzyme ) to pyrroline-5-carboxylate and subsequently to proline or glutamate . production of polyamines appears to depend mostly on arginase i [ 45 - 47 ] . these findings suggest that arginase ii expression by tumor cells may not be as relevant to polyamine synthesis and the regulation of tumor cell proliferation . in an earlier study , a marked growth inhibition by n - hydroxy - l - arginine was observed in a cell line expressing only arginase i , but not in cell lines expressing only arginase ii . regulation of alternative pathways of arginine metabolism has been demonstrated by th1/th2 cytokines in monocytes . while proinflammatory cytokines ( e.g. , rifn- ) induce inos , arginase i is induced by th2 cytokines ( e.g. , interleukin-4 ) . inhibition of arginase activity by rifn- could be of importance in the tumor microenvironment as utilization of arginine may be switched to no synthesis . in addition , arginine has been reported to increase nk cell activity both in vitro and in vivo , and a suppression of nk cell activity was observed after arginase treatment . inhibition of arginase activity by rifn- may thus potentiate other effects of this cytokine on the host immune system . since rifn- actually increased arginase activity in the 2008 cell line and its cisplatin - resistant subline , 2008.13 , it is possible that rifn- induces a paradoxical increase in arginase activity in some tumor systems . this increase in arginase activity in turn might counterbalance the stimulatory activity of this cytokine on the cells of the host innate and adaptive immune systems . in conclusion , arginase expression and activity varied among eoc cell lines . arginase activity decreased after rifn- treatment in 3 of the cell lines and increased in 2008 and 2008.c13 cells . arginase ii appears to be the isoenzyme responsible for the arginase activity in eoc cells . the growth - inhibitory effects of rifn- treatment on eoc cell lines does not appear to be associated with the inhibition of arginase activity . these findings , however , do not discount the possibility that elevated arginase activity in eoc cells and its modulation by rifn- in vitro might be somehow relevant to the regulation of the host - tumor interaction in the tumor microenvironment in vivo . bm designed the experiments , performed the measurements for arginase activity , and drafted the manuscript .

backgroundarginine metabolism in tumor cell lines can be influenced by various cytokines , including recombinant human interferon- ( rifn- ) , a cytokine that shows promising clinical activity in epithelial ovarian cancer ( eoc).methodswe examined eoc cell lines for the expression of arginase in an enzymatic assay and for transcripts of arginase i and ii , inducible nitric oxide synthase ( inos ) , and indoleamine 2,3-dioxygenase ( ido ) by reverse transcription - polymerase chain reaction . the effects of rifn- on arginase activity and on tumor cell growth inhibition were determined by measuring [ 3h]thymidine uptake.resultselevated arginase activity was detected in 5 of 8 tumor cell lines , and analysis at the transcriptional level showed that arginase ii was involved but arginase i was not . rifn- reduced arginase activity in 3 eoc cell lines but increased activity in the 2008 cell line and its platinum - resistant subline , 2008.c13 . inos transcripts were not detected in rifn--treated or untreated cell lines . in contrast , ido activity was induced or increased by rifn-. suppression of arginase activity by rifn- in certain cell lines suggested that such inhibition might contribute to its antiproliferative effects . however , supplementation of the medium with polyamine pathway products did not interfere with the growth - inhibitory effects of rifn- eoc cells.conclusionsincreased arginase activity , specifically identified with arginase ii , is present in most of the tested eoc cell lines . rifn- inhibits or stimulates arginase activity in certain eoc cell lines , though the decrease in arginase activity does not appear to be associated with the in vitro antiproliferative activity of rifn-. since cells within the stroma of eoc tissues could also contribute to arginine metabolism following treatment with rifn- or rifn--inducers , it would be helpful to examine these effects in vivo .

Background Methods Reagents Cell lines Measurement of arginase activity Immunocytochemistry RNA extraction Reverse transcription-polymerase chain reaction Measurement of growth inhibition Results and Discussion Conclusions Authors Contributions Acknowledgement

neurocardiogenic syncope has a peak incidence in subjects in their late teens and early twenties . the positive rate of ttt with or without a history of syncope ranges from 23.8 to 74% [ 3 - 6 ] . many researchers have studied treatments of neurocardiogenic syncope including salt intake , physical maneuvers , beta - blockers , midodrine , fludrocortisones , paroxetine , and cardiac pacing ; however , the results are conflicting . in general , the prognosis of patients with neurocardiogenic syncope is benign , although some patients experience not only recurrent syncopal episodes but also serious head injuries despite treatment . therefore , the identification of high - risk patients is important for treatment and follow - up . the frequency of previous syncopal episodes has been reported to be the most powerful predictor of recurrent neurocardiogenic syncope [ 16 - 21 ] . no other prognostic factors have been confirmed for males in their late teens and early twenties . therefore , this study sought to identify prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties . subjects with underlying disease or abnormal electrocardiograms ( ecgs ) and those taking any medications were excluded . abnormal ecgs included rhythms other than sinus rhythm , right- or left - axis deviation , left- or right - ventricular hypertrophy , mobitz type 2 second - degree atrioventricular block , complete atrioventricular block , left bundle - branch block , and pathological q - wave and abnormal st - segment or t - wave changes . the subjects were monitored throughout testing with 3-lead electrocardiography and automated blood pressure cuff measurements every 2 minutes . the ttt consisted of passive and drug - provocation phases . after a 5-minute rest in the supine position , the subjects were tilted head - up to a 70 angle on the table for 30 minutes during the passive phase . if the passive phase was negative , the subjects were given sublingual nitroglycerin ( 0.4 mg ) and tilted to the same angle for another 20 minutes during the drug - provocation phase . positive results were classified into the following three types : type 1 ( mixed ) was defined as hypotension and heart rate 40 - 60/minutes ; type 2 ( cardioinhibitory ) was defined as heart rate < 40/minutes or asystole for 3 seconds ; and type 3 ( vasodepressor ) was defined as pure hypotension without bradycardia . hypotension was defined as decreased blood pressure causing syncope or signs of poor tissue perfusion . the subjects with positive results were educated on the prevention of syncope , including the avoidance of predisposing factors , lying down at the onset of prodromal symptoms , fluid or salt intake , and physical maneuvers . the subjects were followed in the outpatient clinic or by telephone on a regular basis for 12 months . all subjects provided informed consent . we analyzed the frequency of previous syncope , the ttt phase that gave a positive result , the ttt duration until a positive result , the types of neurocardiogenic syncope , and the recurrence rate of syncope during the follow - up period . the results are expressed as the mean sd or median ( interquartile range , iqr ) for data that were not distributed normally . the mann - whitney u test and kruskal - wallis test were used for statistical analysis of data that were not distributed normally . univariate and multivariate logistic regression analyses were used to identify variables associated with the recurrence of syncope during the follow - up period . we analyzed the frequency of previous syncope , the ttt phase that gave a positive result , the ttt duration until a positive result , the types of neurocardiogenic syncope , and the recurrence rate of syncope during the follow - up period . the results are expressed as the mean sd or median ( interquartile range , iqr ) for data that were not distributed normally . the mann - whitney u test and kruskal - wallis test were used for statistical analysis of data that were not distributed normally . univariate and multivariate logistic regression analyses were used to identify variables associated with the recurrence of syncope during the follow - up period . of the 665 male subjects ( mean age , 22.0 years ; range , 17 to 27 ) who underwent testing , 305 ( 45.8% ) had positive results on ttt . of the subjects with positive results , 82 were excluded because of abnormal ecgs or loss to follow - up ( fig . we followed 223 subjects ( mean age , 21.1 years ; range , 18 to 26 ) for 12 months . there were 45 ( 20.2% ) subjects with positive results during the passive phase and 178 ( 79.8% ) during the drug - provocation phase ( fig . 1 ) . there were 146 ( 65.5% ) , 39 ( 17.5% ) , and 38 ( 17.0% ) type 1 to 3 subjects , respectively . the frequency of recurrence of syncopal episodes during the follow - up period was 1.3 2.4 . no recurrences occurred in 95 of 116 subjects ( 81.9% ) with one previous syncopal episode , 36 of 54 subjects ( 66.7% ) with two or three syncopal episodes , and 25 of 53 subjects ( 47.2% ) with four or more syncopal episodes . the subjects with four or more previous syncopal episodes in their lifetime had significantly more recurrences of syncopal episodes than did those with fewer than four ( 1 , 2 - 3 , and 4 ; 0 [ iqr , 0 to 0.5 ] , 0 [ iqr , 0 to 2 ] , and 3 [ iqr , 0 to 9.5 ] , respectively ; p = 0.001 ) ( fig . the subjects with positive results during the passive phase had significantly more recurrences of syncope than did those with positive results only during the drug - provocation phase ( 1 [ iqr , 0 to 4 ] and 0 [ iqr , 0 to 1 ] , respectively ; p = 0.022 ) ( fig . ( n = 7 of 45 ) with positive results during the early passive phase ( 12 minutes ) had significantly more recurrences of syncopal episodes than did subjects ( n = 38 of 45 ) with positive results during the late passive phase ( > 12 minutes ) ( 4 [ iqr , 3 to 7 ] and 0 [ iqr , 0 to 4 ] , respectively ; p = 0.011 ) ( fig . however , there were no significant differences between the subjects with positive results during the early ( 10 minutes , n = 146 of 178 ) and late ( > 10 minutes , n = 32 of 178 ) drug - provocation phases ( 0 [ iqr , 0 to 2 ] and 0 [ iqr , 0 to 0.5 ] , respectively ; p = 0.614 ) or among the types of neurocardiogenic syncope ( types 1 to 3 ; 0 [ iqr , 0 to 1 ] , 0 [ iqr , 0 to 3 ] , and 0 [ iqr , 0 to 3 ] , respectively ; p = 0.435 ) and the recurrence of syncope . frequent previous syncopal episodes ( 4 ; p = 0.001 ) and positive results during the passive phase of ttt ( p = 0.001 ) were significantly associated with the recurrence of syncope ( table 2 ) . of the 665 male subjects ( mean age , 22.0 years ; range , 17 to 27 ) who underwent testing , 305 ( 45.8% ) had positive results on ttt . of the subjects with positive results , 82 were excluded because of abnormal ecgs or loss to follow - up ( fig . we followed 223 subjects ( mean age , 21.1 years ; range , 18 to 26 ) for 12 months . there were 45 ( 20.2% ) subjects with positive results during the passive phase and 178 ( 79.8% ) during the drug - provocation phase ( fig . 1 ) . there were 146 ( 65.5% ) , 39 ( 17.5% ) , and 38 ( 17.0% ) type 1 to 3 subjects , respectively . the frequency of recurrence of syncopal episodes during the follow - up period was 1.3 2.4 . no recurrences occurred in 95 of 116 subjects ( 81.9% ) with one previous syncopal episode , 36 of 54 subjects ( 66.7% ) with two or three syncopal episodes , and 25 of 53 subjects ( 47.2% ) with four or more syncopal episodes . the subjects with four or more previous syncopal episodes in their lifetime had significantly more recurrences of syncopal episodes than did those with fewer than four ( 1 , 2 - 3 , and 4 ; 0 [ iqr , 0 to 0.5 ] , 0 [ iqr , 0 to 2 ] , and 3 [ iqr , 0 to 9.5 ] , respectively ; p = 0.001 ) ( fig . the subjects with positive results during the passive phase had significantly more recurrences of syncope than did those with positive results only during the drug - provocation phase ( 1 [ iqr , 0 to 4 ] and 0 [ iqr , 0 to 1 ] , respectively ; p = 0.022 ) ( fig . 3 ) . the subjects ( n = 7 of 45 ) with positive results during the early passive phase ( 12 minutes ) had significantly more recurrences of syncopal episodes than did subjects ( n = 38 of 45 ) with positive results during the late passive phase ( > 12 minutes ) ( 4 [ iqr , 3 to 7 ] and 0 [ iqr , 0 to 4 ] , respectively ; p = 0.011 ) ( fig . however , there were no significant differences between the subjects with positive results during the early ( 10 minutes , n = 146 of 178 ) and late ( > 10 minutes , n = 32 of 178 ) drug - provocation phases ( 0 [ iqr , 0 to 2 ] and 0 [ iqr , 0 to 0.5 ] , respectively ; p = 0.614 ) or among the types of neurocardiogenic syncope ( types 1 to 3 ; 0 [ iqr , 0 to 1 ] , 0 [ iqr , 0 to 3 ] , and 0 [ iqr , 0 to 3 ] , respectively ; p = 0.435 ) and the recurrence of syncope . frequent previous syncopal episodes ( 4 ; p = 0.001 ) and positive results during the passive phase of ttt ( p = 0.001 ) were significantly associated with the recurrence of syncope ( table 2 ) . this prospective , observational study elucidated prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties in whom the incidence of neurocardiogenic syncope is high . we found that most subjects ( 81.9% ) with one previous syncopal episode had no recurrence and that frequent previous syncopal episodes in their lifetime ( 4 ) , a positive result during the passive phase of ttt , and positive results during the early passive phase ( 12 minutes ) were significantly related to the recurrence rate of syncope . therefore , a positive result during the early passive phase of ttt and frequent previous syncopal episodes might be prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties . in previous studies , the frequency of syncope before ttt was the most powerful predictor for recurrent syncope [ 16 - 20 ] . female gender , a history of bronchial asthma , and the number of previous syncopal episodes may predict recurrences of neurocardiogenic syncope . however , the ttt phase or period associated with positive results as prognostic factors have not been studied in males in their late teens and early twenties . neurocardiogenic syncope occurs frequently during prolonged motionless standing , and the passive phase is similar to this situation . the drug - provocation phase is performed on subjects who can tolerate the passive phase . therefore , subjects with a positive result during the passive phase would tend toward a high recurrence rate of syncope . furthermore , subjects with a positive result during the early passive phase could be more susceptible to a shorter duration of motionless standing . . the mechanisms of each type and the relationship between the type and prognosis are debatable . for patients suspected of neurocardiogenic syncope , it is important to obtain a medical history and to perform ttt . patients with positive results during the early passive phase of ttt and with more frequent episodes of previous syncope need to be followed closely and treated optimally . the follow - up period of our subjects was relatively short ; therefore , future prospective studies are needed to ascertain the recurrence of syncope in more subjects for longer periods of time at various centers . there are different ttt protocols ( e.g. , the westminster protocol using isoproterenol for the drug - provocation phase ) . a positive result during the early passive phase of ttt and frequent previous syncopal episodes are significant prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties . the follow - up period of our subjects was relatively short ; therefore , future prospective studies are needed to ascertain the recurrence of syncope in more subjects for longer periods of time at various centers . there are different ttt protocols ( e.g. , the westminster protocol using isoproterenol for the drug - provocation phase ) . a positive result during the early passive phase of ttt and frequent previous syncopal episodes are significant prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties .

background / aimsthis study elucidated the prognostic factors for neurocardiogenic syncope in males in their late teens and early twenties.methodstilt-table testing ( ttt ) was performed on 665 males ( age range , 17 to 27 years ) following the italian protocol . the subjects were tilted head - up at a 70 angle on a table for 30 minutes during the passive phase . if the passive phase was negative , the subjects were given sublingual nitroglycerin and tilted to the same angle for 20 minutes during the drug - provocation phase . the subjects with positive results were followed without medication . we analyzed factors related to the recurrence rate of syncope.resultsof 305 subjects ( 45.8% ) with positive results , 223 ( age range , 18 to 26 years ) were followed for 12 months . the frequency of previous syncopal episodes 4 ( p = 0.001 ) and a positive result during the passive phase ( p = 0.022 ) were significantly related to a high recurrence rate . a positive result during the early passive phase ( 12 minutes ) was significantly related to a higher recurrence rate than was that during the late passive phase ( > 12 minutes ; p = 0.011).conclusionsa positive result during the early passive phase of ttt and frequent previous syncopal episodes were prognostic factors for neurocardiogenic syncope in men in their late teens and early twenties .

INTRODUCTION METHODS Statistical analysis RESULTS Baseline characteristics Tilt-table test and follow-up results Factors related to the recurrence of syncope DISCUSSION Limitations Conclusions

lung burden analysis was performed on 126 autopsy cases of persons who died in new york city from 1966 through 1968 . of the 126 cases , 107 were probably non - occupationally exposed , judging by occupational history and asbestos body content of lung . fifty - three of the 107 cases contained short chrysotile fibers / fibrils , < 5 microns in length , present in 3-fold greater amounts than were found in laboratory background controls . the fiber concentrations ranged from 1.8 to 15.7 x 10(6 ) f / gm / dry lung tissue , and the proportion of fibers > or = 5 microns in length was only 0.34% of the total chrysotile population found . other inorganic particles present included fragments of amphiboles . in contrast to these data , the lung parenchyma of persons occupationally exposed to asbestos commonly showed the presence of other fiber types , especially amosite and crocidolite , at very much higher concentrations and greater fiber length . any chrysotile present would usually be in fiber bundle form , with both fibers and fibrils > 5 microns in length . comparison of the lung fiber content of occupationally exposed persons with that of the general population showed marked qualitative and quantitative differences . fibers are durable , and are retained in a range of concentrations . their length and dose , among other factors , which control their biological potential are different in the two populations ; the risk factors for chrysotile - induced disease are not the same.imagesfigure 1 . afigure 1 . bfigure 1 . c

Images

mast cells have a wide variety of functions , which not only encompass regulation of immune responses , but also autoimmunity , tolerance to graft rejection , promotion of or protection from cancer , wound healing , angiogenesis , cardiovascular diseases , diabetes mellitus , obesity , and other significant diseases . in the previous days , these cells were considered as important due to their role in ig - e driven allergic reactions . however , today the wide spectrum of properties of mast cells is well - recognized . they play an important role in the induction of angiogenesis in the early - stages of development of tumor . the association of angiogenesis and cancer has been credited to the visionary pioneer folkman ( 1933 - 2008 ) , who first stated that tumor growing was directly dependent on the blood vessel network development . experimentally induced tumors have shown mast cell accumulation close to the tumor cells before the onset of angiogenesis . on the other hand , tumors induced in mast cell - deficient mice acikalin et al . found that microvessel density ( mvd ) was a significant prognostic factor in colorectal carcinoma ( ca ) . they concluded that microvessel counts and mast cell density ( mcd ) have a significant correlation with one another , which prompted them to suggest that mast cells may play a role in promoting angiogenesis thereby assisting in tumor progression . in their study they found in their study that mvd is an important prognostic factor in case of invasive transitional cell ca of bladder . concluded that tumor neovascularization might play a vital role in the prognosis of patients with squamous cell ca of the head and neck . invasive squamous cell carcinoma ( scc ) of the cervix is the most common malignant tumor of the female genital tract in most countries , especially in developing countries like india and the most frequent neoplasm among women in many of them . this study was done to evaluate the relationship between mcd and mvd in carcinoma in situ ( cis ) , microinvasive carcinoma ( microinvasive ca ) and invasive squamous cell cervical ca . the term cis was employed when there was no differentiation at any level of the cervical squamous epithelium ( despite some occasional flattening of the surface cells ) and the basal cell was disorganized . the term cis has now been incorporated within the domain of high grade squamous intraepithelial lesion , under the bethesda classification . even though this classification was originally designed for the cytologic specimens , microscopically , three major categories of cervical scc exist : large cell nonkeratinizing , keratinizing , and small cell . this study was carried out over a period of 2 years from august , 2011 to june , 2013 , in our department . we studied 6 cases of cis , 4 cases of microinvasive scc ( microinvasive scc ) and 38 cases of invasive cervical ca ( invasive ca ) . all these tissue sections were obtained from patients who had undergone total abdominal hysterectomy with or without bilateral oopherectomy . cervical punch biopsies and cases of cervical intraepithelial neoplasia ( cin ) grades 1 and 2 were excluded from our study . the samples were fixed in 10% formalin and embedded in paraffin , according to standard procedures . 5 m thick sections were cut and mounted on glass slides . for each case , three sections were obtained : one for routine hematoxylin and eosin staining , one for toluidine blue staining and the third for immunohistochemical analysis with cd-34 . for immunohistochemistry , the sections were mounted on poly - l - lysine coated slides . the toluidine blue stain gives a light blue background to the section with mast cells appearing red - purple in color . ten hot spots ( areas with the highest mcd ) from each slide were identified . the total of the counts of the ten fields was recorded as the mast cell count per 10 hpf . however , we found that the toluidine blue staining method was simpler and it produced better results . single endothelial cell or clusters of endothelial cells positive for cd-34 were considered as a microvessel . the presence of blood cells or fibrin without any detectable endothelial cells is not sufficient to define a microvessel . three hot spots ( areas with the highest microvessel concentration ) from each slide were identified . mvd of the sample was estimated as a mean of mvd in three histological fields and it was recorded as the mvd per hpf . we studied 48 cases , of which 38 were of invasive ca , 4 of microinvasive scc and 6 of cis . the mean diameter of these tumors was 4.6 cm . among the 38 cases of invasive ca , 12 were found to be in the stage pt1b1 and 26 in the stage pt1b2 . all the 4 cases of microinvasive ca were in the stage pt1a2 . among the 38 cases of invasive cervical ca , 34 cases were of large cell nonkeratinizing type . four cases were of large cell keratinizing type [ figure 1 ] . ( a ) gross appearance of a case of invasive cervical carcinoma ; ( b ) microphotograph showing nonkeratinizing invasive squamous cell carcinoma ( scc ) of cervix , 100 ; ( c ) microphotograph showing nonkeratinizing invasive scc of cervix , 400 ; ( d ) microphotograph showing nonkeratinizing invasive scc of cervix with clear cell differentiation , 400 we found that both mcd and mvd increased from normal samples through cis to invasive cervical ca [ figures 2 and 3 ] . in the four cases of microinvasive ca , the mcd and mvd were more than that of the control samples but less than that of the six cases of cis [ table 1 ] . microphotograph showing mast cells in invasive cervical squamous cell carcinoma ; ( a ) giemsa stain , 400 ; ( b ) toluidine blue stain , 400 microphotograph showing microvessels by cd-34 staining in ( a ) control cervical tissue samples , 400 ; ( b ) microinvasive carcinoma of cervix , 400 ; ( c ) invasive cervical squamous cell carcinoma of cervix , 400 mcd and mvd in control samples , cis , microinvasive ca and invasive ca the mast cells were mostly found located at the interface between the tumor tissue and underlying stroma . statistical significance of mcd and mvd as determined by student 's t - test is shown in tables 2 and 3 . statistical significance of mcd when compared by student 's t - test statistical significance of mvd when compared by student 's t - test the presence of mast cells in tumor tissue was first reported by ehrlich in 1878 . mast cells were thought to play a pivotal role in angiogenesis due to their close association with blood vessels and lymphatic channels . these cells were also found to accumulate in substantial numbers in richly vascularized tissues such as hemangiomas , polyps , and tumors . the data on relationship between mcd and mvd in cervical cancers and pretumoral conditions are scanty . in our study , we found that both mcd and mvd increased from normal cervical samples through cis to invasive ca . but , in the four cases of microinvasive scc in our study , both mcd and mvd were higher than that of the control samples but less than that of cis . we found highest mcd ( 102/10 hpf ) in a case of large cell nonkeratinizing scc with clear cell differentiation ( stage pt1b2 ) . lowest mcd ( 20/10 hpf ) was found in two cases of large cell nonkeratinizing scc ( stage pt1b1 ) . in our study , lowest mvd ( 2/hpf ) was found in a case of large cell nonkeratinizing scc ( stage pt1b1 ) . we found highest mvd ( 35/hpf ) in another case of large cell nonkeratinizing scc ( stage pt1b2 ) . reported that the mcd remained constant through the grades 1 - 3 of cin , but it significantly increased in invasive cervical ca . they concluded that the mast cells provide an effective mechanism to create the vascularized microenvironment necessary for tumor cells to proliferate and disseminate . utrera - barillas et al . proved by their results that mast cells and macrophages are of vital importance in the development of tumor associated blood and lymphatic capillaries in cervical ca . bentez - bribiesca et al . found that the mvd in normal epithelium and in dysplasias was similar but they observed a significant increase in cis and invasive cervical ca . found an increase in mvd from the control samples through cis to microinvasive cervical ca . wilk et al . found similar increase both in mcd and mvd in their study . on the other hand , naik et al . reported that mast cells increase in inflammatory conditions of cervix , but decrease in malignant conditions . vieira et al . compared 3 endothelial markers , anticd-31 , anticd-34 and bnh9 , for evaluation of angiogenesis in cervical cancers . they concluded that anticd-34 and bnh9 have higher sensitivity than anticd-31 . in this study , anticd-34 has been used for assessment of mvd . in our study , all the 38 cases of invasive cervical ca belonged to stage pt1 . this is probably because surgical treatment or hysterectomy is considered only for early - stage cervical ca . we also noted that during our study period of 2 years , we obtained a large number of cases of invasive cervical ca ( 38 ) , compared to the number of cases of cis ( 6 ) and microinvasive ca ( 4 ) . we attributed this discrepancy with the poor socioeconomic conditions and lack of awareness among the patients of developing countries like ours . the patients fail to seek medical help at an early - stage of the disease , thus contributing to the large number of cases of invasive ca that we encountered . several studies have found a correlation between mvd and prognosis in cases of cervical cancers . our study is limited by the fact that a similar assessment could not be done , since we lost most of our patients to follow - up . randall et al . concluded in their study that mvd is an important prognostic factor in high - risk early - stage cervical cancer . independently reported in their studies that higher mvd is associated with poor overall survival rates . found similar significance of mvd and they suggested that in future , this criterion may be used for selection of patients for antiangiogenesis therapy . a correlation between mcd and tumor progression has been reported in malignancies of other organs as well . mukherjee et al . found that mcd was higher in well - differentiated gastric cancers than in control subjects . they also found that poorly - differentiated gastric cancers had lower mcd than well - differentiated ones . reported in their study that mcd is correlated with angiogenesis and progression of tumor in patients with gastric ca . elezoglu and tolunay et al . found that there is an association between mcd and mvd in colorectal ca . they reported that the grade of colorectal ca increased with the number of mast cells , while survival decreased with an increase in mcd . in our study , we found that both mcd and mvd are higher in invasive cervical ca than in cis or microinvasive scc . mast cell accumulation is related with angiogenesis in cis , microinvasive ca and invasive cervical ca . the values of mcd and mvd are higher in invasive cervical cas when compared to those in cis , microinvasive ca and control samples . therapeutic strategies against mast cell mediators or angiogenesis may be of help in control of progression of early - stage cervical ca . however , further studies with larger sample size are required before drawing any definite conclusion .

background : mast cells are involved in induction of angiogenesis in the early - stages of tumor development and in modulating blood vessel growth in the later stages of tumor progression.aims and objectives : this study was carried out to evaluate the association between mast cell density ( mcd ) and microvessel density ( mvd ) in carcinoma in situ ( cis ) , microinvasive carcinoma ( ca ) and invasive squamous cell ca of cervix.materials and methods : six cases of cis , four cases of microinvasive ca and 38 cases of invasive ca were studied over a period of 2 years from august , 2011 to june , 2013 . ten control samples were included in the study . routine histologic examination was done . toluidine blue stain was used for mcd determination . immunohistochemical analysis with cd-34 was done for assessing mvd . student 's t - test was used to calculate the statistical significance of mcd and mvd.results:both mcd and mvd increased from normal samples through cis to invasive cervical ca . in the four cases of microinvasive ca , the mcd and mvd were more than that of the control samples , but less than that of the six cases of cis.conclusion:there is a correlation between mast cell accumulation and angiogenesis in cis , microinvasive ca and invasive cervical squamous cell ca . mcd and mvd in invasive ca exceed those in cis and microinvasive ca . it gives us an opportunity to postulate that therapeutic strategies against mast cell mediators and angiogenesis may be of benefit in patients of early - stage cervical ca .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

the migration of an encircling silicone band through a rectus muscle is a rare postoperative complication associated with the scleral buckling procedure . however , both kreis et al . and tan et al . have reported cases of this rare complication . here , we describe what we believe to be the first reported case of a scleral buckling - associated encircling silicone band that migrated through the rectus muscles , despite the band being securely surgically fixed to the sclera in the scleral tunnel ; i.e. , a review of the video recording of the surgery confirmed that the encircling band had been placed under the medial rectus muscles during the scleral buckling surgery . a 58-year - old man presented with a rhegmatogenous retinal detachment in his left eye . pars plana vitrectomy with the placement of an encircling silicone band ( # 240 ; mira , inc . , waltham , ma . , usa ) the solid silicone band was placed under the four rectus muscles and surgically fixed in a scleral tunnel at all four quadrants ( fig 1 ) . the scleral tunnels were prepared by making two vertical incisions of one - half of the scleral thickness , and then performing a lamellar dissection with a surgical blade . the anterior extent of each tunnel was 2.02.5 mm posterior to the rectus muscle insertions . one year later , the patient complained of a mild foreign body sensation in his left eye . upon examination , the encircling band was found to be exposed on the nasal side of conjunctiva next to the limbus ( fig 2 ) . the patient did not report any diplopia , and the movement of the associated eye in the field of the medial rectus muscle was found to be normal . two weeks later , the encircling silicone band was surgically removed without any complications . during that surgery , it was noted that the encircling band had cheese - wired through the medial rectus muscle , which had become reattached close to its original insertion with no thinning . at the patient 's most recent follow - up , although it has been reported that a solid silicone band can cheese - wire forward through the rectus muscle postoperatively [ 3 , 4 ] , the underlying mechanism of that migration has yet to be elucidated . it has been suggested that a migration of an encircling band may occur if the band is embedded too deeply , placed anterior to the equator , and not securely anchored to the sclera . in the case shown in this present study , the encircling band was fixed in the scleral tunnel at all four quadrants . a previous study has shown that as with the use of sutures , the use of a scleral tunnel is an alternative and secure method of anchoring an encircling band . however , in the case shown in this present study , we theorize that the band migration possibly resulted from the scleral flaps being thin . an alternative explanation as to why the band migrated is that it might have been placed over the rectus muscle . however , a review of the video recording of the surgery confirmed that the encircling band had actually been placed beneath the muscle . it has been reported that migrating bands can induce ocular motility disturbances [ 3 , 4 ] . tan et al . reported a case with ocular motility disturbances in whom reattachment of the cheese - wired lateral rectus muscle was not observed . in the case shown in this present study , the cheese - wired medial rectus muscle was found to have become reattached close to its original attachment site . we theorize that this was the reason why the ocular motility in our patient was preserved . reportedly , the slow process of cheese - wiring migration through rectus muscle allows sufficient time for the muscle to reattach spontaneously behind the migrating band . in conclusion , the findings of this study show that migration of an encircling element can occur within 1-year after placement , and with subtle symptoms such as foreign body sensation . to prevent cheese - wiring migration , a scleral tunnel that is both deep and long enough to securely fix the silicone band even when an encircling silicone band is surgically secured around the eye , periodic and detailed postoperative follow - up examinations and careful surgical procedures should be performed to ensure no migration of the band .

the migration of an encircling silicone band through a rectus muscle is a rare postoperative complication associated with scleral buckling surgery for retinal detachment . in this present study , we describe what we believe to be the first reported case of a patient who experienced postoperative migration of an encircling silicone band through the rectus muscle , despite the band being surgically secured to the sclera in a scleral tunnel . a 58-year - old man presented with a rhegmatogenous retinal detachment in his left eye . pars plana vitrectomy was performed with the placement of an encircling silicone band , and the patient 's retina was successfully reattached . one year postoperatively , the encircling band became exposed on the nasal side of the conjunctiva next to the limbus without any symptoms . two weeks later , the exposed encircling band was surgically removed without any complications . the findings of this study show that even when an encircling silicone band is surgically secured around the eye , periodic and careful postoperative follow - up examinations should be performed to ensure no migration of the band .

Introduction Case Report Discussion Statement of Ethics Disclosure Statement

in the olden days , chumash saw the spirit , mind and body as inseparable entities that could not be treated separately in disease . the first steps in healing were more spiritual , which opens the mind and body to healing . the next steps in healing may have been directed more to the mind and body . in current society , diseases are considered to be the result of a problem with one component of the body . for instance , heart disease is considered a problem of high blood pressure leading to a weak heart , or atherosclerosis leading to thrombi that damage the heart . drugs are administered to control high blood pressure or to control cholesterol in order to prevent atherosclerosis and thrombosis . there is usually only a very ineffective attempt to control weight that would prevent or ameliorate heart disease . in the chumash village , the approach was very different . obesity was not tolerated , except perhaps among some chiefs ( wot in chumash , pronounced wote ) . obesity was considered a sign of laziness , an attitude that was not tolerated in a chumash village ( 1 ) . everyone knew their job and knew they were critical to the survival of the village . chumash lived along the california coast from malibu to san luis obispo and inland 50 miles or more ( 1 ) . chumash people built the missions at ventura , santa barbara , santa ynez , la purisima and san luis obispo ( 2 ) . they spoke the chumash language , a hokan language , of which there were many dialects . prayer invites god ( xoy in chumash , pronounced hoy ) to participate in the healing process . prayer came in many forms and could be as simple as the patient and healer praying together . the healer , or an elder from the village , put a small branch of dried white sage in a suitable container such as a seashell , typically an abalone shell . the white sage was ignited with fire . the smoke from white sage has a pleasant smell and is thought to help carry prayers to god ( 1 ) . the healer prayed for the health of the patient while moving the seashell to allow the smoke to touch every part of the patient 's body including the soles of the feet . the healer sometimes touched the patient 's back with an eagle or hawk wing to draw out harmful spirits ( nunasus ) . the wing was then flicked down to send the harmful spirits back into the underworld where they originated ( 4 ) . if you 're not praying , someone is not being protected. cecilia garcia ( 3 ) . . it may be appropriate to learn from chumash practices and bring prayer back into hospitals and clinics . prayer is free , comforts patients and may even decrease mortality in cardiac patients ( 5 ) . prayer is completely safe for patients in hospitals as demonstrated by numerous clinical trials ( 6 ) . since prayer has been shown to be safe for patients , prayer is not dangerous to the practice of medicine . when a boy became 8 years old it was time for him to begin the process of becoming a man ( 1 ) . the purpose of the ceremony was to assess the fitness of a boy and to prepare him for manhood by having him pass through a major challenge . the elders and the healers , ' antap in chumash ( pronounced gontop ) , of the village decided when the time was right for this to occur . sometimes teenage girls also went through this ordeal . this plant is also called california jimson weed , toloache or thorn apple and was formerly named datura meteloides . the stems and roots of the plant the preparation was placed in water tight baskets and allowed to ferment in the sun for several days . a few white sage leaves , s. apiana , were added in the final day of fermentation of the momoy . white sage was thought to enhance any medicine , since white sage purifies the mind and spirit . when the time was right , the momoy preparation was taken to the mother of an 8-year - old boy . this ordeal was meant to purify and strengthen the boy , and make him fit to become a man in the village . boys were prepared for the initiation ceremony by the ' antap and other elders , who told the boys legends about the ceremony ( 4 ) , instructed them in prayer and how to prepare for the sacred dreams that would come . momoy was a normal medicine that was used everyday in chumash villages ( 4 ) . the strong who survived , were considered worthy , or healthy enough , to become fathers and help the village continue . usually , most of the boys survived and carved soapstone spirit guides ( ' atishwun in chumash , pronounced gatteeshwun ) . the boy kept his ' atishwun for the rest of his life as his protection . boys who passed through the momoy ceremony were then mature enough to be trained to eventually take a place in the village . momoy stems and leaves contain atropine and scopolamine as well as apohyoscine , norhyoscine , meteloidine and norhyoscyamine ( 7 ) . the roots contain these compounds and ( -)-3,6-ditigloyloxytropane , 3,6-ditigloyloxytropan-7-ol , tropine , pseudotropine and 3,6-dihdroxytropane ( 7 ) . atropine and scopolamine have similar pharmacology and cause dry mouth , blurred vision , visual and auditory hallucinations , respiratory depression and death . scopolamine is erratically and slowly absorbed into the brain , taking up to 13 h to be absorbed . momoy is currently abused in the american southwest and results in many deaths and hospitalizations every year . unfortunately , the internet , popular fictional accounts and word of mouth have spread rumors that eating the seeds is safer than using the rest of the plant , since the seeds are supposed to contain less atropine and scopolamine . has resulted in many deaths ( 8) . there are three common types of deaths that occur from eating momoy ( 9 ) . the first occurs when the person panics as the auditory and visual hallucinations start . the person may drive a car into a fatal accident or have some other fatal accident , usually due to loss of vision . the second type of death occurs when a person on momoy has had a nonfatal accident and goes to the emergency room . this is usually fatal since anesthesia causes respiratory depression that is additive with the respiratory depression caused by momoy . the third type of death occurs in people who have very slow and erratic absorption of scopolamine . death occurs from d. wrightii ingestion with blood levels of as much as 47 ng ml of atropine and 21 ng ml of scopolamine . urine levels at death can be as high as 200 ng ml of atropine and 95 ng ml of scopolamine ( 3 ) . death from respiratory depression may occur as late as 13 h after the initial ingestion of momoy . some boys were initiated with red harvester ants , rather than momoy ( 3 ) . red harvester ants ( pogonomyrmex californicus , shutulhul in chumash , pronounced shuetulhul ) were once abundant in california , but are being replaced by small , aggressive argentine ants that were introduced into california several years ago . red harvester ants were used as a cure for diarrhea of all kinds ( 3 ) . they were also used to induce sacred dreams , hallucinations for the initiation of boys into manhood . the ants were administered by an ant doctor , usually a woman , who scooped the ants up on eagle down . she would then pop the live ants and eagle down into the mouth of the boy , who was instructed to swallow everything . of course , the ants stung the inside of the mouth and throat as they were swallowed . the venom of red ants contains formic acid and polypeptide kinins that induce pain , inflammation and can lower blood pressure ( 3 ) . some kinins have nicotinic cholinergic activity that may be responsible for the induction of hallucinations . there are no reports of contemporary harvester ant use in california . the safety or dangers of this process they were typically painted in black , red and white . sometimes yellow , green , this is what cecilia garcia 's grandparents taught her when they instructed her in chumash healing practices . sometimes they came from long distances , such as chemehuevi people who came to chumash pictograph sites nearly 100 miles away . a visitor to a pictograph site would sit or lie in the cave and gaze at the pictographs during the healing procedure . the purpose of the pictographs was to relax or even amuse patients and help take their minds off their problems ( fig . this type of relaxation therapy is well known to help in healing processes ( 11 ) . for instance a woman having trouble conceiving may have been shown a pictograph depicting the uterus ( fig . the ' antap may have explained that the uterus was important in conception and pregnancy . the purpose of the pictograph of the uterus was to show the woman , and her husband , a part of her body that could not otherwise be seen . phallic symbols may have served the purpose of encouraging conception , much as the uterus symbol . powder from pecking the cupules was used by pomo and perhaps also chumash , in fertility ceremonies for a woman and her husband ( 1 ) . the powder from the cupules was inserted into the wife by the husband prior to intercourse . peon is a gambling game where one player hides a stick in one of his hands . if the sun wins , it will be a very hot year and many people will die . one writer claimed that the pictographs were painted while the ' antap was under the influence of momoy ( 12 ) . this is impossible since momoy blurs the vision so much , that no one could paint a pictograph under the influence of momoy . there is a legend that an ' antap painted a pictograph that showed people with blood coming out of their mouths , reminiscent of tuberculosis ( 1 ) . this pictograph may have been painted to warn other chumash not to abandon their traditional ways , and stay away from the missions , or they would die . the painted cave near santa barbara was considered taboo by some chumash because they thought the pictographs were depictions of death ( 1 ) . there is a story of a man who went to a pictograph site ( shrine ) to pray for his daughter to get well . when the daughter died , he returned to the site and destroyed the pictographs ( 1 ) . apparently , in the olden days , some people assumed the ' antap had power over life and death , called ' ayip ( a powerful supernatural medicine , pronounced ghiyeep ) . the authors are not aware of any study that has ever shown that anyone has the power to make another sick or die from a distance . some writers have stated that the chumash people did not dare to approach pictograph sites ( 12,13 ) . the pictographs have been explained as attempts to placate an inimical universe, prevent death , drive the spanish and the mexicans away ( fig . a rebellion occurred in 1824 , where many chumash took over the mission at la purisima and fought the mexicans . this made it very clear that the chumash wanted the mexicans to go away and leave the missions to the chumash ( fig . 3 ) . it could also be that the pictographs have been over interpreted by some authors . the true intent of the ' antap or artist who painted a pictograph is not known for the majority of pictographs . pictographs may have had specific meanings or may have been painted as abstractions to relax the observer . as with all art , it is a shame that observation of these pictographs is becoming more difficult due to restricted entry into pictograph sites . it is also a shame that many of the pictographs are not being protected and are being allowed to fall off the rocks . in a chumash village , every member of the village was essential to the survival of the village . when any member of the village became sick , it was essential to the village for that person to be healed . the ' antap had to know how to heal sick people and get them back to work for the village . the ' antap knew how to heal with prayer , plants , heat therapy , healing touch ( 14 ) and by comforting . the ' antap comforted patients with many techniques including reassurance , nourishment and helping the patient find a new job in the village , if necessary . a new job would be found , for instance , for a hunter who had lost a leg and could no longer run after deer . for instance , women recently diagnosed with breast cancer may become so distraught that they suffer from other conditions . it has been shown that women with phobic anxiety suffer from more coronary heart disease than other women ( 15 ) . , a patient who lives alone may not be able to switch jobs , as dictated by a medical condition . the patient may have bills to pay that can not wait for the patient to find another job . a sick patient may quickly lose a job , since there are many other people looking for work . there is a large literature base on these subjects in other cultures ( 1618 ) . however , some of the writing about american indians has focussed on the unusual aspects of healing . drug - induced frenzies , shape shifting , removing objects from patients ' bodies without surgery and other such unusual practices are discussed in many publications . the purpose of the current work is to humanize the chumash practices and underscore the importance of learning chumash healing practices in modern medicine . this is not a new message , but must be restated in order to overcome the overstated views of some historical figures who found the chumash to be naked , uncivilized ( 2 ) and by implication insignificant with respect to learning . recent surveys indicate that up to 79% of the american population professes a belief in god ( 19 ) , 82% of american teenagers believe in god ( 20 ) and 60% of american doctors have religious beliefs ( 21 ) . however , many doctors do not participate in the spiritual health of their patients . instead this may leave the patient with the feeling that spiritual health is not important to doctors . however , it is more common to use drugs such as benzodiazepines to calm the mind . psychotherapy can be of benefit , but may not be used by patients . in the chumash village , the ' antap practiced a form of psychotherapy that was mandatory in healing . many people in our current society feel isolated and could benefit from a supportive environment . women with small social circles , as opposed to large social circles , suffer from more coronary artery disease ( 22 ) . the sky and sea are anthropomorphic whereas the earth has lines and circles , perhaps indicating villages and paths . elye wun in chumash ( pronounced ghaylyaykwune ) was fabled to drive whales onto the beach and provide food for people during the winter . ( d ) night sky is an intricate drawing of concentric designs with four direction indicators . chumash legends describe a stink beetle that sticks its head in the ground and creates a bad smell all around it . the beetle is able to ignore everyone else and drive others away with the bad smell ( 13 ) . these worlds were seen as identical mirror images of each other by the chumash ( 13 ) . ( a ) sky coyote and the sun playing peon as described in the text . the dancers hold the deer skins on sticks and move the arms as they dance ( 14 ) . chumash pictograph of a comet in february of 1824 , a comet appeared in the sky . there followed a revolt on february 24 , 1824 against the missions santa ynez and la purisima by the chumash . this revolt may have been precipitated by the flogging of an indian in the mission santa ynez ( 8) . the chumash were much aware of the night sky and may have found comets beautiful and mysterious .

this article discusses the importance of the spirit and mind in health and well - being among chumash people . prayer was the first step in healing since prayer invites the participation of god . initiation practices are discussed that encouraged young people to develop the maturity and spiritual strength to become productive members of society . pictographs were used in healing usually not only as a relaxation therapy , but also as a mode of education . a supportive environment was an important factor in chumash health care , since the support of friends helps , comforts and relieves anxiety that is detrimental to healing .

The Spirit, Mind and Body Prayer in Healing The Initiation Ceremony Red Harvestor Ants Pictographs as Healing Images The Importance of a Supportive Village Conclusions Figures and Tables

studies on quality of life ( qol ) of a population have substantially[112 ] focused on the elderly[1325 ] . research in the caribbean in particular has primarily examined qol of the elderly[141626 ] and outside of that studies have also examined a population 's wellbeing[2728 ] , qol of sickle cell patients and qol of jamaican women . scholars like gayle and chevannes , among others , have examined some aspect of the life of youths in caribbean , and in particular jamaica , but they have done so from the perspective of qualitative methodology . those who have used quantitative methodology ( i.e. , survey research ) like lipps et al . , anglin - brown et al . , having pursued a plethora of literature on qol in jamaica and wider english - speaking caribbean countries , it was realized that there is a lack of studies on the quality of life of youths in general . youths constitute a significant segment of the working age population ( i.e. , productive population people ages 15 through 60 years ) and equally important about this age cohort is the fact that it represents the future of any nation . therefore , we can not deny the importance of this age cohort to current and future development , health of the workforce and population . qol of this group must become crucial to clinicians , medical practitioners and policy makers . it is within this context that this study seeks to fill the gap in the literature firstly by examining the qol of jamaican youths and secondly by identifying factors that explain their qol . qol is widely accepted by medical researchers and clinicians as an alternative paradigm to dysfunction in the measurement of health and treatment of health - care customers ( i.e. , patients)[4041 ] . many scholars including economists such as sen[4445 ] , easterlin[56 ] , stutzer & frey , and di tella , et al . have proposed that qol ( or wellbeing ) must incorporate subjective as well as objective conditions . they contend that any construct which may be used to capture qol ( or wellbeing ) must be such that it embodies economic wellbeing ( i.e. , gross domestic product per capita growth ) and emotional reactions to events as they are a part of the whole life of an individual . this argument was also forwarded by psychologists such as diener and veenhoven , that justifies the use of happiness or self - reported overall qol to assess wellbeing[35691112 ] . in order to assess overall qol of an individual , it is argued that the best approach was to use a questionnaire that collects information on qol[14750 ] . kashdan writes that the assessment of subjective wellbeing can be addressed with a questionnaire on happiness which the aforementioned literature has outlined as the proposition of other scholars . , on the other hand , believe that qol assessment can be done by way of self - reported satisfaction with life and subjective assessment of the life by the individual . a part of this assessment was self - esteem ; self - achievement ( or actualizations ) which are embodied in abraham maslow 's 5-level hierarchy of needs . pacione opines , the simplest model states that satisfaction with life in general is a weighted sum of satisfactions with different domains or aspects of life ( for example , job satisfaction ) and that , in turn , these domain satisfactions are weighted sums of specific satisfiers and dissatisfiers a more complex formulation is the hierarchy of needs of model . cummins , on the other hand , provides a contravening argument to the view of pacione that needs must not be used as an assessment of life 's quality of an individual . he argues that the drawback to the use of needs is embedded in the fact that low degree of needs does not necessarily associate with qol . hence , cummins 's delimitations will not hold in the current study as the needs index are moderate or high evaluations . this age cohort is vulnerable to specific risk ( i.e. , high crime and victimization , high teenage pregnancy , high unemployment ) just as children ( ages 0 to 15 years ) and the elderly ( 60 years and older ) are , and a research on the qol of this age group will provide invaluable information about this group 's wellbeing status . in order to establish a model that can simultaneously examine and provide possible factors that influence qol , this study uses econometric analysis multivariate analysis which has been used by other scholars like grossman and smith & kingston ( see theoretical framework ) to do similar studies . an econometric model was developed by grossman to evaluate the wellbeing of the world 's population which is in keeping with the who 's definition of wellbeing . grossman 's model reads [ eqn ( 1 ) ] : ht = f(ht-1 , g0 , bt , mct , ed ) ( 1 ) in which the ht ( current health in time period t ) is a function of stock of health in previous period , ht-1 ; good personal health behaviours ( including exercise ) , go ; bad health behaviour ( i.e. , smoking and excessive drinking ) , bt ; use of medical care , mct ; education of each family member , ed . according to smith & kington , using ht = f ( ht-1 , pm go , bt , mcted , t , ) to conceptualize a theoretical framework for stock of health noted that health in period t , ht , is the result of health preceding this period ( ht-1 ) , medical care ( mct ) , good personal health ( go ) , the price of medical care ( pm ) , and bad health choices ( bt ) , and a vector of family education ( ed ) , and all sources of household income ( t ) . embedded in this function is the wellbeing that that individual enjoys ( or does not enjoy ) . modifications were made to the previous works in keeping with the culture , the literature and studied group . another fundamental difference between the current research and that of grossman and smith & kington is that it is area specific as it focuses primarily on youths which make up a substantial proportion of the jamaican population . for any effective health education and private care to take place , this cohort 's general health status must be explained by way of scientific inquiry . the proposed model that this research seeks to evaluate is displayed below [ eqn . ( 2 ) ] : qoli = f(rei , wi rai , ppii , ari , xi , ssi , ci , esi , tli , oi , ai , esi , i ) ( 2 ) where qoli of youths i is a function of religiosity , rei ; welfare index of youths i , wi ; race of youths i , rai ; political participation index of person i , ppii ; area of residence of youths i , ari ; gender of youths i , xi ; subjective social class of youths i , ssi ; confidence in socio - political institution index of youths i , ci ; economic situation of youths i , esi ; interpersonal trust of person i , tii ; occupation of person i , oi ; age of person i , ai ; educational level of person i , ei ; employment status of person i , esi ; and an error term , i . using empirical data qol of sample can be determined by qoli= f(rei , wi , xi , esi , i ) ( 3 ) an econometric model was developed by grossman to evaluate the wellbeing of the world 's population which is in keeping with the who 's definition of wellbeing . grossman 's model reads [ eqn ( 1 ) ] : ht = f(ht-1 , g0 , bt , mct , ed ) ( 1 ) in which the ht ( current health in time period t ) is a function of stock of health in previous period , ht-1 ; good personal health behaviours ( including exercise ) , go ; bad health behaviour ( i.e. , smoking and excessive drinking ) , bt ; use of medical care , mct ; education of each family member , ed . the grossman model encapsulates biological conditions , psychological and socioeconomic factors . according to smith & kington , using ht = f ( ht-1 , pm go , bt , mcted , t , ) to conceptualize a theoretical framework for stock of health noted that health in period t , ht , is the result of health preceding this period ( ht-1 ) , medical care ( mct ) , good personal health ( go ) , the price of medical care ( pm ) , and bad health choices ( bt ) , and a vector of family education ( ed ) , and all sources of household income ( t ) . embedded in this function is the wellbeing that that individual enjoys ( or does not enjoy ) . modifications were made to the previous works in keeping with the culture , the literature and studied group . another fundamental difference between the current research and that of grossman and smith & kington is that it is area specific as it focuses primarily on youths which make up a substantial proportion of the jamaican population . for any effective health education and private care to take place , this cohort 's general health status must be explained by way of scientific inquiry . the proposed model that this research seeks to evaluate is displayed below [ eqn . ( 2 ) ] : qoli = f(rei , wi rai , ppii , ari , xi , ssi , ci , esi , tli , oi , ai , esi , i ) ( 2 ) where qoli of youths i is a function of religiosity , rei ; welfare index of youths i , wi ; race of youths i , rai ; political participation index of person i , ppii ; area of residence of youths i , ari ; gender of youths i , xi ; subjective social class of youths i , ssi ; confidence in socio - political institution index of youths i , ci ; economic situation of youths i , esi ; interpersonal trust of person i , tii ; occupation of person i , oi ; age of person i , ai ; educational level of person i , ei ; employment status of person i , esi ; and an error term , i . using empirical data qol of sample can be determined by qoli= f(rei , wi , xi , esi , i ) ( 3 ) an econometric model was developed by grossman to evaluate the wellbeing of the world 's population which is in keeping with the who 's definition of wellbeing . grossman 's model reads [ eqn ( 1 ) ] : ht = f(ht-1 , g0 , bt , mct , ed ) ( 1 ) in which the ht ( current health in time period t ) is a function of stock of health in previous period , ht-1 ; good personal health behaviours ( including exercise ) , go ; bad health behaviour ( i.e. , smoking and excessive drinking ) , bt ; use of medical care , mct ; education of each family member , ed . the grossman model encapsulates biological conditions , psychological and socioeconomic factors . according to smith & kington , using ht = f ( ht-1 , pm go , bt , mcted , t , ) to conceptualize a theoretical framework for stock of health noted that health in period t , ht , is the result of health preceding this period ( ht-1 ) , medical care ( mct ) , good personal health ( go ) , the price of medical care ( pm ) , and bad health choices ( bt ) , and a vector of family education ( ed ) , and all sources of household income ( t ) . embedded in this function is the wellbeing that that individual enjoys ( or does not enjoy ) . modifications were made to the previous works in keeping with the culture , the literature and studied group . another fundamental difference between the current research and that of grossman and smith & kington is that it is area specific as it focuses primarily on youths which make up a substantial proportion of the jamaican population . for any effective health education and private care to take place , this cohort 's general health status must be explained by way of scientific inquiry . the proposed model that this research seeks to evaluate is displayed below [ eqn . ( 2 ) ] : qoli = f(rei , wi rai , ppii , ari , xi , ssi , ci , esi , tli , oi , ai , esi , i ) ( 2 ) where qoli of youths i is a function of religiosity , rei ; welfare index of youths i , wi ; race of youths i , rai ; political participation index of person i , ppii ; area of residence of youths i , ari ; gender of youths i , xi ; subjective social class of youths i , ssi ; confidence in socio - political institution index of youths i , ci ; economic situation of youths i , esi ; interpersonal trust of person i , tii ; occupation of person i , oi ; age of person i , ai ; educational level of person i , ei ; employment status of person i , esi ; and an error term , i . using empirical data qol of sample can be determined by qoli= f(rei , wi , xi , esi , i ) ( 3 ) during the months of july to august 2006 , the centre of leadership and governance , department of government ( clg ) , the university of the west indies , mona campus , conducted a stratified probability sample of 1,338 respondents . the sampling design used for the study was that used by the statistical institute of jamaica . the survey was the first of its kind as it collected data on jamaica 's political culture . the themes ranged from democracy , civic culture , trust and confidence , perception of wellbeing using abraham maslow 's 5-level hierarchy of needs , preference for whether the private or public sector should be solving problems in the economy , political participation and civic engagement , and finally , leadership , party , and electoral preferences . face - to - face interviews were used to collect the data on an instrument which took about 90 minutes . the instrument consisted of 166 items that were taken from latino barometer and euro barometer cross - cultural survey , the american national election studies series , the harvard / washington post leadership survey , the new zealand election surveys , the cross - cultural variations in distributive justice perception survey and the carl stone surveys . the instrument was vetted by senior scholars and researchers as well as by interviewers within the data divisions of the statistical institution of jamaica ( statin ) and social development commission ( sdc ) . after the vetting phase , the questionnaire was pretested in a number of communities across the 14 parishes of jamaica as well as among uwi faculty and the student population . modifications were made at a training symposium based on the comments of the different interviewers and remarks of trained researchers . all the interviewers employed by the clg 's team were either data collectors by statin or sdc . although the interviewers are trained data collectors , they were trained by the clg team for a 3-day period . lloyd waller ( project manager of the clg ) was assigned to travelling across the entire island as a verifier of the interviewers collection of the information from jamaicans . furthermore , a part of this study was to examine jamaicans qol , and so questions ( needs , physiological needs , social needs , self - esteem and self - actualisation ) were placed on the instrument that examined respondents perceptions on abraham maslow 's 5-level hierarchy of needs model . prior to data entry , a data template was created by senior researcher in the department of government , dr . alfred lawrence powell , who also trained and familiarized the data - entry clerks with the instrument . the data were entered by trained data - entry clerks who are employed in the department of sociology , psychology and social work . three different groups independently entered the data and these were cross - reference by paul andrew bourne , a demographer and reviewed by alfred l. powell for accuracy . both bourne and powell were responsible for the cleaning and validation process of the entered data . data were stored and retrieved in the statistical package for the social sciences ( spss 16.0 ) . the sampling error was 3% at the 95% confidence level ( i.e. , ci ) . this was done to aid the external validity of the survey , as well as to enhance the associational and inferential statistics . cronbach alpha was used to test the internal reliability of qol ( i.e. , qol ) , which was a 5-item likert scale question . descriptive statistics were used to provide background information on the sample , t - test was used to examine the association between quality of life and gender , analysis of variance ( anova ) was used to test whether a statistical correlation existed between quality of the thee age groups and logistic regression ( i.e. , enter method ) was used to establish the model . the predictive power of the model was tested using omnibus test of model , and hosmer and lemeshow was used to examine goodness of fit of the model . the correlation matrix was examined in order to ascertain whether autocorrelation ( or multi - collinearity ) existed between variables . cohen and holliday stated that correlation can be low / weak ( 0 to 0.39 ) , moderate ( 0.4 - 0.69 ) , or strong ( 0.7 - 1.0 ) . this was used in this study to exclude ( or allow ) a variable in the model . finally , wald statistics was used to determine the magnitude ( or contribution ) of each statistically significant variable in comparison with the others , and the odds ratio ( or ) for the interpretation of each significant variable . ( 3 ] was determined by those variables that were statistically significant in table 2 ( p < 0.05 ) . demographic characteristics of sample quality of life of youths by some explanatory variables . of the sampled population ( n=1,338 ) , the proportion of those respondents aged 18 to 25 years was 27% ( n=364 ) and this constitutes the sample for the current study . the overall response rate for the survey was 95.7% and that of the youths was 96.4% . the power of the study is 0.98 with an alpha of 0.05 to detect a 10% difference between people who were classified in the reference group ( i.e. , low qol ) and those in the moderate to high group . these items were safety needs , physiological needs , social needs , self - esteem and self - actualisation . using cronbach alpha for the five - item scale , reliability was 0.841 ( or = 84% ) . hence ; qoli = 1/5*ni where i is each need ( i.e. , i = 1 , 2 , 3 , 4 , 5 ) where the qol index is : 0qoli 10 . the index valuations can be interpreted as low ( where the values can be interpreted as low ( 0 to 3 ) , moderate ( 4 to 6 ) and high ( 7 to 10 ) . for the purpose of logistic regression , the dependent variable , qol , was a dummy variable where 1 = moderate to high qol , 0 = otherwise or low . welfare index , w , is the index of the extent of individual 's or government 's responsibility for particular functions within a society . the functions vary from health care , employment and retraining , adequate housing , child - care assistance , replacement income due to loss of job owing to accident , retirement income , disability assistance , and educational assistance for tertiary training . each function is on a 10-point likert scale , where 1 , the lowest , refers to this function being totally the individual 's responsibility and 10 , the highest , refers to this function being solely the government 's responsibility . hence , the welfare index is the mean summation of the 15-question , 10-point likert scale response . the minimum score is 1 and the maximum is 10 . political participation index , ppi . this is the extent of someone 's involvement in conventional ( road blocks , demonstrations , protest , riots , etc . ) or unconventional political activities ( internet blogging , etc ) . response to a question on political behaviour , such as voting , involvement in protest which is given a value of 1 and a no was given a value of 0ppi19 . religiosity denotes the frequency with which an individual attends church , mosque , or synagogue . these items were safety needs , physiological needs , social needs , self - esteem and self - actualisation . using cronbach alpha for the five - item scale , reliability was 0.841 ( or = 84% ) . hence ; qoli = 1/5*ni where i is each need ( i.e. , i = 1 , 2 , 3 , 4 , 5 ) where the qol index is : 0qoli 10 . the index valuations can be interpreted as low ( where the values can be interpreted as low ( 0 to 3 ) , moderate ( 4 to 6 ) and high ( 7 to 10 ) . for the purpose of logistic regression , the dependent variable , qol , was a dummy variable where 1 = moderate to high qol , 0 = otherwise or low . welfare index , w , is the index of the extent of individual 's or government 's responsibility for particular functions within a society . the functions vary from health care , employment and retraining , adequate housing , child - care assistance , replacement income due to loss of job owing to accident , retirement income , disability assistance , and educational assistance for tertiary training . each function is on a 10-point likert scale , where 1 , the lowest , refers to this function being totally the individual 's responsibility and 10 , the highest , refers to this function being solely the government 's responsibility . hence , the welfare index is the mean summation of the 15-question , 10-point likert scale response . the minimum score is 1 and the maximum is 10 . political participation index , ppi . this is the extent of someone 's involvement in conventional ( road blocks , demonstrations , protest , riots , etc . ) or unconventional political activities ( internet blogging , etc ) . response to a question on political behaviour , such as voting , involvement in protest which is given a value of 1 and a no was given a value of 0ppi19 . religiosity denotes the frequency with which an individual attends church , mosque , or synagogue . these items were safety needs , physiological needs , social needs , self - esteem and self - actualisation . using cronbach alpha for the five - item scale , reliability was 0.841 ( or = 84% ) . hence ; qoli = 1/5*ni where i is each need ( i.e. , i = 1 , 2 , 3 , 4 , 5 ) where the qol index is : 0qoli 10 . the index valuations can be interpreted as low ( where the values can be interpreted as low ( 0 to 3 ) , moderate ( 4 to 6 ) and high ( 7 to 10 ) . for the purpose of logistic regression , the dependent variable , qol , was a dummy variable where 1 = moderate to high qol , 0 = otherwise or low . welfare index , w , is the index of the extent of individual 's or government 's responsibility for particular functions within a society . the functions vary from health care , employment and retraining , adequate housing , child - care assistance , replacement income due to loss of job owing to accident , retirement income , disability assistance , and educational assistance for tertiary training . each function is on a 10-point likert scale , where 1 , the lowest , refers to this function being totally the individual 's responsibility and 10 , the highest , refers to this function being solely the government 's responsibility . hence , the welfare index is the mean summation of the 15-question , 10-point likert scale response . the minimum score is 1 and the maximum is 10 . political participation index , ppi . this is the extent of someone 's involvement in conventional ( road blocks , demonstrations , protest , riots , etc . ) or unconventional political activities ( internet blogging , etc ) . response to a question on political behaviour , such as voting , involvement in protest which is given a value of 1 and a no was given a value of 0ppi19 . religiosity denotes the frequency with which an individual attends church , mosque , or synagogue . table 1 examines the demographic characteristics of the sample . of the sampled population ( n=364 ) , 96.4% responded to the question of gender ( n=351 ) . of those who indicated a gender , 57.3% ( n=201 ) were females . the mean age ( sd ) of the sample was 21.6 years ( 2.3 years ) . one - half of the population had a qol of 7.2 out of a total index of 10 , with most respondents having a qol of 7.6 out of 10 . using analysis of variance ( anova ) , no statistical difference was found between the mean wellbeing of youths , other adults and the elderly . the mean ( sd ) wellbeing of youths ( n=364 , 29.9% ) was 6.9 ( 1.7 ) , for other adults ( n= 810 , 64.4% ) 6.8 ( 1.8 ) , and the elderly ( n=83 , 6.6% ) 7.0 1.7 , with f - test 3 , 1259 = 0.699 , p = 0.552 . table 2 presents a logistic regression of social and political variables on qol of youths in jamaica . the final model [ eqn ( 3 ) ] explained 20% of the variance in qol of respondents who were youths . four variables account for the qol of youths , and these factors are religiosity , extent of the welfare index , gender , and economic situation of the youths parents . table 1 examines the demographic characteristics of the sample . of the sampled population ( n=364 ) , 96.4% responded to the question of gender ( n=351 ) . of those who indicated a gender , 57.3% ( n=201 ) were females . the mean age ( sd ) of the sample was 21.6 years ( 2.3 years ) . one - half of the population had a qol of 7.2 out of a total index of 10 , with most respondents having a qol of 7.6 out of 10 . using analysis of variance ( anova ) , no statistical difference was found between the mean wellbeing of youths , other adults and the elderly . the mean ( sd ) wellbeing of youths ( n=364 , 29.9% ) was 6.9 ( 1.7 ) , for other adults ( n= 810 , 64.4% ) 6.8 ( 1.8 ) , and the elderly ( n=83 , 6.6% ) 7.0 1.7 , with f - test 3 , 1259 = 0.699 , p = 0.552 . table 2 presents a logistic regression of social and political variables on qol of youths in jamaica . the final model [ eqn ( 3 ) ] explained 20% of the variance in qol of respondents who were youths . four variables account for the qol of youths , and these factors are religiosity , extent of the welfare index , gender , and economic situation of the youths parents . table 1 examines the demographic characteristics of the sample . of the sampled population ( n=364 ) , 96.4% responded to the question of gender ( n=351 ) . of those who indicated a gender , 57.3% ( n=201 ) were females . the mean age ( sd ) of the sample was 21.6 years ( 2.3 years ) . one - half of the population had a qol of 7.2 out of a total index of 10 , with most respondents having a qol of 7.6 out of 10 . using analysis of variance ( anova ) , no statistical difference was found between the mean wellbeing of youths , other adults and the elderly . the mean ( sd ) wellbeing of youths ( n=364 , 29.9% ) was 6.9 ( 1.7 ) , for other adults ( n= 810 , 64.4% ) 6.8 ( 1.8 ) , and the elderly ( n=83 , 6.6% ) 7.0 1.7 , with f - test 3 , 1259 = 0.699 , p = 0.552 . table 2 presents a logistic regression of social and political variables on qol of youths in jamaica . the final model [ eqn ( 3 ) ] explained 20% of the variance in qol of respondents who were youths . four variables account for the qol of youths , and these factors are religiosity , extent of the welfare index , gender , and economic situation of the youths parents . studies in the literature have shown that age , education , race , social class , employment , and occupation are statistically associated with qol [ 56 , 8 , 10 , 12 ] . however , some of the aforementioned factors are not statistically significant in determining qol of youths , although this is well - established in other cohorts . one - quarter of youths are below the age of 20 years and may still be residing with parents , which can indicate the reliance on parental or family support . some of the important findings that emerged from the current research are the role of parents economic situation on qol of youths , the importance of moderate religiosity , and the significance of the nation 's social security programmes on youths wellbeing . embedded in those findings are the capacities of parents and the nation to provide for this age cohort of jamaicans as well as the positive attributes of religiosity on wellbeing . it follows that a slowing of economic growth and development of the nation will impact not only the ability and capacity of the nation , but also the likelihood of youths becoming increasingly involved in criminality to subsidise for the state 's lowering of social assistance to this age cohort . religion is seen as the opiate of the people from karl marx 's perspective , but theologians hypothesised that religion is a coping mechanism against unhappiness and stress . according to kart , religious guidelines aid wellbeing through restrictive behavioural habits which are health risks such as smoking , drinking of alcohol , and even diet . scholars found that the relationship was even stronger for men than for women , and that this association was influenced by denominational affiliation . 's study found that blood pressure for highly religious male heads of household in evan county was low . the findings of this research did not dissipate when checked for age , obesity , cigarette smoking , and socioeconomic status . a study on the mormons in utah revealed that cancer rates were lower ( by 80% ) for those who adhered to church doctrine than for those with weaker adherence . in a study of 147 volunteer australian males between 18 and 83 years old , a study by jurkovic & walker found that the stress levels of non - religious were higher than those of religious men . the researchers in constructing a contextual literature quoted many studies that made a link between non - spirituality and dryness , which results in suicide . even though jurkovic & walker 's research was primarily on spiritual wellbeing , it provides a platform that can be used in understanding linkages between psychological status of people and their general wellbeing . in a study which looked at young adult women edmondson et al . did a study of 42 female college students of which 78.8 percent were caucasian , 13.5 percent african - american , 5.8 percent asian and 92 percent were non - smokers in which they established an association between spirituality and wellbeing of female caucasians and african - americans . in examining the limitation of this study , this research , which is a cross - sectional study , can not be used the same way as an experimental design , which is to establish causality . in addition , based on some of the findings presented in this study , questions have emerged that must be addressed ( such as , why male youths have higher qol than female youths ) , but the current study will not be able to provide all of the answers to those questions . hence , the researcher recommends that an ethnographic methodology be utilised to unearth the cultural underpinnings that will explain everything further . qol of jamaican youths is substantially determined by the household economic situation , religiosity and the perceived reported extent of welfare state . the study revealed that a youth who had moderate religiosity was 4 times more likely to have a greater qol with reference to one who reported low religiosity . whereas a youth who reported high religiosity is 3 times more likely to report a greater qol with reference to a youth who reported low religiosity . the current work has offered us an understanding of possible causal factor of qol of youths , but this must be further studied using longitudinal study in order to establish with finality the causal explanatory factors of qol .

background : studies on quality of life ( qol ) on youths are limited and have not examined determinants of qol for this cohort.aims:the current study seeks to examine the qol of jamaican youths and to build a model that identifies factors that explain qol.materials and method : during the period june to august 2006 , the centre of leadership and governance , department of government , at the university of the west indies , mona campus , conducted a stratified random probability survey of 1,338 respondents . data were collected using a 166-item questionnaire . of the sampled population ( n=1,338 ) , the proportion of those respondents age 18 to 25 years was 27% ( n=364 ) and this constitutes the sample for the current study . the data were stored and retrieved in the statistical package for the social sciences ( spss 12 ) . descriptive statistics were used to analyse the data , and logistic regression was used to establish the model.results:the quality of life of jamaican youths was determined by 4 factors which explain 20% of the variability in quality of life . the parents economic wellbeing has the most influence on the quality of life of jamaican youths ( or=1.348 ; 95% ci : 1.35 , 3.04 ) , followed by moderate religiosity ( or=3.594 ; 95% ci : 1.47 , 8.82 ) , the extent of the welfarism of the state ( or=5.273 ; 95% ci : 1.04 , 1.69 ) and gender ( or = 1.329 , 95% ci = 1.04 , 1.69).conclusion : the current work has offered us an understanding of the determinants of qol of youths and how interventions can be planned for in the future .

Introduction None Theoretical Framework Materials and Methods None Measurement Results None Demographic characteristics of sample Multivariate Analysis Discussion Conclusion

over the last few decades , a significant decline in cancer - related mortality of colorectal cancer ( crc ) has been observed due to the considerable progress in the diagnosis and treatment , but crc still remains a major public health problem throughout the world . colorectal cancer is ranked second within cancer - related deaths in the united states [ 1 , 2 ] and the fourth in china . therefore , finding new molecular biomarkers is necessary to improve the prognosis of crc , as well as to create new treatment strategies and improve clinical outcome . the wnt and notch signaling pathways have been shown to play a major role in intestinal morphogenesis and homeostasis [ 47 ] . the wnt signaling pathway primarily regulates the self - renewal of the intestinal epithelium , and a high incidence of gastrointestinal malignancies might be induced by deregulation of this self - renewal processes . moreover , several members of the wnt signaling pathway , either tumor suppressors apc and axin2 or oncogene -catenin and lymphoid enhancer factor-1 ( lef1 ) , are often aberrantly activated in crc development . the inappropriate activation of the wnt signaling pathway and the subsequent formation of nuclear lef / tcf/-catenin complexes lead to uncontrolled downstream target gene activation and ultimately result in the malignant transformation of cells . in addition , transcription factor lef1 is a potential candidate biomarker for crc since it serves as a key role in the regulation of many important cellular functions , including proliferation , growth , survival , mobility , and angiogenesis . the notch signaling pathway maintains the balance between cell proliferation , differentiation , and apoptosis . furthermore , it has been reported that the notch signaling pathway promotes cell survival , angiogenesis , and resistance to therapy in many different tumors . the aberrant activation of notch signaling has been associated with tumorigenesis ; however , the exact function of notch signaling in tumor development and progression remains unknown . studies suggest that notch signaling could be either oncogenic or antiproliferative depending upon the context of its activation . in addition , both the wnt and notch signaling pathways have been reported to be useful therapeutic targets in several noncolorectal tumors [ 19 , 20 ] . based on these findings , the wnt and notch signaling pathways have been established as important key mediators of intestinal tumorigenesis . nevertheless , the relationship between the combination of lef1 status and notch2 status and their prognostic relevance in crc has yet to be established . therefore , the aim of this study was to examine the potential crosstalk between these two pathways and their possible synergistic effects in tumorigenesis . we have evaluated the significance of lef1 expression and notch2 expression and their crosstalk in crc . in addition , we have examined the association of these two potential biomarkers with the clinicopathologic characteristics and survival of patients . tissue collection was compliant with the agreement of the conduct of human ethics committee of the first affiliated hospital , college of medicine of xi'an jiaotong university . written informed consent was obtained from each patient . one - hundred and eighty - four patients with colorectal cancer who underwent curative surgery without chemotherapy and/or radiotherapy treatment at the first affiliated hospital , college of medicine of xi'an jiaotong university from 2007 to 2008 were enrolled in this study . the study included 104 men and 80 women aged between 30 and 78 years ( mean , 54 years ) . in addition to tumor tissue , 184 samples of matched paratumorous normal colorectal tissue ( at 5 cm distance from the tumor ) were taken from the same patients . the pathological types of all the specimens were confirmed by two independent pathologists under double - blinded conditions . tumors were classified according to the criteria from the tnm union for international cancer control ( uicc ) , while tumor cellular differentiation ( tcd ) was defined by edmondson 's classification . , cases were regarded as censored data when patients were either lost to followup or died of causes other than crc . formalin fixed paraffin - embedded sections were deparaffinized , rehydrated , and incubated with 3% hydrogen peroxidase . next , the sections were heated in a microwave oven for 3 min at 100c for antigen retrieval . slides were then incubated with blocking serum and primary antibodies for lef1 ( 1 : 100 , c12a5 ; cell signaling technology , danvers , ma ) and notch2 ( 1 : 200 , d76a6 ; cell signaling technology , danvers , ma ) , overnight at 4c . the immunohistochemical reaction was visualized with 0.05% 3,3-diaminobenzidine tetrahydrochloride ( dab ) followed by a counterstaining with hematoxylin . finally , the sections were examined and analyzed using a microscope ( q550cw ; leica , manheim , germany ) . for the negative controls , immunostaining was defined independently by two pathologists blinded to the clinical data and scored by multiplying the intensity of staining and the percentage of the stained tumor cells . the intensity of staining was graded as follows : 0 ( colorless ) , 1 ( pallide - flavens ) , 2 ( yellow ) , and 3 ( brown ) . the percentage of the stained tumor cells was graded as 0 ( < 5% ) , 1 ( 5%25% ) , 2 ( 26%50% ) , 3 ( 51%75% ) and 4 ( > 75% ) . a score of 0 was defined as negative expression , scores 14 as weak expression , scores 58 as moderate expression , and scores 912 as strong expression . for the purpose of further analysis , the samples with score 04 were defined as low expression , while the samples with scores 512 were grouped and defined as high expression . few specimens with inconsistent score were re - evaluated again by two pathologists until the agreement was reached . the total mrna was extracted from fresh tissue samples with trizol reagent according to the manufacturer 's instruction ( invitrogen , carlsbad , ca ) . less than 500 ng of total rna were used for complementary dna synthesis with an sybr exscript rt - pcr kit ( takara , dalian , china ) . the reaction was performed using the iq5 multicolour real - time pcr detection system ( bio - rad , hercules , ca ) and sybr premix ex taq tm ii ( takara ) . the primer sequences used for lef1 and notch2 analysis were as follows : lef1 forward 5-agcgaatgtcgttgctgagtgta-3 , reverse 5-ctcttgcagaccagcctggataa-3 , notch2 forward 5-ctacagttgtcgctgcttgc-3 , reverse 5-gttggagaggcactcgttga-3 , respectively . gapdh was used as the internal housekeeping gene control , and the primer sequences were as follows : glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) forward 5-atggggaaggtgaaggtcg-3 , reverse 5-gggtcattgatggcaacaatatc-3. for each real - time rt - pcr reaction , a dissociation curve analysis was performed with each reaction in triplicate . the ct values were determined by subtracting the average internal housekeeping gene ct value from the average target gene ct value . since the amplification efficiency of the target genes and internal control gene was equal , the relative gene expression in the crc tissues compared with paratumorous normal colorectal tissues was calculated using the 2 method , where ct = ct ( cancer tissue ) ct ( paratumorous normal tissue ) . the tissue samples used in western blot analysis were lysed with cell lysis buffer as previously described . equal amounts of protein were separated by 6%~12% sds - page and were electroblotted onto polyvinylidene difluoride membranes ( millipore , danvers , ma ) , which were blocked with 5% blocking buffer and subsequently incubated with the following primary antibodies : anti - lef1 antibody ( 1 : 800 , c12a5 ; cell signaling technology , danvers , ma , usa ) , anti - notch2 ( 1 : 800 , d76a6 ; cell signaling technology , danvers , ma , usa ) , and anti--actin antibody ( 1 : 1000 , sc-130301 ; santa cruz biotechnology , santa cruz , ca , usa ) . then , the membranes were incubated with a horseradish peroxidase - conjugated secondary antibody ( santa cruz biotechnology , santa cruz , ca , usa ) , and the blots were visualized using an ecl detection system ( millipore , danvers , ma , usa ) . qualitative analysis was used to define the negative expression ( protein band , absent ) or positive expression ( protein band , present ) . the associations between the lef1 expression and notch2 expression and each clinicopathologic parameter were examined using either the test or fisher 's exact test ( two sided ) . student 's t - tests ( independent samples t - test ) or a u - test were adopted to determine the difference between two sample means . one - way analysis of variance ( anova ) was used to assess the difference among three or four sample means , and spearman 's rank test was used to assess the correlation between lef1 expression and notch2 expression . the survival rates were assessed by the kaplan - meier method and compared using the log - rank test . multivariate analysis , using the cox proportional hazards regression model , was performed to assess the prognostic value of the marker expression and clinicopathologic factors . we have examined the lef1 expression in 184 primary crc tissues and paired paratumorous normal colorectal tissues . among these 184 primary crc tissues , 126 ( 68.5% ) cases showed high lef1 expression , while only 40 ( 21.7% ) cases in matched paratumorous normal colorectal tissues . the results of immunohistochemical analysis showed that lef1 expression was significantly higher in crc tissue than lef1 expression in the paratumorous normal colorectal tissue ( p < 0.001 ) . in addition , significant differences in lef1 expression in tumor tissue were observed between tumors with node metastasis , distant metastasis and different tnm stages ( p = 0.001 , < 0.001 , < 0.001 , resp . ) there was no significant association observed between the lef1 expression and age , gender of patients , tumor location , or histology ( table 1 ) . in addition to immunohistochemical analysis , real - time pcr analysis was used to assess the lef1 mrna expression in 184 pairs of crc tissues and paratumorous normal colorectal tissues . our results showed that lef1 mrna was significantly increased in most crc tissues compared with the paratumorous normal colorectal tissues ( p < 0.001 ) , and the association between lef1 mrna expression and clinicopathologic factors was in accordance with the results of the immunohistochemical analysis ( table 2 ) . in addition , western blot was used to confirm these results in the examined 184 paired tumor and corresponding normal tissues . the rate of positive lef1 expression was 64.1% ( 118 out of 184 ) in crc tissues and 20.1% ( 37 out of 184 ) in the matched paratumorous normal colorectal tissues . lef1 positive expression was significantly higher in crc tissues than that in the matched paratumorous normal colorectal tissues ( p < 0.01 ) ( figures 2(a ) and 2(c ) ) . as shown in table 1 , only 64 out of 184 ( 34.8% ) analyzed cancer tissues showed high notch2 protein expression . in contrast , high notch2 expression was detected in 142 ( 77.2% ) out of 184 of paratumorous normal colorectal tissues , and notch2 protein expression was observed in the membrane and/or cytoplasm of tissue cells ( figure 1(b ) ) . in our study , low notch2 expression was strongly correlated with poor differentiation status , node metastasis , distant metastasis , and tnm stage ( p < 0.001 , resp . ) ( table 1 ) . in addition , notch2 mrna levels were significantly decreased in most crc tissues compared with paratumorous normal colorectal tissues ( p < 0.001 ) ( table 2 ) . in western blot analysis , positive notch2 expression was detected in only 40 out of 184 ( 21.7% ) analyzed cancer tissues compared with 73.9% ( 136 out of 184 ) in paratumorous normal colorectal tissues . notch2 positive expression was significantly lower in cancer tissues than that in matched paratumorous normal colorectal tissue ( p < 0.01 ) ( figures 2(b ) and 2(c ) ) . furthermore , notch2 mrna expression was decreased in samples from patients with less differentiated tumors , node metastasis , distant metastasis , and of an advanced tnm stage ( p < 0.05 ) ( table 2 ) , consistent with the results from immunohistochemical analysis . we analyzed the correlation between lef1 expression and notch2 expression in crc at the protein level and mrna level . among the 184 analyzed crc samples , 58 ( 31.5% ) were lef1-low whereas 126 ( 68.5% ) were lef1-high tumors . in notch2 immunohistochemical analysis , 120 ( 65.2% ) tumors were found to be notch2 low , whereas 64 ( 34.8% ) were found to be notch2 high ( table 1 ) . a significant negative correlation between the lef1 expression and notch2 protein expression in the crc samples was observed ( r = 0.315 , p < 0.001 , spearman 's rank test ) ( figure 3 ) . when analyzing western blot data , we found a negative correlation between the lef1 expression and notch2 expression in the crc tissues ( r = 0.430 , p < 0.001 , spearman 's rank test ) . a similar correlation between the lef1 and notch2 mrna expression in the crc samples was also observed ( r = 0.571 , p < 0.001 , spearman 's rank test ) . all 184 patients were included in the survival analysis ( with followup period of 5 years ) to assess lef1 expression and notch2 expression as potential prognostic factors in crc . the survival time of patients included in this study ranged from less than four months to more than 60 months , and the median survival time was 51 months . the analysis of prognostic factors for survival is summarized in table 3 . in order to assess the prognostic significance of the lef1 and notch2 protein expression , kaplan - meier survival curves were established ( figures 4(a ) and 4(b ) ) , and the results of the log - rank tests for the clinicopathologic factors and lef1 protein expression and notch2 expression in crc patients are summarized in table 3 . in the univariate analysis , a statistically significant association with shorter survival time was observed for patients with poor tumor differentiation status , advanced tnm stage of tumors , and the combination of increased lef1 coexpression and decreased notch2 coexpression ( p < 0.05 ) . the high lef1 protein expression [ exp(b ) , 2.31 ; 95% ci , 1.154.64 ; p = 0.016 ] and low notch2 protein expression [ exp(b ) , 2.26 ; 95% ci , 1.154.43 ; p = 0.017 ] were also proved to be associated with shorter survival and higher risk of death in patients with crc . however , gender ( p = 0.909 ) , age ( p = 0.698 ) or tumor location ( p = 0.644 ; p = 0.587 ) had no prognostic value on survival of patients with crc . in multivariate analysis , the cox proportional hazards model was adjusted for gender , age , differentiation status , tnm stage , and lef1 expression and notch2 expression . as a result , lef1 and notch2 protein levels proved to be independent predictors of survival for patients with crc , indicating that patients with a high lef1 expression and low notch2 expression had a higher risk of death than those with lef1 ( low)/notch2 ( high ) tumors . moreover , tnm stage and the combination of increased lef1 coexpression and decreased notch2 coexpression also proved to be prognostic factor for crc patients ( p < 0.05 ) ( table 3 ) . there was no significant association found with the overall survival for other analyzed clinicopathologic factors . the present results showed that lef1 expression was higher in crc tissues compared to the corresponding paratumorous normal tissue , whereas notch2 expression was lower in the tumor tissue than in the matching normal colorectal tissue . these results indicated that lef1 and notch2 might present an opposite function during the development of crc . in addition , the spearman 's rank test showed that there was a significant negative correlation between lef1 expression and notch2 expression in these tumors . in order to estimate the prognostic significance of the combined lef1 and notch2 expression profile and to detect the lef1 expression and notch2 expression associations with overall survival , we have reclassified patients into the following four groups : lef1 ( low)/notch2 ( high ) ( n = 33 ) , lef1 ( high)/notch2 ( high ) ( n = 31 ) , lef1 ( low)/notch2 ( low ) ( n = 25 ) , and lef1 ( high)/notch2 ( low ) ( n = 95 ) . the subgroup analysis showed that patients with an lef1 high expression and notch2 low expression had a shorter overall survival time than all other combined status patients ( figures 4(c ) and 4(d ) ) . multivariate analysis revealed that patients with high lef1 expression and low notch2 expression tumors had a significantly worse overall survival compared with patients of other combined lef1/notch2 expression groups ( table 3 ) . in this study , we aimed to examine the expression of lef1 and notch2 in crc and their association with clinicopathologic variables and crc patients ' overall survival ; therefore , an appropriate ihc scoring system and statistical method were very important for our study . we semiquantified the ihc staining for lef1 and notch2 ranging from 0 to 12 , then classified score 04 as low expression and 512 as high expression and used these re - converted enumeration data for statistical analyses . we thought that the enumeration data were more suitable for the comparison between kinds of groups , especially for statistical analysis with respect to overall survival . there are several similar literature reports which use the evaluation of the converted ihc staining results before starting the statistical analysis , compared with the use of final score [ 2426 ] . our results indicate that lef1 mrna and protein expression were increased in crc tissue and were correlated with the node metastasis , distant metastasis and the tnm stage of tumors . most importantly , a statistically significant relation was observed between the lef1 protein expression and patients ' survival , and those whose tumors were high lef1 expression had a shorter survival time . , higher lef1 expression was associated with longer patient survival time . in the study of chu et al . , low notch2 expression was associated with unfavorable clinicopathologic features and a poor prognosis of crc patients , consistent with our data . the significantly different outcomes between patients expressing high and low levels of lef1 and notch2 suggested that lef1 and notch2 may be used to predict the clinical outcome . these findings are valuable in the providing potential therapeutic targets for the future treatment of crc . it has been shown that lef1 is critical for the adhesion and/or migration of tumor cells , indicating that lef1 is probably involved in tumor invasion and metastasis . lef1 protein belongs to a high mobility group ( hmg ) family , which has been implicated in dna binding [ 30 , 31 ] . in addition , it plays a pivotal role in carcinogenesis and the progression of crc partly due to its involvement in the lef1/-catenin complex , a crucial effector of the wnt signaling pathway . our study established that increased lef1 expression was correlated with node metastasis , distant metastasis , and the advanced tnm stage of tumors . these results have proven that lef1 is involved in the invasion and metastasis of crc , consistent with some early findings of other authors [ 3234 ] . the notch signaling pathway plays an essential role in the differentiation of the gastrointestinal tract [ 6 , 35 , 36 ] and can either have oncogenic or tumor suppressor functions in different cancers . notch2 is one of the notch receptors , which interacts with the dsl ( delta / serrate / lag-2 ) family of ligands to regulate the cell differentiation . notch2 has the highest homology with notch1 , but unlike notch1 , it can present a tumor - suppressive action in breast cancer [ 38 , 39 ] . it has recently been reported that notch2 is a novel target for -catenin - dependent wnt signaling . in our study , low notch2 mrna and protein expression correlated with poor differentiation status , node metastasis , distant metastasis , and the advanced tnm stage in crc therefore , a loss of notch2 is a general feature during crc progression , indicating a potentially conflicting role of lef1 and notch2 in this type of cancer . it is known that alterations in the wnt and notch signaling pathways play a significant role in numerous cancers . studies have shown that these two pathways are aberrantly activated in crc [ 21 , 28 , 29 ] ; however , the possible crosstalk between these two pathways in cancer development is unknown . although an increasing body of evidence indicates that wnt and notch pathways crosstalk and transactivate each other in the normal tissue development as well as in cancer , such as in the survival of murine t - cell lymphomas , the mechanism by which wnt pathway transactivates notch pathway has not yet been fully determined . therefore , further studies are necessary to disclose the possible convergent points of these two pathways in order to completely understand the relationship between the wnt and notch pathways in tumorigenesis . in our study , we have examined the lef1 and notch2 mrna and protein expression levels in a collection of 184 crc patients stratified according to their outcomes . we showed the first , direct evidence of a negative correlation between lef1 expression and notch2 expression , as well as a high lef1 expression and low notch2 expression in relation with malignant crc transformation . high lef1 protein expression and low notch2 protein expression indicated a poorer prognosis in crc . in viewing these results , it is understood that lef1 has an oncogenic and notch2 a tumor suppressor role during the development of crc , consistent with the results of previous studies [ 4244 ] . the possible reason for the functional diversity of lef1 and notch2 might be in the regulation of different upstream proteins . have reported increased notch2 promoter activity upon the cotransfection of colon cancer cells with high expression recombinant lef1 . based on these findings , we assumed that lef1 either directly regulates notch2 or another protein acting as a bridge , which then activates lef1 and inhibits notch2 activity . nevertheless , the exact molecular mechanism of these processes will need to be determined in future studies . we further examined whether the expression of lef1 and notch2 was associated with the survival of crc patients . although both lef1 and notch2 protein expression were independent prognostic factors , they had completely opposite effects on survival . patients with a high lef1 protein expression had a worse outcome prognosis than those with a low lef1 expression , consistent with the oncogenic role of lef1 . we have also investigated the protein expression pattern of notch2 and opposite to lef1 findings , patients with a loss of notch2 expression had a higher risk of death than those with a higher notch2 expression . based on our results , it seems that either low lef1 expression or high notch2 expression might be predictors of good survival outcomes in crc patients . furthermore , we showed that the abnormal coexpression of lef1/notch2 was a more efficient predictor than any lef1 expression or notch2 expression when separately analyzed . the abnormal coexpression of lef1 ( high)/notch2 ( low ) was correlated with the advanced tnm stage of tumors . also , a worse disease outcome and an extremely poor survival rate were observed in patients with lef ( high)/notch2 ( low ) tumors when compared to patients whose tumors showed either lef1 high expression or notch2 low expression . these findings imply that a combination of lef1 expression and notch2 expression could be an effective molecular prognostic marker in crc . to our knowledge , this is the first study to demonstrate these findings . in conclusion , we have shown the possible coregulation of wnt and notch signaling pathways through the association of lef1 expression and notch2 expression with some of the crc clinical characteristics and their opposite prognostic roles in crc . this combined status could potentially be used as an even more efficient prognostic predictor in crc patients . based on our results , we conclude that lef1 and notch2 play key roles in crc tumorigenesis and could potentially represent new targets for the design of new antitumor therapies .

background / objective . we aimed to examine the expression of lymphoid enhancer factor 1 ( lef1 ) and notch2 in colorectal cancer ( crc ) and their association with clinicopathologic variables and crc patients ' prognosis . methods . immunohistochemistry , quantitative real - time polymerase chain reaction ( qrt - pcr ) , and western blot analysis were performed to assess the expression of lef1 and notch2 in 184 patients with crc . results . we observed a strong negative correlation between lef1 expression and notch2 expression ( p < 0.001 ) . both lef1 mrna and protein expression increased while the notch2 mrna and protein expression decreased in tumor specimens compared with the matched paratumorous normal tissue ( p < 0.001 ) . an increase in lef1 protein expression was significantly associated with lymph node metastases , distant metastasis , advanced tnm ( tumor - node - metastasis ) stage , and shorter overall survival . a decrease in notch2 protein expression was associated with poorly differentiated tumors , lymph node metastases , distant metastasis , advanced tnm stage , and shorter overall survival of patients . in the multivariate cox regression analysis , the lef1 protein expression ( p < 0.001 ) , notch2 protein expression ( p < 0.001 ) , tnm stage ( p < 0.001 ) , and the combination of increased lef1 protein coexpression and decreased notch2 protein coexpression ( p < 0.001 ) were found to be independent prognostic indicators in crc . conclusion . our results suggest that increased lef1 coexpression and decreased notch2 coexpression represent a risk factor for poor overall survival of crc patients .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the temporomandibular joint ( tmj ) is the most regularly used joint in the human body . it opens and closes about 1500 to 2000 times a day and is instrumental in several functional movements such as chewing , breathing and pronunciation.1 because the tmj is a very regularly used joint , its bone , muscle or cartilage may deteriorate over time , leading to disorders of the tmj . temporomandibular disorder ( tmd ) may lead to adaptations in certain body structures to minimize a patient s pain or discomfort , and also to reconfigure musculoskeletal stress zones . these adaptations often lead to deviations in normal body posture , which includes changes in the longitudinal plantar arches.2 epidemiological studies of tmd show that 5 to 6% of the world population will suffer a painful experience involving the tmj at some point during their life,3 and that around 8.5 million brazilians will require some kind of intervention for tmd.4 the biomechanical complexity of body posture derives from the functional integration of several body segments : when there is a change in any biomechanical subunit , a refinement of the postural control systems will necessarily occur.5,6 the muscle groups of the stomatognathic system belong to the cervical muscular chain . considering that the musculoskeletal system is composed of several such muscular chains that are integrated with one another , any disturbance of a body segment will lead to a reorganization of other segments.7,8 this fine tuning of posture control leads to body segment adaptation and realignment , whether physically near to or distant from the tmj.2,5,8,9 deviations in the lower limbs can interfere with postural organization and may even impact head and neck posture.7 valentino et al.10 have shown that the simulation of a flat foot results in increased muscular activity of the masseter and temporal muscles . when a concave foot was simulated , this activity reduced . alteration of the longitudinal plantar arches stimulates mechanoreceptor neurons , and this readjusts head position and body center of gravity . these data reinforce the theory that a deviation in one joint unit can lead to compensation in other joints and , therefore , to an alteration of whole - body posture.2,59 it is important to establish a clear relationship between poorly aligned body posture and the incidence of tmd in order to clarify if the best physical therapy treatment for tmd patients should include body posture realignment . our goal is to minimize symptomatology and to de - emphasize postural deviations that may lead to bone and muscle system imbalance.9 , 1114 although there exist certain studies1518 that have attempted to find a relationship between postural alterations in tmd patients , these studies did not select patients according to their specific diagnoses . furthermore , to date , there have been no studies that investigate this relationship in a group of tmd patients composed only of women diagnosed with anterior disc displacement . also , body deviation studies have focused only on the upper quarter of the body and have not investigated foot alignment . in one study10 that involved the foot , postural deviation was only simulated . consequently , the researchers did not adequately represent real - world postural foot deviations , and the presence of head and neck postural problems was not assessed . in the same way , other studies3,11 did not investigate pain in parts of the body other than in the upper quarter . the aim of this paper was to evaluate and describe the most common tmd diagnosed at the occlusion and tmj service ( soa ) of the faculty of dentistry of the university of so paulo ( fousp ) anterior disc displacement and the associated postural deviations as they relate to the plantar arches , lower limbs , shoulder and pelvic girdle , vertebral spine , head and mandibles . we also aimed to identify common signs and symptoms across the entire body , through our observations of a group of women between 20 and 30 years of age , all of whom had been diagnosed with anterior disc displacement . our study involved 26 volunteer women distributed across two groups : a disc displacement group ( ddg ) and a control group ( cg ) . the choice of involved subjects was based on epidemiological research that showed women from 15 to 40 years of age are most often affected by tmd.1920 the control group consisted of 16 female volunteers without a clinical diagnosis of disc displacement , aged 24.4 2.8 yr and of body mass 56.2 7.9 kg . they were matched for age and weight with a disc displacement group , consisting of 10 female patients 20 to 30 years of age ( 24.5 3.0 yr , 55.5 7.4 kg ) who had been diagnosed with unilateral tmj disc displacement and had presented symptoms for 40.4 41.5 months prior to the start of our trial . the patients disorders were clinically diagnosed by postgraduate students from occlusion and tmj service ( soa ) of faculty of dentistry of university of so paulo ( fousp ) . exclusion criteria were : any trauma history , anatomical deformities and skeletal system fractures , hormonal alterations , orthopedic or rheumatic diseases already diagnosed , three months or more into pregnancy , and no previous tmd treatment over a period of 15 days before this initial assessment . all subjects were interviewed regarded their parafunctional habits , signs and symptoms , and degree of pain consistent with the visual analog scale . following this initial step , an experienced physical therapist performed an independent postural body assessment by visually inspecting all the subjects . for this part of the study , the patients were asked to stand as comfortably as possible wearing bathing suits in a bipedal position with bilateral symmetric weight bearing , while looking towards the horizon . the physical therapist marked the following bone reference points using adhesive tape : lateral malleoli , heads of the fibulas , major trochanter of the femur , antero - superior and postero - superior iliac spines , coracoid processes , c7 and the inferior angle of the scapulas . the frontal anterior and posterior planes and sagittal right and left planes were evaluated . the evaluation protocol was based on kendall21 : any changes from the standard alignment posture were considered evidence of postural deviations . following data acquisition , an experienced physical therapist confirmed all postural classifications using digital photos . this analysis was performed using visual inspection with a digital matrix of horizontal and vertical lines , all of which passed through the bone reference markers . footprint measurements were taken using a harris mat , and the characteristics of the longitudinal plantar arches were evaluated according to cavanagh and rodgers.22 the cavanagh and rodgers22 plantar arch evaluation uses the ratio between the mid - foot area and the total foot area , excluding the toe area , as measured by a digital planimeter . the arch is classified as follows : lower than 0.21 is considered elevated , between 0.22 and 0.26 is normal , and higher than 0.26 is designated a low arch . data were analyzed using descriptive statistics and were tested to compare independent group means . when comparing dichotomic categorical data , we used the non - parametric chi - squared and fisher s exact tests . the disc displacement group showed reported pain more often , but only the presence of local tmj pain was significantly different in comparison with the cg ( p = 0.006 ) ( table 1 ) . there were no statistical differences between groups ( p>0.05 ) in parafunctional habits ( biting tongue , cheeks or lips , chewing gum , biting objects such as pen caps , holding one s head with the hands , chewing only on one side of the mouth ) . the footprint measurements that characterized patients longitudinal plantar arches were not different between groups ( p > 0.05 ) . both groups presented normal longitudinal plantar arches , according to cavanagh and rodgers18 ( cg = 56.25% , ddg = 50% ; low arch cg = 18.75% , ddg = 20% ; high arch pelvis , head and spine - based postural assessments in the frontal and sagittal planes were significantly different between the groups ( tables 2 and 3 ) . finally , the postural assessment of the mandibles in the frontal plane showed a higher incidence of deviation to the left side with an open mouth in the ddg ( 40% ) ( p = 0.03 ) ( table 4 ) . the main purpose of our study was to evaluate and associate the presence of anterior disc displacement with postural deviations across the entire body . the hypothesis of a functional relationship between the stomatognathic system and other body regions remains controversial , especially for body areas that are distant from the tmj.5,913 other studies have attempted to identify a relationship between postural alterations in tmd patients , but none of these trials have specifically focused on women . besides , many studies have only investigated the upper quarter of the body , either to assess postural alignment or to identify pain locations . our results demonstrated that important postural alterations are exhibited by subjects with anterior disc displacement , and these postural deviations can be associated with tmd . considering that pain levels were similar across both groups , except for local tmj pain that was more frequently reported by the ddg subjects , we suggest that there exists no relationship between body pain and tmd . although parafunctional habits were more often present in the ddg , there were no statistical differences between the groups . consistent with previous studies4,23 , our data show the importance of carefully investigating the real influence of parafunctional habits on tmd . the evaluation of patients longitudinal plantar arches showed no statistically significant difference between cg and ddg . our results showed similarities in longitudinal plantar arch anthropometry between the groups , suggesting no relationship between tmd and this characteristic . this result contrasts with that of another study10 in which flat foot simulation induced an increase in temporal and masseter emg activity on the side of the simulation . this could cause postural deviations in cervical and head positions and problems at the tmj . such a hypothesis regarding the presence of head and neck postural deviations was not confirmed , and no postural evaluations were conducted in that study . postural assessments in our study confirmed the findings of previous studies1518 , which revealed ddg - related changes in body posture , particularly in the pelvic position , lumbar and thoracic spines , head and mandibles . these deviations seem to confirm the relationship between the position of the tmj and other body parts . our results support the theory that a deviation in one joint subunit may lead to compensations in other joints2,59 .however , these results must be interpreted with caution because it is not possible to conclude whether tmd is a cause or a result of body posture deviations . first , the clinical diagnoses may have included a limited number of false - positive disc displacement diagnoses.24,25 in addition , and because this was a transverse study , subjects were evaluated only once , so the data do not take into account individual variation over time . due to the high incidence of tmd across the population , investigating the relationship between this condition and global posture is extremely important . our data showed significant ddg - related deviations in the pelvis , lumbar and thoracic spines , head and mandibles . although it is not possible to positively state a cause - effect relationship , our data at least verify the mutual existence of global body posture deviations and tmd . we conclude that the postural evaluation of tmd patients is clearly important as a global approach to provide accurate prevention and treatment . such evaluations can help physicians to achieve more precise diagnoses and select the best possible functional rehabilitation techniques . in the case of tmd patients , it is essential to achieve a better level of interaction among the different therapeutic subspecialties .

aim : to identify the relationship between anterior disc displacement and global posture ( plantar arches , lower limbs , shoulder and pelvic girdle , vertebral spine , head and mandibles ) . common signs and symptoms of anterior disc displacement were also identified . introduction : global posture deviations cause body adaptation and realignment , which may interfere with the organization and function of the temporomandibular joint . methods : global posture evaluation was performed in a group of 10 female patients ( 20 to 30 years of age ) with temporomandibular joint disc displacement and in a control group of 16 healthy female volunteers matched for age , weight and height . anterior disc displacement signs , symptoms and the presence of parafunctional habits were also identified through interview . results : patients with disc displacement showed a higher incidence of pain in the temporomandibular joint area , but there were no differences in parafunctional habits between the groups . in the disc displacement group , postural deviations were found in the pelvis ( posterior rotation ) , lumbar spine ( hyperlordosis ) , thoracic spine ( rectification ) , head ( deviation to the right ) and mandibles ( deviation to the left with open mouth ) . there were no differences in the longitudinal plantar arches between the groups . conclusion : our results suggest a close relationship between body posture and temporomandibular disorder , though it is not possible to determine whether postural deviations are the cause or the result of the disorder . hence , postural evaluation could be an important component in the overall approach to providing accurate prevention and treatment in the management of patients with temporomandibular disorder .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION

ovarian cancer is one of the most common and deadliest gynecologic cancers . in 2010 , 21880 new cases were diagnosed , and such cancer caused nearly 13850 deaths in the united states alone . ovarian cancer usually has poor prognosis , and most patients were diagnosed at advanced stages . the five - year survival rate for all stages of ovarian cancer is 46% in 2010 . it has been well documented that patients ' clinical outcome and five - year survival rate are positively associated with the number of tumor - infiltrating lymphocytes ( tils ) , and the ratio of intraepithelial cd8 tils to treg cells , or negatively associated with tumor- infiltrating treg cells . treg cells are also known as suppressor t cells which consist of a specific subpopulation of cells that functionally suppress the activation of immune system and maintain immune tolerance to self - antigens . treg cells contain two major subsets known as natural treg cells ( ntreg ) and adaptive or induced treg cells ( itreg ) . ntreg cells derived from thymus are considered as classic treg cells , by contrast , itreg cells develop in the periphery in response to self- or tumor antigens by converting naive cd4 t cells into treg cells . because most tumors express self - antigens , treg cells - mediated immunosuppression is believed to be one of the major contributors to immune evasion by tumors and becomes the main obstacle toward successful tumor immunotherapy . in this paper , we will focus on human ovarian cancer and discuss the nature of treg cells including their subsets , trafficking , differentiation , and proliferation and the clinical application of manipulation of treg cells . in early 1970s , gershon and kondo first described the existence of thymus - derived suppressive t cells ( later termed as treg cell ) in vivo [ 7 , 8 ] . after more than a decade , sakaguchi et al . demonstrated that cd4 t cells expressing interleukin-2 ( il-2 ) receptor alpha - chain ( cd25 ) can be defined as the population of treg cells with immune - suppressive activities and maintaining immune tolerance to self - antigen . later in 2003 , hori et al . found that the transcription factor forkhead box p3 ( foxp3 ) controls the development of treg cells and is crucial for maintaining the immune - suppressive function of treg cells . natural treg cells differentiate in the thymus and migrate to periphery , which constitute 510% of cd4 t cells [ 1113 ] . in addition identified another subset of treg cells , cd4 tr 1 cells , that suppress antigen - specific immune responses by producing high levels of il-10 . in addition to cd4 treg , cd8 suppressive t cells have been found playing an important role in the regulation of autoimmune disease [ 7 , 15 ] . cd8 suppressive t cells now refered to as cd8 treg cells are characterized as cd8cd25 , cd8cd122 , or cd8cd45rc treg cells , which comprise less than 1% of peripheral cd8 t cells . th3 treg cells have similar immune - suppressive function ; however , in contrast to natural treg cells , th3 exerts its suppressive capacity independent of cell membrane contact but mainly bases on the action of self - produced cytokine tgf . treg cells consist of ~10% of peripheral cd4 t cells characterized as cd4cd25foxp3 t cells , which is important for the control of autoimmune reaction [ 9 , 11 ] . dysregulation of treg can cause autoimmune diseases and may contribute to tumor - initiated immune evasion . as demonstrated by in vivo mouse model , the deletion of treg cells results in tumor rejection . however , the suppressive capacity of treg cells is also determined by the ratio of treg cells to effector t cells . a high cd8/treg ratio is associated with favorable prognosis and improved survival [ 3 , 20 ] . it has been reported that many human cancers are associated with high frequency of treg cells in the circulation or in the tumor tissues , including ovarian cancer , lung cancer , breast cancer , liver cancer , head and neck cancer , and lymphoma . these increased levels of treg cells are linked to high death hazard and poor survival , while the depletion of tumor - infiltrated treg cells and the blockade of treg trafficking to tumors enhance anti - tumor immune response [ 4 , 26 ] . ccr4 and its binding partners ccl22 and ccl17 are believed to be the most predominant axis in chemokine - mediated selective treg trafficking to the tumors . have profiled chemotactic responses and chemokine receptors expression of human treg cells and found that treg cells specifically express chemokine receptors ccr4 and ccr8 . chemokine ccl22 , the ligand for ccr4 , preferentially attracts activated - antigen - specific t cells to dendritic cells [ 28 , 29 ] . it has also been shown that human ovarian cancer cells and tumor - associated microphages produce chemokine ccl22 , which mediates treg cells trafficking to tumor . blockade of ccl22 in vivo significantly reduces human treg cells trafficking to tumors in ovarian carcinoma . this chemokine - mediated treg trafficking has been also observed in other types of cancer , such as gastric cancer , hodgkin 's lymphoma , and breast cancer . interestingly , in gastric cancer , ccl22 and ccl17 seem both important to recruit treg cells to the tumors as demonstrated by in vivo study as well as in vitro migration assay , and the levels of ccl22 and ccl17 within tumors are correlated to the increased levels of treg cells in early gastric cancer . besides ccr4 chemokine axis , ccr5/ccl5 axis may also selectively recruit treg cells to the tumors . using human pancreatic adenocarcinoma and murine pancreatic tumor model , it has been found that ccr5 is highly expressed in treg cells , while tumor cells produce elevated amount of ccl5 , and disruption of ccr5/ccl5 chemokine axis blocks treg cells migration and reduces tumor growth . in addition , ccl20 chemokine shows high affinity to ccr6 and can also mediate selective ccr6 treg cells trafficking . found that peripheral treg migrates from the thymus and appears in the periphery as early as 10th day of life . they also found that cd4cd25 treg cells differentiation is totally dependent on il-2 , because il-2 knockout mice do not develop cd4cd25 treg in vivo . further evidences have been provided from the studies on irradiated rat model . in this study , autoimmune diseases were induced in rats by thymectomy and irradiation ; however the xenograft transfer of cd4 t cells from normal rats can abrogate the autoimmune responses . these observations suggest that normal thymus - derived t cells have immune suppressive functions and thus prevent autoimmunity . in another model system , adoptive transfer of thymocytes or peripheral t cells depleted of cd4cd25 treg cells causes autoimmune diseases in mice , which provides further evidences of thymic origin of treg cells and their peripheral existence . although there are several arguments about how and what stromal components are involved in thymic treg cell differentiation , thymic stromal cells , including cortical and medullary thymic epithelial cells and dendritic cells ( dcs ) , contribute to treg cells differentiation and selection . jordan et al . used tcr - transgenic mice which express the receptor recognizing specific self - antigen and found that thymocytes bearing a tcr with high affinity to a specific self - antigen undergo selection and become cd4cd25 treg cells when interacting with a single self - antigen , but thymocytes bearing tcr with low affinity do not undergo selection . for instance , tumor microenvironment favors the induction and differentiation of treg cells , and that has been extensively studied for several years . in the tumor microenvironment , dc differentiation and function were suppressed by tumor - associated factors il-10 , vegf , and tgf , resulting in immature / dysfunctional dc . dysfunctional dc directly contributed to the induction of il-10-producing treg cells in vivo in human and in vitro [ 41 , 42 ] . tumor - associated plasmacytoid dc also induced il-10 treg generation [ 43 , 44 ] . tumor can convert dc into tgf-producing immature dc , which selectively promotes treg proliferation in tgf-dependent manner . treg cells can also be converted from peripheral nave cd4cd25 t cells by the action of tgf. tumor microenvironment contains high levels of tgf which might mediate tumor - associated treg cells conversion . in the mouse model , depletion of cd4cd25 treg cells using anti - cd25 antibody causes tumor regression , which correlated to the reduced number of treg cells [ 18 , 47 ] . using the recombinant il-2 diphtheria toxin conjugate dab(389)il-2 ( also known as denileukin diftitox and ontak ) , dannull et al . demonstrated that dab(389)il-2 was capable of selectively eliminating cd25 treg cells from the pbmcs of cancer patients without inducing toxicity on other cellular subsets , and dab(389)il-2-mediated treg depletion enhanced anti - tumor immune responses and significantly reduced the number of treg cells present in the blood of cancer patients . daclizumab ( also known as zenapex ) and basiliximab ( also called simulect ) are monoclonal antibodies against cd25 [ 49 , 50 ] , and the administration of daclizumab in patient with metastatic breast cancer enhanced anti - tumor immunity . cytotoxic t - lymphocyte - associated antigen 4 ( ctla4 ) is constitutively expressed and restricted to cd4cd25 treg cells among all cd4 cells , and the immune - suppressive function of treg is mediated by ctla4 signaling [ 52 , 53 ] . ctla4 binds to inhibitory b7 members on apc and transmits an inhibitory signal to t cells . in vivo administration of anti - ctla4 antibody periodic infusions of anti - ctla4 antibody in previously vaccinated patients with cancer created clinically effective antitumor immune response . patients with metastatic melanoma showed improved antitumor immunity and tumor regression by blockade of ctla-4 together with peptide vaccination . glucocorticoid - induced tumor necrosis factor ( tnf ) receptor family - related protein ( gitr or dta-1 ) is predominantly expressed on the surface of treg cells . an agonistic anti - gitr antibody administration in mice can abrogate treg - mediated immune suppression and enhance effective anti - tumor immunity in vivo [ 57 , 58 ] . in addition , treatment with anti - gitr antibody in b16 mice elicited immune response and rejected tumor . however gitr is not exclusively expressed on treg cell ; it is also expressed by various cd4 t cells and others . therefore , the clinical therapeutic relevance of gitr blockade and its side effects on potential deficits of other effective immune cells remain to be determined . ox40 ( cd134 ) also belongs to tnf receptor family and expressed on activated t cells . similar to gitr , triggering ox40 by an agonistic antibody against ox40 reduces treg - mediated immune suppression and restores effector t - cell function both in vivo and in vitro . it has been also shown that ox40 is necessary for treg development , homeostasis , and immune - suppressive activity . however , stimulation of ox40 signal in nave t cells can abrogate treg - mediated suppression . clinical relevance of the depletion of treg cells has been further confirmed by the treatment of cyclophosphamide ( cy ) in the patients bearing tumor . low dose of cy administration improved patients ' immune responses by reducing the number of tregcells and by decreasing the suppressive activity of treg cells . effects of treg depletion on anti - tumor immune responses were further investigated by the study on b16 melanomas mouse model . other immunosuppressants like cyclosporine a ( csa ) and azathioprine might also inhibit treg cells generation [ 64 , 65 ] . for instance , high dose of csa abrogates treg cell generation ; by contrast , low dose of csa can promote treg cell development . it is therefore important to determine whether lowdose of those agents can improve antitumor immunity in patients . our group has demonstrated that human ovarian cancer cells and tumor - associated macrophage ( tam ) produced chemokine ccl22 , the ligand for ccr4 which functionally expressed on tumor treg cells , mediating treg cells trafficking to the tumor and ascites , and the blockade of ccl22 abrogated treg cells migration . it has been demonstrated that chemokine receptor ccr4 is selectively expressed by treg cells , and the ccr4 and ccr4-associate chemokines axis is one of the most described tumor treg recruitment axes . the administration of anti - ccr4 antibody effectively depletes ccr4 t cells and inhibits treg cells migration in hodgkin lymphoma . furthermore , the significant correlation between ccl17 or ccl22 chemokines and the number of tumor - infiltrating treg cells was found in patients with neoplastic meningitis and gastric cancer [ 30 , 33 ] . ccl5 and ccl20 chemokines are also involved in treg trafficking , and that blockade of those chemokines reduces treg cells trafficking and inhibits tumor growth [ 34 , 35 ] . recently , a study has demonstrated that blockade of cxcr4 by a selective antagonist resulted in the significant reduction of intratumoral treg cells , which was associated with greatly increased antitumor immunity and an improved survival in an immunocompetent mouse model of ovarian cancer . it is thought that blockade of tgf signaling pathway may alter treg phenotype and function and in turn enhances antitumor immunity . notably , tgf is not only important for treg cell functional integrity , but also inhibits the proliferation and functional differentiation of t lymphocytes , nk cells , and macrophages [ 46 , 70 ] . this may induce t - cell unresponsiveness to tcr stimulation , failure to produce th1 cytokines , and production of additional tgf . tgf inhibitor ap 12009 was tested in a phase i / ii clinical trial for advanced pancreatic cancer and other malignancies . ly2109761 , an inhibitor of tgf i / ii receptors , can suppress pancreatic cancer metastases . in a preclinical model , we have shown that anti - tgf can reduce treg cells in tumors and tumor - draining lymph nodes . however , as tgf is implicated in multiple layers of biological activities , the ultimate clinical therapeutic efficiency and side effects of tgf signaling blockade remain to be investigated . the expression , regulation , functional , and clinical relevance of inhibitory b7 family members have been reviewed elsewhere . human ovarian cancer and cancer - associated myeloid antigen - presenting cells express high levels of b7-h1 ( pd - l1 ) , which are negatively associated with patient survival [ 74 , 75 ] . patients with high expression of b7-h1 had a significantly poor prognosis compared to the patients with low expression of b7h1 . b7-h1 expression was also found inversely correlated to the intraepithelial cd8 t lymphocyte count , indicating that b7-h1 on tumor cells may suppress antitumor cd8 t cells . the receptor , programmed death 1 ( pd-1 ) , is expressed on activated t - cell subsets , antigen - specific cd8 t cells , and treg . interestingly , b7-h1/pd-1 has been reported to be involved in the development of induced treg cells . therefore , targeting b7-h1/pd-1 signaling pathway may reduce treg development and function . as anti - pd-1 is in clinical application to treat patients with melanoma , renal cell carcinoma , and other cancers , further mechanistic studies on these patients will determine if the effects of anti - pd-1 on treg cells are mechanistically and clinically relevant . in addition to b7-h1 , human ovarian cancer and cancer - associated myeloid antigen - presenting cells also express high levels of b7-h4 ( b7x , b7s1 ) , which are negatively associated with patient survival [ 74 , 80 , 81 ] . interestingly , treg cells can induce il-10 expression by apcs and indirectly stimulate b7-h4 expression on apcs and convey suppressive activity to apcs [ 74 , 80 , 81 ] . thus , it is tempting to speculate that blocking b7-h4 signaling pathway may disable the suppressive effects of treg cells on apcs . notably , as the receptor for b7-h4 has not been identified , b7-h4 signaling is much less understood in both mouse and human system . nonetheless , studies on ovarian cancer patients and preclinical cancer models suggest that interruption of b7-h4 signaling may lead to improved antitumor t - cell response and decreased treg suppressive function . their phenotype , trafficking mechanism , suppressive activity , and clinical relevance have been defined in human cancer . however , recent evidence indicates that treg cells may not be stable and are subject to environmental regulation . in this regard , although their action mode of mechanisms has been investigated in many different physiological and pathological scenarios , the key suppressive mechanisms may be differed in different tumors or / and in different stages . nonetheless , targeting treg cells or / and reprogramming treg cells is an important strategy to treat patients with cancer . it is suggested that combinatorial therapy by incorporating treg manipulation may be ideal direction to develop novel therapeutic regimen to efficiently treat patients with cancer .

multiple layers of suppressive components including regulatory t ( treg ) cells , suppressive antigen - presenting cells , and inhibitory cytokines form suppressive networks in the ovarian cancer microenvironment . it has been demonstrated that as a major suppressive element , treg cells infiltrate tumor , interact with several types of immune cells , and mediate immune suppression through different molecular and cellular mechanisms . in this paper , we focus on human ovarian cancer and will discuss the nature of treg cells including their subsets , trafficking , expansion , and function . we will briefly review the development of manipulation of treg cells in preclinical and clinical settings .

1. Introduction 2. Regulatory T-Cell Subsets 3. Regulatory T-Cell Trafficking 4. Regulatory T-Cell Differentiation and Proliferation 5. Targeting Regulatory T Cells 6. Conclusions

chronic kidney disease ( ckd ) is defined as the presence of kidney damage , or a decreased level of kidney function , for longer than 3 months5,13 ) . ckd is known to be associated with an increased risk of bleeding following coronary intervention and the use of anticoagulants1,12,14,21 ) . the high risk of bleeding in ckd patients can be partially attributed to disturbances in the coagulation system , coupled with an altered response to medications8 ) . therefore , it could be identified as a significant risk factor for increased morbidity and mortality after stroke11 ) . the incidence of intracerebral hemorrhage has been reported to range from 10 to 30 cases per 100000 individuals10 ) . recently , the incidence of intracerebral hemorrhage ( ich ) with hypertension has been increased in accordance with increased life expectancy due to medical advancements and thus comprehensive treatment strategies are required to treat underlying diseases . in addition , the number of patients who are managing ckd disease and also suffer from ich has been increasing . the prognosis for ich concurrent with ckd is poor , and mortality has ranged from 50% to 90%7,17 ) . however , there are few reports discussing prognostic factors that affect the neurological outcome of ich in patients with ckd . we retrospectively studied 32 ich patients who had suffered from ckd to identify factors affecting prognosis in these patients . a total of 892 patients with ich were admitted to our institute between january 2001 and june 2008 . out of them , 32 patients ( 3.6% , 21 males and 11 females ) had been previously treated for ckd . all 32 patients had been initially diagnosed as spontaneous ich located in the basal ganglia , thalamus , the cortex , brainstem , and cerebellum by computed tomography ( ct ) . the patients with traumatic ich , aneurysmal ruptured or arterio - venous malformation were excluded . the common causes of ckd are hypertension , diabetes mellitus , and glomerulonephritis . out of 32 patients , 18 patients had been hospitalized due to hypertensive renal failure , 9 patients due to diabetic nephropathy , 1 patient due to glomerulonephritis , 1 patient due to polycystic kidney disease , and 3 patients due to an asymptomatic urinary abnormality . the severity of ckd was categorized using a modified glomerular filtration rate ( mgfr ; ml / min/1.73 m ) as follows3 ) : stage 1 was defined as > 90 ml / min/1.73 m ; stage 2 as 60 - 89 ml / min/1.73 m ; stage 3 as 30 - 59 ml / min/1.73 m ; stage 4 as 15 - 29 ml / min/1.73 m ; stage 5 as < 15 ml / min/1.73 m ( table 1 ) . a mild grade of renal dysfunction was defined as stage 1 , a moderate grade as stage 2 , 3 and stage 4 , and a severe grade as stage 5 . the patients were divided into 2 groups ( mild / moderate and severe grade ) according to mgfr level . following diagnosis of ich , intravenous antihypertensive treatment with nicardipine was immediately initiated to maintain systolic blood pressure ( sbp ) at < 160 mm hg . osmotic diuretics such as mannitol were administered following consultation with a nephrologist to reduce cerebral edema . however , surgery was performed in 6 patients because the patients ' neurological status rapidly diminished over time . of these 6 patients , 2 patients were taken to surgery upon admission , 4 patients underwent surgery during hospitalization for the treatment of ich , and 1 patient had an additional surgical operation after stereotactic hematoma aspiration because of ich rebleeding . according to surgical techniques , 2 cases involved open craniotomy for removal of a hematoma and 5 cases received stereotactic aspiration and drainage . the hematoma volumes on admission and at the time of rebleeding were measured using ct . the hematoma volumes were calculated using ct scans ( aquilion one dynamic volume ct , toshiba medical systems corporation , japan ) , assuming an ellipsoid shape and using the formula [ ( widthdepthheight)/6 ] . clinical outcomes using a modified rankin scale ( mrs ) were evaluated at the last follow - up . the predisposing factors in ich patient with ckd were analyzed to examine the relationships between clinical outcome and the following factors : patient age , sex , hospital days , hematoma volume on admission , hematoma location , modified glomerular filtration rate ( mgfr ) , underlying disease , pro - thrombin time , use of anti - platelet agents , accompanying intraventricular hemorrhage ( ivh ) , hemoglobin level , diastolic blood pressure , and sbp on admission and 3 days after ich development . relationships between variables and outcomes were examined using univariate analysis ( mann - whitney u - test ) . the chi - square test , independent 2-sample t - test , and logistic regression analysis were used depending on characteristics of the variables being compared . a total of 892 patients with ich were admitted to our institute between january 2001 and june 2008 . out of them , 32 patients ( 3.6% , 21 males and 11 females ) had been previously treated for ckd . all 32 patients had been initially diagnosed as spontaneous ich located in the basal ganglia , thalamus , the cortex , brainstem , and cerebellum by computed tomography ( ct ) . the patients with traumatic ich , aneurysmal ruptured or arterio - venous malformation were excluded . the common causes of ckd are hypertension , diabetes mellitus , and glomerulonephritis . out of 32 patients , 18 patients had been hospitalized due to hypertensive renal failure , 9 patients due to diabetic nephropathy , 1 patient due to glomerulonephritis , 1 patient due to polycystic kidney disease , and 3 patients due to an asymptomatic urinary abnormality . the severity of ckd was categorized using a modified glomerular filtration rate ( mgfr ; ml / min/1.73 m ) as follows3 ) : stage 1 was defined as > 90 ml / min/1.73 m ; stage 2 as 60 - 89 ml / min/1.73 m ; stage 3 as 30 - 59 ml / min/1.73 m ; stage 4 as 15 - 29 ml / min/1.73 m ; stage 5 as < 15 ml / min/1.73 m ( table 1 ) . a mild grade of renal dysfunction was defined as stage 1 , a moderate grade as stage 2 , 3 and stage 4 , and a severe grade as stage 5 . the patients were divided into 2 groups ( mild / moderate and severe grade ) according to mgfr level . following diagnosis of ich , intravenous antihypertensive treatment with nicardipine was immediately initiated to maintain systolic blood pressure ( sbp ) at < 160 mm hg . osmotic diuretics such as mannitol were administered following consultation with a nephrologist to reduce cerebral edema . , surgery was performed in 6 patients because the patients ' neurological status rapidly diminished over time . of these 6 patients , 2 patients were taken to surgery upon admission , 4 patients underwent surgery during hospitalization for the treatment of ich , and 1 patient had an additional surgical operation after stereotactic hematoma aspiration because of ich rebleeding . according to surgical techniques , 2 cases involved open craniotomy for removal of a hematoma and 5 cases received stereotactic aspiration and drainage . the hematoma volumes on admission and at the time of rebleeding were measured using ct . the hematoma volumes were calculated using ct scans ( aquilion one dynamic volume ct , toshiba medical systems corporation , japan ) , assuming an ellipsoid shape and using the formula [ ( widthdepthheight)/6 ] . clinical outcomes using a modified rankin scale ( mrs ) were evaluated at the last follow - up . the predisposing factors in ich patient with ckd were analyzed to examine the relationships between clinical outcome and the following factors : patient age , sex , hospital days , hematoma volume on admission , hematoma location , modified glomerular filtration rate ( mgfr ) , underlying disease , pro - thrombin time , use of anti - platelet agents , accompanying intraventricular hemorrhage ( ivh ) , hemoglobin level , diastolic blood pressure , and sbp on admission and 3 days after ich development . relationships between variables and outcomes were examined using univariate analysis ( mann - whitney u - test ) . the chi - square test , independent 2-sample t - test , and logistic regression analysis were used depending on characteristics of the variables being compared . clinical characteristics of the 32 ich patients with chronic kidney disease ( table 2 ) . out of 32 patients , 13 patients had a mild / moderate grade of renal dysfunction and 19 patients needed renal replacement therapy because their renal functions had scored into the severe grade , stage 5 ( mgfr < 15 ml / min/1.73 m ) . out of them , 17 patients ( 89.5% ) were managed with hemodialysis and the others were managed with peritoneal dialysis due to the aggravation of renal functions . the mean hematoma volume was 45.3 ml ( range , 14.0 - 303.6 ml ) . the mean follow - up time was 42 days ( range , 2 - 268 days ) . 7 of 32 patients had favorable outcomes ( good recovery or moderate disability ) and 25 patients showed unfavorable outcomes ( poor recovery and death ) . a total of 11 ( 34.4% ) of the 32 patients died within 19 days ( range , 1 - 87 days ) . the demise of 3 patients was directly attributable to cerebral hemorrhage and swelling , and 8 cases were caused by sepsis and respiratory failure . regression analysis showed that initial neurological status ( gcs ) , hematoma volume , the severity of renal dysfunction defined as mgfr , and 3rd day sbp after ich development were significantly related to clinical outcome ( p<0.05 ) ( table 3 ) . the mean mrs scores were 4.91.5 in group a ( severe stage , mgfr < 15 ml / min/1.73 m ) and 3.41.8 in group b ( mild / moderate stage , mgfr > 15 ml / min/1.73 m ) . we found that there were statistically different clinical outcomes between the two groups according to the severity of renal function defined as mgfr . also , there were significant differences in sbp on 3rd day and rebleeding between the two groups ( p<0.05 ) ( table 4 ) . however , initial gcs scores , hematoma volumes , sbp , ivh presence , and hemoglobin levels were not significantly different between the severe renal dysfunction and mild / moderate renal dysfunction groups . that is , the patients with severe renal dysfunction experienced a worse clinical outcome than those with mild / moderate renal function because of trouble controlling their blood pressure , which led to rebleeding of the hematoma , which resulted in poor clinical outcome . we found that the hematoma volume , renal function , and sbp on the 3rd day were significantly related to unfavorable outcome including mortality ( p<0.05 ) ( table 5 ) . regression analysis showed that clinical outcomes were not related to patient age , gender , hospitalization days , hematoma location , concomitant ivh , use of anti - platelet agents , and sbp or diastolic blood pressure on admission ( table 3 ) . the most common complications were a recurrence of hemorrhage and peripheral complications such as deep vein thrombosis and phlebitis . an inter - group analysis showed no significant relationship between ckd stage and the incidence of complications . however , the comparison did show the tendency for the incidence of complications to increase in patients with higher degrees of renal dysfunction ( table 6 ) . regression analysis showed that initial neurological status ( gcs ) , hematoma volume , the severity of renal dysfunction defined as mgfr , and 3rd day sbp after ich development were significantly related to clinical outcome ( p<0.05 ) ( table 3 ) . the mean mrs scores were 4.91.5 in group a ( severe stage , mgfr < 15 ml / min/1.73 m ) and 3.41.8 in group b ( mild / moderate stage , mgfr > 15 ml / min/1.73 m ) . we found that there were statistically different clinical outcomes between the two groups according to the severity of renal function defined as mgfr . also , there were significant differences in sbp on 3rd day and rebleeding between the two groups ( p<0.05 ) ( table 4 ) . however , initial gcs scores , hematoma volumes , sbp , ivh presence , and hemoglobin levels were not significantly different between the severe renal dysfunction and mild / moderate renal dysfunction groups . that is , the patients with severe renal dysfunction experienced a worse clinical outcome than those with mild / moderate renal function because of trouble controlling their blood pressure , which led to rebleeding of the hematoma , which resulted in poor clinical outcome . we found that the hematoma volume , renal function , and sbp on the 3rd day were significantly related to unfavorable outcome including mortality ( p<0.05 ) ( table 5 ) . regression analysis showed that clinical outcomes were not related to patient age , gender , hospitalization days , hematoma location , concomitant ivh , use of anti - platelet agents , and sbp or diastolic blood pressure on admission ( table 3 ) . the most common complications were a recurrence of hemorrhage and peripheral complications such as deep vein thrombosis and phlebitis . an inter - group analysis showed no significant relationship between ckd stage and the incidence of complications . however , the comparison did show the tendency for the incidence of complications to increase in patients with higher degrees of renal dysfunction ( table 6 ) . the prognosis for ich patients with ckd is dismal and overall mortality rates have been reported to range from 43.8% to 83%7,9,17,19 ) . in accordance with previous studies , the present study showed an overall mortality rate of 34.4% , which is better than rates reported in other studies . ochiai et al.18 ) reported that all patients with a pontine hematoma exhibited deterioration of neurological symptoms , which was later related to mortality during hemodialysis . our retrospective study had a smaller number of chronic renal disease patients with a pontine hemorrhage than other studies . we think that one of the reasons which our study had a better outcome was , in part , due to the smaller sample size . another reason is that the mean volume of hematomas in our study was 45.3 ml , which was smaller than the 55.3 - 109.0 ml volumes reported in other studies16,17 ) . some authors reported the relationship between hematoma volume and clinical outcomes in acute ich patients with ckd16,17 ) . molshatzki et al.16 ) concluded the presence of severe ckd in ich patients was associated with the presence of larger lobar hematomas and a poor outcome . based on our regression analysis , hematoma volume was significantly related to neurological outcome ; however , there was no difference in hematoma volumes among the various renal dysfunction groups . previous studies have been examined the association between baseline estimated glomerular filtration rates ( gfrs ) and clinical outcomes in acute stroke ( ischemic or hemorrhagic ) patients11,22 ) . reported that chronic renal dysfunction classified by gfr was a strong independent predictor of mortality and poor outcome in patients with acute stroke . however , estimations of the ckd and gfr cutoff points associated with a poor outcome depend on the equation used to estimate gfr . similarly , our study showed a significant difference in mortality rates and outcomes between patients with different stages of ckd . in our study , patients were divided into 2 groups ( mild / moderate and severe renal dysfunction ) based on their glomerular filtration rate , because the number of patients with mild renal dysfunction was too small to analyze . the majority of patients who succumbed had stage 5 ckd , i.e. , mgfr < 15 ml / min/1.73 m requiring hemo- or peritoneal dialysis ; these conditions define end stage renal disease . ckd patients require careful management because they have a higher risk of bleeding due to disturbances in the coagulation system and altered responses to medications8 ) . in particular , the amounts of osmotic diuretics prescribed to control cerebral edema should be reduced in patients with chronic renal disease . in these patients , it was considered too difficult to strictly control blood pressure and brain swelling , which is associated with a greater risk for vascular complications15 ) . there have been some reports regarding other prognostic factors affecting the clinical outcome of ich in patients with ckd16,22 ) . depending on the ich site , anticoagulants given during dialysis may exacerbate hemorrhaging and increase the risk of cerebral herniation23 ) . some authors have suggested that systolic blood pressure in ich patients with ckd is related to prognosis and hematoma enlargement20 ) . but , in our study , initial systolic and diastolic blood pressures were not found to be associated with clinical outcome , although it is often presumed that initial blood pressure readings and strict blood pressure control are required in patients with renal disease to prevent disease progression and expansion of ich volume20 ) . the 3rd day sbp affected the neurological outcome , and shows the importance of controlling blood pressure during hospitalization rather than the initial blood pressure upon admission , which could mask increased intracranial pressure signs because of ich development . some authors reported that the prognostic factors including gcs score , age ( 80 ) , infratentorial origin of ich , ich volume , and presence of intraventricular hemorrhage are related with neurological outcome in ich patients2,6 ) . among these factors , cho et al.4 ) emphasized that initial neurological status described as gcs and hematoma volume were potentially prognostic factors in putaminal and thalamic ich . based on our results , initial gcs score , hematoma volume , severe renal impairment and 3rd day sbp are related with neurological outcome in ich patients with ckd . in the present study , however , patient age , gender , days of hospitalization , underlying renal disease , hematoma location , concomitant ivh , and use of anti - platelet agents , were not significantly correlated with outcome . the use of surgical methods to treat ich remains controversial , particularly for chronic renal disease patients . free hand aspiration and stereotactic aspiration of a hematoma are beneficial because platelet dysfunction due to uremia and coagulopathy caused by systemic anticoagulation therapy may result in difficulty in maintaining hemostasis and an increased risk of additional complications after surgery . in the present study , 2 patients underwent a craniotomy for aggressive evacuation of a hematoma , and 5 patients underwent stereotactic aspiration of a hematoma and periventricular hemorrhage . one patient who underwent a craniotomy and 2 patients who underwent free hand or stereotactic aspiration died . among the patients with a favorable outcome , none of them underwent surgery , and their mean ich volume was 71.6 ml ; whereas the mean ich volume for patients who died or had unfavorable outcomes was 37.8 ml . it is probable that patients with a favorable neurological status will benefit from conservative treatment even if their hematoma volume is large , whereas patients with an unfavorable neurological status on admission will have an unfavorable outcome irrespective of the surgical procedure . the initial neurological status strongly affected neurological outcome in ich patients with ckd . also , patients who had severe renal dysfunction showed unfavorable clinical outcomes . in conclusion , it is especially difficult to control blood pressure in patients with severe renal impairment . it is possible that poorly controlled blood pressure could increase the chance of rebleeding and worsen the neurological outcomes in these patients . consequently , low gcs score , small hematoma volume , favorable renal function and sbp control are important to improve the neurological outcome in ich patients with ckd . limitations of the present study include its retrospective design and small sample size . also , the series of blood pressure readings that were collected from patients were not treated as an independent variable . additional extended and comprehensive studies may be needed to establish prognostic factors of mortality and clinical outcomes for ich patients with ckd . we found that impaired renal function was associated with a poor outcome , and was a strong independent predictor of mortality , as well as a high hematoma volume , low gcs score , and uncontrolled blood pressure . in addition , our study showed that patients with severe chronic kidney dysfunction had a higher rate of complications than patients with mild or moderate renal dysfunction . hence , the severity of renal function , initial neurological status , hematoma volume , and uncontrolled blood pressure emerged as significant prognostic factors in ich patients with ckd .

objectivewe conducted a retrospective study examining the outcomes of intracerebral hemorrhage ( ich ) in patients with chronic kidney disease ( ckd ) to identify parameters associated with prognosis.methodsfrom january 2001 to june 2008 , we treated 32 ich patients ( 21 men , 11 women ; mean age , 62 years ) with ckd . we surveyed patients age , sex , underlying disease , neurological status using glasgow coma scale ( gcs ) , ich volume , hematoma location , accompanying intraventricular hemorrhage , anti - platelet agents , initial and 3rd day systolic blood pressure ( sbp ) , clinical outcome using the modified rankin scale ( mrs ) and complications . the severity of renal functions was categorized using a modified glomerular filtration rate ( mgfr ) . multifactorial effects were identified by regression analysis.resultsthe mean gcs score on admission was 9.44.4 and the mean mrs was 4.31.8 . the overall clinical outcomes showed a significant relationship on initial neurological status , hematoma volume , and mgfr . also , the outcomes of patients with a severe renal dysfunction were significantly different from those with mild / moderate renal dysfunction ( p<0.05 ) . particularly , initial hematoma volume and sbp on the 3rd day after ich onset were related with mortality ( p<0.05 ) . however , the other factors showed no correlation with clinical outcome.conclusionneurological outcome was based on initial neurological status , renal function and the volume of the hematoma . in addition , hematoma volume and uncontrolled blood pressure were significantly related to mortality . hence , the severity of renal function , initial neurological status , hematoma volume , and uncontrolled blood pressure emerged as significant prognostic factors in ich patients with ckd .

INTRODUCTION MATERIALS AND METHODS Patient population Management of patients Imaging analysis Analysis of factors affecting clinical outcomes Statistical analysis RESULTS Neurological status on admission, hematoma volume, renal function and clinical outcome Neurological outcome according to the severity of renal function The relationship of hematoma volume, renal function, and systolic blood pressure on 3rd day and relation to unfavorable outcome Effects of other variables on clinical outcome DISCUSSION CONCLUSION

alzheimer 's disease ( ad ) is the most prevalent form of dementia , which affects more than 37 million people worldwide , with an estimated cost of $ 422 billion in 2009 [ 1 , 2 ] . moreover , the incidence of the illness and the prospect of an aging population will result in rising social and economic demands . ad is characterised by the presence of extracellular amyloid plaques and intracellular neurofibrillary tangles within the afflicted brain , which cause neuronal loss in the neocortex , hippocampus , and basal forebrain , leading to progressive cognitive and behavioural decline . zinc , in addition to copper and iron , has been shown to be involved in ad . here , we review the current literature relating to neuronal zinc metabolism and the way in which zinc can modulate normal brain activity . we discuss also the contribution of zinc to the formation , aggregation , and degradation of the amyloid- ( a ) peptide and the contribution of zinc to the pathogenesis of ad . as the most abundant trace metal in the brain , zinc is found tightly associated with numerous proteins conferring either structural or catalytic properties upon them . however , a significant amount of loosely bound , chelatable zinc can be found sequestered in presynaptic vesicles forming a subpopulation of zinc enriched ( zen ) neurones [ 5 , 6 ] , which co - release zinc with the neurotransmitter glutamate upon excitation . neurones have their cell bodies located in either the cerebral cortex or the limbic structures of the forebrain , and so an extensive network uniting limbic and cerebrocortical functions is created . this connection between zinc and glutamatergic neurotransmission allows the ion to modulate the overall excitability of the brain and also influence synaptic plasticity . the identification of synaptic zinc was first made by mclardy over fifty years ago who identified that a band of zinc dithizonate staining correlated with hippocampal mossy fibre axons . since then , many more cerebrocortical pathways have been identified which contain zinc - rich synaptic vesicles ; indeed nearly 50% of the glutamatergic synapses are actually gluzincergic in some parts of the cerebral cortex . significantly , only small amounts of chelatable zinc can be determined in glutamatergic pathways which originate outside the cerebral cortex or limbic systems . despite this extensive network of zinc - containing neurons , there are two families of zinc transporters : the znt family , which act to decrease intracellular zinc concentrations by exporting zinc from the cytoplasm to the lumen of organelles or the extracellular space , and the zip family , which import the metal from the extracellular space or organellar lumen into the cytoplasm . whilst many of the transporters have particular distribution patterns , only znt3 expression is restricted to the brain and the testis . it is located in the vesicular membrane and is necessary to transport zinc from the cytoplasm into the synaptic vesicle of the neuron . targeted disruption of znt3 in a mouse model resulted in a complete lack of chelatable zinc . a number of approaches have been taken to confirm that zinc is coreleased with glutamate from the presynaptic bouton during neuronal excitation : imaging of zinc in boutons before and after stimulation , analytical detection of zinc released into perfusates , and direct imaging of released zinc using fluorescent extracellular probes [ 18 , 19 ] . stimulation of organotypic cultures from rat hippocampus produced a cloud of green fluorescence as the released zinc bound an apometalloenzyme confirming the release of zinc from the culture . a later study by quinta - ferreira and colleagues demonstrated a release of zinc with each pulse of an action potential . whilst there is now no doubt that zinc is released during synaptic activity , there is little consensus on the amount or duration of its existence in the synaptic cleft . following an intense burst of neuronal activity , the release of glutamate and postsynaptic membrane depolarisation open a variety of zinc - permeable ion channels which contribute to removing the ion from the extracellular fluid . these include n - methyl - d - aspartate ( nmda ) channels and calcium permeable -amino-3-hydroxy-5-methyl-4-isoxazole propionic acid ( ampa)/kainate channels . the consequences of zinc acting on these receptors are diverse and demonstrate the significance zinc has in modulating fast excitatory glutamatergic transmission . zinc can act to either enhance or depress synaptic activity with varying degrees of potency . initially , zinc was thought to selectively inhibit nmdar - mediated neuronal activity by inducing a voltage - independent noncompetitive inhibition that decreased the probability of the channel being open [ 2224 ] . a voltage - dependent inhibition of nmdar could be observed at higher concentrations of zinc ( > 20 m ) and was believed to be due to binding of the cation within the channel pore . with the cloning of nmdar subunits , it was confirmed that zinc could cause both voltage - independent and voltage - dependent inhibition . the exceptional sensitivity of the glun2a subunit towards zinc suggests that even contaminating ions found in routine laboratory solutions are sufficient to cause inhibition . significantly , despite being responsible for inhibitory effects at nmdar , it has also been shown that nmdar activation may provide a route of influx for zinc contributing to toxic effects of exposure ( figure 1 ) . whilst it is thought that zinc exposure generally attenuates nmdar - mediated neurotoxicity , zinc has been shown to potentiate ampar - mediated toxicity at suggested physiological concentrations ( 50 m ) . originally , it was proposed that the toxic effect was due to zinc influx via voltage - gated calcium channels , with lin et al . subsequently , it has been demonstrated that zinc can carry currents directly via ampar , mostly via the calcium - permeable subtype ( figure 1 ) . at high supraphysiological doses ( 1 mm ) a few studies have also looked directly at zinc - mediated inhibition of voltage - gated calcium channels , as their proximity to vesicular release sites on the presynaptic membrane suggests they could interact [ 33 , 34 ] . most recently , neurotoxicity has been attributed to transient receptor potential metastatin 7 ( trpm7 ) channel activation resulting in increased intracellular zinc ( figure 1 ) . the significance of synaptically released zinc centres on the amount that is released into the synaptic cleft upon excitation . some authors argue that the amount of zinc ( 10100 m ) released following an action potential arriving at the glutamatergic bouton is high enough to bring about the voltage - dependent inhibition of nmdar and that there would be no spillover onto neighbouring cells [ 36 , 37 ] . other authors disagree , suggesting that the zinc concentration would be sufficient to affect nearby cells . it has also been demonstrated that the zinc level ( low nm ) is only sufficient to block the voltage - independent component of nmdar activity . alternatively , it could be that there is little or no diffusible zinc released , supporting the notion that zinc behaves in a tonic mode . kay and tth proposed that zinc is exocytosed from the presynaptic membrane and that instead of diffusing into the extracellular space it remains tightly bound to an as - yet unidentified presynaptic component . this would create a veneer of zinc ions which would build up with synaptic activity or erode with quiescence to modulate plasticity . first , synaptic zinc acts as a conventional neurotransmitter , is contained within presynaptic vesicles , and is released upon excitation and binds to a variety of receptors on the postsynaptic membrane . the downstream consequence of receptor binding is one of tonic modulation of glutamatergic excitatory synapses . the second type is similar to calcium signalling and occurs in conjunction with synaptic zinc signalling . a transmembrane flux of synaptic zinc from the extracellular space passes through post - synaptic zinc - permeable ion channels . this class is difficult to define and as yet has not been identified in neurons but has been demonstrated in mast cells . it is found in synaptic vesicles , released upon excitation , and has multiple synaptic targets . the significant inhibitory effect of zinc on nmdar , alongside the crucial function of nmdar in both neurophysiology and pathophysiology , advocates a vital role for zinc in both healthy and diseased brains . the most prominent lesions in the brain of ad sufferers are the amyloid or senile plaques , which predominantly consist of a peptides derived from the proteolytic processing of the amyloid precursor protein ( app ) . app is an ubiquitously expressed glycosylated transmembrane protein with a large n - terminal extracellular domain , a single hydrophobic transmembrane domain , and a small c - terminal cytoplasmic domain . a specific and saturable binding site for zinc ( kd = 750 nm ) has been reported in the cysteine - rich region on the ectodomain of app [ 44 , 45 ] . it is hypothesised that zinc could have a role in sustaining the adhesiveness of app during cell - cell and cell - matrix interactions [ 46 , 47 ] . app can be processed by one of two pathways : the amyloidogenic pathway , leading to the production of a , and the non - amyloidogenic pathway ( figure 2(a ) ) , reviewed in . in the amyloidogenic pathway , app is sequentially cleaved by the aspartyl protease , -site app - cleaving enzyme 1 ( bace1 ) forming the secreted app ( sapp ) fragment and a membrane bound c - terminal fragment of 99 amino acids ( c99 ) . the c99 fragment is then further processed by the -secretase complex into app intracellular domain ( aicd ) and a peptides , predominantly 40 and 42 amino acids in length . it is these aggregation - prone a peptides which form oligomeric and fibrillar structures which deposit in the brain and over time cause ad . the -secretase complex comprises four components : presenilin ( ps ) 1 or 2 , nicastrin ( nct ) , presenilin enhancer 2 ( pen-2 ) , and anterior pharynx defective-1 ( aph-1 ) . sapp is involved in the pruning of synapses during the development of central and peripheral neurons and aicd is known to be a transcription factor for several genes , including the upregulation of the a-degrading enzyme , neprilysin ( nep ) . the predominant app - processing pathway in healthy brain is the nonamyloidogenic pathway where app is cleaved by the -secretase within the a region forming the secreted app ( sapp ) fragment and the membrane - bound c - terminal fragment of 83 amino acids ( c83 ) ( figure 2(a ) ) . c83 is subsequently cleaved by the -secretase complex generating aicd and p3 ( figure 2(a ) ) . -secretase activity is attributed to the disintegrin and metalloprotease ( adam ) family of zinc metalloproteases ( reviewed in [ 48 , 52 ] ) . the adams , along with the matrix metalloproteases ( mmps ) , are members of the metzincin clan of metalloproteases as they have a long zinc - binding consensus sequence hebxhxbgbxh ( h , histidine , zinc ligand ; e , catalytic glutamate ; g , glycine ; b , bulky apolar residue ; x , any amino acid ) which contains three zinc ligands . structurally , the catalytic domain is globular and divided into two subdomains , with the active site cleft running between the two . the defining feature of the metzincins is the conserved methionine residue which creates a 1,4--turn ( met - turn ) , creating the catalytic cleft . the catalytic zinc atom sits at the bottom of the groove between the subdomains , with the subsites in the groove determining specificity for particular amino acid sequences in the substrate ( reviewed in ) . a number of enzymes in this family , namely , adam9 , 10 , 17 ( also known as tnf- converting enzyme , tace ) and 19 , are known to exert -secretase activity , but it is unclear which enzyme or enzymes are responsible for the -cleavage of app in vivo [ 5558 ] . adam10 appears to be the predominant enzyme as overexpression of functional adam10 in ad transgenic mice led to an increase in sapp and reduced a production , plaque deposition , and cognitive deficits . although fibroblasts from adam10 mice showed no deficiency in -secretase activity , probably due to compensation by adam17 , a recent detailed study has provided strong evidence that adam10 is the physiologically relevant constitutive -secretase in primary neurons . in a healthy brain , the relatively small amount of a-constitutively being produced is rendered safe by a degrading enzymes . the steady state levels of a synthesis and clearance in cerebrospinal fluid ( csf ) are 7.6% and 8.3% per hour , respectively . a large number of candidate a-degrading enzymes have been identified , with the majority being zinc metalloproteases . these include nep , insulin - degrading enzyme ( ide ) , endothelin - converting enzyme ( ece ) 1 and 2 , mmp2 , 3 , and 9 , and prep ( reviewed in ) . nep , ece1 and 2 , and mmps have the conserved zinc - binding motif hexxh ( h , histidine , zinc ligand ; e , catalytic glutamate ; x , any amino acid ) , and ide and its homolog prep are both inverzincins , as they contain the inverted zinc - binding motif hxxeh . nep appears to be the dominant a protease [ 6366 ] , and is capable of degrading monomeric and oligomeric a [ 63 , 67 ] ( figure 2(b ) ) . nep knockout mice have significantly elevated a levels [ 68 , 69 ] and more importantly , human postmortem tissue analysis suggests that nep expression is inversely related to the extent of ad pathology [ 7072 ] . ide is predominantly a cytosolic enzyme but has been found extracellularly and can only degrade monomeric a and not oligomers ( figure 2(b ) ) , although it did lower the net production of oligomers by cultured cells . even though there are conflicting data regarding ide and ad , ide knockout mice have elevated levels of endogenous a [ 76 , 77 ] . there are two isoforms of ece , 1 and 2 , both of which have similar catalytic activity , with ece 1 being the predominant isoform within the brain [ 65 , 78 ] . however , both eces are primarily localised to endothelial cells but have been detected in neurons and glial . the mmps , specifically mmp2 and mmp9 , degrade fibrillar a , whereas prep degrades monomeric a. however , prep is confined to mitochondria , so it would therefore have limited action on the majority of a which is extracellular . high concentrations of zinc ( up to 1 mm ) have also been found within amyloid plaques , which is thought to have been released from glutamatergic synapses . aggregation of the a peptides can be rapidly induced in the presence of zinc ions under physiological conditions in vitro [ 83 , 84 ] and studies on ad tissues show that zinc colocalised with a deposits . the metal binding site for zinc on a is the same as the copper binding site and lies within the n - terminal hydrophilic region , the first 16 residues ( figure 3 ) . the majority of studies on zinc binding to a have utilised truncated peptides of 16 ( a116 ) and 28 ( a128 ) amino acids , as the binding region is situated within these sequences . a116 does not aggregate under moderate conditions [ 8790 ] , making it an ideal model system , and a128 can undergo aggregation and fibril formation , but at significantly reduced rates , to the full - length peptides . zinc binds to a in a 1 : 1 stoichiometry with a mononuclear binding site [ 84 , 8690 , 9294 ] . nmr studies have shown that all three histidine residues ( residues 6 , 13 and 14 ; see figure 3 ) are involved in zinc binding [ 87 , 88 , 90 , 93 , 95 ] , with confirmation from mutational studies [ 96 , 97 ] . other possible ligands have also been reported as zinc coordination classically involves four to six ligands . the candidate ligands are asp1 [ 91 , 93 ] , arg5 , ser 8 , glu11 , and tyr10 ( figure 3 ) however , tyr10 has been ruled out and arg5 has been deemed highly unlikely . the carboxyl side chain of glu11 is a zinc ligand [ 88 , 90 ] however , asp1 is considered the most attractive zinc ligand , either through its n - terminal amino group and/or its side - chain carboxylate group [ 87 , 88 , 91 , 93 ] . raman spectroscopy has shown zinc binding to the n site of histidine side chains in senile plaques taken from ad brains , but it is unclear if zinc only binds to free a peptides that subsequently aggregate or whether zinc binds to a in preformed plaques . the reported apparent binding constants ( kd ) of zinc to a peptides vary from 1 to 300 m ( reviewed in ) . the published kd values vary greatly due to the in vitro conditions ( e.g. , buffer composition , ph ) , a fragment , and experimental method . the high kd ( 20300 m ) values come from tyrosine fluorescence experiments however , even these are contentious and hard to reproduce [ 99101 ] , and any change in tyrosine fluorescence could be due to a aggregation rather than zinc binding . discounting the tyrosine fluorescence measurements , the most likely apparent kd value for zinc binding to a peptides is a range of 120 m . the binding affinity of zinc for preformed a fibrils is approximately the same as of the peptides with a kd of 120 m [ 89 , 101 ] . it has been shown that there is a significant increase in serum and hippocampal zinc in ad patients compared to age - matched controls . . demonstrated a significant decrease in csf zinc but could find no difference in serum zinc levels between ad and age - matched controls . a decrease in serum zinc has also been reported , though it is possible that some of the ad patients included in one study were malnourished [ 104 , 105 ] . overall , there is currently no consensus on what happens to zinc concentrations in ad subjects though much of the discrepancy could be put down to differences in patient allocation , sample type , postmortem interval , or type of analysis used . lovell and coworkers [ 106 , 107 ] have mapped the expression levels of a number of the znt zinc transporters in ad . znt-1 , 4 , and 6 were all found to show increased expression in early stages of disease , though znt-1 expression was decreased during mild cognitive impairment [ 106 , 107 ] . although it is unknown whether increased expression necessarily correlates with increased activity , these changes in transporter level could result in modified subcellular zinc concentrations . an increase in znt6 would lead to an increase in zinc in the tgn which could reduce -secretase activity . it is well established that amyloid plaques contain increased concentrations of copper , iron , and zinc [ 98 , 109 ] . whilst copper and iron appear to be primarily responsible for the toxicity of a via oxidative - stress - type mechanisms [ 109 , 110 ] , zinc has a crucial role in a aggregation which is the most well - established contribution that zinc may have in ad pathogenesis . whilst the concentration of zinc required for fibrillisation to occur is contentious , with concentrations differing by 100-fold being suggested , zinc is an unequivocal partner in the process [ 83 , 111 , 112 ] . in 2006 , dong and co - workers were able to show that zinc could control the rate of self - assembly of the a peptides and go on to regulate the amyloid morphology via specific coordination sites . furthermore , it has been demonstrated that zinc can spontaneously coordinate both intra - and inter - molecular bridging between two peptides to promote a aggregation and that synaptic zinc promotes a oligomer formation and their accumulation at excitatory synapses . studies with synthetic a showed that chelation chemistry could help solubilise amyloid plaques , with depletion of zinc having a more marked effect on extracting a than depletion of copper . oral treatment with 5-chloro-7-iodo-8-hydroxyquinoline ( clioquinol cq ) in tg2576 mice resulted in a 49% reduction in cortical amyloid deposition . although cq has a fairly low affinity ( nm ) for both copper and zinc , it was still able to release the ions from the a binding site . a pilot phase ii trial in humans showed a decrease in cognitive decline and a reduction in plasma a1 - 42 in moderately severe ad compared with placebo control . it has been suggested that although cq may chelate copper and zinc from metallated a and promote disaggregation , it may not completely holt the aggregation process . a second generation chelator ( pbt-2 ) , with improved blood brain barrier penetration , has just completed a phase ii clinical trial in early ad with promising results showing good tolerance , a reduction in csf a and neuropsychological testing . recently , it has been shown that zinc can also accelerate the aggregation of a tau peptide under reducing conditions . zinc inhibited the formation of intramolecular disulphide bonds but promoted intermolecular bonds between key cysteine residues . furthermore , zinc exposure has been shown to increase the phosphorylation of pi3k and mapk - dependent pathways which are key players in tau modifications . the essential requirement for znt3 in loading zinc into synaptic vesicles would suggest that this transporter could have a major impact on zinc signalling in the neuron , even regulating cognitive function . whilst a lack of zinc signalling in brain slices from znt3 mice confirmed the vesicular origin of the released zinc , the mice failed to express a cognitive phenotype . initial studies detailed a 20% reduction in total zinc level and a loss of histochemically reactive zinc in the synaptic vesicle ; however , there was no impairment of spatial learning , memory , or sensorimotor function . the implication being that the vesicular zinc is not required for cognitive function or that compensatory mechanisms made up for the deficits . however , a follow - up study demonstrated marked differences in learning and memory when an older ( 6 month ) cohort of mice was used , suggesting that the lack of effect in the previous study was due to the young age ( 610 weeks ) of the mice and highlights the importance of aging ( the most significant risk factor ) when modelling ad pathology . the results obtained from the older znt3 cohort established a requirement for zinc in memory function and the maintenance of synaptic health upon aging . adlard and colleagues proposed that -amyloid pathology could cause cognitive impairment by trapping zinc within plaques rather than via a directly toxic mechanism . the zinc immobilisation by amyloid would then have similar consequences as a loss of znt3 activity with a loss of zinc - dependent synaptic modulation promoting cognitive decline . an alternative approach to minimising the consequences of released zinc could be to promote mechanisms which enhance reuptake . recently , it has been shown that the cellular form of the prion protein ( prp ) is an evolutionary descendent of the zip family of divalent metal transporters . in particular , zips 5 , 6 , and 10 were found to have a prion - like domain with significant structural similarity . as both prp and the zips bind divalent metal ions via histidine - rich motifs contained with n - terminal repeating sequences , this could suggest that prp is involved in zinc sensing , scavenging , or transport . in agreement with that possibility , we have shown that prp promotes zinc uptake ( watt et al . , unpublished ) . ensuring efficient clearance of extracellular zinc from the synaptic cleft via prp would exploit an existing physiological process . furthermore , enhancing zinc uptake would help prevent its ability to contribute to the synaptic targeting of a oligomers , thus preserving synaptic function and maintaining the proposed ferroxidase activity of app . as prp levels decrease with age and in sporadic ad , it is possible that zinc is cleared less efficiently from the synaptic cleft enhancing aggregation of a and inhibiting app ferroxidase activity to promote a pro - oxidative environment . this would suggest that preserving prp function during ad could provide multifactorial benefits , an inhibition of bace1 which would reduce a formation and ensure efficient clearance of zinc from the synaptic cleft to prevent aggregation of a peptides , as well as provide protection against oxidative stress [ 130 , 131 ] . it is clear that zinc not only plays critical roles in the structural and functional integrity of many proteins , but that it also modulates the activity of glutamatergic synapses and indeed may act as a neurotransmitter in its own right . several of the enzymes involved in processing app and a are zinc metalloproteases , with an essential requirement for zinc in their catalytic activity . although zinc dyshomeostasis may contribute to the development of ad , further work is required to clarify the molecular and cellular mechanisms affected by zinc under both normal and disease situations .

zinc , the most abundant trace metal in the brain , has numerous functions , both in health and in disease . zinc is released into the synaptic cleft of glutamatergic neurons alongside glutamate from where it interacts and modulates nmda and ampa receptors . in addition , zinc has multifactorial functions in alzheimer 's disease ( ad ) . zinc is critical in the enzymatic nonamyloidogenic processing of the amyloid precursor protein ( app ) and in the enzymatic degradation of the amyloid- ( a ) peptide . zinc binds to a promoting its aggregation into neurotoxic species , and disruption of zinc homeostasis in the brain results in synaptic and memory deficits . thus , zinc dyshomeostasis may have a critical role to play in the pathogenesis of ad , and the chelation of zinc is a potential therapeutic approach .

1. Introduction 2. Physiological Role of Zinc in the Brain 3. Role of Zinc in APP Processing 4. Role of Zinc in A 5. Zinc Binding to A 6. Role of Zinc in Alzheimer's Disease 7. Conclusions

taiwan and the offshore island of penghu came under the japanese rule in 1895 under the treaty of shimonoseki , when the ching government of china ceded the islands to the japanese government . in 1911 , however , japanese ruled taiwan until the end of the second world war in 1945 . then , the nationalist government of china came over and took control of taiwan until this day . the first report of taeniasis in taiwan was made by oi in 1915 , when he found 2 positive cases in a fecal parasitological survey of 301 persons composing of prisoners , students , and patients in taichung , central taiwan . in 1927 , oi reported that 2 japanese immigrants were shedding taeniid eggs out of 220 people surveyed for intestinal parasites in hualien port city . then , in 1928 , yokogawa and his associates reported that out of 812 aborigines surveyed in hsinchu , 163 ( 20% ) were found to be excreting taeniid eggs . it was not until 1952 , when huang and associates [ 4 - 6 ] reported that 20.5% ( 130/634 ) of the aborigines surveyed in wulai , taipei prefecture , 16.3% ( 300/1,839 ) in lotung , ilan prefecture , and 9.7% ( 49/503 ) in nan - ao , ilan prefecture , were positive for taeniid eggs shedding , respectively . since then , about 20 reports on the prevalence of taeniasis in humans in taiwan had been published in the 1960s , all under the assumption that the causative agent was taenia saginata . taenia solium is extremely rare in taiwan with only 5 cases being reported from 1957 to 1970 by hsieh in southern taiwan ( cited in chung & liu ) . it was only in 1966 , when huang and associates first proposed that the taenia tapeworm infecting the taiwan aborigines in such high prevalences might not be the same as the classical t. saginata . they observed that the aborigines do not have access to beef , and their main animal protein source came mainly from wild boars and other hunted wildlife . it was only in the 1970s that experimental infection of the eggs of taiwan taeniid and that of the american t. saginata was carried out in bovine calf and goats for comparison . the cysticerci of the american isolate were found in the muscles of the neck , rib , heart , and legs but not in the liver . whereas , about half of the cysticerci of the taiwan isolate were found in the liver of the infected calf . moreover , no hooklets were observed in any of the american isolate cysticerci , but 88% of the taiwan isolate cysticerci had hooklets on their rostellum . in addition , it was also observed that the various morphormetric parameters , such as the body length and width , protoscolex , and sucker diameter were larger for the american isolate than the taiwan isolate . all the cysticerci of the taiwan isolate in the experimentally infected goat were recovered only from the liver , and all of them had hooklets . it was later observed that the cysticerci of taiwan taenia could not grow in the liver of the cow because they degenerate at 2 months post - infection . in the 1980s , it was apparently becoming clear that taiwan taenia might be a different species than that of the classical t. saginata , based on the site of predilection being in the liver , its developmental morphology , and the pig serving as its natural intermediate host ( table 1 ) . the paradox of this parasite epidemiology is that in the area where t. saginata - like infection in humans is widely prevalent , the inhabitants had little chance of eating beef , and cysticercus bovis were not present in the bovids in that area . however , the inhabitants had the habit and chance of eating raw liver of pigs . then , fan and collaborators from other countries observed that taeniids with similar characteristics to taiwan taenia were also found in other asian countries such as korea ( cheju - do island ) , indonesia ( samosir island ) , the philippines , thailand ( chiang mai ) , and myanmar [ 13 - 15 ] . in the early 1990s , despite the overwhelming genetic evidence that the taiwan taenia might be a new species , american and australian workers still suggested that it would be more appropriate to classify it as a subspecies of t. saginata . thus , in 1995 , fan and associates proposed that the taiwan taenia be named as t. saginata asiatica , and the classical t. saginata found in america and europe as t. saginata saginata . today , that parasite , which is prevalent in many asian countries , is now internationally recognized as a distinct species , namely , t. asiatica , mainly through the efforts and description of eom and colleagues in korea . fan and his coworkers published more than 100 papers on t. asiatica . he passed away on 2 september , 2008 , due to an aortic aneurysm at the age of 86 . cysticerci of t. asiatica have been recovered mainly from the liver of pig , calf , goat , and monkey after oral inoculation of the eggs . however , only calcified and degenerated cysticerci were observed in the liver of goat and monkey . t. asiatica cysticerci were found to be able to develop to maturity in scid mice and also mongolian gerbil after subcutaneous injection of oncospheres . these cysticerci were able to grow to maturity in the rodents and then develop into the tapeworm stage in the rodent alternative definitive host or in humans . humans infected with taeniasis infection experience many types of clinical symptoms but not all of them are the same . table 2 shows the clinical manifestation of taeniasis among aborigines in taiwan and these patients were most probably infected with the taiwan taenia . to study the various symptoms of taiwan taeniasis and to obtain the adult worm , many brave researchers had volunteered to orally infect themselves with cysticerci of t. asiatica by eating the raw pig liver ( fig . since there were many taeniasis patients in taiwan through the 6 decades , many types of drugs had been used in the chemotherapeutic deworming trials . these drugs include atabrine ( quinacrine ) , dichlorophen ( arecoline ) , bithionol ( bithin ) , yomesan ( niclosamide ) , acanil ( mebendazole ) , albendazole , and praziquantel ( table 3 ) . it was observed that niclosamide ( table 4 ) , albendazole ( table 5 ) , and mebendazole were not very efficacious against human t. asiatica infections . however , rim et al . stated that albendazole was effective for treatment of t. saginata and t. solium . nevertheless , it must be noted that the efficacy of anthelmintic drugs can be influenced by the patient 's physiological status such as being in a fasting or non - fasting condition . praziquantel , at a single dose of 150 mg , was found to be the most effective against t. asiatica infection in humans , without causing any side reaction . however , sometimes no complete worms could be recovered from the feces of the patient after treatment , probably due to dissolution of the worm by the drug . atabrine , despite producing some side effects , can still be used , in properly controlled dosages , as the drug of choice for human t. asiatica infection if we need to recover the expelled worms for morphological examinations . it can be taken orally at a total of 1 gm divided into 2 equal doses given at 30 min interval , after the patient is fasted and given 4 gm of sodium bicarbonate to prevent vomiting . the patient should then be given a purgative of magnesium salt ( 25 g in 1 liter of water ) at 1.5 hr after taking the second dose . the expelled worm can then be collected from the feces within a few hours . to date , the most number of worms collected from a single patient in taiwan was 24 specimens , after medication with atabrine ( fig . the pig serves as the natural intermediate host of t. asiatica and the site of predilection is in the liver ( fig . 4 ) . however , other parasitic pathogens might also cause apparently similar hepatic lesions . a differential comparison of the hepatic lesions caused by other parasites t. asiatica is still present in taiwan today but in only some aborigines who live in the mountainous areas . however , the cases are getting rarer with the improvement of rural medical health services . taenia asiatica has always been there and has come a long way for its recognition .

an overview of the epidemiological , biological , and clinical studies of taenia and taeniasis in taiwan for the past century is presented . the phenomenal observations that led to the discovery of taenia asiatica as a new species , which differ from taenia solium and taenia saginata , are described . parasitological surveys of the aborigines in taiwan revealed a high prevalence of taeniasis , which might be due to the culture of eating raw liver of hunted wild boars . chemotherapeutic deworming trials involving many patients with taeniasis were discussed . praziquantel was found to be very effective , but sometimes complete worms could not be recovered from the feces after treatment , probably due to the dissolution of the proglottids . atabrine , despite some side effects , can still be used , in properly controlled dosages , as the drug of choice for human t. asiatica infection if we need to recover the expelled worms for morphological examinations . research results on the infection of t. asiatica eggs from taiwan aborigines in experimental animals were also noted . since the pig serve as the natural intermediate host of t. asiatica and the predilection site is the liver , a differential comparison of other parasitic pathogens that might cause apparently similar lesions is also presented .

EARLY REPORTS OF HUMAN TAPEWORM INFECTIONS IN TAIWAN DISCOVERY OF TAIWAN EXPERIMENTAL ANIMAL INFECTION WITH CLINICAL MANIFESTATIONS AND CHEMOTHERAPY OF TAENIASIS PATIENTS IN TAIWAN LESIONS IN THE PIG LIVER PRESENT STATUS OF TAENIASIS IN TAIWAN

ameloblastoma is one of the most common types of odontogenic tumor , however , it accounts for only 1% of all oral tumors . it is a benign tumor whose importance lies in its potential to grow to enormous size resulting in bone deformity . the origin of the tumor is thought to be from sources that include residual epithelium of the tooth - forming apparatus , such as the epithelial cell rests of malassez ; epithelium of odontogenic cysts ; basal cells of the surface epithelium ; epithelium of the enamel organ ; and heterotopic epithelium from extraoral sites , such as the pituitary gland . the unicystic ameloblastoma ( ua ) was first described as a distinct entity by robinson and martinez , although there were several references to these lesions in the earlier literature . it has been termed variously as mural ameloblastoma , intracystic ameloblastoma , cytsogenic ameloblastoma , cystic ameloblastoma , and plexiform ua . the term unicystic ameloblastoma refers to those cystic lesions that show clinical , radiographic , or gross features of a jaw cyst , but on histologic examination show a typical ameloblastomatous epithelial lining part of the cyst cavity , with or without luminal and/or mural tumor growth . this variant is believed to be less aggressive , tends to affect patients at a younger age , and its response to enucleation or curettage is more favorable than the classic solid or multicystic ameloblastomas . it is noteworthy that the ua series published by philipsen and reichart showed that mandible to maxilla ratio varied from 3 to 13:1 and the posterior mandible is the single most often affected region . the report is a rare case of occurrence of ua in the maxilla of a 25-year - old male patient . ua , a variant of ameloblastoma , was first described by robinson and martinez and accounts for 10%15% of all ameloblastomas . the term unicystic ameloblastoma is derived from the macro- and microscopic appearance , the lesion being a well - defined , often large monocystic cavity with a lining , focally but rarely entirely composed of odontogenic ( ameloblastomatous epithelium ) . it is often accompanied by an innocuous epithelium of varying histologic appearance that may mimic the lining of a dentigerous or radicular cyst . some investigators believe that the ua arises from preexisting odontogenic cysts , in particular dentigerous cyst , while others maintain that it arises de novo . leider et al proposed 3 pathogenic mechanisms for the evolution of ua : ( 1 ) the reduced enamel epithelium associated with a developing tooth undergoes ameloblastic transformation with subsequent cystic development ; ( 2 ) ameloblastoma arise in dentigerous or other types of odontogenic cysts in which the neoplastic ameloblastic epithelium is preceded temporarily by a nonneoplastic stratified squamous epithelial lining ; and ( 3 ) a solid ameloblastoma undergoes cystic degeneration of ameloblastic islands with subsequent fusion of multiple microcysts and develops into a unicystic lesion . the unicystic variant occurs most commonly in the mandible as an intrabony lesion during the second or third decade of life . maxillary ua are very rare . the first case of maxillary ua was reported by gardner and colleagues in 1987 , which occurred in a 12-year - old boy in the molar area . the ua occurs in a younger age group , with slightly more than 50% of cases occurring in patients in the second decade of life . between 50% and 80% of cases are associated with tooth impaction , the mandibular third molar being most often involved . the mean age for unilocular , impaction - associated ua is 22 years , whereas the mean age for the multilocular lesion unrelated to an impacted tooth is 33 years . continued growth of the tumor and enlargement of the involved area may eventuate in the ulceration of the overlying mucosa . small lesions tend to be discovered more often on routine radiographic examination or as a result of local effects produced by the tumor . such local effects include tooth mobility , occlusal alterations , and failure of eruption of teeth . radiographic appearance of ua presents with unilocular and multilocular patterns with clear predominance of unilocular configuration . it is often difficult to distinguish ua upon panoramic radiograph or ct scan images . in a clinicopathologic study , li et al showed that 75% of ua are in fact temporarily diagnosed as odontogenic cysts , such as a dentigerous cyst or a keratocyst . histologically , the minimum criterion for diagnosing a lesion as ua is the demonstration of a single cystic space lined by odontogenic ( ameloblastomatous ) epithelium often seen only in focal areas . histologic subgrouping ( modified after ackermann et al ) by philipsen and reichart : true nature of the lesion becomes evident only when the entire specimen after enucleation is available for histopathologic examination . the specimen should be subjected to multiple and serial sectioning for examination of cells and tissue configuration of an ameloblastomatous nature in intramural nodules . plexiform ua , the histologic equivalent of intraluminal ua , refers to a pattern of epithelial proliferation that has been described in dentigerous cysts . ua diagnosed as subtypes 1 and 1.2 can be treated conservatively [ careful surgical enucleation ] , whereas uas belonging to 1.2.3 and 1.3 subtypes should be treated aggressively . aggressive approach can also be utilized if infiltration from the epithelial cyst lining into the cyst wall has been demonstrated . lau et al in their study on 132 patients of ua observed that the recurrence rate was 3.6% for resection , 30.5% for enucleation alone , 16% for enucleation followed by application of carnoy 's solution , and 18% for marsupialization . the surgical treatment of the present case consisted of careful enucleation of the whole lesion , followed by chemical cauterization and extraction of all the involved teeth . a 25-year - old male patient , a laborer by profession , reported to the outpatient department of sardar patel post graduate institute of dental and medical sciences , lucknow , with the chief complaint of painless swelling on the left side of the face since one and a half years [ figure 1 ] . extraoral swelling on the left side of the face the patient was apparently asymptomatic one and a half years back . then he noticed a swelling on the left side of the face , swelling was painless in nature from its inception , and initially of a small dimension , which gradually increased in size up to the present size . the patient had consulted at another medical college for the same complaint 6 months earlier and was operated under local anesthesia . an intraoral incisional biopsy was performed after the extraction of first premolar from the left maxillary quadrant . his physical examination revealed no abnormality other than those related to the chief complaint . on extraoral examination , well - circumscribed , nontender , nonfluctuant , smooth surfaced swelling of hard consistency , spherical in shape and approximately 5 4 cm in size was present in the left maxillary region extending from midline to 5 cm anterior to the tragus . obliteration of nasolabial fold was present along with slight elevation of alar base on the left side . on superficial examination of the nostrils , the nasal floor was found to be elevated in the left nostril . on intraoral examination , bicortical expansion was present in the left maxillary quadrant vestibular area extending from midline to third molar , causing complete obliteration of vestibular on the buccal side and also extending into the palatal region from the left maxillary central incisor region to the greater palatine foramen region and up to the midpalatal region . intraoral swelling showing bicortical expansion and vestibular obliteration vitality test revealed 11 , 21 , 22 , 23 to be vital and 25 , 26 , 27 to be nonvital . needle aspiration performed through area of fluctuance revealed yellow straw colored fluid with plenty of cholesterol crystals . detailed radiographic examination ( including 3-d ct scan ) revealed the presence of multilocular lesion extending from left maxillary central incisor to the third molar region . multilocularity is of honey comb appearance in the anterior part of the maxilla up to premolar , whereas posterior molar part showed soap bubble appearance [ figure 3 ] . complete obliteration and haziness of left maxillary sinus along with involvement of lateral wall of piriform aperture was observed [ figure 4 ] . interestingly , anterior teeth up to the canine showed mild displacement , which is suggestive of less aggressive nature , whereas premolar and molar showed extensive root resorption , which indicates more aggressive nature of the lesion . multilocular radiolucency 3-d ct scan reveals obliteration of left maxillary sinus with involvement of the wall of piriform aperture the patient was operated under general anesthesia and with the help of intraoral approach and osteotomies , the lesion was thoroughly removed leaving sufficient tissue margin . the ameloblastoma was completely surrounded by a dense fibrous capsule and lined with ameloblastic epithelium , with tall columnar basal layer , subnuclear vacuoles , reverse nuclear polarity , and central layer of edematous , stellate cells . histologic analysis reveals ameloblastic epithelium and dense connective tissue postoperative recall checkup was performed to observe recurrence for a period of 1 year in which noticeable improvement was seen clinically extraorally and intraorally [ figures 7 and 8 ] . the paranasal sinus radiograph showed bone healing and reduction in size of radiolucency [ figure 9 ] . during the recall checkup and subsequent follow - up period , there was no evidence of recurrence and the patient showed a drastic improvement in his condition . preoperative diagnosis of ua can be difficult or sometimes impossible because this variant of ameloblastoma shares significant clinical and radiographic similarities with odontogenic cysts and tumors and because incisional biopsy may not be able to reflect the true nature of the lesion . long - term follow - up is mandatory because recurrence may appear years after tumor removal .

the term unicystic ameloblastoma ( ua ) refers to those cystic lesions that show clinical , radiographic , or gross features of a jaw cyst , but on histologic examination show a typical ameloblastomatous epithelium lining part of the cyst cavity , with or without luminal and/or mural tumor growth . although the histology suggests that cystic ameloblastomas follow a biologically low - grade course , recent evidence suggests that they may often behave clinically as aggressive tumors . this is supported by the high incidence of cortical perforation , tooth resorption , increase in lesion size , bony destruction , and a high rate of recurrence after simple enucleation . here , the authors present a case report on unicystic variant of ameloblastoma in the maxilla . an attempt has been made to emphasize that it can involve the maxillary jaw , which is rarely affected and could be more aggressive than previously thought . a literature review on the topic has been added along with the case report . it is important to remember that a proper and timely diagnosis of the character and extent of a ua ( with a thorough histopathologic examination of the entire specimen ) can help in the overall long - term well - being of the patient .

I R C C

wandering spleen is a known but rare entity . it may present as an acute abdominal emergency if the vascular support to the spleen is obstructed due to torsion we report a case of a wandering spleen in a 14-year - old girl with recurrent abdominal pain due to venous outflow obstruction resulting in developing splenorenal collaterals . in the presence of splenorenal collaterals on imaging a twisted wandering spleen should be considered , even if the spleen is in its normal position . a 14-year - old girl was admitted to the pediatric department of a regional hospital with a 3-week history of recurrent abdominal pain , malaise , and fatigue without fever . laboratory findings were negative for epstein barr virus ( ebv ) , cytomegalovirus ( cmv ) , and hepatitis igm ; aspartate transaminase ( asat ) , alanine transaminase ( alat ) , carcinoembryonic antigen ( cea ) , ca 125 , and alfa - foetoprotine were all within normal range ; hb was 8.0 mmol / l , leucocytes 5.1 10/l with a normal differentiation and thrombocytes 108128 10/l during hospitalization . on initial ultrasound ( us ) , the spleen had a normal architecture of the parenchyma ( fig . 1 ) and a normal blood flow on color doppler . the hepatic artery and portal vein showed a normal blood flow and direction on color doppler . differential diagnosis was splenomegaly e causa ignota . because there were no signs of infection , liver disease , hematologic , or autoimmune disease . as clinical symptoms progressed without further explanation , an mri of the abdomen was made 10 days after the initial us . it also showed torsion of the splenic hilar vessels and spontaneously enlarged splenorenal collaterals ( fig . the patient was referred to a tertiary pediatric hospital where a pediatric surgeon was consulted . at the first elective moment ultrasound shows a splenomegaly ( 19 cm ) located in the normal left upper abdominal quadrant . magnetic resonance imaging : the arrows show the venous escape of splenorenal collaterals at the left kidney side . after untwisting the spleen counterclockwise , the spleen was easily brought into the left upper quadrant of the abdominal cavity . through the 12-mm torcart the postoperative course was uneventful and she left the hospital 4 days after the surgery . she was admitted at the emergency department and us showed a stable position of the spleen in the left upper quadrant of the abdomen . at 3 months follow - up , she was without complaints and us showed again a stable position on the left upper quadrant . it usually presents between the age of 20 and 40 years.1 patients may be asymptomatic or complain of acute or chronic recurrent abdominal pain . sometimes a mobile mass is detected in the abdomen on physical examination . the differential diagnosis of a mobile mass in the abdomen consists of a myoma , an ovarial tumor or cyst , a lymphangioma , an inflammatory pseudotumor,2 and in less than 0.2% incidence a wandering spleen.3 a wandering spleen is characterized by a mobile spleen migrating from the left upper abdominal quadrant to more caudal and pelvic regions . however , as is shown in our case , the migration is not always found on physical examination . the increased laxity of suspensory ligaments leaves the spleen solely attached to its vascular pedicle , which may result in migration of the spleen due to lengthening of the vascular pedicle . this leads to splenic congestion and to the development of venous outflow escape , creating collaterals to the upper gastrointestinal tract and to the splenorenal area.4 in our case , splenorenal collaterals were seen on mri , without hepatobiliary abnormalities suggestive for portal hypertension . it is safe , rapid , and efficient to analyze the location , size , and vascularization of the spleen . changes of its normal position , together with an abnormal splenic size correlated with the age of the patient5 and vascular obstruction with collaterals seen on color doppler us can be seen as pathognomonic signs for a wandering spleen . a whirled appearance of the splenic vessels and the surrounding fat is suggestive for torsion of the vascular pedicle , together with ischemia due to a temporary disrupted blood flow in the hilar and parenchymal vessels . color doppler us allows the evaluation of patency and flow direction of the hilar and parenchymal splenic vessels . in splenic torsion , the hilar and parenchymal vessels show a low or absent amplitude of blood flow profile . ischemia of the parenchyma is not only characterized by a change in blood flow but also by a heterogeneous echogenicity of the spleen.6 torsion of the spleen can be so severe that it may result in ischemia and acute splenic enlargement . if torsion progresses to 360 degrees , the arterial vessels become compromised thereby increasing the risk for an acute splenic infarction . nonoperative treatment of a wandering spleen has a 65% chance of torsion with ischemic infarction of the spleen7 and therefore surgery with fixation of the spleen is generally advised . both congenital and an acquired conditions are described as being the cause of wandering spleens . for example , malformation or even absence of the splenic suspensory ligaments play a role in the congenital condition.8 while trauma , postdiaphragmatic hernia repair are well known acquired conditions . however , malaria , infectious mononucleosis , benign hematologic diseases , and hormonal changes are less known but have also been described as etiologic factors that could induce an acquired wandering spleen.8 splenectomy or splenopexy is the treatment of choice . only in case of a splenic infarction with complete necrosis or signs of malignancy a splenectomy needs to be performed.4 in most cases , a splenopexy can be done either by laparoscopy or laparotomy.8 in general , it is possible to laparoscopically derotate the spleen ( if necessary ) and fixate the spleen to the abdominal wall or diaphragm with resolvable meshes . also , opening of a peritoneal pocket in the left upper abdominal wall has been suggested to reposition and fixate the spleen.7 only in cases of severe infarction with necrosis and in cases of severe bleeding , the spleen needs to be removed . in conclusion , signs of recurrent abdominal pain , splenomegaly , and splenorenal collaterals on imaging techniques even though the spleen is in its normal position should be suggestive for a twisted wandering spleen .

wandering spleen is a rare cause of acute or chronic recurrent abdominal pain with a risk of splenic torsion and infarction . we describe a case of a 14-year - old girl with chronic recurrent abdominal pain with a palpable spleen in normal position on the initial physical examination . laboratory findings were normal . a normal blood flow was seen on the initial ( color doppler ) sonography . magnetic resonance imaging showed an enlarged spleen in the pelvic region with torsion of hilar pedicle and splenorenal collaterals . semielective , a laparoscopic splenopexy was performed without complications . a twisted wandering spleen should be included in the differential diagnosis of recurrent abdominal pain despite possible normal positioning of the spleen . the presence of splenorenal collaterals on imaging techniques can be used as a diagnostic hallmark .

Introduction Case Report Discussion Complications

arsenic is a known carcinogen , and increasing evidence also suggests a possible role of chronic arsenic exposure in the development of chronic diseases , including cardiovascular diseases . cardiovascular diseases associated with high levels of arsenic in the drinking water include atherosclerosis , hypertension , cerebrovascular diseases , ischemic heart diseases , and peripheral vascular disease [ 3 , 4 ] . the possible role of chronic arsenic exposure in the development of hypertension has been previously reported from taiwan , bangladesh , and the united states [ 57 ] . these studies reported that individuals drinking arsenic - contaminated water for a long period of time might be at higher risk of developing hypertension compared to those unexposed to arsenic , and the effects were dose dependent . hypertension is one of the major risk factors for cardiovascular diseases and is considered a major public health problem worldwide . a total of 972 million adults were reported to have hypertension in 2000 and that number is estimated to increase by 60% , to a total of 1.56 billion , by the year 2025 . , only a few cross - sectional and cohort studies have investigated the association between hypertension and chronic arsenic exposure . therefore , it is important from the public health perspective to explore the role of chronic arsenic exposure in development and prevention of hypertension . in this study , we conducted a meta - analysis that included all relevant cross - sectional and cohort studies of chronic arsenic exposure and hypertension . the meta - analysis provides greater precision in estimating risk especially when data are scarce and inconclusive . our analysis includes a careful assessment of the possible effects of study quality as well as other biases on the meta - analysis results . the research question was defined as is there any association between chronic arsenic exposure and hypertension ? this question was then broken down to cover specific search terms such as hypertension , chronic arsenic exposure , arsenite , the search was first carried out in ovid medline and google scholar in september 2009 , without limitation on the time of publication . we also replicated the search in embase and pubmed , but no additional references were identified through these databases . the search was last updated in february 2012 to locate new studies published after the initial search . the references cited in the collected list of articles were also hand - searched for additional relevant studies . the included studies ( 1 ) were observational studies , that is , cross - sectional , case control or cohort studies , of chronic arsenic exposure through drinking water and hypertension , ( 2 ) reported a relative risk ( rr ) or odds ratio ( or ) , or such parameters could be estimated from the published data , and ( 3 ) measured arsenic , using a laboratory technique . two investigators ( t. a. and r. e. y. ) screened the initial list of articles to identify articles that were irrelevant and , therefore , discarded from the list . to facilitate faster screening , articles were first judged on the basis of their titles , where obviously irrelevant articles were discarded . the abstracts of the remaining articles were then read by three investigators ( t. a. , b. r. , and a. h. m. ) to ensure that the main subject of the study was related to arsenic exposure and hypertension . articles whose abstracts showed that the study was not relevant to the objective of the meta - analysis were discarded . after the screening , information for the articles was extracted and a quality evaluation was done . the data items extracted from each study were general information : first author 's name and affiliation , year of publication , country , and region in which the study was conducted ; study design : population , number and sources of study participants , and type of study ; exposure and outcome measurement : analytical methods for measuring arsenic , speciation of arsenic , duration of arsenic exposure , relevant information on individual level of exposure assessment , and measurement of hypertension ; analysis : covariates for adjustment in multivariate models , adjusted and unadjusted or stratified effect estimates ( i.e. , rr and or ) and 95% confidence intervals ( cis ) . if a study did not report cis , the standard error and the resulting ci from the p value were estimated , where possible . for cross - sectional studies , ors were extracted as the estimate of the effect of arsenic exposure . for cohort studies , quality assessment was facilitated through the use of a standardised questionnaire which was developed specifically for this study . the questionnaire was a comprehensive scoring instrument based on critical appraisal principles and understanding of the methodological issues of population selection , measurement of arsenic exposure and outcome , adjustment for potential confounders , and appropriateness of analysis . each criterion was given weighted scores to evaluate the quality of the studies in comparison to each other , with key factors being given specific scores . although the scoring in itself can be subjective , it enables comparisons among the studies . three independent readers ( t. a. , r. e. y. , and a. f. ) scored each of the studies and were blinded to the others ' assessments . any significant disagreement between the readers was resolved through discussion . for minor differences , the maximum score value that could be assigned to each study was 100 , and this score summarised the overall quality of the study . the score was the weighted sum of four major domains of quality : selection issues ( score weight 20% ) , measurement issues ( of exposure and outcome , score weight 50% ) , adjustment of confounding factors ( score weight 20% ) and analysis ( score weight 10% ) . the analysis section was given the least weight because if the other three sections were of good quality but the analysis was not carried out properly , the data could often be reanalyzed . two scoring systems were developed , one for cross - sectional studies and one for prospective studies . to assess the interrater reliability of the study quality scores , reliability and reproducibility were analyzed by computing intraclass correlation coefficients ( iccs ) for absolute agreement between raters on each quality domain along with the overall score . to conduct the meta - analysis , ors were extracted from cohort studies and used to estimate the effects , with the exception of one cohort study where the rr was used instead . for studies where several measures of association were reported , associations which related hypertension to amount of arsenic intake , or to arsenic intake combined with duration of exposure , were considered . pooled ors were estimated by comparing the highest exposure category to the lowest one combined for males and females . the meta - analysis included checking for heterogeneity of the ors , checking for influential studies , checking for asymmetry and publication biases , and checking for relationships between the log of effect measures and the article 's quality scores . effect estimates ( ors ) were pooled using dersimonian and laird 's inverse - variance - weighted random effects method . heterogeneity was measured using the i - statistic , which describes the proportion of total variation in study estimates that is due to heterogeneity . the influence of each study on the pooled effect measure was examined by repeating the meta - analysis while omitting each study one by one . a random effect metaregression was conducted using the logs of the effect measures ( or ) as the outcome variable and the study quality score as the explanatory variable to assess the possible impact of study quality on the effect measures . these random effect models were fitted with two additive variance components : within study variance and between study residuals [ 16 , 17 ] . the database search yielded 85 articles , 10 of which investigated the association between chronic arsenic exposure and hypertension . two of these articles were excluded from the meta - analysis because the full texts were not available . thus , the final meta - analysis comprised eight studies : seven analytical cross - sectional studies and one prospective cohort study . of these eight studies , two reported arsenic concentration only as exposure , two reported arsenic concentration and duration of drinking arsenic - contaminated water as a combined exposure value , and three reported arsenic concentration and arsenic concentration and duration of exposure separately . the average total scores and average per criterion scores for quality assessment are summarized in table 2 . the one cohort study scored better in the domains of selection and outcome compared to the other seven cross - sectional studies . the cohort study had a selection score of 18.7 ( of 20 possible ) , while the cross - sectional studies averaged 15.8 . the cohort had an outcome score of 16 ( of 20 possible ) , while the 7 cross - sectional studies averaged 14.7 . in particular , the study by zierold et al . scored low in this domain ( 1.3 ) due to missing details in the report . the 7 cross - sectional studies scored higher in the exposure ( cross - sectional = 24.3 , cohort = 20 , of 30 possible ) and confounders ( cross - sectional = 18.6 , cohort = 10 , of 20 possible ) domains . the analysis ( cohort = 9.3 , cross - sectional = 10 , of 10 possible ) domain scores were similar ; but , overall , the cross - sectional studies ( total score = 84.1 ) scored higher than the cohort study ( total score = 74 ) . good interobserver agreement on the total quality scores was verified by the intraclass correlation coefficient ( icc ) . the highest agreement was seen among scores for the exposure ( icc = 0.87 95% ci : .56.98 ) and outcome ( icc = 0.96 95% ci : 0.641.00 ) domains , and the lowest for the analysis ( icc = 0.001 95% ci : 0.240.78 ) domain . the low icc , however , was due to one rater 's disagreement on one study , but there was perfect agreement among the raters on the rest of the studies . other domains showed moderate agreement : the icc for confounders was 0.59 ( 95% ci : 0.190.90 ) while that for selection was 0.66 ( 95% ci : 0.010.93 ) . the eight selected studies were scored based on criteria that were specifically developed to assess their quality . the cohort study by wang et al . scored a total of 74 points , having scored well on selection and exposure but not on confounder criteria . the seven cross - sectional studies had an average score of 84.1 ( range = 61 to 93.3 ) . overall , the cross - sectional studies scored higher than the prospective cohort study for the confounders and exposure criteria but scored lower for the selection and outcome criteria . the studies differed in the adjustment of potential confounders , such as age , sex , and body mass index , as well . the pooled or of studies using arsenic concentration as the exposure measure was 1.9 ( 95% ci : 1.23.0 ) , while the pooled estimate for or of studies using arsenic concentration and duration including biomarker as the exposure was 1.4 ( 95% ci : 0.952.0 ) . < 0.001 ) , while , for the concentration and duration studies , i was 80% ( p the meta - analysis results are presented with forest plots in figure 1 . in the forest plots , the point estimate for one study is represented by the centre of each rectangle . the size of the rectangle is relative to the weight of the point estimate when the results are pooled . the length of the horizontal line through the rectangle represents the 95% confidence interval of the point estimate . the pooled estimate is represented by the diamond on the lower portion of the plot . the vertical axis through the diamond represents the point estimate , and the horizontal end corners are the upper and lower 95% confidence boundaries . the results of the influence analysis showed that no single study exerted a disproportionate influence on the pooled estimate for either arsenic concentration or arsenic concentration and duration ( figure 2 ) . investigation of the publication bias showed some evidence of positive results for the concentration and duration studies . the egger 's test p value for arsenic concentration studies was 1.00 , while the egger 's test p value for the concentration and duration studies was 0.004 . the funnel plot shows possible bias only for concentration and duration studies ( figure 3 ) . using the scores from the quality assessment , a metaregression was performed to verify the dependency of the outcome measure on the quality scores . of all the scoring criteria , the quality of exposure measurement and total quality was significantly associated with the outcome measure . for one unit increase in the score from the exposure domain , the or decreased by 6% ( p = 0.004 , 95% ci : 2.1%10.7% ) . in the studies included in the meta - analysis , arsenic exposure was measured by different studies in different ways . even when two studies used the same units of measurement , they may still have differed in categorization and definition of subjects being exposed to arsenic . however , the definition of exposure differs from one study to another , since there is no agreement on how to express the duration of exposure or what quantities of arsenic constitute an exposure . this problem results from the fact that external validation of the methods used to determine exposure in studies is still problematic . in addition , while methods for detection of exposure to high levels of arsenic have been well characterized , measurement of arsenic exposure at low concentrations is still not very reliable . have followed the who protocol for the measurement of blood pressure and have used the criteria of diastolic blood pressure > 95 mm hg or systolic blood pressure > 160 mm hg to define hypertension , while huang et al . specified hypertension as diastolic > 90 mm hg or systolic > 140 mm hg . in the study by jones et al . , they followed diastolic blood pressure > 90 mm hg or systolic blood pressure > 140 mm hg to define hypertension . overall , this meta - analysis suggests that chronic arsenic exposure is likely to be associated with hypertension . the pooled or of arsenic concentration studies is 1.9 ( 95% ci : 1.23.0 ) and that for arsenic concentration and duration studies is 1.4 ( 95% ci:.952.0 ) . investigation of publication bias showed some evidence of positive results for concentration and duration studies . the egger 's test p value for arsenic concentration studies was 0.828 , while the p value for concentration and duration studies was 0.04 . chen et al . obtained similar results in their 2007 review of arsenic , diabetes , and hypertension . this paper included only four studies regarding arsenic exposure and hypertension and did not include a meta - analysis . in our meta - analysis , seven good quality studies were included that related arsenic exposure to hypertension using proper statistical analysis , with control groups ( table 1 ) . as opposed to the report of chen et al . , which only presented the results of their reviewed papers , the meta - analysis conducted here attempted to pool the reported ors , tested for heterogeneity , and conducted a meta - regression . to the best of our knowledge , this is the first meta - analysis that has explored the association between hypertension and chronic arsenic exposure . one of the major limitations of this meta - analysis is the limited number of studies examining the association between hypertension and chronic arsenic exposure . these studies were also heterogeneous as reflected by the high values of the i statistics . the adverse effects of arsenic on blood vessels have been demonstrated in previous studies which reported that constant exposure of rats and rabbits to arsenite caused a considerable increase in peripheral vascular resistance . the eight studies evaluated in this paper have shown how varied the impact of arsenic on hypertension , depending on factors such as sex , age , body - mass index , diabetes , and triglyceride levels of the subject population . however , an increased risk for hypertension among arsenic exposed participants has not been consistently observed . for instance , dastgiri et al . reported a significant difference both for systolic and diastolic blood pressures between exposed and unexposed subjects , while khan et al . inconsistent findings may be due to differences in measurement criteria both for exposure and outcome variables , or due to bias caused by limited consideration of potential confounders . due to these inconsistencies , the increased prevalence of hypertension for a population that is exposed to high arsenic levels can not yet be established . . however , the small number of studies and limitations in study quality pose challenges to establishing causation between arsenic exposure and hypertension . nevertheless , since a larger proportion of the rural bangladeshi population drink arsenic contaminated water and the risk of hypertension is increasing among the general population , even a small association may lead to a large number of cases and a large population attributable risk .

background . there is inconclusive evidence from cross - sectional and cohort studies that arsenic exposure is a risk factor involved in the development of hypertension . methods . a database search , using several keywords , was conducted to identify relevant studies . separate odds ratio estimates for arsenic exposure with concentration only and arsenic exposure with duration , including biomarker , were extracted from studies that met all inclusion criteria . the extracted odds ratios ( or ) comparing the highest exposure categories with the lowest in each study were pooled using the random effects methods of meta - analysis . heterogeneity of odds ratios in the included studies were analyzed using i2 statistics . results . eight studies were analyzed . using the exposure as arsenic concentration in the drinking water , the or estimate was 1.9 ( 95% ci : 1.23.0 ) , with the i2 = 92% , while using the exposure as concentration and duration , the or estimate was 1.4 ( 95% ci : 0.952.0 ) with the i2 = 80% . meta - regression was done and the quality of exposure measurement was found to be significantly associated with the effect measure . for a one unit increase in the score from exposure assessment , the odds ratio decreased by 6% . no publication bias was evident . the only major weaknesses of this study were heterogeneity across studies and small sample size . conclusions . the study findings provide limited evidence for a relationship between arsenic and hypertension . in summary , the relationship between arsenic exposure and hypertension is still inconclusive and needs further validation through prospective cohort studies .

1. Introduction 2. Materials and Methods 3. Statistical Analysis 4. Results 5. Risk Estimate and Meta-Analysis 6. Discussion 7. Conclusions and Recommendations

recurrent pyogenic cholangitis ( rpc ) was first recognized as a distinct clinical entity in the 1930s by digby . he recognized that intrahepatic biliary calculus occurred more frequently in hong kong chinese as compared to europeans . in the 1950s , cook proposed the subsequent term recurrent pyogenic cholangitis to describe the condition as a repeated infection of the biliary system with the formation of biliary stones and strictures in the biliary system . repeated infections of the biliary system have been implicated as one of the important causes of disease progression resulting in complications like biliary cirrhosis and cholangiocarcinoma [ 3 , 4 ] . the therapeutic goals for the management of recurrent pyogenic cholangitis should include firstly amelioration of the acute biliary sepsis by decompression of the infected biliary tree and this can be accomplished nonoperatively by percutaneous transhepatic biliary drainage or endoscopic sphincterotomy and/or biliary stent placement , secondly , complete clearance of calculi and particulate debris from the biliary tract , via methods such as percutaneous transhepatic cholangioscopic lithotomy ( ptcsl ) and peroral cholangioscopy and thirdly , and the elimination of bile stasis which is essential for preventing recurrent cholangitis and stone formation . therefore , it is imperative that the anatomical abnormalities including biliary tract ectasia and strictures are addressed and rectified definitively if possible . there is a myriad of interventions , including radiologically guided and endoscopic procedures , as well as surgical procedures including operative biliary drainage and hepatectomy [ 510 ] . however , the clinical presentation and subsequent management of rpc vary significantly , depending on the location and extent of the calculi , strictures , or abscesses in the biliary tree . furthermore , the different management approaches are limited by the state of the patient 's comorbid conditions and preexisting liver function . due to the complexity of the treatment and the inherent propensity for stone recurrence the objective of this study is to retrospectively analyze the disease profile of the patients treated at a single asian tertiary institution . in addition , we aim to evaluate our approach to the management of rpc over the past decade , according to the various degrees of severity and extent of the disease , and identify the patterns of recurrence in this complex clinical condition . this is a singhealth centralised ethics board approved retrospective review of a prospectively maintained database of patients with recurrent pyogenic cholangitis at change general hospital singapore , an acute tertiary centre . between first january , 2002 and october 1 , 2011 , eighty patients subsequently underwent treatment by the hepatopancreaticobiliary service at our institution ; nine patients defaulted before the initiation of treatment and were excluded from the study . the diagnosis of rpc was made based on the following premises : firstly , the presence of cholangitis defined by clinical pictures suggestive of cholangitis , including but not limited to the symptoms of fever , jaundice , right upper quadrant or central abdominal pain and this was supported by a biochemical picture of raised white cell count ( wbc ) , bilirubin ( bil ) , and alkaline phosphatase ( alp ) , consistent with cholangitis , secondly , imaging investigations suggestive of rpc evidenced by the presence of intrahepatic stones , with or without intrahepatic biliary strictures , ectatic and dilated intrahepatic ducts , liver atrophy , or liver abscesses , thirdly , confirmed pathological features of rpc on histological examination in patients who had undergone hepatectomies . the exclusion criterion was defined as the presence of a neoplastic ( i.e. , cholangiocarcinoma ) , congenital ( i.e. , choledochal cysts or caroli 's disease ) , autoimmune ( i.e. , primary sclerosing cholangitis ) , or postoperative causes for the biliary obstruction . the definition of the extent of ductal involvement is in accordance with the terminology of the hepatic anatomy sanctioned by the international hepatobiliary pancreatic association . the complexity of the bile duct involvement was deemed to be simple if the disease was restricted to first order ducts and complex if the disease involved the second and third order ducts . routine assessment of the bile ducts with intraoperative choledochoscopy was performed for those cases that underwent operative management . for cases which underwent the nonoperative treatment options ( i.e. , ercp and ptc guided procedures ) , assessment of the ducts was based on the cholangiography images . strictures were defined as a narrowing of the bile duct calibre in comparison with an undiseased bile duct of a similar generation associated with proximal dilatations of obstructed ductal system . ectasia of the bile duct was determined by the presence of irreversible dilatation of the bile ducts despite an adequate drainage procedure with decompression of the obstructed system . atrophy were determined if there was obvious atrophic changes of the liver parenchyma on the radiological findings or intraoperative assessment . all patients underwent preoperative imaging of the biliary tract that included either computed tomogram ( ct ) or magnetic resonance imaging ( mri ) assessment of the liver and extrahepatic biliary tree . intraoperative assessment of liver abscess and atrophy was performed and confirmed with histology where biopsy or resection was performed . the initial conservative measures for acute cholangitis consist of intravenous broad - spectrum antibiotics , fluids , adequate analgesia , and close observation of the clinical condition . in some patients when there are signs of severe cholangitis such as persistent fever , severe sepsis , septic shock , worsening abdominal tenderness , emergent therapeutic decompression , and drainage of the biliary tract is necessary . this can usually be achieved by endoscopic retrograde cholangiopancreatoography ( ercp ) guided stent insertion or sphincterotmy and removal of obstructing calculi . this has the advantage of immediate biliary decompression if the site of obstruction is at the common bile duct ( cbd ) . in situations where ercp guided removal of calculus or stent placement drain is inadequate , an addition of a percutaneous transhepatic biliary decompression is necessary . after resolution of the acute episode of cholangitis , definitive treatment is planned . for patients with isolated disease in the first order ducts , either operative biliary drainage or non - operative drainage by ercp guided procedures for patients with stones or strictures in the second order ducts and beyond , ptc guided treatment or hepatectomy were offered . in cases where there were concomitant liver abscesses , or liver atrophy , hepatectomy operative management options are described as follows : operative biliary drainage procedure which includes exploration of the common bile duct and extraction of the calculi which was performed by stone forceps , balloon catheters , or dormia baskets . biliary reconstruction was typically performed with a high choledochojejunostomy ( above the level of cystic duct insertion ) or hepaticojejunostomy . the definition of the hepatectomy was performed in accordance with the international hepatobiliary pancreatic association definitions . operative biliary drainage procedure was added if the stones could not be cleared by hepatectomy alone , usually because of contralateral intrahepatic stones or impacted common hepatic / bile ducts stones . all patients who underwent operative management options underwent cholecystectomies when the gall bladder was not previously resected . all patients underwent intraoperative choledochoscopy to confirm the level of disease before the treatment and after the operative treatment to confirm clearance of the calculi or successful treatment of the biliary strictures if present . endoscopic retrograde cholangiopancreatography ( ercp ) guided procedures include the use of ercp for sphincterotomy , stone extraction with the dormia basket , and balloon catheter , with or without placement of a biliary stent . percutaneous transhepatic cholangiography ( ptc ) guided procedures were employed when there was no liver atrophy or when patients refused surgery . ptc guided procedures included balloon catheter or dormia basket assisted removal of stones , stricture dilatation , and placement of biliary drains . postoperative morbidity and mortality were defined as complications or death within 30 days of the operation . the effectiveness of each therapeutic modality was assessed for initial stone clearance immediately after the procedure and the development of recurrent cholangitis , recurrent stones , or liver abscesses during the follow - up period . residual stones were confirmed by the cholangiography after the procedure was performed , when further removal of stones was not technically possible . disease specific mortality was defined as the cause of death attributable to biliary disease , that is , cholangitis , liver abscesses , or liver failure . long - term failure was defined as recurrent cholangitis , recurrent stones , or recurrent liver abscesses during the follow - up period . recurrent cholangitis was diagnosed based on recurrent bil > 35 , fever , and right hypochondrium pain . recurrent liver abscesses were diagnosed based on ultrasound or ct imaging performed during the follow - up . statistical analysis was performed with spss version 17.0 ; fisher 's exact test was used to compare the proportions of treatment failure and complication rates between the groups . logistic regression analysis was employed for multivariate analysis of the risk factors associated with treatment failure . the kaplan meier graph was used to express time to failure for the various treatment modalities . the patients ' ages ranged from 22 to 95 years , with a mean age of 58.2 years . there were 48 chinese , 22 malay , two filipino , two bangladeshi , two burmese , and four vietnamese patients . the general characteristics of the patients were generally similar , except for the higher proportion of bedbound patients ( n = 5 , p = 0.007 ) in the group that underwent nonoperative management . with regard to the disease characteristics , the operative management group had a significantly higher proportion of patients with liver atrophy ( n = 19 , p = 0.021 ) ; other differences in the disease characteristics 25 of them underwent ercp guided procedures and 6 of them underwent ptc guided procedures . of the 49 patients who underwent surgical procedures , eight patients underwent hepatectomy only , 11 patients underwent hepatectomy combined with operative biliary drainage procedures , and 30 patients underwent operative biliary procedures only . of those patients who underwent hepatectomy , two patients underwent bilateral hepatectomies for the treatment of bilateral disease . ercp guided procedures had an initial failure rate of 36% ( n = 9/25 ) and a 68% ( n = 17/25 ) long term failure rate in terms of stone clearance . for the patients who underwent ptc guided procedures an initial failure rate was 16.7% ( n = 1/6 ) and long term failure rate was 16.7% ( n = 1/6 ) overall , for non - operative treatment , the collective initial failure rate of stone clearance was 32.3% ( n = 10/31 ) , and the long - term failure rate was 58.1% ( n = 18/31 ) . of the patients who underwent operative biliary drainage only , three out of 30 patients had residual stones . thus the initial failure rate was 10.0% ( n = 3/30 ) and long - term failure rate was 23.3% ( n = 7/30 ) . there were no residual stones or long - term treatment failures for the eight patients who underwent hepatectomy only . the two patients who underwent bilateral hepatectomy did not suffer from initial or long - term failure . for the patients who underwent combined hepatectomy and operative biliary drainage , the initial failure rate was 18.2% ( n = 2/11 ) and long - term failure rate was 27.3% ( n = 3/11 ) , due to the residual stones in the third order ducts of the unresected contralateral liver and recurrent cholangitis and stone , respectively . considering all forms of operative management , there were an initial failure rate of 10.2% ( n = 5/49 ) and a long - term failure rate of 20.4% ( n = 10/49 ) . initial failure rate in terms of residual stone of operative compared with non - operative treatment was 10.2% versus 32.3% ( p = 0.020 ) . long - term failure rate for operative compared with non - operative treatment was 20.4% versus 61.3% ( p = 0.010 ) ( see table 2 ) . based on multivariate logistic regression , the only significant factors associated with failure were bilaterality of disease ( or : 8.101 , p = 0.007 ) and non - operative treatment ( or : 26.843 , p = 0.001 ) ( see table 3 ) . the median time to failure of the operative group was 48 months as compared to 20 months in the nonoperative group ( p < 0.010 ) . there were no patients lost to followup , censored data was attributable to the fact that the event ( failure ) has not occurred yet ( see figure 2 ) . the general complication rate of the operative procedures was 44.9% versus 22.5% in the non - operative group ( p = 0.057 ) . the significantly surgical complications were mainly attributable to wound infection , wound dehiscence , and bleeding which was not observed in the non - operative treatment group ( see table 4 ) . the postoperative biliary complications rate for the nonoperative group was 16.2% versus 10.2% for the operative group ( p = 0.513 ) . among the biliary complications , the rates for bile leak and biloma formation were 8.2% in the operative group versus 3.2% in the non operative group ( p = 0.647 ) ; the rates of cholangitis in the perioperative period were 9.7% in the non - operative group versus 2.0% in the operative group . there was no initial or long - term failure observed in the two patients who underwent bilateral hepatectomy ( see table 5 ) . there were four mortalities in the non - operative group , one patient passed away due to recurrent cholangitis and the other three passed away due to pneumonia and cerebrovascular accidents . this is because of the resultant strictures and ectatic bile ducts which predispose to bile stasis , formation of biliary calculi , and recurrent infection [ 6 , 7 ] . furthermore , the disease may result in atrophy of the affected liver segments and formation of abscesses as a consequence of the obstruction of biliary drainage and recurrent cholangitis . thus the optimal treatment methods are directed at stone clearance and prevention of recurrent disease . this can be achieved by establishing adequate biliary drainage with or without removal of the diseased biliary tract by formal hepatic / biliary tree resection . this treatment option is fairly established in the setting where there is associated liver atrophy , liver abscesses , or third order ductal calculi [ 1215 ] . however , there are many constraints for this method of treatment . inadequate liver remnant , bilobar involvement , and poor patient fitness to tolerate major resection are several factors limiting liver resection as the treatment of choice . furthermore , rpc involving the first order ducts is mainly treated by biliary drainage procedures via endoscopic , radiological , or surgical routes , without the need for hepatectomy . based on our management approach , our methods of non - operative interventions , ercp and ptc guided procedures , had a 58.1% failure rate and were significantly associated with treatment failure on multivariate analysis . this reflected a need for a better method of non - operative stone extraction and biliary dilatation . in our institution , this could be due to the failure of complete clearance of stones , most likely limited by the technical constraints of the procedure and the nature of the stones associated with rpc which are soft brown pigmented stones prone to leaving residue despite best efforts . ptc guided procedures mainly employed for access of second or third generation ducts have stone retrieval and stricture dilatation capabilities , which could have accounted for the lower failure rate as compared to ercps . nonetheless , these non - operative methods have an important role as a temporising procedure in the management of patients presenting with acute cholangitis . as shown in our study , the median time of failure of 20 months would mean that this procedure can be employed as a first line treatment for the elderly patient with significant surgical risks and yet is durable enough . based on the results , repeat ercps or ptcs should be planned within 20 months to reduce the risk of recurrent cholangitis . surgical treatment of rpcs generally yielded better results than non - operative techniques due to the surgical removal or bypass of the diseased biliary tract along with the eradication of stones in those disease bile ducts . in our series and li et al . had high rates of recurrent stones and cholangitis , this was not observed at our institution . this could be attributable to the fact that we performed resection or dilatation of the associated biliary strictures where possible . in addition , the routine intraoperative choledocoscopy aided the identification of the location of the strictures and stones and subsequent confirmation of stone clearance . we routinely performed a high biliary bypass with the bile duct above the level of cystic duct insertion or at the level of the hepatic duct to maximise the size of the biliary conduit . there was high proportion of patients with biliary ectasia in our cohort which possibly contributed to the patency of the biliary drainage . there were two treatment failures in the combined operative biliary drainage and hepatectomy group due to the inability of complete stone clearance of the third order ductal stones in the contralateral hemiliver which was not resected . in the multivariate analysis , our data showed that patients with bilateral disease had a significantly higher risk of treatment failure . similar observations were made by other studies , where bilateral disease often represented more complex disease and was treated aggressively . it has been reported in other papers that bilateral hepatectomy in which liver resection of all stone bearing segments in patients with bilateral disease achieved similar outcomes as surgical resection for patient with only unilateral disease [ 8 , 15 , 18 ] . in our series , only two patients have undergone bilateral hepatectomy for treatment of bilateral intrahepatic calculi and there was no recurrent disease seen in those patients . considering all the treatment modalities , there was a higher rate of failure in the non - operative treatment group as compared to that of the operative treatment group . this was not withstanding the relatively less severe and extensive disease for those who underwent non - operative treatment modalities . currently , there are many east asian centres in taiwan , japan , and korea with a high incidence of rpc , developing various methods of peroral or percutaneous cholangioscopic treatment modalities with encouraging results [ 9 , 10 , 19 , 20 ] . those methods have also become the main non - operative treatment modalities in preference to cholangiography guided options . it was also observed that the operative treatment group had a higher risk of developing complications of bile leak and biloma , although these too did not reach statistical significance . the reason for the bile leakge as explained by li et al . was related to unidentified aberrant biliary anatomy and recurrent cholangitis impairing bile duct healing . in addition , even bile leak tests performed intraoperatively can not predict postoperative bile leak and biloma formation . despite these risks associated with operative procedures , the complication rate is relatively low and there were no mortalities related to biliary complications . the durability of the different therapeutic modalities for rpc is also a crucial determinant of the effectiveness of those options . from the kaplan meier curve , it can be observed that operative procedures are almost three times more durable than non - operative methods . thus in an otherwise healthy patient , it is more effective to undergo an operative procedure albeit the slightly higher complication rate . although less durable , non - operative treatment methods can still be employed as temporizing procedures or continued to be offered as definitive therapy for elderly patients with poor premorbid status and a shorter life expectancy . it is known that chronic proliferative cholangitis ( cpc ) initiated by stone mechanical stimulation or repeated acute cholangitis may persist and progress within the remaining bile ducts even after stone removal . cpc leads ongoing fibrotic thickening or restenosis of the bile ducts and hyperplasia of submucosal glands that hypersecrete mucoglycoprotein . mucoglycoprotein , an important lithogenic factor , together with bile duct restenosis , facilitates stone recurrence . some authors have investigated the value of performing chemical biliary duct embolization ( cbde ) to eradicate cpc and thereby prevent the recurrence of intrahepatic calculi . however , this technique has been restricted due to the cost of complete destruction of the subsidiary hepatic segment and related bile duct . hence , until newer techniques to arrest the process of cpc can be found , the best available therapy remains the current available techniques of ductal clearance . being a retrospective review that spans a 10-year period , it would have seen advances in diagnostics , perioperative care , and improvements in endoscopic and surgical techniques . a prospective controlled trial would be ideal to better define the optimal treatment modality and outcomes between the different therapeutic modalities available . however , the varied presentation and complication , relative paucity of cases , and wide variety of therapeutic options continue to pose a formidable challenge , given the evidence of other studies [ 5 , 7 , 12 , 19 ] . despite the limitations of the study , the results of this study suggest that with appropriate case selection , operative treatment would yield more favourable and durable results over non - operative methods for the treatment of rpc .

recurrent pyogenic cholangitis ( rpc ) is characterized by repeated infections of the biliary system with the formation of stones and strictures . the management aims are to treat acute cholangitis , clear the biliary ductal debris and calculi , and eliminate predisposing factors of bile stasis . operative options include hepatectomy and biliary drainage procedures or a combination of both ; nonoperative options include endoscopic retrograde cholangiopancreatography ( ercp ) or percutaneous transhepatic cholangiography ( ptc ) guided procedures . this current study compares the operative and the nonoperative management outcomes in patients with rpc in 80 consecutive patients . in addition , we aim to evaluate our approach to the management of rpc over the past decade , according to the various degrees of severity and extent of the disease , and identify the patterns of recurrence in this complex clinical condition . initial failure rate in terms of residual stone of operative compared with nonoperative treatment was 10.2% versus 32.3% ( p = 0.020 ) . long - term failure rate for operative compared with non - operative treatment was 20.4% versus 61.3% ( p = 0.010 ) . based on multivariate logistic regression , the only significant factors associated with failure were bilaterality of disease ( or : 8.101 , p = 0.007 ) and nonoperative treatment ( or : 26.843 , p = 0.001 ) . the median time to failure of the operative group was 48 months as compared to 20 months in the nonoperative group ( p < 0.010 ) . thus operative treatment is a durable option in long - term resolution of disease . hepatectomy is the preferred option to prevent recurrent disease . however , biliary drainage procedures are also an effective treatment option . the utility of nonoperative treatment can achieve a reasonable duration of disease free interval with minimal complications , albeit inferior to operative management .

1. Introduction 2. Materials and Methods 3. Diagnostic Criteria 4. Results 5. Discussion

, poor wound healing may retard return to work or daily activities.5 during the early period after hemorrhoidectomy , patients usually need analgesics medication to relieve postoperative pain and discomfort.6 sitz bath with warm water was well accepted as a safe postoperative care after anal surgery and routinely utilized to relieve postoperative pain and promote wound healing during the posthemorrhoidectomy period.7,8 however , recent studies have revealed that warm sitz bath did not relieve pain , promote wound healing or reduce consumption of analgesics after anal surgery but offered only a significant relief in anal burning and a marginally higher satisfaction score.9,10 traditional chinese medicine ( tcm ) has been used to treat hemorrhoids for centuries in our country.11 therefore , chinese herbal decoction , xiaozhi decoction ( xzd ) , was added into sitz bath as posthemorrhoidectomy care in our clinical practice due to its positive effect on pain relief . the aim of the current prospective study was to clarify the efficacy of sitz bath with xzd as postoperative care for patients who underwent hemorrhoidectomy . between may 2013 and march 2015 , 315 patients who underwent open hemorrhoidectomy in the first people s hospital affiliated to huzhou normal college were included in this prospective study . according to the computer - based sequential method , 160 patients were randomly assigned to accept sitz bath with warm water after hemorrhoidectomy ( control group ) and 155 patients were randomly assigned to accept sitz bath with xzd ( xzd group ) after hemorrhoidectomy . inclusion criteria were as follows : 1 ) age between 18 and 75 years and 2 ) indication for hemorrhoidectomy : symptomatic iii and iv degree hemorrhoids . patients who had associated fistula , anal fissure , inflammatory bowel disease , perineal skin inflammation , proctitis , pregnancy , previous anorectal surgery or allergy to the decoction were excluded from this study . this study was approved by the ethics committee for medical research of the first people s hospital affiliated to huzhou normal college and was performed on the basis of the declaration of helsinki and good clinical practice guidelines . , metronidazole tablets were administrated at a dose of 250 mg , twice a day for 1 week . analgesic tablets containing a combination of tramadol hydrochloride 37.5 mg and paracetamol 325 mg ( ultracet ; xian janssen pharmaceutical ltd . , xian , people s republic of china ) were prescribed as needed but not more than four tablets each day . sitz bath was begun on postoperative day ( pod ) 1 and lasted for 7 days . patients accepted sitz bath for 15 min each time , twice a day , once in the morning after defecation and another just before bedtime . patients in the control group accepted sitz bath with warm water alone , while in the xzd group 100 ml of xzd was added into the warm water . the composition of xzd ( table 1 ) consisted of flos chrysanthemi indici 10.0 g , radix sophorae flavescentis 10.0 g , herba taraxaci 10.0 g , mirabilitum 10.0 g , rhizoma corydalis 10.0 g , olibanum 10.0 g , myrrha 10.0 g , galla chinensis 10.0 g , radix et rhizoma rhei 7.5 g , flos carthami 5.0 g and radix glycyrrhizae 3.0 g. all the herbs were decocted in 1000 ml of water and finally condensed into 100 ml of decoction . patients were monitored and discharged within 72 hours after surgery . postoperative pain at 12 hours after surgery and on pods 1 , 2 , 7 , 14 and 28 was evaluated by visual analog scale ( vas ) scored 0 ( no pain ) to 10 ( very severe pain ) . pain on defecation on pods 1 , 2 , 7 , 14 and 28 was also recorded using the vas . the number of analgesic tablets consumed by each patient per day was also recorded and analyzed . the measurement data were represented as mean sd and were compared using two - sample t - test . ridit analysis was used to compare the distributions of ranked data , such as the degree of hemorrhoids , posthemorrhoidectomy and analgesic consumption of the two groups . spss 21.0 ( ibm china investment co. ltd . , beijing , people s republic of china ) statistical software was adopted for data analyzing . a p - value of < 0.05 was considered statistically significant . between may 2013 and march 2015 , 315 patients who underwent open hemorrhoidectomy in the first people s hospital affiliated to huzhou normal college were included in this prospective study . according to the computer - based sequential method , 160 patients were randomly assigned to accept sitz bath with warm water after hemorrhoidectomy ( control group ) and 155 patients were randomly assigned to accept sitz bath with xzd ( xzd group ) after hemorrhoidectomy . inclusion criteria were as follows : 1 ) age between 18 and 75 years and 2 ) indication for hemorrhoidectomy : symptomatic iii and iv degree hemorrhoids . patients who had associated fistula , anal fissure , inflammatory bowel disease , perineal skin inflammation , proctitis , pregnancy , previous anorectal surgery or allergy to the decoction were excluded from this study . this study was approved by the ethics committee for medical research of the first people s hospital affiliated to huzhou normal college and was performed on the basis of the declaration of helsinki and good clinical practice guidelines . , metronidazole tablets were administrated at a dose of 250 mg , twice a day for 1 week . analgesic tablets containing a combination of tramadol hydrochloride 37.5 mg and paracetamol 325 mg ( ultracet ; xian janssen pharmaceutical ltd . , xian , people s republic of china ) were prescribed as needed but not more than four tablets each day . sitz bath was begun on postoperative day ( pod ) 1 and lasted for 7 days . patients accepted sitz bath for 15 min each time , twice a day , once in the morning after defecation and another just before bedtime . patients in the control group accepted sitz bath with warm water alone , while in the xzd group 100 ml of xzd was added into the warm water . the composition of xzd ( table 1 ) consisted of flos chrysanthemi indici 10.0 g , radix sophorae flavescentis 10.0 g , herba taraxaci 10.0 g , mirabilitum 10.0 g , rhizoma corydalis 10.0 g , olibanum 10.0 g , myrrha 10.0 g , galla chinensis 10.0 g , radix et rhizoma rhei 7.5 g , flos carthami 5.0 g and radix glycyrrhizae 3.0 g. all the herbs were decocted in 1000 ml of water and finally condensed into 100 ml of decoction . postoperative pain at 12 hours after surgery and on pods 1 , 2 , 7 , 14 and 28 was evaluated by visual analog scale ( vas ) scored 0 ( no pain ) to 10 ( very severe pain ) . pain on defecation on pods 1 , 2 , 7 , 14 and 28 was also recorded using the vas . the number of analgesic tablets consumed by each patient per day was also recorded and analyzed . the measurement data were represented as mean sd and were compared using two - sample t - test . ridit analysis was used to compare the distributions of ranked data , such as the degree of hemorrhoids , posthemorrhoidectomy and analgesic consumption of the two groups . spss 21.0 ( ibm china investment co. ltd . , beijing , people s republic of china ) statistical software was adopted for data analyzing . no statistical difference was found in baseline characteristics between the two groups , in terms of age , gender , body mass index ( bmi ) , hemorrhoidal disease duration , operation duration or degree of hemorrhoids ( table 2 ) . postoperative pain did not differ between the two groups at 12 hours after surgery ( xzd group : 7.241.08 vs control group : 7.321.17 , p=0.5291 ) or on pod 1 ( xzd group : 5.801.01 vs control group : 5.750.98 , p=0.6560 ) . moreover , no significance was found in pain on defecation on pod 1 between the two groups ( xzd group : 4.191.04 vs control group : 4.221.12 , p=0.8057 ) . after initiation of sitz bath with xzd , postoperative pain score of the xzd group decreased and was significantly lower on pod 2 ( 6.041.11 vs 6.331.14 , p=0.0229 ) , pod 7 ( 3.350.75 vs 4.220.87 , p=0.0000 ) and pod 14 ( 2.870.64 vs 3.640.77 , p=0.0000 ) than that of the control group ( figure 1 ) . similarly , patients in the xzd group experienced significantly less pain on defecation on pod 2 ( 5.021.34 vs 5.431.56 , p=0.0130 ) , pod 7 ( 3.081.17 vs 3.521.29 , p=0.0017 ) and pod 14 ( 2.310.85 vs 2.680.99 , p=0.0004 ) than those of the control group ( figure 2 ) . as a result of reduced posthemorrhoidectomy pain by the xzd , patients in the xzd group consumed significantly less analgesic medication on pod 2 ( p=0.0136 ) , pod 7 ( p=0.0074 ) and pod 14 ( p=0.0046 ) than the control group ( table 3 ) . no statistical difference was found in baseline characteristics between the two groups , in terms of age , gender , body mass index ( bmi ) , hemorrhoidal disease duration , operation duration or degree of hemorrhoids ( table 2 ) . postoperative pain did not differ between the two groups at 12 hours after surgery ( xzd group : 7.241.08 vs control group : 7.321.17 , p=0.5291 ) or on pod 1 ( xzd group : 5.801.01 vs control group : 5.750.98 , p=0.6560 ) . moreover , no significance was found in pain on defecation on pod 1 between the two groups ( xzd group : 4.191.04 vs control group : 4.221.12 , p=0.8057 ) . after initiation of sitz bath with xzd , postoperative pain score of the xzd group decreased and was significantly lower on pod 2 ( 6.041.11 vs 6.331.14 , p=0.0229 ) , pod 7 ( 3.350.75 vs 4.220.87 , p=0.0000 ) and pod 14 ( 2.870.64 vs 3.640.77 , p=0.0000 ) than that of the control group ( figure 1 ) . patients in the xzd group experienced significantly less pain on defecation on pod 2 ( 5.021.34 vs 5.431.56 , p=0.0130 ) , pod 7 ( 3.081.17 vs 3.521.29 , p=0.0017 ) and pod 14 ( 2.310.85 vs 2.680.99 , p=0.0004 ) than those of the control group ( figure 2 ) . as a result of reduced posthemorrhoidectomy pain by the xzd , patients in the xzd group consumed significantly less analgesic medication on pod 2 ( p=0.0136 ) , pod 7 ( p=0.0074 ) and pod 14 ( p=0.0046 ) than the control group ( table 3 ) . hemorrhoidectomy is a standard treatment for extensive hemorrhoids and usually causes significant postoperative pain which would harm postoperative quality of life.12 posthemorrhoidectomy pain is mainly caused by surgical incision per se and tissue inflammation related to bacterial infiltration of the wound.13 in the first few hours after hemorrhoidectomy , wound inflammation is the primary cause of pain , while during the days after hemorrhoidectomy bacterial infiltration mainly causes the posthemorrhoidectomy pain . another factor of posthemorrhoidectomy pain could be spasm of the internal sphincter which is always aggravated by wound inflammation , swelling and infection during the pods.14 in our clinical practice , sitz bath with xzd was routinely performed after hemorrhoidectomy and was found effective for pain relief and wound healing . in its composition , theoretically , the xzd could not only directly relieve postoperative pain but also diminish the major adverse factors such as wound inflammation , swelling and infection which cause postoperative pain after hemorrhoidectomy . in the current study , we found that patients in the xzd group experienced significantly less postoperative pain and pain on defecation and consumed less analgesic medication than those in the control group on pods 2 , 7 and 14 . the chinese herbal decoction , xzd , could effectively relieve postoperative pain and reduce analgesic medication after hemorrhoidectomy . because of the open - label nature and small sample size of this study , further double - blind , placebo - controlled studies with larger sample size are required to verify our results . in addition , more investigation is needed to figure out the potential mechanisms of therapeutic effects of xzd .

objectivethe aim of this study was to investigate the effect of xiaozhi decoction ( xzd ) on posthemorrhoidectomy pain and analgesic medication consumption.methodsfrom may 2013 to march 2015 , 315 patients who underwent open hemorrhoidectomy in our hospital were enrolled in this study , of whom , 160 patients were randomly assigned to accept sitz bath with warm water after hemorrhoidectomy ( control group ) and 155 patients were randomly assigned to accept sitz bath with xzd ( xzd group ) after hemorrhoidectomy . postoperative pain at 12 hours after surgery and on postoperative days ( pods ) 1 , 2 , 7 , 14 and 28 was evaluated by visual analog scale ( vas ) . pain on defecation on pods 1 , 2 , 7 , 14 and 28 was also recorded using the vas . the consumption of analgesics was also analyzed.resultsno significant difference was found in baseline characteristics between the two groups . postoperative pain score of the xzd group was significantly lower on pod 2 ( 6.041.11 vs 6.331.14 , p=0.0229 ) , pod 7 ( 3.350.75 vs 4.220.87 , p=0.0000 ) and pod 14 ( 2.870.64 vs 3.640.77 , p=0.0000 ) than that of the control group . similarly , patients in the xzd group experienced significantly less pain on defecation on pod 2 ( 5.021.34 vs 5.431.56 , p=0.0130 ) , pod 7 ( 3.081.17 vs 3.521.29 , p=0.0017 ) and pod 14 ( 2.310.85 vs 2.680.99 , p=0.0004 ) . patients in the xzd group consumed significantly less analgesic medication on pod 2 ( p=0.0136 ) , pod 7 ( p=0.0074 ) and pod 14 ( p=0.0046 ) than the control group.conclusionxzd could effectively relieve postoperative pain and reduce analgesic medication consumption after hemorrhoidectomy .

Introduction Methods Patients Treatment Outcome measurements and follow-up Statistical analysis Results Baseline characteristics Posthemorrhoidectomy pain Discussion Conclusion

human societies form a dynamic and complex system , which requires frequent interaction between individuals . according to the social brain hypothesis ( dunbar , 1998 ; adolphs , 2003 ) parts of the human neo - cortex have evolved to improve survival in dynamic groups and therefore to process social information . this enables us to successfully mate , raise children , manage relationships , communicate , and understand each other . the significance of social interactions in human behavior is also reflected in several psychiatric disorders where impairments in social interaction are either an integral part of the diagnosis ( e.g. autism spectrum disorder , schizophrenia , social phobia etc . ) or relevant for experienced psychological strain . accordingly , the topic of social interaction has increasingly been addressed in the field of psychiatry and psychotherapy as well as the cognitive neurosciences . the present review provides an overview on recent findings on the rewarding nature of social interactions and discusses its implications with respect to psychiatry . the involvement of the mesocorticolimbic pathways in processing reward and addiction has been thoroughly studied in recent years ( insel , 2003 ; spreckelmeyer et al . , 2009 ) . a central role in these processes is assigned to dopamine projections of the ventral tegmental area to the striatum ( satoh et al . , 2003 ) . evidence from animal studies or in vivo imaging studies in humans indicates that the reward circuit in the basal ganglia , particularly mediated by dopamine , is involved in processing rewarding non - social stimuli such as money , food and psychostimulant drugs ( koob and le moal , 1997 ; schultz et al . , 1997 ; knutson et al . , 2001 ; zink et al . , 2004 ; izuma et al . , however , it is hypothesized that the underlying neural systems have evolved to facilitate reproductive behavior thus motivating social interactions ( kelley and berridge , 2002 ) . there are indeed several empirical studies which support this hypothesis and indicate that social reward is processed in the same subcortical network as non - social reward and drug addiction . several studies in rodents highlight the importance of striatal dopamine for highly socially motivated behavior such as maternal care , mating behavior and social attachment . for instance , the access to pups is more reinforcing than cocaine in female rats ( insel , 2003 ) and dopamine in the nucleus accumbens ( nacc ) is involved in typical mating behavior and social interactions of monogamous praire voles ( wang and aragona , 2004 ; liu et al . , 2010 ) . data from functional imaging studies in humans exhibit striatal activations for a variety of rewarding social stimuli such as beautiful faces ( aharon et al . , 2001 ) , positive emotional expressions ( rademacher et al . , 2010 ) , own social reputation ( izuma et al . , 2008 ) and maternal and romantic love ( bartels and zeki , 2000 , 2004 ) . additionally , a recent study has shown activation of the nucleus accumbens ( nacc ) , the putamen and thalamic nuclei during the anticipation of positive social feedback ( spreckelmeyer et al . , 2009 ) . these findings are in line with activations found for anticipation of non - social outcomes such as money ( knutson et al . , 2000 ) or food ( mcclure et al . , 2007 ) and highlight the salience and motivational potential of social stimuli . altogether , there is evidence from a variety of studies that the dopaminergic reward circuits in the basal ganglia form the primary neural system for processing reward of various social stimuli which could motivate social behavior . however , reward processing of social stimuli is certainly more complicated than dopamine release in the striatum on its own . first , with regard to neurochemical processes other neurotransmitters , e.g. excitatory amino acids or neuropeptides , such as oxytocin may modulate activity in these circuits ( insel , 2003 ; skuse and gallagher , 2009 ) . second , in natural situations , social reward is embedded in complex environments and , hence is strongly dependent on the situational context . this implicates that social interaction must not inherently be rewarding due to the appearance of a positive social stimuli ( e.g. smiling face ) . in a competitive interaction an outplayed counterpart may display sorrow , which likewise would be processed as a rewarding stimulus . thus , mere salience and anticipation of social incentives is not sufficient ; rather , the rewarding nature of the social stimuli depends on their processing on the side of the recipient . accordingly , the experience of rewarding interpersonal communication integrates appearance of social stimuli but further comprises the mental processing and interpretation of these stimuli . inferring the mental states of a counterpart , an ability often labeled as having a theory of mind ( tom ) , is one of the core mental processes to enable successful human communication ( adolphs , 2003 ) . empathic appreciation and acknowledgement of the listener 's emotional state ( affective tom ) as well as a more rational inference of others intentions , thoughts , and desires ( cognitive tom ) facilitate mutual understanding and deepens social relationships ( shamay - tsoory et al . , 2007 ) . as described above , potential positive social interactions offer a wide variety of rewarding stimuli for human beings . in a recent fmri study examining human robot interaction , participants even indicated having enjoyed direct social interactions with anthropomorphic robots ( krach et al . , 2008 ) . further , this enjoyment was correlated with the amount of human - likeness of the interaction partner . as such , it is reasonable that decoding mental states of interaction partners ( tom ) in general provides a means to gain social benefit from these interactions . neuroanatomically , the medial prefrontal cortex , the superior temporal sulcus , the temporo parietal junction and the amygdala have been implicated in mental state attribution processes ( frith and frith , 1999 ; adolphs , 2003 ) . as the physiological basis of mentalizing the impact of dopamine release on tom has been discussed ( abu - akel , 2003 ) . further , a link between the basal ganglia , comprising the substantia nigra which contains most of the dopaminergic neurons , and tom has been made ( bodden et al . , 2010 ) . accordingly tom deficits have been described in schizophrenia ( sprong et al . , 2007 ) and parkinson 's disease ( mengelberg and siegert , 2003 ; pron et al . , 2009 ) , both associated with dysfunctions of the dopaminergic system . notably , not only social stimuli activate striatal circuits but to a similar degree these structures are implicated by direct social interactions and mutual cooperation ( rilling et al . , 2002 ) . in sum , dopamine is involved in the prediction and mediation of rewarding stimuli ( life 's pleasures ) ( schultz , 2001 ) , whereas successful social interactions comprise some of the most potent rewarding stimuli for human beings . it could be a promising approach to examine both , processing of social reward and tom in a coherent framework considering the potential overlap in functional anatomy and involved neurochemical substrates . especially the neuropeptide oxytocin , which has often been discussed in the context of animal models for social reward ( liu et al . , 2010 ) , has recently been associated with impairments in tom and accordingly its presence is assumed to facilitating mentalizing processes . skuse and gallagher hypothesized that an interaction of both , dopamine and oxytocin , underlies and respectively enables successful and as such rewarding human social interaction ( skuse and gallagher , 2009 ) . various psychiatric disorders are characterized by difficulties in social interactions ; whereas patients with borderline personality disorder have , e.g. difficulties to maintain social relationships , patients with social phobia are afraid to initiating social interactions or patients with schizophrenia who misinterpret social cues . both , in patients with autism spectrum disorder and patients with schizophrenia the reduced capability to developing tom is considered as a pivotal deficit ( baron - cohen et al . , 1985 ; sprong et al . , 2007 ) . furthermore , difficulties in engaging into functional social relationships or partnerships are common in schizophrenia and autism . these patients are less interested in social relationships , and hence do not experience the rewarding character of close relationships . similar to the decreased consumption of food or sex which is observed in rats being under dopamine blockage ( lopez and ettenberg , 2001 ) , it is hypothesized that the hedonic pleasure of engaging in social interactions may not be valued as less positive per se , but as their salience is diminished , the drive to engage into social interactions is lacking ( berridge and robinson , 1998 ) . similarly , in autism spectrum disorder the motivation to engage into social interactions is reduced , however , here the scarcity of oxytocin has been related to the tom deficits . accordingly , oxytocin is targeted as one of the most encouraging drug treatments in autism spectrum disorder which potentially helps to enhance social skills and facilitates communication abilities ( bartz and hollander , 2008 ) . the relationship between psychotherapist and patient plays an important role in different therapeutic approaches , and further , it is seen as one of the best predictors of treatment outcome . as outlined above , tom can be seen as one crucial prerequisite of functional human interaction , and appropriate tom deepens social relationships . during the therapeutic process patients might appreciate the therapist 's behavior and statements to some extent biased , especially when their experiences or mental schemata affect their perception . this can be seen when a patient with social phobia tends to notice negative evaluative beliefs of the other people or when patients with borderline personality disorder tend to interpret facial expressions of other persons more hostile than healthy controls ( dyck et al . , 2009 ) . to gather patient 's inner world of thoughts , e.g. how his or hers learning history and past experiences imbue thinking and future experiences or how possible dysfunctional cognitions or mental schemata influence a patient 's perception , the therapist engages in mentalizing during the therapy . specific therapeutic approaches as mentalization based treatment ( allen et al . , 2008 ) account for the improvement of patients mentalizing abilities as an important part of the therapeutic procedure . as such , it might be speculated that the psychotherapeutic process enables the patient to enhance the experience of rewarding aspects of social interactions . furthermore , it should be noted that psychotherapy outcome will be improved by increased mentalizing abilities in both , the therapist and the patient ( allen et al . , 2008 ) . in summary we have argued that successful social interaction can provide one of the most rewarding stimuli for humans . appearance of social stimuli does not sufficiently mediate the rewarding character of social interactions without the process of perspective taking in the recipient which is regarded as a crucial component in order to decode the rewarding character of social interactions . hence , patients with various psychiatric disorders have difficulties in appropriate mentalizing which might detain them to experience the reward character of interactions diminishing the ability to form and maintain functional social relationships . various psychiatric disorders are characterized by difficulties in social interactions ; whereas patients with borderline personality disorder have , e.g. difficulties to maintain social relationships , patients with social phobia are afraid to initiating social interactions or patients with schizophrenia who misinterpret social cues . both , in patients with autism spectrum disorder and patients with schizophrenia the reduced capability to developing tom is considered as a pivotal deficit ( baron - cohen et al . , 1985 ; sprong et al . , 2007 ) . furthermore , difficulties in engaging into functional social relationships or partnerships are common in schizophrenia and autism . these patients are less interested in social relationships , and hence do not experience the rewarding character of close relationships . similar to the decreased consumption of food or sex which is observed in rats being under dopamine blockage ( lopez and ettenberg , 2001 ) , it is hypothesized that the hedonic pleasure of engaging in social interactions may not be valued as less positive per se , but as their salience is diminished , the drive to engage into social interactions is lacking ( berridge and robinson , 1998 ) . similarly , in autism spectrum disorder the motivation to engage into social interactions is reduced , however , here the scarcity of oxytocin has been related to the tom deficits . accordingly , oxytocin is targeted as one of the most encouraging drug treatments in autism spectrum disorder which potentially helps to enhance social skills and facilitates communication abilities ( bartz and hollander , 2008 ) . the relationship between psychotherapist and patient plays an important role in different therapeutic approaches , and further , it is seen as one of the best predictors of treatment outcome . as outlined above , tom can be seen as one crucial prerequisite of functional human interaction , and appropriate tom deepens social relationships . during the therapeutic process patients might appreciate the therapist 's behavior and statements to some extent biased , especially when their experiences or mental schemata affect their perception . this can be seen when a patient with social phobia tends to notice negative evaluative beliefs of the other people or when patients with borderline personality disorder tend to interpret facial expressions of other persons more hostile than healthy controls ( dyck et al . , 2009 ) . to gather patient 's inner world of thoughts , e.g. how his or hers learning history and past experiences imbue thinking and future experiences or how possible dysfunctional cognitions or mental schemata influence a patient 's perception , the therapist engages in mentalizing during the therapy . ( allen et al . , 2008 ) account for the improvement of patients mentalizing abilities as an important part of the therapeutic procedure . as such , it might be speculated that the psychotherapeutic process enables the patient to enhance the experience of rewarding aspects of social interactions . furthermore , it should be noted that psychotherapy outcome will be improved by increased mentalizing abilities in both , the therapist and the patient ( allen et al . , 2008 ) . in summary we have argued that successful social interaction can provide one of the most rewarding stimuli for humans . appearance of social stimuli does not sufficiently mediate the rewarding character of social interactions without the process of perspective taking in the recipient which is regarded as a crucial component in order to decode the rewarding character of social interactions . hence , patients with various psychiatric disorders have difficulties in appropriate mentalizing which might detain them to experience the reward character of interactions diminishing the ability to form and maintain functional social relationships . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

the objective of this short review is to highlight rewarding aspects of social interactions for humans and discuss their neural basis . thereby we report recent research findings to illustrate how social stimuli in general are processed in the reward system and highlight the role of theory of mind as one mediating process for experiencing social reward during social interactions . in conclusion we discuss clinical implications for psychiatry and psychotherapy .

Introduction The Rewarding Character of Social Stimuli Interpretation of Social Interaction Requires Theory of Mind Clinical implications Mentalization during psychotherapy Conflict of Interest Statement

perceptual systems adjust rapidly to changes in the environment , with neural and behavioral responses dynamically changing to mirror changes in the input ( sharpee et al . , 2006 ; gutinsky and dragoi , 2008 ) . such adaptive codes provide efficient representations because they direct computational resources toward uncommon inputs and provide information about potentially important changes in the world ( barlow , 1990 ) . although adaptive coding is less - well - studied in audition than vision , behavioral demonstrations of context - dependence , particularly in speech perception , resonate with the perspective that context adaptively tunes perceptual codes . the identity ( ladefoged and broadbent , 1957 ) or accent ( evans and iverson , 2004 ) of a talker , the rate of the utterance ( liberman et al . , 1956 ) , and the phonetic make - up of a preceding utterance ( mann , 1986 ) all influence perception of subsequent speech targets . from an adaptive coding perspective , the perceptual system s response to preceding speech lingers to affect subsequent processing significantly , however , this can only be true to the extent that context and target share common neural resources . in this way ( frisby , 1980 ) because they can expose neural coding related to perceptual experience through the residual effect of one stimulus upon perception of another ( clifford and rhodes , 2005 ) . thus , context - dependent speech perception perhaps can serve to reveal the underlying representation of speech . a simple model clarifies the approach ( figure 1 , after rhodes et al . , imagine two populations of units coding a dimension of auditory representational space ( e.g. , acoustic frequency , or a higher - order feature like talker identity ) . pool 1 units best code below - average values along the dimension whereas pool 2 units better code above - average values ; within each pool , more extreme values are coded more robustly . the average value along the dimension is encoded implicitly in the neutral cross - over point at which pools respond equivalently . an input with a higher value along the dimension would result in strong pool 2 response , thus reducing pool 2 responsiveness in the short - term due to adaptation . in this way , the context stimulus lingers in the perceptual system to affect the resources available to process subsequent stimuli . as is evident in figure 1 , this reduction shifts the neutral point where the two pools respond equivalently toward higher values and the formerly average value is now more robustly coded by pool 1 neurons . overall , adaptive encoding results in a contrastive shift in target encoding as a function of whether the context was better - coded by pool 1 or pool 2 neurons . this toy model is simple , to be sure , but the general principle may extend to higher - dimensional perceptual spaces and more complex representations . in vision , adaptive coding has been successful in predicting patterns of interactions among low - level representations for brightness and hue ( see frisby , 1980 ) as well as higher - level representations for faces and bodies ( see clifford and rhodes , 2005 ) . what is implicit in this approach is the assumption that context and target stimuli are encoded along common dimension(s ) of representation . here , we pursue context - dependent speech categorization to examine significant representational dimensions of speech categories . for these purposes , ladefoged and broadbent s ( 1957 ) classic demonstration of talker normalization is relevant . in their study , listeners heard a constant target - word with a relatively ambiguous vowel at the end of a context phrase the first ( f1 ) and/or second ( f2 ) formant frequencies ( peaks in energy of a voice spectrum ; fant , 1960 ) of the context phrase were increased or decreased . these shifts can be conceptualized , respectively , as decreasing and increasing the talker s vocal tract length and , correspondingly , as a change in talker . when the resulting phrases preceded the speech targets , listeners categorization shifted in a manner suggesting that they were compensating , or normalizing , for the change in vocal tract length or talker . a constant vowel was more often heard as bit when it followed a phrase synthesized as though spoken by a shorter vocal tract ( higher formant frequencies in the phrase ) , but more often as bet following the same phrase modeling speech from a longer vocal tract ( lower frequencies ) . a central and enduring theoretical issue has been the representational dimension across which listeners normalize speech categorization in this way . is the relevant representational dimension talker identity , vocal tract shape / anatomy , or acoustic phonetic space ( joos , 1948 ; ladefoged and broadbent , 1957 ; halle and stevens , 1962 ; nordstrom and lindblom , 1975 ; mcgowan , 1997 ; mcgowan and cushing , 1999 ; poeppel et al . , 2008 ) ? here , we investigate the extent to which ladefoged and broadbent s classic results can be explained by adaptive coding along a representational dimension that has a general auditory , rather that talker- , or speech - specific basis : the long - term average spectrum ( ltas ) of the preceding sound . recent research has suggested that listeners are sensitive to the ltas of sound stimuli and adjust perception of subsequent sounds contrastively opposing context ltas . holt ( 2005 , 2006a , b ) found that sequences of 21 non - speech sine - wave tones , each with a unique frequency sampling a 1000 hz range affect speech categorization of /ga//da/ as a function of the mean frequency of the tones forming the sequence . the influence of these contexts on speech categorization can not be attributed to any particular acoustic segment of the sequences because tones were randomly ordered on a trial - by - trial basis . instead , the pattern of context - dependent speech categorization is predicted only by the tone sequences ltas . perception of the subsequent speech targets was relative to , and contrastive with , the ltas consistent with the adaptive coding scheme sketched above if ltas serves as the common representational dimension linking non - speech contexts and speech targets . here , we seek to directly replicate the ladefoged and broadbent ( 1957 ) results with speech contexts and to explicitly test whether non - speech contexts modeling critical characteristics of the speech contexts ltas produce the same effects on vowel categorization . directly mimicking the methods of ladefoged and broadbent ( 1957 ) , listeners categorized a series of speech sounds varying perceptually from bet to but in the context of a preceding phrase ( please say what this word is ) . : one with a larger vocal tract and the other with a smaller vocal tract . the same listeners also categorized the same bet to but targets preceded by sequences of non - speech sine - wave tones with frequencies modeling the ltas of the context phrases . should the speech and non - speech contexts similarly influence vowel categorization , it would suggest that speech and non - speech contexts draw upon common neural resources . rather than articulatory or talker - specific dimensions that typically have been proposed to account for talker normalization twenty - six adult native - english speakers from the carnegie mellon university campus with no reported speech or hearing disabilities were recruited for the experiment . all received written informed consent in accord with carnegie mellon university ethics approval , and course credit for their time . each stimulus had a 1600 ms context segment , followed by a 50 ms silent interval and a 250 ms speech categorization target drawn from a six - step series of speech syllables varying perceptually from /bt/ to /bt/ ( bet to but ) . the /bv/ segment was created by varying the second formant ( f2 ) frequency of the main vowel portion in equal steps from 1300 hz / b/ to 1700 hz / b/ using klattworks ( mcmurray , in preparation ) . the onset f2 frequency was 1100 hz and gradually changed to the target frequency across 50 ms . similarly , the first formant was 150 hz and linearly transitioned to 600 hz over 50 ms . the fundamental frequency and the third formant frequency were held constant at 120 and 2600 hz , respectively . the /t/ segment was taken from a natural utterance of whit recorded from a male native - english talker and appended to each speech target . ( a ) schematic illustration of stimulus components ; ( b ) spectrogram in time x frequency dimensions for the high mean speech context ( top panel ) and mean percentage of but responses in speech contexts ( bottom panel ) ; ( c ) spectrogram in time x frequency dimensions for a representative high mean tone context ( top panel ) and mean percentage of but responses in tone context ( bottom panel ) . preceded by both speech ( b ) and tone ( c ) contexts , higher - frequency contexts led to more low - frequency target responses ( but ) , and vice versa . two types of context preceded these speech targets , one speech and the other a sequence of tones . the speech context was generated by extracting formant frequencies and bandwidths from a recording a male voice uttering the sentence please say what this word is , and using these values to synthetically reproduce the sentence in the parallel branch of the klatt and klatt ( 1990 ) synthesizer . following the methods of ladefoged and broadbent with modern techniques , this 1600 ms base phrase was spectrally manipulated by adjusting formant center frequencies and bandwidths to create different talkers . to mimic a longer vocal tract , a voice with relatively lower frequencies in the region of f2 was created ( across the phrase , f2 frequencies ranged from 390 to 1868 hz with an average of 1300 hz ) . a voice with a relatively shorter vocal tract was mimicked by increasing these base frequencies by 400 hz . thus , the mean acoustic energy in the range of f2 approximated the energy varying across the /bt//bt/ speech target stimuli . the non - speech tone contexts were composed of a sequence of 16 repeated 70 ms sine - wave tones ( 5 ms linear amplitude onset / offset ramps ) with 30 ms silent intervals separating them as in holt ( 2005 ; 1600 ms total duration ) . the tone contexts modeled the mean f2 frequency of the speech contexts ( 1300 and 1700 hz for the long and short vocal tracts , respectively ) and each tone was a single harmonic without variation . as such , the non - speech contexts did not sound like speech or possess information about talker identity , vocal tract anatomy , or phonetic space . thus , these non - speech contexts eliminated shared information between context and target along talker- and speech - specific dimensions while preserving a similar frequency - specific peak in the ltas . stimuli were rms - matched in amplitude to the bet endpoint of the target - word series . participants categorized each target as bet or but using labeled keyboard buttons across a 1 h experiment under the control of e - prime ( schneider et al . , 2002 ) . participants first categorized 10 randomly ordered repetitions of each speech target in isolation to assure that targets were well - categorized as the intended vowels . they then categorized the same speech targets preceded by high and low versions of speech and non - speech contexts , blocked by context type with block order counterbalanced across participants . sounds were presented diotically over linear headphones ( beyer dt-150 ) at approximately 70 db spl(a ) . twenty - six adult native - english speakers from the carnegie mellon university campus with no reported speech or hearing disabilities were recruited for the experiment . all received written informed consent in accord with carnegie mellon university ethics approval , and course credit for their time . each stimulus had a 1600 ms context segment , followed by a 50 ms silent interval and a 250 ms speech categorization target drawn from a six - step series of speech syllables varying perceptually from /bt/ to /bt/ ( bet to but ) . the /bv/ segment was created by varying the second formant ( f2 ) frequency of the main vowel portion in equal steps from 1300 hz / b/ to 1700 hz / b/ using klattworks ( mcmurray , in preparation ) . the onset f2 frequency was 1100 hz and gradually changed to the target frequency across 50 ms . similarly , the first formant was 150 hz and linearly transitioned to 600 hz over 50 ms . the fundamental frequency and the third formant frequency were held constant at 120 and 2600 hz , respectively . the /t/ segment was taken from a natural utterance of whit recorded from a male native - english talker and appended to each speech target . ( a ) schematic illustration of stimulus components ; ( b ) spectrogram in time x frequency dimensions for the high mean speech context ( top panel ) and mean percentage of but responses in speech contexts ( bottom panel ) ; ( c ) spectrogram in time x frequency dimensions for a representative high mean tone context ( top panel ) and mean percentage of but responses in tone context ( bottom panel ) . preceded by both speech ( b ) and tone ( c ) contexts , higher - frequency contexts led to more low - frequency target responses ( but ) , and vice versa . two types of context preceded these speech targets , one speech and the other a sequence of tones . the speech context was generated by extracting formant frequencies and bandwidths from a recording a male voice uttering the sentence please say what this word is , and using these values to synthetically reproduce the sentence in the parallel branch of the klatt and klatt ( 1990 ) synthesizer . following the methods of ladefoged and broadbent with modern techniques , this 1600 ms base phrase was spectrally manipulated by adjusting formant center frequencies and bandwidths to create different talkers . to mimic a longer vocal tract , a voice with relatively lower frequencies in the region of f2 was created ( across the phrase , f2 frequencies ranged from 390 to 1868 hz with an average of 1300 hz ) . a voice with a relatively shorter vocal tract was mimicked by increasing these base frequencies by 400 hz . thus , the mean acoustic energy in the range of f2 approximated the energy varying across the /bt//bt/ speech target stimuli . the non - speech tone contexts were composed of a sequence of 16 repeated 70 ms sine - wave tones ( 5 ms linear amplitude onset / offset ramps ) with 30 ms silent intervals separating them as in holt ( 2005 ; 1600 ms total duration ) . the tone contexts modeled the mean f2 frequency of the speech contexts ( 1300 and 1700 hz for the long and short vocal tracts , respectively ) and each tone was a single harmonic without variation . as such , the non - speech contexts did not sound like speech or possess information about talker identity , vocal tract anatomy , or phonetic space . thus , these non - speech contexts eliminated shared information between context and target along talker- and speech - specific dimensions while preserving a similar frequency - specific peak in the ltas . stimuli were rms - matched in amplitude to the bet endpoint of the target - word series . participants categorized each target as bet or but using labeled keyboard buttons across a 1 h experiment under the control of e - prime ( schneider et al . , 2002 ) . participants first categorized 10 randomly ordered repetitions of each speech target in isolation to assure that targets were well - categorized as the intended vowels . they then categorized the same speech targets preceded by high and low versions of speech and non - speech contexts , blocked by context type with block order counterbalanced across participants . sounds were presented diotically over linear headphones ( beyer dt-150 ) at approximately 70 db spl(a ) . participants categorization of speech targets in isolation was orderly , as indicated by a significant main effect target f2 frequency , f ( 5 , 25 ) = 139.43 , p < 0.01 . a 2 ( context type , speech / non - speech ) x 2 ( ltas , low / high ) x 6 ( target f2 frequency ) repeated - measures anova of listeners percent but responses reveals that , as expected from vowel categorization in isolation , responses varied reliably as a function of the target f2 frequency , f ( 5 , 25 ) = 290.50 , p < 0.001 . moreover , there was no main effect of context type indicating no overall bias in vowel categorizations a function of the type of context that preceded targets , f ( 1 , 25 ) = 0.274 , p = 0.61 . of greater interest , there was a significant main effect of ltas on vowel categorization , f ( 1 , 25 ) = 27.05 , p < 0.001 . the vowels were categorized as // significantly more often following high - frequency contexts whereas the same vowels were more often labeled as // following low - frequency contexts . thus , the context - dependent effect was spectrally contrastive and consistent with previous studies of the influence of sentence - length contexts on speech categorization ( ladefoged and broadbent , 1957 ; watkins and makin , 1994 , 1996 ; holt , 2005 , 2006a , b ; huang and holt , 2009 ) . the interaction between ltas and target f2 frequency was significant , f ( 5 , 25 ) = 11.65 , p < 0.001 , indicating that context had a greater influence on perceptually ambiguous targets . this pattern of contrastive context - dependent vowel categorization was evident for both speech , f ( 1 , 25 ) = 21.62 , p < 0.001 , and non - speech contexts , f ( 1 , 25 ) = 17.38 , p < 0.001 . of primary interest , there was no significant interaction between context type and ltas , f ( 1 , 25 ) = 0.324 , p = 0.574 . it is interesting that although the ltas contrast was larger in the non - speech contexts compared with speech context condition ( figure 3 ; see detail explanation in discussion ) , the magnitude of the influence of speech and non - speech contexts on speech target categorization was statistically indistinguishable . neither the interaction between context type and target frequency , f ( 1 , 25 ) = 1.22 , p = 0.30 , nor the three - way interaction was significant , f ( 5 , 25 ) = 1.424 , p = 0.22 . in sum , talker is not an essential element of talker normalization as it appears even in the absence of a talker when context is merely a sequence of sine - wave tones . long - term average spectrum of target stimuli ( a ) , speech contexts ( b ) , and tone contexts ( c ) . the shaded area indicates f2 frequencies critical to distinguishing the speech targets and two context types ( speech and tone ) in present experiments . the residual effect of one stimulus upon perception of another demands that the two share common neural processing and/or representation . thus , the comparable influence of speech and non - speech contexts on speech categorization indicates a common substrate of interaction . importantly , since the two context types did not share linguistic , articulatory gestural , or talker - specific information , but yet produced equivalent effects on speech categorization , it does not appear that speech- , vocal tract- , or talker - specific information is essential in eliciting the patterns of context - dependent perception that have been described in the literature as talker normalization . what the two context types in the present experiment shared was a similar pattern of spectral energy across their time course . figure 3 illustrates the ltas of the speech - target endpoints ( 3a ) and speech ( 3b ) and non - speech contexts ( 3c ) . we suggest that the context - dependent speech categorization observed here ( and in ladefoged and broadbent , 1957 ) arises because the auditory system is sensitive to the context ltas and the speech target is encoded relative to , and contrastive with , that long - term average . specifically , we propose that speech is adaptively coded according to the ltas of ambient sound . the simple model described in the introduction can clarify one means by which this might be accomplished . imagine pools of neurons sensitive to energy in the range of the second formant with one pool better coding relatively lower frequencies and the other better coding higher frequencies . by this model , presentation of the speech context modeling a longer vocal tract with lower - frequency energy within this frequency range would result in greater activity among the pool of neurons that better code lower frequencies . subsequent adaptation among this pool of responsive neurons would result in a shift toward the opposite , higher - frequency neural pool at the time of speech target presentation . neutral frequencies would be now more robustly encoded by the higher - frequency neural pool , shifting representation contrastively away from the lower - frequency context . this adaptive coding serves to exaggerate differences between the ltas of the context and target ( holt , 2006a ) . by this model , talker normalization effects on speech targets are predicted and obtained even when no speech information is available in the context . of note , the ltas model makes no reference to specific linguistic units , such as phonemes . this generality makes the adaptive coding approach in general , and the ltas model in particular , extend straightforwardly to other normalization phenomena in speech perception . huang and holt ( 2009 ) report that shifts in the peak energy of the ltas in the region of the fundamental frequency ( f0 ) of a mandarin chinese sentence predict patterns of context - dependent mandarin lexical tone normalization ( leather , 1983 ; fox and qi , 1990 ; moore and jongman , 1997 ) . similarly , although the adaptive coding approach to context - dependent speech categorization reveals ltas as an important dimension of representation , the model s application is more general . wade and holt ( 2005 ) , for example , investigated rate - dependent normalization effects whereby the rate of a precursor sentence affects how listeners categorize a rate - dependent speech distinction like /ba/ versus /wa/ , finding that the rate of presentation of a sequence of non - speech tones evokes a similar contrastive influence on speech categorization . if demonstrations of talker normalization can be accounted for by general perceptual processes that are not talker- or speech - specific then there remains the question of whether the context - dependent speech categorization taken as evidence of normalization really accommodates the acoustic variability in speech that arises from different talkers . we argue that it does . across context sentences like those of the current study , speech maps the scope of a talker s articulatory space and the mean of that space resembles a talker s neutral vowel , the shape of the non - articulating vocal tract ( story , 2005 ) . this neutral vowel serves as an effective normalization referent because , as story ( 2005 ) has demonstrated , most of the variability across talkers can be accounted for by differences in the shape the vocal air space of talkers neutral vowels . thus , if listeners were able to extract an estimate of the neutral vowel , the mean of the articulatory space , they would have an excellent referent for talker normalization . the results we describe here suggest an alternative . as talkers produce a variety of consonants and vowels , speech maps the articulatory space but it also produces a sound spectrum that maps the acoustic space and , across time , samples an ltas . instead of solving the inverse problem to recover the actual neutral vocal tract shape as an articulatory referent for normalization , listeners may use the average spectrum ltas as an auditory referent . the observation that non - speech tones modeling the ltas of a talker are as effective in shifting speech categorization as speech contexts supports the viability of a general auditory referent . however , it should be noted that ltas is unlikely to be the only contributing factor in talker normalization . speaker identities , for example , may mediate listeners attention and expectation and influence the way listeners tune their perception to the preceding contexts ( magnuson and nusbaum , 2007 ) . . nonetheless ltas , which provides sufficient context information via general perceptual processes , is an important factor in the adaptive coding of speech perception processing that contributes to talker normalization . the lingering influence of a sequence of non - speech tones on listeners response to speech targets indicates a shared substrate , the level of which remains to be evaluated . relevant to this , holt ( 2005 ) reported that non - speech contexts influence on speech categorization persists across 1300 ms of silence . moreover , the aftereffect of the tones was present even when 13 neutral - frequency tones intervened between tone contexts and speech targets . the influence of temporally non - adjacent tone sequences can even override the influence of temporally adjacent speech contexts on speech targets ( holt , 2006b ) . these observations argue for a central , rather than peripheral , substrate . in fitting the mind to the world , the present results demonstrate that patterns of context - dependent speech categorization long taken to be evidence of talker - specific normalization for articulatory referents or rescaling of phonetic space may arise , instead , from general principles of adaptive perceptual coding . in listening for the norm , listeners appear to adjust perception to regularities of the ambient environment . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

perceptual aftereffects have been referred to as the psychologist s microelectrode because they can expose dimensions of representation through the residual effect of a context stimulus upon perception of a subsequent target . the present study uses such context - dependence to examine the dimensions of representation involved in a classic demonstration of talker normalization in speech perception . whereas most accounts of talker normalization have emphasized talker- , speech- , or articulatory - specific dimensions significance , the present work tests an alternative hypothesis : that the long - term average spectrum ( ltas ) of speech context is responsible for patterns of context - dependent perception considered to be evidence for talker normalization . in support of this hypothesis , listeners vowel categorization was equivalently influenced by speech contexts manipulated to sound as though they were spoken by different talkers and non - speech analogs matched in ltas to the speech contexts . since the non - speech contexts did not possess talker , speech , or articulatory information , general perceptual mechanisms are implicated . results are described in terms of adaptive perceptual coding .

Introduction Materials and Methods Participants Stimuli Procedure Results Discussion Conflict of Interest Statement

dental implants have been proven to be a reliable long - term therapy against edentulism [ 13 ] . however , the reported high success figures of implant therapy have been based on implants inserted using two - stage surgical protocol and conventional loading . the increased demand on implant performance and the broadened treatment indications have led to the development of new moderately rough surfaces . alterations in both the surface chemistry and topography may contribute to chemical influence on bone tissue , a phenomenon defined as bioactivity . furthermore , other factors such as surface energy , surface wettability , cellular maturation state , nutrition status , and microstresses alter the degree of bioactivity too . compared to the previously used turned implants , the bioactively modified implants have demonstrated higher success rate in demanding cases , for example , early functional loading , one - stage surgery , and reconstructive jaw surgery . when moderately rough surfaces remain within bone tissue no differences on microbial colonization are observed as compared to minimally rough surfaces . however , there has been increasing evidence pointing out that as soon moderately rough implants are exposed to the oral milieu the case changes . a series of studies examining clinical , histological , and radiological aspects of experimental peri - implantitis in a dog model has reported that exposure of the implant surfaces to the oral environment leads to spontaneous progression of experimental peri - implantis [ 911 ] . the same research group has reported that implant surface characteristics affect the possibility to treat experimental peri - implantitis without antimicrobial therapy , thereby influencing the treatment outcome . additionally , a recent in vitro study has proposed that increased implant roughness promotes bacterial colonization most likely depending on protection of bacteria from shear forces . even if the referred studies are experimental in nature , the idea of developing an implant that combines the osseoconductive properties of a moderately rough surface with the accessibility for debridement of turned surfaces is intriguing . in order to enhance bone formation , laminins are heterotrimeric glycoproteins that bind to integrins , especially 1 and 2 isomers . the n - terminal of laminin-1 has been reported to selectively recruit osteoprogenitors through integrin 1-mediated cell attachment [ 20 , 21 ] and to stimulate production of alkaline phosphatase by osteoblasts . additionally , recent in vitro studies [ 23 , 24 ] have elucidated the role of laminin as nucleation center and its potential to enhance osteoid formation in a simulated body fluid . nevertheless , since the in vivo environment is more complex in terms of protein interactions and desorption of the coating agent , in vivo validation has been imperative . in theory , any effects of a protein coating are more pronounced during the early stages of osseointegration . the purpose of this in vivo study is to investigate the detailed molecular mechanisms underlying the possible effects of the coating agent laminin-1 on osseointegration and to compare them to histological evaluation methods . in total , 90 threaded titanium ( grade 4 ) implants with turned surface were used ( diameter : 1.5 mm , length : 2.5 mm , internal hexagonal connection , batch 800101579 , neodent , brazil ) . half of the implants ( n = 45 ) were coated with laminin-1 in accordance with previous in vitro study and served as the test group . in brief , laminin-1 ( l2020 , sigma - aldrich , stockholm , sweden ) was diluted to a concentration of 100 g / ml in dulbecco 's phosphate - buffered saline ( dpbs ) without cacl2 or mgcl2 ( 14190 - 094 ; gibco , invitrogen corporation , grand island , ny , usa ) . the implants were subsequently incubated in 48-well plates ( nunclon surface , nunc , roskilde , denmark ) containing 250 l of the laminin-1 solution per well , for 1 h at room temperature . the protein thickness after incubation was estimated by ellipsometry . since the implant surface did not reflect the light beam in a measurable manner , the amount of adsorbed laminin was calculated on optically smooth titanium surfaces produced at the laboratory as described by linderbck et al . . as previously described by bougas et al , the optically smooth titanium surfaces were fixed in the ellipsometric quvette filled with pbs at room temperature . the ellipsometric angles 0 and 0 were measured at three locations with a rudolph research autoel iii ellipsometer operating in a wavelength of 632.8 nm at a 70 angle of incidence . subsequently , the quvette was emptied and filled with laminin solution and new angles and calculated . the protein layer thickness was calculated from the ellipsometric angle changes for a protein refractive index of n = 1.465 . by using the mccrackin algorithm for the calculations , it was concluded that the incubation resulted in protein thickness corresponding to 2.6 nm . the surface topography of the implants was characterized with an optical interferometer ( microxam , ade phase shift , tucson , az , usa ) operating in wavelength of = 550 nm . according to the proposed guidelines for implant surface characterization , three implants from each group were randomly selected and each measured in 9 regions ( 3 thread tops , 3 thread valleys , and 3 flank regions ) . the following three topographical parameters were evaluated : an amplitude parameter , sa ( m ) = the arithmetic average height deviation from the mean plane ; a spatial parameter , sds ( m ) = the density of summits ; and a hybrid parameter , sdr ( % ) = the developed surface ratio . the study was approved by the malm / lund , sweden , regional animal ethical committee ( approval number : m253 - 10 ) and included 45 male wistar hannover galas rats with an average weight of 350 g. prior to surgery , the animals were sedated by intraperitoneal administration of a mixture of dormicum 5 mg / ml ( midazolam , roche ) , hypnorm ( fentanylcitrate 0.315 mg / ml and fluanisone 10 mg / ml , janssen pharmaceutical ) and sterile saline 0.9 mg / ml ( braun ) in a dose of 1.52 ml / kg body weight . the hind legs were disinfected with 70% ethanol and 70% chlorhexidine , and lidocaine hydrochloride ( xylocaine ; astrazeneca ab ) was administrated as the local anaesthetic at each insertion site at a dose of 0.5 ml . one control implant was operated into the right tibia and one test implant into the left of each animal . after the operation , buprenorphine hydrochloride ( 0.5 ml temgesic ; reckitt benckiser , slough , uk ) was administered as an analgesic for 3 days . the animals were divided into three groups and were sacrificed after 3 days ( n = 14 ) , 1 week ( n = 15 ) and 3 weeks ( n = 15 ) with an overdose of carbon monoxide in a gas chamber . the skin above the implants was incised , and 20 implants ( 10 pairs control / test ) for each of the two first groups ( 3 days and 1 week ) were turned out manually . since one implant in the 3-week group did not osseointegrate , 18 implants ( 9 pairs control / test ) were turned out manually . the removed implants , along with the interface bone tissue , were placed in rnalater solution ( qiagen gmbh , hilden , germany ) , and frozen at 80c until analysis . the samples were processed in the tissuelyser instrument ( qiagen gmbh ) together with -mercaptoethanol rneasy lysis - buffer to remove and disrupt the cells attached to the surface of the implant screw . rna was extracted from the sample mixtures with rneasy micro kit number 74004 ( qiagen gmbh ) according to manufacturer 's instructions , including carrier to minimize decrease in yield due to small sample quantity . during extraction , all samples were dnase - treated according to manufacturer 's instructions with rnase free dnase set # 1023460 ( qiagen gmbh ) to reduce gdna contamination . all rna samples were reverse transcribed in single 10 l reactions according to manufacturer 's instructions using tataa rt kit number a103b ( tataa biocenter ab ) to generate cdna . the controls were analyzed in pools of five , containing 1.5 l of each sample ( total volume 7.5 l ) . control of rna concentration was not possible due to the presence of carrier in extraction procedure . for each real time rt - pcr , 10 l mixtures were prepared with 1 l cdna , according to the manufacturer 's recommendations ( applied biosystem , ca , usa ) . amplification was carried out in 96-well thermal cycle plates on a stepone detection system ( applied biosystems , usa ) according to the manufacturer 's recommendations with custom - designed real - time assays and sybr green detection ( primerdesign ltd , southampton , uk ) ( table 1 ) . the remaining implants from each group were retrieved en bloc and were immersed in 4% neutral buffered formaldehyde . since one implant from the 3 week group did not osseointegrate possibly due to an incorrect insertion angle , the final numbers of implants processed for histology were ; n = 8 for 3 days , n = 10 for 1 week , and n = 8 for 3 weeks . all the samples were processed for undecalcified ground sectioning . briefly , after a series of dehydrations and infiltrations in resin , the samples were embedded in light - curing resin ( technovit 7200 vlc ; heraeus kulzer wehrheim , germany ) . one central ground section was prepared from each implant by using exakt sawing and grinding equipment ( exakt apparatebau , hamburg , germany ) . the sections were ground to a final thickness of approximately 10 m and histologically stained with toluidine blue mixed with pyronin g. histological evaluations were performed using a light microscope ( eclipse me600 ; nikon , japan ) , and the histomorphometrical data were analyzed by image analysis software ( image j v. 1.43u ; national institutes of health , bethesda , maryland ) . the bone - implant contact ( bic ) and the bone area ( ba ) percentage along the whole implant were calculated at 10 objective magnification as described previously [ 32 , 33 ] . the statistical calculations were performed with spss ( version 18 chicago , illinois , usa ) . the statistical comparison for the mean values of the topographic parameters sa , sds , and sdr was assessed by students t - test . for bic and ba the nonparametric wilcoxon signed ranks test was used while for relative gene expression , the student 's paired t - test was employed . the laminin-1 coating increased the density of summits ( sds ) significantly ( p = 0.009 ) . on the contrary , the protein coating did neither affect the average height deviation from the mean plane ( sa ) ( p = 0.261 ) nor the developed surface ratio ( sdr ) ( p = 0.446 ) of the implants significantly ( table 2 ) . although the gene expression for the osteoprogenitor marker runt - related transcription factor 2 ( runx2 ) was lower for the test than for the control after 3 days , it was doubled at 7 days resulting in statistically significantly higher levels as compared to the control . after 21 days , the difference in the expression of the gene for runx2 between test and control was evened out ( figure 1(a ) ) . the second osteoprogenitor differentiation , marker bone morphogenic protein-2 ( bmp-2 ) , did not differ between test and control at any time point ( figure 1(b ) ) . the initial gene expression ( 3 days ) of the osteblastic markers osteocalcin ( figure 1(c ) ) , alkaline phosphatase ( alp ) ( figure 1(d ) ) and type i collagen ( figure 1(e ) ) was higher for the control group . nevertheless , after 7 days the expression of the osteoblastic markers increased for the test group and declined for the control . this alteration resulted in statistically significantly higher mrna levels of osteocalcin and type i collagen in favour of the test group . after 21 days no statistically significant differences were detected between test and control in the expression of osteoclacin and alp . on the contrary , the expression of type i collagen for the control group was enhanced to statistically significantly higher levels as compared to the test group . the expression of the osteoclastic marker cathepsin k ( figure 2(a ) ) demonstrated a descending trend for the control group during the observation time . in contrast to the control group , the expression of cathepsin k remained stable for the test group throughout the observation period . the expressed levels of cathepsin k were statistically significantly lower for the test group at all times ( 3 days , 7 days , and 21 days ) . the mrna levels of the osteoclastic marker tartrate - resistant acid phosphatase ( trap ) ( figure 2(b ) ) declined with time . after 3 days , the levels of trap were statistically significantly higher for the control group , whilst no statistically significant differences were detected between test and control at 7 or 21 days . the gene expression of integrin 1 ( figure 3(a ) ) for the test group peaked at 7 days . at this time point , the mrna levels for integrin 1 were statistically significantly higher for the test group ( 4.90-fold ) . despite the enhanced levels of integrin 1 mrna expression in the control group after 21 days , no statistically significant differences were detected . the proinflammatory cytokines tumor necrosis factor ( tnf- ) ( figure 3(b ) ) and interleukin 1 ( il-1 ) ( figure 3(c ) ) peaked at 7 days . the fold of relative mrna expression was 6.65 for tnf- and 51.88 for il-1 in favour of the control group . the expression of tnf- and il-1 remained stable for the test group at 3 , 7 , and 21 days . no statistically significant differences were detected between test and control in the expression of the anti - inflammatory cytokine il-10 ( figure 3(d ) ) . the values of bic and ba were enhanced after 7 and 21 days as compared to 3 days . the test group demonstrated higher median bic and ba at all the evaluated time points ( figures 4 and 5 ) . the differences between the test and control were though not statistically significant ( p > 0.05 ) ( table 2 ) . in the current study , we have investigated the effects of laminin-1 coating on the early stages of osseointegration . the implants chosen for this purpose are turned with a smooth surface ( sa = 0.28 m ) . implants with turned surface have a long history of clinical documentation [ 13 ] and hence may be regarded as the gold standard . the rational for rather using a smooth implant than a moderately rough , is based upon the theorem that moderately rough implants enhance osseointegration , thereby possibly concealing any effects of the biochemical coating . additionally , a turned implant surface was chosen in order to investigate whether a biochemical coating can induce cell responses equivalent to the ones promoted by surface topography modifications [ 35 , 36 ] . according to the surface analysis since the implant surface has a minimally rough profile , the protein coating may be detected by the interferometer as prominences on the implant surface , hence resulting in elevated peak density of the test implant . depending on protein - desorption kinetics , the biochemical coating is theoretically most active during the first days after the implant installation . for this reason , we have chosen to investigate the early effects of the laminin-1 coating after 3 , 7 , and 21 days . the early time - points investigated in this study have been previously used in the literature in order to screen the expression of bone - related genes and inflammatory markers in a rat model [ 35 , 37 ] . since the degree of diffusion of the coating into the surrounding bone is unknown , we have chosen to collect the interface bone tissue from the removed implant instead of retrieving the implant along with the surrounding bone en bloc . the analysis of the interface bone tissue is further justified by a histological study concluding that implant coating material released by the shear forces during implant insertion residues within the peri - implant space . the gene analyses from the interface bone tissue reveal after 7 days significantly higher levels of the transcription factor runx-2 , which is the master gene for osteoblast differentiation and is expressed by the committed osteoprogenitors . at the same time point , it has been suggested that laminin stimulates osteoprogenitors by attachment to integrin 1 in vitro [ 20 , 21 ] . it has also been demonstrated that activation of runx2 by mapk is possible by binding of type i collagen to 2 1 integrins . since collagen type i is also elevated after 7 days , a possible mechanism of action for laminin-1 could be indirect activation of runx2 by elevating the expression of type i collagen which attaches to integrin 1 . after 7 days , no significant difference in bmp-2 levels was detected between test and control . this may imply that laminin-1 has an indirect effect on the existing osteoprogenitors in the peri - implant space , without promoting commitment of the surrounding mesenchymal stem cells to osteoprogenitors via bmp-2 . apart from the molecular mechanisms involved in the effect of laminin-1 on osteoprogenitors , our results suggest an additional effect on differentiated osteoblasts . the gene expression of collagen type i and the marker for mature post - proliferative osteoblasts , osteocalcin , are up - regulated after 7 days . hence , laminin-1 may contribute to the enrichment of the extracellular matrix in the direct proximity of the implant . if we additionally take into account the significantly decreased expression of the osteoclastic proteolytic enzyme cathepsin k , the bone remodeling may be further displaced in favor of osteogenesis . as reported in the literature , low expression of cathepsin k can be correlated to low levels of the proinflammatory cytokines il-1 and tnf- , both considered to be expressed on bone sites with pronounced osteoclastic resorption . as it concerns the 3-day time point , the expression of both osteogenic and osteoclastic markers is higher for the control group . keeping into consideration that the outcome of the bone metabolism is decided by a coupled mechanism between bone deposition and bone resorption , it is uncertain whether this increased activity will result to more or less new bone . a comparison of the findings from the gene analyses to the findings from the histomorphometry reveals some discrepancies . although there are important differences in gene expression , no differences are detected on bic or ba after 3 and 7 days . this finding is considered reasonable keeping in mind that bone remodeling is a time - demanding process . discrepancies between the results from traditional evaluation methods and genetic analysis have been reported previously . the fact that no differences were detected on bic or ba after 21 days is in agreement with the results from the gene expression . this result may be explained by the fact that the coating is expected to be more active during the early stages of osseointegration , since it may be gradually desorbed from the interface as demonstrated in vitro . conclusively , within the limitations of our study , we suggest that it is possible to alter the cell behavior on the implant - bone interface towards the osteogenic direction by coating the implant surface with laminin-1 . however , the reported changes are not detected by histomorphometry , most likely depending on the fact that this method is not adequately sensitive at the short times of follow - up applied on the present study .

the aim of this study was to evaluate the early bone response around laminin-1-coated titanium implants . forty - five rats distributed in three equally sized groups were provided with one control ( turned ) and one test ( laminin-1-coated ) implant and were sacrificed after 3 , 7 , and 21 days . real - time reverse - transcriptase polymerase chain reaction was performed for osteoblast markers ( alkaline phosphatase , runt - related transcription factor 2 , osteocalcin , type i collagen , and bone morphogenic protein 2 ) , osteoclast markers ( cathepsin k and tartrate - resistant acid phosphatase ) , inflammation markers ( tumor necrosis factor , interleukin 1 and interleukin 10 ) , and integrin 1 . bone implant contact ( bic ) and bone area ( ba ) were assessed and compared to the gene expression . after 3 days , the expression of bone markers was higher for the control group . after 7 days , the expression of integrin 1 and osteogenic markers was enhanced for the test group , while cathepsin k and inflammation markers were down - regulated . no significant differences in bic or ba were detected between test and control at any time point . as a conclusion , implant coating with laminin-1 altered gene expression in the bone - implant interface . however , traditional evaluation methods , as histomorphometry , were not adequately sensitive to detect such changes due to the short follow - up time .

1. Introduction 2. Materials and Methods 3. Statistics 4. Results 5. Discussion

production of blue colored ceramic in glaze industry is of important concern for structuring of floors and walls . this is because cobalt has mobile 3d electrons in its atomic structure ( 1 ) . the main component , such as silica , present in ceramic are similar to glass , causing both favorite melting point and color ( 2 , 3 ) . this solution then is applied to a clay body at increasing temperature up to 1300c . therefore , an interface layer is made up by glaze and clay body interaction , then , glaze is adhered to the clay ( 2 , 3 ) . finally , color is occurred on glaze in result of high temperature reaction . in such process , cobalt toxicity is taken place when glazers are exposed to the cobalt in powder form . to prevent adverse effect of cobalt , such as , gamut of respiratory disorders , asthma , and also lung cancer , occupational exposures are of great concern in the ceramic industries ( 2 , 3 ) . cobalt is not a cumulative toxicant and is mainly excreted in urine to a lesser extent via faces . the two main target organs are the skin and the respiratory tract ( 4 ) . cobalt is the critical toxic component causing hard metal lung disease ( 5 ) that is a rare form of occupational lung disease that can occur in workers engaged in the manufacture , utilization , or maintenance of tools hard metal . cobalt may cause allergic dermatitis ( 69 ) , cardiomyopathy ( 10 , 11 ) and asthma ( 7,1215 ) . exposure to cobalt leads to severe alterations in capillaries , edema and hemorrhage of lung in experimental animals ( 16 ) . in hard metal industries such as cobalt , occupational asthma the international agency for research on cancer ( iarc ) recently has classified cobalt and cobalt compounds as possibly carcinogenic to humans ( class 2b ) ( 17 ) . the objectives of this study were to determine the cobalt level in urine of glazers of a ceramic industry and also to find out whether a relationship exists between factors including duration of exposure , work shift breathing masks , skin dermatitis , overtime work , ventilation , age , weight , height , and the urinary concentration of cobalt . investigation of the relation between occupational exposure in glazers and the lung function was another aim of this study . mean - while , considerable procedures have been developed for preparing various samples before analysis [ 1819 ] . solid phase extraction developed in our previous study was used to prepare samples [ 2025 ] followed by inductively coupled plasma - atomic emission spectroscopy ( icp - aes ) . this case - control study was carried out in glazing units of a ceramic industry where blue - colored ceramic glazes were produced . a control group consisting of 55 office workers was considered for comparison study . in glazers , age ranged from 22 to 50 years with a mean value of 30.67 years and for the control group it was 23 to 50 years with a mean value of 32.6 years . all participants filled out a self administered questionnaire comprises questions about overtime work , duration of exposure , work shift , use of mask , skin allergy , ventilation , age , weight , and height . there were not significant differences between glazers who exposed to cobalt and the referents concerning age , weight , and height . urine samples were taken for determination of cobalt , at the start and end of the work ( totally 98 samples ) . samples were collected before starting to work and at the end of the work shift while workers removed their work uniforms . they were advised to wash their hands before sampling in order to reduce the potential for contamination . twenty milliliters urine was collected in acid - washed polyethylene containers and was stored at + 4c until the analyses time . cartridges were filled up with 500 mg amberlite xad-7 resin . in order to remove organic and inorganic contaminants , amberlite 2.5 ml urine sample was adjusted at ph 9 and the cobalt present in the samples was chelated with ammonium pyrrolidine dithiocarbamate ( apdc ) . the solution was then passed through the sorbent at a flow rate of 5 ml / min under gravity . then , the retained analyte was eluted by 15 ml of 2 m hno 3 . the urinary cobalt was analyzed by inductively coupled plasma - atomic emission spectroscopy ( icp - aes ) ( spectro , arcos , germany ) . the calibration of the icp - aes was performed using standard solutions containing 2001000 g / l of cobalt . the lung function tests were performed on each control and cobalt exposed subject by spirometer system ( model 2120 ) . the spirometer was calibrated daily with one liter calibration syringe and operated at temperature ranged from 20 to 25c . is measurement , forced vital capacity ( fvc ) , forced expiratory volume in one second ( fev1 ) , forced expiratory flow fef 2575 were measured . paired t - tests were used to assess the changes between pre- and post - shift measurements for the glazers . analysis of covariance ( ancova ) was used to evaluate the effect of each factor on post - shift measurement after controlling for the pre - shift shift . cartridges were filled up with 500 mg amberlite xad-7 resin . in order to remove organic and inorganic contaminants , amberlite 2.5 ml urine sample was adjusted at ph 9 and the cobalt present in the samples was chelated with ammonium pyrrolidine dithiocarbamate ( apdc ) . the solution was then passed through the sorbent at a flow rate of 5 ml / min under gravity . then , the retained analyte was eluted by 15 ml of 2 m hno 3 . cartridges were filled up with 500 mg amberlite xad-7 resin . in order to remove organic and inorganic contaminants , amberlite 2.5 ml urine sample was adjusted at ph 9 and the cobalt present in the samples was chelated with ammonium pyrrolidine dithiocarbamate ( apdc ) . the solution was then passed through the sorbent at a flow rate of 5 ml / min under gravity . then , the retained analyte was eluted by 15 ml of 2 m hno 3 . the urinary cobalt was analyzed by inductively coupled plasma - atomic emission spectroscopy ( icp - aes ) ( spectro , arcos , germany ) . the calibration of the icp - aes was performed using standard solutions containing 2001000 g / l of cobalt . the lung function tests were performed on each control and cobalt exposed subject by spirometer system ( model 2120 ) . the spirometer was calibrated daily with one liter calibration syringe and operated at temperature ranged from 20 to 25c . through is measurement , forced vital capacity ( fvc ) , forced expiratory volume in one second ( fev1 ) , forced expiratory flow fef 2575 were measured . paired t - tests were used to assess the changes between pre- and post - shift measurements for the glazers . analysis of covariance ( ancova ) was used to evaluate the effect of each factor on post - shift measurement after controlling for the pre - shift shift . important demographic characteristics and the results of the lung function tests for glazers and their matched controls are shown in table 1 . mean value for age , height , and weight was not significantly different between groups . mean values of fvc , fev1 , fev1/fvc , and fef 2575 were lower in the exposed group compared to the control group ( table 1 ) . analysis of the lung function tests revealed significant differences in all spirometric parameters between the glazers and the control groups ( p<0.001 ) ( table 1 ) . population characteristics of the study groups urinary level of cobalt at the start of the work shift was ranged from 0.01 to 5 g / l , with a mean value of 1.73 g / l and at the end of the work shift ranged from 0.01 to 15 g / l , with a mean value of 3.47 a significant difference was found between co concentration of start and the end shift samples . there were significant differences in the mean concentration of cobalt between the exposure group and the control group ( table 2 ) . table 3 gives the results of biological monitoring at the start and end of the work shift . comparison of urinary cobalt between pre- and post - shift samples in the glazers and control group urinary cobalt measured at pre- and post - shift of the glazers in meybood city of iran the glazers were subdivided in several subgroups according to the variables . concentrations of co in urine increased during the shift . on the other hand , the highest values of cobalt based on the work history , there were no significant differences in the mean values of urine cobalt levels between glazers , however , glazers with long work history ( 61month ) had a higher urine cobalt level compared to those who had work history of 24 months ( 4.47 g / l versus 2.14 g / l ) ( table 3 ) . glazers who were working in the evening had higher urine cobalt compare to the morning shift ( 3.87g / l versus 3.08g / l ) . ancova showed that , after adjusting for pre - shift cobalt , the effect of shift on post - shift lead was not significant ( table 4 ) . the mean value of cobalt concentration in glazers with dermatitis was 5.7g / l versus a mean of 2.54g / l among glazers without skin allergy ( table 3 ) . ancova showed that , after adjusting for pre - shift cobalt , the effect of skin allergy on post - shift lead was significant ( table 4 ) . results obtained after anocova for post - shift urinary cobalt by independent factors controlled for pre - shift cobalt tile glazers had a slightly higher urine cobalt level compare to the pottery glazers ( 3.39g / l versus 3.7g / l ) . ancova showed that , after adjusting for pre - shift cobalt , the effect of job on post - shift cobalt was not significant ( table 4 ) . glazers without protective masks or local exhaust ventilation during mixing or handling of glazes had significantly higher levels of cobalt compare to the glazers with protection ( 4.58 g / l versus 2.77 ancova showed that , after adjusting for pre - shift cobalt , the effect of masks and ventilation on post - shift cobalt was not significant ( table 4 ) . glazers who had work history more than 21 hour showed higher urine cobalt levels compared to the glazers with overtime work less of 21(7g / l versus 2.75g / l ) . ancova showed that , after adjusting for pre - shift cobalt , the effect of overtime work on post - shift cobalt was not significant ( table 4 ) . in this study , the mean value of the urinary concentrations of cobalt in the glazers ( 3.47g / l ) was below the acgih biological exposure indices of 15 g / l ( 26 ) . however , cobalt is an important constituent of blue glazes , however , in time of sampling , because of ceramic characteristics , the use of this metal in glazes was somehow lower the normal . nevertheless , the glazers had a mean urinary cobalt concentration three to four times higher compared to the controls . the subjects exposed to a soluble cobalt pigment in pottery painting had an increase in the urinary cobalt concentration ( 27 ) . in contrary to the results obtained through this study , roig - navarro et al . ( 1997 ) have reported high urinary cobalt level in the ceramic factories ( 28 ) . relationship of cobalt in the development of lung cancer has been studied among women exposed to the cobalt blue dye . results showed the incidence of lung cancer slightly higher than the expected value ( 29 ) . moulin et al . showed simultaneous exposure to cobalt and tungsten carbide causing lung cancer ( 30 ) . at the end of the shift , urinary concentrations of cobalt were higher than start of the shift levels , thus , results indicated that , cobalt is alimented immediately via urine . this study also confirms that , urinary cobalt seems to reflect the amount of cobalt recently absorbed . since condition of workplaces such as ventilation system and glaze constituents did not change in the shifts , there was no significant difference between groups regarding to shift work . this study also confirms the role of cobalt in occupational dermatitis similar to previous studies ( 31,32 ) . exposure to cobalt can be reduced by improving skin protection and personal hygiene in workplaces ( 33 ) . improperly ventilation and working without mask was associated with significantly higher levels of cobalt in the urine of glazers . ( 1985 have indicated the level of cobalt in the blood and urine 2.5 and 1.8 times ( respectively ) lower in the workers who used respiratory protection devices compared to those who did not use respirators ( 34 ) . because of ceramic characteristics both pottery and tile glazers use glazes that generally contain the same amount of cobalt , therefore , this variable in pottery and tile glazers were not significant . in glazers with greater overtime work , due to more time exposure to cobalt , a significant increase in urinary cobalt level was observed . in the present study age , bmi , and work history were not significant variable . however , the highest values of cobalt were recorded among older workers due to the unhygienic behavior , higher bmi and work history . in the present study , the decline in fev1 and the ratio of fev1/fvc was higher in those who have exposed to cobalt compared to those who have not exposed . results obtained in this study showed a reduction in lung function , mainly of the obstructive syndrome type in the glazers . these findings are due to the effect of both the glaze constituents and raw material used such as silica . have reported exposure to silica related to reduction in pulmonary function and chronic obstructive pulmonary disease ( copd ) ( 35 , 36 ) . in another study , in ceramic workers in iran , respiratory complaints and abnormal pulmonary function several studies have been indicated prevalence of chronic bronchial obstruction in relation to the cobalt exposure ( 38 , 39 ) . raffn et al . among plate painters exposed to the cobalt blue dye showed increased respiratory symptoms and airway resistance ( 40 ) . cobalt exposure is associated to a decline in fev1 in smokers who are exposed to cobalt ( 41 ) . further studies are required to understand the mechanism of interaction between heavy metals and silica in prevalence impaired lung functions . although cobalt poisoning occurred mainly among subjects who use cobalt for product blue colors in the ceramics , it could also occur in the general population during the normal use . cobalt can be extracted into the food substances due to the improper formulation and firing of glazes . acidic food and juice readily induce leaching of cobalt from glaze ( 42 , 43 ) . cobalt is released by some of the dishes ( 44 ) . for reduction of cobalt exposure , workers should use respirators , not to eat or smoke at job position , separate work uniform from the other clothes to prevent the hazards of working with cobalt - containing glazes . also , hygienic behaviors , washing facilities , and using proper personal protection equipments can be considered as effective means to reduce the cobalt exposures . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .

background : cobalt is one of the most important constituent present in ceramic industries . glazers are the relevant workers when they are producing blue colored ceramic , causing occupational exposure to such metal . through this study , urinary cobalt was determined in glazers in a ceramic industry when they were producing blue - colored ceramic glazes.methods:in this case - control study , spot urine samples were collected from 49 glazers at the start and end of work shifts ( totally 98 samples ) in 2011 . control group were well matched for age , height , and weight . a solid phase extraction system was used for separation and preconcentration of samples followed by analysis by inductively coupled plasma - atomic emission spectroscopy ( icp - aes).all participants filled out a self administered questionnaire comprises questions about duration of exposure , work shift , use of mask , skin dermatitis , kind of job , ventilation system , overtime work , age , weight , and height . the lung function tests were performed on each control and cobalt exposed subjects . analysis of covariance ( ancova ) was used to evaluate the obtained results.results:urinary levels of cobalt were significantly higher in the glazers compared to the control group . there were significant differences at urinary concentration of cobalt at the start and end of the work shift in glazers . spirometric parameters were significantly lower in the glazers compared to the control group . among the variables used in questionnaire the significant variables were dermatitis skin , mask , ventilation , and overtime work.conclusion:this study verified existence of cobalt in the urine glazers , showing lower amount than the acgih standard .

Introduction Materials and Methods Experimental Sample preparation Analysis procedure Results Discussion Conclusion Ethical considerations

the nuclear spins of xenon and other noble gases can be hyperpolarized ( hp ) to order unity by the process of spin - exchange optical pumping ( seop ) . in this two - step process , the electron spins of an alkali metal vapor such as rubidium are first polarized by the absorption of angular momentum from circularly polarized light . spin - exchange collisions between the alkali metal atoms and xe then transfer the angular momentum to the xe nuclear spins through fermi hyperfine interactions , resulting in a high non - boltzmann distribution of xe spin states that increases the detection sensitivity of nmr / mri . the two most common approaches to hyperpolarize xe via seop are termed continuous flow(714 ) and stopped flow(1525 ) ( sometimes also referred to as batch mode ) with respect to the delivery of xe gas to and from the polarization cell . n2 gas is typically added to the gas mixture to quench alkali metal fluorescence . the batch - mode / stopped - flow systems are attractive not only because of their relative simplicity but also because they can operate in a xenon - rich regime that obviates the need to separate the polarized xe from the n2 ( or he ) via cryocollection , eliminating a potential source of polarization loss as well as facilitating applications using quadrupolar noble gas isotopes . this production method has also been scaled up for automated production of clinically required quantities . regardless of the polarization method , hp noble gases have seen wide application varying from fundamental physics experiments to nmr / mri applications including molecular biosensors , probing structural aspects of cage molecules and proteins , and studies of porous materials ( to name only a few ) . however , it has been biomedical applications that have largely driven the development of hyperpolarized mr techniques over the past decade ; indeed , for gas imaging in particular , hp xe can be used to assess lung function and report on functional and microstructural abnormalities . a useful figure of merit for xe hyperpolarizers is the total xe magnetization , mxe , delivered in a clinically useful gas volume , typically 0.51 l at 760 torr . mxe is determined by the product of nuclear spin polarization pxe and xe concentration [ xe ] , i.e. , mxe pxe[xe ] . it is therefore important to maximize mxe through both pxe and [ xe ] , which is challenging because pxe generally decreases as [ xe ] within the seop - cell increases ( mostly because of increased alkali metal spin - destruction rates from non - spin - conserving collisions with xe ) . but fundamentally laser photons are the source of xe hyperpolarization ; thus , the decreasing cost of laser diodes narrowly tuned to the alkali metal rubidium d1 wavelength ( 794.8 nm ) has made economically feasible the higher photon fluxes required to improve mxe when xe partial pressures are high . in the present work , a 200 w laser diode array ( lda ) was used in a 3d - printed , automated xe polarizer to study seop dynamics as a function of xenon density , laser power , and seop - cell temperature . more specifically , the seop polarization conditions at several partial pressures of natural abundance xe ( 26.44% xe isotope enrichment ) were studied : ( i ) 275 torr xe and 1725 torr n2 , ( ii ) 515 torr xe and 1485 torr n2 , ( iii ) 1000 torr xe and 1000 torr n2 , ( iv ) 1500 torr xe and 500 torr n2 , and ( v ) 2000 torr xe and 200 torr n2 , where the gases were loaded with an accuracy of 25 torr . the reader is also directed to supporting information for detailed descriptions of the experimental setup , which represents the second - generation device of our hxtc consortium ( figure 1 ) . for each seop cell loading , data were obtained for a range of incident laser power levels ( approximately 100 , 125 , 140 , or 170 w ) and variable seop - cell surface temperatures ranging from 42 to 92 c . for each condition , measurement of xe polarization dynamics allowed the rate constant for pxe accumulation ( seop ) and the maximum attainable steady - state pxe value [ pxe(t ) or xe pmax ] to be determined from exponential fits . the temperature of the seop cell was monitored by a thermistor mounted directly to its surface ; temperature control allows the rb concentration in the gas phase to be varied . the seop 3d - printed portable polarizer ( figure 1 ) consists of a 200 w frequency narrowed volume holographic grating ( vhg ) laser diode array ( lda ) , a custom 3d - printed thermoelectric cooling ( tec ) optical pumping ( op ) oven , a 0.5 l seop cell , an electromagnet providing 47 khz xe and h larmor frequencies , in situ nmr polarimetry endowed by a magritek kea2 system , and a magritek 88 mm bore magnet for ex situ nmr polarimetry and mri ( magritek , wellington , new zealand ) . the components of the polarizer and 47.5 mt mri have been discussed in detail previously and thus are only discussed briefly here . ( a ) spin exchange optical pumping ( seop ) 3d - printed polarizer used to perform all in situ experiments . ( b ) side view of laser aligned to the seop oven , seop cell , and near - ir spectrometer . ( c ) top view , with the oven lid removed to show seop cell . in situ nmr polarimetry for these experiments was performed via single - shot xe nmr at 47 khz ( figure 2a ) calibrated against h nmr at the same frequency from a sample of thermally polarized water doped with 10 mm cuso4 inside a 0.5 l seop - cell phantom ( 200 000 scans , figure 2b ) . the polarizer allows the rb electron spin polarization , prb , to be estimated by comparing the integrated intensities of transmitted laser spectra measured with and without the applied magnetic field ( e.g. , figure 2c ) . for each set of conditions , pxe was sampled every 520 min throughout seop ; the process is repeated by either destroying the xe polarization with a series of crusher pulses or allowing it to decay with the laser off . the time - course examples in figure 2d , e show the excellent reproducibility of pxe , prb , and seop in these experiments ( and those values were not sensitive to the application of the rf pulses ) . once steady - state xe polarization was achieved , growth curves can be extracted ( e.g. , figure 2f ) and fit to an exponential : pxe(t ) = pmax[1 exp(seopt ) ] . in the absence of seop , in - cell room - temperature ( rt ) measurement of the spin lattice relaxation time constant ( t1 ) can be obtained after steady - state pxe has been achieved by quickly bringing the cell to room temperature to minimize the rb gas - phase concentration , turning off the laser , and performing in situ nmr polarimetry while the polarization decays ; for example , the data in figure 2 g were fit to an exponential decay curve : pxe(t ) = pxe(0 ) exp[xet ] , where xe ( = 1/t1 ) is the xe spin - destruction rate , here exhibiting an ultralong in - cell xe t1 of 150.5 2.5 min ( or 2.5 h ) . particularly when optimizing seop under the regimes of high [ xe ] and laser power , it is also important to be observant for the onset of positive feedback effects that give rise to dramatic increases in [ rb ] and laser absorption over time ( and ultimately poorer pxe ) . examples showing the manifestation of such rb - runaway effects are provided in figure 2h , which shows behavior where relatively small increases in cell surface temperature result not only in reduced peak pxe but also in reduced pxe over time . ( a ) example of an in situ low - field xe nmr spectrum from a seop - cell during seop ( single scan , b0 = 4.00 mt ) . ( b ) corresponding h nmr spectrum from a thermally polarized water reference sample using 200 000 scans , b0 = 1.10 mt . ( c ) examples of field - cycled near - ir spectra of laser light transmitted through the seop - cell used to estimate prb : room temperature before seop ( dark gray ) , during seop with b0 electromagnet on ( blue ) , and during seop with b0 electromagnet turned off ( red ) . ( d , e ) examples of data sets for studying time - resolved seop build - up and decay kinetics using a cell containing 1000 torr ( each ) of xe and n2 gas ( 143 w laser power , 65 c ) . ( d ) plot showing reproducibility of pxe accumulation following the application of > 500 rf crusher pulses that nearly zero - out the xe polarization ( time periods marked by vertical green bars ) ; prb ( red circles ) was sampled via field - cycled near - ir spectroscopy ( c ) before and after application of the crusher pulses . ( e ) similar to ( d ) , with xe nmr signals acquired with different interpulse durations and with polarization decay observed after turning the laser off ( times demarked with vertical arrows ) ; here xe decay was observed with the seop cell temperature maintained at 65 c . pulse delay ( pd ) refers to timing between nmr acquisitions during build - up . ( f ) exponential buildup of xe polarization during the seop process for a cell filled with 2000 torr of xe and 200 torr of n2 . ( h ) time - course examples showing the temperature - dependent effects of nonequilibrium rb runaway in a 1500 torr xe seop cell using only 100 w laser power : a normal build - up curve at 72 c ( black squares ) , a mildly distorted build - up curve at 82 c ( red circles ) , and a significantly distorted build - up curve at 92 c ( orange triangles ) . all spectra were recorded with a surface coil using small radiofrequency ( rf ) excitation pulses with little to no measurable effect on xe magnetization . except for the fitting curves in ( f ) and ( g ) , connecting lines are meant only to guide the eye . ex situ pxe at 47.5 mt was calculated by comparing the hp xe signal with the c signal at 508 khz c larmor frequency from a reference sample of thermally polarized sodium 1-c - acetate dissolved in d2o ( figure 4a ) . the xe t1 relaxation time inside the polypropylene phantom sphere was 9.2 min ( figure 4c ) , which is sufficient for short - term storage of hp xe . moreover , this xe t1 value was used in parallel experiments to precisely calibrate the rf excitation pulse for the 47.5 mt rf probe shown in figure 5f ; the image signal decay is due to both t1 decay and excitation rf pulses . a y - slice projection of fast gradient echo ( gre ) imaging with millimeter - scale spatial resolution without slice selection shows the excellent xe signal intensity ( figure 5a ) . all 20 images ( figure 5b e , selected images shown ) were acquired identically with te = 4.0 ms , tr 80 ms ( limited by the spectrometer electronics response time ) , 50% k - space sampling , 64 64 imaging matrix with 72 72 mm field of view ( fov ) , and a spectral width of 20 khz . given the relatively long t1 in the phantom ( figure 4c ) , the decay of the hyperpolarized signal was primarily due to rf - pulse - induced polarization loss in figure 5f . the calibrated rf pulse width for the flip angle ( 2.7 0.1 ) was used for calculation of % pxe for the hp xe post - transfer in figure 4 ( see supporting information for details ) . the dependence of xe polarization and its dynamics as functions of temperature , photon flux , and xenon partial pressure was systematically studied under stopped - flow operation in the regimes of high xenon density and photon flux . results for five xe : n2 seop - cell compositions at four different lda incident powers ( approximately 100 , 125 , 140 , and 170 w ) with seop - cell surface temperatures ranging from 42 to 92 c are displayed in figure 3 : figure 3a provides example plots of % pmax and seop as functions of seop - cell surface temperature for a cell containing 1000 torr of xe and 1000 torr of n2 and illuminated by 100 w of laser power from the lda . such data were used to create contour plots ( maps ) of xe % pmax and seop for each xe density as functions of laser power and seop - cell surface temperature ( figures 3c l ) ; the highest values achieved for % pmax for each xe : n2 mix studied are summarized in figure 3b and table 1 ( corresponding numerical values for all data points in figure 3 are tabulated in the supporting information , table s1 ) . the data in figure 3 exhibit several trends . first , increasing cell surface temperature gives rise to an exponential increase in seop ( e.g. , figure 3a ) , consistent with the expected exponential increase in the rb gas - phase concentration [ rb ] . this dependence of seop on [ rb ] arises from the relation1where se and kse are the rb / xe spin - exchange rate and cross - section , respectively . thus , the behavior of seop mostly reflects the spin - exchange rate , since generally kse[rb ] > xe or kse[rb ] xe under our conditions . ( at the highest temperatures studied , kse[rb ] xe ; at the lowest temperatures kse[rb ] can approach or become less than xe , but xe is expected to have a more mild dependence on surface temperature that trends in the opposite direction . ) however , pmax exhibits significantly different behavior , for example , peaking at 72 c for the data in figure 3a . pmax is given by2where prb is the spatial average of the local rb electron spin polarization , prb(r ) , which itself is determined by3where op(r ) is the local rb optical pumping rate ( the integrated product of the laser flux at position r and the rb absorption cross section ) and rb is the rb electronic spin destruction rate ( which is essentially proportional to [ xe ] under our conditions ) . intuitively from eq 2 , xe pmax prb when kse[rb ] xe , which occurs at higher temperatures . however , having higher rb densities generally translates into greater optical density , which in turn gives rise to reduced transmittance of the laser light and hence poorer illumination throughout the cell , lower op , and ultimately reduced prb , thereby decreasing pmax . thus , % pmax initially grows with increasing temperature as more rb is vaporized ( e.g. , figure 3a ) , but once [ rb ] becomes too high , overall prb decreases in accordance with eq 3 , resulting in lower xe % pmax at some of the highest temperatures studied . mapping the conditions of rb / xe seop for five different xe partial pressures . ( a ) example data set showing the dependence of % pmax and seop on the seop - cell surface temperature , here for a 1000 torr xe pressure cell ( also filled with 1000 torr n2 ) with 100 w incident laser power . ( b ) dependence of % pmax and seop on xe partial pressure for five cell xe : n2 compositions using 170 w incident laser power and operating at the optimal cell temperature for each xe loading . ( c - l ) % pmax and seop maps for five cell xe : n2 compositions showing the interdependence on incident laser power and seop - cell surface temperature . the highest % pmax values in the contour plots of figure 3c l were always achieved at the maximum lda power of 170 w. however , as the xe density increased , the optimal temperature decreased from 92 to 62 c , in qualitative agreement with our previous results obtained at a much smaller scale . this inverse relationship between xe density and optimal cell surface temperature , an effect amplified by the use of frequency - narrowed lasers , may be explained in part by the fact that as [ xe ] rises , xe - induced rb spin - destruction becomes increasingly dominant ; thus , lowering the cell temperature helps maintain a sufficient photon - to - rb ratio to ensure high global prb and hence higher % pmax ( provided that the cell xe t1 is sufficiently long ) . the effect may also be exacerbated by greater in - cell temperature gradients caused by ( i ) greater absorption of laser energy and ( ii ) the several - fold lower thermal conductivity of xe compared to that of n2 . indeed , the effects of differential heating are also manifested in the seop maps : seop ( and hence se ) is not a constant of exterior cell temperature but shows some variation . for example , the value at 100 w , 82 c for the 2000 torr xe gas composition is nearly twice that for the 275 torr xe gas composition ; overall , apparent seop values tend to increase with increasing laser power and [ xe ] , consistent with higher - than - expected rb vapor densities ( and higher internal temperatures ) under these conditions . next , there is a clear indication that all the studied xe densities benefited from the increased laser power ( see also figure s1 ) . consequently , the use of lda power greater than 170 w should lead to further increases in % pmax . furthermore , if the increased heat load could be mitigated , greater lda power would allow for operation in the regimes with higher [ rb ] , thereby increasing seop and hp xe production rate . data are absent from some regions of the seop maps in figures 3c l . these regions were avoided because the build - up rate seop was found to be excessively long , the % pmax values were clearly low , and/or the conditions would render an unfavorably high [ rb ] , resulting in undesirable effects dubbed rb pre - runaway or rb runaway . the phenomenon of rb runaway takes place when undissipated heat from laser absorption or cell heating rapidly compounds the amount of rb in the vapor phase over a short time ; the increasing [ rb ] results in decreasing prb in more poorly illuminated regions of the cell and hence more laser absorption and heat dissipation from the gas into the inner surface of the cell ( and rb pools ) in a self - reinforcing pattern . the effect can be characterized by its severity : in full rb runaway , one sees a dramatic decrease in the amount of laser light transmitted through the cell over time which may be followed by deteriorating pxe and even elevated exterior cell surface temperatures . the behavior is also hysteretic , as simple temperature reduction to normal operating regimes generally fails to regain efficient seop . on the other hand , a more mild condition ( here termed rb pre - runaway ) does not have as pronounced a manifestation in the transmitted laser s near - ir spectroscopy but is readily observed during measurements of the kinetics of pxe build - up . examples of rb pre - runaway can be seen in figure 2h ( orange trace ) , where pxe grows , passes the maximum , and then dips . the effect is less pronounced in figure 2h ( red trace ) and nonobservable in figure 2h ( black trace ) . causes % pxe to irreversibly deteriorate and requires a restart of the seop procedure from initial conditions to lower [ rb ] , rb pre - runaway is not hysteretic and can be more easily controlled by reducing the cell temperature . however , it results in lower polarization ( figure 2h ) . in any case , these deleterious effects are more problematic for higher xe densities because of the greater rb spin - destruction rates ( and hence greater light absorption from more poorly polarized rb , as well as any possible contributions from reduced thermal conductivity ) . apparent or usable xe hyperpolarization % pmax(app ) is computed according to ref ( 23 ) to reflect that xe is diluted by n2 gas as follows : % pxe(max , app ) = [ % pxe(max)](pxe / ptot ) where pxe is partial pressure of xe and ptot is total mixture pressure . the production cycle time ( for producing of 0.8 l of hp xe / n2 gas mix ) is calculated as the sum of 2/seop ( i.e. , when the bulk ( 87% of pmax ) of xe hyperpolarization is established , in addition to a reasonable ( 25 min long ) interval necessary to unload / reload the op cell ( with cool - down / reheating procedure described in ref ( 24 ) ) with xenon mix ; seop value corresponding to a maximum value of % pmax was used for every gas composition . the production rate is calculated by dividing 0.8 l gas volume expanded in the tedlar bag during each production cycle by the production cycle time . table 1 summarizes the maximum achieved xe polarization ( % pmax ) for every xe : n2 mix studied . the results show not only the trend of decreased % pmax with increasing xe in - cell pressure but also a corresponding decrease in seop measured at these optimal conditions , a finding that predominantly reflects the lower concentration of rb vapor that must be attained to achieve maximal xe polarization at higher xe densities . nevertheless , the optimization process allows the total magnetization ( mxe ) to continue to grow despite the decrease in % pmax , as the xe density increases faster than % pmax decreases . while the xe polarization values ( and amounts ) are significantly higher here than those in ref ( 21 ) , the improvement in mxe from 1000 to 2000 torr of xe is more marginal . higher laser power may provide further improvements in % pmax ( and mxe ) at high [ xe ] by allowing operation with higher rb densities and hence higher seop rates . other useful metrics describing the overall hyperpolarizer performance summarized in table 1 include the apparent % pxe(max ) due to xe dilution by n2 gas ( % pxe(max , app ) ) , production cycle time , and apparent production rate of hyperpolarized gas ( l / h ) . % pxe(max , app ) is a useful metric because it takes into account hp xe dilution by n2 gas , which has not been eliminated because the hp xe cryocollection step was obviated . production cycle time corresponds to the time necessary to complete the production of 0.8 l of hp xe / n2 gas composition and return the hyperpolarizer ( i.e. , gas reloading , etc . ) to the same step in the operational cycle . computed in this fashion production cycle time was used for estimating the apparent production rate of the hyperpolarizer in liters of hyperpolarized xe / n2 mixture per hour . the production rate in l / h is truly the characteristic of continuous - flow hyperpolarizers , and the apparent production rate values computed in table 1 should be used with care for direct comparison with continuous - flow hyperpolarizers , because the batch - mode method used here produces a single batch per each production cycle , and there is no produced hp xe until the cycle is finished . to validate the in situ nmr results , the polarized contents of the seop - cell filled with 1000 torr of xe and 1000 torr of n2 was transferred into an evacuated ( < 10 torr ) 0.05 l hollow polypropylene sphere located in a rf probe of a 47.5 mt imaging system ( see supporting information for details ) . in - cell pxe was measured in situ as 54 5% before the transfer , and a pxe value of 51 2% was detected in the 47.5 mt preclinical mri scanner ( 558.6 khz xe larmor frequency ) , corresponding to polarization enhancement > 11 000 000 after the gas transfer ( figure 4b ) . figure 5 also demonstrates the feasibility of millimeter - scale mri of hyperpolarized xe at very low magnetic fields using frequency optimized rf coils . ex situ 47.5 mt nmr spectroscopy of hp xe gas expanded into a phantom . ( a ) c nmr spectroscopy using thermal c polarization ( % p13c = 4.1 10% ) of a 17.5 ml reference sample of 5.2 g of sodium 1-c - acetate dissolved in d2o . 256 averages were acquired at 508 khz resonance frequency with a 90 square excitation rf pulse and a repetition time ( tr ) of 200 s. acquisition time was 100 ms . ( b ) ex situ xe nmr spectroscopy of hp xe gas ejected from the polarizer , 0.61 mmol of xe spins ( % pxe= 51 2% ) ; cell loading was 1000 torr of xe and 1000 n2 . the spectrum is acquired at 558.6 khz xe resonance frequency with a single scan ( 2.7 excitation rf pulse ) and tr = 200 ms . the rf pulse is calibrated by monitoring signal decay in the mri images ( see figure 5 ) and accounting for t1 relaxation of the hp xe in the phantom ( c ) ( a ) y - slice / projection across the center of the image shown in ( b ) . ( b e ) selected mri gradient echo ( gre ) images from a series of 20 images . all 20 images were acquired identically with te = 4.0 ms , tr 80 ms ( limited by the spectrometer electronics response time ) , 50% k - space sampling , 64 64 imaging matrix with 72 72 mm field of view ( fov ) , and a spectral width of 20 khz . ( f ) decay of hp signal primarily due to rf - pulse - induced polarization loss . the temporal decay of the signal measured between individual images within 20-image series was used to calibrate rf pulse width ( 2.7 0.1 corresponding to 20 s at 80 mw ) using t1 determined by the data shown in figure 4c , because the signal decay in figure 5f is due to both t1 decay and excitation rf - pulse - associated magnetization losses . simultaneous optimization of various seop conditions ( xe density , cell surface temperature , and photon flux ) combined with previously reported seop hardware improvements yielded greatly improved % pxe . indeed , very high values of % pxe and mxe were demonstrated here for dense ( up to 2000 torr of xe in 2200 torr total ) xe gas mixtures , in part enabled by optimized laser illumination throughout the cell , ultralong in - cell xe relaxation times , and efficient thermal management that also allows for diligent avoidance of rb runaway regimes . the seop condition maps provide guidance for the production of highly polarized xe gas at different xenon densities for a wide variety of applications ranging from materials science to biomedical imaging . furthermore , our results indicate that the pxe values at higher xe densities are still laser - power - limited . thus , while the benefit in total xe magnetization was less substantial at the highest xe densities studied , the advantage will likely be improved when more powerful lda instrumentation is available provided that the greater thermal loads can be mitigated . finally , the highly reproducible maps of seop build - up rates , combined with automated fine control of cell conditions and real - time spectroscopic feedback , should also allow optimization of multiexponential xe polarization dynamics , pointing the way to multifold improvements in hp xe production efficiency .

we present a systematic , multiparameter study of rb/129xe spin - exchange optical pumping ( seop ) in the regimes of high xenon pressure and photon flux using a 3d - printed , clinical - scale stopped - flow hyperpolarizer . in situ nmr detection was used to study the dynamics of 129xe polarization as a function of seop - cell operating temperature , photon flux , and xenon partial pressure to maximize 129xe polarization ( pxe ) . pxe values of 95 9% , 73 4% , 60 2% , 41 1% , and 31 1% at 275 , 515 , 1000 , 1500 , and 2000 torr xe partial pressure were achieved . these pxe polarization values were separately validated by ejecting the hyperpolarized 129xe gas and performing low - field mri at 47.5 mt . it is shown that pxe in this high - pressure regime can be increased beyond already record levels with higher photon flux and better seop thermal management , as well as optimization of the polarization dynamics , pointing the way to further improvements in hyperpolarized 129xe production efficiency .

Introduction Methods Results and Discussion Conclusions

rat 42 and mouse ( 1)21 ion channels were expressed in xenopus laevis oocytes . for 42 receptors , subunit stoichiometry was controlled by varying the 4:2 subunit ratio and verified by voltage jump experiments . dose - response measurements for these channels were performed with a holding potential of 60 mv . unnatural amino acids and -hydroxy acids were prepared , coupled to dca and ligated to 74-mer thg73 as described previously15 . single - channel recording was performed in the cell - attached configuration with a pipette potential of + 100 mv as described previously27 . popen values were calculated from event - detected data using clampfit 9.2 single - channel search . full methods and any associated references are available in the online version of the paper at www.nature.com/nature . rat 42 and mouse ( 1)21 ion channels were expressed in xenopus laevis oocytes . for 42 receptors , subunit stoichiometry was controlled by varying the 4:2 subunit ratio and verified by voltage jump experiments . dose - response measurements for these channels were performed with a holding potential of 60 mv . unnatural amino acids and -hydroxy acids were prepared , coupled to dca and ligated to 74-mer thg73 as described previously15 . single - channel recording was performed in the cell - attached configuration with a pipette potential of + 100 mv as described previously27 . popen values were calculated from event - detected data using clampfit 9.2 single - channel search . full methods and any associated references are available in the online version of the paper at www.nature.com/nature .

nicotine addiction begins with high - affinity binding of nicotine to acetylcholine ( ach ) receptors in the brain . the end result is over 4,000,000 smoking - related deaths annually worldwide and the largest source of preventable mortality in developed countries . stress reduction , pleasure , improved cognition , and other cns effects are strongly associated with smoking . but , if nicotine activated ach receptors found in muscle as potently as it does brain receptors , smoking would cause intolerable and perhaps fatal muscle contractions . despite extensive pharmacological , functional , and structural studies of ach receptors , the basis for the differential action of nicotine on brain vs. muscle ach receptors has not been determined . here we show that at the 42 brain receptors thought to underlie nicotine addiction , the high affinity of nicotine is the result of a strong cation- interaction to a specific aromatic amino acid of the receptor , trpb . in contrast , the low affinity of nicotine at the muscle - type receptor is largely due to the fact that this key interaction is absent , even though the immediate binding site residues , including the key trpb , are identical in the brain and muscle receptors . at the same time a hydrogen bond from nicotine to the backbone carbonyl of trpb is enhanced in the neuronal receptor relative to the muscle - type . a point mutation near trpb that differentiates 42 and muscle - type receptors appears to influence the shape of the binding site , allowing nicotine to interact more strongly with trpb in the neuronal receptor . ach receptors are established therapeutic targets for alzheimer s disease , schizophrenia , parkinson s disease , smoking cessation , pain , attention deficit - hyperactivity disorder , epilepsy , autism , and depression1 . along with solving a chemical mystery in nicotine addiction , our results provide guidance for efforts to develop drugs that target specific types of nicotinic receptors .

Methods Summary Whole-cell electrophysiological characterization of agonist-induced responses Unnatural amino acid / -hydroxy acid incorporation Single-channel characterization of 42 Supplementary Material

localized amyloidosis , also referred to as amyloidoma , is a rare type of amyloidosis in which the amyloid deposition is focal . in soft tissues , various localizations including the breasts , the respiratory and gastrointestinal tract , and the central nervous system have been reported.1 2 3 4 5 6 7 8 9 10 11 in contrast , solitary amyloidoma of the bone is rare . in the axial skeleton , the thoracic spine is most commonly involved , followed by the cervical spine.12 13 14 15 16 17 18 19 20 21 22 23 24 however , the involvement of the sacrum is extremely rare ; only two cases have been reported previously.25 26 amyloidoma of the bone is a benign tumorlike lesion characterized by bone destruction and extension into the adjacent soft tissue . at the level of the axial skeleton , the destruction of the bone may result in vertebral instability and compression of the spinal cord.12 15 18 19 the clinical and radiologic diagnosis of amyloidoma may be difficult due to its variable clinical manifestations and unspecific radiologic findings on plain films , computed tomography ( ct ) scans , and magnetic resonance imaging ( mri).18 27 28 29 definitive diagnosis is based on histopathology including immunohistochemistry for igg lambda and kappa light chains and the demonstration of amyloid protein a ( aa ) and anti - transthyretin in tissue obtained by an open biopsy or fine needle aspiration.7 8 11 27 29 due to the frequent development of neurologic deficits , amyloidomas of the axial skeleton are usually treated surgically . however , the overall prognosis depends on the presence or development of a systemic disease . those cases are usually associated with a poor prognosis.30 here we report the rare case of a localized amyloidoma of the sacrum , its diagnosis , and its surgical and oncological treatment as well as the later clinical course . a 64-year - old woman with a history of several years of lower back pain presented to our clinics with increasing pain and neurologic deficits including weakness and paresthesia of the right leg and difficulties in bladder control . conventional radiographs and a ct scan revealed a large osteolytic tumor ( 75 60 55 mm ) with destruction of the posterolateral aspect of the sacrum extending the right sacroiliac joint . mri of the sacrum showed an extradural mass with low signal intensity on t1-weighted and enhanced intensity on t2-weighted images with complete obliteration of the spinal canal below s1 ( fig . 1 ) . single - photon emission ct and intravenous contrast ct of the thorax and the abdomen did not show any further skeletal lesions or signs for a primary tumor or metastases . preoperative computed tomography ( transversal plane ) at the level of si joint and magnetic resonance imaging ( coronal plane ) scan show the osteolytic tumor and extradural mass ( 75 60 55 mm ) with low signal in t1-weighted and inhomogeneous enhancing intensity in t2-weighted images with complete obliteration of the spinal canal below s1 . a ct - guided needle biopsy was performed . upon histologic analysis , the tumor consisted of amyloid deposits as revealed by typical apple - green birefringence following congo red staining . amyloid deposits were partially engulfed by multinucleated giant cells , and an accompanying lymphocytic infiltration was found . immunohistologic specification of the amyloid deposits revealed lambda light chain amyloidosis ( al ; fig . 2 ) . hematoxylin and eosin ( a ) and congo red ( b ) staining of the biopsy material in 100 magnification . the biopsy largely consists of rather homogeneous , pale pink , nonfibrillary , amorphous extracellular mass ( amyloid , a , asterisk ) , which typically stains brick red in a congo stain ( b ) and reveals a classical apple - green birefringence under polarized light . giant cells of the foreign body type were found as a reaction to the amyloid deposits ( a , arrow ) . multiple myeloma was excluded by bone marrow biopsy and immunoelectrophoresis of the serum and the urine . systemic amyloidosis was ruled out by mri of the heart and biopsies of the colon and the kidney . abbreviations : alp , alkaline phosphatase ; alt , alanine transaminase ; ast , aspartate transaminase ; crp , c - reactive protein ; ggt , gamma - glutamyl transpeptidase ; ldh , lactate dehydrogenase ; pth , parathyroid hormone . en the tumor tissue was very brittle and the resection was performed in a piecemeal fashion with curettage and suction . lumbopelvic stabilization from l4 to the ileum was performed with a modified galveston technique using the uss ileosacral system ( depuy synthes , oberdorf , switzerland ) because the sacrum could not be used for screw placement due to its lytic destruction.31 32 solid screw purchase could only be achieved in the supra - acetabular region of the right ilium . all nerve roots as well as the presacral iliac vessels could be separated from the tumor mass and preserved . the surgical intervention took 3 hours 45 minutes , and the intraoperative blood loss was 1,700 ml . no intraoperative or postoperative complications occurred ( fig . 3 ) . intraoperative situ after intralesional tumor debulking and spinopelvic stabilization . on the right side , resection included the medial aspect of the ilium ; therefore , two iliac screws were necessary . the dural sac was circumferentially cleared below the spinous process of l5 ( triangle ) , and the exiting roots s1 and s2 ( asterisks ) were decompressed . histopathologic analysis of the surgical specimen revealed dense tumor - forming amyloid deposits and an accumulation of mature clonal plasma cells revealing a lambda light chain restriction and monotypic expression of igg ( fig . bone marrow biopsy was repeated and again revealed no evidence of multiple myeloma . in the demonstrated absence of systemic disease surgical treatment was followed by uneventful consolidation radiation therapy ( 50 gy total dose , given in 25 fractions over 5 weeks ) . hematoxylin and eosin staining and immunostaining for lambda light chains ( inlay upper left ) of the intraoperatively retrieved specimen in 400 magnification . the biopsy largely consists of sheets of mainly mature plasma cells as well as islands of homogenous , pale pink , nonfibrillary , amorphous extracellular mass ( amyloid , asterisks ) . at 6 months ' follow - up , the patient showed no signs of local recurrence , had regained neurologic function of the lower extremities completely , and had normal bladder and bowel control . at 9 months , a restaging including serum immunoelectrophoresis showed elevated plasma levels of lambda light chains , which now indicated systemic disease . along with new radiologic findings of osteolyses of the cranium and the proximal femur , multiple myeloma was diagnosed and the final diagnosis of the sacral tumor was revised to standard induction chemotherapy with bortezomib and dexamethasone was initiated . at 12 months ' follow - up ( fig . 5 ) the patient was free of local disease at the sacrum and the systemic disease was in remission . the osteosynthesis was stable and intact , and the patient was mobile without neurologic impairment . the large defect is still visible but not progressing , and the implant material is intact without signs of loosening . there is a small lytic lesion visible in the right ileum indicative for multiple myeloma ( arrowheads ) . amyloidoses are a heterogenous group of diseases characterized by the extracellular deposition of amyloid in various locations . the disease can be localized or systemic and is defined according to the deposited protein ( e.g. , serum aa , light chain amyloid , 2-microglobulin , transthyretin).27 in systemic forms , the precursor protein is released into the circulation in its soluble form and deposited as amyloid in various locations . localized amyloidosis , also referred to as amyloidoma , appears as a circumscribed lesion that may occur in the breast , lung , gastrointestinal tract , central nervous system , and bone.1 2 3 4 5 6 7 8 9 10 11 27 29 30 amyloidomas present as tumorlike lesions with signs of malignant tumor growth.15 18 28 29 33 in localized amyloidosis of the bone , the lesions are usually composed of immunoglobulin kappa or lambda light chains ( al amyloidoma).27 29 30 the accumulation of al amyloid in the bone may be primary or associated with systemic disease in the context of multiple myeloma . in the latter case , monoclonal immunoglobulin light chains are also present in the blood.29 34 skeletal involvement of localized al amyloidosis is unusual . most cases have been reported in the spine , preferentially in the thoracic and cervical part.12 13 14 15 16 17 18 19 20 21 22 23 24 with only two reported cases so far , affection of the sacrum as in our case is extremely rare.25 26 clinical presentation of amyloidoma in the axial skeleton varies . depending on the location , size , and involvement of neural structures patients may be asymptomatic , have localized back pain , or show varying degrees of neurologic symptoms including radiculopathy , paraparesis , and paraplegia.14 15 16 26 33 35 36 37 38 pathologic fractures are rare.15 26 38 39 involvement of the skeleton may lead to bony destruction mimicking other locally aggressive processes including infections or malignancies such as chondrosarcoma , lymphoma , and bone metastases.15 18 28 29 33 on conventional radiographs , amyloidoma of bone presents as lytic lesions with varying degrees of calcification . cortical disruption may be present due to the expansion of amyloid deposits into the surrounding soft tissue.13 for lesions at the level of the axial skeleton , an evaluation with respect to potential instability and neurologic affection is needed . computed tomography is well suited to evaluate bone destruction and instability with well - known limitations to assess the expansion into the soft tissue.15 36 on mri , amyloidoma usually exhibit low to intermediate signal intensity on both t1- and t2-weighted images with variable contrast enhancement on t1-weighted images.15 40 however , mri is not specific in the diagnosis of localized amyloidosis . the amyloidoma in our case presented as a lytic lesion with a calcified matrix on conventional radiographs and ct scan . the lesion had signs of malignant tumor growth such as the destruction of the posterolateral aspect of the sacrum with extension over the right sacroiliac joint . such aggressive appearance has also been described for the two reported cases of localized amyloidosis of the sacrum.25 26 in agreement with the literature , mri findings in our case showed a spinal epidural mass but were otherwise unspecific for the diagnosis of the lesion . in accordance with bruninx et al25 and griffin et al,26 definite diagnosis could not be made based upon the imaging studies . therefore , the final diagnosis requires the histopathologic demonstration of typical apple - green birefringence of the amyloid upon staining with congo red and an examination under polarized light.7 27 29 30 41 subsequently , immunohistochemical characterization of the chemical type of amyloid is required . because localized amyloidosis of the bone are composed of al amyloid , immunostainings for kappa and lambda immunoglobulin light chains to prove clonal restriction should be performed.29 41 to exclude secondary or inflammation - associated amyloidosis , immunohistochemical characterization should also include aa , anti - transthyretin , and 2-microglobulin.27 in the absence of neurologic symptoms , amyloidoma can be managed conservatively by observation and serial imaging . in cases with increasing pain , instability , or cord compression , in large tumors with extensive soft tissue expansion , complete excision may not be possible or associated with a high risk of complications and morbidity . given the lack of neurologic symptoms , one of the two so far reported cases was observed without specific treatment.26 the other patient was treated surgically with bilateral laminectomy from s1 to s3 and complete excision of the tumor mass . no adjuvant therapy was performed.25 the lesion reported by bruninx et al was limited to the body of s2 with expansion into the left neuroforamen of s1.25 at 75 60 55 mm , the amyloidoma we present was very large ( fig . 1 ) and complete resection was not possible without removal of the l5 to s3 nerve roots . to limit the morbidity the role of radiation therapy in localized amyloidoma of the bone has not been established , but seemed reasonable given the similar clinicopathologic features of localized amyloidoma and plamacytoma.27 28 30 42 other amyloid deposits or an underlying multiple myeloma have to be ruled out with adequate procedures , as in our patient . whether primary amyloidomas represent a benign plasma cell neoplasm or a plasmocytoma with local amyloid production is controversial . the outcome of localized amyloidoma is determined by the presence or the development of multiple myeloma . a localized extraosseous plasma cell clone associated with localized amyloidosis may not necessarily imply an increased risk of progressing to systemic disease.34 43 44 lipper and kahn reported three patients with amyloidomas of the bone who did not develop multiple myeloma over a follow - up period of up to 12 years.7 in contrast , pambuccian et al stated that amyloidomas of the bone in fact represent plasmacytomas with a frequent later progression to multiple myeloma.30 unfortunately , this has been the case in our patient , who developed multiple myeloma 9 months after local therapy . therefore , the initial diagnosis of primary solitary amyloidoma of the sacrum was revised to multiple myeloma - associated localized amyloidoma . this case highlights that careful follow - up of patients with localized amyloidosis is mandatory to ensure initiation of adequate systemic therapy . intralesional resection with adjuvant radiotherapy can result in a favorable outcome with recovery of symptoms and local tumor control . however , the overall prognosis depends on the presence or development of underlying systemic disease that require standard staging procedures and adequate follow - up and if necessary medical treatment of multiple myeloma .

study design case report . objectives with only two previously reported cases , localized amyloidosis of the sacrum is extremely rare . here we report a 64-year - old woman with a large osteolytic lesion accompanied by weakness and paresthesia of the right leg and difficulties in bladder control . methods fine needle biopsy and standard staging procedures revealed a primary solitary amyloidoma that was treated with intralesional resection , lumbopelvic stabilization , and consolidation radiotherapy . results clinical follow - up revealed the diagnosis of multiple myeloma 9 months after initial treatment . at 12 months , no local recurrence has occurred , the neurologic symptoms have resolved , and the systemic disease is in remission . conclusions intralesional resection with adjuvant radiotherapy of the amyloidoma achieved good local tumor control with limited morbidity .

Introduction Case Report Discussion Conclusion

polycythemia is clinically defined as elevated red blood cell mass ( hemoglobin > 18.5 g / dl in men , 16.5 g / dl in women or other evidence of increased red cell volume or hemoglobin or hematocrit greater than 99th percentile of method - specific reference range for age , sex , altitude of residence or hemoglobin greater than 17 g / dl in men , 15 g / dl in women if associated with a documented and sustained increase of at least 2 g / dl from an individual 's baseline value that can not be attributed to correction of iron deficiency , or elevated red cell mass greater than 25% above mean normal predicted value 1 . polycythemia can be further classified as primary polycythemia , secondary polycythemia , or polycythemia due to abnormal hypoxia sensing . primary polycythemias are caused by intrinsic defects in the erythroid precursors that result in hyper responsiveness to normal level of serum erythropoietin ( epo ) . secondary polycythemias are driven by the factors ( predominantly epo but also insulin growth factor 1 and cobalt ) extrinsic to the erythroid progenitor cells . generally , in secondary polycythemia , the increased red cell mass represents a physiologic response to tissue hypoxia or abnormally increased level of serum epo 2 . polycythemias due to abnormal hypoxia sensing include chuvash polycythemia , polycythemias associated with von hippel - lindau mutations other than the chuvash polycythemia mutation , and polycythemia due to proline hydroxylase mutation 3 , 4 . acquired conditions that lead to increased epo production , such as chronic hypoxia and a variety of tumors , are the most common causes of secondary polycythemias . these include hemoglobin variants with high affinity for oxygen , congenitally low erythrocyte 2 , 3 biphosphoglycerate levels , and inherited methemoglobinemias . all these conditions are characterized by a left shift in hb dissociation curve which in turn leads to tissue hypoxia and a physiologically appropriate increase in epo levels . congenital cyanotic heart or lung disorders , which lead to tissue hypoxia and increased epo level are also examples of secondary congenital polycythemias but these are characterized by a normal hb dissociation curve . two subjects ( mother and daughter ) , from a family with multiple subjects with polycythemia , were available for evaluation : subject 1(mother ) : she is a 59 year old caucasian woman who presented with lifelong history of polycythemia . her medical history was remarkable for 1 ) multifocal ductal carcinoma in situ ( dcis ) of the breast in 2002 , treated with simple mastectomy and 2 ) colonic diverticula and internal hemorrhoids since 2005 . family history was remarkable for presence of lifelong history of polycythemia in her mother and two daughters . laboratory parameters revealed high hb ( 16 gm% ) , high hematocrit ( 48% ) , normal mcv , normal platelet and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . subject 2 ( daughter ) : she is a 30 year old caucasian woman who presented for further evaluation of lifelong history of polycythemia . family history was significant for lifelong history of polycythemia in her mother , maternal grandmother and her younger sister . laboratory parameters were remarkable for elevated hemoglobin ( 17.2 gm% ) and hematocrit ( 51.4% ) but normal mcv , normal platelets and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . both subjects underwent following laboratory tests : serum epo levels were normal in both subjects ( 15 miu / ml and 19 miu / ml respectively , normal range 4.1 - 19.5 miu / ml ) . venous blood gas parameters were obtained which included partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation . calculation of affinity of hb for oxygen ( p50 ) was done using the mathematical formula as described 5 . routine hb electrophoreses , high performance liquid chromatography ( hplc ) 6 , 7 , isoelectric focusing ( ief ) in polyacrylamide gel , globin chain analysis 8 and peptide mapping 9 were performed . this was followed by beta globin gene sequencing which was performed by abi3730 96-capillary sequencer at the dna sequencing core facility at the university of utah school of medicine ( primers and conditions available upon request ) . the p50 was found to be low at 18 mm hg ( normal range 22.6 to 29.4 ) suggesting increased affinity of hb for oxygen . ief showed a band anodal to hb a and globin chain analysis by hplc revealed an unidentified beta globin variant in both subjects ( figure 1 ) . peptide mapping showed an extra peak at 26.9 min but showed no decrease in any peaks suggesting a mutation somewhere in the core ( figure 2 ) . beta globin gene sequencing revealed a novel mutation ( gtg->ttg ) of codon 109 of exon 3 of beta globin gene . this mutation leads to a previously reported high affinity hb variant known as hb johnstown ( beta109 val->leu ) 10 - 12 ; however , this nucleotide change is novel and previously unreported ; and it leads to a previously described amino acid substitution that was however , caused by a different nucleotide missense mutation . hb johnstown ( beta109 ( g11 ) val->leu ) is a high oxygen affinity hb variant and there are three reports in the literature . it was first reported by jones and colleagues in oregon , in 1990 , in a healthy asymptomatic subject with mild erythrocytosis and left - shifted hemoglobin - o2 dissociation curve10 . as with many other hb variants , hb johnstown is silent on standard hemoglobin electrophoretic analyses , and was identified and isolated by reverse - phase hplc of individual globin chains . structural analysis revealed the substitution beta 109 ( g11 ) val ->leu 10 . in 2000 , the underlying beta globin mutation [ beta - globin codon 109 ( gtg ->ctg ) ] was first reported by ropero and colleagues , in two unrelated families ( total four subjects ) of basque extraction in spain 11 . in one of these families , hb johnstown mutation was present in double heterozygosity with another beta 0 thalassemia mutation ivs-1-nt1 ( g->a ) . in 2004 , feliu - torres and colleagues reported hb johnstown [ beta - globin codon 109 ( gtg ->ctg ) ] in an eight year old girl , who had been referred for evaluation of erythrocytosis , in double heterozygosity with another beta globin mutation [ ivs - i-1(g->a ) ] . however , these reports described a causative g to c mutation that is different that mutation we describe in our subject with hb johnstown , namely g to t , both encoding the same amino acid ; i.e. leucine and present in subjects not known to be of spanish / basque extraction . the sigmoid shape of hb - oxygen dissociation curve is indicative of cooperative interaction between heme and oxygen . oxygen affinity and hb - oxygen dissociation is affected by blood ph , 2 , 3- biphosphoglycerate ( 2 , 3 bpg ) level in the red cell and temperature , and globin structure 13 . affinity of hb with oxygen is expressed as the p50 , which is the partial pressure of oxygen in blood at which 50% of the hb is saturated with oxygen . the venous p50 can be measured directly using a cooximeter which is no longer easily available in routine and even reference laboratories . lichtman and colleagues have reported a mathematical formula which can be used to calculate p50 reliably 5 . calculating p50 using this formula requires the following venous gas parameters : partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation , and uses anti - log mathematical function that many clinicians find difficult to use for calculation 5 . the p50 of a healthy person with normal hb is 26 1.3 mm hg . the 99% confidence interval for individual observations has been reported to be 22.6 to 29.4 mm hg . an abnormally low p50 reflects an increased affinity of hemoglobin for oxygen and vice versa . elevations and reductions in 2 , 3- bpg level in the erythrocyte will also lead to corresponding changes in p50 values ; however , in only reported subjects this decrease was limited to a p50 value between 20 and 35 mm hg . there should be high suspicion for the presence of a high affinity hb variant if p50 value is < 20 mm hg 5 . during oxygenation and deoxygenation , there is considerable movement along the interface of alpha 1 and beta 2 chains of the hb tetramer . all these substitutions can affect the cooperative nature of oxygen binding with heme , and in turn , can change the affinity of hb for oxygen . the majority of mutations affecting oxygen affinity result in high affinity hb variants which result in leftward shift of the dissociation curve and relative tissue hypoxia 14 . there are 90 high affinity hb variants , listed on the globin server , known to be associated with high affinity for oxygen ( http://globin.bx.psu.edu/hbvar/menu.html accessed on may 04 , 2007 ) 15 . high affinity hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia . this leads to increased production of epo from kidneys which results in increased red blood cell mass and polycythemia . at an elevated level of increased red blood cell mass ( which depends upon the oxygen affinity of a given variant ) adequate oxygenation of the tissue is reestablished and epo production plateaus and at this new steady state serum epo is often at normal level . this leads to stabilization of hb level after achieving a certain elevated level of hematocrit . family history of polycythemia in a subject with polycythemia should raise the suspicion for the presence of a high affinity hb variant 14 . a low p50 value ( obtained from venous gas parameters ) is supportive of high oxygen affinity hb variant or decreased 2 , 3 bpg level . in a polycythemic patient , establishing a correct diagnosis of a high affinity hb variant is important as these patients have normal life expectancy and do not require phlebotomy . the therapies used for polycythemia vera such as phlebotomy and chemotherapy should not be used in patients who have polycythemia due to high affinity hb variants . with this report , we are providing an electronic version ( using microsoft excel program ) of the mathematical formula 5 , with which p50 can be calculated in few seconds , provided venous gas parameters are available , without necessity of more sophisticated calculations using antilog parameters . with increased ease and rapidity of calculation using our excel program ( supplementary material ) , we hope that use of p50 will increase , leading to improved detection of hb variants in subjects with familial polycythemia .

two polycythemic subjects from a family with multiple polycythemic subjects were evaluated . estimation of oxygen affinity of hb from venous blood gas parameters ( p50 ) revealed low p50 suggesting a high affinity hb variant . further work up , which included beta globin gene sequencing , revealed a novel mutation changing a codon to the previously reported high affinity hb - hb johnstown ( beta109 val->leu ) . polycythemic subjects with high affinity hb variant are asymptomatic with normal life expectancy . their differentiation from polycythemia vera ( pv ) is crucial to avoid therapy which is otherwise reserved for pv patients . we provide an electronic version ( in microsoft excel program ) of a previously reported mathematical formula for rapid calculation of p50 from venous blood gases . estimation of p50 is an essential initial step in the evaluation of a subject with personal and family history of polycythemia .

1. Background 2. Methods 3. Results and Discussion 4. Conclusion Supplementary Material

sex cord - stromal tumors of ovary account for approximately 5 - 8% of all ovarian tumors ( 15 ) . they are composed of granulosa cells , theca cells , sertoli cells , leydig cells and fibroblasts singly or in various combinations ( 2 , 6 ) . leydig stromal tumor is a rare member of this group that accounts for less than 0.1% of all ovarian tumors ( 7 , 8) . they are usually benign , unilateral ( 2 , 610 ) and characterized by the presence of crystals of reinke in the steroid cells ( 8 , 9 , 11 ) . they produce testosterone , leading to hyperandrogenism and virilization ( hirsutism , voice deepening , clitoromegaly , increased muscle mass , et al ) in woman who are mostly postmenopausal ( 7 , 8 , 11 ) . here we report a 41-years old woman with virilization and an ovarian leydig stromal cell tumor . a 41-year - old woman with a 5-year history of amenorrhoea was admitted to our hospital because of relapsing vaginal bleeding , hirsutism , acne , some skin lesion especially on her abdomen , deepening of the voice and feeling of pressure in the pelvic for past 6 months . she first had gone to a dermatologist office with an excessive hair growth on the body and acne . because of an abnormality in her serum androgen and a pelvic mass in the ultrasonography , physician referred her to a gynecologist . adreno - corticotropin hormon ( acth ) , dehydro - epiandrostone sulfate ( dheas ) , thyroid function test and urine free cortisol level with a volume of 1300ml were normal . ultra sound revealed a uterus with 12.5 x 3.8x7 cm in diameters with a myomatosis pattern and an endometrial length of 7 mm . a heterogenous mass of about 62x65 mm with multiple calcification areas was seen in right adenex , so an ovarian mass or pedunculated myoma was suggested . on her transvaginal examination , right adenex fullness with a uterus larger than normal size in a postmenopausal woman was detected . she underwent an exploratory laparatomy , total hysterectomy , infracolic omentectomy , bilateral salpingo - oophorectomy and peritoneal washings . in pathologic report , macroscopic finding includes an encapsulated creamy gray solid mass with smooth and lobulated external surface , with areas of orange discoloration . in microscopy : ovarian stroma , leydig cells and spindle stromal cells without atypia were seen ( figs . 1 , 2 ) . ovarian stroma with leydig cells and spindle stromal cells ( hematoxylin eosin staining ) polygonal and spindle cells of tumor with obvious vasculature ( hematoxylin eosin staining ) a benign leydig stromal cell tumor was reported with no omental or lymph node involvement and cytology of peritoneal washing was negative for malignant cell . operative follow - up , serum testosterone level decreased , and there was regression of the virilizing changes . sex cord - stromal tumors are groups of tumors composed of granulosa cells , theca cells , sertoli cells , leydig cells and fibroblasts of stromal origin , singly or in various combinations ( 2 , 6 ) . they account for approximately 5 - 8% of all ovarian tumors and because they are rare tumors , there is a limitation in understanding their natural history , management , and prognosis ( 15 ) . women older than 50 years of age show the most incidence of ovarian sex cord - stromal tumors although a significant proportion occurs in premenopausal women ( 2 ) . leydig stromal cell tumor is a rare case of these tumors that mostly occurs in a post menopausal women ( 2 , 7 , 8 , 11 , 12 ) . in two reports with series of cases , the average age of patients was 60 years ( 6 ) although the patient in this study was younger . ovarian tumors that induce virilization ( like hirsutism , enlargements of clithoris , the voice deepening , etc ) constitute less than 0.2% of hyperandrogenism . the time to onset of symptoms is usually faster in these tumors than the other causes of hyperandrogenism such as polycystic ovary syndrome ( pcos ) ( 12 ) , similar to our patient whose symptoms appear within months . leydig stromal cell tumors account for less than 0.1% of all ovarian tumors ( 7 , 8 , 12 ) . evidence of virilization as a result of hyper androgenism , is seen in approximately one - half of the patients , and one - third have presented with estrogenic manifestation ( 6 ) . about 30% of patients such as patient in this study may have endometrial hyperplasia and dysfunctional uterine bleeding ( 13 ) . when abnormal vaginal bleeding is present or a thickened endometrial lining on ultrasound detected , endometrial biopsy must be done to exclude endometrial cancer prior to surgery ( 12 ) . when the tumor is removed , the virilizing changes will regress but may not disappear . aetiologies of the estrogenic changes include : estrogen secretion by the tumor , peripheral conversion of androgen , associated stromal hyperthecosis or a combination of these factors . this tumor is distinguished from the sertoli - leydig cell tumor by the absence of a sex - cord component ( follicular granulosa cells which are homologue of sertoli cells in the testis ) ( 6 ) . the stromal component resembles the theca cell tumor , and the presence of crystals reinke in the steroid cell identifies them as leydig cells ( 6 , 11 ) . some ovarian leydig cell tumors arise in the hilus from hilar leydig cells which can be identified in over 80% of normal adult ovaries . other leydig cells tumors that are located within the ovarian stroma are referred to as non hilar leydig cell tumors , and the term leydig cell not otherwise specified is used when it is impossible to be certain about the origin ( 6 , 9 ) . the main treatment of the sex cord stromal ovarian tumors is surgery ( 2 ) . unfortunately clinical presentation and sonographic appearance a conservative surgery with unilateral salpingo - oophorectomy and a careful staging are justified reasonable for patients who want to preserve their fertility with the absence of extraovarian spread . if advanced - stage disease or bilateral ovarian involvement is present or the patient does not want to preserve her reproductive potential , abdominal hysterectomy and bilateral salpingo - oophorectomy should be performed . this includes a thorough exploration of the abdominal cavity , washing for cytologic analysis , multiple biopsies , omentectomy , and pelvic and para - aortic lymph node sampling or dissection ( 2 ) . in some cases , androgen secreting tumors response to gonadotropin releasing hormone agonist , therefore in patients who surgery is not straightforward such as high surgical risk , this treatment can be used ( 12 , 13 ) . although polycystic ovary syndrome ( pcos ) and non - malignant androgen excess disorders are common causes of hyper - androgenism , other aetiologies such as ovarian tumors should be considered . a complete evaluation should be done in a woman with skin disorder ( such as hirsutism and acne ) that can be related to hyperandrogenism .

leydig stromal cell tumor is a rare ovarian tumor that belongs to the group of sex - cord stromal tumors . they produce testosterone leading to hyperandrogenism . we present a 41yr old woman with symptoms of virilization and a mass of right adenex via ultra sonography , and a rise of total and free serum testosterone . an ovarian source of androgen was suspected and a surgery performed . a diagnosis of leydig - stromal cell tumor was confirmed.our report is a reminder that although idiopathic hirsutism and other benign androgen excess disorder like polycystic ovarian syndrome ( pcos ) are common , ovarian mass should be considered in differential diagnosis .

Introduction Case report Discussion Conclusion

proteins are essential components of all organisms , carrying out tasks defined by the information encoded within genes , for example catalyzing biochemical reactions , mediating cell signaling , or providing structural rigidity . simulations range from elucidation of enzymatic reaction mechanisms , to the study of folding pathways , to design of therapeutic molecules against disease . in biomolecular simulations such as these , molecular mechanics ( mm ) force fields are often used in which electrostatic interactions are described by atom - centered point charges . however , there is no unique method for partitioning the rigorously calculated quantum mechanical ( qm ) electron density among the individual atoms and different charge derivation schemes often lead to very different results . in commonly used force fields such as amber , the mm partial charges of protein molecules are optimized by fitting them to reproduce the qm electrostatic potential ( esp ) of small molecules . these esp charges are well - suited for mm force fields , as they reproduce ab initio multipole moments and electrostatic interactions between molecular fragments . a disadvantage of such techniques is the neglect of polarization by the environment indeed , a recent density functional theory ( dft ) natural population analysis of an entire protein in water found that net charges of residues can vary by up to 0.5 e from their putative integer values . while mean field approaches for charge fitting are the most appropriate for deriving transferable force field parameters , often , as in the example of the study of protein ligand binding , we are only interested in sampling in the vicinity of the protein s native state . in these cases , it would be ideal to incorporate electrostatic polarization that is specific to that native state into the charge fitting procedure . recent studies have calculated atom - centered charges for entire proteins , accounting for native state polarization by including background point charges in a series of iterative fragment - based esp fits . the resulting polarized protein - specific charges perform better than standard amber charges in determining free energies of ligand binding , in pka calculations , and in comparisons with nmr data . these results point to the potential improvements that can be made by using polarized protein - specific point charges . however , such an approach potentially requires a large number of qm calculations to iterate all charges in the system to self - consistency and requires restraints or conformational averaging to treat buried atoms and to address the sensitivity of the charges to small conformational changes . an ideal charge derivation scheme should efficiently account for the surrounding environment , while the resulting charges should be chemically intuitive , reproduce ab initio electrostatic properties , be robust with respect to conformational changes , and be insensitive to buried atoms . the charges should be derived from first principles , with no empirical parameters , applicable to a wide range of systems without requiring specialized treatments based on specific chemical knowledge of a particular molecule , and preferably computable from a single qm calculation of the whole system . recently , there has been renewed interest in electronic density - based atoms - in - molecule ( aim ) charge partitioning based on the hirshfeld approach . such methods differ conceptually from esp in that the net atomic charges are assigned by dividing a converged , qm electronic density into a union of overlapping atomic basins . the density derived electrostatic and chemical charges ( ddec ) method , developed by manz and sholl , combines two aim approaches , iterative hirshfeld ( ih ) and iterated stockholder atoms ( isa ) , to assign atomic charges from the electron density . the resulting charges have already been shown to be suitable for force field development . they adapt to the atom s environment , reproduce the ab initio electrostatic potential , and , where applicable , correlate well with x - ray diffraction and x - ray absorption near - edge spectroscopy data . the method can be applied with no adjustable parameters to buried atoms and to either periodic or nonperiodic systems . ddec charges have already been used to develop force fields for molecular adsorption inside metal organic frameworks . the ddec method is implemented in a freely available code ( http://ddec.sourceforge.net/ ) , which is interfaced with codes such as vasp and gaussian among others . thus , ddec charges are suitable for environment - specific , flexible force field development for biomolecular simulations but are limited by the unfavorable computational scaling of the underlying qm calculation to systems of a few hundred atoms . in this paper , we overcome this limitation by implementing the ddec scheme in the onetep linear - scaling dft code . onetep combines high basis set accuracy , comparable to that of plane - wave dft methods , with a computational cost that scales linearly with the number of atoms , which allows for an accurate , fully qm description of systems of thousands of atoms , including entire proteins . we begin by outlining the various underlying aim schemes , followed by a brief description of the linear - scaling dft code onetep . we validate our internal implementation of the ddec methodology against quantum chemistry calculations in gaussian09 for a benchmark set of 25 representative small molecules and show that charges are derived with linear - scaling computational cost , allowing analysis of proteins comprising thousands of atoms from a single dft calculation . we demonstrate that , for these large systems , the features of the ddec scheme that make the charges desirable for flexible force field development are maintained . namely , the charges ( i ) respond to their environment in a chemically intuitive manner ; ( ii ) reproduce electrostatic properties of the dft calculation ; and ( iii ) are not overly sensitive to small conformational changes or the presence of buried atoms . finally , we construct a mm force field based on the ddec charges for three proteins and compare the results of our mm simulations with experimentally measured nmr dynamic observables and a standard biomolecular force field . the ddec method is based upon two recently developed extensions to the original hirshfeld aim scheme . in the original formulation , an electronic density n(r ) is divided into overlapping atomic basins na(r ) for each atom a according to the weighting formula:1where na0(r ) is the atomic reference density , whose overlapping sum over all atoms in the system bnb0(r ) is termed the promolecular density . this form of stockholder partitioning , where the electronic density at each point r is distributed based on the proportional contribution from the reference densities of each atom at that point , has been shown to minimize the information distance faim ( kullback liebler entropy ) between the real and promolecular density , maximizing the information retained in the reference atomic states na0(r ) when transferring to the molecular environment:2subject to the constraint that ana(r ) = n(r ) ; that is , the electronic density is completely partitioned . in other words , the stockholder partitioning exhaustively divides the real electronic density into a set of overlapping atomic densities na(r ) in such a way as to maximize the density distribution similarity to their respective reference density counterparts na0(r ) . shortcomings of the original hirshfeld method included an arbitrariness in the choice of reference atomic densities na0(r ) . neutral , gas - phase atomic densities were often chosen as references , although these commonly led to atomic populations that were too close to zero . such problems are addressed in recently proposed iterative extensions to the hirshfeld method , in which reference densities are successively improved until self - consistency is achieved . in the iterative hirshfeld ( ih ) , the ih reference densities na0(i , r ) are derived from the partitioned atomic density at iteration i , na(i , r ) , by the following procedure . first , the ( noninteger ) electronic populations of each atom qa(i ) are computed in the usual way from the partitioned atomic densities:3instead of choosing neutral reference states as in the original hirshfeld method , new reference states are generated by linear interpolation between densities of free atoms or ions with the next lowest integer ( = lint(qa(i ) ) and the next highest integer ( + 1 ) number of electrons:4the purpose of the interpolation is to obtain a suitable gas - phase reference density for a hypothetical ion comprising qa(i ) electrons . the partitioned atomic densities for the next iteration i + 1 are then derived from the reference states generated at iteration i:5the procedure is iterated until the changes in the set of ih charges fall below a specified threshold . the resulting charges have been shown to reproduce ab initio electrostatic properties of small polypeptides and to be relatively insensitive to small conformational changes . an alternative approach by lillestolen and wheatley , meanwhile , named iterated stockholder atoms ( isa ) , takes the spherical average of the partitioned atomic density na(i , r ) at iteration i as the ( isa ) reference density that enters into eq 5 , where a denotes spherical averaging about the center of atom a:6 in practice , the averaging is performed on a set of discrete radial shells up to a maximum radius rmax . the isa scheme is argued to be less empirical than ih , as the latter still relies on a library of externally generated ionic densities . isa also produces a better fit to the esp due to the low - order multipoles possessed by the converged na(r ) resulting from the spherical - averaging procedure used to generate the reference densities . the ddec scheme by manz and sholl combines the ih and isa methods by minimizing a combined information entropy functional ( eq 2):7where fih / isa are constructed with ih / isa reference densities and weighted by an adjustable parameter . minimizing eq 7 with respect to na(r ) with the same constraint as eq 2 leads to a partitioning of the form:8where naih / isa(i , r ) are the respective reference densities given by eqs 4 and 6 . by allowing a fraction of fih to contribute toward curvature in regions that otherwise have shallow optimization landscapes , for example , buried atoms , this technique alleviates the slow convergence of the isa method for such regions while retaining the appealing attributes of the isa scheme . an important addition to the ddec scheme is the employment of charge - compensated reference ih densities , referred to as the ddec / c2 scheme . these densities are generated from dft ground - state ionic calculations in the presence of a charge compensation sphere , akin to a conductor - like polarizable continuum model ( cpcm ) treatment with a solvent of infinite dielectric constant . the justification for using such compensated densities instead of free ionic states , as in the original ih scheme , stems from the dielectric screening experienced by an ion embedded within a molecule , whereby its density profile can be modified by the effective dielectric constant . the charge compensation sphere acts to expand ( contract ) the reference density in the case of cations ( anions ) . onetep is a linear - scaling dft package based on a reformulation of conventional kohn sham dft in terms of the single - particle density matrix:9where { (r ) } are nonorthogonal generalized wannier functions ( ngwfs ) that are localized in real space , and k is a representation of the density matrix in the biorthogonal duals of the ngwfs . onetep achieves linear - scaling by exploiting the nearsightedness of the single - particle density matrix in nonmetallic systems . in practice , linear - scaling arises from enforcing strict localization of the ngwfs onto atomic regions and through the optimization of the density kernel and ngwfs , subject to localization constraints . optimizing the ngwfs in situ allows for a minimal number of atom - centered orbitals to be used while maintaining plane - wave accuracy . the ngwfs are represented in a basis of highly localized periodic cardinal sine ( psinc ) functions ( otherwise known as fourier the psinc functions are related to plane waves via a fourier transform , meaning that systematic improvement is possible through adjustment of the psinc grid spacing , analogous to converging the kinetic energy cutoff in traditional ( n ) plane - wave dft codes . in order to expedite optimization , the ngwfs can be initialized closer to their ground states by using an in - built pseudoatomic solver , which self - consistently solves the dft kohn sham equations for isolated atoms using the same pseudopotentials and exchange - correlation functional as the full calculation . implicit solvation , whose inclusion is essential both for an accurate description of the protein s aqueous environment and to aid optimization of the density kernel , is implemented within onetep . this is a minimal parameter , self - consistent model based on direct solution of the inhomogeneous poisson equation for a solute cavity defined by the isosurface of the electron density . we have implemented the ddec method within onetep as a postprocessing module to take advantage of its parallel and efficient algorithms for sparse matrix algebra and operations with localized orbitals and electron distributions . a single dft calculation is performed on the system to obtain the ground - state electronic density , which is then processed to extract the ddec net atomic charges . reference densities for the ih part of the calculation are generated internally at run time using the same exchange - correlation functional , pseudopotentials , and ngwf cutoff radius as the full dft calculation , with the c2 charge compensation scheme . specifically , using the pseudoatomic solver module , as described in section 2.2 , the kohn sham equations for a set of atomic orbitals of an isolated atom are solved self - consistently on a radial grid with an additional spherical surface of compensation charge . the effect of this charged surface is expressed equivalently via gauss law as an additional radial electrostatic potential term vcomp in the hamiltonian:10where the first three operators are the kinetic energy , local and nonlocal potentials , and vcomp = qcomp/|r| for |r| > rcomp , with qcomp and rcomp the charge and radius of the compensation sphere . following manz and sholl , for cations , the magnitude of the compensation charge ( qcomp ) is chosen to neutralize the ion , with the compensation sphere radius ( rcomp ) set to the average of nlm|r|nlm expectation values of all occupied orbitals { |nlm } in the neutral species that are vacant in the cation . for anions , the compensation charge is chosen to make the electrostatic potential at an infinitesimal distance outside the compensation sphere zero . the radius of the compensation sphere is incrementally adjusted in 0.1 bohr steps until the total energy of the system is minimized . whole - molecule densities ( total and promolecular ) are stored on regular cartesian grids , while spherically averaged promolecular density profiles for individual atoms are computed and stored on atom - centered sets of equally spaced radial shells up to a predefined maximum cutoff radius . linear - scaling computation with respect to the number of atoms ( for each iteration ) is achieved at a modest cost of computational memory by computing and storing the total promolecular density ( bnb0(i , r ) ) once per ddec iteration , on the same grid as the molecular density . figure 1a shows the computational scaling of our ddec implementation for periodic supercells of bulk water of increasing size , up to around 2500 atoms ( supporting information ) . even for the largest system , the computation time of the ddec analysis is under 20 min . the dft calculation itself requires around 12 h on 160 cores , making the calculation of ddec charges for systems comprising thousands of atoms feasible on a near - routine basis . ( a ) computation time required for ddec postprocessing calculations of bulk water . ( b ) ddec atomic and molecular charge distributions of bulk water for three system sizes . importantly , the number of iterations required for charge convergence remains virtually constant for increasing numbers of atoms , ensuring that the total computational effort remains linear - scaling with respect to system size . figure 1b reveals that the distribution of charges obtained for bulk water is independent of system size . the atomic charges distributions are centered on values close to those typically used in mm force fields ( tip3p ) , while they show some spread as one might expect for atoms in a liquid with differing local environments . recently , manz and sholl introduced an update to the ddec method , named ddec / c3 . the ddec / c3 method improves convergence of charges for nonporous solids with short bond lengths between diffuse atoms by enforcing exponential decay of atomic electron densities and conditioning the reference ih densities naih(i , r ) that enter eq 8 to the material of interest . in our implementation , we use the conditioned reference densities but do not enforce radial decay of the partitioned atomic densities na(r ) . our reasoning is that our studies are aimed at biomolecular systems , which are porous materials lacking compacted regions , and we anticipate that the partial weighting by ih reference densities during optimization will be sufficient to ensure the stability of atomic charges for embedded atoms . in addition , in our implementation , core charge handling has been completely excluded , as we employ norm - conserving pseudopotentials . literature studies have found little dependence of ih charges on the treatment of core electrons . nevertheless , in the following section , we test both of these assumptions by validating onetep - calculated ddec charges against the full ddec / c3 method employing the all - electron code gaussian09 . the validity of our ddec implementation was tested using a set of 25 diverse , neutral , small , organic molecules . benchmarking was performed against the standard ddec method as implemented in the chargemol package ( version 2.1 beta , obtained from http://ddec.sourceforge.net/ ) , employing 100 radial shells ( nrad ) up to a maximum cutoff radius ( rmax ) of 5 , together with the supplied c3 charge - compensated reference density library ( ddec / chargemol ) . molecular geometries were optimized in vacuo with a 6 - 311g(d , p ) basis set , and electronic densities were generated with an aug - cc - pvqz all - electron basis set in gaussian09 . the mixing parameter was set to /14 , which has been shown to give the optimal balance between minimizing the atomic multipoles and maximizing chemical accuracy . the set of net atomic charges was considered converged when the maximum absolute change for any atom for three successive iterations was less than 2 10e . onetep calculations were performed in vacuum using a cubic simulation cell of 30 , with the spherical cutoff coulomb approach to avoid electrostatic interactions between molecules and their periodic images . ngwfs were initialized as orbitals obtained from solving the kohn sham equation for free atoms , with a 1s configuration for h , a 2s2p configuration for c , n , o , and f , and a 3s3p configuration for s and cl . the ngwfs were expanded in a psinc basis with an energy cutoff of 1000 ev , corresponding to a grid spacing of 0.45 bohr , and were localized in real space with radii of 10 bohr . convergence of the atomic charges generated by our implementation of the ddec method in onetep ( referred to as ddec / onetep ) with respect to the onetep psinc grid spacing and ngwf cutoff radii , as well as the ddec parameters rmax and nrad was investigated for nitroethane and discussed in supporting information figure s1 . figure 2 shows the correlation between the ddec / onetep and ddec / chargemol charges for every atom in the benchmark set . despite the different approaches used in obtaining the ground - state electronic densities and the subsequent charge analysis , the difference between the two charge sets is very small with a mean absolute deviation ( mad ) of less than 0.02 e. correlation between ddec / chargemol and ddec / onetep charges for all atoms in the 25 molecule benchmark set . also shown is the mean absolute deviation ( mad ) between the two sets . atomic charges for use in force fields should approximately reproduce the ab initio electrostatic potential outside the molecule s electron density . we can measure the error v in the coulombic potential of the ddec charges , compared with dft , as11where the sum is performed for all points i lying within 1.4 and 2.0 times the van der waals radii of the nuclei , on the same grid mesh used to calculate the electron density . in order to remove the arbitrary vacuum level of the dft potential v(r ) , the potentials are displaced by the averaged difference over the included grid points . our calculations of v are performed for a test charge of 1 e in vacuum . typical errors in , for example , interaction energies of neutral ligands with proteins in solution will tend to be lower than this error estimate . nevertheless , it is a good indicator of the ability of a method to reproduce the ab initio esp . figure 3 ( bottom ) shows that ddec charges reliably reproduce the electrostatic potential around the molecule , with v errors of approximately 1 kcal / mol for both ddec / chargemol and ddec / onetep . for neutral molecules , the dipole is the leading order term in the multipole expansion and , thus , is the most significant in determining intermolecular electrostatic interactions . in figure 3 ( top ) , we compare the ddec vector dipole moments with those computed directly from their respective ab initio electronic densities . again , onetep performs as well as chargemol . for comparison , we have also plotted the error in the dipole moment and v ( eq 11 ) for esp charges . in agreement with previous charge comparisons , the esp charges reproduce the ab initio electrostatic potential and dipole moment more closely . despite this better performance of esp charges for small molecule electrostatics , ddec charges will be suitable for polarized protein - specific charges if , as we shall investigate in the next section , they are able to reproduce the electrostatic properties of much larger molecules containing buried atoms better than standard mm force fields . we conclude that , at least for organic systems comprising light atoms , our use of ddec charge analysis within the pseudopotential approximation and without enforcing radial decay of the partitioned atomic densities is valid . it should be emphasized that the ddec analysis can only be as accurate as the electron density output by the underlying qm calculation . in the current paper , we have used the pbe exchange - correlation functional in our onetep calculations , although future advances will allow alternative treatments of electron electron interactions , such as b3lyp and dynamical mean field theory . for comparison , supporting information figure s2 compares gaussian09 ddec charges calculated using pbe and b3lyp exchange - correlation functionals . the mad is less than 0.02 e , implying that the pbe functional gives a reliable electron density for the calculation of ddec charges . in order to aid in the interpretation of qm simulations , atomic point charges should respond in a chemically intuitive manner to their environment . as an example , figure 4 , b and c , shows onetep / ddec charges for the phenol molecule in two different environments : first in water and , second , in a small model cluster representing the negatively charged binding pocket of the l99a / m102e mutant of t4 lysozyme ( supporting information ) . the two environments are typical of those simulated in , for example , the optimization of small molecule inhibitors for drug design . for comparison , figure 4a shows the resp charges for phenol , calculated in vacuum at the hf/6 - 31 g * level to approximate aqueous polarization , the same level of theory that has been used to parametrize the amber force field that we employ as a benchmark in later sections . the ddec charges in water agree with the resp charges with a root - mean - square ( rms ) deviation of 0.04 e. similar results are obtained by comparing with resp charges derived using a polarizable continuum model ( pcm ) to model solvation ( supporting information figure s3 ) . there are no large changes in the ddec charges of the phenol molecule on moving to the protein binding pocket . charges on the aromatic ring change by up to 0.05 e in the more hydrophobic environment , while the oh group , which is hydrogen - bonded to residue e102 , becomes more strongly polarized . ( a ) resp charges for phenol calculated in vacuo at the hf/6 - 31 g * level . ( b ) ddec / onetep charges calculated in a 20 molecule water cluster using with identical simulation parameters as section 2.4 . ( c ) same as in part b , but within a 86 atom cluster representing the t4 lysozyme l99a / m102e binding pocket . standard error of the mean is less than 0.01 e for the oh group , and the maximum on any atom is 0.018 e. we have utilized the linear - scaling nature of our ddec implementation to calculate ddec charges of three proteins : ubiquitin , the smn tudor domain , and hen egg lysozyme ( pdb : 1ubq , 1mhn , 6lyt ) . initial structures were prepared by protonation using the amber11 tleap module or by the molprobity software . dft calculations were performed using the minimal parameter continuum solvation model of onetep with a relative dielectric permittivity of 80 to represent water solvent . a postprocessing calculation was performed on the converged electronic density to extract ddec charges ( supporting information ) . it should be emphasized that the entire charge set is derived from a single dft calculation , on systems up to 1960 atoms , and thus naturally incorporates native state polarization . as we found for the small test systems , ddec charges for the proteins are similar to the mean field amber ff99sb charges , with a correlation coefficient of 0.96 ( figure 5a ) . however , the rms deviation between the charge sets is 0.11 e , as expected since the aims were optimized based on the ab initio electronic density for atoms embedded in their local environment . comparisons with the amber ff03 force field charges yield similar conclusions ( supporting information figure s4 ) . for chemically identical atoms that share the same charges in amber , the ddec charges span a wider range , which is indicated by the vertical spread of points . for example , ddec charges for backbone o atoms of leucine vary between 0.72 and 0.56 e , with an average of 0.63 e , compared to the constant amber value of 0.57 e. the prominent outliers in figure 5a ( with absolute charge disagreement larger than 0.25 e ) are mostly nonbackbone sp carbon atoms , most of which are close to neutral in amber , but adopt a range of values in ddec , depending on the residue type and their particular local environments . for example , the c atom in glutamine has a charge of 0.06 e in amber , but ranges from 0.41 to 0.37 e in ddec . similar deviations in c charges from amber values have been observed in conformationally averaged esp charges derived from dipeptide fragments . the largest discrepancy between the two charge sets is in the terminal nitrogen atom , which is positively charged in amber ( 0.16 e ) but negatively charged in ddec ( 0.52 e ) . several esp studies have indicated that our ddec value is more appropriate for the charge of the n - terminus . ( a ) correlation between ddec partial atomic charges and the amber ff99sb force field for ubiquitin . ( b ) electrostatic contribution to the backbone hydrogen bond energies in the x - ray crystal structure of ubiquitin . backbone hydrogen bonds calculated by ddec / onetep are more polarized than in the amber force field . following ji et al . , we define the electrostatic contribution to the hydrogen bond between backbone nh and co groups as the coulombic interaction between atoms carrying point charges q:12figure 5b reveals that the resulting dipole it is possible that the enhancement of the interaction is a systematic bias in the potential of the ddec charges , though it does support previous hypotheses that proteins are stabilized in their native environment via electronic polarization . we investigate this effect further in section 4 by comparing the dynamics of backbone hydrogen bonds with experimental nmr observables . the correct treatment of electrostatics is vital in the accurate determination of molecular interactions in biological systems . in particular , if ddec charges are to be useful as polarized protein - specific charges , they should reproduce ab initio electrostatics for large molecules better than standard force fields that are based on esp charges . we have calculated the electrostatic potential and the dipole moments of the three proteins studied in the previous section with full dft , the derived ddec charges , and with a standard amber force field ( supporting information figure s4 gives the same information for the amber ff03 force field ) . for all charge distributions , the electrostatic potential was computed in vacuum , in order to better observe the discrepancy between ab initio and point charge values that would otherwise be dampened by dielectric screening . we note , however , that the ab initio , ddec and amber charge distributions have already incorporated solvation effects in their calculation , and the electrostatic comparisons are , therefore , equivalent . table 1 shows that ddec / onetep aims reproduce the total ab initio potential and dipole moments dft for all three proteins , vastly outperforming the standard mm charges . figure 6 shows the difference in electrostatic potential between the two charge sets and the dft calculation . although the standard mm charges are fit to closely reproduce the esp of small molecules , they neglect large - scale electronic polarization that is present in protein - specific charges , and hence , the error in the computed esp is large . the computed errors in the mm electrostatic potential are consistent with literature studies of errors in interaction energies between charged biotin ligands and the avidin protein in vacuum ( 11 kcal / mol on average ) . for more realistic simulations , the same study found that the error was reduced to approximately 2 kcal / mol for neutral ligands and to 0.7 kcal / mol if solvent screening is also included . the esp difference is calculated at the solvent - accessible surface of the protein . also shown as gray , blue , and red arrows are the calculated dft , ddec , and amber dipole moments , respectively . also shown are errors in the protein dipole moment vectors , which have been calculated relative to the center of mass of each protein to remove ambiguity for charged systems . the ddec charges reproduce electrostatic properties of large molecules much better than do the mean field classical point charges . we noted earlier that isa charges are particularly good at reproducing the esp , since the electron density is divided into spherically symmetric partitions . this point is reinforced by figure 7 , which reveals that the deviation from the ab initio dipole moment of ubiquitin decreases with decreasing ( increasing isa fraction ) . however , one of the motivations for including ih reference densities in the ddec information entropy functional ( eq 8) was to alleviate problematic convergence for aim charges of embedded atoms due to the shallow optimization landscapes experienced in such regions . we find that the ddec method with = /14 , as recommended for all systems by manz and sholl , is a good compromise between reproducing accurately the esp of the system , reducing the number of self - consistency iterations required for convergence ( figure 7 ) and , as we shall see in the next section , improving the transferability of the charges . further comparisons between ddec , ih , and isa charges are presented in supporting information figure s5 . dependence of the ddec dipole moment error on the mixing parameter . increasing the isa content reduces the dipole error but also increases the number of iterations required for charge convergence and , hence , the computational time . in order to be of use in parametrizing flexible force fields , atomic charges , even those of buried atoms , must not be overly sensitive to small conformational changes . to study conformational dependencies of the ddec charges for large systems , we have performed ddec analysis of nine experimental nmr conformers of bovine pancreatic trypsin inhibitor ( bpti , pdb : 1pit ) in implicit solvent ( 892 atoms ) . each residue in figure 8 is colored by the average of the standard deviation in the calculated atomic charges over the nine conformations . the first point to note is that the ddec charges are much more stable to conformational change than the isa charges . while some fluctuation due to the changing environment is expected , the protein conformers are all close to the native state and the ddec charges reflect this . this is in stark contrast to resp charges , for which a recent review of atomic charge models found strong fluctuations in partial charges for an ensemble of polypeptide chain conformations . second , there is no discernible difference between charge fluctuations in buried and exposed residues , as would be observed for shallow optimization landscapes . finally , the width of the protein chains in figure 8 reflects the average positional fluctuation of each residue . it is noticeable that ddec charges vary more strongly in residues with a high degree of flexibility , especially when they form intramolecular contacts ( between -sheets , within -helices , and in sections linked by disulfide bridges ) , as one might expect . ddec / onetep charge and conformation fluctuations for nine nmr models of bpti . average positional fluctuation per residue is represented by its putty width and average charge fluctuation ( standard deviation ) per residue by its color . isa charge fluctuations have been clipped at 0.04 e for visual clarity ( ten residues in the isa method have values greater than 0.04 e , with a maximum of 0.06 e ) . isa charges are ddec / onetep charges derived with = 0 ( eq 7 ) . we showed in the previous section that ddec charges are able to accurately reproduce the esp around the structure that they are fit to . here , we investigate whether average charges derived for an ensemble of native state conformations are able to accurately describe the electrostatic properties of each conformation close to that native state . such a test is vital if the charges are to be used in the construction of force fields for simulating the dynamics of proteins . figure 9 shows the discrepancy between dipole moments calculated via atomic point charges and dft . to obtain the best agreement with the dft dipole moment of a particular structure , it is preferable to fit the ddec atomic point charges to that particular structure . however , encouragingly , there is very little degradation in performance if ddec charges that have been averaged over the full ensemble are used instead . this reflects the transferability of ddec charges between conformations close to the native state . the force field charges perform relatively well for this structure but not as well as the polarized protein - specific charges . this behavior is in agreement with previous work showing that esp charges give the best fit to ab initio electrostatics for a given structure , but that ddec charges are generally more transferable to different , similar structures . deviation between charge model and ab initio dipole moment vectors for nine nmr conformers of bpti . ddec / onetep charges have been calculated separately for each structure ( dark blue ) and averaged over all structures ( light blue ) . as we have demonstrated in the previous section , ddec charges derived from the dft electron density of entire proteins have properties that make them desirable for use in flexible force fields . we now put this into practice by performing molecular dynamics ( md ) simulations of the three proteins described previously ( pdb : 1ubq , 1mhn , 6lyt ) using force fields based on our calculated ddec charges . we have followed the procedure of tong et al . by taking the bonded and lennard - jones parameters directly from the amber ff99sb force field but replacing the atom - centered point charges by the ddec / onetep charges . it should be emphasized that torsional and lennard - jones parameters are as important as the charges in determining protein dynamics and a large number of alternative force fields exist , many of which outperform the ff99sb force field in comparison with experiment . nevertheless , here we concentrate on demonstrating the feasibility of using aim approaches to supplement an existing , commonly used force field . figure 10 shows the backbone rms deviations of the three proteins from their x - ray crystal structures over the course of 10 ns simulations , performed at 300 k in explicit water ( supporting information ) . for both force fields , backbone c root - mean - square deviation ( rmsd ) with respect to the initial experimental pdb structure for 1ubq , 1mhn , and 6lyt , with running averages taken over 50 ps windows . the first and last four residues have been excluded due to their high flexibility . to assess the quality of simulated mm dynamics , it is common to use , as metrics , experimental nmr - derived quantities . the square of the generalized order parameter s , based on the lipari szabo model - free approach to analyzing nuclear spin - relaxation measurements , is the plateau value of the time - correlation function c2(t ) of the second - order legrendre polynomial of backbone n h bond unit vectors e(t):13where c2(t ) is time - averaged over a trajectory .s represents the spatial restriction of the motion of n h bond vectors , and a lower s value corresponds to a more flexible residue . s values were calculated from our 10 ns md simulations using the ired method as implemented in the amber11 ptraj module . in this method , h unit bond vector pairs ei , j in a fixed reference frame and averaged over the entire trajectory:14s of residue i is then obtained from solving the eigenvalue equation mm = mm as15where the sum is taken over n 5 eigenvectors excluding five with the largest eigenvalues , and mi is the ith component of eigenvector m. figure 11 compares simulated and experimentals profiles for the standard amber ff99sb force field and the same force field supplemented by ddec / onetep atomic charges . the only difference between the simulation protocols is in the point charges and so any improvement in the calculated order parameters is due to the inclusion of native state polarization in their calculation . table 2 compares the agreement between simulated and experimental s data ( for all residues where experimental data is available ) . it indicates that ddec aim charges perform better than mean field force field charges in providing a suitable electrostatic environment that maintains protein stability throughout the 10 ns trajectory while remaining dynamically consistent with experimental observations . h order parameter s for 1ubq , 1mhn , and 6lyt using amber ff99sb and ddec atomic charges . the agreement of the generalized order parameter with experiment is improved by using the ddec / onetep protein - specific charges . in addition to backbone rigidity , we also compared the nmr scalar coupling jnc of the n backbone hydrogen bonds , which provides a measure of hydrogen bond dynamics within a protein . it was shown by barfield that jnc values , being dependent on the wave function overlap across the hydrogen bond , are strongly geometry dependent and can be parametrized as such by several formulas , with the simplest based on only the ho distance roh and ho = c angle :16equation 16 was used to compute the time - averaged jnc of backbone backbone hydrogen bonds using the amber ff99sb and ddec / onetep mm snapshots over the 10 ns trajectories . the rms deviations between simulation and experiment ( figure 12 , in brackets ) once again indicate that ddec / onetep charges perform at least as well as amber charges , illustrating that backbone n h and c = o bond polarization is also suitably described by the electron density partitioning approach to charge derivation . the ddec atoms - in - molecule scheme for the assignment of atomic charges through partitioning of the ab initio electron density has a number of features that makes it desirable for charge derivation for flexible force fields . however , its use in the analysis of realistic biomolecular systems has , until now , been limited by the computational expense of the underlying qm calculation . in this paper , we have implemented the ddec scheme in the linear - scaling dft code onetep . strict localization of the ngwf basis in onetep onto atomic regions allows derivation of the electronic density of systems comprising thousands of atoms with affordable computational expense . optimizing the ngwfs in situ allows for a minimal number of atom - centered orbitals to be used while maintaining near - complete basis set accuracy . systematic improvement in accuracy is achievable via tuning of a very small number of parameters and , along with a minimal parameter solvation model , allows the user to derive charges for any molecular system with no prior knowledge of its chemical characteristics . the ddec method is also suitable for implementation in other dft codes , as well as for example fragment molecular orbital approaches to generating the electron density of large systems , for which we hope our implementation will provide an accuracy benchmark . we have validated our implementation of the ddec method in onetep against the standard chargemol package with quantum chemistry calculations in gaussian09 . in agreement with previous observations , ddec charges perform less well than esp charges in reproducing the ab initio potential of small molecules . nevertheless , our interest here is in the calculation of polarized charges for entire proteins . indeed , we have found that the errors in the electrostatic potential at the surfaces of three proteins are very similar to those for small molecules ( errors of 1.31.5 kcal / mol ) . furthermore , the system - specific ddec charges outperform standard amber charges for these molecules ( errors of 57 kcal / mol ) . we would expect similar performances for other force fields that have been fit to small molecules without incorporating large - scale polarization . although the esp method is unsuited to the direct calculation of atomic charges from a single qm calculation due to the sensitivity of the charges to buried atoms and small conformational changes , a number of studies have determined protein - specific charges based on this method . by separating the system into a large number of dipeptide fragments , fitting esp charges to the resulting structures and averaging them over several conformations of the protein , stable and transferable charges have been obtained . by also including the effects of the environment , represented by point charges , in an iterative esp fit , it should be possible to further derive polarized protein - specific charges that are stable with respect to small changes in conformation . although the esp charges are preferable to ddec for reproducing the ab initio potential of small molecules , it is not obvious that these conformation - averaged esp charges are the optimum choice for large molecules . in fact , manz and sholl have shown that ddec and conformation - averaged esp charges give essentially the same agreement with the ab initio electrostatic potential of small molecules . it would be interesting , in future work , to make this comparison for larger molecules . further advantages of the ddec charges are that , since they are derived from a single dft calculation of entire biomolecules , environmental polarization is naturally included . moreover , no prior , system - specific chemical knowledge or specialized treatment is required to ensure proper charge derivation , rendering the method extremely versatile . in agreement with previous observations of smaller systems , the charges are insensitive to small conformational changes and buried atoms require no special treatment . in this paper , we are interested in the application of ddec charges to standard mm force fields . therefore , we have restricted the ddec expansion to monopole order in our electrostatic potential comparisons . as discussed by manz and sholl , the electrostatic potential description of ddec charges can be trivially improved by including higher order multipole terms in the partitioned aim densities , without requiring a new fitting procedure . we have incorporated the ddec charges of three proteins into a classical force field and run molecular mechanics simulations to compute nmr order parameters and scalar couplings . our observations indicate that the ddec aim charges perform at least as well , if not better than amber ff99sb in replicating protein dynamics . backbone hydrogen bonds are more polarized in ddec / onetep than in the standard amber force field . nevertheless , they are able to replicate dynamics consistent with experiments when used in mm force fields . our results are therefore consistent with previous hypotheses that electronic polarization is important in stabilization of a protein s native state . it should be noted that these ddec aims were obtained without explicit fitting to replicate electrostatic effects nor parametrization to experimental properties . the potential applications of linear - scaling ddec analysis span a wide range of problems in which accurate determination of electrostatics via atomic point charges is important . ddec charges have already been used to study molecular adsorption inside metal organic frameworks . in the biomolecular sciences , the optimization of protein - inhibitor interactions for drug design , pka calculation , study of ion channel conductivity and elucidation of enzymatic reaction mechanisms all depend critically on an accurate description of the electrostatic potential , for which ddec perform markedly better than standard classical force field charges .

atomic partial charges for use in traditional force fields for biomolecular simulation are often fit to the electrostatic potentials of small molecules and , hence , neglect large - scale electronic polarization . on the other hand , recent advances in atoms - in - molecule charge derivation schemes show promise for use in flexible force fields but are limited in size by the underlying quantum mechanical calculation of the electron density . here , we implement the density derived electrostatic and chemical charges method in the linear - scaling density functional theory code onetep . our implementation allows the straightforward derivation of partial atomic charges for systems comprising thousands of atoms , including entire proteins . we demonstrate that the derived charges are chemically intuitive , reproduce ab initio electrostatic potentials of proteins and are transferable between closely related systems . simulated nmr data derived from molecular dynamics of three proteins using force fields based on the onetep charges are in good agreement with experiment .

Introduction Computational Methodology Properties of DDEC Charges Protein Dynamics Conclusions

operating room ( ors ) fires related to anaesthesia ventilator mishaps are extremely rare events , but when they do occur , result in serious and sometimes mortal consequences . cardiac arrest associated with ventilator fire has not been reported in the published english literature . we report a near - fatal incident of cardiac arrest following ventilator mishap and successful revival of a patient who underwent subtotal thyroidectomy . a 65-year - old 60 kg asa grade i female patient underwent subtotal thyroidectomy for diffuse multinodular colloid goiter . pre - anaesthetic check up revealed normal cardiorespiratory systems . all investigations including electrocardiogram ( ecg ) , echocardiography and chest x - ray were within normal limits . routine general anaesthesia was administered and maintained using o2/n2o / isoflurane / fentanyl / vecuronium and ippv with an electrically driven volume - controlled anaesthesia ventilator . during the operation , intravenous fluids were administered based on haemodynamic parameters . at the end of near - completion of surgery , a moderately loud explosive sound this was followed within seconds by the appearance of smoke and an orange flame from the control panel of the ventilator . within minutes , both the smoke and the flame increased significantly and engulfed the ventilator , leading to complete melting of its parts [ figure 1 ] . the patient was disconnected immediately from the ventilator and ventilated with an ambu resuscitation bag . meanwhile , oxygen , nitrous oxide and electric supply of the anaesthesia apparatus and ventilator were disconnected and the fire was extinguished by spraying water . the anaesthetic and surgical teams shifted the patient out of the fire area to another adjacent operation theatre along with the ambu bag . in the or , the patient was reconnected to the monitor and another anaesthesia work station and ventilation was started with 100% oxygen . the approximate time between disconnection of endotracheal tube ( ett ) and ventilation with 100% oxygen was 23 min . meanwhile , we noticed absence of pulse and oxygen saturation with ecg showing tracings of asystole . cardiopulmonary resuscitation ( cpr ) was started and the lungs were ventilated with high flows ( 12 l / min ) of 100% oxygen . following 34 min of cpr and i.v . atropine 3 mg and adrenaline 2 mg ( 1 mg + 1 mg ) , the patient showed return of spontaneous circulation ( rosc ) . thereafter , the patient maintained a heart rate of 110120 bpm , bp 100/70 mmhg and oxygen saturation of 9394% . a 12-lead ecg , serum troponin a , serum electrolytes and abg were obtained to rule out other causes of cardiac arrest , and were within normal limits . once the patient 's circulation was restored and maintained for 1520 min , the remaining part of the surgery was allowed to complete . after the completion of the procedure , the neuromuscular blockade was antagonized with neostigmine 3.0 mg and glycopyrrolate 0.4 mg . she was observed and monitored in the post - anaesthesia care unit ( pacu ) for 24 h and then discharged on the fifth post - operative day . she was followed - up after 2 weeks and later monthly with no reported adverse sequelae of the event . the incident was notified to the manufacturer of the ventilator and is under an investigation stage to determine the cause of the incident . among all or fires , equipment - related fires are extremely rare incidents , probably because of strict electrical safety standards , good design of equipment and routine inspection and preventive maintenance . however , when these occur , the consequences are often disastrous for both the patient and the or personnel , particularly in poorly equipped hospital set - ups . historically , or fires or explosions caused by anaesthesia equipment were attributable to flammable anaesthetic agents.[25 ] berry et al . have reported combustive destruction of the anaesthetic circuit expiratory valve and explosions within the anaesthesia machine were reported by castro et al . normally , they create some smell or vapors , and these are controlled by stopping the flow of electricity to the device . sometimes , the fire can flare up without these warnings , as noted in our case . to cause fire , an oxidizing agent , a source of heat and a flammable material or fuel must be present . in the present case , sparks due to friction or electrical short circuit might have acted as the source of the ignition , which led to fire and explosion in the oxygen - rich environment . fire mishaps in ventilators are prevented by routine pre - use checkups and device service as per minimum standards mentioned in the user manual . cardiac arrest following ventilator fire is also a rare incident . because this mishap occurred intraoperatively , the first priority was to immediately shift the patient out of the danger area to protect from further thermal damage . although we disconnected the patient from the ventilator immediately , some smoke - rich gases were delivered by the ventilator . as other causes of cardiac arrest were ruled out , we suspected carbon monoxide toxicity as one of the causes for severe hypoxaemia and cardiac arrest . although cooximeter analysis helps in the estimation of carboxyhaemoglobin ( cohb ) , it is not routinely available in sub district - level hospital set ups . the half - life of cohb is between 4 and 6 h with room air , which further drops to 4090 min and 1530 min if the patient is receiving normobaric 100% oxygen and hyperbaric oxygen , respectively . although hyperbaric oxygen is the treatment of suspected co poisoning , high - flow normobaric 100% oxygen can still be life saving . timely and effective resuscitation helped us to revive the patient successfully . in conclusion , ventilator fires , although infrequent , can be disastrous . although the patient did not suffer thermal injury , the or team should be prepared to handle any eventuality arising out of such disaster . prevention of fires requires attention from everyone in the or to hospital authorities who make purchasing decisions . the knowledge and vigilance of the or teams in preventing fire and a quick response during such incidents appears a necessity . having a stringent quality control and ensuring electrical safety of medical equipment

operating room fires are rare events , but when occur they result in serious and sometimes fatal consequences . anaesthesia ventilator fire leading to cardiac arrest is a rare incident and has not been reported . we report a near catastrophic ventilator fire leading to cardiac arrest in a patient undergoing subtotal thyroidectomy . in the present case sparks due to friction or electrical short circuit within the ventilator might have acted as source of ignition leading to fire and explosion in the oxygen rich environment . the patient was successfully resuscitated and revived with uneventful recovery and no adverse sequelae . the cardiac arrest was possibly due to severe hypoxia resulting from inhalation of smoke containing high concentrations of carbon monoxide and other noxious gases .

INTRODUCTION CASE REPORT DISCUSSION

moreover , there are no blood markers for the early detection of lung cancer ( unlike for cancers such as prostate , colorectal , and gynecological cancers ) ( 1 ) . in the past , non - specific cytotoxic agents were the first choice of treatment for patients with stage iv non - small - cell lung cancer ( nsclc ; either adenocarcinoma or squamous cell carcinoma ) ( 2 , 3 ) . however , in the last decade , novel molecular pathways have been found to be involved in adenocarcinoma and squamous cell carcinoma of the lung , and , as a result , targeted treatments are now being used . the most important of these are the treatments that target the epidermal growth factor receptor ( egfr ) , anaplastic lymphoma kinase ( alk ) , serine / threonine - protein kinase b - raf ( braf ) , proto - oncogene tyrosine - protein kinase ros ( which is encoded by the ros1 gene ) , c - met proto - oncogene protein ( which is encoded by the met gene ) , and ret proto - oncogene protein ( which is encoded by the ret gene found on chromosome 10 ) ( 4 , 5 ) . an issue that has yet to be clarified is whether these targeted treatments are effective against eye metastasis . this issue is discussed in the following section , which is based on data that were obtained via a search of the us national center for biotechnology information s pubmed service on february 19 , 2017 . overview of the use of targeted treatments in relation to eye metastasis currently , oral tyrosine kinase inhibitors ( tkis ) are being used to treat egfr- and alk - positive patients . in particular , for egfr - positive patients , erlotinib , gefitinib , and afatinib ( the first two of which are first - generation tkis that target egfr , and the third of which is a second - generation tki that targets egfr ) are the treatments of choice . if an egfr - positive patient being treated with tki experiences a relapse ( as assessed using the response evaluation criteria in solid tumors ( recist ) ( 6 ) ) , a rebiopsy should be performed ( 7 ) . however , if the patient s condition does not allow for a rebiopsy , a liquid biopsy should be performed ( 8) . in particular , if the egfr t790 m mutation is detected , osimertinib ( a tki that targets egfr ) should be administered ( 9 ) . research indicates that gefitinib could be an effective agent against choroidal metastasis , and it should be used if such a metastasis exists ( 10 ) . in the case of brain metastasis , research indicates that afatinib may be effective as a first - line treatment ( 11 ) . furthermore , a recent study showed that osimertinib was rapidly effective against brain metastasis , and it negated the need for radiotherapy ( 12 ) . regarding patients with alk mutations , crizotinib ( a tki that targets alk ) is used as the first - line treatment ( 13 ) . in particular , crizotinib has been shown to be effective against uveal and choroidal metastasis ( 14 , 15 ) . the human epidermal growth factor receptor 2 ( her2 ) has been found to be overexpressed in patients with lung cancer ( 16 ) and , in these cases , trastuzumab ( a monoclonal antibody that targets her2 ) may be administered ( 17 ) . research has indicated that this drug is able to control ocular metastasis ( 18 ) . however , it is important to take into consideration that fact that trastuzumab can also induce adverse ocular effects ( 19 ) . in addition to alk mutations , braf mutations have been observed in patients with lung cancer ( 20 ) . in these cases , the patients could be treated with ipilimumab ( a monoclonal antibody that targets cytotoxic t - lymphocyte - associated protein 4 ( ctla-4 ) ) . in particular , ipilimumab has been successfully used for uveal metastasis ( 20 - 24 ) . however , orbital myositis and retinopathy have been observed in patients treated with ipilimumab ( 22 , 23 ) , and other immunotherapies such as nivolumab and pembrolizumab ( both of which are monoclonal antibodies that target programmed cell death protein 1 ( pd-1 ) ) are currently being tested ( 20 , 21 ) . in some patients with lung cancer , the ros1 pathway has been found to be upregulated ( 25 ) . in these cases , furthermore , research has indicated that eye metastasis that involves ros1 upregulation can be efficiently controlled with crizotinib ( 14 ) . alternatively , cabozantinib ( a tki that targets c - met and vascular endothelial growth factor receptor 2 ( vegfr-2 ) ) can be used in cases involving crizotinib resistance ( 27 ) . the ret pathway has also been found to be upregulated in some patients with lung cancer ( 25 ) . in these cases , crizotinib ( a tki that targets alk and ros1 ) or alectinib ( a tki that targets alk ) should be administered ( 28 , 29 , 30 ) cabozantinib may also be effective ( 31 ) . lastly , the c - met pathway has been also shown to be upregulated in some patients with lung cancer ( 32 ) . furthermore , a previous study has suggested that , in patients with melanoma , c - met overexpression is associated with uveal metastasis , but more data are required to clarify this association ( 34 ) . a previous study indicated that crizotinib is effective against uveal metastasis that involves the upregulation of the c - met pathway in a melanoma model ( 15 ) . however , for nsclc , cabozantinib should be used in cases involving upregulation of the c - met pathway ( 33 ) . overall , the data on the use of tkis or immunotherapy to control eye metastasis are limited . we recommend that if a patient experiences a cancer relapse , biopsies should be taken from the sites of relapse . we are currently waiting for trials with larger numbers of patients with braf , met , ret , and ros mutations . in these trials , data with the control of eye metastasis should be collected so that clear conclusions can be drawn regarding the optimum treatment approaches . all the aforementioned authors met the international committee of medical journal editors ( icmje ) criteria for authorship for this manuscript , take responsibility for the integrity of the work as a whole , and have provided approval for the revised manuscript to be published . all the aforementioned authors met the international committee of medical journal editors ( icmje ) criteria for authorship for this manuscript , take responsibility for the integrity of the work as a whole , and have provided approval for the revised manuscript to be published .

lung cancer remains the leading cause of death due to cancer . we do not have effective tools for the early detection of lung cancer , so patients are usually diagnosed at an advanced stage . however , novel therapies based on molecular pathways ( such as those involving the epidermal growth factor receptor , anaplastic lymphoma kinase , serine / threonine - protein kinase b - raf , proto - oncogene tyrosine - protein kinase ros , c - met proto - oncogene protein , and ret proto - oncogene protein ) are now commonly used in the treatment of lung cancer . in particular , these therapies are considered as first - line treatments for non - small - cell lung cancer . this manuscript outlines previous research on these targeted treatments , focusing on whether they are effective against eye metastasis .

INTRODUCTION DISCUSSION DISCLOSURE Conflict of interest

a 32-year - old , 173 cm , 79 kg male patient was admitted to the emergency room ( er ) for the treatment of facial pain due to an automobile accident . on arrival , he was fully conscious with an glasgow coma scale score of 15/15 and stable vital signs : blood pressure ( bp ) 115/76 mmhg , heart rate ( hr ) 58 beats / min , and body temperature 37. frontal skull fracture was suspected , and an x - ray skull and computed tomography ( ct ) were taken which demonstrated a fracture of the zygomatic bone on the right side . under general anesthesia , an open reduction of the right sided zygomatic bone fracture was planned . patient 's medical history , neurological and physical examinations were normal . preoperative blood test findings were normal : na 143 meq / l , k 3.9 meq / l , cl 106 meq / l , ca 9.3 mg / dl . the electrocardiogram ( ecg ) and chest x - ray results were also normal ( fig . 1 ) . no premedication was provided , and the patient 's vital signs were measured immediately after entering the operating room ( or ) ; bp was 120/80 mmhg , hr was 50 beats / min , and pulse oximetry ( spo2 ) was 99% . due to the facial injury , facemask ventilation was thought to be difficult to perform and hence , manual assisted ventilation , using rapid - sequence induction , with o2 of 5 l / min was performed and , 450 mg of thiopental and 80 mg of succinylcholine were injected intravenously one after another . immediately after tracheal intubation , bp increased from 120/80 to 160/90 mmhg and hr rose from 50 to 120 beats / min , and premature ventricular complexes ( pvc ) were detected on ecg . therapy for ventricular arrthymias was intitated with a 70 mg of lidocaine intravenous injection , but the ventricular arrhythmias changed into patterns of ventricular bigeminy , ventricular tachycardia ( vt ) , and torsades de pointes subsequently ; bp measured at that time was 60/30 mmhg . immediately , the administration of sevoflurane was discontinued and manual assisted ventilation was performed with 100% o2 , while an external cardiac defibrillator was being prepared for attempting defibrillation . as an intravenous injection of esmolol was being prepared , ventricular fibrillation ( vf ) without measurable bp was detected . as early defibrillation was attempted using 360 j , chest compression was resumed and 1 mg of epinephrine was administered intravenously . thereafter , vf on ecg disappeared , and the heart rhythm returned to its normal sinus rhythm ( nsr ) . considering it difficult to proceed with the operation , the patient was transferred to the intensive care unit ( icu ) as soon as the patient 's vital signs stabilized and normal spontaneous respiration was confirmed . after the patient was transferred to the icu , arterial blood gas analysis ( abga ) and electrolyte studies were conducted and the results showed a ph of 7.334 , paco2 of 44.8 mmhg , pao2 of 70.1 mmhg , base excess -2.7 mmol / l , hco3 23.3 mmol / l , sao2 of 93% , na 142 mmol / l , k 4.2 mmol / l , cl 103 mmol / l , ca 1.16 mmol / l , and mg 1.7 mg / dl ; which were within their normal limits . however , chest x - ray revealed cardiomegaly and mild pulmonary edema , while ecg detected a t - wave inversion in leads ii , iii , avf , and v2 - 6 , and qtc prolongation to 547 ms ( fig . akinesia of the anteroseptum & inferoposterolateral wall of the left ventricle was detected , and in coronary angiography , the left ventricular ejection fraction was 38% demonstrating hyposystole , and an increase in the left ventricular cavity size to 60 mm were detected , while there were no other abnormalities seen . epinephrine provocation test was positive and hence the patient was diagnosed with lqts . on the fifth day of admission , implantable cardioverter - defibrillator ( icd ) was implanted . afterwards , the patient 's vital signs improved and were within their normal ranges and the qtc intervals on ecg also showed normalization . hence on the twelfth day of admission , open reduction of the fractured zygomatic bone on the right side was performed under general anesthesia . in the preoperative evaluation , blood tests showed findings within their normal ranges . on ecg , t - wave inversion persisted in leads ii , iii , and avf . normal t - waves were seen in v2 - 6 and the qtc of 406 ms was also within its normal limits ( fig . 1 ) . as a premedication , 2.5 mg of midazolam was injected intravenously at the entrance of the or . on arrival in the or , vital signs were measured : bp 110/75 mmhg ; hr 85 beats / min ; spo2 95% . before induction of anesthesia , preoxygenation was performed with 6 l / min of o2 , and propofol administration was initiated with an effect - site concentration of 4.0 g / ml using a target - controlled infusion device ( orchestra , fresenius vial s.a , france ) . afterwards , 0.15 g / kg / min of remifentanil , a useful opioid , was continuously injected intravenously , loss of consciousness was confirmed . following complete muscle relaxation by an intravenous injection of 70 mg of rocuronium bp recorded immediately after intubation was 100/60 mmhg , and hr was 75 beats / min . after the patient 's vital signs stabilized , propofol was infused with an effect - site concentration of 2.5 - 3.0 g / ml , and continuous remifentanil infusion was given at a rate of 0.05 g / kg / min to 0.10 g / kg / min . during anesthesia , no particular changes were noted in bp and on ecg . after completion of the operation , muscle relaxation was reversed immediately with an infusion of glycopyrrolate 0.2 mg and pyridostigmine 10 mg . after confirming normal spontaneous respiration and consciousness , the patient was extubated and when his vital signs were found to be stable , he was transferred to the recovery room ( rr ) . the total time exposed to anesthesia was 3 hours and 45 minutes . in the rr , the patient was in a stable condition and after he fully recovered from the anesthesia , he was transferred to the general ward . on the nineth postoperative day lqts is an inherited or acquired disorder , but is usually inherited , which may cause sudden death due to episodes of syncope , seizure , and ventricular tachycardia . it is a rare disorder , with an estimated prevalence of around 1 per 2,500 - 10,000 . in korea , a study was performed by koo et al . on anesthetic management of a patient with congenital lqts . it has been known that lqts is caused by mutations in 1 of the 12 genes and , these mutations may create abnormalities in cardiac ion channels , prolong ventricular repolarization , and prolong the qt interval , causing serious arrhythmias such as ventricular tachycardia or torsades de pointes . in general , a corrected qt ( qtc ) interval is considered prolonged if the interval is longer than 440 ms . the lqts diagnostic criteria proposed by schwartz et al . , are based on ecg findings , clinical history of syncope or congenital deafness , and family history . difinite lqts is difined by the lqts score reaches 4 or more points ( table 1 ) . however , it is difficult to diagnose lqts accurately only on the basis of the clinical history and ecg findings because of variable penetrance and genetic heterogeneity . therefore , genetic testing is recommended , but diagnostic genotyping is very expensive and hence it is not practically feasible . 30% of patients with congenital lqts have apparently normal phenotype and thus a normal qt interval , so they remain undiagnosed until an initiating event . in addition , a variety of commonly prescribed drugs given to patients can prolong cardiac repolarization , prolong the qtc . these patients are considered as potential or silent lqts gene carriers and 70% of them have a normal qtc interval until they are exposed to a provoking drug . in the present case at the first attempt for open reduction , there were no preoperative abnormal findings in the patient 's clinical history and family history , and the qtc on preoperative ecg was 439 ms , which can bearly be considered as prolonged qtc . also , per the lqts score was 0 ; hence it was difficult to term the patient as a lqts case and was a low risk case . however , when the medication for anesthetic induction was administered and tracheal intubation was performed , ventricular tachycardia and fibrillation did occur . based on the findings on ecg taken in the icu which revealed that the qtc was prolonged to 547 ms and t - wave inversion was detected in leads ii , iii , avf , and v2 - 6 , the patient was diagnosed with lqts . therefore , it seems plausible to assume that he was an asymptomatic potential lqts patient and the medication administered for anesthetic induction triggered lqts . even though from many studies , the effects of anesthetic drugs on qt interval have been known , it is difficult to identify which particular medication is responsible for the qt interval prolongation as several drugs are administered simultaneously . to date , there has been no study reporting the usage of only one single anesthetic drug to induce anesthesia and investigating its effect on the qtc interval . in this case for rapid - sequence induction , thiopental and succinylcholine were injected , while 2.0 vol% of sevoflurane was also administered shortly . according to saarnivaara and lindgren , thiopental prolongs the qtc in the healthy patients and succinylcholine is effective in maintaining the qtc interval prolongation . have reported that sevoflurane , isoflurane , and desflurane all prolong the qtc and there is a possibility that all the medications administered for anesthetic induction prolong the qtc . as sudden sympathetic activation due to tracheal intubation may also be a cause of prolongation of the qtc ; galloway and glass have suggested that drugs which activate the sympathetic nervous system ; such as ketamine and pancuronium , should be avoided . magnesium sulphate is the treatment of choice in lqts patients when an arrhythmic episode such as torsades de pointes develops . if magnesium sulphate is ineffective in suppressing torsades de pointes , temporary transvenous pacing is a viable alternative and it is recommended to apply transvenous pacing to the right atrium through the central venous catheter . in the present case , we did not have time for these options due to the transition into vf , and hence , defibrillation had to be attempted promptly . the use of drugs such as epineprine and norepinephrine that activate the sympathetic nervous system may lead to further prolongation of qtc interval . in this case wherein the patient had vf and cardiac arrest without measurable bp , we however had to administer epinephrine while performing cpr by chest compression . the purpose of the treatment for lqts is to prevent torsades de pointes and sudden cardiac death . generally , beta - receptor blocking agents ( -blockers ) are the first choice in the treatment of lqts . recently in the cases of episodes of syncope , torsades de pointes , or cardiac arrest requiring cpr despite the administration of -blockers , icd implantation is being performed . icd implantation is also recommended for patients with prolonged qtc to 550 - 600 ms or more ; dangerous enough for leading to sudden cardiac death . even though icd does not prevent torsades de pointes , it is known that icd reduces the risk of torsades de pointes or sudden cardiac death due to vf . in the present case , because the patient had a prolonged qtc of 547 ms and had a history of cardiac arrest accompanied with vf , icd implantation was performed and hr was well maintained at 70 - 80 beats / min . preoperatively , -blockers should be administered ; hr should maintained below 130 beats / min ; normal serum electrolyte levels should be maintained . it is recommended to avoid any medical agents that have the potential to prolong the qt interval . it is also important to pay attention to sudden activation of the sympathetic nervous system , and icd needs to be evaluated . in the preoperative assessment of the present case , the patient did not complain of any particular symptoms , and the blood test findings including the serum electrolyte levels were normal . in the present case at the second attempt for open reduction , in the preoperative ecg evaluation , inverted t - waves in lead v2 - 6 detected on ecg taken in the icu were normalized ; the qtc was in the normal range ; hr was well maintained to 70 - 80 beats / min . therefore , -blockers were not used and the operation was started after icd was evaluated . it has been reported that inhalation anesthetics such as sevoflurane , isoflurane , and desflurane may prolong the qtc and michaloudis et al . have suggested that the propofol does not affect the qtc interval much , while midazolam does not influence the qtc interval either . in light of these suggestions , in order to allay the patient 's fear , we also gave intravenous administration of midazolam as a premedication to prevent sympathetic stimulation due to tracheal intubation and the operation and to minimize the influence on the qtc interval , we performed total intravenous anesthesia using mainly propofol and remifentanil , which was well maintained without any significant changes on vital signs and ecg . hence , it is safe to avoid the reversal of muscle relaxation as far as possible . in the present case , however , bp and hr were very well maintained and muscle relaxation reversal was performed , and it did not lead to any problems . in conclusion , our patient may be a potential lqts gene carrier , and was diagnosed with lqts after he was exposed to the provoking anesthesia - inducing drugs , which precipitated the malignant arrhythmia . a variety of commonly administered drugs for general anesthesia can affect the qt interval and cause unexpected life - threatening situations . it is beneficial to make a proper choice of anesthetic drugs which do not affect the qt interval for both ; the patients diagnosed with lqts and the patients not diagnosed with lqts , as a patient not diagnosed with lqts may also be a potential lqts patient and exposure to a provoking drug can make such a patient transit to an lqts phase . needless to say , that more attention should be directed to the anesthetic management of patients diagnosed with lqts .

long qt syndrome ( lqts ) is an arrhythmogenic cardiovascular disorder resulting from mutations in cardiac ion channels . lqts is characterized by prolonged ventricular repolarization and frequently manifests itself as qt interval prolongation on the electrocardiogram ( ecg ) . a variety of commonly prescribed anesthetic drugs possess the adverse property of prolonging cardiac repolarization and may provoke serious ventricular tachyarrhythmia called ' torsades de pointes ' , ventricular fibrillation , and sudden death . we experienced a case of ventricular tachycardia and ventricular fibrillation after anesthetic induction and it came out into the open that anesthetic induction provoked long qt syndrome .

Case Report Discussion

a metal block of dimension 3 mm 3 mm 3 mm was fabricated using auto - cad wire cut iridium technology ( electronic , electra , mektron , maxicut 734 ) for standardizing the dimensions of the zirconia blocks . the metal block was scanned using a software for cad / cam machine ( intelli denta , dental smart products , italy ) . the three - dimensional ( 3d ) design was fabricated with software ( minimagics , version 2.0 ) . using the 3d design 20 zirconia blocks ( noritake cerabien ) were fabricated in the same dimension as that of the metal block by cad / cam technology . the 20 zirconia blocks obtained were divided into 2 groups of 10 each group a : ceramic veneered onto zirconia core by pressinggroup b : ceramic veneered onto zirconia core by layering . group a : ceramic veneered onto zirconia core by pressing group b : ceramic veneered onto zirconia core by layering . the dimension of the zirconia blocks was checked using a separable metal mold of 3 mm 3 mm 3 mm and the zirconia blocks were cleaned with 70% ethanol [ figure 1 ] . dimensions of the zirconia block checked in a removable metal mold the pressed samples were fabricated by fabricating a 2 mm thickness wax pattern on the clean end of group a zirconia blocks and the dimension of the wax pattern was checked in the separable metal mold [ figure 2 ] . these wax patterns were invested in gypsum bonded investment ( noritake press investment ) as per the manufacturer 's instructions . burnout was carried out and noritake czr press ingots ( lot no . : oexz01 , 201412 ) were pressed using noritake plunger in the ceramic furnace ( ep600 , emu fru32 , ivoclar vivadent ) , as per the manufacturer 's instructions [ figure 3 ] . the dimension of pressed specimens was checked by placing it in the separable metal mold . wax pattern fabrication and spruing done for group a zirconia blocks group a specimens fabricated by pressing veneering ceramics for the fabrication of layered samples , the separable metal mold was isolated by ceramic separating solution ( ceramic separating stick , noritake cerabien ) to avoid adhesion of ceramic powder onto the mold during layering . the ceramic powder ( noritake czr , lot no . : oexz01 , 201412 ) was mixed with the respective liquid as per manufacturer 's instruction and layered on group b zirconia blocks . the group b specimens were glazed in the ceramic furnace ( vop , ceramic master ) as per the manufacturer 's instructions . the dimensions of layered specimens were checked by placing it in the separable metal mold [ figure 4 ] . group b specimens fabricated by layering veneering ceramics the veneered group a and b specimens were mounted onto the center of a polyvinyl chloride tube of 1 cm height using self - cure acrylic resin leaving 3 mm of the veneered surface exposed as cantilever . , batch no , h72214 ) was used for adhesion of these specimens to the self - cure acrylic resin . the specimens were stressed with notched shear bond test using a universal loading apparatus ( unitek 94100 , fie ) the blocks were loaded up to failure with a chisel - shaped piston at the interface parallel to the block at a crosshead speed of 5 mm / min [ figures 5 and 6 ] . specimen stressed in a universal loading apparatus specimens loaded up to failure shear bond strength ( mpa ) was calculated dividing the load value ( n ) at which the failure occurred by the bonding area of the zirconia - veneer interface ( mm ) . shear stress ( mpa ) = load ( n ) area ( mm ) a comparative evaluation of the shear bond strength of ceramic material veneered onto zirconia core by two different techniques , layering and pressing was done using independent samples t - test . a comparative evaluation of the shear bond strength of ceramic material veneered onto zirconia core by two different techniques , layering and pressing was done using independent samples t - test . pressed ceramics performed significantly better when comparing the shear bond strength of ceramics veneered onto zirconia core by pressing and layering technique . the mean shear bond strength of specimens fabricated by pressing was 12.536 1.633 mpa and by layering was 8.458 0.845 mpa . the t value was 4.96 and p = 0.001 which was statistically significant [ table 1 ] . ceramics veneered onto metal alloys or zirconia core have been available for quite some time but the bonding mechanism between zirconia core and ceramic veneer have not been clearly demonstrated . according to various clinical studies , the reasons for failures may be due to material composition , properties , firing temperatures , cooling rates , operator 's skill , porosities , and fabrication process which may affect the quality and strength of bond between the core and the veneered material . according to kim et al . and aboushelib et al . one or more surface treatments like airborne particle abrasion or application of a liner will typically enhance the bond strength by increasing the surface area of contact between zirconia core and veneered ceramic . reported that scanning electron microscopy ( sem ) observations of the sectioned areas reveals compositional differences across the interface between the core and the veneer due to a chemical alteration of the glass ceramics adjacent to the core , possibly altering the properties such as strength and coefficient of thermal expansion at the interface . ban and anusavice suggested that adhesion of porcelain to zirconia core depends on chemical bonding and reaction taking place at the grain boundaries . reported that the presence of global residual compressive stresses and porosities at the interface can also lead to poor bonding mechanism . this study was done to evaluate the significant difference in the shear bond strength of ceramic material veneered to zirconia core by two different techniques , layering and pressing . noritake czr press ( pressable ceramics ) and noritake czr ( layered veneer ceramics ) , cerabien , japan was used . the result obtained in this study showed that pressable ceramic perform significantly better than the layered specimen ( p = 0.001 ) . the study result was in accordance to the result reported by aboushelib et al . and ansong et al . wherein , the mean shear bond strength of pressed samples was 12.54 1.63 mpa ( standard deviation ) and of layered samples was 8.458 0.845 mpa . investigated the micro tensile bond strength between one type of zirconia substrate and various commercially available ceramic material for veneering by both pressing and layering techniques , the mean shear bond strength ranged from 25 to 48.8 mpa for pressable ceramic and 17.241.1 mpa for manual layered ceramic . ishibe et al . in his study reported that the mean shear bond strength for pressed zirconia ceramic specimen ranged from 21.34 ( 24.30 ) mpa to 40.41 ( 10.28 ) mpa , ( p < 0.05 ) and mean shear bond strength for layered zirconia specimens ranged from 30.03 ( 9.49 ) mpa to 47.18 ( 12.99 ) mpa , ( p < 0.05 ) . the result of this study was not in accordance with ishibe et al . who reported a higher bond strength value for layered samples when compared to pressed specimens . delamination can be due to a weak bond between the zirconia core and the ceramic veneer . sem examination of the core veneer interface of sound specimens shows that pressable veneers had better surface contact with zirconia . this can be due to an improved surface contact between the two materials due to the applied external pressure , especially at the microscopic surface roughness level . as they cool below glass transition point under pressure , there is less chance for micro gap formation as a result of deformation and cooling stresses . however , in layering multiple firing of veneer ceramic over zirconia core , relaxation of residual stresses and tetragonal monolithic transformation of zirconia may occur . this may not only affect the strength of the structure , but may also affect core veneer bond strength . these uplifts , which occur at the microscopic level , can reduce the core veneer bond strength . the limitations of this study include the fact that the design of the specimen does not report the clinical situation and limited sample size . within the limitations of this study , it is conclusive that the mean shear bond strength of specimens veneered on to zirconia core by pressing technique performed significantly better than the layered specimen ( p = 0.001 ) . the mean shear bond strength of pressed samples was 12.54 1.63 mpa and layered samples were 8.458 0.845 mpa . the clinicians and dental laboratory technicians should consider the use of pressed ceramics as an alternative to traditional layering of ceramics on to zirconia core which would reduce the chances of chipping and delamination of the veneered ceramics with other advantages such as excellent accuracy and better marginal adaptation .

statement of problem : although ceramic veneered on to zirconia core have been in use for quite some time , information regarding the comparative evaluation of the shear bond strength of pressable & layered ceramic veneered on to zirconia core is limited.purpose of study : to evaluate the shear bond strength of zirconia core and ceramic veneer fabricated by two different techniques , layering ( noritake czr ) and pressing ( noritake , czr press).materials and method:20 samples of zirconia blocks were fabricated and the samples were divided into group a & b. group a - ceramic veneered over zirconia core by pressing using noritake czr press . group b - ceramic veneered over zirconia core by layering using noritake czr . the veneered specimens were mounted on to the center of a pvc tube using self - cure acrylic resin leaving 3 mm of the veneered surface exposed as cantilever . using a universal testing machine the blocks were loaded up to failure.result:the results were tabulated by using independent samples t - test . the mean shear bond strength for pressed specimens was 12.458 1.63(s.d ) mpa and for layered specimens was 8.458 0.845(s.d ) mpa.conclusion:pressed specimens performed significantly better than the layered specimen with a p value 0.001 . clinicians and dental laboratory technicians should consider the use of pressed ceramics as an alternative to traditional layering procedures to reduce the chances of chipping or de - lamination of ceramics

Material and Methods Statistical analysis Results Discussion Conclusion Financial support and sponsorship Conflicts of interest

tall cell variant papillary thyroid carcinoma ( tcv ) was first described in 1976 by hawk and hazard as an aggressive histological variant of papillary thyroid cancer . tcv is defined as tall papillary epithelial cells with a height at least twice the width and basement membrane oriented nuclei comprising at least 30% of the cells within the tumor [ 13 ] . usual variant papillary thyroid cancer describes conventional papillary thyroid carcinoma composed of papillary epithelial cells arranged in papillae with fibrovascular cores without excessive height compared to cell width . the published incidence of tcv is between 3.8% and 10.4% [ 1 , 410 ] . unlike the usually good prognosis of usual variant papillary thyroid cancer ( uv ) , tcv histology is generally reported as an independently poor prognostic factor [ 1 , 3 , 5 , 6 , 8 , 9 ] . more recently reported case series do not show that tcv histology adversely affects prognosis [ 7 , 10 , 11 ] . one such large retrospective study concluded the poor prognosis of tcv tumors was not particularly related to histology but to factors such as stage and grade . another case series found the higher rate of recurrence in tcv was strictly associated with age over 50 . although these more recent studies improved on previously reported studies by increasing the sample sizes , the number of tcv cases still remain small in comparison to the uv group . a reason for the low tcv numbers could be misclassification bias where the diagnosis of tcv is missed by routine pathologic examination . as first described in a case series of 162 papillary thyroid cancers , initial routine pathological examination failed to detect 8 out of 11 cases of tcv . the additional eight cases were discovered only by an experienced pathologist with a special interest in thyroid pathology and familiar with tcv histology . this may lead to erroneous comparisons of recurrence and mortality data between tcv and uv . the purpose of this meta - analysis is to evaluate the prognostic impact of tcv histology in papillary thyroid cancer in currently published studies by comparing tcv and uv disease - related mortality and recurrence data . we hypothesize that the cumulative published evidence supports tcv as a negative prognostic factor as measured by a greater disease - related mortality and recurrence rate than uv . a systematic literature review was conducted on may 23 , 2007 utilizing the ovid search engine to access the medline database . the term tall cell variant papillary thyroid cancer was used as a keyword search and yielded 108 articles . the titles and abstracts were carefully reviewed and those evaluating the prognostic implication of tcv histology in papillary thyroid cancer were included for review . the papers were evaluated based on predetermined inclusion and exclusion criteria and their references were reviewed for additionally relevant papers . the primary inclusion criterion was studies that compared prognostic factors in tcv to uv papillary thyroid cancer . exclusion criteria included those with total sample size less than or equal to 15 , non - english reports , and the absence of recurrence and disease - related mortality data for both tcv and uv groups . the medline and bibliography search after application of the inclusion and exclusion criteria yielded six reports that were included in our study ( table 1 ) . both odds ratios and 95% confidence intervals for both recurrence and disease - related mortality were calculated for each of the studies . in the case of a 0 count in a study , 0.5 was added to all the counts for that study to allow calculation of an odds ratio and 95% confidence interval . the next step determined the combined odds ratio of all six studies for recurrence and disease - related mortality . both the fixed effects cochran - mantel - haenszel and a random effects method for binary data were used to calculate combined odds ratios . a fixed effects method gives each study a weighting in accordance to the precision of its estimate whereas a random effects method accounts for variation between studies by giving a relatively larger weight to the less precise studies . for both the odds of recurrence and mortality , a test for heterogeneity that accompanies the fixed effects , cochran - mantel - haenszel model was significant ( p = .023 and p = .033 , resp . ) suggesting that between - study variability was too great for a fixed effects model . as a result , the random effects method to determine the odds ratio was preferred to account for the extra variation between studies . after application of our inclusion and exclusion criteria , six articles were available for review ( table 1 ) . this allows for our study to have the largest number of tcv cases available for evaluation in the literature to the best of our knowledge . reviewing the data from [ 3 , 810 ] , the tcv patients had a higher rate of extrathyroidal extension ( cumulative average of 60.33% patients ) and higher rate of distant metastases at diagnosis ( cumulative average of 15% ) . in addition , the cumulative average of lymph node metastases in tcv cases is 58.12% versus 34.5% in uv cases . the percentage of recurrence and disease - related mortality is also noted to be higher in tcv group versus uv group . the cumulative average disease - related mortality in tcv group is 23.6% versus 1.5% for uv group . the odds ratios calculated by this study for recurrence and disease - related mortality are provided in table 2 . all of the individual study 's odds ratios demonstrate a greater odds of recurrence in the tcv subjects compared to the uv subjects . the odds ratios are statistically significant in all the studies except the prendiville et al . study . all the calculated odds ratios for individual study disease - related mortality similarly demonstrated an increased rate of disease - related mortality in tcv subjects compared to uv subjects ; however , only three of the six studies [ 6 , 9 , 10 ] had statistically significant odds ratios where the confidence interval did not include one . the combined odds ratios for recurrence and disease - related mortality using both the fixed and random effects methods are provided in table 3 . the test for heterogeneity ( p = .023 ) that accompanies the random effects method in determining the odds of recurrence indicates the random effect method would be preferable to account for the extra between - study variation by giving a relatively larger weight to the less precise studies . although both combined odds ratios of recurrence demonstrate a greater rate of recurrence in the tcv subjects compared to uv subjects , the preferred random effects model odds ratio suggests that recurrence occurs with 4.50 times greater odds in tcv tumors versus uv tumors and that this is statistically significant ( 95% ci 2.906.99 ) . similarly , the combined odds of disease - related mortality is greater for tcv subjects compared to uv subjects regardless of whether a fixed versus random effects method is used . using the preferred random effects model , the odds of disease - related mortality in tcv patients are 14.28 times greater than uv patients . tcv is a negative prognostic indicator in papillary thyroid cancer . by performing a meta - analysis on published research , we hoped to overcome the limitations of small sample sizes of individual articles to examine the impact of such a rare histological subtype on prognosis . additionally , we found tcv has a 14.28 times greater disease - related odds of mortality compared to uv . we also noted higher trends in lymph node metastasis , distant metastasis , and extrathyroidal extension in tcv patients versus uv patients . the adverse effects of tcv on prognosis , as represented by our study , necessitate a careful and perhaps more aggressive approach than typically followed with uv . whereas partial thyroidectomy ( defined as thyroid lobectomy with or without isthmusectomy ) is an acceptable conservative approach to patients with low - risk uv for recurrence and mortality ( by ames criteria ) , our research suggests a more aggressive approach for tcv ( e.g. , total thyroidectomy with central neck dissection ) may be indicated . the problem at hand is that tcv is detected at pathological evaluation , which occurs after the initial thyroid surgery has been performed . hence , we propose that if a newly diagnosed patient with tcv has undergone partial thyroidectomy , then the patient should return to the operating room for at least a completion thyroidectomy and central neck dissection followed by radioactive iodine ablation of residual tissue . if a total thyroidectomy was performed at initial surgery , then careful consideration should be given for return to the operating room for a central neck dissection ( depending on surgeon experience ) followed by radioactive iodine ablation versus radioactive iodine ablation alone . if the tumor is not radioactive iodine avid , then early intervention with external beam radiation should be considered . additional issues , such as longer follow - ups and extensive screening for distant metastasis , may also be warranted . a recent review of papillary thyroid cancer variants recommended an aggressive approach to tcv with at least a total thyroidectomy . in a recent matched - pair analysis comparing tcv patients to the matched uv cohort , 5-year disease specific survival was poorer in the tcv cohort ( 81.9% versus 91.3% , p = .049 ) . the number of deaths in the tcv cohort was higher than in the matched papillary thyroid cancer cohort ( p = .043 ) . this study further affirms the results of our study showing higher rate of recurrence and mortality in tcv patients . our results stress the necessity of accurate pathological diagnosis . since the discovery of tcv in 1976 , the ability to study and evaluate the prognostic implications of histology in papillary thyroid cancer resides solely on accurate pathological identification . hence , there is no substitute for an experienced pathologist in the management of this disease . firstly , we have large confidence intervals which reflect the variation between studies and the relatively small number of studies included in the meta - analysis . this is also reflected in the test of heterogeneity that we performed that directed us to use the random effects model rather than the fixed effects model . in addition , the articles by segal et al . and terry et al . did not have data on patient age , tumor size , lymph node metastasis , extrathyroidal extension , or distant metastases . these articles were included due to the presence of recurrence and disease - related mortality data . in conclusion , the data supports tcv as a poor prognostic factor as determined by disease - related mortality and recurrence rates . as a result , this data supports early aggressive surgical and adjuvant radioactive iodine management and the necessity for accurate pathologic diagnosis . it unequivocally supports the absolute need for further study of tvc as an independent prognostic factor in future studies on papillary thyroid cancer .

objective . to evaluate the prognosis of tall cell variant ( tcv ) compared to usual variant ( uv ) papillary thyroid cancer by comparing disease - related mortality and recurrence data from published studies . methods . ovid medline keyword search using tall cell variant papillary thyroid cancer was used to identify studies published in english that calculated disease - related mortality and recurrence rates for both tcv and uv . results . a total of 131 cases of tall cell variant papillary thyroid cancer were reviewed . the combined odds ratio of recurrence for tcv compared to uv is 4.50 with a 95% confidence interval from 2.90 to 6.99 . for disease - related mortality , the combined odds ratio for tcv was compared to uv of 14.28 with a 95% confidence interval from 8.01 to 25.46 . conclusion . currently published data suggests that tcv is a negative prognostic indicator in papillary thyroid cancer and requires aggressive therapy . this meta - analysis provides the largest prognostic data series on tcv in the literature and clearly identifies the need for accurate pathological identification of tcv and its further study as an independent prognostic factor .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

during october 12 , 2014march 28 , 2015 , samples collected from 1,058 persons in liberia with suspected ebov infection were submitted to the cdc nih elwa laboratory . the samples used for this research were collected for public health surveillance and not human subjects research , so institutional review board review and approval were not required . early during the study period ( october november ) , most of the patients from whom samples were collected received a diagnosis of ebov infection ( figure 1 , panel a ) ; toward the end , however , few cases of ebov infection were diagnosed in liberia . the number of patients who received a diagnosis of plasmodium spp . parasitemia remained stable over time ; thus , despite the lack of positive ebov test results in the final months of the study period , overall , 40%60% of patients each week received a diagnosis of ebov infection , plasmodium spp . parasitemia , or both ( figure 1 , panel a ) . of 1,058 samples tested , 259 ( 24.5% ) were positive for ebov alone , 243 ( 23% ) were positive for plasmodium spp . alone , and 47 ( 4.4% ) were positive for both ( figure 1 , panel b ) . of 311 plasmodium - positive samples that were further analyzed , 296 ( 95% ) were positive for p. falciparum ( figure 1 , panel c ) , confirming that p. falciparum was the main plasmodium species causing parasitemia in our cohort . rna in patient samples submitted to the centers for disease control and prevention national institutes of health diagnostic laboratory at the eternal love winning africa campus in monrovia , liberia , from october 12 , 2014 ( epidemiologic week 42 ) , through march 28 , 2015 ( week 13 ) . whole blood samples were inactivated , and rna was extracted by using the qiaamp viral rna mini kit ( qiagen , hilden , germany ) . rna by real - time quantitative reverse transcription pcr ( qrt - pcr ) ( 13 ) . a ) number of patients , as determined by qrt - pcr , positive for ebov , plasmodium spp . , both , or neither ( i.e. , no ebov and no plasmodium spp . ) , by epidemiologic week . b ) total number of patients receiving a laboratory diagnosis of ebola viremia , plasmodium spp . qrt - pcr positive samples that were retested with a qrt - pcr specific for p. falciparum ( 14 ) . a high ct value corresponds to a low - level parasitemia ; the lower the ct value , the higher the number of plasmodium parasites detected . all patients in the cohort were triaged as having suspected ebov infection , and thus all had clinical symptoms that might have been caused by ebov , plasmodium spp . , or a different pathogen . of note , significantly fewer plasmodium parasites were detected in patients with ebov infection than in patients who were not infected with ebov ( average plasmodium ct 24.7 vs. 20.37 ; p<0.01 by unpaired student t - test ) , likely because clinical symptoms in these patients were caused by the ebov infection rather than malaria . some of the patients in our cohort with plasmodium spp . parasitemia might have been asymptomatic carriers , especially those with a low - level parasitemia . parasitemia over time by month of sample submission , for samples submitted to the centers for disease control and prevention national institutes of health diagnostic laboratory at the eternal love winning africa campus in monrovia , liberia , from october 12 , 2014 , through march 28 , 2015 . cycle threshold ( ct ) values were detected by using real - time quantitative reverse transcription pcr . triangles represent parasite loads in parasitemic patients co - infected with ebola virus ; circles represent patients with plasmodium spp . similar to other malaria - endemic regions , a large proportion of the population is infected with plasmodium parasites without developing clinical disease . to compensate for this and the higher sensitivity of the pcr assay compared with light microscopy , we used a cutoff of ct < 30 rather than ct < 40 under the assumption that a 10-ct difference would compensate for the 1,000-fold higher sensitivity of pcr over microscopy . this principle could be carried further to assume that a ct < 25 would be in the range detectable by the rapid diagnostic test . of note one could argue that because all patients with febrile illness who were seen at many of the etus were given antimalarial treatment when they first sought medical care , providing laboratory testing for plasmodium spp . presumptive artemisinin - based combination treatment is recommended for all patients seen at etus , followed by prompt malaria diagnostic testing so that appropriate measures can be taken if oral treatment can not be sustained because of clinical symptoms ( 9,10 ) . moreover , mathematical models predict a large increase in malaria in the epidemic region because of lapses in malaria control ( 7 ) . parasitemia testing of all febrile patients seen at healthcare facilities could be used to determine whether this increase is indeed occurring so that countermeasures can be scaled up accordingly . differential diagnostic testing should be expanded to identify the cause of disease in the patients in our cohort whose samples tested negative for ebov and plasmodium spp . , as was attempted in 1 laboratory in sierra leone ( 15 ) . however , this kind of testing was difficult for several reasons . first , during the height of the evd epidemic in liberia , most laboratories were already working close to capacity while testing for ebov alone . testing for additional pathogens would have required the allocation of additional resources , including equipment and personnel . second , it might not be possible to perform diagnostics using a whole blood sample for all the pathogens of differential diagnostic importance that can cause signs and symptoms similar to those of evd ( e.g. , typhoid , bacterial sepsis , shigellosis , cholera , leptospirosis , dengue fever , rickettsioses , relapsing fever , meningitis , viral hepatitis , influenza , lassa fever ) . third , each of these pathogens likely is the cause of disease in only a small subset of febrile patients . because broad - spectrum antimicrobial drugs and antimalarial drugs are routinely administered to all patients seen at an etu , consideration for additional testing should focus on endemic pathogens that would not respond to these treatments . by using pcr - based detection for plasmodium spp . parasitemia , the need for additional handling of clinical specimens possibly infected with ebov was eliminated . thus , the addition of pcr - based diagnostic tests to detect plasmodium spp . does not pose an additional safety risk to laboratory staff . also , it is less time - consuming to add additional pcr reactions to a pcr run than to separately perform microscopy or an rdt on each sample , and these additions would add only 15 minutes to the overall time needed from sample submission to reporting of results . moreover , if a multiplex approach is used , the additions would not require extra time or reagents . parasitemia can be implemented easily and safely in laboratories performing ebov diagnostics to assist with case - patient management during evd outbreaks in malaria - endemic areas .

malaria is a major public health concern in the countries affected by the ebola virus disease epidemic in west africa . we determined the feasibility of using molecular malaria diagnostics during an ebola virus disease outbreak and report the incidence of plasmodium spp . parasitemia in persons with suspected ebola virus infection .

The Study Conclusions

managing financial resources is one of the main functions of a healthcare system ( 1 ) . different methods are used to collect revenue in healthcare systems , such as public taxes , compulsory contributions for social health insurance ( usually based on one s wages with little or no consideration of risks ) , voluntary participation in private health insurance ( usually considers risks ) , out - of - pocket ( oop ) payments along with endowments and private donations ( 2 ) . the main determining factor in fair financing of the healthcare system is the amount of prepayment required and its percentage of the total expenditure required to obtain healthcare services . out - of - pocket payment is the most inequitable method of payment for healthcare , and it makes those who seek healthcare vulnerable to potentially catastrophic financial burdens ( 3 ) . while financing healthcare in most countries where incomes are high is dependent upon public taxes or the provision of social healthcare insurance ( 4 ) , out - of - pocket payment by the patient is the main financing mechanism in most asian and developing countries ( 5 ) . out - of - pocket payment is the cost that is incurred directly by the patient when insurance does not cover the total costs incurred for healthcare services ( 6 ) . individuals incur out - of - pocket expenditures when they must pay for all their healthcare services and when they pay for a portion of their healthcare services while other payers , such as the government or private health insurance companies , pay the remaining balance ( 7 ) . out - of - pocket payment , in which the individual pays the service provider directly , is the simplest and least - effective payment method ( 8) . these non - reimbursable , out - of - pocket payments include the premium payments for health insurance and paying directly for healthcare services when there is no insurance coverage . these expenditures can include the costs for caring for the patient at home ; purchasing medicine and equipment , such as prescription drugs and a walker ; providing special dietary needs , such as low - sodium foods ; providing transportation to medical appointments and other required outings ; and obtaining diagnostic services ( 9 ) . in countries in which people have no financial support for healthcare , the costs associated with diseases or injuries can be completely overwhelming to many , if not most , of the people in the population . the expenditures they can incur include out - of - pocket expenditures related to medical treatment and indirect expenditures , such as reduced income that results from the inability to work or go to the hospital . treatment expenditures often consume a significant share of the family s income , forcing the entire family into poverty ( 10 ) . today , the lack of financial protection in obtaining healthcare is regarded as a serious malady of healthcare systems , the clearest sign of which is that when families have to deal with the burden of diseases , they simultaneously must face the burden poverty due to the backbreaking expenditures in their healthcare system ( 8) . when the healthcare system depends on out - of - pocket payments from individuals to meet their healthcare needs , such individuals likely will incur backbreaking payments . the world health organization ( who ) has identified the expenditure of funds to protect people from diseases as one of the three main objectives of a healthcare system ( 11 ) . every year , 100 million people throughout the world become poor because they have to make personal payments for healthcare . thus , governments and private enterprises concerned with healthcare systems should focus on two , interconnected issues , i.e. , caring for the personal health of individuals and caring for their financial health ( 4 ) . the current challenge for the governments of low - income countries is to reduce the progressive burden of out - of - pocket expenditures through state - supported payment plans . this is essential if we ever expect to reduce the personal expenditures that create financial risks and backbreaking costs for individuals and families ( 2 ) . in 2006 , medicare part d went into effect to provide support against high out - of - pocket payments for prescribed medicines . high levels of out - of - pocket payments for healthcare services may cause people to ignore the need for healthcare services and medicines because of the choice they have to make between healthcare and other basic needs , such as food and housing . a system that forces the poor people in a society to make such a heart - rending choice is certain to lead to a reduced quality of life among such individuals . out - of - pocket payments for healthcare have been identified as a common cause of bankruptcy cases among sick or injured people who seek access to healthcare ( 12 ) . according to the statistics of the ministry of health in october 2012 , about 5 - 7% of people fall below the poverty line because of their expenditures for medical issues ( 13 ) . in fact , out - of - pocket payments of people for medical care can be reduced through financial support by the government or private health insurance ; some countries consider the requirement for out - of - pocket payments for healthcare to be an obstacle that stands in the way of people accessing and using healthcare services when they are needed . families who can not afford to pay for medical services must either postpone acquiring the healthcare they need or forego it altogether . on average , in all oecd member nations , 19% of health payments are paid directly by the patient ( 6 ) . the data about out - of - pocket expenditures are not normally excited , therefore , collecting this kind of data is difficult ( 14 ) . according to who , value of out - of - pocket payment for sanitary expenditures in 2008 in vietnam , cambodia , and laos were 14% , 3.4% , and 1.7% , respectively , and , in 2009 , it was 1.2% for the philippines ( 1517 ) . a study conducted in 2013 indicated that the share of out - of - pocket payment in germany , france , japan , and cuba was 10% , and the shares in the usa , bahrain , turkey , malaysia , pakistan , and iran were 18 , 21 , 30 , 40 , 75 , and 56% , respectively ( 13 ) . who has a chronic disease , the family spends 10% of its annual income on oop payments for healthcare services ( 9 ) . in 20102011 , the australian institute of health and welfare ( aihw ) estimated that $ 24.3 billion in healthcare payments were made directly by individuals . oop payments in australia were double those of the united kingdom and new zealand ( 18 ) . it is the main task of any government to provide public healthcare , and article 29 of the law of the islamic republic of iran is focused on this issue . the iranian fourth development plan includes a provision to reduce oop payments in iran for healthcare and medical services up to 30% ( 13 ) . another of the objectives of the health development plan in iran is to reduce oop payment by hospitalized patients by as much as 10% ( 19 ) . for diseases to be treated properly , diagnostic services are a vital element to provide the best care measures for patients , because these services provide the information physicians need to evaluate and diagnose patients conditions and provide the appropriate care . in addition , timely diagnostic services , which are a vital part of healthcare , will indicate whether the patient has a disease or not , allow more effective treatment , and ensure quicker recovery of the patient ( 11 ) . in this study , we estimated the oop expenditures for outpatient imaging services , and identified the most expensive imaging service . this descriptive , cross - sectional study was conducted in imam khomeini hospital in tehran in 2014 . the sector of the population that we studied was people who sought outpatient imaging services at the hospital . the number of such people required for accurate statistical analysis of the results was estimated to be 100 . the study was conducted through structured interviews with the outpatients who requested imaging services , and we also investigated the availability of any financial resources provided by the hospital for these outpatients . the amounts of oop payments made by the patient and payments made by insurers , if any , were determined , the percentage of oop payments made by the outpatients was calculated by dividing the oop payments made by the patient for each service ( radiology , ultrasonography , ct - scan , mri ) was divided by the total payment required for each service , i.e. , oop payment by the outpatient plus any payment made by any basic and/or supplementary insurance . furthermore , when time was available , we also investigated the personal situations of the outpatients . in addition , the confidentiality of the patients names was observed through all stages of the research . measures of central tendencies and measures of dispersion were to provide a better description of each imaging service that was used . the pearson correlation test was used to investigate the relationship between age and the amounts of the oop payments , and the t - test was used to analyze the relationship between the outpatients gender and the amount of the opp payments they were required to make . the total percentage of oop payments by patients was 32% , which was obtained by dividing the total amount of all oop payments by the total cost paid ( patients opp share , insurers share , and state subsidies ) . in this regard , the highest opp share , i.e. , 41% was for ct - scan services , the least opp share , i.e. , 30% , was for radiology services . the highest oop payment for imaging services was for a ct - scan , and the least oop payment was for ultrasonography . state subsidies refers to payments made in an individual s behalf by the government ( table 1 ) . the average insurance coverage provided to insured outpatients who acquired imaging services was 73% of the total charge , and the most common types of insurance among the outpatients who were insured were social welfare insurance ( 33% ) and national health service ( nhs ) ( 29% ) . twenty - seven percent of the patients had no insurance coverage ( figure 1 ) . the relationship between the ages of the outpatients and the amount of their oop payments was not significant ( p = 0.01 ) , i.e. , the outpatients ages had no effect on the amount of the oop payment they were required to make for imaging services . the relationship between gender and the amount of the required oop payments was significant ( p < 0.05 ) . the average opp payment made by males was more than the average opp payment made by females , i.e. , the average for males was 286,274 rials , and that for females was 77,210 rials . in who s annual report , the worldwide average oop percentage was about 24% in 2001 , but it was 44% for the east mediterranean region ( 20 ) . this study showed that 32% of imaging expenditures paid to the hospital consisted of oop payments . in a study conducted by asef zadeh in 2012 , the oop payment percentage was 45% for imaging services ( 11 ) . in another study , xu stated that vietnam s oop percentage of 10.5% in 1998 has shown an increasing trend through 2008 relative to the trends in other countries for the same period ( 21 ) . according to ortega - sanchez s study in 2012 , who s 2010 report stated that , on average , 45% of the total payments for outpatient services , including physician s consulting fees , medicine , tests , and other expenditures was oop payments made to governmental service providers . oop payments for outpatient services at state healthcare centers comprise less than 10% of the total cost in guatemala and malawi , whereas they comprise more than 95% in china ( 23 ) . in a study by russell in which the relationship between oop expenditures for healthcare and the abilities of families to afford those expenditures was assessed , their increasing affordability has had a direct and positive effect that has led to decreasing oop payments , which shows the ascending and desirable system of health financing ( 24 ) . while 75% of the resources required by nepal s healthcare system is financed by oop payments , only 11% of japan s healthcare financing is dependent on this source ( 25 ) . the highest backbreaking expenditures for healthcare services occur for poor populations in the area of financing medical care ( 23 ) and outpatient services . in low - income , developing countries , even a low oop value can cause poor families to reduce their spending on healthcare as well as non - health - related expenditures ( 3 ) . the high reliance on financing through oop payments in thus , when diseases occur , families must choose between expenditures for medical care or accepting the risk associated with the lack of treatment , which could lead to the exacerbation of the disease . meeting medical needs could take most of families household budgets , and this could lead to more borrowing of money or even selling their homes . this fact is effective in the reduction of household welfare ( 26 ) . according to a study by mastilica as well as who s 2000 report , households in the bottom deciles spend a higher share of their monthly income on medical expenditures , and they face tremendous financial pressure since their oop payment is more than their income ( 27 , 28 ) . in the current study , the highest percentage of oop payment for outpatient imaging services was related to ct - scan , and asef zadeh s study made the same observation ( 11 ) . in this study , the main reason for the high value of oop payments was inadequate insurance coverage , with 27% of the outpatients having no insurance at all . in this study , the most prevalent rate of insurance coverage was among those who had social welfare insurance . this finding was the same as that of keshavarz in 2011 , who indicated that , on oop payments for treatment , most insured customers ( 60% ) had social welfare insurance ( 8) . in a study by david evan et al . , the results showed that the percentage of backbreaking expenditures was very diverse among the nations and that it was exceptionally high in latin american countries . three reasons could be mentioned to explain the causes of this issue , the poverty that prevented insurance payments , low affordability of individuals for oop payments , and the availability of healthcare services related to oop payments . the result is that low - income households should be provided assistance so they can avoid these expenditures , and such supportive policies should be considered in these nations ( 29 ) . in this study , no significant relationship was observed between the age of the outpatients and the amount of their oop payments . however , the relationship between gender and the amount of oop payments was significant , with males oop payments being more than those of females . the results of another study conducted on diagnostic services reported similar findings ( 11 ) . it could be stated that financing oop payments could make the healthcare financing system inequitable and exasperate the members of households who are trying to get medical attention for their healthcare needs . this problem affects the welfare of the entire household , and this is especially true for poor families . similar to semnani s study , the results of this study showed that a high percentage of treatment expenditures consist of oop payments by the patient , and this continues to occur in spite of the attempts of healthcare policy makers to increase insurance coverage for the poor and decrease their oop expenses for healthcare ( 26 ) . to address this problem , the financing of the healthcare system should be planned in such a way that the have - nots pay less for healthcare ; in addition , insurance coverage should be made available for everyone in the country . furthermore , the insurers should provide suitable depth in their service coverage along with complete coverage , and they should cover different services and support vulnerable groups and the victims of accidents to a much greater extent than is being done currently . in addition , according to the results of this study , insurance companies should give special consideration to the older patients who require imaging services , and the government should provide special supportive policies concerning imaging services for older females . in addition , expensive diagnostic tests , such as the ct - scan , should address the real needs of patients by making the cost of these important diagnostic services more reasonable for everyone in our society , but especially for the poor among us . the results of this study showed that oop payments for outpatient imaging services amount to 32% of the total expenses associated with a ct - scan . it was found that 73% of patients had insurance coverage , and their main insurer was social welfare insurance . there was a significant relationship between gender and the amount of oop payments , with males paying much more than females . no significant relationship was observed between the ages of patients and the amounts of their oop payments . the practical importance of these findings provides a basis that policy makers can use to justify assigning financial resources to the healthcare sector . it is suggested that the oop payments for all healthcare services , including diagnostic services , be investigated and evaluated for their reasonableness and fair treatment of all patients irrespective of gender and age . conducting complementary research on imaging services in educational and private hospitals along with clinics is highly recommended for future studies in this field .

background : direct out - of - pocket ( oop ) payment is the most inequitable way to pay for healthcare services , and this trend exposes patients and their families to backbreaking financial risks . the aim of this study was to estimate the out - of - pocket expenditures for outpatient imaging services in imam - khomeini hospital in tehran.methods:this cross - sectional study was conducted in 2014 on 100 users of outpatient imaging services ( radiology , ultrasonography , ct - scan , and mri ) in imam - khomeini hospital in tehran . structured interviews and the analysis of related documents were used to acquire the pertinent data . the percentage of out - of - pocket expenditures was obtained by dividing the out - of - pocket expenditures by the total expenditures paid to the service provider , i.e. , the sum of out - of - pocket expenditures and insurance payments . to analyze the data , we used descriptive - analytic statistics , distribution indices , the t - test , and the pearson product - moment correlation coefficient.results:health insurance covered 84% of costs incurred by users of outpatient imaging services . there was no significant relationship between the user s age and the amount of out - of - pocket expense ( p = 0.01 ) . the relationship between the user s gender and out - of - pocket expense was significant ( p = 0.05 ) . the average payment for males was greater than the average payment for females . the highest percentage of the total payment the users incurred was 41% for a ct - scan , and the lowest percentage the users incurred was 30% for radiology services.conclusion:it is suggested that expensive diagnostic tests , such as ct - scans , be prescribed according to the actual needs of patients to make the financial burden of diagnostic services reasonable for all patients .

Introduction Material and Methods Results Discussion Conclusions

the synthesis and maturation of rnas are tightly controlled , and they shape complex gene expression networks that ultimately drive biological processes . these networks need to be robust as well as highly plastic in order to allow rapid adaptation to environmental or genetic perturbations . an in - depth understanding of the principles and mechanisms governing these complex gene expression programmes is important to better understand complex diseases such as cancer . for more than 10 years , microarrays have allowed the simultaneous monitoring of expression levels of all annotated genes in cell populations [ 2 , 3 ] . the ability to analyse entire gene expression programmes has opened new horizons for our understanding of global processes regulating gene expression . similarly , with the increasing realisation that rnas transcribed from non - coding portions of genomes are playing fundamental roles , genome - wide approaches have provided valuable insights into this aspect of transcriptomes . later generations of microarrays ( referred to as tiling arrays ) , which consist of probes designed to interrogate a genome systematically irrespective of any gene annotation , have been instrumental in discovering unknown transcripts . applying this technique to several different organisms these platforms allow the rapid and cost - effective generation of massive amounts of sequence data . even though direct sequencing of cdna libraries has been achieved before with sage and mpss approaches , next - generation sequencing ( ngs ) technologies are more straightforward and more affordable . , we will first provide an overview of the strengths and challenges inherent to rna - seq and will then highlight major biological insights gained from rna - seq in a wide range of organisms . the ngs market is currently dominated by three different platforms : the flx pyrosequencing system from 454 life sciences ( a roche company ) , the illumina genome analyser ( developed initially by solexa ) , and the ab solid system ( now life technologies ) . on all three platforms , dna fragments are sequenced in parallel , producing large numbers of relatively short sequence reads or the throughput varies from hundreds of thousands of reads for the flx system to hundreds of millions of reads for the illumina genome analyser and ab solid systems . read lengths range from 30100 bp for illumina and solid to 200500 bp for flx . it is important to note that these technologies are evolving at a tremendous pace , with ever - increasing numbers and lengths of sequence reads . the three major systems differ significantly in the approaches used to produce massive amounts of sequences . an in - depth discussion of the technical and methodological aspects of these next - generation sequencers is beyond the scope of this review and can be found elsewhere [ 12 , 13 ] . despite their technological differences , the three major platforms rely on similar work flows for the production and analysis of sequencing libraries ( fig . 1 ) . first , the sample nucleic acids have to be sheared in order to reach a size compatible with sequencing ( typically < 500 bp ) . second , dna adapters containing unique sequences are attached at both ends of the sheared dna molecules . these adapters subsequently allow the dna fragments to be singled out , either on beads or on a slide ( flowcell ) , to then be sequenced in parallel.fig . 1flowchart of a typical rna - seq experiment flowchart of a typical rna - seq experiment the library preparation is a key step of rna - seq , because it determines how closely the cdna sequence data reflect the original rna population . in the classic ngs protocols , which have been developed for the analysis of genomic dna , adapters are ligated onto shared double - stranded dna fragments . in order to allow the analysis of transcriptomes by ngs , the most straightforward approach is to simply synthesise double - stranded cdna , to which the adapter can then be ligated . this robust protocol has been attractive , because it applies the procedures developed by the manufacturer for the analysis of genomic dna , and it has been widely used in the original rna - seq studies . a substantial drawback of this approach , however , is the loss of information on transcriptional direction , because the adaptor is ligated to double - stranded cdna . an elegant study has managed to maintain strand information simply by pre - treating the rna samples with sodium bisulphate . they differ in how the adaptor sequences are inserted into the cdna , which is achieved ( 1 ) by direct ligation of rna adaptors to the rna sample before reverse transcription [ 15 , 16 ] , ( 2 ) by addition of the adaptor sequences by template switch during reverse transcription , ( 3 ) by double - random priming coupled to solid phase extraction , ( 4 ) by direct ligation of the dna adaptors to single - stranded cdna [ 1921 ] , ( 5 ) by reverse transcription of in vitro polyadenylated rna fragments followed by intramolecular ligation , or ( 6 ) by incorporation of dutp during second strand synthesis and digestion with uracil - n - glycosylase . these methods are likely to differ in potential biases introduced in the data , and careful comparisons will be highly interesting . ngs technologies exploit light that is emitted when the correct base ( or oligonucleotides in case of solid ) matches the template being sequenced and is incorporated into the sequencing reaction . thus , ngs raw outputs are image records of the light emitted by every single parallel sequencing reaction at every sequencing cycle . the images are then processed in order to extract numerical signals for every base at every synthesis event from all the parallel reactions . quality and reliability of signal extraction and base calling has led to significant increases in the quality and throughput of ngs data [ 2426 ] . after image and signal processing , ngs data consist of a list of short sequences together with their base call qualities . with hybridisation - based techniques , the scanner returns signal intensities for each probe on the array . in the case of rna - seq data , the number of reads mapping to any given region of the genome makes up the signal . besides providing single base pair resolution , sequencing allows the maintaining of total control on which reads are included in the final analysis and hence contribute to the expression signals . the generation of reliable rna - seq data therefore relies heavily on proper mapping of sequencing reads to corresponding reference genomes or on their efficient de novo assembly . first , the computing resources required to map huge numbers of small reads within a reasonable time can be limiting . however , tremendous effort has been invested during the last couple of years to develop algorithms that allow mapping of millions of small reads using limited computing resources and time [ 2733 ] . the second challenge arises from the relatively high error rate of ngs data , meaning that non - perfect matches have to be considered when mapping reads back to a genome . this issue is particularly relevant when single nucleotide polymorphisms ( snps ) are of interest to detect allele - specific expression in rna - seq data . to distinguish sequencing errors from snps requires higher sequencing depths such that correct base calls at each position can be made , even in heterozygous samples , because each base is sequenced multiple times . analysis protocols have been developed for the detection of genetic variation at a reasonable sequencing depth and hence at affordable costs . library preparation and/or sequencing procedures can also introduce systematic biases and artefacts such as over - amplification of gc - rich regions and generation of duplicate sequences . a third challenge , which is also one of the most exciting feature of rna - seq data , is to identify reads containing post - transcriptionally modified or rearranged sequences which can not be mapped directly to the reference genome . finally , for cases when no good quality reference genome is available , direct de novo assembly of rna - seq data into contigs may be useful . once the sequencing reads have been filtered and mapped ( or assembled ) , it is possible to compute an expression score for every base in the genome and thus obtain transcriptome maps at the best possible resolution . the true resolution of this approach , however , depends on the amount of sequence coverage and therefore on the amount of sequences generated . sequence coverage can be a limiting factor , especially when large genomes are analysed , due to costs and machine time required . the use of ngs technologies for the analysis of rna has been pioneered by researchers working with small regulatory rnas , possibly because this field has benefited less from microarrays as the usual size of small rnas is too short to be captured adequately with the limited resolution provided by microarrays . sequencing of short regulatory rnas has resulted in important and exciting papers which has been extensively reviewed elsewhere [ 46 , 47 ] . , transcriptomes have been sequenced for over a dozen organisms including human [ 14 , 16 , 1820 , 4855 ] , mouse [ 17 , 23 , 5658 ] , budding yeast [ 22 , 23 , 5962 ] , fission yeast , worm , fruit fly , non - model organisms [ 66 , 67 ] , several plants [ 15 , 6871 ] and prokaryotes [ 21 , 72 , 73 ] . unlike the genome , the transcriptome dynamically changes in response to the environment or to intrinsic programmes , and many studies have reported transcriptome sequences for several cell types or physiological conditions . the countable , almost digital , nature of rna - seq data makes them particularly attractive for the quantitative analysis of transcript expression levels . nearly every rna - seq study published to date has addressed this question , and they agree that rna - seq data are highly quantitative and give reliable measurements of transcript levels in one or more conditions . the dynamic range of these data is theoretically only limited by the sequencing depth and has been reported to span at least 5 orders of magnitude . this dynamic range is well beyond the range achieved by microarrays and close to the estimated range of transcript frequencies in the cell . a few studies also looked at the ability of rna - seq to measure differential gene expression [ 51 , 57 , 61 ] . these studies agree in saying that rna - seq performs at least as well as microarrays provided an adequate sequencing depth . rna - seq has the advantage though that , besides differential transcripts levels , levels of different splice variants or of transcripts with different utr length can be assessed at the same time ( see below ) . producing enough reads for accurate quantification of lowly expressed transcripts , however , can still be quite expensive for large transcriptomes . in a variant of rna - seq , this assay permits the measurement of even lowly expressed transcripts with a limited amount of sequencing reads [ 57 , 74 ] . besides this quantitative aspect , rna - seq studies are enabling researchers to refine transcript annotation , providing for instance accurate maps of transcript start and end sites . this feature is of particular help for dense prokaryotic genomes , allowing confident discrimination between single gene transcriptional units and operons encompassing several genes . the analysis of transcript structures is also fundamental for the study of complex diseases such as cancer . genomic re - arrangements or mutations can generate aberrant fusion transcripts which , if stably expressed , can lead to pathologies . such gene fusions have been shown to be commonly associated with different types of tumours . direct sequencing of transcriptomes , coupled with analysis pipelines allowing the detection of sequence re - arrangements and abnormal transcript structures , are powerful tools which permit direct detection of such fusion events . several studies have already provided proofs of principle that this approach is suitable for discovering new aberrant transcripts [ 19 , 50 ] . another characteristic of rna - seq data is their high sensitivity , allowing the detection of the expression of substantially more transcripts in a given cell type compared to what could be detected by microarrays . rna - seq studies also contribute to an increased list of the transcripts expressed in all organisms studied , most of these newly defined transcripts being non - coding . a high coverage rna - seq study of the fission yeast ( schizosaccharomyces pombe ) transcriptome during vegetative growth revealed that over 94% of this genome is actively transcribed at some level , including genes required only under specialised physiological conditions . this finding could reflect a small percentage of cells in the population expressing a different transcriptional programme , or it could reflect a certain amount of basal background transcription . the latter would be compatible with the suggestion that as much as 90% of all rna polymerase ii ( pol ii ) initiation events represent transcriptional noise and raises the question of the biological relevance of an almost ubiquitous noisy transcription . rna - seq has also been used to dig deep into eukaryotic transcriptomes and reveal an intriguing new feature of eukaryotic transcription at promoters . cryptic unstable transcripts ( cuts ) are small rna pol ii transcripts found in the budding yeast ( saccharomyces cerevisiae ) which are targeted for degradation by the exosome complex immediately after synthesis . while the mechanisms regulating their processing have been extensively studied , the prevalence of cuts in the yeast genome has remained unknown . two studies have determined the genome - wide distributions and structures of cuts [ 78 , 79 ] , using ngs to sequence a sage library enriched for cuts or high - density tiling arrays , respectively . interestingly , cuts seem to be well - defined transcriptional units arising mostly from nucleosome - free regions ( nfrs ) . nfrs are characteristic of eukaryotic genomes and can be found mainly in the promoters and terminators of genes . a fraction of cuts are overlapping the 5 ends of genes , suggesting a potential regulatory function . however , cuts are most frequently transcribed in divergent orientation from the promoters of genes , suggesting that they could be by - products of pol ii - dependent transcription [ 78 , 79 ] . these data suggest that bidirectional transcription is a widespread characteristic of eukaryotic promoters . in budding yeast , stable transcripts arising from bidirectional transcription can also be detected , suggesting that this phenomenon is not restricted to cryptic transcripts . a possible regulatory role of bidirectional transcription remains to be determined , but some data suggest that divergent transcripts could act as transcriptional links between neighbouring genes and potentially regulate their co - expression . bidirectional transcription seems to be a conserved characteristic as it can also be detected in multicellular eukaryotes . transcripts similar to yeast cuts have been detected after inactivation of the exosome in human cells . these so - called promoter upstream transcripts ( promts ) are mostly transcribed from promoters of active genes in both directions . as in yeast , stable transcripts mapping to both strands of promoters can also be detected in metazoans [ 16 , 8284 ] . a similar class of short transcripts , 2090 nucleotides in length , has been found in mouse es cells , up- and downstream of the transcription start sites ( tss ) . interestingly , these short divergent transcripts are not enriched in terminator or intergenic regions . analysis of histone marks around these transcripts has revealed that marks associated with transcription elongation are present on the gene sequences but not in the antisense direction , suggesting that productive elongation occurs mostly downstream of the tss . in this context , it is possible that these short rnas mark regions of pol ii pausing . a similar picture could be detected in human fibroblasts where nascent rnas have been sequenced using ngs technology , providing an overview of the distribution of pol ii engaged in transcription at a given time . this study concludes that a large amount of pol ii is paused shortly after initiation . in addition , engaged pol ii has been detected in divergent direction relative to genes . however , the lack of sequencing reads further upstream indicates that divergent pol ii does not productively elongate transcripts . these findings suggest that regulation of transcript elongation participates in the control of gene expression . in summary further investigation will now be required to understand what portion of these divergent transcription events represents useless by - products of transcription initiation and what portion plays regulatory roles . post - transcriptional regulation is a fundamental part of gene expression , which may well match transcriptional control in importance and sophistication . it includes the control of alternative splicing and polyadenylation , rna editing , rna degradation and translation . with the possible exception of translational control , the sequences of the processed rna molecules can therefore differ substantially from the corresponding genome sequences . our understanding of the sequence motifs governing post - transcriptional control improves steadily but does not yet allow prediction of mrna processing events based on the genomic sequence alone . techniques allowing global characterisation of post - transcriptional sequence alterations and rearrangements are therefore required . high - density tiling arrays are only partially suited for the analysis of post - transcriptional structural changes as their probe design is unable to capture sequences that either are not encoded in the genome , as in the case of editing , or are not adjacent in the genome , as in the case of splicing . these limitations could in principle be circumvented by designing additional sets of probes for the array , but this requires high quality annotation . rna - seq , on the other hand , is particularly well suited for the study of mrna processing , as it generates transcript sequence data from a library independently of the organism s genome sequence . in case of rna splicing , for instance , where tiling arrays require the design of special sets of probes , sequencing relies only on an appropriate mapping strategy able to retrieve reads containing non - adjacent sequences ( fig . , the set of reads which does not map properly to the reference genome can successively be mapped against a reference sequence library containing all known or predicted exon trans - reads ) are diagnostic for post - transcriptional rearrangements . while quite straightforward and flexible , this approach is limited when it comes to discovering new , un - annotated splice junctions . alternatively , a reference sequence library of all possible splice junctions instead of all known splice junctions could be used for mapping . , sequencing reads are either mapped allowing gaps in the alignment or split in two before mapping both halves back separately to the reference genome . the reads , whose two halves do not map next to each other , point to a post - transcriptional rearrangement or splicing event . this approach is potentially extremely powerful as it does not rely on any genome annotation . however , it requires sufficiently long sequencing reads to be confidently mapped even if split in two . in addition to mapping the sites of post - transcriptional rearrangements , trans - reads provide a quantitative measurement of the levels of different transcript isoforms . this feature has been exploited to sample splicing efficiencies across all introns and genes under different conditions in fission yeast . ngs sequencers have been up - graded to allow sequencing both ends of each dna fragment in the library . in this case the distance between the two reads is known as it equals the fragment size of the library . this development has been critical for making it much easier , for example , to map short reads in low complexity regions . for the analysis of post - transcriptional rearrangements by rna - seq , the paired reads that map much closer or farther apart to each other than the insert size of the library can point to rearrangements . while being compatible with short reads and not relying on any prior knowledge about the regulatory motifs or genome annotation , this fourth approach does not provide direct base pair mapping of the junction . an advantage of the first three strategies described above is that the exact splice junction or rearrangement point coordinates can be identified.fig . 2detection of post - transcriptional modifications and rearrangements by rna - seq . a reads spanning exon exon junctions give positive evidence for splicing events ( trans - reads in red ) . comparing the number of trans - reads for a selected junction to the number of reads spanning its corresponding exon intron junctions ( blue ) gives a measure of splicing efficiency . b reads containing poly(a ) tracts which are not encoded in the reference genome are diagnostic of polyadenylation events . c reads containing sequence polymorphisms compared with the reference genome are potential polymorphisms or editing sites detection of post - transcriptional modifications and rearrangements by rna - seq . a reads spanning exon exon junctions give positive evidence for splicing events ( trans - reads in red ) . comparing the number of trans - reads for a selected junction to the number of reads spanning its corresponding exon b reads containing poly(a ) tracts which are not encoded in the reference genome are diagnostic of polyadenylation events . c reads containing sequence polymorphisms compared with the reference genome are potential polymorphisms or editing sites analysis of alternative splicing by rna - seq has been performed recently on several human tissues [ 48 , 49 , 56 ] and cell lines [ 48 , 55 ] . the ability to globally sample every possible splice isoform has uncovered a much larger amount of alternative splicing in human tissues than previously estimated . considering different tissues , as many as 95% of the human multi - exon genes have been found to undergo alternative splicing , with exon skipping being the most frequent form of regulation [ 48 , 49 ] . these results considerably increase previous estimates , which have suggested that about two - thirds of human genes are differentially spliced . importantly , for 92% of genes , the second most frequent isoform has a relative frequency above 15% , indicating that in most cases several isoforms of the same transcript reach substantial levels of expression . isoforms differ mostly between tissues , while between individual variations are two- to threefold less common . this finding indicates that tissue specific alternative splicing is an almost universal mode of tissue - specific gene regulation . extreme switch - like behaviours , where two isoforms are mutually exclusive in two distinct tissues , have also been detected . in these cases an interesting study has applied rna - seq to analyse the transcriptome of single mouse cells . the authors report 335 genes that display multiple isoforms in a single blastomere , indicating that alternative splicing can also increase the diversity of the transcriptome of a single cell during embryonic development . similar analyses performed in fission and budding yeasts have provided interesting insights into how simpler unicellular eukaryotes exploit alternative splicing as a mode of post - transcriptional regulation [ 59 , 63 ] . in fission yeast , intron retention seems to be the main event detected during sexual differentiation . in addition , global splicing efficiencies and transcript expression levels seem to be positively correlated during vegetative growth and sexual differentiation , suggesting coordination between transcription and splicing . a recent rna - seq study in budding yeast has uncovered many alternative isoforms showing differential expression between vegetative growth and response to heat - shock . interestingly , some of these isoforms are possibly coding for proteins of different lengths . taken together , these data show that regulation of splicing is also used by unicellular eukaryotes to control and diversify gene expression . finally , bioinformatics tools helping to extract the respective expression levels of different transcript isoforms from rna - seq data are becoming available and will help to refine the global picture of alternative splicing in eukaryotes [ 88 , 89 ] . a related mechanism by which transcript diversity can be increased is the use of alternative polyadenylation sites . rna - seq is particularly well suited to study polyadenylation as it allows direct sequencing of the junctions between poly(a ) tails and the rest of the transcript ( fig . this approach permits the disentangling of several isoforms with alternative polyadenylation sites in a single sample . for example , human cells show a strong correlation of alternative splicing and alternative polyadenylation between tissues , suggesting coordination between these two processes . interestingly , alternative introns and 3 untranslated regions ( utrs ) are sharing common regulatory motifs , suggesting that they also share regulatory factors . this process involves deamination of adenosines into inosines , which are then read as guanosines . direct sequencing of transcriptomes is the method of choice to understand how prevalent is this mode of post - transcriptional regulation ( fig . indeed , a pioneering rna - seq analysis of human brain and other tissues has revealed hundreds of new editing sites , many of which are located in non - coding rnas . rna interactions is fundamental for the understanding of regulatory networks governing the different layers of post - transcriptional control . predicting protein rna binding sites is difficult not least due to the relatively low sequence conservation of rna binding motifs . rna interactions can be mapped directly , however , using approaches similar the chromatin immunoprecipitation technique used to identify protein dna interactions . this approach is achieved in two ways : ( 1 ) rna - binding proteins are immunoprecipitated together with their intact target transcripts ( rip ) , or ( 2 ) rna - binding proteins are crosslinked to the rnas they interact with and treated with rnase before immunoprecipitation ( clip for crosslinking immunoprecipitation ) . this second approach limits the analysis to rna fragments protected by the binding protein and is reminiscent of a footprint . the immunoprecipitated rnas need eventually to be identified using either single - gene or genome - wide methods . several clip - seq ( also called hits - clip , for high - throughput sequencing clip ) studies have analysed the binding patterns of human splicing regulators in different cell types and tissues [ 9698 ] . for example , analysis of the binding patterns of the neuron - specific splicing factor nova has demonstrated that its binding to introns determines the outcome of alternative splicing while its binding to 3-utrs can regulate alternative polyadenylation . rip and clip - seq have also been used to characterise ago - rna complexes in mouse , human and fission yeast [ 99101 ] . sequencing the populations of micrornas ( mirnas ) and mrnas bound to ago proteins in the mouse brain has allowed direct identification of in vivo expressed mirnas and their potential target transcripts . rip - seq with ago has led to the discovery of a new class of small rnas in humans , originating from small nucleolar rnas ( snorna ) which can function like mirnas . ribosomes are riboprotein complexes mediating the translation of rna transcripts into proteins and are probably the most abundant rna - binding proteins in the cell . studying the amount and position of ribosomes bound to transcripts , total cellular rna is fractionated based on the amount of associated ribosomes ( polysome profiling ) . ngs technologies with their ability to detect the exact sequence of short rna molecules have now enabled a transition from genome - wide polysome profiling to genome - wide ribosome foot - printing . similarly to the clip method outlined above , this approach is based on the isolation of short rna fragments occupied by ribosomes and hence protected from degradation by an endonuclease . it permits not only the measurement of the number of ribosomes associated with different transcripts but their exact positions along the rna molecules . the ability to detect the distribution of ribosomes on transcripts at maximum resolution has revealed that the density of ribosomes is not uniform across transcripts . all transcripts contain a region of constant length at their 5ends showing a high density of ribosomes . this observation could explain the previously published phenomenon that short transcripts tend to be much more densely packed with ribosomes than large transcripts [ 103 , 104 ] . the amount of ribosomes found in introns and 3-utrs is less than 1% of the ribosome density seen in open reading frames ( orfs ) , indicating that retained introns are rarely translationally active . moreover , many small orfs ( uorfs ) are detected in the 5-utrs of genes , but their functional relevance remains elusive . the ribosome density in these uorfs is significantly higher than in other regions of the 5-utrs , indicating that pervasive translation occurs upstream of the orf . surprisingly , a substantial amount of these uorfs are using non - aug start codons , thus unexpectedly increasing the scope of peptides that can be translated from a given transcript . next - generation sequencing technologies are revolutionising genomics research and beyond by enabling the much more rapid and cost - effective generation of massive amounts of sequences compared to traditional sanger sequencing . this technological breakthrough provides an opportunity for regular research institutes and departments to engage in ambitious projects which so far have only been conceivable for large genome centers . the impact of ngs technologies for the analysis of gene regulation is particularly high . within only two years , rna - seq has reached a point where recent state - of - the - art technologies such as high - density tiling arrays look almost old fashioned . it looks likely that sequencing - based approaches will largely supersede hybridisation - based approaches within a few years . rna - seq permits the sequencing and quantifying of transcriptomes at maximal resolution and dynamic range , independently of transcript size , and above all free from any preconception ( or even knowledge ) of the genomes they are derived from . rna - seq has started to change the way we think about studying the complexity and dynamics of transcriptomes and genome regulation . early rna - seq studies have revealed more extensively expressed genomes and more complex transcriptomes than anticipated , thus giving insight into novel regulatory mechanisms . these pioneering studies have also uncovered rich and extensive post - transcriptional regulation of transcript structures and sequences . rna - seq will without doubt drive many more exciting discoveries within the next few years . for example , sequencing of rna from complex samples containing more than one organism , either collected in the wild [ 105108 ] or created in the laboratory , will ultimately provide information about transcriptome dynamics of living communities and interactions within ecosystems . on the other hand , sequencing of rna from closely related species or members of a population given sufficient sequencing depth , rna - seq analysis of cell populations adapting to changing environmental conditions could also reveal rare changes in transcript sequences that do not necessarily lead to an increase in fitness , thus helping to understand evolutionary mechanisms and dynamics . the main challenge for researchers is to creatively exploit the opportunities provided by those rapidly evolving technologies . sequencers such as the helicos system , which can sequence millions of single molecules in parallel , are entering the market and seem to be suited to analyse rna . truly , progress is limited mainly by our imagination , and exciting times are certainly ahead .

next - generation sequencing technologies are now being exploited not only to analyse static genomes , but also dynamic transcriptomes in an approach termed rna - seq . although these powerful and rapidly evolving technologies have only been available for a couple of years , they are already making substantial contributions to our understanding of genome expression and regulation . here , we briefly describe technical issues accompanying rna - seq data generation and analysis , highlighting differences to array - based approaches . we then review recent biological insight gained from applying rna - seq and related approaches to deeply sample transcriptomes in different cell types or physiological conditions . these approaches are providing fascinating information about transcriptional and post - transcriptional gene regulation , and they are also giving unique insight into the richness of transcript structures and processing on a global scale and at unprecedented resolution .

Introduction RNA-seq data generation and analysis Applying RNA-seq to probe the breadth and depth of genome transcription Applying RNA-seq to interrogate post-transcriptional gene regulation Conclusions and outlook

the prevalence of overweight and obesity is high in most parts of the world , and this is particularly alarming not only for the increasing risk of multiple comorbidities , but also due to the tendency of childhood overweight and obesity to track into adulthood . the metabolic syndrome ( mets ) , a cluster of several cardiovascular disease risk factors , is a complex entity of metabolic disorders that significantly increases the risk of type ii diabetes and cardiovascular disease beyond that of its individual components . the emergence of mets parallels the rising rates of overweight and obesity observed in youth worldwide . a variety of anthropometric indices have been used as a proxy for total and abdominal fat to assess risk for diseases , particularly cardiovascular diseases ( cvd ) and diabetes . epidemiologic studies have shown that body mass index ( bmi ) , the most widely recognised measure of obesity , is a powerful predictor of cvd . nevertheless , waist circumference ( wc ) and waist - to - height ratio ( whtr ) measures of central obesity have yielded important insight as well and also provide information on the risk of cvd . although different anthropometrical measures of obesity have been proposed , it remains unclear which measures of adiposity best predict the role of metabolic risk factors . the aim of this study was to determine the ability of different measures of adiposity , namely , bmi , wc , and whtr to discriminate between low / high metabolic risk using receiver - operating characteristic ( roc ) curves in a sample of portuguese adolescents from the azorean archipelago . data for the present study derived from a longitudinal school - based study , the azorean physical activity and health study ii , aimed to evaluate physical activity , physical fitness , overweight / obesity prevalence , health - related quality of life , and related factors . details on the study design and sampling strategy are reported elsewhere . the final sample included in this cross - sectional analysis was comprised of 517 adolescents ( 297 girls and 220 boys ) aged 15 to 18 . all participants in this study were informed about the objectives of the work , and the parent or guardian of each participant provided written informed consent . the study was approved by the faculty and the portuguese foundation for science and technology ethics committee and conducted in accordance with the declaration of helsinki for human studies of the world medical association . height was measured to the nearest millimeter in bare or stocking feet with the adolescent standing upright against a stadiometer ( holtain ltd . , weight was measured to the nearest 0.10 kg , with adolescents lightly dressed using a portable electronic weight scale ( tanita inner scan bc 532 ) . bmi was calculated as body weight ( kg ) divided by body height ( m ) . the waist and height were used to compute the whtr . to determine the pubertal stage ( ranging from stage 1 to 5 ) , each subject was asked to self - assess his / her stage of secondary sex characteristics . stages of breast development in girls and genital development in boys were evaluated according to the criteria of tanner and whitehouse . blood samples were collected from the antecubital vein between 8:00 and 10:00 a.m. , in a sitting position after ten hours of fasting . blood samples were drawn in vacuum tubes gel ( sarstedt ) in order to obtain values of plasmatic total cholesterol ( tc ) , high - density lipoprotein cholesterol ( hdl - c ) , triglycerides ( tg ) , glucose , and insulin . the following analyses were measured on a cobas integra 400 plus ( roche diagnostics , indianapolis , ind , usa ) : tc , hdl - cholesterol , tg , and glucose . the fasting serum insulin was measured on an immulite 2000 , ( diagnostic products corporation , los angeles , calif ) . the ratio of total cholesterol to hdl - c was calculated as an index of atherogenic lipid profile . the homeostatic model assessment ( homa ) , calculated as the product of basal glucose and insulin levels divided by 22.5 , was used as a proxy measure of insulin resistance . the biochemical evaluation of all participants from the different islands was conducted in the same laboratory . blood pressure ( bp ) was measured using the dynamap adult / pediatric vital signs monitors , model bp 8800 ( critikon , inc . , measurements were taken by trained nurses , and with all adolescents were required to sit and rest for at least five minutes prior to the bp test . the participants were in a seated , relaxed position with their feet resting flat on the ground . two measurements in the right arm were taken after five and ten minutes of rest . if the two measurements differed by 2 mmhg or more , a third measure was taken . since there is no consensus regarding the establishment of a universal criterion for definition of the mets in adolescents , we decided to compute a continuous metabolic risk score ( mrs ) from the following measurements : tc / hdl - c ratio , tg , homa , and systolic bp . for each of these variables , a z - score was computed by age and sex . then , an mrs was constructed by summing the z - scores of all individual risk factors . a similar z - score approach has been used previously in children and adolescents . comparisons between groups involved student t - test for continuous variables . linear regression analyses were used to study the relationship between different measures of adiposity and low and high mrs , adjusting for age and pubertal stage . receiver - operating characteristic ( roc ) curve analyses were used to analyse the potential diagnostic accuracy of the different measures of adiposity to discriminate between low and high mrs . the area under the curve ( auc ) and 95% confidence interval ( ci ) were calculated . the auc represents the ability of the test to correctly classify adolescents having a low and high mrs . the values of auc range between 1 ( perfect test ) and 0.5 ( worthless test ) . data were analyzed using the pasw statistic v.18 ( spss , chicago , ill , usa ) and med calc software v.10.4.5 ( medcalc software , mariakerke , belgium ) . girls had lower height , weight , wc , systolic bp , glucose , and tc / hdl - c levels and higher tc and hdl - c than boys ( p < 0.05 for all ) . linear regression analyses , adjusted for age and pubertal stage , showed that bmi ( girls : = 0.291 , 95% ci : 0.2190.364 , p < 0.001 ; boys : = 0.396 , 95% ci : 0.3240.468 , p < 0.001 ) , wc ( girls : = 0.086 , 95% ci : 0.0600.111 , p < 0.001 ; boys : = 0.121 , 95% ci : 0.0930.150 , p < 0.001 ) , and whtr ( girls : = 1.738 , 95% ci : 0.5552.922 , p = 0.004 ; boys : = 1.220 , 95% ci : 0.2092.648 , p = 0.09 ) were positively and significantly associated with mrs in both sexes , with exception of whtr for boys . roc curve analysis showed that all measures of adiposity performed well on average in identifying high mrs , as indicated by auc greater than 0.7 . the roc performance of bmi showed a better discriminatory accuracy than wc and whtr in predicting high mrs in both sexes . in boys , the roc performance of bmi was slightly better than in girls . the auc of bmi were significantly different from wc ( p < 0.05 ) for the whole sample . in girls , the auc of wc was significantly different from whtr ( p < 0.05 ) . a bmi of 23.7 kg / m for girls and 27.0 kg / m for boys , a wc of 83 cm for girls and 92 cm for boys , and a whtr of 0.55 for girls and 0.49 for boys were found to be optimal cutoffs for defining high mrs in this adolescent population ( table 2 ) . the main findings of this study suggested that bmi provides a marginally superior tool for discriminating high mrs compared with wc and whtr , for both sexes . slightly higher pooled auc were observed in boys compared to girls , suggesting that discrimination is more precise , on average , in male . linear regression analyses showed that all different measures of adiposity were positively and significantly associated with mrs in both sexes , with the exception of whtr for boys . showed that bmi had the best predictive power to identify metabolic syndrome , its components , and markers for low - grade inflammation , which is in agreement with our results . the bmi has been used to predict body composition and health risk , whereas wc indicates visceral adipose tissue and can predict health risks in children . both bmi and wc are simple measures to use and interpret , yet they have some limitations . the bmi does not distinguish fat mass from fat - free mass or between different body fat distributions , and for wc , there are currently no agreements about a health - related classification for children and adolescents . several previous studies considered the 90th percentile as a cut - off point for high wc , whereas other studies consider the 75th or 70th percentile as a cutoff point the whtr has been significantly associated with cardiovascular risk factors , due to abdominal obesity both in adults and children . the higher auc value for whtr than for wc could be due to the fact that whtr takes into account differences in body height . contrary to our findings , some studies have shown that whtr is better for classifying obesity related to cardiovascular risk than bmi and wc [ 5 , 20 ] . in girls , the auc value for whtr is slightly better than auc value for wc . despite the auc value for bmi was slightly higher than the other two measures in girls , the auc value for whtr showed higher sensibility than auc value for bmi . there is no agreement for which anthropometrical measures of adiposity best predict a role of unfavorable cardiovascular risk factors . studies carried out among children and adolescents in cyprus and japan concluded that both wc and whtr are better predictors of tc , tg , hdl - cholesterol , low - density lipoprotein cholesterol , and systolic and diastolic bp levels than bmi . also , the bogalusa study reported that wc and whr were related to adverse levels of tg and hdl - cholesterol , independently of race , sex , age , weight , and height . conversely , bmi is the measure of obesity most used and has been shown to be extremely effective when used in longitudinal studies . nevertheless , we were unable to draw cause - effect conclusions and to make observations over the time because of the cross - sectional nature of our data and the multifactorial etiology of high mrs . however , the association between these measures of adiposity and the clustering of metabolic risk factors has not been studied in this population , making it one of the strengths of this study . in conclusion , bmi , wc , and whtr are all predictors of high mrs . despite the small differences in the discriminatory capabilities among measures of adiposity , making it difficult to recommend the best measure of obesity , bmi seems to have the best trade - off between sensitivity and specificity to screen for high mrs in both sexes .

introduction . this study aimed to evaluate the screening performance of different measures of adiposity : body mass index ( bmi ) , waist circumference ( wc ) , and waist - to - height ratio ( whtr ) for high metabolic risk in a sample of adolescents . methods . a cross - sectional school - based study was conducted on 517 adolescents aged 1518 , from the azorean islands , portugal . we measured fasting glucose , insulin , total cholesterol ( tc ) , hdl - cholesterol , triglycerides , and systolic blood pressure . homa and tc / hdl - c ratio were calculated . for each of these variables , a z - score was computed by age and sex . a metabolic risk score ( mrs ) was constructed by summing the z - scores of all individual risk factors . high risk was considered when the individual had 1sd of this score . receiver - operating characteristics ( roc ) were used . results . linear regression analyses showed that , after adjusting for age and pubertal stage , all different measures of adiposity are positively and significantly associated with mrs in both sexes , with exception of whtr for boys . bmi , wc , and whtr performed well in detecting high mrs , indicated by areas under the curve ( auc ) , with slightly greater auc for bmi than for wc and whtr in both sexes . conclusion . all measures of adiposity were significantly associated with metabolic risk factors in a sample of portuguese adolescents .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusion

heat transfer is the transition of thermal energy or simply heat from a hotter object to a cooler object . when an object is at a different temperature than its surroundings or another object , heat transfer occurs in such a way that the body and the surroundings reach thermal equilibrium . heat transfer always occurs from a higher - temperature object to a cooler - temperature one , a result of the second law of thermodynamics . where there is a temperature difference between objects in proximity , heat transfer between them can never be stopped . . the transfer of energy could be primarily by free electron diffusion as predominant in metals or phonon vibration as predominant in insulators . in other words , heat is transferred by conduction when adjacent atoms vibrate against one another , or as electrons move from atom to atom . the mechanisms of heat conduction are different in solid , liquid , and gas conditions . the mechanisms of heat conduction in gas can be divided into two parts , macro mechanisms and micro ones . in macro mechanisms , heat conduction is produced by the collision of a large number of molecules and randomly heat movement . in micro mechanisms , when the distance between gas molecules is less than that of mean free path of gas molecules , the way of heat conduction is changed . heat conduction is widely used in many industrial fields . on account of the development of the nanotechnology , nanodevices have attracted much attention in recent years . however , with the decreasing size of nanodevices , there are many problems about thermotics and electrics in nano spacing ( ns ) , which can not be solved by macro theories . many efforts have been made toward investigating heat conduction of thin film . however , research on heat conduction of gas , especially in ns , is rarely reported . so many theories must be firstly taken into account in ambient air and then extended to other gaseous surroundings . the change of heat conduction of air in ns will be measured with heat conduction instrument . it is very important for the nanodevices to improve their life and efficiency , which may lead to a new research direction . the hot plate and cooling one were made of copper , a diameter of 13 cm and a thickness of 0.8 cm . the two plates were polished by the polishing machine to make sure surface roughness less than 0.3 nm . at first the sample was put on the cooling plate in order to ensure the bottom of the sample to closely touch the top of the cooling plate . the hot plate was simultaneously set on the sample to make sure the top of the sample to tightly contact with the bottom of the hot plate . finally the hot plate was heated . after a short time , the temperature of the hot plate ( t1 ) and cooling plate ( t2 ) obtained by measuring the voltage were hold under an equilibrium condition . the hot plate was further heated in order to make the temperature of cooling plate increase 10 c . then the hot plate was moved away and the cooling plate was cooled in air automatically . the changes of the temperature of the cooling plate were recorded by measuring the voltage in 30s interval until the temperature of the cooling plate was cooled to less than 5 c belowt1 . finally , the cooling rate and the heat conduction coefficient of the sample were calculated . schematic diagram of heat conduction instrument the key point in the experiment was to obtain the different thickness of air in ns , so the suitable spacers needed to be found . carbon nanotubes ( cnts ) were put into the spacing between the hot plate and the cooling plate and utilized to produce 2 and 15 nm thicknesses of air in ns using the 2-nm - diameter single - walled carbon nanotubes and 15-nm - diameter multi - walled carbon nanotubes , respectively . in order to make parallel to two plates , cnts were settled at three different points which size was less than 100 m on the cooling plate . the thickness of 100 pieces of papers was firstly measured to calculate the thickness of one piece of paper . according to the thickness of spacing , an appropriate numbers of papers were also set at three different points which size is less than 1 mm on the cooling plate . heat transfer has three kinds of forms , including conduction , convection , and radiation . in this experiment the equation of radiation is , wheremis the spectral radiance factor , is emissivity ( for copper , = 0.03),is stefan boltzmann constant ( 5.67 10 w k m ) , andtis the absolute temperature . so the quantity of heat through radiation in ns is 0.5 w ~ 2 w. however , the quantity of heat through heat conduction in ns is 70 w ~ 500 w. so the quantity of heat through radiation in ns can be ignored . now the experiment only considers the heat conduction . the diameter of the plate is 13 cm while the size of the cnts and papers are less than 1 mm . the interface between plates and spacer is too much smaller relative to the area of plates so that the effect of materials properties of the samples on heat conduction of air can be ignored . the spacing of air between plates is too much smaller than the diameter of the cooling plate , so the thermal diffusion effect at the side of the air layer can be ignored . the plate is 0.8-cm - thick and enough hard to ensure that the two plates are parallel each other when the sample is settled between them . this experiment is supposed that the direction of temperature - change is along the direction z. so the heat conduction equation can be written as follows:(1 ) in eq . 1q is the quantity of heat , k is heat conduction coefficient ( refers to the conducting heat ability of material ) , a is the area of heat conduction , and t is the difference in temperature of the material . take into consideration of the time,(2 ) eq . minus symbol represents the direction of heat conduction along the direction of the decreasing temperature . the quantity of heat conduction through the air during tis:(3 ) whereais the area of the hot plate in present study ( namely , the area of heat conduction ) andhis the thickness of spacer.change eq . 4 , is the quantity of heat conduction in unit time , which can be regarded as the heat conduction rate of air ( v ) . these parameters , including t , the heat conduction coefficient can be calculated if only the heat conduction rate of air is known . in this experiment , it can be supposed that temperature do not change with surroundings so that keeps stable . it is obvious that the rate of heat conduction is equal to the rate of heat diffusion . supposingranddare the semi - diameter and the thickness of the plates , respectively , the total diffusive heat area ( a1 ) can be calculated:(5 ) according to eq . 4 , when heat is conducted from the cooling plate to air , v1is proportional toa1 . if the cooling plate can diffuse heat by itself , the total diffusive heat area is equal to the surface area of the plate ( a2).(6 ) v2 is the corresponding heat conduction rate of the cooling plate . combine v1a1v2 , and a2 into a new equation:(7 ) next specific heat of the cooling plate will be discussed .(8 ) in eq . 8 m is the weight of the cooling plate , is the difference in temperature between t2 and the instantaneous temperature.change eq . all the parameters can be measured from the experiment , so the heat conduction coefficient can be calculated . in this experiment , the relationship can be written as an equationt = x v.tis temperature , xis constant , andvis voltage . substituting it into eq . 11 , replacetbyv , and then get a new equation about the heat conduction coefficient as follows,(12 ) figure 2is the relationship between the heat conduction coefficient and the thickness of air . as shown , when the thickness of air is small down to nanometer scale , the heat conduction coefficient increases with the increasing of thickness of air . when the thickness of air is big up to millimeter , the heat conduction coefficient tends to a stable value , 0.026 w k cm . the relationship between heat conduction coefficient and the thickness of air when the thickness of air is small down to nanometer scale , the change of heat conduction coefficient is unstable with the thickness resulting in a complex non - linear relationship , so it is not a good parameter for evaluating the change of heat conduction coefficient in ns.change eq . figure 3is the relationship between the rate of heat conduction in unit area and the thickness of air . effects of the rate of heat conduction in unit area on the thickness of air in present work , the thickness of air ranging from 100 nm to 1000 nm is difficult to construct . due to the systematic errors of the instrument by itself , the exactly demarcate point in 1.0 10 ~ 1.0 10 nm ( thickness of air ) has not been found . the changes of heat conduction of air in ns produced by cnts were studied by means of measuring the heat conduction with heat conduction instrument . the results show when the thickness of air is small down to nanometer scale , the thickness of air present a complex non - linear relationship with heat conduction coefficient and is unsuitable for evaluating the change of heat conduction in ns . it was found that the rate of heat conduction in unit area could be more suitable as a typical parameter . this study is supported by national natural science foundation of china no.50730008 , shanghai science and technology grant no . 0752nm015 , and national basic research program of china no .

the scale effect of heat conduction of air in nano spacing ( ns ) is very important for nanodevices to improve their life and efficiency . by constructing a special technique , the changes of heat conduction of air were studied by means of measuring the heat conduction with heat conduction instrument in ns between the hot plate and the cooling plate . carbon nanotubes were used to produce the nano spacing . the results show that when the spacing is small down to nanometer scale , heat conduction plays a prominent role in ns . it was found that the thickness of air is a non - linear parameter for demarcating the heat conduction of air in ns and the rate of heat conduction in unit area could be regard as a typical parameter for the heat conduction characterization at nanometer scale .

Introduction Experimental Results and Discussion Conclusions Acknowledgments

nerve terminals are generally considered the destination points for electrical signals , which propagate unidirectionally from the soma to nerve terminals . here , we demonstrate that small hyperpolarizations or depolarizations ( ~10 mv ) , generated under physiological conditions in rat nerve terminals , backpropagate up the axon ( ~400 800 m ) , and change the threshold for initiating action potentials and thus firing patterns . these results suggest a novel mechanism for information processing in neurons and neuronal circuits .

Supplementary Material

microbial keratitis ( mk ) , epithelial loss from the cornea with underlying stromal infiltration by white blood cells and disintegration of the stroma , occurs when one of the protective mechanisms of the ocular surface is disrupted . it is a vision - threatening condition that requires rapid and appropriate management and antibiotic treatment if vision loss is to be prevented . mk caused by pseudomonas aeruginosa is commonly associated with contact lens wear ( table 1).121 predisposing risk factors for microbial keratitis can vary with geographical location and can depend on the penetration of contact lens wear . the differences may also be associated with the incidence of single nucleotide polymorphisms ( snps ) in cytokine genes in different populations . recently , snps in the gene for interleukin ( il)-10 have been associated with severity of and predisposition to mk.22 in developing countries , trauma to the eye may be a predominant risk factor,23 whereas in developed countries , contact lens wear is often the most important risk factor.24 a study from malaysia suggested that as p. aeruginosa is also a common inhabitant of soil , water , and vegetation , it may also be the main pathogen following vegetation - related corneal injury in certain regions.15 the incidence of contact lens - related microbial keratitis has been estimated over the past 20 years , and has remained almost constant at 1/2500 contact lens wearers who wear lenses on a daily wear basis ( that is removing lenses each night and placing in disinfecting solution prior to re - wearing the lens the next day ) , or 1/500 wearers if the lenses are worn on a continuous or extended wear basis ( ie , the person wears lenses for 24 hours , sleeping in lenses overnight).25 it is now common for lens wearers to discard their lenses after 2 weeks or 1 month of wear.25 in a study from north america , it was found that the incidence of all ulcerative keratitis was 2.76 per 10,000 person - years ( 95% confidence interval [ ci ] : 2.463.09 ) but the incidence of contact lens - associated keratitis was 13.04 per 10,000 person - years ( 95% ci : 11.1315.17 ) , with an adjusted relative risk of 9.31 ( 7.4211.7 ; p < 0.001 ) compared with non - contact lens wearers.1 another study put the incidence of mk at 1.1 per 10,000 persons / year in the us24 but a different study found an incidence of 79.9 per 10,000 persons / year in nepal.23 the risk with therapeutic contact lenses is higher at approximately 52/10,000 yearly.26 a study of armed forces of the uk evacuated because of keratitis from the middle east showed an incidence of mk of 35 per 10,000 ( with 74% being associated with soft contact lens wear).27 the percentage of microbial keratitis cases caused by pseudomonas species ( most likely p. aeruginosa ) is shown in table 2 for different geographical locations.113,1518,2844 whilst p. aeruginosa / pseudomonas sp . are usually a predominant causative agent , temperate zones tend to have a higher incidence of gram - positive bacteria causing the disease and less aggressive keratitis.44 in most studies , pseudomonas sp . are usually isolated in monoculture from cases of mk , however , a study from thailand demonstrated that in 46% of mk cases caused by pseudomonas sp . other gram - negative bacteria including escherichia coli , acinetobacter calcoaceticus , klebsiella pneumoniae , serratia marcescens , and enterobacter sp . could also be cultured.16 however , the predominance of p. aeruginosa during contact lens - associated mk is not always seen . for example , even though 29.4% of mk cases were associated with contact lens wear in a study from wellington , new zealand , no cultures of p. aeruginosa were reported.19 the predominant gram - negative bacteria isolated was moraxella sp . ( 12.5% of all bacterial isolates),19 and this predominance of moraxella sp . from mk scrapes has been reported from a study in christchurch , new zealand.45 climate may also affect the incidence of p. aeruginosa keratitis . in australia , the incidence of p. aeruginosa contact lens microbial keratitis ( clmk ) is increased in tropical compared to temperate zones , whereas the incidence of serratia marcescens clmk is higher in temperate zones.44 determinants of the clinical outcome of mk include distance of the ulcer from the limbus and the minimum inhibitory concentration ( mic ) of the first antimicrobial used or lowest mic if combination therapy was used.5 a large multicenter clinical trial with participants from india and the us has shown that p. aeruginosa ulcers were significantly worse for visual acuity than patients with other bacterial ulcers , but interestingly showed significantly more improvement in 3-month best - spectacle - corrected visual acuity than those with other bacterial ulcers.46 pseudomonas sp . are often associated with the largest ulcers.5 ideally , every case of presumed mk should be scraped for microbiological investigations , especially with the possibility of increasing isolation of antibiotic - resistant microbes . however , it must be borne in mind that there is often a small ulcer and so relatively little material might be obtained . corneal scrapings obtained with a surgical blade ( eg , bard - parker blade # 15 ) , kimura spatula , or 21-gauge disposable needle should be inoculated on chocolate agar , sheep blood agar , and into thioglycolate broth , and incubated at 35c . sabouraud s agar plates should also be used and these are maintained at 25c to enhance fungal growth . samples may also be inoculated onto non - nutrient agar and into brain heart infusion broth . scraping of small lesions ( smaller than 2.0 mm ) is probably not worthwhile , and patients with such lesions can be empirically treated . scrapes should not only be sent for microbial culture , but also smeared onto microscope slides and examined by gram stain ( and potassium hydroxide if fungal keratitis is suspected ) . however , as there is often only a small amount of material , cultures on agar plates for bacteria and fungi , as well as gram stain , are most often used . the following clinical parameters are useful in monitoring the clinical response to antibiotic therapy : blunting of the perimeter of the stromal infiltrate , decreased density of the stromal infiltrate , reduction of stromal edema and endothelial inflammatory plaque , reduction in anterior chamber inflammation , re - epithelialization , and cessation of corneal thinning . therapies used in different geographical locations are shown in table 3.4,5,8,9,12,16,31,39,42,4749 monotherapy with ciprofloxacin ( 0.3% ; or another fluoroquinolone ) is commonly used . in severe cases , subconjunctival injections of gentamicin may be used.31 the combination of two fortified antibiotic preparations , 1.5% gentamicin and 5% cefuroxime , covers almost the entire range of common bacterial pathogens causing corneal ulcers . randomized controlled trials have demonstrated that monotherapy with fluoroquinolones has non - inferiority and fewer side effects compared with combination therapy.50,51 a study from iran recommended the concurrent use of ceftazidime and amikacin or ceftazidime and ciprofloxacin as the initial treatment based on antibiotic sensitivities of isolates , and as all p. aeruginosa isolates were resistant to chloramphenicol , trimethoprim , vancomycin , and cefazolin , these antibiotics should probably not be included in any empirical antibiotic regimen in that country.47 data from taiwan41 demonstrate that ciprofloxacin was statistically significantly more effective against p. aeruginosa than the combination of cefazolin and gentamicin . whilst therapy is most often , if not always , commenced prior to results of cultures being obtained , a study from japan has shown that the therapeutic outcome was better when antimicrobial agents were selected based on culture results , thus reemphasizing the importance of culture studies.18 sometimes a combination of piperacillin / tazobactam might be effective with unresponsive p. aeruginosa mk.52 the use of steroids in conjunction with antibiotics has been a source of controversy for many years , despite the demonstration in an animal trial that the combination of tobramycin and dexamethasone was safe and resulted in the reduction of clinical scores and lower bacterial numbers in the cornea.53 however , a recent large scale multicenter clinical trial that enrolled subjects in india and us found that the use of moxifloxacin combined with prednisolone phosphate did not improve overall clinical outcome.46 sensitivity of pseudomonas sp . to antibiotics by geographical region is shown in table 4.2,7,8,16,20,21,2831,35,37,4042,47,54 generally p. aeruginosa is sensitive to fluoroquinolones , but there have been reports of multi - resistant p. aeruginosa strains , for example , from australia where the strains were resistant to ciprofloxacin , gentamicin , tobramycin , and amikacin but was sensitive to ceftazidime , imipenem , meropenem , and timentin.55 recent data examining possible synergistic activity between different classes of antibiotics against p. aeruginosa has shown that a combination of meropenem / ciprofloxacin gave the lowest mean fractional inhibitory concentrations ( ie , best synergy ) for p. aeruginosa isolates , with 90% of isolates showing an additive or synergistic effect56 and so this may be a promising therapy for the more resistant strains . comparisons between tables 3 and 4 demonstrate that ciprofloxacin is the most commonly prescribed antibiotic to treat mk in iraq , however only 62% of pseudomonas sp . likewise for india , tobramycin is one of the most commonly prescribed antibiotics but only 30% of pseudomonas sp . this is different from all other most commonly prescribed treatments in other geographical locations which are > 95% effective . whilst there are no true cut - off points for sensitivity or resistance for topically applied antibiotics , it is perhaps important for those countries where there are high levels of apparently resistant strains of p. aeruginosa to monitor the clinical outcome of mk very carefully . in conclusion , pseudomonas sp . ( predominantly p. aeruginosa ) is often isolated from cases of contact lens - induced microbial keratitis . the most commonly used therapies to treat this disease are either monotherapy with a fluoroquinolone or fortified aminoglycosides . strains of p. aeruginosa isolated from contact lens - induced mk are commonly still sensitive to these antibiotics , but geographic differences in sensitivity exist and should be taken into account when recommending treatment options .

pubmed and medline were searched for articles referring to pseudomonas keratitis between the years 2007 and 2012 to obtain an overview of the current state of this disease . keyword searches used the terms pseudomonas + keratitis limit to 20072012 , and [ ulcerative or microbial ] + keratitis + contact lenses limit to 20072012 . these articles were then reviewed for information on the percentage of microbial keratitis cases associated with contact lens wear , the frequency of pseudomonas sp . as a causative agent of microbial keratitis around the world , the most common therapies to treat pseudomonas keratitis , and the sensitivity of isolates of pseudomonas to commonly prescribed antibiotics . the percentage of microbial keratitis associated with contact lens wear ranged from 0% in a study from nepal to 54.5% from japan . these differences may be due in part to different frequencies of contact lens wear . the frequency of pseudomonas sp . as a causative agent of keratitis ranged from 1% in japan to over 50% in studies from india , malaysia , and thailand . the most commonly reported agents used to treat pseudomonas keratitis were either aminoglycoside ( usually gentamicin ) fortified with a cephalosporin , or monotherapy with a fluoroquinolone ( usually ciprofloxacin ) . in most geographical areas , most strains of pseudomonas sp . ( 95% ) were sensitive to ciprofloxacin , but reports from india , nigeria , and thailand reported sensitivity to this antibiotic and similar fluoroquinolones of between 76% and 90% .

Introduction

obesity is associated with increased morbidity and mortality from cardiovascular disease , type 2 diabetes , and fatty liver disease , all of which have been clearly linked to a chronic , low - grade inflammatory status . multiorgan involvement of obesity - induced inflammation ( liver and adipose tissue ) , sex differences in obesity and obesity - related conditions ( including pre- versus postmenopausal status ) , and dynamic interactions between immune and metabolic responses ( termed metaflammation ) are all considered important determinants of metabolic disease in obesity . the complement system is recognized as a key immune regulatory system for cell and tissue homeostasis . one major source of circulating complement proteins , such as c3 , is the liver , although adipose tissue and macrophages also secrete c3 . the liver is constantly exposed to complement - activating pathogens via the portal venous system . proximal and distal activation of complement c3 leads to production of anaphylatoxins c3a and c5a , respectively , which have multiple immune functions including stimulation of histamine secretion and oxidative burst and chemotactic activity as well as secretion of various cytokines ( reviewed in ) . in recent years , c3a and c5a have also been found to have multiple metabolic functions in tissue homeostasis [ 810 ] and tissue regeneration as well as brain development . in circulation , c5a and c3a are rapidly cleaved by carboxypeptidases to generate c5adesarg and c3adesarg , respectively . c3adesarg , also known as acylation stimulating protein ( asp ) , is a lipogenic hormone , involved in lipid storage and energy homeostasis ( reviewed in ) . asp stimulates free fatty acid incorporation into adipose tissue by increasing triglyceride synthesis and glucose uptake and reducing triglyceride lipolysis in adipocytes . these complement components bind to a family of three receptors , which belong to the superfamily of g - protein - coupled receptors : the c3a receptor ( c3ar ) , c5a receptor ( c5ar ) , and c5a receptor - like 2 ( c5l2 ) . all three receptors ( c3ar , c5ar , and c5l2 ) have demonstrated roles in the immune process with more recent data in knockout ( ko ) mice demonstrating emerging roles in energy metabolism [ 8 , 10 , 13 , 14 ] . c3ar , which binds c3a , has demonstrated roles in asthma , sepsis , and liver regeneration as well as neuron maturation . further , based on studies in c3ar knockout mice , c3ar plays a role in insulin resistance and adipose tissue macrophage infiltration . c5ar , which binds c5a and , to a lesser extent , c5adesarg , is involved in many inflammatory diseases including asthma , sepsis , rheumatoid arthritis , and inflammatory bowel diseases as well as cancer and liver diseases . one previous study showed that c5a stimulates food intake after central administration , while a very recent study in c5ar knockout mice demonstrated decreased body weight and fat storage regardless of diet ( low fat chow or diet - induced obesity regimen ) . c5l2 binds c5a as well as c5adesarg , the latter with a higher affinity than to c5ar . c5l2 has been postulated to be both a nonsignaling decoy receptor for c5a [ 17 , 18 ] as well as a signaling receptor . in previous studies , we have demonstrated a role for c5l2 in asp function [ 20 , 21 ] , with binding of asp / c3adesarg and c3a to c5l2 [ 16 , 20 ] , downstream signaling activation [ 19 , 22 ] , and functional output ( such as increased glucose uptake and tg synthesis ) [ 23 , 24 ] ; however , the binding of asp / c3adesarg to c5l2 remains controversial . recent studies have demonstrated formation of c5l2/c5ar homo- and heterodimers , with colocalization upon stimulation with either asp / c3adesarg or c5a , as confirmed recently . sex steroids are an additional factor impacting body fat distribution patterns , circulating lipids , and prevalence of metabolic diseases . recent studies have shown that 17-estradiol may play a role in reducing the inflammatory response in adipose tissue as well as the cardiovascular and neural systems [ 2830 ] . further , various cell studies have indicated that sex hormones may play a role in the regulation of c3 , c5ar [ 32 , 33 ] , and the c5l2/asp response . in relation to liver function specifically , a recent study in humans indicated that plasma c3a was associated with liver steatosis and hepatocellular injury in individuals consuming considerable amounts of alcohol daily as well as in severely obese people . c3ko mice and c5l2ko mice on a high - fat diet are prone to develop enhanced hepatic steatosis as a result of increased hepatic triglyceride content , lipogenesis - related gene expression and hepatic glucose uptake , and reduced fatty acid oxidation [ 8 , 24 , 36 ] . a role for c5l2 and asp in liver regeneration in mice has also been suggested , as administration of asp in c3ko mice restores adequate liver regeneration , an effect absent in c5l2 knockout mice . together , these findings suggest a protective role for c3/c3 peptides and c5l2 against the development of hepatic steatosis . based on this , we hypothesized that hepatic expression of c3 , c3ar , c5ar , and c5l2 in humans would be associated with hormonal status and specific metabolic profiles in severely obese pre- and postmenopausal women . further , we hypothesized that specific liver expression patterns might predict improvement in postoperative metabolic profile and liver enzymes of subjects over one year following biliopancreatic diversion surgery to induce weight loss . the experimental protocol was approved by the university hospital ethics committee ( criucpq : centre de recherche de l'institut universitaire de cardiologie et pneumologie du qubec ) and all participants provided written informed consent for participation in medical research . samples were selected from the criucpq tissue bank ( http://www.criucpq.ulaval.ca/index.php/en/tissue-bank ) among severely obese women who had undergone bariatric surgery with biliopancreatic diversion ( bpd ) based on the following criteria : surgery within a 3-year period ( 20072010 ) , no ovariectomy , no lipid lowering medication , no diabetes , and liver biopsy and blood sample availability . of the 252 pre- and postmenopausal severely obese women identified , estradiol was measured ( see below ) and 91 subjects were chosen based on their plasma estradiol levels , < 25th percentile ( n = 46 ) and > 75th percentile ( n = 45 ) of the cohort tested . fasting blood samples were collected prior to the surgery and at 3 , 6 , and 12 months postoperatively . the experimental protocol was approved by the ethics committee of the criucpq and all participants provided written informed consent for participation in medical research . patient selection criteria for bariatric surgery included body mass index ( bmi ) , the presence of comorbidities , and a history of prior weight loss attempts . clinical assessment . anthropometric measurements ( height , weight , waist circumference , and hip circumference ) were measured the day before surgery . height , circumferences , and body weight of subjects were measured on a scale with 0.5 cm and 0.5 kg increments , respectively , and bmi ( kg / m ) was calculated . blood samples were obtained from participants after overnight fasting and collected into edta - containing tubes . the hospital clinical biochemistry laboratory measured fasting plasma glucose ( glu ) , triglyceride ( tg ) , total cholesterol ( tc ) , low density lipoprotein cholesterol ( ldl - c ) , high density lipoprotein cholesterol ( hdl - c ) , apolipoprotein b ( apo b ) , apolipoprotein a1 ( apo a1 ) , and liver enzymes aspartate transaminase ( ast ) , alanine transaminase ( alt ) , alkaline phosphatase ( alp ) , and gamma glutamyl transpeptidase ( ggt ) . the following assays were measured directly in the research laboratory : estrone ( e1 ) and estradiol ( e2 ) ( both ria , beckman coulter canada lp , mississauga , on ) , adiponectin ( ria , millipore , billerica . ma , usa ) , and sex hormone binding globulin ( shbg ) ( elisa , alpco , salem , nh , usa ) following instructions of the manufacturers . asp concentration was measured using an in - house sandwich elisa , following previously published methodology . weight , fasting tg , hdl - c , ldl - c , glu , and liver enzymes ( alt , ast , alp , and ggt ) were measured at 3 , 6 , and 12 months after surgery as described above . biopsies . liver biopsies were performed according to standard criucpq tissue bank procedures and approved by the ethics committee of the criucpq . the liver biopsies were washed with sterile kreb - ringer - hepes buffer , placed in liquid nitrogen , and then immediately transported and stored at 80c . all samples ( maximum 40 mg liver tissue ) were homogenized in qiazole ( qiagen inc , mississauga , on , canada ) . total rna was extracted from homogenates using the rneasy plus universal mini kit ( qiagen inc . ) according to the manufacturer 's instructions . from the total amount , 0.1 g of purified rna was retrotranscribed to cdna using a quantitec reverse transcription kit ( qiagen inc . ) with a final volume of 20 ul . genomic dna contamination was eliminated by dnase treatment included in quantitec reverse transcription kit . for real - time pcr evaluation of gene expression , rt2 sybr green qpcr master mix ( qiagen inc . ) was used and a 3-step pcr was performed using cfx96 real - time pcr detection system ( bio - rad laboratories , mississauga , on , canada ) , using the following protocol : an initial denaturation step at 95c for 10 minutes , 40 cycles of 95c for 10 s , 55c for 10 s , and 72c for 30 s were followed by a final extension step of 95c for 10 s and melt curve 65c to 95c . real - time rt - pcr was performed to quantify human c3 , c3ar , c5ar , and c5l2 relative to glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) as a housekeeping gene , with primers obtained from alpha - dna ( montreal , canada ) . the sequences for the primers used were c5l2/gpr77-right ; 5-tccgagaggtcgctgtaatc-3 , c5l2/gpr77-left ; 5-tcaaggactcccaaaaccag-3 , c3ar1-right ; 5-agcagagaaagacgccattg-3 , c3ar1-left ; 5-actgtggctaagtgtgggga-3 , c5r1-right ; 5-tatccacaggggtgttgagg-3 , c5r1-left ; 5-gcccaggagaccagaacat-3 , c3-right ; 5-gcaatgatgtcctcatccag-3 , c3-left ; 5-cctggactgctgcaactaca-3 , and gapd - right ; 5-aatgaaggggtcattgatgg-3 , gapd - left ; 5-aaggtgaaggtcggagtcaa-3. for data analysis the ct method was used , as performed with bio - rad cfx manager software ( version 1.5 ) ( bio - rad laboratories ) . statistics . statistical analysis was performed using graphpad prism 5 ( graphpad software , ca , usa ) or sigmastat 3.5 ( systat software , san jose , ca , usa ) . descriptive parameters are provided as mean sem or in percentages . for nonnormally distributed parameters , two - tailed t - tests were used to analyze the differences between means and proportions of two groups . two - way anova analyses were used to compare among groups ( as indicated ) . stepwise forward multiple regression analysis was used to assess how gene expression predicts variables of the metabolic profile . baseline patient characteristics of the 91 severely obese women ranging in bmi ( 37.5 bmi 78.9 kg / m ) and age ( 2169 years ) are given in table 1 . the subjects were grouped , based on fasting estradiol ( e2 ) , into pre- and postmenopausal status groups as shown in table 1 . biochemical analysis indicated that subjects in the high e2 subgroup ( p < 0.0001 ) also had higher levels of estrone ( e1 ) ( p < 0.0001 ) and progesterone ( p < 0.05 ) and were younger ( p < the high e2 group also had lower apo b levels ( p < 0.0001 ) , higher apo a1 ( p = 0.025 ) , and higher apoa1/b ratio ( p < 0.0001 ) , despite having significantly higher waist circumference ( p < 0.05 ) and lower hdl - c ( p < 0.05 ) . hepatic gene expression of c3 and the three related receptors ( c5l2 , c3ar , and c5ar ) in pre- versus postmenopausal groups are shown in figure 1(a ) . while expression levels of c3 , c3ar and c5ar were not different between the two groups , c5l2 gene expression was higher in premenopausal status women ( higher e2 ) ( p < 0.01 ) . further , c5l2 gene expression also correlated directly with plasma e2 and e1 levels ( e2 r = 0.27 , p < 0.05 ; e1 r = 0.42 , p < 0.0001 ) as shown in figures 1(b ) and 1(c ) , while c3 correlated inversely with shbg ( r = 0.28 , p < 0.01 , data not shown ) . hepatic complement gene expression and metabolic profile . the relationships between hepatic gene expression and various anthropometric parameters and metabolic profile were then evaluated . hepatic c3 expression correlated inversely with the liver enzyme ggt ( r = 0.28 , p < 0.05 , data not shown ) . c3ar was associated with adiponectin ( figure 2(a ) , r = 0.36 , p < 0.05 ) while c5ar correlated with bmi ( figure 2(b ) , r = 0.34 , p < 0.01 ) and liver enzyme ast ( r = 0.32 , p < 0.05 , data not shown ) . hepatic gene expression of c5l2 correlated with apoa1 ( figure 2(c ) , r = 0.25 , p < 0.05 ) , apoa1/b ( r = 0.25 , p < 0.05 , data not shown ) , and waist circumference ( r = 0.25 , p < 0.05 , data not shown ) , with inverse correlations between c5l2 and apob ( figure 2(d ) , r = 0.25 , p < 0.05 ) , age ( r = 0.26 , p < 0.05 , data not shown ) , and ldl - c ( r = 0.23 , p < 0.05 , data not shown ) . forward stepwise regression analyses indicated that the dependent variable c5ar could be predicted from a linear combination of the independent variables age , bmi , and glucose ( pooled r = 0.20 , p < 0.001 ) and the dependent variable c5l2 could be best predicted from a linear combination of independent variables ldl - c and e1 ( pooled r = 0.24 p < 0.001 ) . c5l2/c5ar ratio and metabolic parameters . as recent in vitro experimental evidence indicates a direct interaction ( heterodimerization ) between c5ar and c5l2 receptors [ 26 , 39 ] which could affect subsequent cellular signaling and response , we tested associations of the c5l2/c5ar mrna ratio with various metabolic indices in our subjects . while plasma asp levels were significantly lower in premenopausal women versus postmenopausal women ( p < 0.01 ) , the hepatic c5l2/c5ar mrna ratio was higher ( figure 3(a ) , p < 0.001 ) . further , positive correlations between c5l2/c5ar mrna ratio and sex hormones were identified ( e1 : r = 0.28 , p < 0.01 and e2 : r = 0.38 , p < 0.001 , data not shown ) . interestingly , the hepatic c5l2/c5ar mrna ratio was inversely associated with circulating liver enzymes ( alt , ast , and ggt ) and apob ( figures 3(b)3(e ) ) , as well as age ( r = 0.29 , p < 0.01 , data not shown ) . because of significant correlations between the c5l2/c5ar mrna ratio and preoperative liver enzymes and metabolic parameters , subjects were partitioned based on high versus low c5l2/c5ar mrna ratio . before bariatric surgery , alt , ast , and ggt but not alp were significantly higher in the low - c5l2/c5ar group , with a lower apoa1/b ratio , although there was no significant difference in bmi between these two groups ( figure 3(f ) ) . relationship of c5l2/c5ar ratio with bariatric surgery outcome . metabolic profile and anthropometric results were evaluated postoperatively and compared to baseline data . as expected , the anthropometric and metabolic profile of subjects substantially improved over a 12-month follow - up after bariatric surgery . hepatic c5l2 mrna expression was positively associated with % weight loss ( figure 4(a ) , r = 0.22 , p < 0.05 ) . following bariatric surgery , subjects were routinely followed in the surgical clinic at 3 , 6 , and 12 months . globally , over the 12-month period , all liver enzyme levels in the low c5l2/c5ar mrna ratio group remained higher than in the high c5l2/c5ar mrna ratio group ( figures 5(a)5(d ) , alp p < 0.05 , alt p < 0.05 , ast p < 0.001 and ggt p = 0.0002 by 2-way anova ) , although there was no significant difference in bmi reduction curves ( data not shown ) . one - year changes in bmi , ldl - c , hdl - c , total cholesterol , glucose , and triglyceride are shown in figure 4(b ) . although the expected improvements in all parameters were not significantly different between the two groups , the relative change in tg was significantly different between the low and high c5l2/c5ar mrna groups ( fisher exact test , p = 0.02 ) . in this study we investigated liver tissue mrna expression of complement c3 and its cleavage product receptors , c3ar , c5ar , and c5l2 and their relationship with hormonal status among severely obese women who underwent bpd . in addition , we assessed the subjects ' metabolic profile before and up to one year after surgery in relation to partitioning between high and low liver c5l2/c5ar mrna ratio . the major findings of this study are ( 1 ) associations of hepatic complement - related gene expression in severely obese women with sex hormones and metabolic profile and ( 2 ) associations of hepatic c5l2/c5ar ratio with pre- and postoperative metabolic profile . although many studies have examined the role of complement c3 , and to a lesser extent , the role of related receptors c5l2 , c5ar , and c3ar , overall the major focus of these studies has been in an immune context . more recently , however , the impact of c5l2 , c5ar , and c3ar in the area of energy ( lipid and glucose ) metabolism has been recognized as a result of studies in gene knockout mice [ 810 , 14 ] . however , there is little information available on gender and sex hormone influence on complement - related receptors and their potential roles in liver function . in the present study , the positive correlation of hepatic c5l2 ( and c5l2/c5ar ratio ) with circulating estrogens ( e1 , e2 ) and the decrease in expression in postmenopausal vivo animal studies support the notion that estrogens increase adipose c3 expression and neural c5ar expression but have differential effects on c5l2 depending on estrogen receptor targeting ( er and ) in different tissues . it is now well recognized that most tissues in both men and women are influenced by estrogens , and the liver is particularly sensitive , including effects on lipid metabolism . estrogen withdrawal results in increased hepatic lipogenesis , decreased vldl lipoprotein production and secretion , and decreased lipid oxidation with associated gene expression changes [ 41 , 42 ] . in the present study , given the correlations between c5l2 and various lipid parameters , including apoa1 and apob , estrogens may mediate the effects either directly or indirectly via hepatic lipid changes . the increased plasma asp levels commonly seen in metabolic dysfunction ( including type 2 diabetes and cardiovascular diseases ) have been proposed as indicating an asp resistant state a recent study demonstrated that diet - induced obesity in mice results in increased plasma asp , decreased adipose c5l2 expression , and decreased in vivo asp response , providing proof - of - concept of asp resistance . the lower hepatic c5l2/c5ar mrna ratio with yet higher asp plasma level in postmenopausal obese women suggests the presence of asp resistance in hepatic cells . pathologically , if the asp / c5l2 signaling is disturbed in adipose tissue , as in the case of decreased expression of the asp receptor ( a decrease in asp function ) , this may enhance diversion of available glucose and fatty acids to other tissues ( muscle , liver , and arterial wall ) , leading to lipotoxicity , unless disposal mechanisms are upregulated such as increased fatty acid oxidation . this consequence was demonstrated in c5l2ko mice where it was shown that , in response to reduced tg storage in white adipose tissue , c5l2ko mice developed a compensatory mechanism of increased muscle fat oxidation . we speculate that the presence of asp resistance in postmenopausal women may contribute to their metabolic dysfunction . the c5l2/c5ar mrna ratio was also informative in predicting postoperative outcomes : higher values of this ratio were associated with greater relative weight loss , greater decreases in fasting tg , and lower liver enzymes both before surgery and over the follow - up . in the preoperative state , increased c5l2/c5ar mrna ratio was associated with lower bmi , apob , and liver enzymes , and yet higher apoa1 . overall , these data suggests that a high hepatic c5l2/c5ar mrna ratio is a beneficial feature and raises the question of what the specific functional roles of c5l2 and c5ar are in relation to lipid metabolism in the liver . while there is little data on the function of complement - related receptors directly in liver cells ( either parenchymal hepatocytes or nonparenchymal cells ) , the complement system may contribute in either a beneficial or detrimental manner . in cells , c3 production in hepatocytes is stimulated by ppar , tnf , il-6 , and lps [ 46 , 47 ] while c5a , via interaction with hepatic c5ar , is involved in proliferation , glycogen phosphorylase , and glucose output [ 4850 ] . in vivo , the complement system can both promote inflammation / injury and play a homeostatic role in repairing damaged tissue . while c3 , c3ar , c5ar , and c5l2 blockade / deficiency can protect from liver failure and improve sepsis survival in mice [ 51 , 52 ] , by contrast , the presence of these same proteins , as well as the c3 products asp and c3a , plays roles in promoting liver regeneration , liver transplant tolerance , and protection from steatosis [ 9 , 37 , 53 , 54 ] . in relation to metabolic effects , an obesogenic diet induces increased liver expression of c3 , c5ar , and c5l2 [ 8 , 14 , 55 ] , while c3ko , c5arko , c5l2ko , and c3arko mice are resistant to diet - induced obesity [ 8 , 9 , 23 , 24 , 56 ] . finally , c3 and asp / c3a have been implicated in human studies of fatty liver disease [ 57 , 58 ] . how the balance between the various ligands ( c3a , asp , and c5a / c5adesarg ) and their receptors ( c3ar , c5l2 , and c5ar ) could influence overall hepatic function remains to be elucidated . recent studies suggest that the ability of several ligands binding to the same receptor to evoke differential signaling and biological responses constitutes a phenomenon referred to as biased agonism . depending on the local environment and the circumstances under which complement proteins are generated , they may contribute to cell and tissue homeostasis , to benefit or burden inflammation , or to promote tissue regeneration versus fibrosis . for example , while in mid - grade sepsis , blockage ( or gene absence ) of either c5ar or c5l2 improved survival , in high - grade sepsis combined blockage of these two receptors was necessary . further , asp demonstrated a biphasic role with a balance between inflammation / injury versus regeneration . while c3ar neither homodimerizes nor heterodimerizes , by contrast , c5ar and c5l2 both homo- and heterodimerize [ 26 , 60 ] . the potential for cooperative interaction between c5l2 and c5ar has been evaluated in in vivo and in vitro studies . c5l2 acts as a positive modulator for both c5a- and c3a - induced responses in neutrophils , macrophages , and fibroblasts and is critical for optimal signaling . conversely , another study on human neutrophils demonstrated that c5l2 functions as an intracellular receptor , becoming colocalized with c5ar after c5a binding , acting as a negative modulator through the beta - arrestin pathway . further , a recent study demonstrated formation of c5l2/c5ar heterodimers in adipocytes and macrophages , with cointernalization / colocalization upon stimulation with either asp / c3adesarg or c5a . such dimerization may be one mechanism underlying the potential positive / negative modulatory effect of c5l2 on c5a or asp / c3a effector functions . limitations of this study should be noted : all of the interpretations and conclusions are based on the evaluation of obese subjects , and all analyses were in women . in addition , based on the limited availability of small quantities of frozen tissue from liver biopsies , the present study relied on c5ar and c5l2 mrna expression without addressing the possible posttranslational modifications , protein levels , or functional assays of the examined receptors . further , as this is a cross - sectional study , the potential links between cause and effect can only be speculated upon . in this study , evidence is presented to integrate data suggesting that complement - related proteins correlate with sex hormones and metabolic profile in liver tissue . c5l2-c5ar interactions and the association with other mediators , such as estrogens , may have a role in metabolic and inflammatory functions of complement - related proteins in human liver cells .

objective . obesity is associated with metabolic dysfunction with sex differences and chronic , low - grade inflammation . we proposed that hepatic expression of immune complement c3 related receptors ( c3ar , c5ar , and c5l2 ) would be associated with pre- or postmenopausal status and metabolic profile in severely obese women . we hypothesized that c5l2/c5ar ratio , potentially influencing the asp / c5l2 metabolic versus c5a / c5ar immune response , would predict metabolic profiles after weight loss surgery . materials and methods . fasting plasma ( hormone , lipid , and enzyme analysis ) and liver biopsies ( rt - pcr gene expression ) were obtained from 91 women during surgery . results . hepatic c5l2 mrna expression was elevated in pre- versus postmenopausal women ( p < 0.01 ) and correlated positively with circulating estradiol , estrone , apob , apoa1 , apoa1/b , waist circumference , age , and ldl - c ( all p < 0.05 ) . while plasma asp was lower in pre- versus postmenopausal women ( p < 0.01 ) , the hepatic c5l2/c5ar mrna ratio was increased ( p < 0.001 ) and correlated positively with estrone ( p < 0.01 ) and estradiol ( p < 0.001 ) and negatively with circulating apob and liver enzymes alt , ast , and ggt ( all p < 0.05 ) . over 12 months postoperatively , liver enzymes in low c5l2/c5ar mrna ratio group remained higher ( alp and alt , p < 0.05 , ast and ggt , p < 0.001 2-way - anova ) . conclusion . c5l2-c5ar association with other mediators including estrogens may contribute to hepatic metabolic and inflammatory function .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

peripheral neuropathy is a common , but a debilitating adverse effect of several classes of chemotherapeutic agents including vinca alkaloids , taxanes , and antitubulins . the incidence of chemotherapy - induced peripheral neuropathy ( cipn ) can vary from 3% to 7% with a single agent and rise up to 38% in patients who are on combination therapy . the severity of neuropathy depends on the dose of the chemotherapeutic agent , duration of exposure , cumulative dose , concurrent use of other agents , and coexisting disease such as diabetes , vitamin b12 deficiency , or alcoholism . cipn pain is not only debilitating , but also may be the reason for stopping a lifesaving curative chemotherapy . dysregulation in the calcium homeostasis in the dorsal nerve root ganglion and dorsal spinal cord has been implicated in the causation of neuropathic pain . neuromodulators such as gabapentin and pregabalin inhibit the 2- subunit of the calcium channel in the neuronal cells thus reducing the neuropathic pain . between the two , a 17-year - old boy diagnosed with early precursor t - cell , all and no other medical comorbidities completed his induction phase with vincristine , cytarabine , and cyclophosphamide in july 2015 . in the beginning of august 2015 , he was started on consolidation phase of chemotherapy with vincristine , daunorubicin , polyethylene glycol daunorubicin asparaginase , and prednisolone . midway through the consolidation ( after 2 cycles ) phase , he developed tingling sensation in the plantar aspect and toes of his feet , which progressed to pins and needles sensation in 1 week . the pediatric oncology team abandoned his chemotherapy due to intolerable pain and admitted him for debilitating neuropathy . they started him on ultracet ( tramadol 37.5 mg + paracetamol 325 mg ) 4 times a day for pain . the patient spent most time in bed and used a wheel chair to go to the toilet . on examination , he had developed grade iii neuropathy ( cancer therapy evaluation program , common terminology criteria for adverse events , version 3.0 ) . he was started on tablet pregabalin 75 mg at night and escalated his dose every 3 day by 75 mg until pain was controlled . the boy had good pain control ( edmonton symptom assessment scale - 1/10 ) on day 15 with no side effects . he was able to walk to the bathroom without support and do his routine activities without any discomfort . a 40-year - old lady who was diagnosed with primary peritoneal serous carcinoma and no other medical comorbidities was administered paclitaxel and carboplatin . while she was on chemotherapy , she developed mild burning sensation in the plantar aspects of forefoot and toes bilaterally . the pain was aggravated by walking , standing , and local application of pressure on the forefoot and toes . , she was found to have grade iii peripheral neuropathy ( nci - ctc version 3.0 ) . she was started on tablet pregabalin 75 mg at night , and the dose of pregabalin was increased by 75 mg every 3 days until resolution of pain . the patient responded to a dose of 375 mg of pregabalin without any of the known side effects of pregabalin ( including drowsiness or giddiness ) . her neuropathy improved from grade iii to grade i. she was able to get back to doing her routine household work . in view of radiological progression of her disease she , however , continues to have walking on cotton - wool sensation and occasional tingling sensation in her toes . a 17-year - old boy diagnosed with early precursor t - cell , all and no other medical comorbidities completed his induction phase with vincristine , cytarabine , and cyclophosphamide in july 2015 . in the beginning of august 2015 , he was started on consolidation phase of chemotherapy with vincristine , daunorubicin , polyethylene glycol daunorubicin asparaginase , and prednisolone . midway through the consolidation ( after 2 cycles ) phase , he developed tingling sensation in the plantar aspect and toes of his feet , which progressed to pins and needles sensation in 1 week . the pediatric oncology team abandoned his chemotherapy due to intolerable pain and admitted him for debilitating neuropathy . they started him on ultracet ( tramadol 37.5 mg + paracetamol 325 mg ) 4 times a day for pain . the patient spent most time in bed and used a wheel chair to go to the toilet . on examination , he had developed grade iii neuropathy ( cancer therapy evaluation program , common terminology criteria for adverse events , version 3.0 ) . he was started on tablet pregabalin 75 mg at night and escalated his dose every 3 day by 75 mg until pain was controlled . the boy had good pain control ( edmonton symptom assessment scale - 1/10 ) on day 15 with no side effects . he was able to walk to the bathroom without support and do his routine activities without any discomfort . a 40-year - old lady who was diagnosed with primary peritoneal serous carcinoma and no other medical comorbidities was administered paclitaxel and carboplatin . while she was on chemotherapy , she developed mild burning sensation in the plantar aspects of forefoot and toes bilaterally . within 1 month , this progressed to severe burning pain in the same regions . the pain was aggravated by walking , standing , and local application of pressure on the forefoot and toes . , she was found to have grade iii peripheral neuropathy ( nci - ctc version 3.0 ) . she was started on tablet pregabalin 75 mg at night , and the dose of pregabalin was increased by 75 mg every 3 days until resolution of pain . the patient responded to a dose of 375 mg of pregabalin without any of the known side effects of pregabalin ( including drowsiness or giddiness ) . her neuropathy improved from grade iii to grade i. she was able to get back to doing her routine household work . in view of radiological progression of her disease , she , however , continues to have walking on cotton - wool sensation and occasional tingling sensation in her toes . certain chemotherapeutic agents belonging to vinca alkaloids , taxanes , and antitubulins class produce adverse effects such as sensory and motor neuropathy , laryngeal neuropathy , and sensory ataxia , which can significantly affect patient 's quality of life . multiple mechanisms have been hypothesized in the causation of cipn , which include myelinopathy , axonopathy , intraepidermal nerve fiber loss , and mitotoxicity . cipn occurs in the glove and stocking distribution and occasionally perioral paresthesia is experienced with certain chemotherapeutic agents . sensory symptoms that are commonly reported include paresthesia , dysesthesia , allodynia , hyperalgesia , hypoalgesia , or pain that is burning , shooting , or electric - shock - like . painful symptoms may persist well - beyond discontinuation of treatment ( so called coasting ) , resulting in a condition as painful or more painful than the original cancer . cipn pain among other sensory symptoms has presently no standard protocol and the current approach is to stop the chemotherapeutic agent until the neuropathy resolves , in some conditions abandon the chemotherapy regimen and use a lower dose or alternative chemotherapeutic agent . multiple approaches have been discussed to either prevent or treat chemotherapy - induced neuropathic pain . in a study , calcium gluconate and magnesium sulfate ( ca / mg ) infusions , prior and after oxaliplatin treatment , seemed active against acute symptoms ; however , the trial had to be interrupted as there was lower tumor response rate in this group . duloxetine and venlafaxine are known to significantly reduce pain and paresthesia , but other antidepressants such as amitriptyline and nortriptyline failed to show any effect . antidepressant drugs can produce serious adverse effects which might limit the dose escalation , especially in elderly . these drugs significantly interact with other drugs concomitantly administered in cancer treatment resulting in serious adverse reactions . neuromodulators such as gabapentin and pregabalin are gamma - aminobutyric acid analogs , which interact with the 2- subunit of the voltage - gated calcium channels , found to be effective in neuropathic pain . cancer chemotherapeutic agents cause increased expression of sodium channel , 2-1 subunit of the calcium channel ( also activated by opening of sodium channel and n - methyl - d - aspartate [ nmda ] receptor activation ) , and nmda receptors at the dorsal nerve root ganglion and dorsal horn cells . activation of these receptors leads to influx of extracellular calcium and leakage of the mitochondrial calcium . this rise in the intracytoplasmic calcium leads to neuronal cell death through generation of toxic oxygen radicals and triggering of apoptosis . gabapentin and pregabalin reduce the calcium - dependent neurotransmitters in the neuronal membrane , thus inhibiting the neuronal excitability . pregabalin , in contrast to gabapentin , has a higher bioavailability ( 90% vs. 3366% ) , rapid absorption ( peak : 1 h ) with plasma concentration increasing linearly with increasing dose , which justifies its equivalent efficacy at a lower dose and lower risk of adverse effect . also as pregabalin is not known to have drug - drug interaction , it can be safely co - administered with chemotherapeutic agents . our patients showed reduction in the hyperalgesia and allodynia and improvement in the quality of life . the common side effects include dizziness and somnolence , which is known to resolve with continued treatment , followed by dry mouth , peripheral edema , blurred vision , weight gain , abnormal thinking , myoclonus , asterixis , and gynecomastia . chemotherapy - induced neuropathic pain though an uncommon side effect has significant impact on the quality of life of the patients . the current approach of reducing the dose of chemotherapy or stopping the medication can significantly affect the survival of the patients . there is , thus , a need to explore the use of neuromodulators such as pregabalin in the management of chemotherapy - induced neuropathic pain .

chemotherapeutic agents belonging to vinca alkaloids , taxanes , and antitubulins produce peripheral neuropathy for which there is no validated treatment . pregabalin , a gamma - aminobutyric acid analog , is known to inhibit the2 subunit of the voltage - gated calcium channel . earlier studies and case reports have shown pregabalin to be effective in treating neuropathic pain . we present a case series of patients with chemotherapy - induced peripheral neuropathy who were successfully treated with pregabalin with reduction in the hyperalgesia , allodynia , and improvement in the quality of life .

INTRODUCTION CASE REPORTS Case 1 Case 2 DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

despite enormous efforts to search for cure , diabetes mellitus ( often simply referred to as diabetes ) still remains as a formidable challenge for public health . as of 2000 at least 171 million people worldwide suffer from diabetes or 2.8% of the population , and the prevalence of diabetes will rise to 11.4% in 2030 . the increased prevalence is likely attributable to rapid economic development , improved living standards , an aging population , and a westernized lifestyle . epidemiological studies and clinical trials strongly support the notion that hyperglycemia is the principal cause of microvascular and macrovascular complications such as renal failure , neuropathy , retinopathy , coronary and cerebral artery diseases , and amputation . therefore , effective blood glucose control is the key to preventing or reversing diabetic complications and improving quality of life in diabetic patients . although no cure is yet available for type 2 diabetes , oral hypoglycemic agents have been developed and are widely used . current medications , however , are not adequately effective in maintaining long - term glycemic control in most patients , even when used in combination , leaving diabetics susceptible to developing life threatening and debilitating complications . therefore , there is an urgent need for more potent and safe therapeutic agents with noble mechanisms of action . in this context , the practice of diabetes prevention by use of herbal remedy is considered to be an alternative , but more realistic and fundamental strategy for the management of this dread disease . the english word ginseng derives from the chinese term rnshn ( ) , literally man root ( referring to the root s characteristic forked shape , resembling the legs of a man ) . the botanical / genus name panax means all - heal in greek , sharing the same origin as panacea. both american ginseng ( ag , p. quinquefolius ) and asian ginseng ( p. ginseng meyer ) roots are taken orally as adaptogens , aphrodisiacs , nourishing stimulants , and in the treatment of type 2 diabetes , as well as for sexual dysfunction in men . therapeutic uses of ginseng were recorded in the oldest comprehensive materia medica ( shen nong ben cao jing [ ] ) about 2000 years ago , and anti - diabetic potential of ginseng was found in another compendium of materia medica ( ben cao gang mu [ ] written by shizhen li ) . the symptoms was called xiao ke ( ) described as hyperphagia , excessive drinking and losing body weight which are cardinal diabetic symptoms in modern medicine . this medicinal plant has attracted considerable attention from diabetes researchers as well as general public since 1995 , when sotaniemi et al . published an article demonstrating anti - diabetic activity of ginseng . shortly thereafter , there has been a steady progress in uncovering the therapeutic efficacy and molecular mechanisms of anti - diabetic properties of ginseng . this review is intended to shed light on pharmacological and therapeutic activities , and action mechanisms of ginseng ( and its active components ) as an anti - diabetes agent . the hypoglycemic activity of ginseng extract and its active ingredients has been known since 1980s . in 1980s , several glycans including panaxans and quinquefolans were isolated from asian ginseng and ag , respectively , and they were known to be hypoglycemic constituents [ 10 - 13 ] . now , it is generally accepted that the triterpene -glycoside , known as ginsenosides , are the major active constituents in ginseng . along with this notion , different batches contain different profiles of ginsenosides , which may result in inconsistent outcomes . until 2000 , we are only aware of 3 published long - term studies investigating the anti - diabetic efficacy of ginseng from any source in people with type 2 diabetes . in the first study , 8 wk of treatment with 100 and 200 mg / d of an unspecified ginseng improved fasting plasma glucose ( fpg ) and glycosylated hemoglobin ( hba1c ) , respectively . the second study showed that 24 mo of treatment with 3 to 4.5 g of a korean red ginseng ( krg ) extract decreased hba1c by an unspecified magnitude . finally , the third study represents the original proof - of - concept for an acute clinical screening - model used to select a ginseng with sustainable efficacy and safety . . showed that 8 wk of supplementation with an ag extract at the dose of 1 g ( prandial agent 40 min before each meal ) similarly improved fpg and hba1c . these effects appeared to be mediated by a possible insulinotropic mechanism , as opposed to the insulin sensitizing mechanism proposed for the selected krg treatment . taken together , the suggestion is that different ginseng sources , especially american ginseng and krg , can be selected to have clinical efficacy in type 2 diabetes . this efficacy , nevertheless , may be mediated by different mechanisms . despite the recent conclusion that the best evidence for anti - hyperglycemic efficacy among complementary alternative medicine therapies is for ag , there remains limited clinical data to support the efficacy and safety of a krg source . vuksan and sievenpiper conducted clinical trial to explore the acute and chronic effects of american and asian ginseng in subjects with and without diabetes by using a randomized , double - blind and placebo - controlled protocol : highly variable acute glycemic effects are observed secondary to the ginsenoside profile as it varies across ginseng batch , preparation , variety , and species . they concluded that without these data the consumer can not be assured of the safety and efficacy of ginseng products and the calls from the medical community for randomized controlled trials and standardization of ginseng are needed . effects of ginseng on diabetes - related parameters in human studies auc , area under the curve ; hba1c , glycosylated hemoglobin ; homa , homeostasis model assessment ; krg , korean red ginseng ; ppar- , peroxisome proliferator - activated receptor ; ppd , protopanaxadiol ; ppt , protopanaxatriol ; tc , total cholesterol ; tg , triglyceride . as show table 1 , vuksan et al . performed the first randomized , double - blind and placebo - controlled crossover clinical studies to examine the long - term anti - diabetic efficacy and safety of a krg , selected based upon an acute - screening model . nineteen participants with well - controlled type 2 diabetes completed the study . using a double - blind , randomized , crossover protocol , each participant received 2 g of krg ( rootlets ) at 40 min before each meal ( total 6 g / d ) for 12 wk as an adjunct to their usual anti - diabetic therapy ( diet and/ or medications ) . they concluded that although clinical efficacy , as assessed by hba1c , was not demonstrated , supplementation with the selected krg treatment for 12 wk maintained good glycemic control and improved plasma glucose and plasma insulin regulation safely beyond usual therapy in people with well - controlled type 2 diabetes . the number or severity of adverse events did not differ between the selected krg treatment and placebo . hepatic , renal , hemostatic , and blood pressure variables were also not altered on the selected krg treatment as compared with placebo . the demonstrated safety is noteworthy , as reviews have consistently warned of adverse effects of ginseng that include impaired hemostatic function and elevated blood pressure . but owing to the large number of dropouts and problems regarding participants who may not represent typical candidates for adjunctive therapy , these benefits can only be considered as preliminary support for the possibility that further investigation with the selected krg treatment may show clinical efficacy . however , recent clinical trials independently performed by reay et al . and reeds et al . may fall into decline the ginseng s reputation as a potential therapeutic agent for type 2 diabetics . lugano , switzerland ) or krg in placebo - controlled , double - blind , crossover studies . it was found that p. ginseng had no effect on any gluco - regulatory parameter investigated , suggesting that chronic use of p. ginseng by non - diabetic individuals will have little long - term effect on glucose regulation . in other clinical trial , conducted by reeds et al . , to determine whether ginseng or ginsenoside re improves -cell function and insulin sensitivity in insulin - resistant subjects , fifteen overweight or obese adults were randomly assigned to 4 wk treatment with either : placebo capsule , krg extract ( 3 g / d for 2 wk and 8 g / d for 2 wk ) , ginsenoside re ( 250 mg / d for 2 wk , followed by 500 mg / d for 2 wk ) . they found no evidence that oral ginseng or ginsenoside re therapy improves -cell function or insulin sensitivity in overweight or obese subjects with impaired glucose tolerance or newly diagnosed type 2 diabetes . although they can not exclude the possibility that other ginsenosides and their metabolites or non - ginsenoside components of ginseng extract are bioavailable when given orally , they suggest that poor systemic bioavailability might be responsible for the absence of a therapeutic effect of krg extract and ginsenoside re . a growing evidences of rigorously conducted cell and animal studies are pointing to different ginsenosides for anti - diabetic indications . both protopanaxadiol ( ppd)-type saponins ( rb1 , rb2 , rc , rg3 , rh2 , compound k , and ppd ) and protopanaxatriol ( ppt)-type saponins ( re , rg1 , rg2 , and ppt ) were reported to possess anti - diabetic activity in cell and animal studies ( tables 2 and 3 ) . however , animal and cell data would suggest four possible mechanisms that could potentially account for the modulation in blood glucose levels : 1 ) modulation of insulin production and secretion , 2 ) modulation of glucose metabolism , 3 ) modulation of glucose uptake , and 4 ) modulation of inflammatory pathway . effects of ginseng on different molecular targets related to diabetes in cell line studies ampk , amp - activated protein kinase ; ap2 , fatty acid binding protein ; bcl2 , b - cell lymphoma 2 ; camkk , calcium / calmodulin - dependent protein kinase kinase ; cox-2 , cyclooxygenase-2 ; erk1/2 , extracellular signal - regulated kinase ; glut , glucose transporter ; inos , inducible nitric oxide synthase ; irs , insulin - receptor substrate ; jnk , c - jun nh2-terminal kinase ; krg , korean red ginseng ; lkb1 , liver kinase b1 ; lpl , lipoprotein lipase ; mapk , mitogen activated protein kinase ; nf-b , nuclear factor-b ; no , nitrite oxide ; parp , poly ( adp - ribose ) polymerase ; pepck , phosphoenolpyruvate carboxykinase ; pi3k , phosphatidylinositide 3 kinase ; ppar- , peroxisome proliferator - activated receptor ; ppd , protopanaxadiol ; ppt , protopanaxatriol ; rmc , rat mesangial cell ; ros , reactive oxygen species ; sglt1 , sodium - glucose cotransporter 1 ; shp , small heterodimer partner ; srebp , sterol regulatory element - binding protein ; tnf- , tumor nuclear factor- ; ucp , uncoupling protein . effects of ginseng on diabetes - related parameters in animal studies ages , advanced glycation end products ; ampk , amp - activated protein kinase ; ast , aspartate transaminase ; cml , n-carboxymethyl lysine ; cox-2 , cyclooxygenase-2 ; erk1/2 , extracellular signal - regulated kinase ; fas , fatty acid synthase ; fpg , fasting plasma glucose ; g6pase , glucose-6-phosphatase ; glut , glucose transporter ; gpat , glycerol-3-phosphate acyltransferase ; hba1c , glycosylated hemoglobin ; hdl - c , high - density lipoprotein cholesterol ; hscrp , high sensitivity c - reactive protein ; inos , inducible nitric oxide synthase ; irs , insulin - receptor substrate ; jnk , c - jun nh2-terminal kinase ; krg , korean red ginseng ; ldl - c , low - density lipoprotein cholesterol ; mef-2 , myocyte enhancer factor-2 ; nefa , non - esterified fatty acid ; nf-b , nuclear factor-b ; no , nitrite oxide ; nmda - nr1 , n - methyl - d - aspartate receptor nr1 , nrf-1 , nuclear respiratory factor-1 ; oletf , otsuka long - evans tokushima fatty ; pepck , phosphoenolpyruvate carboxykinase ; pgc-1 , peroxisome proliferator - activated receptor- coactivator-1 ; ppar- , peroxisome proliferator - activated receptor ; ppd , protopanaxadiol ; ppt , protopanaxatriol ; rage , receptor for ages ; scd1 , stearoyl - coa desaturase-1 ; srebp , sterol regulatory element - binding protein ; tba , thiobarbituric acid ; tc , total cholesterol ; tg , triglyceride ; tgf- , transforming growth factor- ; tnf- , tumor nuclear factor- ; ucp , uncoupling protein . first , ag and krg stimulate insulin secretion in hitt15 cells and isolated rat pancreatic islets , respectively , and other studies also demonstrate ag and krg increase insulin production and secretion through inhibition of cytokine - induced -cell apoptosis . lee et el . demonstrated that intravenous injection of ginsenoside rh2 into wistar rats decreased the plasma glucose levels parallel with increase in plasma insulin levels , and this effect is mediated by stimulating muscarinic m3 receptors in pancreatic cells . in our previous study , compound k ( also known as ih-901 ) , an active metabolite of ppd ginsenosides , showed the most potent insulin secretion stimulating activity . in vitro studies using hit - t15 cells and primary cultured islets , compound k enhanced the insulin secretion and this effect was completely abolished in the presence of diazoxide ( k channel opener ) or nifedipine ( ca channel blocker ) . insulin secretion stimulating activity of compound k was also confirmed with an oral glucose tolerance test in icr and db / db mice . from these studies , we concluded that compound k lowered the plasma glucose level by stimulating insulin secretion and this action was presumably associated with an atp - sensitive k channel . second , wang et al . demonstrated the hypoglycemic activity of ginseng glycopeptide possibly through stimulation of -adrenoceptor and increase of various rate - limiting enzyme activities related to tricyclic acid cycle . our group also reported that ginseng radix can ameliorate hyperglycemia possibly by blocking intestinal glucose absorption and inhibiting hepatic glucose-6-phosphatase , and ginseng rootle can do it through the up - regulation of adipocytic peroxisome proliferator - activated receptor ( ppar- ) expression as well as inhibiting intestinal glucose absorption in kkay mice . one of the most efficient ways to modulate glucose metabolism in diabetic patients would be a perturbation on hepatic glucose production . recently , ginsenoside rb2 , re and rg1 were reported to suppress the hepatic gluconeogenesis in h4iie and hepg2 cells , respectively , via activation of amp - activated protein kinase ( ampk ) . third , enhancement of glucose uptake through glucose transporter 4 ( glut4 ) overexpression was documented to occur by treatment with either p. notoginseng , rg3 , re and 20(s)-ppt in adipocytes or skeletal muscle cells . recently , lee et al . reported that krg at a dose of 200 mg / kg / d for 40-week - period improves insulin sensitivity in otsuka long - evans tokushima fatty rats by increasing expression of peroxisome proliferator - activated receptor- coactivator-1 , nuclear respiratory factor-1 , cytochrome c , cytochrome c oxidase-4 , and glut4 . lots of medicinal plants including p. ginseng show anti - diabetic effect as well as controlling inflammation . it has been postulated that diabetes is a manifestation of an ongoing chronic low - grade inflammation . chronic subclinical inflammation is associated with insulin resistance , a situation of increased risk for developing diabetes . inflammatory processes seem to play an important role in the development of diabetes and its late complications . inflammatory cytokines , for example , tnf- , il-1 , il-6 , nitrite oxide , and so on , are released from macrophages or other tissues during a state of inflammation . these factors can activate the ib kinase ( ikk)/c - jun nh2-terminal kinase ( jnk ) pathway , which results in the inhibition of insulin receptor substrate / phosphatidylinositide 3-kinase pathway and brings about insulin resistance . therefore , slight or moderate anti - inflammatory effects of p. ginseng ( or its active components ) may be responsible for their hypoglycemic mechanisms . for example , zhang et al . examined the insulin signaling and anti - inflammatory effect of gin - senoside re in 3t3-l1 adipocytes and in high fat dietfed rats to dissect its anti - hyperglycemic mechanism . the results show that re reduces insulin resistance through inhibition of jnk and nuclear factor - kb . this may contribute new evidences indicating that slight or moderate regulatory modulation by re on inflammation may be an effective tactic to prevent the development of insulin resistance . recently , lee et al . also demonstrated that ginsenoside rb2 inhibits palmitate - induced gluconeogenesis in h4iie cells ( rat - derived hepatocytes ) via ampk - induced orphan nuclear receptor small heterodimer partner by relieving endoplasmic reticulum stress , which is induced by palmitate through jnk activation . taken together , proposed action mechanisms of p. ginseng and ginsenosides as a potential anti - diabetic agent can be summarized in fig . 1 . recent trends in drug prescription for type 2 diabetics have seen a move away from agents that stimulate insulin secretion , such as the sulfonylureas , toward agents that increase insulin sensitivity , such as biguanides ( metformin ) and thiazolidinediones ( pioglitazone ) . an exciting recent development has been a finding that both of these latter classes of drug activate the ampk . as research on ampk has progressed , it became increasingly clear that ampk activators might be useful as drugs to treat insulin resistance or type 2 diabetes . first , ampk acutely increases glucose uptake into adipose tissue or skeletal muscle via a mechanism that remains functional in insulin - resistant individuals and also increases glut4 expression so that insulin would promote glucose uptake even with no change in insulin sensitivity . second , ampk promotes glucose metabolism by increasing mitochondrial biogenesis , which is relevant because people at risk of developing type 2 diabetes appear to have a deficit in mitochondrial function . third , ampk could increase insulin sensitivity by promoting fat oxidation and reducing triglyceride storage ; an excess amount of muscle triglyceride is associated with insulin resistance . finally , an important source of the high glucose concentrations in type 2 diabetes patients is elevated hepatic glucose production , which ampk inhibits by down - regulating gluconeogenic genes such as phosphoenolpyruvate carboxykinase and glucose-6-phosphatase . up to now , about fifteen articles were published to demonstrate that pharmacological and therapeutic effects of ginsenosides are associated with ampk . ginsenosides as an ampk activator can ameliorate metabolic diseases such as diabetes ( rb2 , rc , rg3 , compound k , rg1 , rg2 , re ) , obesity ( rg3 and rh2 ) , nonalcoholic fatty liver disease ( compound k ) , and cancer ( rg3 and compound k ) . along with other researchers , our group is working on ampk signaling pathway as a molecular target of ginseng and specific ginsenosides since 2007 , and several ginsenosides including rg3 , compound k , re , rg1 and rg2 are shown to activate ampk signaling pathway and possess beneficial effects on type 2 diabetes , obesity and nonalcoholic fatty liver disease . at present , we do not know exactly how ginseng or specific ginsenoside activates ampk signaling pathway , so further studies are needed to investigate whether ampk is a direct molecular target for ginseng and specific ginsenoside . unlike 5-aminoimidazole-4-carboxamide riboside , a well - known direct ampk activator , ginsenosides seem not to be a direct ampk activator . we are now working on the hypothesis that ginsenosides , as an uncoupler like carbonylcyanide - p - trifluoromethoxyphenylhydrazone ( fccp ) and 2,4-dinitrophenol , may cause a decrease in atp biosynthesis in mitochondria , resulting change in amp : atp ratio , which provides a possible mechanism for its activation of ampk . taken together , our results regarding ampk signaling pathway as a molecular target , we propose the action mechanism of ginsenosides to suppress hepatic gluconeogenesis and steatosis via activation of ampk signaling pathway ( fig . the prevalence of obesity in a modern society has increased dramatically over the past few years and has reached epidemic proportions . obesity is a major risk factor for type 2 diabetes , cardiovascular problems , and some forms of cancer . although efforts to address the environmental and genetic factors responsible for the epidemic must continue , and because currently available anti - obese and anti - diabetic drugs have limited efficacy and/or safety concerns , developing safe and effective medicinal agents , particularly with the dual properties of controlling body weight and reducing blood glucose , offers exciting possibilities for developing successful therapies . in this context , it would be more desirable if p. ginseng or its active constituents show both anti - obese and anti - hyperglycemic effects . for example , attele et al . evaluated anti - hyperglycemic and anti - obese effects of p. ginseng berry extract and ginsenoside re in c57bl/6j ob / ob mice . intraperitoneal injection of berry extract significantly improved glucose tolerance and caused to reduce body weight , and ginsenoside re was known to be responsible for anti - hyperglycemic action of p. ginseng berry extract . recently , xiong et al . identified ginsenoside rb1 as anti - obese and anti - hyperglycemic agent . acute administration of rb1 suppressed food intake , probably mediated by stimulation of c - fos gene . four - week administration of rb1 significantly reduced food intake , body weight gain , and body fat content and increased energy expenditure in high fat diet - induced obese rats . rb1 also markedly decreased fasting blood glucose and improved glucose tolerance , suggesting that although rb1 s anti - hyperglycemic effect is partially attributable to reduced food intake and body weight , there may be additional effects of rb1 on glucose homeostasis . data from animal and in vitro studies have shown that ginseng extract and specific ginsenosides have beneficial effects on glucose and lipid metabolism . however , the results from clinical studies for ginseng root or ginsenoside re are unclear because of confounding factors that could have influenced the outcomes , such as changes in body weight and physical activity , changes in diabetic medications , large drop - out rates , and poor systemic bioavailability . although some ginsenosides including re have claimed anti - hyperglycemic and/or diabetes - related activities , it remains unclear which species and batches of ginseng have anti - hyperglycemic efficacy and which saponin or non - saponin components confer this efficacy . therefore , there are some points to be duly considered for usage of ginseng ( or its active constituents ) as a dietary supplement for diabetes mellitus : 1 ) standardization , 2 ) pharmacokinetic and pharmacodynamic studies at the molecular levels , and 3 ) double - blind and placebo - controlled large scale clinical studies . although most of preclinical studies have mainly focused on ginsenosides as active constituents of p. ginseng for diabetes , researches directed at the identification of active components are still needed to support efficacy claims for ginseng . another concern is the claim of poor systemic bioavailability of ginseng and ginsenoside re , which is recently reported by reeds et al . . they did not observe any beneficial effects of krg and ginsenoside re on pancreatic -cell function and insulin resistance . they concluded that poor systemic bioavailability might be responsible for the lack of a therapeutic effect , since ginsenosides re , rb1 , and rb2 were not detectable in plasma after treatment with ginseng root or ginsenoside re . , however , have detected simultaneously ginsenoside re and its probable metabolites ( rg1 , rf1 , rh1 , and ppt ) in plasma after re administration in healthy volunteer . therefore , in - depth pharmacokinetic studies of ginseng and specific ginsenosides are to be performed to examine the presence of active metabolites . along with these pharmacokinetic and pharmacodynamics studies , standardization for ginseng preparation while more studies are warranted to further understand these contradictions , ginseng holds promise as a therapeutic agent for diabetes prevention and treatment .

panax ginseng exhibits pleiotropic beneficial effects on cardiovascular system , central nervous system , and immune system . in the last decade , numerous preclinical findings suggest ginseng as a promising therapeutic agent for diabetes prevention and treatment . the mechanism of ginseng and its active components is complex and is demonstrated to either modulate insulin production / secretion , glucose metabolism and uptake , or inflammatory pathway in both insulin - dependent and insulin - independent manners . however , human studies are remained obscure because of contradictory results . while more studies are warranted to further understand these contradictions , ginseng holds promise as a therapeutic agent for diabetes prevention and treatment . this review summarizes the evidences for the therapeutic potential of ginseng and ginsenosides from in vitro studies , animal studies and human clinical trials with a focus on diverse molecular targets including an amp - activated protein kinase signaling pathway .

INTRODUCTION ANTI-DIABETIC ACTIVITY AND ACTION MECHSNISMS OF GINSENG CONCLUSION

hearing aid validation using aided speech evoked auditory evoked potentials is of research and clinical interest . such measurements involve elicitation of an evoked potential using a speech stimulus that has been processed through a hearing aid . hearing aids , being mostly nonlinear , may have implications for the nature of speech stimulus used as input . the present study focuses on the effect of nonlinear hearing aid processing on speech stimuli used for measurement of cortical auditory evoked potentials ( caeps ) . factors such as input level , duration , crest factor ( ratio of peak to root mean square ( rms ) amplitude ) , modulation depth , and modulation frequency of the input signal may affect the gain applied by the hearing aid , in ways that would not occur with a linear system [ 14 ] . these effects have been attributed to the level - dependent signal processing architecture , which in many hearing aids includes frequency specific compression threshold , compression ratio , compression time constants , number of channels , gain in each channel , expansion threshold , and expansion time constants [ 1 , 512 ] . in addition , hearing aid processing may also consider the frequency characteristics of the input stimulus ( e.g. , [ 13 , 14 ] ) . hence the output of a hearing aid to a specific input is the product of complex interactions between input stimuli and hearing aid features that may or may not be known to or may not be adjustable by the end user . nonlinear hearing aids , being sensitive to features of the input signal , process speech or speech - like stimuli differently from nonspeech stimuli [ 3 , 7 , 10 , 15 ] . since the main goal of hearing aid validation procedures is to assess benefit of hearing aid use while listening to speech , it is preferable that such procedures use speech stimuli in the most natural or frequently encountered form as possible . behavioural validation procedures ( tests that require active participation of the hearing aid user ) such as speech tests , mostly use speech in various natural forms . examples include the use of sentence materials , such as the bamford - kowal - bench sentence test , or materials with less grammatical context such as isolated words or nonsense syllables ( e.g. , the nonsense syllable test ) . but the speech stimuli may need to be modified for use in alternative validation methods such as aided auditory evoked potentials [ 1823 ] . aided auditory evoked potentials are objective and electrophysiological ( they record neural responses to sound ) but historically have not used speech stimuli . of these , one of the reasons caeps have been of interest in the validation of hearing aid fittings is because natural speech sounds can be used as stimuli [ 19 , 2327 ] . often phonemes or syllables excised from running speech or from standard speech tests have been used to record reliable caeps ( e.g. , [ 2729 ] ) . although natural speech can be used as stimuli , caep testing involves presentation of these stimuli with interstimulus intervals ( isi ) . these isis usually range on the order of 1 - 2 seconds ( e.g. , [ 23 , 29 , 30 ] ) optimized for the latency of caeps and refractory periods of the cortical pyramidal neurons [ 3032 ] . these stimuli are repeated 100200 times , with constant or slightly variable isis and caeps elicited to each of the presentations are averaged . presence of a caep elicited by a specific stimulus is interpreted as the stimulus being relayed to the source of caeps , the auditory cortex [ 21 , 24 ] . evidence suggests that caep thresholds ( i.e. , the lowest stimulus level at which a caep is detected ) are closely related to behavioral thresholds ( i.e. , the lowest stimulus level at which the participant detects the stimulus ) [ 33 , 34 ] . therefore , presence of a caep is likely to suggest audibility of the eliciting stimulus . on these premises , recent aided caep protocols for hearing aid validation have used brief segments of speech in the form of phonemes or syllables ( e.g. , [ 2125 ] ) . depending on their length , these brief segments may differ in their representation of certain features cues such as formant transitions , compared to longer segments of these same phonemes embedded in running speech . commercial equipment such as the hearlab uses phonemes , sampled across the speech frequency range presented at their naturally occurring levels within running speech , and presented in isolation to permit averaging of caep across several sweeps . phonemes presented in isolation for caep protocols may differ in several important ways from phonemes presented within running speech . in caep protocols , the target phoneme is preceded by an isi ( a silence period ) whereas the same phoneme in running speech is likely to be preceded by other phonemes . since nonlinear hearing aids continuously and rapidly adjust band - specific gains based on the acoustic input , there is a possibility that the hearing aids may react differently to the same phoneme when presented during aided caep testing as compared to when they occur in running speech . with 1 - 2 seconds of isi preceding every repetition of the stimulus , nonlinear hearing aids may demonstrate an overshoot at the onset of the stimulus consistent with compression circuitry . also , hearing aids of different models and different manufacturers may vary in how quickly they respond to changes in the acoustic input . therefore , verifying that hearing aid output is comparable for phonemes presented in these two contexts ( preceding silent periods / isi versus embedded in running speech ) may be an important step in evaluating the validity of using caep protocols in hearing aid validation . previous reports on non - caep related measures suggest that certain features of nonlinear signal processing in hearing aids may attenuate the level of speech sounds immediately preceded by silence [ 37 , 38 ] . the effects of caep protocols on the gain achieved while processing tone bursts have been reported elsewhere in this issue [ 40 , 41 ] . these studies provide evidence that hearing aid gain differs for tone bursts ( short and long ) presented in isolation versus pure tones that are continuous . specifically , the gain achieved during processing of tone bursts was lower than the verified gain , when measured at 30 ms poststimulus onset and at maximum amplitude . onset level is of interest because the first 30 to 50 ms of the stimulus primarily determines the characteristics of the elicited caep . stimulus level of the hearing aid processed tone bursts was positively related to the caep amplitude , with stimulus level at 30 ms poststimulus onset being a better predictor of caep amplitude compared to maximum stimulus level . these reports [ 40 , 41 ] substantiate the need to verify output levels of caep stimuli across contexts , and to consider stimulus onsets . the present study will focus upon aided processing of phonemes across contexts and measure both overall level ( level measured across the entire duration of the phoneme ) and onset level of the stimuli at the output of the hearing aid . the purpose of this study was to understand if hearing aids process caep phonemes presented in isolation differently to phonemes presented in running speech . the primary outcome measure of interest in this study was the output level of phonemes in both contexts . findings from this study may provide some insights into the design of hearing aid validation protocols that employ aided caep measures , because large differences in hearing aid output arising due to stimulus context may influence interpretation of audibility based on aided caeps . hearing aids were sampled across a representative range of major manufacturers and were behind - the - ear ( bte ) in style . of the 10 hearing aids , six were programmed and verified to meet dsl v5a adult prescription targets for an n4 audiogram . the n4 audiogram represents hearing loss of moderate to severe degree with thresholds of 55 db hl at 250 hz worsening down to 80 db hl at 6 khz . the remaining four hearing aids were programmed and verified to meet dsl v5a targets for an n6 audiogram . the n6 audiogram represents hearing loss of severe degree with thresholds ranging from 75 db hl at 250 hz worsening to 100 db hl at 6 khz . hearing aids appropriate for different audiograms were chosen from different manufacturers to obtain a representative sample of commonly available commercial products . all hearing aids were programmed to function on a basic program with all additional features such as noise reduction , feedback cancellation , and frequency lowering disabled during verification and recording . as such , variance across devices is mainly attributable to the nonlinear characteristics of the devices , in isolation of these other aspects of hearing aid signal processing . stimuli were constructed to have both running speech and phoneme - in - isolation contexts as follows . for the running speech context , eight phonemes ( /a/ , /i/ , /u/ , /s/ , // , /m/ , /t/ , and /g/ ) were identified within a recording of the rainbow passage . the passage was spoken by a male talker and lasted 2 minutes and 14 seconds . aided recordings of this passage were made for each hearing aid , and the level of each phoneme was measured from within the aided passage . for the isolated context , the same phonemes and phoneme boundaries were used , but were excised from the passage for use as individual stimuli . boundaries of these phonemes were chosen such that any transitions preceding and following these phonemes due to coarticulation were excluded . ms , /i/84 ms , /u/124 ms , /s/133 ms , //116 ms , /m/64 ms , /t/26 ms , and /g/19 the durations of these phonemes differed naturally and were not modified in order to allow direct comparisons between the two contexts . these specific phonemes were chosen as the first six of these phonemes are a part of the commonly used ling 5 or 6 sounds test [ 44 , 45 ] . the last three have been commonly used in a series of aided caep studies ( e.g. , [ 26 , 27 , 46 ] ) and are also a part of the stimulus choices available in the hearlab . a silent interval of 1125 ms preceding each phoneme was created using sound editing software goldwave ( v.5.58 ) . this is to simulate a caep stimulus presentation protocol where the isi usually ranges between one and two seconds . recordings of hearing aid output used a click - on coupler ( brel & kjr ( b&k ) type 4946 conforming to ansi s3.7 , iec 60126 fitted with microphone type 4192 ) with an earplug simulator . this was set up in a b&k anechoic box ( box 4232 ) that also housed a reference microphone . the outputs of the reference and coupler microphones were captured in spectraplus ( v5.0.26.0 ) in separate channels using a sampling rate of 44.1 khz with 16-bit sampling precision . spectraplus software was used to record the reference and coupler signals as .wav files for further signal analyses . running speech was presented at overall rms levels of 55 , 65 , and 75 db spl . these levels approximate speech at casual through loud vocal effort levels . since individual phonemes naturally varied in their relative levels within the rainbow passage , the level of each isolated phoneme was matched to the level at which it occurred in the rainbow passage , for each presentation level . with this recording paradigm , the overall input levels of each phoneme were matched between the two contexts . during presentation of phonemes in the isolation context , approximately 10 repetitions of each phoneme ( each preceded by isi of 1125 ms ) were presented during any single recording . two measurements were made per phoneme and per context : the overall level of the phoneme ( db spl rms recorded over the entire duration of the phoneme ) and the onset level of the phoneme ( db spl rms recorded over the first 30 ms of the stimulus phoneme ) . onset measurements could not be completed for phonemes /t/ and /g/ as the duration of these phonemes was shorter than 30 ms . for these phonemes , the first few repetitions were discarded as , in our preliminary recordings using a few hearing aids , interrepetition variability was observed to be high in the first few repetitions . this is likely related to nonlinear signal processing in the hearing aids but these effects were not formally evaluated in this study . figures 1(a ) and 1(b ) illustrate examples of the variability observed in the first few repetitions . repeated measures of analysis of variance ( rm - anova ) were completed using spss ( v. 16 ) with context ( running speech and isolation ) , level ( 55 , 65 , and 75 db spl ) , and phoneme as the three independent factors . for interpretation of these multiple t - tests , sequential bonferroni type corrections that control for false discovery rates were used to determine critical p values [ 49 , 50 ] . phonemes embedded in running speech were measurable for nearly all hearing aids in this study . for one of the hearing aids , the output level of /g/ in isolation at 55 db spl input level could not be measured as it was embedded within the hearing aid noise floor . across the sample , the average overall phoneme level measured in the running speech context was 94.07 db spl ( standard error ( se ) = 1.79 db ) and in the isolation context was 92.43 db spl ( se = 1.94 db ) . on average , the phoneme onset level measured in the running speech context was 94.67 db spl ( se = 1.79 db ) and in the isolation context was 94.44 db spl ( se = 1.83 db ) . the outcome of statistical tests for overall phoneme level and phoneme onset level will be described below . rm - anova revealed a significant effect of context ( f = 10.114 [ 1 , 8 ] , p = 0.013 ) , input level ( f = 834.58 [ 1.02 , 8.12 ] , p < 0.001 ) , and phoneme ( f = 93.26 [ 1.95 , 15.62 ] , p < 0.001 ) . interactions between input level and context ( f = 8.36 [ 1.35 , 10.82 ] , p = 0.011 ) , phoneme and context ( f = 3.38 [ 2.63 , 21.05 ] , p = 0.042 ) , and input level and phoneme ( f = 5.25 [ 2.69 , 21.56 ] , p = 0.009 ) were also significant . the three - way interaction between input level , context , and phoneme was not significant ( f = 1.061 [ 2.48 , 29.79 ] , p = 0.388 ) . paired contrasts comparing overall phoneme levels between contexts at each input level showed significant differences at the 55 and 65 db spl input levels but not at the 75 db spl input level . at input levels of 55 and 65 db spl , the levels of phonemes were significantly higher when they appeared in running speech compared to when they occurred in isolation ( see figure 2(a ) and table 3 for group means ) . in summary , the difference between contexts reduced as input level increased . paired contrasts comparing overall phoneme levels between contexts for each phoneme showed significant differences for all phonemes except /m/ all phonemes except /m/ were higher in level when they occurred in running speech compared to when they occurred in isolation . a similar result was obtained for phoneme onset level . rm - anova revealed a significant effect of context ( f = 7.41 [ 1 , 9 ] , p = 0.024 ) , input level ( 846.94 [ 1.05 , 9.44 ] , p < 0.001 ) , and phoneme ( f = 52.84 [ 1.78 , 16.04 ] , p < 0.001 ) . interactions between input level and context ( f = 17.71 [ 1.20 , 10.81 ] , p = 0.001 ) , and phoneme and context ( 3.95 [ 3.45 , 31.09 ] , p = 0.013 ) were significant . interaction between input level and phoneme ( f = 1.49 [ 2.06 , 18.56 ] , p = 0.250 ) and the three - way interaction between input level , context , and phoneme were not significant ( f = 0.89 [ 3.25 , 29.25 ] , p = 0.473 ) . paired contrasts between phoneme onset levels of both contexts at each input level showed significant differences between contexts at 55 and 65 db spl but not at the 75 db spl input level . at input levels of 55 and 65 db spl , the onset levels of phonemes were significantly higher when they appeared in running speech compared to when they occurred in isolation ( see figure 3(a ) and table 3 for group means ) . similar to overall phoneme level , the difference between contexts reduced with increasing input level . paired contrasts comparing phoneme onset levels between contexts for each phoneme revealed no significant differences for all phonemes except // and /u/ ( see figure 3(b ) and table 4 for group means ) . phonemes // and /u/ were higher in onset level when they occurred in running speech compared to when they occurred in isolation . the mean difference in overall phoneme level averaged across hearing aids , input levels , and phonemes was found to be 1.64 db , where phonemes in running speech measured higher on average . the mean difference in phoneme onset level computed similarly was 0.23 db , onset of phonemes in running speech measuring higher on average . although the mean value suggests a clinically insignificant difference due to context , inspection of individual data highlights the differences observed across hearing aids and phonemes . tables 5(a ) and 5(b ) provide the difference ( in db ) in the output measures ( overall phoneme level and phoneme onset level ) in both contexts , averaged across all three input levels . these differences were obtained by subtracting the level of each phoneme in isolation from the corresponding level in running speech . hence , a positive value indicates that the level of the phoneme is higher when it occurs in running speech , as it would in daily life , versus in isolation , as it would during caep measurement . differences of greater than 3 db are presented in bold . the proportion of difference values greater than 3 and 5 db are presented in table 6 for both overall phoneme levels and phoneme onset levels at each input level . pooled across both directions of differences and input levels , about 24% of the overall phoneme levels ( total of 239 observations across three levels , 10 hearing aids and eight phonemes , 1 missing value ) showed differences of greater than 3 db and 7% showed differences of greater than 5 db . in case of phoneme onset levels , about 33% of the observations ( total of 180 observations across three levels , 10 hearing aids and six phonemes ) showed differences of over 3 db and nearly 13% showed differences of over 5 db . in general , differences greater than 3 db are well outside of test - retest differences in electroacoustic measurement , while differences greater than 5 db are greater than a typical audiometric step size . the latter is likely clinically significant , while the former may have impact for interpretation of research data and calibration . we note that the majority of aided phoneme levels agreed between the two contexts within 3 db . results suggest that hearing aid output level of a phoneme in isolation may either match or may differ from the output level of the same phoneme when it occurs in running speech . agreement was observed in approximately 66% to 75% of cases , while differences exceeding 3 db were observed in 24% to 33% of cases . agreement occurred in more cases ( 75% ) for measures of overall level of phoneme , and in fewer cases ( 66% ) for measures of phoneme onset level . when differences existed , they typically manifested as the hearing aid producing a lower output for the phoneme in isolation than it did for the phoneme in running speech . results from the present study are similar to the findings from other reports in this issue [ 40 , 41 ] . specifically , these reports and the current study show that across measurement strategies and stimulus types , hearing aids may apply lower gain and output ( at onset as well as at maximum amplitude ) to brief stimuli that are immediately preceded by silence , such as those commonly used to elicit the caep . however , one may note that the hearing aids used in these studies [ 40 , 41 ] were set to function linearly , unlike the hearing aids used in the present study . another study has used a nonlinear hearing aid to study the effect of hearing aid processing on the tone burst onset while comparing it with the unaided condition . the aided condition in this study produced a marginal increase in the level at onset due to the presence of an overshoot . in the present study , there were fewer instances of significant overshoot , but recall that the unaided condition was not assessed in this study . therefore , the present results pertain only to the comparison of aided levels between the isolation context and running speech . overshoot may be present in both conditions . also , the effects of overshoot attributable to nonlinear signal processing in hearing aids may vary across devices , with the effects being idiosyncratic to specific devices or stimuli . results similar to the majority of the observations in the present study have also been noted in non - caep related studies of nonlinear signal processing in hearing aids [ 37 , 38 ] . the decrease in differences in overall and onset level of phonemes between contexts with increase in input level could indicate an effect of output limiting . as the output levels of phonemes come close to the maximum power output of the hearing aids , they are subject to compression limiting [ 1 , 5 ] . compression limiting restricts the maximum output level by using a very high or infinite compression ratio in an output controlled compression system . hence , at higher input levels , where the output levels are likely subject to output limiting in both stimulus contexts , the differences seen are smaller compared to lower input levels that are relatively less likely to be affected by output limiting . we did not perform a direct comparison across phonemes because the individual phonemes occur at different levels relative to , the overall rms level of running speech . compression , being a level - dependent nonlinear factor in the hearing aid , may therefore vary the gain applied for each of these phonemes , especially when they are presented in isolation . in addition , compression features such as compression ratio and time constants were likely different across different frequencies due to the slightly sloping configurations of audiograms chosen and the presence of multiple channels in our hearing aid sample . since phonemes varied in their spectral composition and position of spectral peaks one stimulus characteristic that could have been influential in determining overall phoneme output levels is the duration of phonemes . table 5(a ) suggests that differences larger than 3 db occurred more often for /g/ and /t/ relative to other phonemes . among all eight phonemes , /t/ and /g/ were the lowest in level and shortest in duration , measuring 26 ms and 19 ms , respectively . this may have made these phonemes in isolation more susceptible to the dynamic effects of hearing aid nonlinearity [ 1 , 37 , 38 ] . however , this study did not study systematically the effects of duration and level as they interact with context . further study on this may be necessary to determine the effects of phoneme level and duration . also , the preceding context within running speech may have differed in ways crucial to determination of gain / compression characteristics for the target phoneme . tables 5(a ) and 5(b ) illustrate that individual hearing aids may amplify individual phonemes differently , even though they were set to produce similar gain for long - duration signals . hearing aids not only varied in differences due to context but also showed differences for the same phoneme in the same context . differences in other parameters across hearing aid manufacturers have also been reported among hearing aids that were matched in gain characteristics ( e.g. , sound quality comparisons by dillon et al . ) . the finding that hearing aids show large individual variability makes it challenging to predict the nature of differences on a case - by - case basis in clinical practice . parameters such as amplitude and latency of individual peaks reflect changes in stimulus level or sensation level of the stimulus with reference to the behavioral threshold of the caep stimulus . a change in sensation level of the stimulus from a positive ( above threshold ; audible ) to a negative ( below threshold ; inaudible ) value is likely to decrease the probability of eliciting a caep . if output levels of phonemes in running speech are considered to be the reference condition of interest , caep test measures may underestimate audibility when phonemes are presented in isolation . these data indicate that underestimation is minimal ( about 2 db ) on average , but was between 3 and 8 db in over 24% of cases . there were also instances that may result in overestimation of audibility , but these are far fewer in number and magnitude . since the experimental conditions used in this study were limited to one duration of isi and one naturally occurring preceding context per phoneme , generalization to other instances and variation across durations or levels of phonemes may require further investigation . investigation of the effects of hearing aid signal processing on spectral characteristics such as formant transitions may also be possible , but these effects were not evaluated in this study . the effects of other aspects of hearing aid signal processing , such as digital noise reduction , may also be relevant and were not explored in this study . based on this study , we conclude that significant differences in hearing aid functioning between running speech and isolated phoneme contexts occur , along with considerable interhearing aid variability . in over a fourth of aided phonemes , the magnitude of these differences was large enough to impact calibration , or interpretation of group data . this may indicate the need to perform acoustic calibration for individual hearing aids for the purpose of well - defined caep stimuli . in 7%13% of phonemes , the differences exceeded that of an audiometric step size and therefore may be clinically important .

background . functioning of nonlinear hearing aids varies with characteristics of input stimuli . in the past decade , aided speech evoked cortical auditory evoked potentials ( caeps ) have been proposed for validation of hearing aid fittings . however , unlike in running speech , phonemes presented as stimuli during caep testing are preceded by silent intervals of over one second . hence , the present study aimed to compare if hearing aids process phonemes similarly in running speech and in caep testing contexts . method . a sample of ten hearing aids was used . overall phoneme level and phoneme onset level of eight phonemes in both contexts were compared at three input levels representing conversational speech levels . results . differences of over 3 db between the two contexts were noted in one - fourth of the observations measuring overall phoneme levels and in one - third of the observations measuring phoneme onset level . in a majority of these differences , output levels of phonemes were higher in the running speech context . these differences varied across hearing aids . conclusion . lower output levels in the isolation context may have implications for calibration and estimation of audibility based on caeps . the variability across hearing aids observed could make it challenging to predict differences on an individual basis .

1. Introduction 2. Method 3. Results 4. Discussion

hepatitis c virus ( hcv ) is a ribonucleic acid ( rna ) virus that causes chronic hepatitis and liver failure , worldwide.1,2 it consists of six different genotypes that are differentially distributed geographically.3,4 success of treatment varies greatly depending on the genotype.4,5 the genome contains cis - acting replication elements ( cres ) that are critical for hcv rna replication and translation.6,7 rna structural elements present in 5- and 3-untranslated regions ( 3utr ) of the hcv genome interact with viral and cellular proteins to initiate and facilitate the replication and translation processes.811 in our previous studies , we showed that rna secondary structure of the nonstructural ( ns)5b coding region of the hcv genome was required for hcv rna replication , and hence viral particle production.1215 it has been shown that the x region in the 3-utr of the hcv rna genome contains a highly conserved sequence.16 the latter have also been found to form stable secondary stem - loop structures that require physical contact between its rna - dependent rna polymerase for hcv replication.1719 we hypothesized that rna structural analogs resembling secondary stem - loop structure of the x region could be created that can compete with natural hcv genomic structure for binding to proteins and inhibit hcv replication . the aim of this study was to introduce rna structural analogs resembling these cres into human liver cells and to identify secondary structural elements of the hcv x - region involved in hcv replication and infection . in order to identify important secondary structural elements , the effects of hcv structural analogs on hcv replication in two model cell lines were studied : a constitutive replication model and an infection model . in addition , to evaluate whether differences in viral genotype could affect the possible interactions of structural analogs , viruses representing two different genotypes 1 and 2 , were studied . replicon cells , bb7 , a cell culture system containing the hcv genotype 1b genome , were obtained from apath ( st . louis , usa).20,21 cells were maintained in dulbecco 's modified eagle medium ( dmem ) supplemented with antibiotic / antimycotic solution ( invitrogen , usa ) , 10% fetal bovine serum ( fbs ) and 0.5 mg / ml g418 . for jfh-1 hcv genotype 2a studies , huh7.5 cells ( human hepatoma cell line ) ( obtained from dr . charles rice , rockefeller university , ny , usa ) were maintained in dmem supplemented with antibiotic / antimycotic solution and 10% fbs . jfh-1 complementary deoxyribonucleic acid ( cdna ) , an hcv genotype 2a strain , from dr . takaji wakita ( national institute of infectious diseases , tokyo , japan)2224 was used to produce infectious hcv viral particles in huh7.5.25,26 to make jfh-1 hcv stocks for infection , huh 7.5 cells were infected with jfh-1 hcv . media were collected 5 days post - infection and centrifuged at 1000g for 20 min to remove debris . jfh-1 hcv in media was concentrated with a centrifugal device ( 100k nmwl , amicon ultra , millipore , usa ) . infectivity levels of viral stocks were checked by quantitation of jfh-1 hcv rna in media 48 h post - infection of huh7.5 cells with hcv genotype 2a specific primers ( table 1 ) using real time reverse transcriptase polymerase chain reaction ( rt - pcr ) . the pcr conditions were : one cycle of 2 min at 50 c and 10 min at 95 c followed by 40 cycles of 15 sec at 95 c and 1 min at 60 c . specificity of all designed primers was determined with pcr amplification and sequencing of amplified product ( data not shown ) . melt curve analysis was performed following each rt - pcr to identify the presence of primer dimers and analyze the specificity of the reaction . cmv , cytomegalovirus ; fw , forward ; hcv , hepatitis c virus ; jfh-1 , japanese fulminant hepatitis virus-1 ; ldha , lactate dehydrogenase a ; rv , reverse . rna structural analog x-94 was designed to be 100% identical to the ( + ) strand of x - region ( 9508 - 9605 nucleotides ( nt ) ) on the 3-end of the hcv genotype 1b ( 94% identical to genotype 2a ) genome ( fig . 1a ) . to determine whether stem - loop structures versus specific sequences of hcv of rna were most important in hcv replication , base pair changes , described below , were made in stems ( analog x-12 ) and loops ( analog x-12c ) of analog x-94 ( fig . 1b and 1d ) . several software products are available for prediction of secondary structures of rna based on thermodynamic parameters . because of its high reliability and reproducibility , mfold ver 3.2 was used in the current study.2729 rna structural analogs x-12 and x-12c were predicted to adopt stem - loop structure identical to analog x-94 ( fig . table 3 shows the percent identity of the various rna structural analogs with hcv genotypes 1b and 2a . to determine the minimal structure of the x - region that could inhibit hcv rna replication , shorter rna structural analogs x-12a and x-12b ( fig . 1c ) were designed that were predicted to retain individual stem - loop structures of analog x-94.2729 all analogs were named based on hcv genome region studied and sequence homology of the analogues relative to the jfh-1 hcv genotype 2a genome . for expression studies , the x-94 sequence was subcloned into a psilencer 4.1 cytomegalovirus ( cmv ) puro plasmid ( ambion , usa ) , as previously described.12 psilencer 4.1 cmv puro plasmid enables high level expression of cloned hairpin short rna templates . expression vectors for rna structural analogs x-12 and x-12c were constructed from a plasmid expressing the rna analog x-94 using a quikchange ii site - directed mutagenesis kit ( agilent technologies , inc . 1b shows nucleotide replacements made in stems of analog x-94 resulting in analog x-12 , and fig . 1d illustrates nucleotide replacements made in loops of analog x-12 to construct analog x-12c . shorter rna structural analogs x-12a and x-12b ( fig . 1c ) were constructed from a plasmid expressing rna analog x-12 using a quikchange ii site - directed mutagenesis kit . these sequences were selected as non - overlapping fragments of x-12 that were individually predicted by mfold to retain all the structural elements present in the parent x-12 analog . 5b-74 rna analog , which was previously shown to inhibit viral genome replication12 was used as a positive control for inhibition of viral replication , and a plasmid expressing an unrelated sequence , hb , from hepatitis b virus was used as negative control . an rna structural analog 5b-46 was predicted to adopt stem - loop structures identical to analog 5b-74 as determined by mfold , and was constructed using a plasmid expressing rna analog 5b-74 with quikchange ii site - directed mutagenesis kit . sequences of each analog in psilencer 4.1 cmv puro plasmid ( ambion ) were verified with cmv puro primers ( table 1 ) as recommended by the manufacturer . for bb7 hcv genotype 1b replicon studies , cells were plated in 6-well plates 2 days before transfection . seventy - five percent confluent cells were transfected with various amounts of each plasmid to generate rna structural analogs individually or in combinations using lipofectamine ( life technologies ) according to manufacturer 's instructions . in brief , lipofectamine and plasmid dna were separately diluted in opti - mem i medium ( invitrogen ) without serum . after 15 min incubation , they were combined , incubated for 20 min at room temperature , and added to cells in varying concentrations . cells were harvested 48 h post - transfection with trizol ( invitrogen ) , and hcv rna levels quantitated in the cell lysates . for hcv genotype 2a infection studies , two models were used : transfection into cells with a pre - existing infection and transfection into cells before infection . for pre - existing jfh-1 hcv infection studies , 75% confluent huh7.5 cells were infected with jfh-1 hcv for 8 h and then transfected with plasmids expressing rna structural analogs with lipofectamine , as described above . in brief , cells were washed with phosphate buffered saline ( pbs ) . lipofectamine and plasmid dna were separately diluted in opti - mem i medium without serum . after a 15 min incubation , they were combined , and incubated for 20 min at room temperature before being added to cells . culture medium , 200 l , was collected for quantification of jfh-1 hcv levels , and replaced with fresh 200 l of cell culture medium at 0 , 4 , 8 , 12 , 24 , 36 , 48 , and 72 h of transfection . for before infection studies , 75% confluent huh7.5 cells in 6-well plates were transfected with 16 g of each plasmid expressing rna structural analogs , as described above . after 8 h of infection , cells were washed twice with pbs to remove input jfh-1 hcv . culture medium , 200 l , was collected for quantification of jfh-1 hcv levels and replaced with fresh 200 l of cell culture medium at 0 , 4 , 8 , 12 , 24 , 36 , 48 , and 72 h of infection . for bb7 hcv genotype 1b studies , whole cell rna was isolated from replicon cell lysates with an rneasy kit ( qiagen , germany ) according to manufacturer 's instructions and treated with rnase free dnase ( invitrogen ) . cdna was synthesized using 4 g dnase treated rna with superscript iii first - strand kit ( invitrogen ) and quantified by real time rt - pcr with power sybr green pcr master mix ( applied biosystems , usa ) using hcv genotype 1b specific primers ( table 1 ) according to manufacturer 's instructions . human lactate dehydrogenase a ( ldha ) mrna levels were quantified in each sample to normalize hcv rna levels using human ldha specific primers ( table 1 ) . assays were done in quadruplicate , and results expressed as mean standard error of hcv rna levels in cells transfected with analogs compared to untreated controls . for jfh-1 hcv infection studies , viral rna was extracted from 200 l media collected from infected cells with a qiaamp viral rna kit ( qiagen , germany ) according to manufacturer 's instructions . cdna was synthesized using 4 g rna with superscript iii first - strand kit ( invitrogen ) , and quantified by real - time rt - pcr with power sybr green pcr master mix ( applied biosystems ) using jfh-1 hcv rna specific primers ( table 1 ) according to manufacturer 's instructions . assays were repeated with three independent replicates , and results are expressed as means standard error of jfh-1 hcv rna levels in media from infected cells transfected with analogs before or after infection compared to untreated controls . in order to identify important secondary structural elements , the effects of hcv structural analogs on hcv replication in two model cell lines were studied : a constitutive replication model and an infection model . in addition , to evaluate whether differences in viral genotype could affect the possible interactions of structural analogs , viruses representing two different genotypes 1 and 2 , were studied . replicon cells , bb7 , a cell culture system containing the hcv genotype 1b genome , were obtained from apath ( st . louis , usa).20,21 cells were maintained in dulbecco 's modified eagle medium ( dmem ) supplemented with antibiotic / antimycotic solution ( invitrogen , usa ) , 10% fetal bovine serum ( fbs ) and 0.5 mg / ml g418 . for jfh-1 hcv genotype 2a studies , huh7.5 cells ( human hepatoma cell line ) ( obtained from dr . charles rice , rockefeller university , ny , usa ) jfh-1 complementary deoxyribonucleic acid ( cdna ) , an hcv genotype 2a strain , from dr . takaji wakita ( national institute of infectious diseases , tokyo , japan)2224 was used to produce infectious hcv viral particles in huh7.5.25,26 to make jfh-1 hcv stocks for infection , huh 7.5 cells were infected with jfh-1 hcv . media were collected 5 days post - infection and centrifuged at 1000g for 20 min to remove debris . jfh-1 hcv in media was concentrated with a centrifugal device ( 100k nmwl , amicon ultra , millipore , usa ) . infectivity levels of viral stocks were checked by quantitation of jfh-1 hcv rna in media 48 h post - infection of huh7.5 cells with hcv genotype 2a specific primers ( table 1 ) using real time reverse transcriptase polymerase chain reaction ( rt - pcr ) . the pcr conditions were : one cycle of 2 min at 50 c and 10 min at 95 c followed by 40 cycles of 15 sec at 95 c and 1 min at 60 c . specificity of all designed primers was determined with pcr amplification and sequencing of amplified product ( data not shown ) . melt curve analysis was performed following each rt - pcr to identify the presence of primer dimers and analyze the specificity of the reaction . cmv , cytomegalovirus ; fw , forward ; hcv , hepatitis c virus ; jfh-1 , japanese fulminant hepatitis virus-1 ; ldha , lactate dehydrogenase a ; rv , reverse . rna structural analog x-94 was designed to be 100% identical to the ( + ) strand of x - region ( 9508 - 9605 nucleotides ( nt ) ) on the 3-end of the hcv genotype 1b ( 94% identical to genotype 2a ) genome ( fig . 1a ) . to determine whether stem - loop structures versus specific sequences of hcv of rna were most important in hcv replication , base pair changes , described below , were made in stems ( analog x-12 ) and loops ( analog x-12c ) of analog x-94 ( fig . 1b and 1d ) . several software products are available for prediction of secondary structures of rna based on thermodynamic parameters . because of its high reliability and reproducibility , mfold ver 3.2 was used in the current study.2729 rna structural analogs x-12 and x-12c were predicted to adopt stem - loop structure identical to analog x-94 ( fig . 1b and 1d ) . table 3 shows the percent identity of the various rna structural analogs with hcv genotypes 1b and 2a . to determine the minimal structure of the x - region that could inhibit hcv rna replication , shorter rna structural analogs x-12a and x-12b ( fig . 1c ) were designed that were predicted to retain individual stem - loop structures of analog x-94.2729 all analogs were named based on hcv genome region studied and sequence homology of the analogues relative to the jfh-1 hcv genotype 2a genome . for expression studies , the x-94 sequence was subcloned into a psilencer 4.1 cytomegalovirus ( cmv ) puro plasmid ( ambion , usa ) , as previously described.12 psilencer 4.1 cmv puro plasmid enables high level expression of cloned hairpin short rna templates . expression vectors for rna structural analogs x-12 and x-12c were constructed from a plasmid expressing the rna analog x-94 using a quikchange ii site - directed mutagenesis kit ( agilent technologies , inc . 1b shows nucleotide replacements made in stems of analog x-94 resulting in analog x-12 , and fig . 1d illustrates nucleotide replacements made in loops of analog x-12 to construct analog x-12c . shorter rna structural analogs x-12a and x-12b ( fig . 1c ) were constructed from a plasmid expressing rna analog x-12 using a quikchange ii site - directed mutagenesis kit . these sequences were selected as non - overlapping fragments of x-12 that were individually predicted by mfold to retain all the structural elements present in the parent x-12 analog . 5b-74 rna analog , which was previously shown to inhibit viral genome replication12 was used as a positive control for inhibition of viral replication , and a plasmid expressing an unrelated sequence , hb , from hepatitis b virus was used as negative control . an rna structural analog 5b-46 was predicted to adopt stem - loop structures identical to analog 5b-74 as determined by mfold , and was constructed using a plasmid expressing rna analog 5b-74 with quikchange ii site - directed mutagenesis kit . sequences of each analog in psilencer 4.1 cmv puro plasmid ( ambion ) were verified with cmv puro primers ( table 1 ) as recommended by the manufacturer . for bb7 hcv genotype 1b replicon studies , cells were plated in 6-well plates 2 days before transfection . seventy - five percent confluent cells were transfected with various amounts of each plasmid to generate rna structural analogs individually or in combinations using lipofectamine ( life technologies ) according to manufacturer 's instructions . in brief , lipofectamine and plasmid dna were separately diluted in opti - mem i medium ( invitrogen ) without serum . after 15 min incubation , they were combined , incubated for 20 min at room temperature , and added to cells in varying concentrations . cells were harvested 48 h post - transfection with trizol ( invitrogen ) , and hcv rna levels quantitated in the cell lysates . for hcv genotype 2a infection studies , two models were used : transfection into cells with a pre - existing infection and transfection into cells before infection . for pre - existing jfh-1 hcv infection studies , 75% confluent huh7.5 cells were infected with jfh-1 hcv for 8 h and then transfected with plasmids expressing rna structural analogs with lipofectamine , as described above . in brief , cells were washed with phosphate buffered saline ( pbs ) . lipofectamine and plasmid dna were separately diluted in opti - mem i medium without serum . after a 15 min incubation , they were combined , and incubated for 20 min at room temperature before being added to cells . culture medium , 200 l , was collected for quantification of jfh-1 hcv levels , and replaced with fresh 200 l of cell culture medium at 0 , 4 , 8 , 12 , 24 , 36 , 48 , and 72 h of transfection . for before infection studies , 75% confluent huh7.5 cells in 6-well plates were transfected with 16 g of each plasmid expressing rna structural analogs , as described above . cells were then infected with jfh-1 hcv 48 h post - transfection . after 8 h of infection , cells were washed twice with pbs to remove input jfh-1 hcv . culture medium , 200 l , was collected for quantification of jfh-1 hcv levels and replaced with fresh 200 l of cell culture medium at 0 , 4 , 8 , 12 , 24 , 36 , 48 , and 72 h of infection . for bb7 hcv genotype 1b studies , whole cell rna was isolated from replicon cell lysates with an rneasy kit ( qiagen , germany ) according to manufacturer 's instructions and treated with rnase free dnase ( invitrogen ) . cdna was synthesized using 4 g dnase treated rna with superscript iii first - strand kit ( invitrogen ) and quantified by real time rt - pcr with power sybr green pcr master mix ( applied biosystems , usa ) using hcv genotype 1b specific primers ( table 1 ) according to manufacturer 's instructions . human lactate dehydrogenase a ( ldha ) mrna levels were quantified in each sample to normalize hcv rna levels using human ldha specific primers ( table 1 ) . assays were done in quadruplicate , and results expressed as mean standard error of hcv rna levels in cells transfected with analogs compared to untreated controls . for jfh-1 hcv infection studies , viral rna was extracted from 200 l media collected from infected cells with a qiaamp viral rna kit ( qiagen , germany ) according to manufacturer 's instructions . cdna was synthesized using 4 g rna with superscript iii first - strand kit ( invitrogen ) , and quantified by real - time rt - pcr with power sybr green pcr master mix ( applied biosystems ) using jfh-1 hcv rna specific primers ( table 1 ) according to manufacturer 's instructions . assays were repeated with three independent replicates , and results are expressed as means standard error of jfh-1 hcv rna levels in media from infected cells transfected with analogs before or after infection compared to untreated controls . analogs x-94 and x-12 were 100% and 59% identical to hcv genotype 1b , respectively , but were only 94% and 12% identical to the jfh-1 hcv genome , respectively . analog x-12c was 50% identical to hcv genotype 1b , and 0% identical to the jfh-1 hcv genome . to determine whether short rna sequences predicted to fold into secondary structural analogs of the x region of hcv rna genome could inhibit hcv replication , plasmids expressing rna analogs x-94 , x-12 , and x-12c were transfected in replicon cells . 2 shows that the effects of transfection of plasmids expressing rna structural analogs were dose - dependent and most effective at 16 g of plasmid . higher doses did not increase effects beyond those at 16 g , and based on this information , 16 g of each plasmid was used for transfection for subsequent experiments . 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assays showed no significant toxic effects due to dna transfection ( data not shown ) . replicon cells were transfected with various concentrations of plasmids expressing hb , 5b-74 , x-94 , and x-12 . hcv rna levels were quantified in cell lysates by qrt - pcr 48 h post - transfection . the values represent hcv1b rna levels in transfected cells compared to untreated controls ( n=4 ) , * p<0.001 . 3 shows that transfection of plasmids generating rna analogs affected hcv rna levels in replicon cells . after transfection of 5b-74 , 5b-46 , x-94 , x-12 , and x-12c at 16 g , hcv rna levels were decreased to 42% , 55% , 52% , 53% , and 54% , respectively , compared to levels of untreated controls . these differences were significant ( p<0.001 for all ) . an unrelated control plasmid ( hb ) generating an hbv sequence had no significant effect under identical conditions . furthermore , combinations of 5b-74 plus x-94 and 5b-46 plus x-12 administered at the same total dose , and under identical conditions , decreased hcv rna levels to 21% and 30% , ( p<0.001 ) , respectively , compared to untreated controls ( fig . these levels of inhibition for the combinations were greater than that for any individual analog alone . replicon cells were transfected with hb , 5b-74 , x-94 , x-12 , x-12c , 5b-74 plus x-94 , and 5b-46 plus x-12 , and hcv rna levels were quantified in cell lysates by qrt - pcr 48 h post - transfection . the figure represents hcv 1b rna levels in transfected cells compared to untreated controls ( n=4 ) , * p<0.001 . we wondered whether smaller structural elements could be produced that retained inhibitory effects . to test this hypothesis , two smaller analogs , x-12a and x-12b , were created that corresponded to nt 1 - 55 and nt 56 - 95 regions , respectively , of analog x-12 ( fig . transfection with x-12a decreased hcv rna to 58% , about the same as intact x-12 ( p<0.001 ) . however , the other fragment , x-12b , was much less effective , resulting in a level of only 78% and not significantly different from untreated control . a combination of x-12a plus x-12b inhibited levels to 60% of untreated controls , which was similar to the effects of x-12a alone ( fig . the data suggested that the x-12a region was the portion of the x analog that was responsible for the majority of the inhibitory activity . replicon cells were transfected with hb , 5b-74 , x-12a , x-12b , and x-12a plus x-12b , and hcv rna levels were quantified in cell lysates by qrt - pcr 48 h post - transfection . the figure represents hcv 1b rna levels in transfected cells compared to untreated controls ( n=4 ) , * p<0.001 . to determine whether rna structural analogs were also effective in an infection model and against a different hcv genotype , 5 shows that the levels in untreated controls increased progressively , and by 12 h , exceeded the level of input hcv rna levels by 6-fold ( extreme left bars ) at 72 h. in contrast , huh7.5 cells transfected with analogs 5b-74 , 5b-46 , x-94 , and x-12 and infected with jfh-1 48 h later , inhibited hcv rna levels to 5.9% , 6.2% , 6.6% , and 1.8% , respectively , compared to untreated controls ( p<0.001 ) . even after 72 h , no cells treated with analogs had hcv rna levels that exceeded more than 30% of input levels . huh7.5 cells were transfected with analogs hb , 5b-74 , 5b-46 , x-94 , and x-12 and then infected with jfh-1 hcv 48 h post - transfection . hcv rna levels in media were quantified by qrt - pcr at various time points post - infection . the values represent jfh-1 hcv rna levels in media from cells transfected with analogs 48 h before infection compared to untreated controls at various time points ( n=3 ) , * p<0.001 . to determine whether rna structural analogs could inhibit a pre - existing hcv infection , cells were infected with jfh-1 hcv for 8 h and then transfected with analogs hb , 5b-74 , 5b-46 , x-94 , and x-12 . 6 shows that there was a progressive increase in jfh-1 hcv rna levels with time in the media compared to uninfected controls . rna levels exceeded those of input virus at 12 h post - transfection and were four - fold higher by 72 h. however , 72 h after transfection with analogs 5b-74 , 5b-46 , x-94 , and x-12 ; hcv rna levels were 8.8% , 10.5% , 9.0% , and 11.6% , respectively , compared to untreated controls . huh7.5 cells infected with jfh-1 hcv , and then transfected with analogs hb , 5b-74 , 5b-46 , x-94 and x-12 8 h post - infection . hcv rna levels in media from infected cells were quantified by qrt - pcr at various time points post - transfection . the figure represents jfh-1 hcv rna levels in media from infected cells transfected with analogs 8 h post - infection compared to untreated controls at various time points ( n=3 ) , * p<0.001 . many previous studies , including our own , have shown that specific domains of the genomes of some rna viruses are critical for viral translation and replication.3032 the ns5b coding region of the hcv genome adopts a stem - loop structure that is involved in the replication of hcv . expression of rna structural analogs predicted to mimic the stem - loop structure identical to the ns5b region of the hcv genome was able to inhibit replication of hcv genotype 2a.12 the current study confirms previous reports that rna secondary structure is important for hcv rna replication.16,33 conserved genomic rna sequences have been shown to fold to adopt stem - loop motifs that interact with other rna motifs and/or proteins required for translation and replication.10,31,3437 identification of such rna sequences and determination of secondary structure formed by these sequences are challenging because structural motifs depend on various parameters , including host cellular microenvironments and the presence of other host and viral interacting molecules.29,3840 several types of software have been developed to predict the stable structures formed by rna sequences based on thermodynamic parameters . the current data generated by mfold software confirm our previous findings that structures predicted using these two - dimensional models do have substantial inhibitory activity against hcv replication . it is also clear that the actual molecules exist not in a two - dimensional but a three - dimensional state , and it is the latter that causes the inhibitory activity . nevertheless , the data support the notion that two - dimensional structures are related to and can predict the activity of analogs in three - dimensions . the structural analogs were effective in models of both genotype 1 and 2 viruses , suggesting that because the design of the molecules was based on secondary rather than primary structure , the effects are more likely to be multigenotypic . this may be clinically relevant as it has already been demonstrated that some current direct acting antiviral agents vary in efficacy against hcv genotypes41,42 and even subtypes.43 design of novel anti - hcv agents based on secondary structural considerations may offer a strategy to develop new agents that are independent of viral genotype or subtype . for hcv genotype 1b studies , a replicon cell model with an integrated hcv genome was used to constitutively generate subgenomic hcv1b replicons in huh7.5 cells.20 this system has been used extensively to determine the effects of various drugs and proteins on viral replication and infection.44,45 however , because hcv rna replication in this model is constitutive , it is not a simulation of hcv infection . for this reason , we examined here the effects of structural analogs on jfh1 , to provide a more realistic hcv infection model system.24,46,47 the results from the jfh-1 infection model systems offered insight into the differences in efficacy among structural analogs depending on whether they were introduced before or after viral infection . the jfh-1 hcv infection system has been used to determine the anti - hcv activity of several proteins and inhibitors ( example : raloxifene , nsc compounds ) before or after infection of hepatic cells.48,49 introduction of rna structural analogs after viral infection resembles treatment strategies for hepatocytes already infected with hcv , while exposure of cells before viral infection represents a potential prophylactic approach . expression of the stem - loop structure of x - region in the 3-utr of hcv genome ( using rna analogs x-94 , x-12 , and x-12c ) was found to be effective against hcv replication , regardless of the sequence of rna . furthermore , we have identified a small portion , one of the stem - loop structures of the x - region , x-12a , as the smallest identified portion of the x - region analog that retains inhibitory activity . the other stem - loop structure , x-12b of approximately the same length ; which also possesses natural hcv sequences , was virtually ineffective . these data confirmed that a specific structure , the stem - loop conformation , was involved , and that the observed inhibitory effects were not due a nonspecific interaction of hcv sequences . the studies on nucleotide base substitution in the x - region showing reduction in the identity to the natural hcv sequence to less than 50% , while retaining secondary structure , indicated that the observed inhibitory effects did not likely involve anti - sense mechanisms . the data indicate that conformation of secondary structures in 3-utr of hcv rna genome is required for hcv replication . stable expression of rna analogs predicted to have identical stem - loop structures , but sequences vastly different from hcv genomic rna , might inhibit hcv infection of hepatocytes in liver , and may represent a novel approach to design anti - hcv agents .

background and aimsthe noncoding regions in the 3-untranslated region ( utr ) of the hepatitis c virus ( hcv ) genome contain secondary structures that are important for replication . the aim of this study was to identify detailed conformational elements of the x - region involved in hcv replication.methodsribonucleic acid ( rna ) structural analogs x94 , x12 , and x12c were constructed to have identical conformation but 94% , 12% , and 0% sequence identity , respectively , to the x region of hcv genotype 2a . effects of structural analogs on replication of hcv genotypes 1b and 2a hcv rna were studied by quantitative reverse transcriptase polymerase chain reaction.resultsin replicon bb7 cells , a constitutive replication model , hcv rna levels decreased to 55% , 52% , 53% , and 54% after transfection with expression plasmids generating rna structural analogs 5b-46 , x-94 , x-12 , and x-12c , respectively ( p<0.001 for all ) . in an hcv genotype 2a infection model , rna analogs 5b-46 , x-94 , and x-12 in hepatic cells inhibited replication to 11% , 9% , and 12% , respectively . because the x-12 analog was only 12% identical to the corresponding sequence of hcv genotype 2a , the sequence per se , or antisense effects were unlikely to be involved.conclusionsthe data suggest that conformation of secondary structures in 3-utr of hcv rna genome is required for hcv replication . stable expression of rna analogs predicted to have identical stem - loop structures might inhibit hcv infection of hepatocytes in liver and may represent a novel approach to design anti - hcv agents .

Introduction Materials and methods Cell culture A genotype 1b BB7 constitutive replication system A Japanese Fulminant Hepatitis Virus-1 (JFH-1) HCV infection system RNA structural analogs Cloning and expression Quantitative RT-PCR (qRT-PCR) Results Discussion Conclusions

a 63-year - old male presented with complaints of gradually progressive painless diminution of vision in the left eye since last 1 year . the patient had undergone left eye optical penetrating keratoplasty 10 years back for leucomatous corneal opacity post corneal ulcer , managed medically . the patient presented to us with visual acuity of 6/36 in the left eye with astigmatism of 6.50 diopter cylinder ( dc ) at 30 and unaided visual acuity of 6/9 in the right eye . slit - lamp examination of the left eye revealed clear , full thicknesscorneal graft of around 8 mm diameter with no graft edema , and cataract of nuclear colour ( nc ) and nuclear opalescence ( no ) of grade 4 . early morning ultrasound pachymetry was 526 m for the left eye and 546 m for the right eye . a complete ophthalmological examination including refraction , pentacam for corneal topography , specular microscopy and pachymetry , biometry , iol selection and systemic investigations were performed . preoperative , endothelial cell count was 1450 cells/ mm on specular microscopy . iol master keratometry readings of k1 44.25 d at 55 , k2 54.0 d at 145 with preoperative corneal astigmatism of + 9.75 dc at 145 and average keratometry reading of 49.13 d were used for iol power calculation . as per the calculation , the iol recommended was acrysof sn60t9 spherical equivalent + 6 d with residual cylindrical power of 5.48 d at 146 at the corneal plane [ fig . 1 ] . the patient underwent clear corneal phacoemulsification using infiniti , ozil system after markings for acrysof toric iol , with special surgical considerations for the corneal graft . incision was placed at 110 with acrysof toric iol marks aligned along 146. the preoperative 3 , 6 and 9 o clock markings were made with nuijts reference corneal marker under topical anaesthesia with the patient sitting upright . intraoperatively , location of the corneal incision and axis of iol placement was marked using mendez ring and nuijts toric axis marker . preoperative intraocular lens power calculation for acrysof sn60t9 was spherical equivalent + 6 d with residual cylindrical power of 5.48 d at 146 at the corneal plane two clear corneal side - port incisions were made at 2 and 9 o clock hour positions . graft endothelium was coated with viscoat , alcon ( 3% sodium hyaluronate + 4% chondroitin sulfate ) and anterior chamber formed with healon gv , amo ( arshinoff soft shell technique ) . triplanar clear corneal incision was made at 110. well - centered , approximately 5-mm continuous curvilinear capsulorrhexis was completed . capsular bag was filled with healon gv and iol implanted into capsular bag with the axis of the iol aligned around 15 short of the final axis of alignment ( 146 ) . viscoelastic removal was done along with final rotation of the iol , and the axis aligned [ fig . 2 ] . postoperatively , the patient was reviewed on day 1 , 3 , 14 days , 6 weeks , 4 months and 10 months . on the immediate postoperative day , the corneal graft was clear with well - formed anterior chamber with 1 + cellular reaction , and well - centered aligned iol with an intraocular pressure of 13 mmhg in goldmann applanation tonometer . refraction 6 weeks postoperative was 2.0 dc at 20 , vision improving to 20/30 on snellen visual acuity chart . the patient was examined at 10 months follow - up and has best - corrected visual acuity ( bcva ) of 20/30 and no rotation of toric iol [ fig . 3 ] . capsular bag implanted toric intraocular lens ( iol ) at the end of surgery after viscoelastic removal . note the position of toric iol marks on the optic postoperatively at 10 months , there was clear corneal graft and no rotation of intraocular lens was noted at present , toric iol provides an effective management option for the correction of post - keratoplasty high astigmatism and cataract.[812 ] nuijts et al . implanted artisan phakic toric iol for the correction of post - keratoplasty high corneal astigmatism in 36 eyes of 35 patients and achieved an average of 88.8% reduction of astigmatism . but there was continued loss of the endothelial cells till 3 years of follow - up . reported the use of icl , a posterior chamber phakic toric iol , for post - keratoplasty astigmatism . no serious complication or refractive shift occurred at 1 year post surgery follow - up . the above authors have used phakic toric iols . in our patient with post - keratoplasty high corneal astigmatism with coexisting cataract , we used acrysof toric iol . this patient achieved bcva of 6/9 with astigmatism of 2 dc at 20 ( astigmatism reduced to roughly one third ) with clear corneal graft . the better refractive result than that calculated can be explained as after keratoplasty , the biomechanical response of the corneoscleral tissue to the incision may be somewhat unpredictable , and a greater variability in surgically induced astigmatism may be seen . in conclusion , acrysof toric iol provides excellent correction of post - keratoplasty high corneal astigmatism in patients with coexistent cataract .

we report a 63-year - old male who had undergone left eye optical penetrating keratoplasty for central leucomatous corneal opacity 10 years earlier . the eye had clear donor graft with residual astigmatism of 6.50 diopter cylinder ( dc ) at 30. the patient underwent clear corneal phacoemulsification with implantation of + 6.0 d spherical equivalent acrysof sn60t9 intraocular lens ( iol ) . postoperatively , at 10 months , the patient had distance corrected visual acuity of 20/30 with 2.00 dc at 20. acrysof toric iol offers an effective treatment option for post - keratoplasty high corneal astigmatism in patients with cataract .

Case Report Discussion

clathrin - independent endocytosis includes the constitutive pinocytotic pathway as well as endocytosis mediated by caveolae and glycolipid rafts . glycolipid rafts are detergent - insoluble , low - density membrane fractions that are rich in cholesterol and sphingolipids ; caveolae are cholesterol- and sphingolipid - rich smooth invaginations of the plasma membrane that partition into raft fractions and whose expression is associated with caveolin-1 . caveolae are therefore a subdomain of the biochemically defined glycolipid raft ( anderson , 1998 ; kurzchalia and parton , 1999 ) . the consequent sensitivity of endocytosis , via both caveolae and rafts , to nonacute cholesterol depletion with agents such as filipin , nystatin , or methyl--cyclodextrin distinguishes these pathways from both the clathrin - dependent and constitutive pinocytotic pathways . caveolae and raft pathways mediate the internalization of sphingolipids and sphingolipid binding toxins ( cholera toxin [ ctx ] * and shiga toxin ) , gpi - anchored proteins , the autocrine motility factor ( amf ) , endothelin , growth hormone , and il2 receptors , viruses ( including sv40 ) , and bacteria ( nichols and lippincott - schwartz , 2001 ; duncan et al . , 2002 ; johannes and lamaze , 2002 ; pelkmans and helenius , 2002 ; conner and schmid , 2003 ) . the gtpase activity of dynamin is required for the budding of caveolae from purified endothelial plasma membranes ( oh et al . , 1998 ) . microinjection of antidynamin antibodies , or expression of a dominant negative dynamin k44a mutant ( dynk44a ) deficient in gtp hydrolysis , prevents the caveolae- and raft - mediated internalization of various molecules ( henley et al . , 1998 ; dessy et al . , 2000 ; lamaze et al . , 2001 ; puri et al . , 2001 ; le et al . , 2002 ; pelkmans et al . , 2002 ; le and nabi , 2003 ) . in contrast , a defining feature of the pinocytotic pathway is its insensitivity to dynamin inhibition ( damke et al . the caveolae- and raft - dependent pathways are therefore characterized by a common sensitivity to cholesterol depletion and inhibition of dynamin function . few to no caveolae are present in cells in which caveolin-1 expression levels are significantly reduced or absent , and the reintroduction of caveolin-1 into these cells induces the formation of caveolae at the plasma membrane ( fra et al . , 1995 ; and others ) . a central dogma of the caveolae / glycolipid raft field , therefore , has been that the invaginated flask - shaped morphology of caveolae is a specific consequence of the association of caveolin-1 with select raft domains . however , even in the absence of caveolin , the internalization of rafts must invoke the invagination and budding of a vesicular structure that is cholesterol and sphingolipid rich and necessarily related to caveolae . the commonly accepted view that caveolae and rafts mediate distinct endocytic pathways ignores the extensive fundamental similarities between these two processes . in this review , we argue that caveolae and rafts mediate a common endocytic pathway , caveolae / raft - dependent endocytosis , defined by its clathrin independence , dynamin dependence , sensitivity to cholesterol depletion , and the morphology and lipid composition of the vesicular intermediate . the internalization of caveolae is facilitated by disruption of the actin cytoskeleton , inhibited by the kinase inhibitors staurosporine and genistein , and enhanced by the phosphatase inhibitors okadaic acid and vanadate ( parton et al . , 1994 ; pelkmans et al . , 2001 ; mundy et al . , 2002 ; nichols , 2002 ; pelkmans et al . , 2002 sv40 binding to the cell surface activates a tyrosine kinase based signaling cascade , disrupting the local actin cytoskeleton , and recruiting dynamin ii to the site of internalization where it is endocytosed together with caveolin-1-gfp ( pelkmans et al . , 2002 ) . albumin binding to its receptor , gp60 , triggers caveolae endocytosis via a gi - coupled src kinase mediated pathway ( minshall et al . , 2000 ) . caveolin-1 interaction with gp60 is required for albumin uptake , and albumin uptake is inhibited in caveolin-1 null cells ( minshall et al . , 2000 ; razani et al . , 2001 ) . the internalization of some caveolar ligands is , therefore , a signal - mediated process that requires caveolin-1 expression . for instance , amf follows an essentially equivalent cholesterol- and dynamin - dependent pathway to the er in caveolin - expressing nih-3t3 cells as well as in transformed nih-3t3 cells that express little caveolin and few cell surface caveolae ( benlimame et al . , 1998 ; le et al . , 2002 ) . internalization of ctx via caveolae to the golgi apparatus is cholesterol sensitive and occurs via a caveolin-1positive endosomal intermediate ( parton et al . , 1994 ; henley et al . , 1998 ; nichols et al . , 2001 ; puri et al . , 2001 ; nichols , 2002 ; wolf et al . , 2002 ; le and nabi , 2003 ) . at the same time pathway in caco-2 cells and jurkat lymphoma cells that do not express caveolin-1 ( orlandi and fishman , 1998 ) . furthermore , reduction of caveolin-1 expression in cos-7 cells with rnai does not prevent ctx delivery to the golgi ( nichols , 2002 ) . due to the absence of caveolae in caveolin - deficient cells and of a defined vesicular intermediate for the raft pathway , in lymphocytes that do not express caveolin , cross - linked gpi - anchored proteins cluster in smooth vesicles morphologically equivalent to caveolae before endocytosis ( deckert et al . , 1996 ) . expression of dynk44a in abl - transformed nih-3t3 cells that express little caveolin and few caveolae results in the expression of smooth invaginations that are morphologically indistinguishable from caveolae induced in the same cells by expression of caveolin-1 ( fig . the dynk44a - induced smooth invaginations are derived from cholesterol - rich glycolipid raft domains as they are not present in cells treated with methyl--cyclodextrin ( le et al . , 2002 ) . the fact that these caveolae can only be visualized when budding is inhibited indicates that , upon invagination , they exhibit a limited residence time at the plasma membrane . instability of invaginated rafts at the plasma membrane would necessarily limit morphological detection of these structures , especially in ultrathin electron microscopy sections that represent but a fraction of the total plasma membrane surface . the extent to which , in the absence of caveolin-1 , invagination and budding are intrinsic properties of the raft domain remains to be determined . ligand binding and antibody cross - linking may serve not only to recruit receptors to rafts but also contribute to the formation and internalization of these domains ( parton et al . , 1994 ; deckert et al . , 1996 ; verkade et al . , 2000 ; lamaze et al . , 2001 ; fivaz et al . , 2002 ) . v - abl - transformed nih-3t3 cells that exhibit minimal caveolin expression and few cell surface caveolae were infected with adenoviruses coding for either the dynamin k44a mutant ( dynk44a ) or caveolin-1 ( cav-1 ) , and the cells were then processed for electron microscopy . for details , see le et al . , 2002 . although raft - derived smooth vesicles are technically raft invaginations , use of this nomenclature implies that raft - derived smooth invaginations mediate different endocytic processes than do caveolae . caveolar invaginations and caveolar vesicles therefore encompass both endocytosis - competent caveolin - positive caveolae and more transient caveolin - negative raft - derived morphological equivalents . this represents a nomenclature that reflects the similar morphology , lipid composition , and role in endocytosis of these domains . associated caveolae are a functionally distinct organelle whose expression and function are associated with caveolin-1 expression ( fig . 2 a ) . caveolae are not observed in endothelial cells of caveolin-1 knock - out mice , although some smooth caveolae - like invaginations were reported ( drab et al . , 2001 ; razani et al . , 2001 ; zhao et al . , 2002 ) . the extent to which the caveolae / raft - dependent pathway functions in caveolin-1 null cells and whether expression of the dynk44a mutant induces the expression of caveolar invaginations in these cells represent critical experiments that remain to be performed . ( a ) the cholesterol - dependent invagination of glycolipid rafts occurs independently of caveolin-1 expression and results in the formation of caveolar invaginations that remain only transiently associated with the plasma membrane . caveolin-1 is a negative regulator of the budding of caveolar invaginations , and caveolin-1expressing stable cell surface caveolae can become endocytosis competent aftert specific signaling events . caveolar invaginations bud in a dynamin - dependent manner from the plasma membrane to form caveolar vesicles . ( b ) cop- dependent pathways target ctx ( blue ) and sv40 ( green ) via the caveosome for delivery to the golgi and er , respectively , whereas amf ( red ) is targeted via a distinct pathway that is apparently direct to the er . ctx and sv40 could alternatively be targeted to a common caveosome ( gray ) and subsequently segregated for delivery to the golgi and er , respectively ( dashed lines ) . frap studies have shown that caveolin-1 gfp is highly immobile at the plasma membrane and that only a minority of caveolin-1 gfp - positive vesicles actually internalize ( pelkmans et al . , 2001 ; mundy et al . , 2002 ; thomsen et al . , decreased expression of caveolin-1 in ras and abl - transformed nih-3t3 cells is associated with the increased endocytosis of amf to the er ; reintroduction of caveolin-1 specifically reduces the er delivery of amf identifying caveolin-1 as a negative regulator of caveolae / raft - dependent endocytosis ( le et al . , 2002 ) . caveolin-1 therefore appears not to induce raft invagination but rather to stabilize the plasma membrane association of invaginated rafts retarding their dynamin - dependent budding and detachment ( fig . association of caveolin-1 with raft domains may act as a lock that regulates their dynamic constitutive endocytosis and that can be opened by specific signaling events . if so , ligand internalization via caveolae / raft - dependent endocytosis may be signal mediated in cells expressing caveolin-1 but not in cells exhibiting minimal caveolin-1 expression levels . caveolin may act by regulating the cholesterol content of raft domains ( roy et al . , 1999 ) , by retarding the dynamin - dependent budding of caveolae ( henley et al . , 1998 ; oh et al . , 1998 ; le et al . , 2002 ) , or by sequestering signaling molecules , such as g proteins , required for caveolae / raft internalization ( minshall et al . , 2000 ; oh and schnitzer , 2001 ) . increasing caveolin-1 association with individual raft domain levels may progressively reduce their endocytic potential . alternatively , the requirement of a threshold level of cholesterol for caveolae invagination ( hailstones et al . , 1998 ) suggests that a threshold level of caveolin-1 association with individual rafts may be required to stabilize the plasma membrane association of caveolae . the latter possibility envisions the existence within the same cell of dynamic , highly endocytic raft domains as well as more stable , plasma membrane - associated , less endocytic caveolae ( van deurs et al . , 2003 ) . caveolae and rafts represent highly heterogeneous populations of functionally distinct membrane domains ( maxfield , 2002 ) . multiple raft - associated proteins may therefore serve to segregate and define raft domains that exhibit differential endocytic capacities . the existence of multiple caveolin-1 binding partners ( liu et al . , 2002 ) implicates caveolin-1 as a scaffolding molecule that determines the cargo for caveolae / raft - dependent endocytosis . for instance , cholera , shiga , and anthrax toxins bind to cell surface raft domains and yet are internalized via clathrin - dependent pathways ( sandvig et al . , 1989 ; shogomori and futerman , 2001 ; abrami et al . , 2003 ) . raft association can not therefore be considered a criterion in and of itself for internalization via the caveolae / raft - dependent pathway . two caveolar ligands , sv40 and ctx , are delivered to a caveolin-1positive endocytic compartment or caveosome ( parton et al . , 1994 ; pelkmans et al . , 2001 ; nichols , 2002 ) . the caveosome is distinguished from the early endosome by its neutral ph and by the expression of caveolin-1 ( pelkmans et al . , 2001 ) . whether the caveosome is a fusion station for budding caveolar vesicles or rather a sorting site is not yet clear . distinct caveolin-1positive endocytic structures are labeled for sv40 and ctx ( nichols , 2002 ) , suggesting that sorting of these two caveolar ligands for delivery to the golgi and er , respectively , may occur before delivery to distinct endosomal populations . although sv40 has been reported to be targeted to the er without traversing the golgi ( kartenbeck et al . , 1989 ) , the intracellular targeting of both sv40 and ctx is cop - mediated ( norkin et al . , 2002 ; richards et al . ctx and sv40 could conceivably take the same retrograde route to the er with significantly different resident times in the golgi . alternatively , sorting of these two ligands may occur either at the plasma membrane , targeting different caveosome populations , or via segregation within the caveosome , resulting in different intracellular targeting routes ( fig . interestingly , although treatment with the microtubule - depolymerizing agent nocodazole , brefeldin a , or a 20c temperature block disrupts the delivery of ctx and/or sv40 to the golgi and er , respectively ( pelkmans et al . , 2001 ; norkin et al . , 2002 ; richards et al . , 2002 ) , none of these treatments affects amf delivery to the smooth er . furthermore , amf and ctx internalized via caveolae / raft - dependent pathways do not localize to common intracellular compartments ( le and nabi , 2003 ) . endocytic ligands can therefore be sorted at the plasma membrane to different caveolae / raft domains for internalization to distinct intracellular compartments , including an apparently direct route to the er ( fig . segregation of caveolar endocytic cargo has also been demonstrated in endothelial cells in which albumin and insulin are localized to distinct caveolae populations ( bendayan and rasio , 1996 ) . the multiple mechanisms that exist to regulate recruitment to caveolae / raft domains may also serve to segregate and sort lipids and proteins to functionally distinct raft domains that follow varied intracellular targeting pathways . caveolae- and raft - mediated endocytosis therefore represent essentially equivalent clathrin - independent , dynamin - dependent , cholesterol - sensitive endocytic routes with similar ligand specificity and morphology of the vesicular intermediate . caveolin-1 acts not as a determinant of caveolae invagination and internalization but rather as a regulator that stabilizes caveolae at the plasma membrane and reduces the endocytic potential of caveolae / raft domains . the existence of distinct endocytic routes for caveolae / raft - internalized ligands demonstrates that raft heterogeneity at the plasma membrane functionally segregates raft - associated proteins and lipids to generate distinct caveolar vesicles . although caveolins are certainly implicated in this sorting event , other factors yet to be identified are necessarily determinants of the formation , endocytic potential , and intracellular targeting of raft domains .

although caveolae are well - characterized subdomains of glycolipid rafts , their distinctive morphology and association with caveolins has led to their internalization being considered different from that of rafts . in this review , we propose that caveolae and rafts are internalized via a common pathway , caveolae / raft - dependent endocytosis , defined by its clathrin independence , dynamin dependence , and sensitivity to cholesterol depletion . the regulatory role of caveolin-1 and ligand sorting in this complex endocytic pathway are specifically addressed .

Introduction Endocytosis of caveolae/raft domains Morphologically equivalent vesicles mediate endocytosis of caveolae and rafts Caveolin-1 stabilizes the cell surface expression of raft domains Sorting in caveolae/raft-dependent endocytosis Conclusion

organisms ' adaptation to environmental stress has become a subject of great interest over the last decades [ 15 ] . like other organisms , budding yeast saccharomyces cerevisiae has developed several strategies to survive stressful changes in their environment . clearly , yeast cells respond rapidly and modify their internal systems to prevent dramatic events . depending on the intensity and type of stress , it is widely believed that cell exposure to mild stress results in the acquisition of cellular resistance to further lethal stress , what is called adaptive response or the phenomenon has been observed in various organisms : from bacteria to humans . in many cases , an exposure to mild stress develops tolerance not only to higher doses of the same stressor but also to stress caused by other factors . cross - adaptation [ 6 , 7 ] , suggests the existence of complex mechanisms , which sense and respond to different kinds of stress . the literature includes data on s. cerevisiae general response , pre - adaptation , and cross - adaptation to extreme temperatures , osmotic shock , and oxidative stress [ 2 , 6 , 812 ] . there is information on the increased resistance to severe stress in yeast preexposed to mild sublethal stress , which requires the global - stress transcription factors msn2/4p to regulate induction of the so - called environmental stress response genes [ 6 , 11 ] . activation of msn2/4p , in particular , is an important way to induce antioxidant defense against hydrogen peroxide [ 13 , 14 ] . yap1p transcriptional regulatory protein also mediates an adaptive response of yeast to h2o2-induced stress [ 4 , 9 , 1315 ] . sublethal hormetic concentrations of hydrogen peroxide are believed to induce a protective response with increased resistance to subsequent lethal stress in yeast cells [ 6 , 7 , 10 , 16 ] . however , unlike msn2/4p , the potential role of yap1p in the cross - adaptation phenomenon is poorly investigated . yap1p is found to be localized in the cytoplasm under nonstressful conditions , but upon exposure to hydrogen peroxide it rapidly translocates to the nucleus and changes the expression of target genes [ 1719 ] . although yap1p was earlier suggested to play a minor role in the regulation of gene expression under ethanol stress , like h2o2 , ethanol was recently found to trigger yap1 nuclear accumulation and activate some antioxidant enzymes in s. cerevisiae . in the present study , we have shown that low hormetic concentrations of hydrogen peroxide as well as ethanol stimulated yeast colony growth . therefore , we evaluated the role of one substance in cell cross - adaptation to the other substance as well as some weak organic acid preservatives , and potential role of yap1p in yeast cross - adaptation by hormetic concentrations of hydrogen peroxide and ethanol to stressful conditions . the saccharomyces cerevisiae strains used in this study are yph250 ( wild type : mat a trp1-1 his3-200 lys2 - 801 leu2-1 ade2 - 101 ura3 - 52 ) and its isogenic derivative yap1 ( yph250 yap1::his3 ) described earlier . the strains were kindly provided by professor yoshiharu inoue ( kyoto university , japan ) . yeast cells were grown in erlenmeyer flasks containing ypd liquid medium ( 1% yeast extract , 2% peptone , and 2% glucose ) in a volume that respected the ratio 1 : 5 regarding media volume to flask volume . , 28c , and ph 7.0 for 24 h to late exponential phase ( a600 ~ 0.8 - 0.9 ) . the experimental culture after growth under the conditions mentioned above was split into three groups : one exposed to stress , another preadapted by low concentrations of hydrogen peroxide or ethanol and then exposed to stress , and the last one serving as a control to which none of the abovementioned substances was added . for stress induction , aliquots of experimental culture were incubated at 28c with 50 mm h2o2 for 30 min , 15% or 20% ethanol for 60 min , and 200 mm acetic or 100 mm propionic acid for 120 min . at low ph , acetic acid ( pka 4.75 ) and propionic acid ( pka 4.88 ) exist mainly in the undissociated state , in which they enter the cell rather easily . for acid stress , the ph value of ypd medium was adjusted to 3.0 with hcl in order to reach maximum penetration of the acids into cells [ 24 , 25 ] . under stress induced by hydrogen peroxide or ethanol the ph value of ypd medium was 7.0 . to study the preadaptation effect on cell survival under stress , aliquots of experimental culture were preincubated with 0.05 , 0.25 , and 0.5 mm h2o2 or 1% , 2.5% , and 5% ethanol at 28c and ph 7.0 for 30 or 60 minutes , respectively . control cells were incubated under the same conditions but without hydrogen peroxide , ethanol , acetate , or propionate . in preliminary experiments , it was shown that yeast colony growth was virtually the same at ph 3.0 and 7.0 [ 7 , 26 ] . thus , control cells for acetate- and propionate - induced stress were incubated in ypd medium at ph 3.0 without organic acids . yeast colony growth was analyzed by plating in triplicate on ypd agar after proper dilution . the plates were incubated at 28c for 3 days and the colony forming units ( cfu ) were counted . yeast colony growth was expressed as percentage of total amount of respective control cells plating on ypd agar . experimental data are expressed as the mean value of 46 independent experiments the standard error of the mean ( sem ) , and statistical testing used student 's t - test . the biphasic - dose response to hydrogen peroxide is the phenomenon of particular interest in hormesis research [ 8 , 2831 ] . in the case of budding yeast , special attention is focused on the concentrations of hydrogen peroxide ( 0.4 mm ) found to stimulate yeast colony growth by about 30% ( stimulatory / hormetic zone ) . at the same time , hydrogen peroxide has been shown to induce cell toxicity at concentrations higher than 0.5 mm . earlier , the nonlinear dependence of s. cerevisiae rz53 - 6 survival on different concentrations of hydrogen peroxide was demonstrated by davies and colleagues . in the present study , we observed nonlinear dependence of s. cerevisiae yph250 viability on different levels of h2o2 ( figure 1 ) . since h2o2 low concentrations ( 0.5 mm ) inhibited significantly the colony growth of yap1 mutant derived from yph250 wild type ( figure 1 ) , we suggested yap1p involvement in hormetic effect by low doses of hydrogen peroxide in the parental strain . in different animal models , the dose - response curve for ethanol is also biphasic showing an inhibitory effect at high doses but a stimulatory effect at low doses [ 32 , 33 ] . we observed non - linear dose response to ethanol in s. cerevisiae yph250 wild strain ( figure 2 ) . yeast ability to form colonies in cultures treated with 1% ethanol was decreased by 30% comparing to untreated control cells . cells exposed to 2.5% ethanol demonstrated percent colony growth that exceeded the original control value by about 20% . at the higher concentrations used ( 5% ) , figure 2 demonstrates also the influence of different concentrations of ethanol on the reproductive ability of yap1 mutant isogenic derivative of yph250 . generally , the effect is somewhat similar to that obtained for yph250 parental strain . it should be noted that 2.5% ethanol increased the parameter comparing with that found for cells exposed to 1% ethanol , but colony growth of the yap1 cells treated with 2.5% ethanol did not exceed the initial control value . we also supposed that yap1 regulatory protein was involved in some way in the stimulation of yeast colony growth under stress induced by 2.5% ethanol ( figure 2 ) . the yap1 transcription factor controls the expression of over 150 genes in the response of s. cerevisiae to hydrogen peroxide [ 3436 ] . since most of them were found to play an important role in yeast survival under h2o2-induced stress , we expected that yap1p was involved in hormetic effect by hydrogen peroxide . at the same time , there are somewhat controversial data regarding yap1p activation by ethanol . earlier yap1p was suggested to play a minor role in regulation of gene expression under ethanol stress in s. cerevisiae ; however , ethanol was recently found to trigger yap1 nuclear accumulation and to activate some antioxidant enzymes in the yeast . since both hydrogen peroxide and ethanol at low concentrations were found to stimulate the colony growth of s. cerevisiae wild type , next we evaluated the role of one substance in cell cross - adaptation to the other substance as well as some weak organic acid preservatives . figure 3 shows the effect of yeast pretreatment with low h2o2 concentrations on its reproductive ability under stress induced by ethanol , acetate , and propionate . as seen in the figure , all the stressors significantly inhibited colony growth of s. cerevisiae yph250 ( by 35% , 57% , 23% , and 32% in response to 15% or 20% ethanol and 200 mm acetate or 100 mm propionate , resp . ) . yeast pretreatment with hormetic doses of hydrogen peroxide markedly increased reproductive ability under the stressful conditions . for example , the highest colony growth ( 134% and 118% comparing to control untreated cells ) was observed in yeast preincubation with 0.25 mm h2o2 and then stressed by 15% or 20% ethanol . in the case of weak organic acids , the highest reproductive ability was observed in yeast pre - treated with 0.5 mm h2o2 ( 118% and 113% for acetate- and propionate - exposed cells , resp . ) . hydrogen peroxide is known to affect expression of a variety of genes involved in signal transduction , transcriptional regulation , antioxidant defence , and protein , carbohydrates , or lipid metabolism in different organisms [ 9 , 1214 , 29 , 3539 ] . that is why at low hormetic concentrations , h2o2 may act as an important signal molecule stimulating various defensive mechanisms and enhancing survival of yeast cells under lethal stress . it should be noted that , comparing to the wild type , yap1 mutant demonstrated significantly higher sensitivity to all the types of stressors and no cross - adaptation by low concentrations of hydrogen peroxide to any stressors used ( figure 4 ) . the latter confirms an important role of yap1p in cross - adaptation effect by hormetic doses of hydrogen peroxide in parental yph250 strain . earlier it was suggested that depending on strain genotype , ethanol either provided or did not provide yeast protection against environmental stress . despite the fact that yeast cells demonstrated non - linear dose response to ethanol ( figure 2 ) , we did not observe any stimulatory effect by ethanol preadaptation on colony growth of yeast under stressful conditions ( figure 5 ) . as seen , 50 mm h2o2 , 200 mm acetate , and 100 mm propionate inhibited s. cerevisiae yph250 ability to form colonies by 33% , 76% , and 69% , respectively , and preexposure of yeast by ethanol did not change the parameter . as seen in figure 6 , yap1 mutant demonstrated much higher sensitivity to all the types of stressors comparing to wild type as well as no cross - adaptation by ethanol to any stressors used . this study demonstrates that , unlike ethanol , hormetic concentrations of hydrogen peroxide cause cross - resistance of s. cerevisiae yph250 to different stresses . the regulatory protein yap1 plays an important role in the hormetic effects caused by low concentrations of either hydrogen peroxide or ethanol , and it is involved in the yeast cross - adaptation to stressful conditions by low sublethal doses of hydrogen peroxide .

the biphasic - dose response of microorganisms to hydrogen peroxide is a phenomenon of particular interest in hormesis research . in different animal models , the dose - response curve for ethanol is also nonlinear showing an inhibitory effect at high doses but a stimulatory effect at low doses . in this study , we observed the hormetic - dose response to ethanol in budding yeast s. cerevisiae . cross - protection is a phenomenon in which exposure to mild stress results in the acquisition of cellular resistance to lethal stress induced by different factors . since both hydrogen peroxide and ethanol at low concentrations were found to stimulate yeast colony growth , we evaluated the role of one substance in cell cross - adaptation to the other substance as well as some weak organic acid preservatives . this study demonstrates that , unlike ethanol , hydrogen peroxide at hormetic concentrations causes cross - resistance of s. cerevisiae to different stresses . the regulatory protein yap1 plays an important role in the hormetic effects by low concentrations of either hydrogen peroxide or ethanol , and it is involved in the yeast cross - adaptation by low sublethal doses of hydrogen peroxide .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

lateral closed wedge high tibial osteotomy ( hto ) described by jackson and waugh and coventry is an established technique to treat osteoarthritis of the medial compartment and varus deformity . the advantages of a medial opening wedge osteotomy compared with a lateral closing wedge osteotomy include easier technique , achievement of more predictable correction , maintenance of bone stock , correction of the deformity close to its origin , and avoidance of the peroneal nerve , and , proximal tibiofibular joint . however , a suitable material to fill the opened defect in the medial opening procedure has not been identified . although autogenous bone is the preferred graft material for filling bone defects , autogenous bone grafting has the disadvantages of co - morbidity at the donor site . allografts have commonly been used as substitutes for autogenous bone grafts ; significant problems associated with allografts include a low bone fusion rate and disease transmission [ 2 , 8 ] . hydroxyapatite is widely used as a bone substitute because of its excellent biocompatibility and osteoconductive properties [ 9 , 14 ] . although it biodegrades slowly and there is no progressive bone formation during the bone repair . . reported good long - term results after opening hto using hydroxyapatite as a bone filler . if , however , severe varus or valgus knee deformities were to occur , fixing a component in the tibia during total knee arthroplasty might be difficult . in contrast , most implanted porous -tricalcium phosphate ( tcp ) can be resorbed within a few years . in previous studies , we used -tcp with 75 % porosity , but this has a compressive strength of only 3 mpa , which is inadequate for weight - bearing sites until bone incorporation occurs . thus , we recently developed a wedge - shaped -tcp block with 60 % porosity for opening hto . this -tcp has a compressive strength of 22 mpa , which is approximately sevenfold greater than -tcp with 75 % porosity . we previously reported the clinical results of bone formation and resorption of -tcp using -tcp blocks with 75 and 60 % porosity at 33 months . during opening hto , the opened defect was fixed with a puddu plate , after which -tcp with 75 % porosity was used to fill the cancellous bone defect . on the medial cortical bone side , however , a wedge - shaped -tcp block with 60 % porosity was implanted in front of and at the back of the plate . the use of a -tcp block with 60 % porosity avoided autogenous bone grafting and shortened the surgical time . the decreased porosity reduced pore interconnection , suggesting a longer period for -tcp resorption . in that study , radiographic examination showed that -tcp with 75 % porosity was almost completely resorbed , but some -tcp with 60 % porosity remained . other reports also evaluated -tcp resorption in opening hto using plain x - rays [ 1 , 4 , 11 , 16 , 19 ] . to our knowledge , no radiological rating system to monitor remodelling of -tcp using ct images has been reported . the aim of this study was to establish a novel evaluation system to monitor bone formation and -tcp resorption in opening hto . the -tcp block used in this study was highly pure and provided by olympus biomaterials co. ltd . , briefly , cahpo4/h2o and caco3 at a molar ratio of 2:1 were mixed into a slurry with pure water and particles of zirconium in a pot mill for 24 h and dried at 80 c . calcium - deficient hydroxyapatite was converted to -tcp by calcination at 750 c for 1 h. after sintering of the -tcp powder at 1,050 c for 1 h , a porous -tcp block with a mean pore size of 200 m and a porosity of 75 % was obtained . a bimodal pore size distribution in the -tcp block with 75 % porosity was observed , where one peak existed in a region of > 100 m and the other peak existed in a region of < 5 m . the -tcp block with 60 % porosity was synthesized by the same method as the 75 % material , except that the amount of forming agent was changed . the mean compressive strength of -tcp blocks with 60 and 75 % porosity was 22 and 3 mpa , respectively . during opening hto , the opened defect was fixed with a puddu plate after which the cancellous bone defect was filled with 4 wedge - shaped -tcp blocks of 75 % porosity . on the medial side , however , 3 wedge - shaped -tcp blocks with 60 % porosity were implanted in front of and at the back of the plate . eighteen patients received an opening of 10 mm and 13 patients had an opening of 12.5 mm . the volume of each piece of -tcp block with 60 % porosity for a 10 mm opening was 1.06 cm and for a 12.5 mm opening was 1.39 cm . three pieces of -tcp were implanted in all cases , but 1/3 of one piece was removed in the case of small knees . to fill the cancellous bone defects , 67 and 78 cm of -tcp blocks with 75 % porosity were used for 10 and 12.5 mm openings , respectively . between 2003 and 2005 , opening wedge hto was performed on 36 patients using a puddu plate and -tcp with 60 and 75 % porosity . thirty - one patients ( 22 women and 9 men ) with a mean age of 64 years ( range 5177 years ) at the time of surgery , were evaluated with a mean follow - up point of 75 months ( range 7278 months ) . exclusion criteria in this study included ( 1 ) patients with standing lateral femorotibial angle of more than 184 ; ( 2 ) patients who had an extension loss of more than 10 ; ( 3 ) patients who had severe osteoarthritis in the patellofemoral joint ; and ( 4 ) patients whose bmi was more than 27 ( kg / m ) . after surgery , the knee was protected with a hinged brace for 12 weeks . partial weight - bearing was allowed at 34 weeks , and total weight - bearing was allowed at 56 weeks . all patients received follow - up evaluations at regular intervals in our outpatient clinic , and underwent radiographs and ct examinations at 2 weeks ( fig . ct images parallel to the osteotomy plane were made and images at the centre were used to evaluate -tcp resorption and bone formation . the ct image data were divided into 3 areas by tracing manually on the screen of the computer ( fig . 1-a2 , b2 ) . ct attenuation values [ in hounsfield units ( hu ) ] of the area implanted with -tcp of 60 % porosity , the area implanted with -tcp of 75 % porosity , and hinged - cancellous bone were analysed using the imaging software , osirix . traces of the -tcp blocks were still visible at 6 years post - operatively in some cases , but in most cases , it was hard to define the -tcp implanted area . in those cases , ct circumferential cortical bone of the tibia was excluded from each value of -tcp and cancellous bone.fig . 1ct images of a 64-year - old man showing the centre of the osteotomy plane at 2 weeks ( a1 , a2 ) and 6 years ( b1 , b2 ) . the mean ct values ( hu ) of the area implanted with -tcp of 60 % porosity ( ) , the area implanted with -tcp of 75 % porosity ( ) , hinged - cancellous bone ( ) , and the area with insufficient -tcp implantation ( ) were , 1,717.3 , 1,044.8 , 175.1 , and 39.1 , respectively . six years after surgery , these values were 440.5 , 162.0 , 164.3 , and 21.9 , respectively . indicates the area of the metal plate ct images of a 64-year - old man showing the centre of the osteotomy plane at 2 weeks ( a1 , a2 ) and 6 years ( b1 , b2 ) . the mean ct values ( hu ) of the area implanted with -tcp of 60 % porosity ( ) , the area implanted with -tcp of 75 % porosity ( ) , hinged - cancellous bone ( ) , and the area with insufficient -tcp implantation ( ) were , 1,717.3 , 1,044.8 , 175.1 , and 39.1 , respectively . six years after surgery , these values were 440.5 , 162.0 , 164.3 , and 21.9 , respectively . indicates the area of the metal plate the ct images were evaluated independently by two investigators ( tt and yk ) . the two investigators re - evaluated the ct data one more time at 11 months after the first analysis . inter - observer variability as well as intra - observer variability during the first and second rounds were determined using intraclass correlation coefficient , an appropriate summary statistic for determining the reliability of measurement [ 12 , 20 ] . all patients provided informed consent prior to participation in this study , which was approved by nho utsunomiya national hospital ethical committee ( i d 15 - 1 ) . we used a paired t test to compare ct values of -tcp implanted areas and cancellous bone . the -tcp block used in this study was highly pure and provided by olympus biomaterials co. ltd . , briefly , cahpo4/h2o and caco3 at a molar ratio of 2:1 were mixed into a slurry with pure water and particles of zirconium in a pot mill for 24 h and dried at 80 c . calcium - deficient hydroxyapatite was converted to -tcp by calcination at 750 c for 1 h. after sintering of the -tcp powder at 1,050 c for 1 h , a porous -tcp block with a mean pore size of 200 m and a porosity of 75 % was obtained . a bimodal pore size distribution in the -tcp block with 75 % porosity was observed , where one peak existed in a region of > 100 m and the other peak existed in a region of < 5 m . the -tcp block with 60 % porosity was synthesized by the same method as the 75 % material , except that the amount of forming agent was changed . the mean compressive strength of -tcp blocks with 60 and 75 % porosity was 22 and 3 mpa , respectively . during opening hto , the opened defect was fixed with a puddu plate after which the cancellous bone defect was filled with 4 wedge - shaped -tcp blocks of 75 % porosity . on the medial side , however , 3 wedge - shaped -tcp blocks with 60 % porosity were implanted in front of and at the back of the plate . eighteen patients received an opening of 10 mm and 13 patients had an opening of 12.5 mm . the volume of each piece of -tcp block with 60 % porosity for a 10 mm opening was 1.06 cm and for a 12.5 mm opening was 1.39 cm . three pieces of -tcp were implanted in all cases , but 1/3 of one piece was removed in the case of small knees . to fill the cancellous bone defects , 67 and 78 cm of -tcp blocks with 75 % porosity were used for 10 and 12.5 mm openings , respectively . between 2003 and 2005 , opening wedge hto was performed on 36 patients using a puddu plate and -tcp with 60 and 75 % porosity . thirty - one patients ( 22 women and 9 men ) with a mean age of 64 years ( range 5177 years ) at the time of surgery , were evaluated with a mean follow - up point of 75 months ( range 7278 months ) . exclusion criteria in this study included ( 1 ) patients with standing lateral femorotibial angle of more than 184 ; ( 2 ) patients who had an extension loss of more than 10 ; ( 3 ) patients who had severe osteoarthritis in the patellofemoral joint ; and ( 4 ) patients whose bmi was more than 27 ( kg / m ) . after surgery , the knee was protected with a hinged brace for 12 weeks . partial weight - bearing was allowed at 34 weeks , and total weight - bearing was allowed at 56 weeks . all patients received follow - up evaluations at regular intervals in our outpatient clinic , and underwent radiographs and ct examinations at 2 weeks ( fig . ct images parallel to the osteotomy plane were made and images at the centre were used to evaluate -tcp resorption and bone formation . the ct image data were divided into 3 areas by tracing manually on the screen of the computer ( fig . 1-a2 , b2 ) . ct attenuation values [ in hounsfield units ( hu ) ] of the area implanted with -tcp of 60 % porosity , the area implanted with -tcp of 75 % porosity , and hinged - cancellous bone were analysed using the imaging software , osirix . traces of the -tcp blocks were still visible at 6 years post - operatively in some cases , but in most cases , it was hard to define the -tcp implanted area . in those cases , ct circumferential cortical bone of the tibia was excluded from each value of -tcp and cancellous bone.fig . 1ct images of a 64-year - old man showing the centre of the osteotomy plane at 2 weeks ( a1 , a2 ) and 6 years ( b1 , b2 ) . the mean ct values ( hu ) of the area implanted with -tcp of 60 % porosity ( ) , the area implanted with -tcp of 75 % porosity ( ) , hinged - cancellous bone ( ) , and the area with insufficient -tcp implantation ( ) were , 1,717.3 , 1,044.8 , 175.1 , and 39.1 , respectively . six years after surgery , these values were 440.5 , 162.0 , 164.3 , and 21.9 , respectively . indicates the area of the metal plate ct images of a 64-year - old man showing the centre of the osteotomy plane at 2 weeks ( a1 , a2 ) and 6 years ( b1 , b2 ) . the mean ct values ( hu ) of the area implanted with -tcp of 60 % porosity ( ) , the area implanted with -tcp of 75 % porosity ( ) , hinged - cancellous bone ( ) , and the area with insufficient -tcp implantation ( ) were , 1,717.3 , 1,044.8 , 175.1 , and 39.1 , respectively . six years after surgery , these values were 440.5 , 162.0 , 164.3 , and 21.9 , respectively . the two investigators re - evaluated the ct data one more time at 11 months after the first analysis . inter - observer variability as well as intra - observer variability during the first and second rounds were determined using intraclass correlation coefficient , an appropriate summary statistic for determining the reliability of measurement [ 12 , 20 ] . all patients provided informed consent prior to participation in this study , which was approved by nho utsunomiya national hospital ethical committee ( i d 15 - 1 ) . we used a paired t test to compare ct values of -tcp implanted areas and cancellous bone . the mean preoperative standing lateral femorotibial angle was 181 ( range 177184 ) , which was corrected to a mean angle of 169 post - operatively . ct image analysis containing the centre of the osteotomy plane showed that the mean ct value ( hu ) of the implanted area with -tcp of 60 % porosity at 2 weeks and 6 years were 1,694.0 94.2 , and 574.1 273.5 , respectively . the mean ct value of the implanted area with -tcp of 75 % porosity at 2 weeks and 6 years were 1,010.9 81.1 , and 168.8 75.1 , respectively . the mean ct value of cancellous bone at 2 weeks and 6 years were 178.0 45.1 , and 174.9 69.3 , respectively ( fig . 2 ) . the values with the smallest standard deviation ( sd ) were for hinged - cancellous bone at 2 weeks and values with the largest sd were for areas implanted with -tcp of 60 % porosity at 6 years.fig . 2ct values ( hu ) obtained from each area of 31 cases at 2 weeks and 6 years . the ct values of -tcp with 75 % porosity implanted area at 6 years were not statistically different from those of hinged - cancellous bone , indicating that -tcp with 75 % porosity was completely resorbed and replaced by cancellous bone . the labels 60 , 75 , and bone indicate the area implanted with -tcp of 60 % porosity , the area implanted with -tcp of 75 % porosity , and hinged - cancellous bone , respectively ct values ( hu ) obtained from each area of 31 cases at 2 weeks and 6 years . the ct values of -tcp with 75 % porosity implanted area at 6 years were not statistically different from those of hinged - cancellous bone , indicating that -tcp with 75 % porosity was completely resorbed and replaced by cancellous bone . the labels 60 , 75 , and bone indicate the area implanted with -tcp of 60 % porosity , the area implanted with -tcp of 75 % porosity , and hinged - cancellous bone , respectively six years after surgery , there was no statistical difference of the ct values between the area implanted with -tcp of 75 % porosity and cancellous bone , indicating that the -tcp with 75 % porosity had been completely resorbed and replaced by bone . in contrast , the ct values indicated that approximately 1/3 of the -tcp with 60 % porosity remained even 6 years after surgery ( fig . 2 ) . the intraclass correlation coefficients of the ct values of 60 % porosity -tcp , 75 % porosity -tcp , and hinged - cancellous bone at 2 weeks and 6 years were determined . the intraclass correlation coefficients of the inter - observer measurements for the first and second rounds were 0.670.94 and 0.790.96 , respectively . the intraclass correlation coefficients of the intra - observer measurements for the first and second investigators were 0.890.96 and 0.660.94 , respectively . the most important finding of this study was the quantitative evaluation of the -tcp resorption and bone formation in opening hto . there are several reports that evaluate -tcp resorption in opening hto [ 1 , 4 , 11 , 16 , 19 ] . van hemert et al . developed a radiological rating system to monitor bone healing in opening wedge osteotomies . remodelling of bone gaps filled with -tcp granules or blocks with 70 % porosity was graded into five categories . the results were only analysed by conventional anteroposterior and lateral radiographs , potentially leading to observer variance of radiological measurements . as yet , no radiological rating system using ct images to monitor bone healing in opening hto is available . ct values of 60 % and 75 % porosity -tcp blocks at the centre of ct images at 2 weeks and 6 years were originally measured ; however , ct images at 6 years showed that -tcp with 60 % porosity was not uniformly resorbed ( fig . 1 ) . this strongly suggested that measurements focused on a certain area ( region of interest ) of -tcp were inadequate to evaluate -tcp resorption . we therefore used the imaging software , osirix , which was developed in 2004 by a team of radiologists from geneva and ucla , working on apple computers , and can be downloaded free of charge . -tcp blocks were still visible at 6 years in some cases , but in most of the cases , it was hard to define the -tcp implanted area . in those cases , we referred to ct images taken at 2 weeks to define the -tcp - implanted area . the present study showed that there was no statistical difference between the ct values of the area implanted with -tcp of 75 % porosity at 6 years and cancellous bone , indicating that -tcp with 75 % porosity was completely resorbed and replaced by bone . in contrast , from the ct values , approximately 1/3 of -tcp with 60 % porosity remained even 6 years after surgery . figure 1 showed that ct values in the area with insufficient -tcp implantation was lower than cancellous bone , indicating that poor bone formation occurred in this area . . reported on smoking as a risk factor of non - union in opening hto , but the present study did not show significant difference of -tcp resorption in the two patients who smoked . first , the ct values of each circumferential cortical bone of the tibia were excluded from each value of -tcp and cancellous bone , because it was hard to distinguish newly formed bone from residual -tcp . second , it was hard to obtain completely matched images at 2 weeks and 6 years , even though we tried to measure the centre of the osteotomy plane . third , the ct images were divided into three areas by tracing manually on the screen of the computer . although this manual process caused inter- and intra - observer differences , intraclass correlation coefficients analysis showed substantial to almost perfect agreement between the two independent investigators . the present study showed that -tcp with 75 % porosity was completely resorbed and replaced by bone , but -tcp with 60 % porosity was only partially resorbed . however , the amount of residual -tcp with 60 % porosity was so small that it would not hinder total knee arthroplasty should it be necessary in the future . to promote complete remodeling of -tcp , additional stimulations such as growth factors may also be necessary . this system is the first to quantitatively evaluate the residual amount of -tcp and bone formation in opening hto . it will be a useful technique to evaluate -tcp resorption and bone formation in any -tcp implanted area . the aim of this study was to establish a novel evaluation system to monitor bone formation and -tcp resorption in opening hto using the image software , osirix . the results showed that -tcp with 75 % porosity was completely resorbed and replaced by bone , but -tcp with 60 % porosity was only partially resorbed even 6 years after surgery . the imaging software , osirix , enabled us to evaluate -tcp resorption and bone formation in both opening hto and other -tcp implanted areas .

purposethe aim of this study was to establish an evaluation system to monitor bone formation and beta - tricalcium phosphate ( tcp ) resorption in opening high tibial osteotomy ( hto).methodsfrom 2003 to 2005 , opening hto was performed in 36 patients using a puddu plate and -tcp blocks with 60 and 75 % porosity . thirty - one patients were used for evaluation . all patients underwent ct examination at 2 weeks and 6 years . the ct image data were divided into three areas , and ct values of each area were analysed using the imaging software , osirix.resultsct image analysis at 2 weeks showed that the mean ct - attenuation values ( in hounsfield units ) of the implanted area with -tcp of 60 % porosity , the implanted area with -tcp of 75 % porosity , and cancellous bone were , 1,694.0 94.2 , 1,010.9 81.1 , and 178.0 45.1 , respectively . six years after surgery , these values were 574.1 273.5 , 168.8 75.1 , and 174.9 69.3 , respectively.conclusion-tcp with 75 % porosity was completely resorbed and replaced by bone . -tcp with 60 % porosity was resorbed , but approximately 1/3 still remained even 6 years after surgery . the imaging software , osirix , enabled scanning of the whole area to measure ct values . this system is the first to quantitatively evaluate -tcp resorption and bone formation in opening hto.level of evidencelaboratory studies .

Level of evidence Introduction Materials and methods Preparation of -TCP Reproducibility of the radiological evaluating system Statistical analysis Results Discussion Conclusions

degenerative cervical spondylolisthesis ( dcs ) is a pathological condition defined by anterolisthesis or anterior slippage of the cervical spine ( c - spine ) vertebrae . underlying causes of this slippage include application of a shear force on the vertebra , disc degeneration , and/or hypertrophic arthropathy of the facet joint311172123 ) . while dcs is less prevalent than spondylolisthesis at the lumbar spine , it still has an estimated prevalence of 5.2% to 11% , most commonly involving the c3 - 4 and c4 - 5 levels of the c - spine 111721 ) . in contrast to the abundant literature on degenerative lumbar spondylolisthesis , dcs has been evaluated in only a few studies . several predisposing factors have been reported to contribute to the development of spondylolisthesis at the lumbar spine , among which facet joint orientation is thought to play an important role181920 ) . gao et al.6 ) reported the orientation of the facet joint along the sagittal plane , known as the pedicle - facet ( p - f ) angle , which they measured on lateral view computed tomography ( ct ) scans , to be the highest intrinsically at l4 - 5 , both in patients with lumbar spondylolisthesis and in participants in their control group . they hypothesized that a more horizontal orientation of the l4 - 5 facet joint ( i.e. , a higher sagittal plane angle ) may be a predisposing anatomical factor for spondylolisthesis . however , the characteristic changes in p - f angle at the c - spine have not been well described to date . the balance of the c - spine along the sagittal plane , in relation to the sagittal plane position of the pelvis , is increasingly being recognized as an important predisposing factor for spondylolisthesis . this sagittal plane balance is captured by the slope of the first thoracic vertebra ( t1)1016 ) . therefore , we hypothesized that a high t1 slope , indicative of a loss of alignment of the spine in the sagittal plane , may be a predisposing factor for the development of dcs , increasing the magnitude of anterior shear force along the gravitational vector22 ) . furthermore , this chronic anterior shear force could concurrently lead to arthrotic changes of the posterior facets , which would accelerate disc degeneration and disc collapse . to the best of our knowledge , differences in p - f angle between patients with dcs and normal controls have not been specifically addressed in research . therefore , the main objectives of this study were to compare the p - f angles , measured on simple radiographs , between patients with dcs and a control group matched on sex and age , and to evaluate the relationship between the p - f angle and the amount of vertebral anterolisthesis in patients with dcs . patients with dcs were identified retrospectively from the total group of patients who attended the spine center in our institution between june 2002 and december 2012 . during this period , 983 patients received plain radiographs to inform various diagnoses , such as neck pain and cervical radiculopathy . patients with non - degenerative cervical disease - trauma , infection , tumor , deformity , and inflammatory diseases - or prior cervical spine surgery were excluded . plain anterior - posterior and lateral view radiographs had been obtained with patients in a relaxed standing position , with the upper extremities positioned naturally at the side of the body and the head maintained in a neutral position , with horizontal gaze parallel to the frankfurt horizontal plane . the radiographs were used to confirm a 7-segmental cervical spine and to rule - out developmental anomalies of the c - spine , signs of lytic lesions , and scoliotic deformity of > 10. following screening for exclusion criteria , 30 adult patients with a diagnosis of dcs at c4 - 5 , without evidence of dcs at any other level , consisting of 15 men and 15 women , with an average age of 40.30 years ( range , 23 - 76 years ) , were included in the study . the control group consisted of 30 adults , matched on sex and age with patients in the dcs group , identified by retrospective analysis of patients who had attended the ear , nose , throat out - patient department of our institution between january 2008 and september 2012 , and who had received plain radiographs of the c - spine as part of their medical care . patients in the control group had never been diagnosed with or treated for a spinal problem . the group included 15 men and 15 women , with an average age of 41.10 years ( range , 27 - 81 years ) . dcs was defined , using previously defined criteria , as an anterolisthesis ( i.e. , slip ) of the vertebra of more than 2 mm 2112324 ) . the extent of anterior slip of the vertebra was measured as the distance from the postero - inferior corner of the cranial ( i.e. , superior ) vertebral body to the tangential line along the posterior border of caudal ( i.e. , lower ) vertebral body ( fig . the p - f angle , calculated on lateral view radiographs , was formed by the intersection between a straight line connecting the midpoints of the anterior and posterior cortices of the vertebrae and a straight line positioned parallel to the facet joint ( fig . plain radiographs were saved in the picture archiving and communication system ( pview ; infinitt , seoul , korea ) for analysis . the quality of radiographs for measurements of p - f angles and amount of anterolisthesis was ascertained by two independent observers . after agreement , the outcome variables were independently measured twice , by two spinal surgeons from the neurosurgery department . the pearson 's correlation coefficient between the two measures was calculated as an indicator of agreement . the association of p - f angles to group characteristics , namely age and sex , was evaluated using pearson 's correlation . between - group differences in p - f angles were evaluated using independent - samples t - test . all statistical analyses were performed in spss , version 19.0 ( ibm spss , armonk , ny , usa ) , with p<0.05 considered to be significant . patients with dcs were identified retrospectively from the total group of patients who attended the spine center in our institution between june 2002 and december 2012 . during this period , 983 patients received plain radiographs to inform various diagnoses , such as neck pain and cervical radiculopathy . patients with non - degenerative cervical disease - trauma , infection , tumor , deformity , and inflammatory diseases - or prior cervical spine surgery were excluded . plain anterior - posterior and lateral view radiographs had been obtained with patients in a relaxed standing position , with the upper extremities positioned naturally at the side of the body and the head maintained in a neutral position , with horizontal gaze parallel to the frankfurt horizontal plane . the radiographs were used to confirm a 7-segmental cervical spine and to rule - out developmental anomalies of the c - spine , signs of lytic lesions , and scoliotic deformity of > 10. following screening for exclusion criteria , 30 adult patients with a diagnosis of dcs at c4 - 5 , without evidence of dcs at any other level , consisting of 15 men and 15 women , with an average age of 40.30 years ( range , 23 - 76 years ) , were included in the study . the control group consisted of 30 adults , matched on sex and age with patients in the dcs group , identified by retrospective analysis of patients who had attended the ear , nose , throat out - patient department of our institution between january 2008 and september 2012 , and who had received plain radiographs of the c - spine as part of their medical care . patients in the control group had never been diagnosed with or treated for a spinal problem . the group included 15 men and 15 women , with an average age of 41.10 years ( range , 27 - 81 years ) . dcs was defined , using previously defined criteria , as an anterolisthesis ( i.e. , slip ) of the vertebra of more than 2 mm 2112324 ) . the extent of anterior slip of the vertebra was measured as the distance from the postero - inferior corner of the cranial ( i.e. , superior ) vertebral body to the tangential line along the posterior border of caudal ( i.e. , lower ) vertebral body ( fig . the p - f angle , calculated on lateral view radiographs , was formed by the intersection between a straight line connecting the midpoints of the anterior and posterior cortices of the vertebrae and a straight line positioned parallel to the facet joint ( fig . plain radiographs were saved in the picture archiving and communication system ( pview ; infinitt , seoul , korea ) for analysis . the quality of radiographs for measurements of p - f angles and amount of anterolisthesis was ascertained by two independent observers . after agreement , the outcome variables were independently measured twice , by two spinal surgeons from the neurosurgery department . the pearson 's correlation coefficient between the two measures was calculated as an indicator of agreement . the association of p - f angles to group characteristics , namely age and sex , was evaluated using pearson 's correlation . between - group differences in p - f angles were evaluated using independent - samples t - test . all statistical analyses were performed in spss , version 19.0 ( ibm spss , armonk , ny , usa ) , with p<0.05 considered to be significant . of our prospective group of 983 patients , 30 patients were diagnosed with anterolisthesis of the c - spine ( 3.05% ) . the mean p - f angle values and amount of anterolisthesis , for the dcs and control groups , are reported in table 3 . the p - f angles at c4 - 5 were 141.147.14 for the dcs group and 130.5413.50 for the control group ( p=0.012 ) . in comparison , at c5 - 6 , the p - f angles were 137.468.53 and 128.5316.01 , respectively ( p=0.001 ) . at c2 - 3 , the p - f angles were 137.327.58 and 134.0911.26 , respectively ( p=0.037 ) . however , there were no significant between - group differences in p - f angles at c3 - 4 , c6 - 7 , or c7-t1 levels ( p0.051 ) . age was significantly correlated with the amount of vertebral slipping in the dcs group ( r=0.649 , p<0.001 ) . no significant correlation was found between any other parameters . with a linear regression analysis , statistically significant linear regression models were established by using the following formula : [ vertebral slippage=1.184+(0.4age ) ] , ( p=0.005 ) degenerative spondylolisthesis is more rarely seen in the cervical spine . since lee et al.13 ) first reported differences in radiological findings between traumatic and degenerative listhesis of the c - spine in 1986 , an overall prevalence of dcs of 5.2% to 11% has been reported . the incidence rate in our study was comparable , with dcs diagnosed in 30 of the 983 prospective participants , a prevalence of 7.64% . dcs has been reported to be most common at the c3 - 4 and c4 - 5 levels of the c - spine5711 ) . the distribution was comparable in our study group , with evidence of dcs at c3 - 4 level in 18 patients ( 24.0% ) and at c4 - 5 in 30 patients ( 40.0% ) . however , at the c - spine , trauma may be the most common cause of an anterior displacement of one vertebral body relative to the subjacent one . injuries that lead to this deformity include traumatic spondylolisthesis of the axis , facet dislocation , and facet fracture / subluxation14 ) . this anterior displacement causes progressive hypertrophic arthropathy of the facet joints , which results in joint erosions , marginal osteophyte formation , and subluxation . the secondary loss of motion , or ankylosis , between vertebral segments diminishes the mobility of the c - spine , thus increasing the stress on the adjacent discs and facets , especially during flexion and extension motions of the c - spine . the increased stress may stretch the disc and ligaments , allowing slippage to occur12 ) . the first type , which is more common , occurs adjacent to a relatively stiffer spondylotic segment , which is in the transition zone from stiff to more mobile segments of the spine . considering this possible underlying pathomechanism , ' compensatory subluxation ' could be a more accurate term for this type of dcs . although disc degeneration is present in this compensatory type of anterolisthesis to some extent , the disc degeneration is radiographically and pathologically less in magnitude than in the adjacent levels with more advanced spondylosis . however , this type of spondylolisthesis is associated with osteoarthritic changes of the facet joints , including erosion , joint remodeling , and subluxation . the second type of spondylolisthesis occurs within spondylotic segments of the c - spine because of advanced disc degeneration . in comparison to dean et al.5 ) classification , woiciechowsky et al.24 ) classified dcs into three types : spondylolisthesis with degeneration of the facet joints ; spondylolisthesis with degeneration of the facet joints and vertebral bodies ; and spondylolisthesis with severe c - spine deformity . woiciechowsky et al.24 ) classification is oriented toward clinical practice , being based on the assumption that degeneration of the disc and the facet joints occurs first and leads to the associated segmental instability and neck pain characteristic of dcs . however , the pathomechanism of dcs remains yet to be fully clarified . in our study , we specifically evaluated c4 - 5 based on reports of the highest prevalence of dcs at this level . the highest incidence of dcs in our study group was found at the c3 - 4 and c4 - 5 levels , which is comparable to findings from several other studies2571117 ) . several hypotheses have been advanced to explain the higher likelihood for the development of dcs at c4 - 5 . a number of studies have related the incidence of dcs to the relative hypermobility of the c4 - 5 vertebral segment , with repeated movements leading to relaxation of surrounding ligaments and , progressively , to degenerative articular changes 14610 ) . at the lumbar spine , nagaosa et al.15 ) argued that an increase in the p - f angle is a pathoanatomical risk factor for the development of degenerative spondylolisthesis . supporting this argument , gao et al.6 ) confirmed that the p - f angle was significantly larger at l4 - 5 in patients with degenerative spondylolisthesis compared to a control group , and that the p - f angle of the slipped vertebra was more horizontally inclined6 ) . our results confirmed similar findings for the c - spine , with the p - f angle being significantly larger at c4 - 5 in the dcs group compared to the control group . however , the mean p - f angle at the c4 - 5 level did not correlate with the amount of anterior slipping of the c4 vertebra ; only patients ' age was statistically correlated to the amount of vertebral slipping ( r=0.649 , p<0.001 ) . the limitations of our study must be acknowledged in the interpretation of results . due to our small sample size , the characteristics of the dcs patients , and the fact that all patients were recruited from a single institution , our study group is not representative of the entire population of patients with dcs . as an example , our study did not include patients with dcs who were symptom - free . there is evidence that neck pain may in fact be the main presenting symptom of dcs7 ) . although we did not specifically assess neck pain in our study , more than half of the patients in our dcs group reported neck or occipital pain7 ) . we did not consider the degree of intervertebral disc degeneration , the muscles involved in the cervical spine kinematics , or the vertebral body height in our population . in addition , we did not evaluate the relationships between the p - f angle and the amount of anterolisthesis or other factors , such as clinical manifestations , disc degeneration , and body mass index , in patients with dcs . therefore , further research using larger patient populations may help to more comprehensively explain the risk factors for dcs . we do acknowledge , as well , that the guiding hypothesis for our research is based on previous research of the lumbar spine , which itself presents unresolved issues regarding the interaction between anatomical features , or tropism , of facet joints and the degenerative process of spondylolisthesis . dai4 ) suggested that facet joint tropism was a predisposing factor to the development of disc degeneration and subsequent spondylolisthesis ; however , berlemann et al.1 ) argued against this functional relationship4 ) . in our study , we used simple radiographs , which did not allow us to evaluate the relationship between facet joint tropism and the degenerative process of spondylolisthesis at the c - spine . the influence of anterolisthesis on clinical symptoms was also not specifically evaluated , and therefore we can not comment on the relationship between the amount of slippage and symptomology . the p - f angle was the largest at the c4 - 5 level in the dcs group , which might explain the predisposition of c4 to slip forward . the mean p - f angle at the c4 - 5 level did not correlate to the amount of vertebral slipping of c4 in dcs patients .

objectiveto measure the orientation of the facet joints of cervical spine ( c - spine ) segments in the sagittal plane , known as the pedicle - facet ( p - f ) angle , and to use these measurements to evaluate the relationship between the p - f angle and the amount of vertebral anterolisthesis in patients with degenerative cervical spondylolisthesis ( dcs).methodsa retrospective case - control study was performed including 30 age- and sex - matched patients with dcs and 30 control participants . anterior - posterior and lateral view radiographs of the c - spine were obtained in a standing position . the p - f angle at all cervical levels and the amount of anterolisthesis at c4 - 5 were measured from lateral view plain radiographs.resultsthe p - f angles at c4 - 5 were 141.147.14 for the dcs group and 130.5313.50 ( p=0.012 ) for the control group , and at c5 - 6 were 137.468.53 for the dcs group and 128.5316.01 for the control group ( p=0.001 ) . the mean p - f angle at c4 - 5 did not correlate with the amount of anterolisthesis ( p=0.483 ) . the amount of anterior slippage did correlate with age ( p<0.001).conclusionthe p - f angle was intrinsically higher at c4 - 5 , compared to c5 - 6 , in both the dcs and control groups , which might explain the increased likelihood for anterolisthesis of c4 . higher p - f angles in the dcs group may be a predisposing factor to slippage . the p - f angle may interact with age to increase incidence of anterolisthesis with increasing age .

INTRODUCTION MATERIALS AND METHODS Participants Radiographical assessment Statistical analysis RESULTS DISCUSSION CONCLUSION

the strains that were the subject of this study and their source collections are listed in table1 . the nutrient utilization data presented in table1 are sorted in the same order as the 16s plastid rdna tree . the names in the authority column conform to the convention given in algaebase.org ( guiry and guiry 2014 ) . the phenotypic responses were scored as for no utilization , ( + ) for doubtful utilization and + for positive utilization . the nutrient source is labeled a ) enteric / nonfermenter and b ) gram positive . phc is the abbreviation for p - n - p - phosphorylcholine . for a. protothecoides ( marked with an in table1 ) , incubations were for 48 h at 28c . sag 263 - 2 ( marked with a # in table1 ) was determined not to be uni - algal . the two resulting isolates were therefore isolated and split into two unique strains , 263 - 2.1 and 263 - 2.2 . approximately 1 ng of extracted genomic dna was used as template for the pcr reactions . primers were designed to anneal to regions of the 16s rrna and 23s rrna genes conserved across a wide variety of organisms . oligonucleotides used for the 16s rdnas were designed to amplify a region of 1,431 bp of plastidic dna and included a forward primer with the sequence 5-agagtttgatcctggctcag-3 and a reverse primer with the sequence 5-ggctaccttgttacgacttc-3 , annealing to nucleotides 122583 to 122602 and 124033 to 124014 , respectively in genbank accession no . oligonucleotides used for the 23s rdnas were designed to amplify a region of 530 bp of plastidic dna and included a forward primer with the sequence 5-tgttgaagaatgagccggcgac-3 and a reverse primer with the sequence 5-cagtgagctattacgcactc-3 , annealing to nucleotides 637 to 658 and 1182 to 1163 , respectively , in genbank accession no . algal cultures were incubated aerobically for 5 d at 28c , essentially as described by pore ( 1985 ) , on medium containing 2% glucose , or 2% glucose supplemented with 4 g l yeast extract . nutrient utilization for each strain was assessed using the microbial bbl crystal identification systems ( becton dickinson , franklin lakes , nj , usa ) as described previously ( roesler et al.2006 ) . both the enteric / nonfermenter i d kit and the gram positive i d kit from crystal i d systems were employed to establish utilization profiles . prototheca sample panels were incubated for 48 h at 37c in a 70% humidified chamber . auxenochlorella sample panels were incubated for 48 h at 28c in a 70% humidified chamber . both 16s and 23s plastid rdna sequence data were used to build phylogenetic trees by the maximum - likelihood method . the multiple alignment algorithm used was clustal w while tree generation was performed with the program phyml , with a. protothecoides selected as an outgroup to root the tree . parameters were gtr+g+i mode of sequence evolution search with 1,000 bootstraps ; other tree generation methods tested included bayesian , parsimony and neighbor joining , all of which yielded essentially identical clading patterns . the phylogenetic trees generated for both 16s ( fig.1 ) and 23s ( fig.2 ) rdna share a very similar structure , with only slight differences within clade e. the bootstrap value for each branch length demonstrates the strength of each branch point ; the branches separating each clade have support of 97 or higher . these bootstrap values demonstrate the robustness of this tree , which had the same clading structure regardless of the tree building method used ; very similar trees were generated using the bayesian , parsimony and neighbor joining methods . a 16s plastid rdna phylogenetic tree generated by the maximum - likelihood method . the 16s rdna plastid sequences from the 24 algal strains form five distinct clades , regardless of the tree generation algorithm used ; the maximum - likelihood tree is displayed in figure1 along with associated bootstrap values . the five clades ( a e ) , are composed of : ( a ) auxenochlorella protothecoides ; ( b ) a single prototheca wickerhamii isolate ( c ) a mixture of p. wickerhamii and p. moriformis isolates ; ( d ) p. ulmea and p. stagnora ; ( e ) primarily p. zopfii isolates with two p. moriformis , as well as p. kruegani and p. blaschkaea . 23s plastid rdna tree generated by the maximum - likelihood method . like the 16s rdna plastid sequences the 23s rdna plastid sequences form five distinct clades regardless of the tree generation algorithm used . the five clades are identical in makeup to those described for the 16s clades . using pairwise comparisons between individuals in each clade , the 16s rdna data show that clade a and b share 93.9% sequence similarity ( utex 250 and sag 263 - 11 ) ; clades b and c ( sag 263 - 11 and atcc 16529 ) share 86.8% sequence similarity ; clades c and d ( atcc 16529 and cbs 605.66 ) share 67.9% sequence similarity ; clades c and e ( atcc 16529 and sag 43 - 80 ) share 71.6% sequence similarity ; clades d and e ( cbs 605.66 and sag 43 - 80 ) share 76.1% sequence similarity . the auxanographic data ( table1 ) for these algal strains do not entirely conform to either the current taxonomic groupings or the molecular data presented here . the clades described in the phylogenetic trees group the majority of the trehalose consuming algae together ( clade c ) , with the exception of p. wickerhamii sag 263 - 11 , which was unable to use trehalose . furthermore , a. protothecoides utex 250 ( clade a ) also was able to use trehalose , and was only able to grow at the lower temperature of 28c . kruegani utex 329 and p. stagnora atcc 16528 showed no growth on any of the alternative carbon sources , and p. zopfii sag 263.7 only grew when proline was used as a carbon source . furthermore , a number of organisms in clades d ( p. stagnora cbs 605.66 , p. ulmea atcc 50112 , p. sp . sag 263 - 2.2 ) and e ( p. stagnora utex 1442 , p. moriformis atcc 50081 , p. zopfii 43 - 80 ) only grew on arginine as an alternative carbon source , while others in clade e could use a number of different carbon sources ( fructose , glycerol , lysine and proline ) . the finding that the specificity of the strains with respect to the utilization of different fixed carbon sources is not strictly correlated with the clading results , is interesting since some of these strains show close phylogenetic relations ( see for example p. zopfii sag 263.7 and p. kruegani utex 329 ) . the molecular genetic data provide a robust phylogeny of the different prototheca strains based on both 16s and 23s plastid rdna sequences . this finding reinforces the conclusions of previous work ( ueno et al.2003 ) using 18s nuclear rdna and 16s plastidic rdna sequences . however , the data presented here are more extensive than previous studies because a larger number of taxa were examined and we included 23s plastid rdna information . the same strains that we used for the phylogenetic analyses were analyzed for nutrient utilization , and there were a number of cases in which the nutrient utilization profile was not consistent with the phylogenetic grouping of the organism . while nutrient utilization studies are relatively easy to perform and have been widely used to classify prototheca isolates in the past , our work clearly shows that inferences concerning phylogenetic relationships based on nutrient utilization are problematic . as an example , p. stagnora atcc 16528 ( clade d ; figs.1 and 2 ) shows the exact same auxanographic fingerprint as p. kruegani utex 329 ( clade e ; figs.1 and 2 ) and yet molecular genetic characterization shows these strains to be quite disparate . trehalose utilization was previously used to distinguish p. wickerhamii from all other prototheca species . while others have successfully grown p. wickerhamii sag 263 - 11 , one of the most well - characterized strains , on trehalose ( pore 1985 , ueno et al.2005 ) , in this study the growth of p. wickerhamii sag 263 - 11 was not supported by trehalose ( under either of the temperature conditions used ) . this is surprising since the strain previously tested ( ueno et al.2005 ) is the same as ours based on identical 16s and 23s rdna sequences ( genbank : aj245645 and knauf and hachtel 2002 ) . it is possible that the strain lost its ability to utilize this sugar during long years of culturing in the absence of trehalose ; this could be a feature associated with many nutrient uptake and assimilation systems . furthermore , some of the features associated with nutrient utilization can be acquired as a consequence of lateral gene transfer and would not reflect the phylogeny of the organism . overall , our results are cautionary and suggest that basing strain classification solely on auxanographic features , which has been done in the past , can be misleading , while sequence - based phylogenies , particularly when utilizing multiple gene sequences , provide stronger evidence for evolutionary relationships . the naming of the different species within the genus prototheca has been driven largely by morphological and auxanographic characteristics over the past 120 years . as observed , based on the 16s and 23s plastid rdna phylogenetic trees that we generated , the current taxonomy forms paraphyletic groups . among two of the five clades , p. moriformis isolates share near identical 16s and 23s plastid rdna sequences with p. wickerhamii isolates in clade c and p. zopfii isolates in clade e. similarly p. wickerhamii isolates are spread among clades b and c. furthermore , p. wickerhamii sag 263 - 11 appears to be more closely related to a. protothecoides utex 250 than to the p. wickerhamii isolates in clade c , which includes strains designated as both p. wickerhamii and p. moriformis . based on the molecular genetic data presented here , the strains named p. moriformis , p. wickerhamii and p. stagnora are part of paraphyletic groups that should be resolved in future studies .

because algae have become more accepted as sources of human nutrition , phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied . this can help establish algal evolutionary relationships . here , we compare auxenochlorella protothecoides and 23 strains of prototheca based on their complete 16s and partial 23s plastid rdna sequences along with nutrient utilization ( auxanographic ) profiles . these data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships .

Strains, growth, and genomic DNA extraction Amplification and Sequencing of 16S and 23S rDNA Nutrient utilization Sequence alignment and tree construction Evolutionary relationships based on phylogenies relative to nutritional information Naming inconsistencies between strains

during recent years , infection of acinetobacter baumanii showed a rapid growth in hospitals and community . baumanii infection mainly occurs in the lung and blood , the notable feature being that multi - drug resistant strains cause outbreaks in hospitals . large outbreaks of a. baumanii infection have been reported in hospitals from usa , france , spain , belgium , britain and south korea , which brought great economic loss to the patients and hospitals ( 15 ) . recently , a. baumanii infection increases the mortality rate by 7.823% through cohort and case - control studies ( 6 ) . in the past few years , reports about breaks of a. baumanii infection have also increased in china . since the outbreak among over 20 wards in beijing union medical college hospital in 2004 , similar cases have been reported in a number of cities , including chongqing and hangzhou ( 710 ) . when pathogens invade the body , the natural immune system recognizes foreign pathogens through pattern recognition receptors . so far , toll - like receptors ( tlrs ) , a member of the interleukin-1 receptor ( il-1r ) superfamily , are regarded as the most important pattern recognition receptors . tlr-1 , tlr-6 and tlr-10 do not recognize the ligand directly , and play their roles by forming heterodimers with other tlrs . although tlr-7 and tlr-8 were reported to interact with imidazoquinoline , the synthetic and anti - viral small molecule , their natural ligands have not been identified . currently , researches about tlr-11 are few , and lipopolysaccharide ( lps ) , pgn or poly ( i : c ) can not stimulate nf-b activation in tlr-11-expressing cells . therefore , tlr-2 , tlr-4 , tlr-5 and tlr-9 are the most important tlr members related to the immunal protection against bacteria in the body . more and more studies indicate that single nucleotide polymorphisms ( snps ) in tlr-2 , tlr-4 , tlr-5 and tlr-9 are closely related to the susceptibility to diseases in humans . tlr-2 has a molecular weight of 89.8 kda , forms heterodimers with tlr-1 or tlr-6 , and interacts with bacterial ligands such as lipopeptides , peptidoglycan and membrane fatty acid of gram - positive bacteria ( 11 ) . one variant of tlr-2 ( g2477a / arg753gln ) , with an incidence of 2.79.4% in the population , is associated with the susceptibility to asthma , atopic dermatitis and the infection of mycobacterium tuberculosis , staphylococcus aureus and candida ( 12 , 13 ) . another variant of tlr-2 ( c2029t / arg677trp ) is related to the pathogenesis of lepromatous leprosy in the asian population . furthermore , the levels of interleukin-12 ( il-12 ) are decreased in peoples carrying this polymorphism ( 14 ) . tlr-4 , a protein with 839 amino acids and a molecular weight of 95.6kda , can form homodimers . tlr-4 recognizes heat shock proteins and cilia of gram - positive bacteria , envelope glycoproteins of retroviruses , heat - labile compositions of mycobacteria , as well as muramic acids of spirochetes ( 15 ) . furthermore , tlr-4 plays a definite and critial role during recognizing lps of escherichia coli , neisseria meningitidis , salmonella and legionella pneumophila , as well as subsequent signal transduction ( 14 ) . two common snps in tlr-4 , a1287g / asp299gly and c13174t / thr399ile , change its extracellular structure , slow its response to lps and increase the incidence of septic shock ( 16 ) . besides , these snps are also closely related to the pathogenesis of severe respiratory syncytial virus ( rsv ) bronchiolitis ( 17 ) . another two common snps in tlr-4 ( a896 g and c1196 t ) have protective effects against the infection of legionella pneumophila ( 18 ) . tlr-5 contains 858 amino acids with a molecular weight of 97.7 kda , and can form homodimers or heterodimers with tlr-4 . tlr-5 recognizes flagellin , and induces production of high levels of interleukin-8 ( il-8 ) . one tlr-5 variant ( 1174c / t ) is related to the susceptibility to infection of l. pneumophila(19 ) . it was reported that a polymorphism in the tlr9 promoter ( 1237t / c ) is related to the susceptibility to asthma , eczema , and crohn s disease ( 14 ) . despite the prevalence of a. baumanii infection in many hospitals and communities , the reason underlying a. baumanii outbreaks remains unclear . previous studies mainly focus on the mechanism of drug resistance of bacteria , ignoring the role of the interaction between the susceptibility to infection and the baterial genotype . in this study , we investigated the mechanism of a. baumanii infection from the perspective of host genetics . we screened snps in tlr-2 , tlr-4 , tlr-5 and tlr-9 , and studied whether polymorphisms in tlrs were associated with the susceptibility to a. baumanii infection . the study was approved by the review board / ethics committees of the chinese pla general hospital . cases of a. baumanii infection were collected in major cities of china using the national hospital infection surveillance network . three hundred and eighty five uninfected patients from the same ward and with the same gender were selected as the controls . besides , the ages of infected and uninfected patients from the same ward were less than 2 years . to reduce the interference of population stratification , all the patients in this study were han chinese . genomic dna was extracted using qiagen blood mini kit ( qiagen , ca , usa ) , and stored at 80 c . thirteen snps at the tlr-2 ( rs3804099 , rs7656411 and rs76112010 ) , tlr-4 ( rs1927914 , rs10759932 and rs11536889 ) , tlr-5 ( rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 and rs17163737 ) and tlr9 ( rs187084 ) genes were analyzed ( ta . snps were selected according to their frequencies and positions , as well as their associations with infectious diseases reported previously . snp genotyping was performed using an improved multiplex ligation detection reaction ( imldr ) technique ( genesky biotechnologies inc . , the genotyping success rates of rs3804099 , rs7656411 , rs76112010 , rs1927914 , rs10759932 , rs11536889 , rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 , rs17163737 and rs187084 were 99.5% , 99.3% , 99.5% , 99.4% , 99.5% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% and 99.5% , respectively . the association of a. baumanii infection with gender and age were examined using the pearson chi - square test and the t test , respectively . the chi - square tests were used to determine whether each polymorphism was in hardy weinberg equilibrium . a multiple logistic regression model was used to investigate the individual effect of tlr-2 , tlr-4 , tlr-5 and tlr-9 snps on a. baumanii infection . the analysis was based on additive , recessive and dominant models , and adjusted for age . the odd ratios ( ors ) with 95% confidence intervals ( cis ) were presented . the statistical analysis was performed using snpalyze v4.0 ( dynacom , kanagawa , japan ) . the study was approved by the review board / ethics committees of the chinese pla general hospital . cases of a. baumanii infection were collected in major cities of china using the national hospital infection surveillance network . three hundred and eighty five uninfected patients from the same ward and with the same gender were selected as the controls . besides , the ages of infected and uninfected patients from the same ward were less than 2 years . to reduce the interference of population stratification , all the patients in this study were han chinese . genomic dna was extracted using qiagen blood mini kit ( qiagen , ca , usa ) , and stored at 80 c . thirteen snps at the tlr-2 ( rs3804099 , rs7656411 and rs76112010 ) , tlr-4 ( rs1927914 , rs10759932 and rs11536889 ) , tlr-5 ( rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 and rs17163737 ) and tlr9 ( rs187084 ) genes were analyzed ( ta . snps were selected according to their frequencies and positions , as well as their associations with infectious diseases reported previously . snp genotyping was performed using an improved multiplex ligation detection reaction ( imldr ) technique ( genesky biotechnologies inc . , the genotyping success rates of rs3804099 , rs7656411 , rs76112010 , rs1927914 , rs10759932 , rs11536889 , rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 , rs17163737 and rs187084 were 99.5% , 99.3% , 99.5% , 99.4% , 99.5% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% , 99.8% and 99.5% , respectively . the association of a. baumanii infection with gender and age were examined using the pearson chi - square test and the t test , respectively . the chi - square tests were used to determine whether each polymorphism was in hardy weinberg equilibrium . a multiple logistic regression model was used to investigate the individual effect of tlr-2 , tlr-4 , tlr-5 and tlr-9 snps on a. baumanii infection . the analysis was based on additive , recessive and dominant models , and adjusted for age . the odd ratios ( ors ) with 95% confidence intervals ( cis ) were presented . the statistical analysis was performed using snpalyze v4.0 ( dynacom , kanagawa , japan ) . we selected 13 snps at the tlr-2 ( rs3804099 , rs7656411 and rs76112010 ) , tlr-4 ( rs1927914 , rs10759932 and rs11536889 ) , tlr-5 ( rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 and rs17163737 ) and tlr9 ( rs187084 ) genes ( table 1 ) . the pearson chi - square test showed that the susceptibility to a. baumanii infection was not associated with the gender significantly ( p = 0.98 ) . however , a. baumanii - infection increased with ages , as indicated by the t test ( p = 8.6 10 ) . characteristics of the studied snps at the tlr-2 , tlr-4 , tlr-5 and tlr-9 genes maf , minor allele frequency ; hwe , hardy weinberg equilibrium ; statistically significant values are shown in bold . the positions and minor allele frequencies ( mafs ) of the snps all snps are in hardy - weinberg equilibrium ( hwe ) , except for rs1341987 ( p = 0.046 in control patients ) and rs1640827 ( p = 0.021 in control patients ) of tlr-5 and rs187084 of tlr-9 ( p = 0.021 in control patients ) . the associations of tlr2 , tlr4 , tlr5 and tlr9 gene polymorphisms with a. baumanii infection after logistic regression analysis are shown in table 2 . the snp of tlr-9 , rs187084 , was related to a. baumanii - infection under the additive model ( 2a / a + g / a , to g / g , p = 0.05 , or = 0.82 , 95% ci = 0.671.00 ) and recessive model ( g / g , to a / a + g / a , p = 0.0064 , or = 0.59 , 95% ci = 0.400.86 ) after adjustment with age . however , as mentioned above , rs187084 did not obey the hwe rule in control patients . association of tlr-2 , tlr-4 , tlr-5 and tlr-9 gene polymorphisms with ab infection after logistic regression analysis or : odd ratio ; ci : confidence interval . we found a significant association of the haplotype gcg of tlr-4 with a. baumanii - infection ( p = 0.027 ) . no significant differences were detected in the distribution of tlr-2 and tlr-5 haplotypes between a. baumanii - infected patients and controls . compared with the common haplotype atg of tlr-4 , the haplotye gcg contained two mutations both in the promoter region ( table 1 ) . haplotype distribution of tlr-2 , tlr-4 and tlr-5 polymorphisms in ab infected patients and controls haplotype : tlr-2 [ rs76112010 , rs3804099 , rs7656411 ] ; tlr-4 [ rs1927914 , rs10759932 , rs11536889 ] ; tlr-5 [ rs1861172 , rs5744174 , rs2241097 , rs17163737 ] . frequency : the haplotypefrequency in the whole population including ab - infected patients and controls . or : odd ratio ; ci : confidence interval . the major risk factors of a. baumanii infection include the severity of the underlying disease , surgical operations , a large area of trauma ( especially burns ) , premature birth , ever living in icu , prolonged hospitalization , contact with contaminated ward or equipment , invasive procedures ( such as mechanical ventilation , in - dwelling tubes , etc . ) , and ever using antibiotics . although these factors are statistically associated with a. baumanii infection , they can not accurately predict the risk of exposure , it is difficult to explain why some patients exposed to these factors are infected , and some are not . tlrs are the most important pattern recognition receptors , through which the natural immune system recognizes foreign pathogens . many studies indicate that gene polymorphisms in tlrs are closely related to the susceptibility to diseases in humans . although tlr9 detect bacterial dna and recognize dsdna from viruses and the genomes of protozoa ( 20 ) , and the innate immune system appears to use tlr9 for detecting unmethylated cpg dinucleotides , which are relatively common in bacterial and viral genomes but are highly methylated and rare in vertebrate genomes ( 21 , 22 ) , but in this study , the snp of tlr-9 , rs187084 , was significantly related to a. baumanii infection especially under the recessive model . however , this snp was not in hwe in control patients . therefore , more random and more extensive sampling may be required to confirm further this association . interestingly , the haplotye gcg contained two mutations both in the promoter region , compared with the common haplotype atg . we speculate that these two snps in the tlr-4 promoter , rs1927914 and rs10759932 , influence its transcriptional regulation . one snp of tlr-9 ( rs187084 ) and the haplotype gcg of tlr-4 are significantly associated with a. baumanii infection . our studies provide insights to the mechanism of a. baumanii infection from the perspective of the host . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : during recent years , infection of acinetobacter baumanii showed a rapid growth in hospitals and community . toll - like receptors ( tlrs ) are the most important pattern recognition receptors , which play a critical role during recognizing invading pathogens by the natural immune system . our objective was to determine the associations of tlrs polymorphisms with the susceptibility to a. baumanii infection in a chinese population.methods:we carried out a case - control study , genotyping 13 polymorphisms of tlr-2 , tlr-4 , tlr-5 and tlr-9 genes on 423 a. baumanii - infected patients and 385 exposed controls . thirteen snps at the tlr-2 ( rs3804099 , rs7656411 and rs76112010 ) , tlr-4 ( rs1927914 , rs10759932 and rs11536889 ) , tlr-5 ( rs1341987 , rs1640827 , rs1861172 , rs2241097 , rs5744174 and rs17163737 ) and tlr9 ( rs187084 ) genes were analyzed . snp genotyping was performed using an improved multiplex ligation detection reaction ( imldr ) technique.results:the snp of tlr-9 , rs187084 , was related to a. baumanii - infection significantly under recessive model ( g / g , to a / a + g / a , p = 0.0064 , or = 0.59 , 95% ci = 0.400.86 ) after adjustment with age . besides , the haplotype gcg of tlr-4 was significantly associated with a. baumanii infection ( p = 0.027).conclusion : tlr-4 and tlr-9 may be related to the susceptibility to a. baumanii infection in a chinese population .

Introduction Materials and Methods Study subjects and DNA isolation SNP selection and genotyping Statistical analysis Results Discussion Conclusion Ethical considerations

a 56-year - old male visited our hospital with new york heart association functional class iv dyspnea and pitting edema in his lower extremities . the patient had been diagnosed with tricuspid valve regurgitation and atrial fibrillation at an outside institution 10 years ago . however , the patient had refused surgical treatment at that time . physical examination and laboratory tests demonstrated severe hepatomegaly , ascites , azotemia , and cardiac cirrhosis ( child - pugh class b ) . echocardiography and cardiac magnetic resonance imaging showed severe tricuspid valve regurgitation , with a persistent left superior vena cava ( svc ) draining into the coronary sinus and absence of the innominate vein . magnetic resonance imaging revealed left and right ventricular ejection fractions of 31.5% and 34.2% , respectively . heart transplantation rather than a tricuspid valve surgery was recommended because of the biventricular dysfunction . preoperative computed tomographic venography of the neck and brain was performed to evaluate the probable risk of a left svc ligation . the diameters of the right and left svcs were 17 mm and 16 mm , respectively . abundant collaterals were built up at the sigmoid sinus , which was considered adequate for draining venous blood from the left part of the head to the right svc . this finding suggested that the risk of cerebral venous congestion after left svc ligation was minimal . when opening the pericardium during heart transplantation , the recipient heart showed a large dilated distal part of the left svc draining into the coronary sinus . under moderate hypothermia , orthotopic heart transplantation was performed with the standard aorto - bicaval cannulation technique using an additional venous cannula on the left svc . the donor heart was implanted using the standard bicaval technique . despite the preoperative evaluation suggesting left svc ligation would be safe in this patient , the left svc was anastomosed to the right atrial appendage using an interconnecting conduit ( fig . a tubular conduit 16 mm in diameter and 4 cm in length was constructed using the resected coronary sinus tissue to avoid size discrepancy and kinking . after the orthotopic cardiac transplantation was completed using the bicaval anastomosis technique , the tubular conduit was anastomosed to the distal part of the left svc and to the right atrial appendage using continuous 5 - 0 polypropylene sutures . the cardiopulmonary bypass and donor ischemic times were 354 minutes and 125 minutes , respectively . the postoperative course was uneventful . a computed tomography angiogram at one month after the surgery demonstrated a patent conduit between the left svc and right atrial appendage ( fig . the patient was discharged without any complications and did not show any sign of upper - body venous congestion at the six - month follow - up visit . a left svc is an infrequent congenital abnormality with a prevalence of 0.3% to 0.5% in the normal population and 2.8% to 4.3% in patients with congenital heart disease . in the setting of cardiac transplantation , a persistent left svc deserves consideration to determine the level of venous return during bypass as well as the bicaval anastomosis . if a well - developed innominate vein is present , occlusion of the left svc by simple ligation or division will recreate a normal venous drainage through the innominate vein . however , if the innominate vein is small or absent , occluding the left svc may increase the risk of neurovascular complications . a persistent left svc can be preserved with several surgical techniques during orthotopic heart transplantation . these surgical approaches include end - to - side anastomosis of the left svc to the right svc , end - to - end anastomosis of the left svc to the right atrial appendage ( direct anastomosis or anastomosis using a conduit ) , and anastomosis of both right and left svcs to the innominate vein of the donor graft [ 26 ] . a previous study presented a case of orthotopic heart transplantation in a patient with a persistent left svc . in that patient , the left svc was passed between the ascending aorta and pulmonary artery , and anastomosed to the right svc in an end - to - side fashion . in the present case , there were abundant collaterals present at the sigmoid sinus , which might have prevented venous congestion if the left svc was occluded . however , we decided to preserve the left svc to minimize this risk . connecting the left svc to the right svc behind the ascending aorta was avoided because its passage was right - angled and posed a risk of compression by the aorta and pulmonary artery . in addition , we constructed an interconnecting graft instead of using an in situ conduit , because there were issues such as a size discrepancy and risks of kinking and resultant blood stasis . the coronary sinus tissue was resected , made into a tubular conduit with a diameter of 16 mm , and placed between the left svc and the right atrial appendage . artificial conduits were not considered due to the risk of thrombo - occlusion and infection . in conclusion , we successfully performed an orthotopic heart transplantation in a patient with a persistent left svc by reconstructing the left svc with an interconnecting conduit made from autologous coronary sinus tissue , which was anastomosed to the distal part of the left svc and to the right atrial appendage .

a 56-year - old male presented with severe exertional dyspnea and pitting edema in the lower extremities . the pre - operative evaluation demonstrated biventricular dysfunction associated with severe tricuspid valve regurgitation and a persistent left superior vena cava . he was registered as a transplantation candidate , and orthotopic heart transplantation was performed using the standard bicaval technique . the left superior vena cava was connected to the right atrial appendage after the construction of a conduit using the recipient s autologous coronary sinus tissue . one - month postoperatively , computed tomography imagery demonstrated a patent conduit between the left superior vena cava and right atrial appendage .

CASE REPORT DISCUSSION

ninety - percent of head and neck cancers are squamous cell carcinomas ( scchn ) involving the mucosal surfaces of the oral cavity , pharynx , and larynx . the overall relative 5-year survival rates for cancers of the oral cavity / pharynx and larynx are estimated to be 58.3% and 64.5% , respectively . morbidities associated with scchn and its treatments are significant and include eating and swallowing difficulties . targeted therapies for scchn are under active investigation with the goals of reducing scchn morbidity and mortality . targeted therapeutics were conceptualized as a means of exploiting specific molecular alterations associated with cancers in order to selectively kill transformed cells and spare normal , healthy tissues . targeted therapies are anticipated to have fewer associated toxicities than standard chemotherapies , which rely predominately on increased rates of cell division to enhance killing of the tumor cells compared to healthy tissues . for tumors that are treated with radiation and/or surgery , targeted therapies delivered systemically also have the potential to eliminate micrometastases that might not be eliminated with radiation therapy ( rt ) and/or surgery . in addition to reduced toxicity and treatment of undetected disease , it is hypothesized that effective targeted therapy may interfere specifically with processes that the cancer is dependent upon and be more effective than conventional therapies . the epidermal growth factor receptor ( egfr ) was anticipated to be a good drug target for scchn treatment because the majority of scchn overexpress egfr [ 2 , 3 ] , and higher tumor levels of egfr are associated with poorer clinical outcomes [ 4 , 5 ] . egfr participates in scchn autocrine stimulation , and overexpression of egfr and its primary ligand in humans , transforming growth factor alpha ( tgf- ) , have been correlated with poor outcomes for patients receiving therapy . cetuximab ( erbitux ; imclone systems ) , a chimeric monoclonal igg1 antibody directed against egfr , was fda - approved for the treatment of scchn in combination with rt for locally or regionally advanced disease and as a monotherapy for recurrent or metastatic scchn patients who have failed prior platinum - based therapy . in addition to antibodies directed against egfr , small molecule tyrosine kinase inhibitors ( tki ) of egfr and egfr antisense agents are currently under active clinical investigation for scchn treatment . egfr - targeted therapeutics delivered as monotherapies for treatment of scchn have demonstrated fewer toxicities compared to combined modality treatment regimens but only marginal clinical response ( 410% ) [ 7 , 8 ] . in general responses to egfr - targeted therapies in scchn clinical trials improving clinical response rates will involve ( 1 ) identifying scchn patients who are likely to respond to egfr - targeted therapies , ( 2 ) developing effective combinations of targeted therapies , and ( 3 ) correctly identifying patients who will respond to specific targeted agents applied alone or in combination . our understanding of the factors contributing to targeted therapy response now extends beyond the molecular alterations of the tumor to include host genetic variation . in this review , we will summarize molecular data correlated with clinical response to egfr - targeted therapies and discuss factors that may be considered for identifying responsive scchn patients . preclinical evidence suggests that src family kinase - targeted agents administered in combination with egfr - targeted therapies may demonstrate improved clinical response over egfr - targeted agents alone . here we also provide rationale for combining egfr- and src - targeted therapeutics for treatment of scchn , discuss published egfr- and src - combination treatment preclinical data , and summarize completed and ongoing clinical trials in solid tumors evaluating src - targeted therapies in combination with egfr - targeted therapies . there are several egfr - targeted therapies in clinical development for scchn , and these agents are described in table 1 . these inhibitors fall into two primary categories : egfr - directed antibodies and egfr tyrosine kinase inhibitors . egfr - directed antibodies include cetuximab , nimotuzumab ( ym biosciences ) , panitumumab ( amgen ) , and zalutumumab ( genmab ) . egfr - targeted tyrosine kinase inhibitors include erlotinib ( genetech and osi pharmaceuticals ) and gefitinib ( astrazeneca ) . in addition to egfr - targeted kinase inhibitors , inhibitors with broader target specificities are also in phase ii or iii development for scchn including lapatinib ( glaxosmithkline ) , which is a dual egfr / her2 inhibitor , and zactima ( astrazeneca ) , which targets vegfr2 and ret in addition to egfr ( table 1 ) . more recently antisense therapy targeting egfr has been evaluated in a phase i clinical trial by our group . results of clinical trials for egfr - targeted therapies cetuximab , nimotuzumab , gefitinib , and erlotinib used alone or in combination with conventional treatments for scchn have been reviewed by us and others and will not be described in detail here [ 1012 ] . a phase i study of panitumumab in combination with chemoradiotherapy involving 19-treatment - nave patients with stage iii / iv head and neck cancer reported an 87% complete response rate among the 15 evaluable patients and no grade 3 or 4 chronic toxicities . a phase i study of lapatinib in combination with chemoradiation in 31 patients with locally advanced scchn reported an overall response rate of 81% with radiation - associated mucositis , dermatitis , lymphopenia , and neutropenia as the most common grade 3 or 4 adverse events . our phase i study of intratumoral delivery of egfr antisense dna in 17 patients with advanced , refractory scchn was associated with no grade 3 or 4 or dose - limiting toxicities and a clinical response rate ( complete response and partial response by modified recist criteria ) of 29% . the current phase of clinical development for each of these agents is presented in table 1 . to date , no molecular marker has been identified to correlate with scchn response to egfr - targeting in patients . scchn tumor expression of the truncated form of egfr , egfr variant iii ( viii ) , which lacks the ligand binding domain , occurs in up to 40% of scchn tumors and confers resistance to egfr - targeted monoclonal antibodies in scchn preclinical models . however , egfr viii expression and resistance to egfr - targeted therapies in scchn patients has not been described . molecular correlates of clinical response / nonresponse to egfr - targeted therapies have been identified for colon and lung cancers . for example , the treatment of lung cancer with the egfr tyrosine kinase inhibitor gefitinib demonstrated effective responses in a subset of patients whose lung cancers were subsequently found to harbor egfr kinase activating mutations [ 16 , 17 ] . importantly , egfr activating mutations do not appear to be frequent in scchn [ 18 , 19 ] . therefore , some of these molecular correlates , such as the egfr tyrosine kinase activating mutations are not applicable to scchn because the frequency of these mutations is very low and will not be discussed further in this review . however , other molecular correlates of response to egfr - targeting agents have been described for lung cancer and colorectal cancers including egfr gene amplification , other somatic tumor mutations and patient genetic variations . egfr gene amplification occurs in scchn , and the rate of reported egfr gene amplification in scchn varies substantially ( table 2 ) . to date , there are no published reports evaluating egfr gene amplification for association with scchn patient response to egfr - targeted therapies . however , egfr gene amplification has been reported to be positively associated with response to egfr - directed antibody therapies in clinical trials for nonsmall lung cancers ( nsclc ) and colorectal cancers . in a phase ii study of 229 nsclc patients with advanced - stage nsclc treated with cetuximab plus chemotherapy , 76 patient tumors were evaluated for egfr gene amplification by fish and disease controls rate ( complete response / partial response and stable disease ) was found to be significantly higher in patients with fish - positive tumors compared to fish - negative tumors ( 81% versus 55% , p = .02 ) . in this same study , median progression - free survival was also significantly longer for patients with fish - positive tumors compared to fish - negative tumors ( 6 months versus 3 months , p = .0008 ) . several studies have reported positive associations between egfr gene amplification and metastatic colorectal cancer response to egfr - directed antibodies [ 2123 ] . egfr gene amplification in scchn has been reported range between 1058% of scchn ( table 2 ) [ 2432 ] . the range of reported prevalence of egfr gene amplification may be due to differences in expression by tumor anatomical site . however , several methods were used to assess egfr gene amplification , including fluorescence in situ hybridization ( fish ) and quantitative real - time polymerase - chain reaction- ( q - pcr- ) based assays . in addition , different scoring methods were employed in the studies presented in table 2 , some of which included polysomy in the definition for egfr amplification and others did not . these differences in methodologies likely contribute to the variation in reported rates of egfr gene amplification in scchn . the presence of egfr gene amplification in a substantial portion of scchn and the previously reported associations between egfr gene amplification and response to egfr - targeted therapies in other cancers suggest that egfr gene amplification may be a predictive marker for response to egfr - targeted therapies in scchn . when evaluating egfr gene amplification for correlation with response to egfr - targeted agents , it will be important to develop consensus definitions of egfr gene amplification . egfr gene amplification has not consistently been reported to correlate with egfr protein levels although a plausible mechanism for gene amplification without protein overexpression is lacking [ 25 , 2830 ] ( table 2 ) . in nsclc and colon cancers a positive association between egfr gene amplification and protein expression has also not been consistently observed [ 44 , 45 ] . importantly , egfr gene amplification status , but not egfr tumor protein levels , is associated with response to egfr - targeted therapies in nsclc and colorectal cancers . these discrepancies likely reflect the semiquantiatitve and variable methods of assessing gene amplification and protein expression levels in various laboratories . the characterization of egfr gene amplification in scchn patients treated with egfr - directed antibodies and the testing of association with response to therapy will be of interest . ras proteins are small gtpases that regulate signal transduction pathways leading to cell growth , differentiation , and survival . three ras genes produce four ras proteins , kras 4a , kras 4b , h - ras , and n - ras , that are more than 90% homologous but demonstrate a high degree of tumor - type mutation specificity . kras mutations have been reported by several independent groups to be negatively associated with response to egfr tyrosine kinase inhibitors in lung cancer and egfr - directed antibodies in colon cancer . a metaanalysis including 17 nsclc egfr tyrosine kinase inhibitor clinical studies with 1008 patient tumors and 8 metastatic colorectal cancer ( mcrc ) studies of anti - egfr monoclonal antibody - based therapies in 817 mcrc patients found that kras mutations were significantly associated with absence of response to egfr - targeted therapies for these cancers . kras mutations are especially important predictors of unresponsiveness to egfr - directed antibodies in colorectal cancers with egfr gene amplification . reported rates of kras mutations in nsclc range between 820% with higher rates reported for adenocarcinoma compared to squamous cell carcinoma histologies [ 49 , 50 ] . kras mutations are relatively rare in scchn . only one published report has described kras mutations in scchn to date , and in this analysis of 29 oral squamous cell carcinoma tumors , 9 ( 6.9% ) were found to harbor kras mutations . according to the catalogue of somatic mutations in cancer ( cosmic ) database from the sanger institute , kras mutations occur in only approximately 3% of all cancers of the oral cavity , pharynx , or larynx while hras mutations occur in 10% of these cancers ( table 2 ) . these rates are similar to data from the genetic alterations in cancer ( gac ) database presented in table 2 . the recent finding that a mouse knock - in model expressing hras from the kras chromosomal context accumulated hras mutations and resulted in increased lung tumorigenicity suggests that tissue - specific expression of kras and hras likely contributes to tumor - type specificity of mutations in these two genes . to date , only one published study of hras mutations scchn reported a 22% rate of mutations in oral squamous cell carcinoma ( table 2 ) . mutations in hras are likely to be more common in scchn than kras mutations and may be important correlates for lack of response to egfr - targeted therapies in scchn . phosphatidylinositol 3-kinases ( pi3ks ) are heterodimeric kinases composed of regulatory and catalytic subunits that are involved in the control of cell proliferation , survival , and motility . the pi3k catalytic subunit , p110alpha ( pik3ca ) has been reported to be somatically mutated and activated in several cancers including scchn . activation of pik3ca leads to plasma membrane recruitment and activation of akt and downstream survival mechanisms . pik3ca mutations have been reported to be associated with resistance to egfr - targeted monoclonal antibodies in patients with metastatic colorectal cancers ( mcrc ) . in a study involving 110 patients with mcrc , pik3ca mutations were found to be significantly associated with reduced objective response rates following treatment with cetuximab or panitumumab ( p = .038 ) and shorter progression - free survival ( p = .035 ) . pik3ca mutations have been reported to occur in up to 8% of scchn as summarized in table 2 [ 3639 ] . additionally , loss of pten expression occurs by mechanisms including promoter methylation and silencing or loss of heterozygosity . in scchn , pten mutations are not common ( table 2 ) [ 4043 ] , and loss of heterozygocity of pten has been reported to occur in approximately 12% of scchn . though the association with response to egfr - targeted therapy in mcrc and loss of pten expression does not appear to be as strongly correlated as response and pik3ca mutations , the consideration of both tumor pten expression status and pik3ca mutation status may contribute to predicting response to egfr - targeted therapies in scchn . several egfr polymorphisms have been reported to be associated with differential response to egfr - targeted therapies . in lung cancer , shorter egfr intron 1 ca repeat polymorphism has been reported to be associated with improved response to gefitinib in two independent studies [ 54 , 55 ] . in one study involving 70 patients with advanced nsclc , patients with fewer than 17 ca repeats at either allele had significantly longer survival following treatment with gefitinib than patients having both alleles greater than 16 ca repeats ( p = .039 ) . fewer egfr intron 1 ca repeats were also significantly associated with mcrc patient response to cetuximab - based treatment in a study involving 110 mcrc patients receiving combined cetuximab - irinotecan salvage therapy . an independent study of 139 nsclc patients with who performance status of 0 or 1 who received gefitinib reported that patients with the egfr haplotype of 216g/191c had significantly worse survival with a hazard ratio of 1.85 ( 95% ci : 1.09 to 3.12 ) after adjusting for performance status , previous platinum treatment , skin rash , and diarrhea . the egfr intron 1 ca repeat polymorphism has been reported to affect egfr basal transcription with higher transcription rates reported in individuals with fewer ca repeats [ 58 , 59 ] . differential promoter activity has also been reported for the two most common egfr haplotypes at the 216 g > t and 191c > a with the 216g/191c haplotype having lower promoter activity and mrna expression [ 60 , 61 ] . these studies , therefore , indicate that patient egfr polymorphisms associated with higher egfr expression are more likely to respond to egfr - targeted therapies . the presence of the egfr k521r variant has also been found to be associated with significantly improved progression - free survival ( pfs ) and overall survival ( os ) in 32 egfr - positive mcrc patients treated with cetuximab in combination with irinotecan . patients with the k521r variant had significantly longer pfs than patients with wild - type egfr , 5.7 months versus 3.2 months , respectively , ( p = .04 , log rank test ) and os , 20.1 months versus 13.8 months , respectively , ( p = .03 ) . this egfr variant , which resides in the extracellular domain of egfr , has reduced ligand - binding , growth - stimulation , and kinase activity in vitro for the 521k variant . these findings suggest that egfr polymorphisms have the potential to be correlated with response to egfr - targeted therapies in scchn . cetuximab , a chimeric monoclonal igg1 anti - egfr antibody ( table 1 ) , may exert its antitumor effects via several mechanisms including antibody - dependent cell mediated cytotoxicity ( adcc ) . the fragment c ( fc ) portion of igg1 antibodies can be recognized by the fc gamma receptors ( fcr ) on immune effector cells to induce adcc . polymorphisms in fcriiia have been shown to be associated with differential response to cetuximab in mcrc patients in clinical studies and to scchn cell lines in vitro [ 6365 ] . the fcriiia polymorphism - v158f variant 158v was found to have higher cetuximab - mediated adcc in vitro [ 64 , 65 ] . the 158v variant was also associated with longer pfs in a study involving 69 mcrc patients treated with cetuximab plus irinotecan . these findings indicate that fcriii variants may contribute to response to cetuximab in scchn patients . the ability to correctly predict which patients will respond to which egfr - targeted therapy will improve clinical response and reduce treatment - associated toxicities for these patients . however , the minority of scchn patients have responded to egfr - targeted therapies in clinical trials , indicating that even if patients likely to respond to egfr - targeted therapy were identified , they would represent a small portion of scchn patients . even though the majority of scchn cancers overexpress egfr , these tumors are not solely dependent upon egfr activity . this is likely due to the presence of preexisting or treatment - induced compensatory signaling pathways . because egfr is activated in scchn and response to egfr - targeted therapies has been demonstrated in clinical trials , it is reasonable to consider targeted therapies to be used in combination with egfr - targeted therapeutics . molecular signaling pathways in scchn that can be activated independently of egfr include pathways initiated by g - protein - coupled receptors , integrins , and other receptor tyrosine kinases . many of these pathways share src family kinases ( sfk ) as downstream mediators of signaling . for these reasons , the combination of sfk- and egfr - targeted agents for treatment of scchn is anticipated to have improved clinical efficacy compared to egfr - targeting agents alone . eight src nonreceptor protein tyrosine kinase family members are expressed in humans : c - src , blk , fgr , fyn , hck , lck , lyn , and c - yes . c - src , fyn , lyn , and c - yes are broadly expressed , while blk , fgr , hck , and lck expression is primarily restricted to hematopoietic cells . src kinases have been implicated in normal cellular functions including cell adhesion , migration , angiogenesis , survival , proliferation , and differentiation [ 67 , 68 ] . when these processes are inappropriately regulated , they can contribute to tumorigenesis , tumor progression and metastases . in scchn models , src kinases are activated in response to egfr stimulation , associate with egfr , and have reduced activity following egfr inhibition in vitro . src kinases are also upstream activators of egfr and other receptor tyrosine kinases ( rtks ) . following g - protein - coupled receptor ( gpcr ) stimulation , src kinases are activated , resulting in the release of rtk ligands [ 71 , 72 ] . in addition to rtks and gpcrs , src kinases are also activated by integrins in scchn . src kinases , therefore , are involved in the autocrine / paracrine stimulation of scchn and mediate egfr - dependent and egfr - independent signaling events . of the src family kinases ( sfk ) , c - src is the most studied and most often implicated in cancer . elevated c - src protein and/or kinase activity has been reported for cancers of the lung , colon , breast , ovary , and pancreas in addition to head and neck cancers [ 68 , 74 ] . . therefore , increased activity of upstream signaling components and/or decreased activity of c - src negative regulators are likely causes of c - src activation observed in many epithelial cancers . the sfk c - src , fyn , lyn , and c - yes are activated in scchn cell lines in vitro following stimulation with the egfr ligand tgf- , and these sfk likely play roles in scchn . at least one group has reported differential response of sfk to integrin 6 signaling following simulation with fibronectin , the integrin 6 ligand , in oral squamous cell carcinoma cell lines . integrin 6 , which is neoexpressed in scchn , has been found to activate fyn but not c - src or c - yes in scchn upon ligation with fibronectin , leading to fyn - dependent activation of the raf - erk / mapk pathway . the murine knock - out models of specific sfk provide insights into the different roles of the individual sfk . the functions of some of the sfks are redundant , at least regarding mouse development , as evidenced by lack of phenotype for single knock - out models of c - yes , hck , c - fgr , and blk . the single knock - out murine models of lyn and lck had immune impairments , fyn knock - out mice exhibited defective brain development and impaired memory and immune functions , and c - src null mice developed a bone remodeling disease with excess accumulation of bone . therefore , some functions are likely shared between the four sfks with a subset of functions that may be unique to selective sfk . the major site of scchn metastases is locoregional lymph nodes , and presence of neck lymph node metastases is universally accepted as the most important prognostic indicator for scchn . the development of metastases requires that cells move from the primary tumor and invade surrounding tissues . invasion by tumor cells is preceded by the loss of cell adhesion and the gain of mesenchymal features in a process similar to events that occur in development termed epithelial - mesenchymal transition ( emt ) . emt is accompanied by the loss of e - cadherin , which is a principal component of cell adhesion complexes , and the gain of mesenchymal characteristics including expression of vimentin . the activation of src kinases has been shown to be involved in emt in cancer . more recently , a study evaluating 50 primary scchn tumors for activated phospho - src ( p - src ) , e - cadherin , and vimentin expression by immunohistochemical staining found increased p - src , decreased e - cadherin , and presence of vimentin expression in scchn tumors to be significantly associated ( p < .05 ) with morphologies associated with aggressive cancers including penetrating invasive fronts , poor or sarcomatoid differentiation , and lymph node metastases . it is important to note that the p - src antibody used in this study recognizes several activated sfks and is not specific for p - c - src . in addition to studies in scchn tumors , preclinical studies indicate that sfks are involved in scchn migration and invasion . our group found that blockage using an src - specific inhibitor a-419259 resulted in decreased invasion and growth of scchn cell lines in vitro following stimulation with a gpcr ligand , gastrin - releasing peptide . an independent group reported that dasatinib ( sprycel , bms-34825 ; bristol - meyers squibb ) , a dual src / abl kinase inhibitor ( table 3 ) , inhibited migration and invasion in vitro in all 8 scchn cell lines evaluated . together these studies implicate an important role or roles for sfk in tumor migration and invasion , which are associated with increased mortality in scchn . which sfks importantly , epithelial tumor cells including scchn that have undergone emt and acquired mesenchymal characteristics are more resistant to egfr - targeted therapies than tumor cells that have epithelial characteristics . combining src - targeted agents with egfr - targeted therapies may be more effective than egfr - targeted therapies alone for the control of scchn locoregional metastases . several small molecule inhibitors of c - src and sfk are currently in clinical development for solid tumors including dasatinib ( sprycel , bms ) , azd0530 ( astrazeneca ) , bosutinib ( ski-606 ; wyeth ) , xl999 ( exelixix ) , and kx01 ( kinex ) ( table 3 ) . all of these inhibitors are reversible inhibitors , and all except kx01 are atp - competitive inhibitors ( table 3 ) . dasatinib and xl999 target several known kinases in addition to sfk ( table 3 ) , while azd0530 and bosutinib are dual sfk / abl inhibitors . dasatinib , which was fda - approved for treatment of nonsolid tumors in june 2008 , and azd0530 are in phase ii clinical trials for scchn . bosutinib and xl999 are in phase ii clinical trials for other cancers ( table 3 ) . however , xl999 , which inhibits vegfr , pdgfr and fgfr in addition to src kinases , was associated with serious cardiovascular toxicities in phase i and ii clinical trials [ 8284 ] . a new addition to src inhibitors in clinical development includes the c - src substrate competitive inhibitor , kx01 , which is currently being tested in phase i clinical trials . kx01 is exquisitely specific for c - src whereas other src - targeting agents inhibit other sfk in addition to c - src [ 8587 ] . to date there are no reports of src - targeted therapeutics in scchn clinical trials or molecular predictors of response to src - targeted therapies in patients with solid malignancies . combining egfr- and src - targeted therapies for scchn is supported by results from preclinical studies . our group reported that combined azd0530 and gefitinib treatment of scchn cell lines in vitro resulted in significantly reduced cell growth and invasion compared to single agent treatments . de novo and acquired resistance to cetuximab are means by which scchn patients fail therapy . scchn and nsclc preclinical models selected for resistance to cetuximab in vitro have been reported to have high levels of activated sfk and to have decreased pi3k / akt activity following dasatinib treatment . interestingly , these cetuximab resistant cells were found to be resensitized to cetuximab following treatment with dasatinib . these data in addition to our current understanding that many egfr - independent cell signaling pathways , including gpcr- and integrin - initiated pathways , are modulated at least in part by sfk provide the rationale for the combined targeting of egfr and sfk for treatment of scchn . to date , there are no published reports of combined egfr- and src - targeted therapies for treatment of patients with solid tumors . three clinical trials combining egfr- and src - targeted therapies for upper aerodigestive cancers are currently ongoing . a phase i trial combining dasatinib with erlotinib in patients with recurrent nsclc is ongoing at the h. lee moffitt cancer center and research institute ( nct00444015 , clincaltrials.gov ) . a phase i / ii study in nsclc also combining dasatinib with erlotinib is ongoing at m.d . our group will soon open a phase 0 biomarker modulation study combining erlotinib with dasatinib for patients with scchn or nsclc ( nct00779389 , clinicaltrials.gov ) . our group recently completed a phase i trial combining cetuximab with dasatinib for treatment of advanced solid malignancies ( nct00388427 , clinicaltrials.gov ) . seventeen of 25 patients enrolled in our phase i study were evaluable for response , and 9 had stable disease while head ache was a primary toxicity . we have evaluated molecular correlates in these patients and found that p - sfk levels in peripheral blood mononuclear cells were transiently reduced following daily dasatinib dosing ( unpublished data ) . in addition , we found that egfr , tgf- and amphiregulin plasma levels were altered following treatment ( unpublished data ) . a phase ii study combining dasatinib and cetuximab for treating scchn patients is planned at the university of pittsburgh cancer institute . results from molecular correlate studies from this trial and others will be of great importance as the scchn medical and research communities work to identify predictive molecular markers of response to these therapies . despite the ubiquitous expression of egfr in scchn , clinical responses to egfr targeting agents , particularly , when administered as single agents , has been modest . cetuximab was fda - approved in 2006 for the treatment of newly diagnosed scchn in combination with radiation and recently extended to the recurrent / metastatic population in combination with chemoradiotherapy . however , in most of these trials , expression levels of egfr in the tumor have not correlated with response to cetuximab and no single biomarker to date in baseline tissue has been proven to predict response to egfr targeting agents . comprehensive genomic and proteomic studies of baseline tissue are required in the context of clinical trials to begin to identify potential markers of clinical activity . since egfr signaling involves intracellular interactions with other oncogenic pathways in scchn preclinical models , it is plausible that cotargeting of egfr in conjunction with blockade of these pathways may be beneficial . src family kinases represent a potential pathway for targeting , especially given the fda - approval of the src kinase inhibitor dasatinib for hematopoietic malignancies . challenges include : ( 1 ) the difficulty of testing antiinvasive / antimetastatic agents in clinical trial settings , and ( 2 ) the possibility that recist criteria may not reflect decreased tumor proliferation , metabolism , or increased apoptosis as evidence by studies that have incorporated pet tracers . more relevant endpoints in egfr-/src - targeted trials than tumor shrinkage may include time to progression or overall survival

the epidermal growth factor receptor- ( egfr- ) directed antibody , cetuximab , was fda - approved for the treatment of squamous cell carcinoma of the head and neck ( scchn ) in 2006 . additional egfr - targeting agents in clinical development for scchn include other egfr - directed antibodies , tyrosine kinase inhibitors and antisense dna . although the majority of scchn overexpress egfr , scchn clinical responses to egfr - targeting agents have been modest . molecular predictors for scchn response to egfr - targeted therapies have not been identified . however , molecular correlate studies in lung cancer and colon cancer , which have egfr - targeted therapeutics fda - approved for treatment , may provide insights . we describe candidate predictive markers for scchn response to egfr - targeted therapies and their prevalence in scchn . clinical response will likely be improved by targeted therapy combination treatments . src family kinases mediate egfr - dependent and -independent tumor progression pathways in many cancers including scchn . several src - targeting agents are in clinical development for solid malignancies . molecular correlate studies for src - targeting therapies are few and biomarkers correlated with patient response are limited . identifying scchn patients who will respond to combined egfr- and src - targeting will require further characterization of molecular correlates . we discuss rationale for egfr and src co - targeting for scchn treatment and describe recent clinical trials implementing combined src- and egfr - targeted therapeutics .

1. Introduction 2. EGFR-Targeted Therapies for SCCHN 3. Predictors of Response to EGFR-Targeted Therapies 4. Src Family Kinases in SCCHN 5. Src Family Kinases in SCCHN Invasion and Progression 6. Src-Targeting Agents in Clinical Development 7. Cotargeting of EGFR and Src Family Kinases in Patients 8. Summary and Future Directions