Datasets:

olivierdehaene

/

xkcd

like 6

Foucault Pendulum

Foucault Pendulum

https://www.xkcd.com/2201

https://www.explainxkcd.com/wiki/index.php/2201:_Foucault_Pendulum

[Megan is addressing Cueball, Black Hat and Ponytail as they are looking a pendulum, which consists of a large swinging sphere with a spike beneath it hanging on a string coming down from above with seven small markers under it. Megan is pointing at it while it is swinging towards them, as indicated with lines behind the sphere and the string.] Megan: This Foucault pendulum demonstrates Earth's rotation. It stays in a fixed plane while the Earth rotates under it. [Close-up on Black Hat holding a hand to his chin.] Black Hat: Hmm, really. Black Hat: So that means... [Zoom out to Black Hat running to the pendulum grabbing it with both hands. He knocks over two of the seven markers that can now be seen to be small pegs standing up on he floor beneath the pendulum. A line goes from his hand on the pendulum up to a sound bubble. Two people off-panel yell at him.] Character off-panel 1: Hey! Character off-panel 2: Stop him! Sound: Grab! [Blondie as a news anchor uses her held out hand to indicate Black Hat who is shown on a screen next to her. There is a caption in two lines above it. The first line in normal text, the second line in white in a black rectangle. There are further unreadable text below the picture.] Blondie: The Earth's rotation was briefly halted today until geophysicists wrestled the intruder to the ground... Breaking news

Black Hat is attending what appears to be a guided tour of a museum with a Foucault pendulum . Megan is explaining to him, Cueball and Ponytail about the device which demonstrates the rotation of the Earth. Black Hat, being himself, immediately sees an opportunity to cause chaos and seizes it with both hands, quite literally — he grabs the pendulum, which causes the others to shout after him to stop. At first this would seemingly be for fear of ruining the delicate demonstration. However, in the final panel, the news anchor Blondie reveals to us that by arresting the motion of the pendulum, Black Hat has somehow stopped the rotation of the Earth. However, it was only briefly, since the local geophysicists managed to wrestle him down, and it must be assumed that they then quickly restarted the pendulum and thus the Earth's rotation. This of course is blatantly impossible, since the Foucault pendulum's motion is tied to the Earth's rotation, not the other way around (at least in any significant way, see below). A Foucault pendulum is a regular pendulum that swings from a bearing that allows rotation in any direction, like your shoulder joint instead of your elbow, as a demonstration that the Earth is rotating beneath it. If the Earth were stationary, the pendulum's plane of oscillation would not change relative to its immediate surroundings, but the Earth is not stationary, so the pendulum's plane of oscillation will appear to rotate over the course of a day, although in reality it is the Earth that rotates. The low-friction bearing doesn't allow the rotation of the Earth to affect the motion of the pendulum, so it tends to stay aligned with its original inertial reference frame rather than with its surroundings, which rotate with the Earth. A Foucault pendulum located at one of the poles will take a full day to "move" one full round. At the equator there is no movement, and in between it will take longer than 24 hours (24 hours divided by the sine of the latitude). The fact that the Earth's rotation does not influence the motion of the pendulum does NOT mean that other forces can't affect it - for example, someone running up and manually repositioning the pendulum. Of course, the apparent rotation of the pendulum's plane relative to the Earth is an effect of the planet's motion, rather than the cause of it. Thus, stopping a Foucault pendulum manually does not entail pausing the rotation of the Earth. [ citation needed ] If it were somehow possible for a Foucault pendulum to control Earth's rotation (see above), Black Hat would probably not want to alter the momentum of the pendulum if he were not at one of the Earth's poles. That is assuming he was told that it was related to Earth's rotation and assuming that he would prefer to preserve his own life over creating chaos (unless he has some means to prevent his being slammed into a nearby wall at the speed of sound). This is because, if the rotation of the Earth were to be stopped for even very short amounts of time (a few seconds), it would cause everything on Earth that wasn't bolted/fastened to the ground to move eastward compared to the now stationary ground. Objects near the Equator would suddenly be moving at a speed of 300-360 meters per second, likely causing the death of most lifeforms on Earth beneath a certain latitude almost instantaneously. Those close enough to the poles may survive, though. Also this will cause massive windstorms, tsunamis, volcanic and tectonic events on a scale not previously observed on Earth. This would likely cause a mass extinction event and wipe out most of humanity in the initial events (which would eventually lead to our total extinction). It is possible that Black Hat's grabbing the pendulum would cause a gradual slowing prior to stopping, minimizing the issue (though this doesn't seem to be the case), but the results would still be catastrophic, as the aforementioned events are still likely to occur (specifically the tsunamis and volcanic events). However, as mentioned above, if this pendulum were located at the South Pole, then Black Hat and other people around him would not be affected immediately, and he could both do it, survive and be stopped again. The question is whether there would be any more news stories to cover this, given what would happen to the rest of the world! If there was no one to readjust the pendulum's rotation, then certain events would happen after the initial damage (see this video [1] ). Randall previously covered this scenario in detail in his what if? book, see XKCD's Creator Explains What Would Happen If Earth Stopped Spinning . To be completely correct, the angular momentum of the Earth+pendulum system is constant, so that when Black Hat "stops" the pendulum's rotation with respect to the Earth, he actually transfers to the pendulum some of Earth's angular momentum, thereby slightly slowing Earth's rotation. But the order of magnitude of that effect is (at most) in proportion to the pendulum-to-Earth mass ratio. Earth's mass being ~6 x 10 24 kg, the effect for any practical pendulum would be beyond the 20th decimal place and would therefore go totally unnoticed. The title text mentions the International Earth Rotation and Reference Systems Service , an organization providing standards for global time and reference frames; this organization would have a very rough day after the fiasco with Black Hat. The title text refers to a (probably) fictional paramilitary enforcement arm of this organization and the foolishness of tangling with such a force. If Foucault pendulums were somehow able to influence the rotation of the Earth in any measurable way, the IERS enforcers would probably strictly control their installation and monitor their use (and misuse). Black Hat is likely in for a rough day as well. It seems likely that some on this team are geophysicists, since they were the ones who took Black Hat down. [Megan is addressing Cueball, Black Hat and Ponytail as they are looking a pendulum, which consists of a large swinging sphere with a spike beneath it hanging on a string coming down from above with seven small markers under it. Megan is pointing at it while it is swinging towards them, as indicated with lines behind the sphere and the string.] Megan: This Foucault pendulum demonstrates Earth's rotation. It stays in a fixed plane while the Earth rotates under it. [Close-up on Black Hat holding a hand to his chin.] Black Hat: Hmm, really. Black Hat: So that means... [Zoom out to Black Hat running to the pendulum grabbing it with both hands. He knocks over two of the seven markers that can now be seen to be small pegs standing up on he floor beneath the pendulum. A line goes from his hand on the pendulum up to a sound bubble. Two people off-panel yell at him.] Character off-panel 1: Hey! Character off-panel 2: Stop him! Sound: Grab! [Blondie as a news anchor uses her held out hand to indicate Black Hat who is shown on a screen next to her. There is a caption in two lines above it. The first line in normal text, the second line in white in a black rectangle. There are further unreadable text below the picture.] Blondie: The Earth's rotation was briefly halted today until geophysicists wrestled the intruder to the ground... Breaking news

Earth-Like Exoplanet

Earth-Like Exoplanet

https://www.xkcd.com/2202

https://www.explainxkcd.com/wiki/index.php/2202:_Earth-Like_Exoplanet

[Side view of Megan standing behind a lectern, speaking to an off-panel audience in front of her. Two people from the audience react to her statement.] Megan: We've discovered the most earth-like exoplanet yet! Off-panel voices: Yay!! [Front view of Megan behind lectern:] Megan: Well, it's in the habitable zone. Habitable-ish. "Habitable." Megan: The survivable zone. [In a frameless panel with the same setting as before, Megan holds her left hand out with palm up.] Megan: It's tidally locked. And blasted with stellar flares. And probably meteors. And bathed in acid. [Closeup side view of Megan, now holding up a finger on her left hand. Again an unseen audience member replies.] Megan: But we've detected water vapor! In between all the swinging blades. Off-panel voice: I see. Megan: We're hoping to find biosignatures in the form of screaming.

This comic is a reference to the recent discovery of water vapor in the atmosphere of exoplanet K2-18b . The planet was discovered already in 2015 by the Kepler Space Observatory , orbiting the red dwarf star K2-18 . Water on exoplanets is considered a biosignature , meaning it's an indicator that there could be life there. However, as Megan reveals the planet's other characteristics, it becomes clear that it is unlikely to actually support life, and in fact is actually a horrible hellscape. The question of habitability by higher forms of life is profoundly different from the way astrobiologists use the term for microbes. Even a "survivable zone" can't mitigate the description of just how inhospitable this new wet planet would be to life as we know it, save possibly for extremophile organisms. In the comic 1231: Habitable Zone , this zone was the subject. The planet being tidally locked indicates that the same side would face the planet's star year-round, meaning half of the planet would be in constant day and the other half would be in constant night. It is believed that K2-18b is tidally locked . Based on our (admittedly limited) understanding of life, abiogenesis can only occur in environments with liquid water; however, the day hemisphere would likely be so hot that all water found there would be in a gaseous state, and all water found in the night hemisphere would likely be frozen due to the intense cold. If life were to be found on this exoplanet, it would be in the twilight strip, a thin ring around the edge separating the two hemispheres where sunlight can reach but is refracted by the atmosphere. The environment in the twilight strip would thus experience something akin to an eternal sunset, and temperatures there would be moderate enough to allow life to come about. Unfortunately, the other characteristics of the exoplanet severely undermine our chances of finding life even in its twilight strip, as there are many problems with the habitability of red dwarf systems . The comic uses swinging blades as a metaphor to succinctly describe the planet's perilous conditions. That is, as far we know, there are no actual swinging blades on K2-18b. [ citation needed ] Swinging blades made their first famous appearance in the Edgar Allan Poe poem "The Pit and the Pendulum ," where the titular pendulum was a large blade swinging back and forth slowly. Due to the fame of Poe's work and the number of allusions made to it over the years, swinging blades have become a common feature in fictional deathtraps, and were used as an analogy to illustrate that the planet is chronically inhospitable to life. "Biosignatures in the form of screaming" suggests that any life that had developed on the planet would be in continuous pain or fear due to their hazardous surroundings. In addition, this suggests that the screaming of these organisms would cause ripples in the atmosphere which we should be able to detect light-years away through the vacuum of space and that it would be more noticeable than other signs of life (such as the spectra from the ash produced by burning organic material.) The title text mentions that fire could indicate the presence of life. This is because fire requires both fuel and oxygen (or some other similar, reactive gas). The occurrence of fire suggests that those things are both being continuously produced by some process. The most likely processes we know for producing oxygen are biological. The irony, of course, is that fire is also very dangerous, and almost universally lethal to organisms that are exposed to it for long enough. Munroe points out that oxygen reliably indicates that there was life, before the fire, with the implication that the fire may have killed everything. [Side view of Megan standing behind a lectern, speaking to an off-panel audience in front of her. Two people from the audience react to her statement.] Megan: We've discovered the most earth-like exoplanet yet! Off-panel voices: Yay!! [Front view of Megan behind lectern:] Megan: Well, it's in the habitable zone. Habitable-ish. "Habitable." Megan: The survivable zone. [In a frameless panel with the same setting as before, Megan holds her left hand out with palm up.] Megan: It's tidally locked. And blasted with stellar flares. And probably meteors. And bathed in acid. [Closeup side view of Megan, now holding up a finger on her left hand. Again an unseen audience member replies.] Megan: But we've detected water vapor! In between all the swinging blades. Off-panel voice: I see. Megan: We're hoping to find biosignatures in the form of screaming.

Prescience

Prescience

https://www.xkcd.com/2203

https://www.explainxkcd.com/wiki/index.php/2203:_Prescience

[Cueball is sitting in an armchair holding a book. He seems to be looking off as he talks to an off-panel person behind him. This person replies.] Cueball: You know, it's been a while since there's been a really big meteor impact. Off-panel voice: Will you stop that?! [Caption below the panel:] I say this kind of thing every so often, because I don't believe it affects the outcome and it has a slim chance of looking incredibly prescient.

In this comic, Cueball states that it's been a long time since there's been a really big meteor impact . Due to the Gambler's Fallacy , this is taken to be Cueball implying that a big meteor impact is coming soon. The off-panel voice is annoyed about his statement, but whether from fear of it happening or because he does this all the time is unclear, see more below. The joke is that Cueball does this often, also with other types of major random events, just in case they do actually happen soon. For instance, if there does happen to be an impact soon after he made the statement, it makes him look incredibly prescient , whereas if there isn't one, no one really cares or remembers. It is also unclear how big an impact he refers to. It has been 60 million years since the impact that killed the dinosaurs , but that if that is the type of event he refers to, then maybe no one will be there to remember what he said. So it is likely much smaller impacts he is talking about. Prescience means to predict the future. It is clear from this comic that Randall makes fun of both of those that claim to have prescience and of those that have a superstition against talking about something happening that could cause it to happen. Although only one method is scientifically recognized, there are at least three possible sources of prescience recognized by people. The first of the two main ways of predicting the future involves a mix of common sense and historical knowledge. By understanding the past, the direction of the future can be guessed at with varying levels of accuracy. This type of prescience is also known sometimes as future modeling, statistical prediction, and even wisdom to name a few. The second way to predict the future is not scientifically recognized but remains popular in culture and fiction. It can involve magic, psychic power, higher powers (gods), and other such methods. Collectively, they are labeled supernatural; any method to predict the future using this class of method cannot be easily measured by science. Although not technically a way to predict the future, the third way to predict the future is through superstition. The method involved in this comic effectively boils down to "speak the name of evil, and you will summon it." This superstition can have surprising power in people's lives, however. A woman planning her outdoor wedding may feel the urge to hit her friend if they say "Gosh, I hope it doesn't rain on that day." A doctor working in the Emergency Room may feel the need to kick anyone who says "Wow, it's really quiet around here." Such thoughts spoken aloud do not have the power to control the weather or cause people to seriously injure themselves. Yet people often react emotionally as if not speaking the name of 'evil' will keep it away. This comic may reflect that emotional reaction when the off-screen character yells at Cueball: "Will you stop that?!". Alternatively, it is one, like Megan , who knows Cueball well enough to know that which is stated in the caption, that he only does this to look good if said thing happens. And the person is so tired of it! Maybe Cueball does it at least once a week, and obviously from the caption, it is not only about meteor impact, but any major random event, that he could then be remembered as having predicted. The title, Prescience, has a double meaning. The first meaning is about the prescience that would appear if one actually predicts a natural disaster this way. The second meaning involves the fact that it is spelled pre-science - since there are many more scientific ways to predict meteor impacts, even though they aren't entirely accurate. The title text refers to the RMS Titanic , a ship which was claimed to be unsinkable by those promoting its maiden voyage. But then it struck an iceberg in an unfortunate way so more compartments would be filled with water that it could survive; and, therefore, it could and eventually would sink. But with all the news stories that had just been published hailing this unsinkable ship as a modern wonder of the world, this shipwreck was particularly ironic. The story of the sinking of the Titanic has been memorialized in popular culture, most memorably in the 1997 film Titanic . In the title text, Randall thus suggests that lots of ships had been called unsinkable before Titanic. But saying such hubris out loud doesn't make any ship more likely to sink. But when such a ship, like Titanic, then sinks it does, however, increase the value of the story ensuring it will be remembered. It should be noted that few among the ship's builders or crew boasted the Titanic to be unsinkable. Most of the boasting came from the owners that used the news media of the day to create hype and promote their ship, just when the ship was finished and dedicated (the ship's builders did, however, boast that the ship exceeded all safety standards of the time). In addition, the hubris was only one small part of the fame of the sinking of the Titanic ; the Titanic' s status as a world record setter for most massive ship ever built, the incredible wealth of most of its passengers, and the fact it sank on its maiden voyage all contributed to the fame and hype behind the great maritime tragedy. Ironically part of what caused this disaster was hubris, since those that were interested in promoting the ship also wished it to make a speed record, by reaching New York a day before expected. Thus the captain, even though he would have realised that the ship could sink, took the fateful decisions of running at full speed through waters known to contain icebergs during a still night with very calm waters. Spotting icebergs in such conditions is known to be difficult, especially as there will be no notably foaming waves around the icebergs' bases and patchy mists will inconveniently diffuse the horizons and any useful starlight. [Cueball is sitting in an armchair holding a book. He seems to be looking off as he talks to an off-panel person behind him. This person replies.] Cueball: You know, it's been a while since there's been a really big meteor impact. Off-panel voice: Will you stop that?! [Caption below the panel:] I say this kind of thing every so often, because I don't believe it affects the outcome and it has a slim chance of looking incredibly prescient.

Ksp 2

Ksp 2

https://www.xkcd.com/2204

https://www.explainxkcd.com/wiki/index.php/2204:_Ksp_2

[Cueball is sitting in an office chair at his desk in front of a computer. He is surrounded by four people, and is looking over his shoulder at the ones standing behind him, Hairy - holding his palms up - and Ponytail stretching her arms out towards him. On the other side of the desk is another Cueball-like guy holding his arms out palms up and Hairbun who stretches her arms out to the side.] Hairy: Please hold off until the end of summer. We can't afford the personnel hit right before the late July launch window. Ponytail: People have already started calling in sick! Hairbun: Do you want a moon? We'll give you a moon! [Caption below the panel:] NASA tries desperately to get the Kerbal Space Program team to delay KSP 2 until after the Mars 2020 mission launches.

Cueball , a programmer, is sitting at his computer while four other persons from NASA , Hairy , Ponytail , Hairbun and another Cueball-like person try to convince him to delay the release of a sequel to Kerbal Space Program (KSP 2). Kerbal Space Program (KSP for short) is a space flight simulation video game with a Keplerian orbital physics engine, allowing for semi-realistic orbital maneuvers. KSP is a recurring theme in xkcd. A sequel, abbreviated here as KSP 2, was planned at the time of the comic's publication to be released in 2020, although it has since been delayed to Early 2023. Also planned for 2020 is the Perseverance mission, a mars rover originally named Mars 2020 , which successfully landed. The joke in the comic comes as engineers are likely to want to extensively play with KSP 2 to the exclusion of other things, and NASA is worried about the Mars 2020 mission being delayed or failing because the engineers are too focused on playing KSP 2, including taking an extended vacation and "sick" days off. Cueball, sitting at a desk in front of a computer, is represented here as being in charge of KSP 2, and the other characters standing around him are pleading with him to delay the release of KSP 2 until the Mars rover program is complete, even being willing to "give [him] a moon". Offering to give somebody the moon occurs occasionally in songs and poetry, as an idiom meaning desire to offer something of great value, or expressing great desire to please. Literally giving a moon to Cueball is impossible, [ citation needed ] but it is possible to name a moon after Cueball, so that may be what is implied instead. This could also be a reference to the film Despicable Me , which revolves around Gru and his Minions trying to steal the Moon. The Kerbals (mascots of Kerbal Space Program) resemble the Minions from the film. The title text is a sentence said by someone from a committee in NASA that oversees the progress and budget of the Mars 2020 mission. They are satisfied that the launch in 2020 is still on track, but has a question regarding the 'human capital/personnel retention' budget, which has several unmarked cash payments, more than they would expect. As they begin to ask what they are, someone from the Mars 2020 project interrupts, having probably foreseen this question, stating that it is Public outreach. In the original Kerbal Space Program, playing in career mode, the player can select various "strategies" at the administration building to exchange or boost various assets. "Public Outreach" appears similar to the "Public Relations" strategy "Appreciation Campaign", which exchanges a portion of in-game money earned completing mission contracts for prestige, which has an effect on mission contracts the game makes available. The title text suggests NASA could be paying Private Division, the developers of Kerbal Space Program, money to delay their release until after the Mars mission. NASA has dabbled in game physics engines for "public outreach," with the same mixed record of success as any promising R&D endeavor. Pertinent projects included a series of collaboration laboratories on various forms of social media including Second Life which hosted a "NASA CoLab" region active from 2007 to around 2013. While the unrealistic constraints imposed by real-time physics engine simulation prevented much actual engineering, such shared 3D computer aided design (CAD) systems provide a measure of drafting training in a play sandbox system outside of a formal work environment. NASA frequently holds design competitions, including some in which winning participants have spoken highly of KSP, and some of which are used for developments in medical informatics, for example, outside the field of aerospace engineering and space colonization simulation. The use of game development competitions to assist scientific progress is also used in the Fold.it competitive protein folding game, where the winners build antibodies to save the lives of those who have health care. Such efforts have often been supported by SBIR -sized government agency grants from several countries, along with other individuals (i.e., customer) support and help from organizations to build software improving competitive score achievement. NASA has also been involved in asking software publishers to remove, withdraw, or restrict their releases, such as the COMSOL plasma physics engine library, rumored to be useful for the design of nuclear weapons. But whether any government agency has ever paid for the delay of a computer simulation game in order to increase their productivity is an open question. An alternative suggestion of the title text is that NASA gave cash to employees, their families, friends, associates, and foreign spy followers to purchase additional copies of KSP 2 to encourage development innovations, international collaboration, as a "force multiplier" for personnel retention, and as bonus incentive awards for engineers who are ahead of schedule for their part of the Mars 2020 launch. [Cueball is sitting in an office chair at his desk in front of a computer. He is surrounded by four people, and is looking over his shoulder at the ones standing behind him, Hairy - holding his palms up - and Ponytail stretching her arms out towards him. On the other side of the desk is another Cueball-like guy holding his arms out palms up and Hairbun who stretches her arms out to the side.] Hairy: Please hold off until the end of summer. We can't afford the personnel hit right before the late July launch window. Ponytail: People have already started calling in sick! Hairbun: Do you want a moon? We'll give you a moon! [Caption below the panel:] NASA tries desperately to get the Kerbal Space Program team to delay KSP 2 until after the Mars 2020 mission launches.

Types of Approximation

Types of Approximation

https://www.xkcd.com/2205

https://www.explainxkcd.com/wiki/index.php/2205:_Types_of_Approximation

[Three panels show the same setup with three different characters. In the upper-right corner of each panel is the lower-left portion of a wheel and hub diagram, showing two spokes going out to a curved rail. The two spokes connect to the rail with a small raised portion on the inside of the rail. There are both readable and unreadable text/symbols both outside and inside the curve and an equation below the curved rail. There are two small squares with readable labels. The three different characters are all holding a pointer up to the diagram while explaining an assumption. In the last panel an off-panel voice interrupts the speaker. This means the text from the reply to this comment goes further down over the diagram, so the top is hidden by text, compared to the first two. Above each panel is a label with the character's profession. As the text on the diagram is the same on all three panel, this text is shown here:] r 1 r 2 d=2π(r 1 +r 2 )/2 [Panel 1 - Cueball. Caption above:] Physicist Approximations Cueball: We'll assume the curve of this rail is a circular arc with radius R . [Panel 2 - Megan. Caption above:] Engineer Approximations Megan: Let's assume this curve deviates from a circle by no more than 1 part in 1,000. [Panel 3 - Ponytail. Caption above:] Cosmologist Approximations Ponytail: Assume pi is one. Off-panel voice: Pretty sure it's bigger than that. Ponytail: OK, we can make it ten. Whatever.

In physics and engineering, problem solving typically requires approximations , as physical properties of the universe can be difficult to model. For example, in introductory physics classes, theories are introduced in frictionless environments. The level of precision required in a calculation or approximation varies depending on the context. In the comic, Cueball , the physicist, generally dealing with theoretical constructs that can use relatively simple math, is introducing a problem with the assumption that the particular curve is a (perfectly) circular arc with a radius represented by R. Engineers have to deal with real things, which deviate from ideal shapes. Dimensions may be known to a certain tolerance. Megan , the engineer, also assumes that the curve is similar to a circle, with a deviation factor of 1/1000 or less. The joke arises when Ponytail , the cosmologist, uses the much less precise approximation of pi (π) equal to 1. Ponytail offering to use 10 instead of 1 alludes to Fermi approximations , as shown in Paint the Earth . Numbers are rounded to the nearest order of magnitude (1, 10, 100, etc.) using a base 10 logarithmic scale. On this scale, "halfway" between 1 and 10 would be √ 10 ≈ 3.16. Thus, numbers between about 0.316 and 3.16 are rounded to 1, between 3.16 and 31.6 are rounded to 10, and so on. Pi is an irrational number that can be approximated by 3.14, so it is very close to the 3.16 cutoff point. The closest order of magnitude to pi is 10 0 , or 1. But using this form of estimation it doesn't really matter to Ponytail whether pi is approximated to 1 or the other reasonable Fermi approximation, 10 1 , or 10. Pi is defined as the ratio of the circumference of a circle divided by its diameter. This number is an irrational starting with 3.14159, the value for this ratio in a flat geometry. But in a curved space , the ratio might be different. The title text makes use of the fact that almost every number can be this ratio depending on the curvature of the space the circle is in. The cosmologist doesn't know the curvature of "this particular universe" (a funny way to state the universe the cosmologist lives in, which is not perfectly flat ), and so pi may not be the best value to use for the ratio between a circle's circumference and diameter. This comic is a parody of the tendency of cosmology to use much rougher approximations in their work that would horrify engineers, other physicists, mathematicians, etc. In general, cosmologists deal with distances, time spans, masses, etc. that are so vast, with such large estimated errors, that approximations that would be ridiculous elsewhere still yield useful answers in cosmology. When dealing with the large numbers in cosmology, small multiplicative factors like 3 vanish into the rounding error: there probably isn't a useful difference between 10 100 and 10 100.497 , even though these numbers differ by a factor very close to pi -- an error that would greatly disturb most physicists and engineers. Approximating pi as 1 may also refer to the habit astronomers have of changing the units of measure such that important constants of the universe (such as the speed of light or the gravitational constant) are equal to 1, which highly simplifies the formulas without compromising the math. The number pi, however, is a dimensionless ratio, which doesn't depend on the unit of measure. [Three panels show the same setup with three different characters. In the upper-right corner of each panel is the lower-left portion of a wheel and hub diagram, showing two spokes going out to a curved rail. The two spokes connect to the rail with a small raised portion on the inside of the rail. There are both readable and unreadable text/symbols both outside and inside the curve and an equation below the curved rail. There are two small squares with readable labels. The three different characters are all holding a pointer up to the diagram while explaining an assumption. In the last panel an off-panel voice interrupts the speaker. This means the text from the reply to this comment goes further down over the diagram, so the top is hidden by text, compared to the first two. Above each panel is a label with the character's profession. As the text on the diagram is the same on all three panel, this text is shown here:] r 1 r 2 d=2π(r 1 +r 2 )/2 [Panel 1 - Cueball. Caption above:] Physicist Approximations Cueball: We'll assume the curve of this rail is a circular arc with radius R . [Panel 2 - Megan. Caption above:] Engineer Approximations Megan: Let's assume this curve deviates from a circle by no more than 1 part in 1,000. [Panel 3 - Ponytail. Caption above:] Cosmologist Approximations Ponytail: Assume pi is one. Off-panel voice: Pretty sure it's bigger than that. Ponytail: OK, we can make it ten. Whatever.

Mavis Beacon

Mavis Beacon

https://www.xkcd.com/2206

https://www.explainxkcd.com/wiki/index.php/2206:_Mavis_Beacon

[Cueball is sitting in an office chair at his desk in front of his computer reading a message that is shown coming from the screen with a zigzag line, going to the text above him. The two upper lines (of five) are separated from the lines below, but connected with a small zigzag line. The computer short cut is written in three boxes. The last line is the numbers from 1 to 9 and 0, in a highly stylized format but recognizable in this context. The digits are shown below in their standard appearance since the stylized versions cannot be reproduced in this transcript.] Congratulations. Use this power wisely. Key Code (secret!!): Alt + Tilde + Scroll Lock + Number 1234567890 [Caption below the panel:] After 30 years, I finally beat the end boss of Mavis Beacon and unlocked the ability to type capital numbers.

Cueball is being congratulated by the game he plays, Mavis Beacon , on his computer, because he has beaten the end boss and unlocked a new ability - the ability to type capital numbers... Mavis Beacon Teaches Typing is a computer game first released in 1987, with the goal of teaching touch-typing and improving typing speed on a computer keyboard. Unlike many video games, Mavis Beacon contains no combat and therefore does not feature any " end boss " (a very powerful enemy encountered as the final challenge of the game). In many video games, defeating major opponents "unlocks" special features, such as improved weapons. Also, playing Mavis Beacon , although it may improve typing skill, has no effect on how typing works on one's computer. In the caption, however, Randall asserts that after 30 years of playing Mavis Beacon , he encountered and defeated such a boss. Playing the same game for 30 years is rare [ citation needed ] . Regardless, Randall claims that defeating this "end boss" unlocked an ability to type esoteric "capital numbers," which Randall depicts as more extravagant versions of the familiar numerals. Although modern Latin letters have different letter case (i.e. capital or upper case and small or lower-case), Arabic numerals - the conventional numerals 0-9 used in the Western world - do not. Stating that the game is old enough that it could have been played for 30 years, could be another attempt at making people, who actually did play the game in the early days, feel old (or an appeal to nostalgia). But this doesn't seem to be the main point of the comic. Typing such numerals is said to require pressing the Alt, tilde (~), Scroll Lock, and numeral keys at the same time. Some keyboard layouts do not have a scroll lock key or a separate tilde key (such that pressing ~ actually requires pressing a shift/ modifier key along with the ~ key), and in any event pressing four or five keys at once would be quite difficult. Needless to say, pressing all those keys simultaneously does not, in fact, do anything like what the comics describes in any known computer system, though some smaller subset of those keys together (i.e. "Alt ~" or "Alt numeral-key") might activate other operating system or user-defined shortcuts. Keyboards vary in how many simultaneous key presses they can process ( rollover ). Computer keyboards for English may be limited to as few as 3 simultaneous keys, whereas other languages or higher quality keyboards may be able to handle an unlimited number of keys at once. (A musical keyboard might need to handle 10 or more simultaneous keys, likewise gaming or braille keyboards may need to handle many simultaneous keys.) In the title text, Randall notes that certain typefaces feature text figures , numerals that have ascenders and descenders, much as lower-case letters do, rather than all standing at the full X-height like capital letters. He then goes on to joke that, conversely, there are true "capital numerals," but they are a guarded secret of Mavis Beacon. Mavis Beacon was the character created as the typing instructor for the Mavis Beacon game, and is fictional, not a real person. Additionally, as a typing instructor, this person (even if she actually existed) would not be able to change typographical standards. Randall's description of Mavis Beacon as a "number maven " (that is, expert or connoisseur) contrasts with her supposed field of expertise in typing, which involves letters and punctuation more than numbers. The comic itself hotlinks to this article: Oldstyle Figures . It is about typographic oldstyle digits. The article assert that oldstyle digits are also called "lowercase" digits. [Cueball is sitting in an office chair at his desk in front of his computer reading a message that is shown coming from the screen with a zigzag line, going to the text above him. The two upper lines (of five) are separated from the lines below, but connected with a small zigzag line. The computer short cut is written in three boxes. The last line is the numbers from 1 to 9 and 0, in a highly stylized format but recognizable in this context. The digits are shown below in their standard appearance since the stylized versions cannot be reproduced in this transcript.] Congratulations. Use this power wisely. Key Code (secret!!): Alt + Tilde + Scroll Lock + Number 1234567890 [Caption below the panel:] After 30 years, I finally beat the end boss of Mavis Beacon and unlocked the ability to type capital numbers.

Math Work

Math Work

https://www.xkcd.com/2207

https://www.explainxkcd.com/wiki/index.php/2207:_Math_Work

[White Hat is watching Cueball from a couple of meters away. Cueball is contemplating the formulas and diagrams that fills the blackboard he stands in front of. Cueball holds a chalk in his hand. None of the content on the blackboard is readable, but there is a diagram in the shape of a circle and a another pie shaped diagram. Both are thinking with large thought bubbles above their heads, with small bubbles connecting them and the larger bubble.] White Hat (thinking): Amazing watching a physicist at work, exploring universes in a symphony of numbers. White Hat (thinking): If only I had studied math, I could appreciate the beauty on display here. Cueball (thinking): Oh no. This has two unknowns. That's gonna be really hard. Cueball (thinking): Ughhhhhhh. Cueball (thinking): Think. There's gotta be a way to avoid doing all that work...

White Hat is observing a physicist , Cueball , who is staring at some equations and diagrams on a chalkboard (unreadable in the comic). White Hat is neither a physicist nor a mathematician , but he seems to glorify those professions. He wishes he understood the mathematics in Cueball's work and "the beauty on display here." People who profess a love for mathematics often cite the beauty they see in pure math, how things work out so perfectly, as the reason they love math. The joke here is that Cueball as a physicist is doing something instead quite simple and relatable: Avoiding hard work. Solving many kinds of constraints for two unknowns isn't necessarily difficult, but can be depending on the details. Cueball clearly thinks a solution is possible but would rather find an easier route. The same could be said about the field of mathematics in general: A proof is beautiful to a mathematician when it provides aesthetic pleasure, usually associated with being easy to understand. A proof is elegant when it is both easy to understand and correct, and mathematical solutions are profound when useful. The title text continues Cueball's thought process, with the possibility of using an automatic equation solver to find the unknowns. Equation solvers are not often considered beautiful ways to address purely mathematical problems, even if they are often the most efficient and in that sense elegant solutions to applied problems in engineering. Using a formal solver with symbolic, numeric, or both methods requires making sure that the constraints (e.g. equations) are entered correctly, with parentheses balanced in their correct locations for the solution to succeed. This might be a further joke about Cueball's laziness, suggesting that he doesn't even have the energy to check whether his parentheses are placed correctly. At the same time it might show how far away he is from finding the real solution: Any missing, misplaced or spurious parenthesis will most likely immediately invalidate the whole equation system. [White Hat is watching Cueball from a couple of meters away. Cueball is contemplating the formulas and diagrams that fills the blackboard he stands in front of. Cueball holds a chalk in his hand. None of the content on the blackboard is readable, but there is a diagram in the shape of a circle and a another pie shaped diagram. Both are thinking with large thought bubbles above their heads, with small bubbles connecting them and the larger bubble.] White Hat (thinking): Amazing watching a physicist at work, exploring universes in a symphony of numbers. White Hat (thinking): If only I had studied math, I could appreciate the beauty on display here. Cueball (thinking): Oh no. This has two unknowns. That's gonna be really hard. Cueball (thinking): Ughhhhhhh. Cueball (thinking): Think. There's gotta be a way to avoid doing all that work...

Drone Fishing

Drone Fishing

https://www.xkcd.com/2208

https://www.explainxkcd.com/wiki/index.php/2208:_Drone_Fishing

[Cueball is seated in a leaning chair, with a tackle box behind it and two drones lying on the ground in front of him. He is holding a fishing rod from which he is flying a kite on a long string. The kite is high up in the air and far away from Cueball. On the long string there are three smaller lines dangling below the string closer to the kite that to Cueball. Each line has six hooks evenly spread out, from a bit beneath the string to the end of the lines. Three quadcopter type drones are in the air nearby, with Science Girl and a Cueball-like kid standing right beneath the kite holding remote-controls for their respective drones. They are facing each other, the Cueball-like kid looking up, whereas Science Girl seems to be looking at the drone right in front of her, between and just above the kids. It has just begun to rise up as shown by lines beneath it. The two other drones are on either side of the kite line, both flying towards the hooks. Whoever controls the third drone must be off panel, and it is not clear which of those two the kid is controlling. The only text is a caption below the panel:] My Hobby: Drone Fishing

Another comic in the My Hobby series. This comic is a parody of the traditional activity of fishing for fish. Typically, a person who is fishing will sit as Cueball does in this comic, by some body of water and wait for a fish to bite their cast line. However, some fisherman will use a kite to allow them to cast their line further in the water, and this is called " Kite fishing ". But it is also possible to use drones for this, as in "drone fishing." Randall , however, is interpreting "Drone fishing" not as fishing with drones but as fishing for drones ("drone fishing" as in "lobster fishing"). In fact, what Cueball (or Randall) is doing, is kite fishing for drones, by flying a kite with fishhooks attached over some drone enthusiasts in hopes of snagging their drones. This is quite likely illegal, especially if Cueball were to "reel" the caught drone in. [ citation needed ] It seems like he has already caught two that lay in front of his feet. All the drones are of the quadcopter type, as they are called in 1630: Quadcopter . The title text parodies a common line about fishing, about the "joy of going out in nature", catching fish, and the struggle of reeling in large fish. However, instead of being about fishing, Randall has replaced the line to be about catching drones, and fighting off their owners. Considering that the two drone owners beneath his kite are children, Science Girl and a Cueball like kid, clearly smaller than Cueball/Randall in the chair, this should not be so tough in the pictured case. Real life methods for capturing drones involve French Army falconry training of golden eagles (a technique abandoned by Dutch police) and firing nets from other drones, which has been proposed for orbital debris removal , or the use of nets hanging on counter-drones. A similar setup for catching bats with hooks on a kite string have been used, although it's illegal. It seems unlikely that Randall has had this in mind when he made this comic though. [Cueball is seated in a leaning chair, with a tackle box behind it and two drones lying on the ground in front of him. He is holding a fishing rod from which he is flying a kite on a long string. The kite is high up in the air and far away from Cueball. On the long string there are three smaller lines dangling below the string closer to the kite that to Cueball. Each line has six hooks evenly spread out, from a bit beneath the string to the end of the lines. Three quadcopter type drones are in the air nearby, with Science Girl and a Cueball-like kid standing right beneath the kite holding remote-controls for their respective drones. They are facing each other, the Cueball-like kid looking up, whereas Science Girl seems to be looking at the drone right in front of her, between and just above the kids. It has just begun to rise up as shown by lines beneath it. The two other drones are on either side of the kite line, both flying towards the hooks. Whoever controls the third drone must be off panel, and it is not clear which of those two the kid is controlling. The only text is a caption below the panel:] My Hobby: Drone Fishing

Fresh Pears

Fresh Pears

https://www.xkcd.com/2209

https://www.explainxkcd.com/wiki/index.php/2209:_Fresh_Pears

[Megan is rattling the coin-slot of a machine while Beret Guy stands behind her arm held out towards her. The Machine has a tall wall in front of Megan, with only the coin-slot and a dispenser visible to her. Behind it is a hopper connected to the dispenser. On top of that is a two time folded arm with a gripper at the end. Below this is a box with a label. Beneath the box is a small cannon like protrusion, which shoots something into the dirt to the left of the machine. There are lines indicating both the explosion, the trajectory of the projectile and the impact with sounds noted at either end. Behind White Hat is a sign.] Box Label: Seeds Cannon: Ptoo Impact: Thwup Coin-slot: Rattle rattle Megan: I put in my quarters. Is the machine broken? Beret Guy: It just takes a while to work. Sign: Fresh pears 50¢

Here, Beret Guy has set up a machine advertising "fresh pears". Megan , presumably his first customer, has inserted her quarters into the machine for the specified price, and expresses concern that the pears aren't being dispensed; Beret Guy simply assures her that "it takes a while to work". Behind the front of the machine, thus hidden from Megan, we see that what the machine does is dispense a seed into the dirt via a small cannon. Above it is a robotic arm and a hopper for collecting and dispensing the ripened pears. So it seems that Megan will have to rattle the coin-slot "a while" before she gets her fresh pear. The term "a while" is ambiguous, but in the context of waiting for a vending machine to dispense food, it's usually assumed to be a matter of seconds [ citation needed ] . Beret Guy, in his typical surrealist approach to business , seems to consider it reasonable to wait at the machine for years until a tree has sprouted from the dispensed seed, grown to maturity and begun bearing fruit, that could be picked by the robotic arm and dispensed to the buyer. This could easily take between 5-8 years for a pear tree, when starting only with a seed! While such a pear would indeed be "fresh", it's implausible that anyone would accept that kind of lag time in buying a pear at a vending machine, even if it is cheap, particularly considering that any number of factors could interfere with the production of pears in the meantime. [ citation needed ] Alternatively, Beret Guy may be planning on using time-altering abilities to rapidly grow the tree. This comic strip may be based on a fable about an old man who plants trees, knowing that he will not be alive when they bear fruit, to "pay it forward" to his children as his ancestors planted the trees that had sprouted and fed him. Beret Guy may be practicing good moral behavior and ecological stewardship, but as a customer-facing business model it leaves a little to be desired. It seems Megan is one of the first to use the machine, as no pear sprouts are shown behind the machine. The title text refers to the increased difficulty in cultivating desirable apples , as compared to other fruits. Apples cannot be reliably produced from seeds, seedlings often don't survive, and even when they do, they don't generally reflect the characteristics of the parent plant. As a result, apple orchards are created by grafting tissue from desirable trees onto suitable rootstock. This process is more complex and labor-intensive than simply planting seeds. The joke, then, is that the next planned version of the machine would not only require the user to wait years, but would also involve as-yet unavailable technology to automatically perform the grafting process as to create an apple tree that produces desirable fruit. [Megan is rattling the coin-slot of a machine while Beret Guy stands behind her arm held out towards her. The Machine has a tall wall in front of Megan, with only the coin-slot and a dispenser visible to her. Behind it is a hopper connected to the dispenser. On top of that is a two time folded arm with a gripper at the end. Below this is a box with a label. Beneath the box is a small cannon like protrusion, which shoots something into the dirt to the left of the machine. There are lines indicating both the explosion, the trajectory of the projectile and the impact with sounds noted at either end. Behind White Hat is a sign.] Box Label: Seeds Cannon: Ptoo Impact: Thwup Coin-slot: Rattle rattle Megan: I put in my quarters. Is the machine broken? Beret Guy: It just takes a while to work. Sign: Fresh pears 50¢

College Athletes

College Athletes

https://www.xkcd.com/2210

https://www.explainxkcd.com/wiki/index.php/2210:_College_Athletes

[Cueball, Ponytail and White Hat are having a conversation. Ponytail is checking her phone.] Ponytail: Oh, huh. California passed a law giving college athletes full rights to their names and images. White Hat: Good, I think? [Cueball holds his hand up in a fist, while Ponytail, holding her phone down, and White Hat looks at him.] Cueball: That's nothing. Our state gave college players rights to use the names and images of any California athletes. Ponytail: It did not. [In a frame-less panel Cueball holds his hands out, Ponytail's phone is gone and White Hat puts a hand to his chin.] Cueball: Sure it did! Cueball: That's how our school fielded a basketball team made up entirely of Steph Currys. White Hat: Or is the plural "Stephs Curry"? [Cueball holds both hands up in front of him. Ponytail has her arms down but she is balling her hands into fists.] Cueball: They didn't all copy the original Steph, though. One player got the rights to his name, then the next player got it from them, and so on. Cueball: This process is known as "currying". Ponytail: ...I hate you so much.

Ponytail is reading from her phone about the California Fair Pay to Play act , which was signed into law on September 30, 2019, two days before this comic was released. It gives college athletes the rights to their name and image (face, body, etc.) for financial gain, in contrast to NCAA rules which require that athletes be unpaid. This bill threatens the NCAA's notion of amateurism , which has become a topic of public debate. White Hat thinks this law is a good thing, but then Cueball claims that his state has passed an even better law giving college players rights to the names and images of any California athletes. Note that Cueball's state is thus not California, so it is very odd they can use names from another state, in addition to the oddity of gaining rights to another person's name and image. Ponytail doesn't believe Cueball, but he carries on claiming that all members of his school's basketball team thus have changed their name to Steph Curry after the NBA player who plays for the Golden State Warriors , a team in California. Cueball explains in particular that only one player copied the name from the NBA player, then another member of the team copied the name from that player, and so on. As it turns out, in his final remark, all this has only been the setup for his grand joke: Cueball tells Ponytail and White Hat that this process of recursive name usage is known as "currying". In addition to a pun with basketball rules against carrying , avoidance of which often involves passing from one player to another, this is also a play on both the basketball player's name "Curry" used here, as well as the mathematical procedure called currying , named after mathematician Haskell Curry . This sort of humor is very typical of Cueball, leading Ponytail to state that she "hates him". Currying is when a multi-variable function is broken down into a sequence of single-variable functions, each of which outputs a new function until the final variable is consumed. For example, the function f(x,y,z) can be curried into f(x)(y)(z), where f is a function that consumes x and produces a function f(x), which in turn consumes y, yielding the function f(x)(y), and that in turn is a function f(x)(y) which consumes the parameter z to finally produce f(x)(y)(z), which is equal to the original f(x,y,z). This is not commonly used in most areas of math except for foundational logic but it is widely used in functional programming. When Cueball says a team made up entirely of Steph Currys , White Hat questions what the plural form should be, and should it instead have been " Stephs Curry "? This is referring to the pluralization of phrases where a noun is followed by a modifier of some sort, such as attorneys general , parts unknown , heirs apparent , mothers-in-law , and so on. In these cases, plurals are formed by pluralizing the noun parts of the phrases; however, some of these are rare or foreign enough that speakers of English don't always identify them correctly and pluralize the last word instead, e.g. attorney generals . The title text is a computer science joke, saying that the Steph Currys basketball team's signature play is the "three-point combinator", a joke on the three-point play in basketball, and a type of fixed-point combinator called the Y Combinator , introduced by Haskell Curry. The description of "three-point combinator" is dense with word play that relates to the Y Combinator, which is used to implement recursive methods in functional programming languages, has notable properties relating to halting (see: the halting problem ), and has a common form in which a second argument is used as a counter that is increased by one with each recursive call until termination. "Signature play" may also be a play on words, as currying transforms a method signature . In this case, when this move is performed, it will just keep accumulating points, as it is guaranteed it cannot halt and will not stop until the time runs out and the buzzer that ends the game is activated. Such a move can of course not be a part of a real basketball game, and more of a nod to the Golden State Warriors' reputation as a high-scoring, nearly-unstoppable offense widely known for three-point shooting. [Cueball, Ponytail and White Hat are having a conversation. Ponytail is checking her phone.] Ponytail: Oh, huh. California passed a law giving college athletes full rights to their names and images. White Hat: Good, I think? [Cueball holds his hand up in a fist, while Ponytail, holding her phone down, and White Hat looks at him.] Cueball: That's nothing. Our state gave college players rights to use the names and images of any California athletes. Ponytail: It did not. [In a frame-less panel Cueball holds his hands out, Ponytail's phone is gone and White Hat puts a hand to his chin.] Cueball: Sure it did! Cueball: That's how our school fielded a basketball team made up entirely of Steph Currys. White Hat: Or is the plural "Stephs Curry"? [Cueball holds both hands up in front of him. Ponytail has her arms down but she is balling her hands into fists.] Cueball: They didn't all copy the original Steph, though. One player got the rights to his name, then the next player got it from them, and so on. Cueball: This process is known as "currying". Ponytail: ...I hate you so much.

Hours Before Departure

Hours Before Departure

https://www.xkcd.com/2211

https://www.explainxkcd.com/wiki/index.php/2211:_Hours_Before_Departure

[Three Cueball-like astronauts with space helmets are walking toward the back side of a van with the rear door open. There is a logo with text on the side of the van. The front of the van is off-panel. Above them is a time and below that a description.] 6:27 AM Crew departs for launch site Logo: NASA [A rocket launch pad with the rocket in the process of taking off, having lifted its exhaust to about a third of the height of the support tower. Smoke is billowing everywhere around the launch pad from the exhaust of the rocket. Above the rocket is a time and below that a description.] 9:32 AM Liftoff [Caption beneath the panel:] I know I tend to arrive too early at the airport, but it still weirds me out that Neil Armstrong left for the launch site just three hours before departure.

This comic, as from the caption, depicts Neil Armstrong , Buzz Aldrin and Michael Collins , leaving in their spacesuits ( Cueballs with helmets) to go in a NASA van at 6:27, to be shot into space on a Saturn V rocket to fly to the Moon on the Apollo 11 mission (1969). The launch happened at 9:32 on July 16, just a bit more than 3 hours after they left for the launch pad. The joke is that Randall is amazed they manage this in just three hours, given that he himself tends to arrive too early at the airport, and since they typically ask you to be there two hours before an international flight, he probably leaves from home more than three hours before his departure. Catching transportation from one place to another requires being there and being prepared before the vehicle leaves. Some transportation, such as public city buses and personal cars require very little in preparation, and one can leave as soon as the vehicle is there and ready. Others have more complications involved, whether it be in payment, security, slower boarding, etc. To board a Greyhound bus , for example, one would normally need to be there 10-15 minutes before it is scheduled to leave, because it takes time to get everyone on board at the same time, stow luggage, and present a boarding pass or proof of payment. Boarding an airline flight is even more complicated (security checkpoints, long terminal walks, more bags, etc.) making the delays longer, and so conventional advice is to arrive two hours early for a domestic (same country) flight and three hours for an international flight. Seasoned travelers can often cut these times shorter, but to be ready for unexpectedly long delays the less experienced traveler would want to leave themselves plenty of time. Based on that, the exceedingly complicated business of traveling to space would instinctively require you to be ready much longer than the three hours they recommend for international flights, however, three hours is about how long it took for the astronauts traveling to the moon for the first time to prepare to take off. The comic doesn't represent the preparations for the Apollo launch entirely accurately, however. Prior to their "departure" to the launch pad, the Apollo 11 astronauts had woken up at 4:15 AM, and after a 25-minute breakfast had spent at least an hour and a half getting into their spacesuits. For regular travel on an airplane or other modes usually no more than a few minutes preparation is needed, for instance, to load luggage in a car or wait for a cab. What's more, because all activity took place at Cape Canaveral, the "trip" to the launch site took only 8 minutes, and the crew began to take their seats in the Saturn V rocket only a few minutes later, at 6:45 AM. Thus they were locked in the capsule for about two-and-a-half hours prior to launch. For normal travel, people will only be in their seats for a few minutes before departure, or for large aircraft maybe a half an hour while it loads. Thus the total time from beginning to get ready to liftoff was about five hours, which in fact is longer than less complicated activities like air travel. [ citation needed ] This is though still significantly shorter than you would think preparation for a journey over a distance of almost 10 times around the Earth, each way, and in significantly more dangerous conditions, would take. The alt-text is a reference to Global Entry , a United States Customs and Border Protection program that allows US citizens to quickly proceed through customs checks when arriving from overseas, instead of waiting in a long line to present a passport. The Global Entry program also allows for access to the TSA PreCheck program, which allows for expedited security screenings, but here the word "Global" is literally true of an astronaut returning to earth, not a marketing phrase. In the case of the Apollo astronauts, their return to the earth involved re-entry into the atmosphere (technically called Atmospheric entry ), and of course global is another word for things relating to the earth. So the Apollo astronauts could be said to have undergone "global entry" on their return. The joke is that since they have "Global Entry" privileges, the astronauts did not need to arrive as early to the Saturn V launch site. [Three Cueball-like astronauts with space helmets are walking toward the back side of a van with the rear door open. There is a logo with text on the side of the van. The front of the van is off-panel. Above them is a time and below that a description.] 6:27 AM Crew departs for launch site Logo: NASA [A rocket launch pad with the rocket in the process of taking off, having lifted its exhaust to about a third of the height of the support tower. Smoke is billowing everywhere around the launch pad from the exhaust of the rocket. Above the rocket is a time and below that a description.] 9:32 AM Liftoff [Caption beneath the panel:] I know I tend to arrive too early at the airport, but it still weirds me out that Neil Armstrong left for the launch site just three hours before departure.

Cell Phone Functions

Cell Phone Functions

https://www.xkcd.com/2212

https://www.explainxkcd.com/wiki/index.php/2212:_Cell_Phone_Functions

[A graph with time on the x-axis and items Randall replaced with his smartphone on the y-axis. For each item, the time he (allegedly) replaced it is marked; the marks form a jagged line down the graph, roughly sorted by when he switched. The regions are marked] I have a specific device for this [and] I just use my phone [items where the switch-over date is in the past:] Telephone Web Browser Camera Newspaper Flashlight TV Remote Credit Card Car Key [items where the switch-over date is in the future:] Dog Leash Steering Wheel Band-Aid Cheese Grater Stapler Nail Clipper Electric Drill Toothbrush [The x-axis (time) shows at point labelled as 'now' roughly halfway along the graph, a grey dashed line runs vertically down the whole graph. Car Keys have just been replaced by a phone, all other items listed below that have yet to be replaced. For the most part the gradient of the trend is constant at around -1. The last item (Toothbrush) is replaced before the penultimate item (Electric Drill)]

This comic pokes fun at the ever-increasing function of smartphones and their users' reliance on them through an unusual horizontal bar graph showing what services a smartphone provides (or will provide) that were performed by other devices in the past and when the switch took or will take place. It starts sensibly: Calling, browsing the Internet, and taking pictures are the most prominent examples of tasks that many if not most people use a smartphone instead of a specific device nowadays. The next item, newspaper, extends the Internet's capabilities (either from within the mobile browser or as a dedicated app), and the next, flashlight, repurposes the phone camera's flash unit; both are now commonplace features of smartphones. Some people even use their smartphone as the remote for their TV (either via RF wireless [e.g., WiFi] for smart TVs, or via their phone's infrared port) or to pay in stores using payment providers like Google Play Wallet, Samsung Pay, or Apple Pay, which utilize the near-field communication functionality of modern smartphones. A few cars now support using a phone app instead of a key fob, rendering yet another item obsolete; apparently, Randall just started using this feature in his car, as this item is in the very recent past in the comic's diagram. Then the comic drifts off into smartphone capabilities either not yet possible or likely never to be possible. These capabilities are right of the "now" mark, meaning Randall has not switched to using a smartphone for them: One cannot currently use a phone app as a dog leash, nor as an adhesive bandage. While using a phone as a steering wheel is possible (likely interfacing with the car's self-driving features), it would be a reversal of current initiatives to prevent drivers from using cell phones while driving. Things get increasingly odd, to the point where a smartphone is allegedly used as a toothbrush. Several items would require physical changes to the phone and not just repurposing existing capabilities, such as operating as a cheese grater, stapler or nail clipper, which would make the phone look and feel more like a Swiss Army Knife instead. [ citation needed ] The title text continues this path by continuing the list of objects his phone will supposedly replace. These include a "tazer" (a misspelling of taser ), a fire extinguisher, a bird feeder, and toilet paper, continuing the path of absurdity the comic implies with its supposed future uses for a phone. [A graph with time on the x-axis and items Randall replaced with his smartphone on the y-axis. For each item, the time he (allegedly) replaced it is marked; the marks form a jagged line down the graph, roughly sorted by when he switched. The regions are marked] I have a specific device for this [and] I just use my phone [items where the switch-over date is in the past:] Telephone Web Browser Camera Newspaper Flashlight TV Remote Credit Card Car Key [items where the switch-over date is in the future:] Dog Leash Steering Wheel Band-Aid Cheese Grater Stapler Nail Clipper Electric Drill Toothbrush [The x-axis (time) shows at point labelled as 'now' roughly halfway along the graph, a grey dashed line runs vertically down the whole graph. Car Keys have just been replaced by a phone, all other items listed below that have yet to be replaced. For the most part the gradient of the trend is constant at around -1. The last item (Toothbrush) is replaced before the penultimate item (Electric Drill)]

How Old

How Old

https://www.xkcd.com/2213

https://www.explainxkcd.com/wiki/index.php/2213:_How_Old

[White Hat holds his hand out towards a man with a sailor-cap standing to the left in the image while addressing Cueball standing to the right.] White Hat: I'd like you to meet my dad. Cueball: Aww, how old is he? [Caption below the panel:] Interaction tip: This is a common question to ask parents about their kids, but for some reason in the other direction it's weird.

Another comic of the tips type , this time regarding one of Randall's problems, social interactions , this time including an interaction tip . White Hat introduces his dad to Cueball , who then expresses a reaction more typical of people being introduced to children, by saying Aww, how old is he? When introduced to a young kid, saying "aww" is accepted as normal, because the speaker thinks the little child is cute. The speaker also wishes both to know the age of the kid and to give the kid a chance to answer this question. But when meeting someone older this would feel very awkward, and Randall, indicating he is very awkward around other (normal) people, continues to make this type of comic about problems with social interactions. Hence for others with his problems, this comic gives an interaction tip in the caption, letting you know that How Old? (the title of the comic) is a common question to ask only when introduced to kids, not to older people such as elderly parents. Another excellent example of how Randall also doesn't know how to speak with people with children can be seen in 1650: Baby . White Hat's father is wearing a sailor cap like the old version of Cueball in 572: Together and as other old people both in 586: Mission to Culture and 1910: Sky Spotters . In the title text, Cueball continues down the road to awkwardness by saying other things normally reserved for meeting kids. Here he notes that he has actually met White Hat's father before, but so long ago that he since has changed height. For kids this usually means they have grown taller, but old people, who have long stopped growing, will over time become more compressed and lose height. So apart from saying that he remembers when White Hat's father was thiiiis tall , he also holds his hand an inch (2–3 cm) above the father's head to indicate this age-related height loss. For a growing child, he would instead have held his hand some distance below the top of their head. This interaction would be really embarrassing for White Hat and his father, as being made aware of aging is usually not something people like to be confronted with by someone they hardly know, and being treated like a child is embarrassing. [ citation needed ] [White Hat holds his hand out towards a man with a sailor-cap standing to the left in the image while addressing Cueball standing to the right.] White Hat: I'd like you to meet my dad. Cueball: Aww, how old is he? [Caption below the panel:] Interaction tip: This is a common question to ask parents about their kids, but for some reason in the other direction it's weird.

Chemistry Nobel

Chemistry Nobel

https://www.xkcd.com/2214

https://www.explainxkcd.com/wiki/index.php/2214:_Chemistry_Nobel

[Ponytail stands in front of an image with a white section in the shape of the 7 rows of the periodic table of the elements, but without the two rows usually shown beneath with the lanthanides and actinides. The “empty” sections at the top of the table are filled with three rows of dotted boxes, 16 boxes in the top row and two rows with 10 boxes each, shifted one right from the top row. Ponytail points to this area with a pointer while she looks and gestures towards an off-panel audience.] Ponytail: I don't know why no one else thought to look here. [Caption below the panel]: The 2019 Nobel Prize in Chemistry went to the team that discovered the elements in the big gap at the top of the periodic table.

The periodic table of the elements is a display which arranges all of the 118 ( currently ) known chemical elements by atomic number and sorts them into columns such that each column contains a group of elements displaying similar chemical properties. The original version of this table was developed by Russian chemist Dmitri Mendeleev in 1869, when he realized that certain properties repeated periodically as elements became more massive. Notably, this system left obvious gaps at the top of the table. Mendeleev correctly predicted that some of these gaps represented elements that had not been discovered yet, and even predicted their properties based on the patterns in the table. The later discovery of those elements (including germanium and gallium) helped validate Mendeleev's work. Other gaps, however, were not due to undiscovered elements, but merely resulted from the properties of electron orbitals in atoms: upper rows of the table represent orbitals with fewer possible electrons and hence fewer elements, so displaying the lower rows properly below the upper ones leaves gaps in the upper rows. In other words, elements could not actually exist in these spaces, spaces which only existed in the realm of human bookkeeping. The joke of this comic is that it treats these gaps as if they represented elements that hadn't been discovered yet. Ponytail and her team have won the Nobel Prize in Chemistry merely by looking for and finding these elements. She expresses surprise that no one else had thought of such a simple direction for research. By definition, each element has one more proton than the previous element - so element 1, hydrogen, has one proton in the nucleus, while element 2, helium, has two protons in the nucleus. The periodic table represents elements in their atomic form, where there are an equal number of protons and electrons (as opposed to an ionized form where they are unequal), so the structure of the periodic table is based on the structure of the "orbitals" that electrons fall into. The first row of the periodic table has elements whose electrons only have an "s orbital" (at least when the electrons are in their ground state, which is the non-excited state that they are normally in). There is only one s orbital in each row, and an s orbital only has room for two electrons, so there are only two elements in the first row. The Pauli exclusion principle, mentioned in xkcd 658, means that only two electrons can be in each orbital. The second row of the periodic table contains elements with only s and p orbitals. As mentioned, there is only one s orbital at each "level" of orbital, with each level basically corresponding to a row, but there are three p orbitals at each level, so there can be four total pairs of elements in the second row, for eight total elements in the second row. (You can see that level one has a total of 1^2 orbitals, or 1 orbital, while level two has 2^2 orbitals, or 4 orbitals.) After p orbitals, the next type of orbital that can exist at higher levels is a d orbital. For levels that have a d orbital, there are five d orbitals at each level. Beginning with the fourth row, you can see elements whose highest-energy electrons are in an s orbital (the first two columns), a p orbital (the last six columns), or a d orbital (the middle ten columns). The d orbitals for row four are actually classified as the 3d orbitals (meaning they belong to level three), but because they have higher energy than the 4s orbital, they are put on the fourth row. The "aufbau principle" says that electrons fill the lowest energy orbitals first, which means that level one orbitals get filled before level two orbitals, which get filled before level three orbitals, and that within each level the s orbitals get filled before the p orbitals. So, there are two columns on the periodic table for each orbital - although helium is put in the far right instead of in the second row with the other elements whose highest electron is the second one in an s orbital, because putting it on the far right shows that helium is stable like the other "noble gases" in the far right row. The final type of orbital that exists as the ground state for a known element is the f orbital, but almost all periodic tables show the elements with their highest electrons in an f orbital - the lanthanides and actinides that are mentioned in the title text and described below - in rows below the table, to prevent the table from becoming too wide to print easily. The comic is based on the joke that somehow every physicist and chemist for generations somehow missed that there are actually p and d orbitals at levels one and two, and so it shows the empty space in the columns corresponding to the p and d orbitals in level one and the d orbitals in level two being filled with undiscovered elements. In reality, there are no p or d orbitals at the first level and no d orbital at the second level, due to quantum mechanics (involving the possible values of something called the quantum n, l, m, and s numbers, where n is the level and l determines whether is an s, p, d, or f orbital). The comic also shows a line of d orbital elements in the third row, even though the 3d orbitals are already represented in the fourth row (where they are placed due to having higher energy than the level 4 s orbitals). The Pauli exclusion principle has been known since 1925, and Mendeleev (mentioned in xckd 965) developed the structure of the periodic table in 1863 to describe the structure of the known elements, so the idea that such a basic thing as more elements in the early rows that had never been discovered by any chemist ever would be quite surprising. In reality, the elements toward the top of the periodic table that are known to be naturally occurring were generally discovered earlier, while all the most recently discovered elements are higher-numbered elements lower down on the table that are very short-lived before they undergo radioactive decay to another element and have never been seen to be naturally occurring. The lanthanides and actinides mentioned in the title text are series of elements with higher atomic numbers that have electrons in orbitals that no previous elements have, and thus occupy columns of the periodic table that don't exist for lower-numbered elements. Sometimes these elements are displayed in the table , a format that corresponds with their actual orbital structure; this format is too wide for most display media, thus the lanthanides and actinides are separated out and displayed "floating" beneath the rest of the periodic table. The title text jokes that these floating series of elements are actually surrounded by actual elements. In real life, the 2019 Nobel Prize in Chemistry was awarded to John B. Goodenough, M. Stanley Whittingham, and Akira Yoshino for their work in the development of lithium-ion batteries; it was announced on October 9, just a few days before this comic was published, so the chemistry Nobel Prize was in the news. [Ponytail stands in front of an image with a white section in the shape of the 7 rows of the periodic table of the elements, but without the two rows usually shown beneath with the lanthanides and actinides. The “empty” sections at the top of the table are filled with three rows of dotted boxes, 16 boxes in the top row and two rows with 10 boxes each, shifted one right from the top row. Ponytail points to this area with a pointer while she looks and gestures towards an off-panel audience.] Ponytail: I don't know why no one else thought to look here. [Caption below the panel]: The 2019 Nobel Prize in Chemistry went to the team that discovered the elements in the big gap at the top of the periodic table.

FacultyStudent Ratio

Faculty:Student Ratio

https://www.xkcd.com/2215

https://www.explainxkcd.com/wiki/index.php/2215:_Faculty:Student_Ratio

[Cueball is sitting hunched over a desk writing while ten people crowd around him, five on each side, all leaning towards him. On the left side, they are Hairbun, a Cueball-like man, Hairy, Megan - who speaks, and another Cueball-like man. On the right are Ponytail, a third Cueball-like man, another Megan-like woman, Blondie, and finally a fourth Cueball-like man.] Megan: How's the work going? Cueball: Can you all at least stand back a little? [Caption below the panel]: My school tried to game the ratings by having a 30:1 faculty:student ratio

Universities are often rated in various ways to help students/parents pick which one to attend. This comic satirizes the very real culture of schools modifying their actions to artificially inflate their ratings. One metric used in ratings is the ratio between the number of faculty members to the number of students . Typically this is expressed as the student-teacher ratio, which normally determines how much time teachers get to spend with individual students. The lower the ratio, i.e., the fewer students per teacher, the smaller classes teachers have to teach, and thus the more attention the teachers can give to each student. However, having many more teachers than student(s), as in this comic, is not very beneficial to the student(s). (For context for international readers, high student-teacher ratios are common and expected in the United States, Randall's home country, whereas some nations especially in Asia sometimes report much lower ratios, often close to 1:1 in some areas.) Another metric commonly used to measure a college's exclusivity and therefore prestige is the college's rejection rate; more prestigious schools get more applicants, and since they can accept only a limited number, they must reject many. Less prestigious schools often accept a higher fraction of their applicants, but some schools will reject students whose test scores, résumé, etc. are much higher than average for the school since it's likely that college is a "safety school" and the student won't actually go there. This rejection can decrease the school's acceptance rate and make it appear more prestigious. However, if the above-average student does want to attend that school, they are unable to, even though it would be good for both the college and the student. For-profit universities and diploma mills may use techniques like this to artificially boost their ratings or use fabricated metrics and accreditation mills to give an inflated appearance of value. Predatory publishers and conferences are other techniques used to inflate the perceived value of a school or to pad curriculum vitae. In the title text, other metrics are skewed in the school's favor: [Cueball is sitting hunched over a desk writing while ten people crowd around him, five on each side, all leaning towards him. On the left side, they are Hairbun, a Cueball-like man, Hairy, Megan - who speaks, and another Cueball-like man. On the right are Ponytail, a third Cueball-like man, another Megan-like woman, Blondie, and finally a fourth Cueball-like man.] Megan: How's the work going? Cueball: Can you all at least stand back a little? [Caption below the panel]: My school tried to game the ratings by having a 30:1 faculty:student ratio

Percent Milkfat

Percent Milkfat

https://www.xkcd.com/2216

https://www.explainxkcd.com/wiki/index.php/2216:_Percent_Milkfat

[Ponytail, raising her palm, and Cueball are talking.] Ponytail: "2% milk" is 2% milkfat. But "whole milk" isn't 100% milkfat–it's 3.5%. Cueball: Weird. What's the rest of it? Ponytail: About 27% is dark matter. The remainder is dark energy.

While cow milk contains a variable amount of fat (about 4.2%), whole milk from the store generally contains about 3.5% milkfat by weight according to the comic and some sources; other sources list similar but not identical numbers such as 3.25%. Dairies commonly sell whole milk as well as products with less fat produced by removing milkfat. In the United States , there are three common products with less fat: 2% or "reduced fat" milk, 1% or "lowfat" milk, and "fat-free" or "skim" milk with 0 to 0.5% milkfat. Since whole milk is labeled as "whole" milk and not as "3.5% milk," one might naively assume that whole milk is 100% milkfat, although this is not the case; 100% would be a product which is entirely milkfat (also known as butterfat), such as clarified butter or ghee. In milk, the remainder is mainly water along with proteins, lactose (a sugar), and other substances. The comic analogizes this difference to the fact that physicists believe that "ordinary" matter constitutes only 5% of the actual mass-energy of the universe. Scientists predict the existence of another kind of matter known as " dark matter ," invisible to our current instruments but exerting gravitational force on ordinary matter, which would constitute 85% of total matter and 27% of the universe's mass-energy, with the remainder an even less detectable and more mysterious " dark energy " accounting for the increasing speed of expansion of the universe . Ponytail uses these quantities to "explain" the "missing" percentage in whole milk between the actual 3.5% and a potential 100% "whole." She actually uses the 27% as mentioned above for dark matter. She thus indicates that dark energy takes up the remaining 69.5% of the whole milk. Ponytail is assuming that dark matter and dark energy are distributed uniformly throughout all pockets of the universe, no matter how small. This assumption is common in statistics and may have seemed appropriate since no one knows the proportion of dark matter or dark energy of an object as small as a milk carton (though a more sensible argument is that all matter is accounted for when considering the milk and the carton; no additional "dark" matter is necessary to explain the weight of the milk carton). Cosmologists are working to better understand dark energy or another reason for the universe's accelerating expansion. The title text supposes that both cosmologists and the Food and Drug Administration (FDA), which regulates milk and other food items in the United States, are trying to understand the dark energy of the whole milk. In real life, the work of cosmologists and FDA scientists does not overlap at all. [ citation needed ] Dark energy was recently mentioned in 2113: Physics Suppression , but before that milkfat and dark energy were actually mentioned in the same sentence in 2063: Carnot Cycle from almost a year before this comic, so the idea behind this comic is not new for Randall. Dark matter was mentioned back in 1758: Astrophysics . [Ponytail, raising her palm, and Cueball are talking.] Ponytail: "2% milk" is 2% milkfat. But "whole milk" isn't 100% milkfat–it's 3.5%. Cueball: Weird. What's the rest of it? Ponytail: About 27% is dark matter. The remainder is dark energy.

53 Cards

53 Cards

https://www.xkcd.com/2217

https://www.explainxkcd.com/wiki/index.php/2217:_53_Cards

[Cueball and Ponytail are standing next to a flowchart, with Cueball gesturing to it.]: Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them. Ponytail: No, you haven't. Cueball: How do you know?! I challenge you to find an error in my math! [The flow chart consist of 15 boxes of different sizes, connected with arrows. In four of them (top, bottom and two in the middle) a deck of card is shown. Next to the top and bottom a number is written, near the other two, which are the only round boxes, numbers are shown in one of the nearby boxes instead. Beneath the top box there are two boxes with readable text. The other 7 boxes, without numbers or card decks have unreadable text. From top to bottom are the readable content:] 52 Shuffle Cut 21 38 53 [Caption below the panel]: Every conversation between a physicist and a perpetual motion enthusiast.

In this comic, Cueball claims that he has found a way to manipulate a 52-card deck into a 53-card deck by shuffling and rearranging the cards, presenting a complex-looking diagram to support his claim. Ponytail naturally disputes the claim immediately, which Cueball counters by challenging Ponytail to prove that his math is wrong. The comic is a satire of the way that conversations tend to go between physicists and perpetual motion enthusiasts (or cranks in general). Perpetual motion is the idea that it could be possible for a mechanical system to work indefinitely without any external input of energy. The laws of thermodynamics absolutely prohibit this, so the only way that this could be possible is if the laws of thermodynamics are wrong. Unfortunately, the laws of thermodynamics are some of the most foundational and well-tested laws in science, so perpetual motion is considered to be a pseudoscience , pursued only by ignorant or quixotic cranks. One of the things that you could do with a perpetual motion machine is to violate the law of conservation of energy - that is, you could create free energy out of nothing, simply by building a mechanical device. This is likely what Randall is satirizing with the idea of a process that can generate an extra card out of nowhere - it makes no physical sense, but nonetheless Cueball is convinced that he has found a way to do it. A common defense employed by pseudoscientists, when challenged on their ideas, is to issue a counter-challenge and demand people prove them wrong, as Cueball does in this comic. This is a fallacious line of argument, since the fact that Ponytail cannot prove Cueball wrong does not mean that he is right. Nonetheless, this aggressive defense often works to discourage argument, since it takes far less effort to make a claim than to refute it. Possibly, Cueball's plan involves usage of the Banach-Tarski paradox , a mathematical theorem which describes a method of "dismantling" a solid sphere, rearranging the component pieces, and reassembling them into two solid spheres identical to the original. This is only possible in a mathematical ideal case, because the "component pieces" are actually collections of infinitely many disjoint points; such a procedure cannot be performed in physical reality. Cueball's operations of shuffling and rearranging are analogous to the operations used in the Banach-Tarski operation, which involves only moving and rotating the component pieces without changing their shape. The Banach-Tarski paradox was also referenced in 804: Pumpkin Carving . In the title text, Ponytail responds to Cueball's challenge with snark, claiming that the most obvious error is the fact that the formula's result is "53". The implication is that his math results in the wrong answer , which is proof that the calculations must contain errors. This, of course, starts with the assumption that Cueball's claimed result is impossible, rather than attempting to find the flaws in his specific method. Because most people would conclude, by basic physical reasoning, that merely shuffling and rearranging a deck of cards cannot increase the number of cards in the deck, that feels like a safe assumption. By analogy, increasing the amount of energy in a system only by moving and transferring energy should be equally impossible, on its face. [Cueball and Ponytail are standing next to a flowchart, with Cueball gesturing to it.]: Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them. Ponytail: No, you haven't. Cueball: How do you know?! I challenge you to find an error in my math! [The flow chart consist of 15 boxes of different sizes, connected with arrows. In four of them (top, bottom and two in the middle) a deck of card is shown. Next to the top and bottom a number is written, near the other two, which are the only round boxes, numbers are shown in one of the nearby boxes instead. Beneath the top box there are two boxes with readable text. The other 7 boxes, without numbers or card decks have unreadable text. From top to bottom are the readable content:] 52 Shuffle Cut 21 38 53 [Caption below the panel]: Every conversation between a physicist and a perpetual motion enthusiast.

Wardrobe

Wardrobe

https://www.xkcd.com/2218

https://www.explainxkcd.com/wiki/index.php/2218:_Wardrobe

[Megan is entering into an open wardrobe, while Cueball stands outside.] Megan: I'll go ask. Megan: You wait here. [Cueball stands outside the now-closed wardrobe.] [In a frame-less panel Cueball keeps standing outside the closed wardrobe with voices heard from inside the wardrobe. The characters talking are inferred from the context.] Mr. Tumnus (from inside wardrobe): Halt! Who goes there? Megan (from inside wardrobe): Hey Tumnus. Quick question. Mr. Tumnus (from inside wardrobe): Yes? [Cueball is walking away from the closed wardrobe. Voices can still be heard from inside the wardrobe.] Megan (from inside wardrobe): Is Narnia in the E.U.? Mr. Tumnus (from inside wardrobe): Yes, we joined after you did. Megan (from inside wardrobe): Oh great, another border to deal with. Cueball: I'll go find a lock for the door.

Megan leaves Cueball outside while she goes into a wardrobe to consult with Tumnus on the pressing question if Narnia is part of the EU. It turns out they have joined (some time after the UK joined), which makes Megan complain about another border to deal with. And Cueball waiting outside goes looking for a lock for the wardrobe door. This comic references The Chronicles of Narnia , a series of children's fantasy books by C.S. Lewis (some of which were later made into movies , plays, and TV and radio shows) about a group of children from England who travel to a magical land called Narnia. In the first book of the series (by publication date), The Lion, the Witch, and the Wardrobe , Narnia is accessible through a wardrobe in a residence in the English countryside. Mr. Tumnus is a faun in Narnia and the first character that the first human visitor, Lucy Pevensie , meets on her first trip through the wardrobe portal. Referencing Narnia is a recurring theme in xkcd. Tumnus was depicted in the first comic to reference Narnia: 665: Prudence . The comic also makes reference to membership in the European Union . The United Kingdom (UK) is a member of the EU at the time of this comic, but narrowly voted via public referendum in 2016 to exit the EU (a process commonly referred to as Brexit , portamanteau for Britain/British and exit), but working out the details of this separation has proven more complicated than the simple in/out vote implied. Narnia applying to join the EU shortly after the UK, as referred to in the title text, would theoretically be possible, even if only The Lion, the Witch and the Wardrobe was considered, since the UK joined the EU in 1973, whereas the wardrobe entrance to Narnia was discovered during World War 2, therefore in the period between 1939 and 1945. However, they would most likely be rejected due to not technically existing in Europe and having a monarchy government (EU membership requires a stable democracy). One of the major issues with Brexit was the border between Northern Ireland and the Republic of Ireland . The two countries share the island of Ireland , but Northern Ireland is part of the UK while the Republic is an independent country which remains part of the EU. If the UK exit the EU, it would have different customs regulations than the Republic of Ireland, and there would need to be some kind of customs border. The most obvious solution would be to establish a controlled land border between the two countries, but this would raise some serious difficulties and dangers. Northern Ireland has had a long history of civil unrest and ethno-nationalist conflict. The most recent period of conflict, commonly referred to as The Troubles , resulted in over 3000 deaths between 1969 and 1998. In 1998, the UK and Ireland entered into a treaty, known as the Good Friday Agreement (overwhelmingly approved by referendums in both parts of Ireland). This treaty was intended to resolve many of the issues that drove the conflict, and has largely been successful in putting a stop to the violence. One of the agreements in the treaty was a totally open border between the two parts of Ireland. As both were in the EU, this was easily done, because they already shared a customs union. Over the following two decades, the ease of transit created major trade links between the two areas, and many people lived in one country and worked in the other. In the UK Brexit referendum, a majority of Northern Ireland voters voted to remain in the EU. Placing a hard border between the two countries would create major economic disruptions, and serious hardships for people living near the border. It would also undermine the intent of the Good Friday Agreement, which could lead to terrorist attacks and the rekindling of hostilities. The Irish government raised this issue from the time Brexit was first proposed, but their warnings were not fully heeded. The alternative to this border would be to maintain open borders between Northern Ireland and the Republic of Ireland, but institute customs checks between the island of Ireland and the United Kingdom. In October 2019, Boris Johnson, British Prime Minister, negotiated a Brexit deal with the EU that included this arrangement While the Northern Ireland/Republic of Ireland border issue has received the most attention, the UK has land borders with two other EU countries. The UK territory of Gibraltar shares a border with Spain. There are also two Sovereign Bases Areas that share a border with the Republic of Cyprus. The portal in the wardrobe represents another border of the UK, namely the border between England and Narnia. This 'border', of course, exists only in fiction, but the joke here is that it must be dealt with in the Brexit negotiations, further complicating an already messy situation. [ citation needed ] A further source of implicit humor is the juxtaposition of a fantasy children's tale about the magical land of Narnia with the highly contentious, political, adult world of Brexit. Cueball suggests solving the situation by simply locking the wardrobe (which was never very accessible, even in The Chronicles of Narnia ), effectively isolating the UK from Narnia and making the border problem moot. This wouldn't work even in the fictional world of the books, as new ways to enter Narnia pop up in every book, although most of them are accessible only to the kids from the first book and their friends. The title text references the amount of time it has taken to complete the Brexit negotiations, currently three-plus years and counting. The negotiators have set a series of deadlines to complete the negotiations, but have repeatedly had to extend those deadlines because they haven't reached any agreement. The comic was posted roughly one week before the then-current Brexit deadline of Oct. 31, 2019. However it was already expected that that deadline too would probably be extended . In The Chronicles of Narnia , time moves inconsistently in Narnia compared to Earth, usually passing more rapidly in Narnia than on Earth. Lucy Pevensie and her siblings enter the wardrobe as children, have extensive adventures in Narnia lasting many years, and then return to Earth to find that they are children again and that only a few minutes have passed. The suggestion here is that holding the slow, complex Brexit negotiations in Narnia would take relatively little time on Earth, and the whole affair could be completed in time for the deadline. A punchline similar to the title text, where the slower passing of time was used to take on time-intensive real world problems, was also used for one of the comics in 821: Five-Minute Comics: Part 3 . The time difference was also mentioned in the title text of 1786: Trash . [Megan is entering into an open wardrobe, while Cueball stands outside.] Megan: I'll go ask. Megan: You wait here. [Cueball stands outside the now-closed wardrobe.] [In a frame-less panel Cueball keeps standing outside the closed wardrobe with voices heard from inside the wardrobe. The characters talking are inferred from the context.] Mr. Tumnus (from inside wardrobe): Halt! Who goes there? Megan (from inside wardrobe): Hey Tumnus. Quick question. Mr. Tumnus (from inside wardrobe): Yes? [Cueball is walking away from the closed wardrobe. Voices can still be heard from inside the wardrobe.] Megan (from inside wardrobe): Is Narnia in the E.U.? Mr. Tumnus (from inside wardrobe): Yes, we joined after you did. Megan (from inside wardrobe): Oh great, another border to deal with. Cueball: I'll go find a lock for the door.

Earthquake Early Warnings

Earthquake Early Warnings

https://www.xkcd.com/2219

https://www.explainxkcd.com/wiki/index.php/2219:_Earthquake_Early_Warnings

[Megan is looking at her phone while standing next to Cueball] Megan: Ooh, California has a new earthquake early warning app. Cueball: Yeah, I'm so mad about it. [Megan puts her phone down and looks at Cueball who throws his arms up in the air.] Megan: What, why? Cueball: It ruins the experience of trying to recognize the p-waves before the obvious main waves hit. [Megan still looks at Cueball who has taken his arms down.] Megan: So you're mad about earthquake spoilers? Cueball: I just want to experience the shaking the way the tectonic plate intended!

A week before this comic, on October 17th, California introduced an earthquake warning system in the form of an app for smartphones called MyShake . The system works through a network of sensors across the state that can detect P-waves from an earthquake , which move faster than the S-waves , which cause most of the damage. In addition, the sensors send the warning electronically - at a significant fraction of the speed of light - much faster than either P-waves or S-waves. Because of these differences in speed, the network can send warnings through the app about 5-20 seconds before major shaking occurs, enough time for people to take cover under tables, run outside, etc. The farther you are away from the epicenter, the more warning time you have. In the comic Megan talks about the app, suggesting how cool it is, but Cueball is upset. He seems to think that prediction of the earthquake coming is like a spoiler that ruins the experience of how an earthquake should be experienced. Apparently he prefers to simply be taken by surprise like most people are when an earthquake large enough to feel hits. He also personifies the tectonic plates (whose shifting positions causes the quake), saying that we should all feel the shaking the way the tectonic plate intended. The statement is usually one regarding to arts, such as a music lover might prefer to listen to older music from vinyl (including cracking sounds, etc.) instead of a remastered digital version, as it is, as the artist intended. In the title text Cueball mentions that he was fired from the National Weather Service five minutes after they hired him because the first thing he did was to rename tornado warnings as tornado spoiler alerts. A spoiler alert is something used, for instance, when talking about a plot twist of a new movie, so that people who haven't seen the movie can avoid learning important details that would spoil the experience of seeing the movie. Cueball seems to genuinely wish to be surprised by these potentially lethal phenomena for which just minutes of warning may make the difference between life and death. Earthquake warnings, on a smartphone but not as an app, were the topic of 723: Seismic Waves , and shortly before that a protip for an alternative seismograph was mentioned in 711: Seismograph . An app for warning about tornadoes was the topic of 937: TornadoGuard . Warnings in general by the NWS were the subject in 2179: NWS Warnings , which mentioned tornadoes, volcanoes, tsunamis, and many other hazards. Tsunamis are often caused by earthquakes, though earthquakes were not specifically mentioned. [Megan is looking at her phone while standing next to Cueball] Megan: Ooh, California has a new earthquake early warning app. Cueball: Yeah, I'm so mad about it. [Megan puts her phone down and looks at Cueball who throws his arms up in the air.] Megan: What, why? Cueball: It ruins the experience of trying to recognize the p-waves before the obvious main waves hit. [Megan still looks at Cueball who has taken his arms down.] Megan: So you're mad about earthquake spoilers? Cueball: I just want to experience the shaking the way the tectonic plate intended!

Imagine Going Back in Time

Imagine Going Back in Time

https://www.xkcd.com/2220

https://www.explainxkcd.com/wiki/index.php/2220:_Imagine_Going_Back_in_Time

[Cueball talks to Megan while looking at his smart phone.] Cueball: Ugh. A player named "Reelect Trump 2020" put a frog Pokemon in the gym next to mine. [Megan puts her hand to her face. Cueball is holding a device in his hand with an antenna. He uses the other hand to move a stick on the device.] Megan: Imagine going back in time and saying that to yourself 20 years ago. Cueball: Oh, I have a time machine! I'll try that. [A sound effect between panels, likely the sound of Cueball's time machine.] Bzzzzt [Two Cueballs standing, facing each other. The one on the right is holding the handheld device, and is thus Cueball from 2019. He is apparently repeating his statement to the other Cueball from 1999, with only the last 3 words shown. He gestures towards the left Cueball. Above the left Cueball there is a frame with a caption:] 1999 Cueball from 2019: ...next to mine. [Cueball from 1999 is shown, with Cueball from 2019 speaking off panel.] Cueball from 1999: I see. Cueball from 1999: Pokemon is still popular in 2019? Cueball from 2019: Yeah. [Cueball from 2019 is holding a finger up in front of Cueball from 1999.] Cueball from 1999: And it's cool for people your age to play it? Cueball from 2019: OK, I did not come here to be mocked. Cueball from 1999: This is a sobering cautionary tale. Cueball from 2019: Listen, self...

Cueball is checking his Pokémon Go app to check on the status of a Pokémon he had previously left in a gym (to defend it against the other two teams in the game). In the gym he sees that another player named "Reelect Trump 2020" has left a frog Pokémon, which is now standing next to his. Cueball, evidently not a fan of President Trump or his supporters, finds it distasteful to be indirectly associated with someone whose political views he finds unpleasant. Alternatively, it may simply be that Cueball doesn't want politics injected into a game that he plays for fun. When he remarks on this to Megan , she observes how strange that remark would sound if he said it to his younger self from 20 years ago. Normally when people say "imagine going back in time", they are merely constructing a hypothetical scenario to illustrate how rapidly society has changed over the years. Megan is likely pointing out that the idea of Donald Trump becoming the President of the United States (let alone coming up for re-election) would have seemed very farfetch'd just 20 years ago. However, it turns out that Cueball somehow actually does have the time-travel technology required to pull this off, and so he takes Megan's suggestion literally and goes back in time 20 years to do exactly what she suggested: he repeats the statement to his younger self to see what his reaction will be. Unfortunately, past Cueball (in the year 1999) chooses to focus on a completely different aspect of the statement: the fact that Pokémon - a game that past Cueball sees as a children's game - will still somehow be popular in 20 years, and that his adult self is still playing it. These observations make Cueball feel uncomfortable, as they highlight the fact that he is spending time on pursuits that his younger self sees as frivolous or childish. He gets defensive and starts to argue with his younger self. When his younger self begins to call it a sobering and cautionary tale, it may dawn upon present Cueball that he may just have changed how his former self will behave. (Could he, in the new iteration, never even begin playing Pokémon Go, and thus present Cueball may disappear and a different version of himself will exist 20 years later? Or could he have seeded encouragement for himself being more readily connected to all things Pokémon in the intervening years, putting himself further ahead of the resurgence in its popularity?) Or else future-Cueball is just frustrated at how past-Cueball is failing to notice his intended revelation — and in turn is failing to appreciate past-Cueball's own naive but still insightful interpretation. Pokémon is a media franchise that debuted in 1996 in Japan as both a video game and a trading card game. It was originally designed for and marketed to younger children (the tie-in cartoon series constantly emphasizes its main characters are ten years old), with a design, aesthetic and gameplay that were optimized for a younger audience. Since then, and up to 2019, there have been a total of eight generations of video games on consoles. As the franchise continued to thrive and evolve, it's gone through multiple generations, including Pokémon Go , an augmented reality game for smartphones. These latest versions, in particular, have become popular with (and marketed to) adults, some of whom grew up playing the earlier generations. In 1999 in North America, only the first generation of Pokémon video games had been released, consisting of Pokémon Blue and Pokémon Red for the Nintendo Gameboy. The second generation of Pokémon video games would not even be announced in Japan until November 1999 , and advertising for the North American release would begin in December of 1999. A person living in 1999, who has only seen the first generation, with no official confirmation that a second generation was even being considered, and unable to predict the nostalgia market that would appear later, would quite plausibly wonder about its popularity 20 years later. Donald J. Trump was the president of the United States at the time of publishing, elected in 2016. Even during his campaign, the idea of his election was considered absurd in many circles, as he had never held any kind of public office, and had no background that would lend itself to expertise in government or public policy. Prior to his election, he was primarily known as a New York real estate mogul and host of the 2003 reality television show The Apprentice . While he'd been teasing the idea of a presidential run since the 1980s, and indeed was seeking the Reform Party candidacy in 1999 (at the advice of then-Governor of Minnesota Jesse Ventura , another actor-turned-politician), most people did not take the idea seriously, and the concept of him actually being President of the United States would have been hugely unexpected to most Americans in an earlier era. 1999 Cueball might regard the name "Reelect Trump 2020" as an ironic joke, like a campaign button for Vermin Supreme or the Sweet Meteor Of Death . That Randall is not a fan of Donald Trump became clear in 1756: I'm With Her and many comics that followed it, now including this. Randall released a comic about Pokémon Go less than a week after its release back in July 2016: 1705: Pokémon Go . But Pokémon in general has been a recurring theme in xkcd long before Pokémon Go was released. Pepe the Frog is an internet meme that has become associated with Donald Trump after his use of it during his presidential campaign. The use of a frog Pokémon, therefore, is a callback to this internet phenomenon. The Pokémon left in the gym is most likely Politoed , the only official frog Pokémon released in the game at the time of publication. It comes from the tadpole series with Poliwag that evolves into Poliwhirl which by using a King's Rock can be evolved to Politoed (instead of to Poliwrath ). There are other frog-like Pokémon in the game which are scheduled to be added to Pokémon Go, but where people who dislike Trump might have chosen Toxicroak , it seems an unlikely choice by a fan that hopes Trump is reelected! This comic's joke is similar to one used in the 1985 science-fiction film Back to the Future , in which Doc Brown (of 1955) is shocked to learn that Ronald Reagan would be the President of the United States in thirty years' time, when in 1955 Reagan was a TV actor. Digimon , as mentioned in the title text, is another media franchise which is similar to Pokémon in some ways, though it is sometimes perceived as more "cool" and "adult" oriented. Its popularity in North America rose around 1999 with the airing of its anime series, but never became as popular as Pokémon . This was the first of two time travel comics in less than a week, as the one two comics after this one, 2222: Terminator: Dark Fate , also had future Cueballs travel back to visit their past self. [Cueball talks to Megan while looking at his smart phone.] Cueball: Ugh. A player named "Reelect Trump 2020" put a frog Pokemon in the gym next to mine. [Megan puts her hand to her face. Cueball is holding a device in his hand with an antenna. He uses the other hand to move a stick on the device.] Megan: Imagine going back in time and saying that to yourself 20 years ago. Cueball: Oh, I have a time machine! I'll try that. [A sound effect between panels, likely the sound of Cueball's time machine.] Bzzzzt [Two Cueballs standing, facing each other. The one on the right is holding the handheld device, and is thus Cueball from 2019. He is apparently repeating his statement to the other Cueball from 1999, with only the last 3 words shown. He gestures towards the left Cueball. Above the left Cueball there is a frame with a caption:] 1999 Cueball from 2019: ...next to mine. [Cueball from 1999 is shown, with Cueball from 2019 speaking off panel.] Cueball from 1999: I see. Cueball from 1999: Pokemon is still popular in 2019? Cueball from 2019: Yeah. [Cueball from 2019 is holding a finger up in front of Cueball from 1999.] Cueball from 1999: And it's cool for people your age to play it? Cueball from 2019: OK, I did not come here to be mocked. Cueball from 1999: This is a sobering cautionary tale. Cueball from 2019: Listen, self...

Emulation

Emulation

https://www.xkcd.com/2221

https://www.explainxkcd.com/wiki/index.php/2221:_Emulation

[Cueball sits in an office chair at a desk typing on a laptop computer. The computers response to his typing is shown emanating from a starburst on the screen with zigzag lines between different sentences.] Laptop: Loading... please insert disk into drive A: Cueball: *click* There you go. Laptop: Thank you. Wow, this disk is incredibly fast! Cueball: Yeah, uh, it's the new model from Memorex. Laptop: Amazing. And how is President Reagan? Cueball: He's... He's fine. [Caption under the panel] I feel weird using old software that doesn't know it's being emulated.

Here Cueball is speaking with a fictitious example of artificially intelligent software similar to the type popularized in the 1980's when personal computers had just become mainstream. Although modern computing platforms might still be backwards-compatible with 8-bit era software, it is more likely that the old applications will need to be run within an emulator that can simulate the necessary hardware components required by the application. In this case the "8-bit AI" is having a conversation with Cueball as it carries out tasks common to the era, specifically asking the user to insert a floppy disk into drive "A:" (A: traditionally being the first floppy drive on IBM-compatible PCs). At the time internal storage like a hard disk was an expensive luxury item and most applications were stored on removable media. An application that could not fit on a single floppy disk would be programmed to prompt the user to insert successive floppies which held the required data. However, the speed at which data could be loaded from such devices was very slow , requiring anywhere from ten seconds to ten minutes to load a level or an advanced dialog box. Sometimes the software would even incorporate feedback mechanisms like loading screens to let the user know the program was proceeding as intended and had not crashed. When software operating under an emulator such as DOSBox makes a request to access disc storage, the emulator will often map the command to a file or file system on the enveloping computing environment which can now contain hundreds or thousands of gigabytes of storage. Depending on the configuration, this may require a user action to complete the virtual operation (Cueball's click). The speed of modern hardware allows the data to be transferred at speeds several orders of magnitude higher than what was possible in the past. The 8-bit AI notices this and makes a comment about the transfer speed. Here we begin to see the consequences of emulation upon the anthropomorphized software application. Because the emulator is constructing the application's entire reality, the 8-bit AI has no reason to believe it is anywhere other than a 1980's computing platform for which it was designed. While the application does notice the abnormally fast load time, Cueball decides to not burst his anthropomorphized program's bubble and responds that the file loaded quickly because of a new floppy disk from Memorex , which was a well-known manufacturer of premium magnetic recording media in the 1980s. Memorex was also known for a famous series of commercials with the tagline, "Is it live? Or is it Memorex?"—tying into the comic's theme of a lack of unawareness that something is being digitally duplicated. To compound the problem, computers of the era often lacked a real-time clock or would have an inability to process dates beyond 1999 , and therefore the software application in this comic still believes that it is running at the time of its creation - the 1980's. To this end the program casually asks how President Reagan is doing, as Ronald Reagan was the President of the United States from 1981-1989 when early PCs were on the rise. He died in 2004, 15 years before the publication of the comic. This is why Cueball seems slightly uncomfortable with noncommittally telling the software Reagan is "fine." In the title text, Cueball references the living in a simulation trope, mentioning that it is not fully clear that he is actually living in 2019. This has been a theme in science fiction such as The Matrix , which has been referenced several times in xkcd. That we are living in a simulation was also the subject of the comic 505: A Bunch of Rocks . [Cueball sits in an office chair at a desk typing on a laptop computer. The computers response to his typing is shown emanating from a starburst on the screen with zigzag lines between different sentences.] Laptop: Loading... please insert disk into drive A: Cueball: *click* There you go. Laptop: Thank you. Wow, this disk is incredibly fast! Cueball: Yeah, uh, it's the new model from Memorex. Laptop: Amazing. And how is President Reagan? Cueball: He's... He's fine. [Caption under the panel] I feel weird using old software that doesn't know it's being emulated.

Terminator Dark Fate

Terminator: Dark Fate

https://www.xkcd.com/2222

https://www.explainxkcd.com/wiki/index.php/2222:_Terminator:_Dark_Fate

[Cueball is walking to the right. Another Cueball, Cueball-2, appears behind him in a bubble of energy that appears with a loud sound. The bubble floats in the air behind the walking Cueball, with Cueball-2 inside holding his arms out to the side and having his legs bend.] Zap! [Cueball-2 from the sphere is standing to the left of Cueball, pointing at him. Cueball has stopped and is looking back over his shoulder] Cueball-2: I've traveled back in time to stop you from seeing Terminator: Dark Fate ! [Cueball-2 is looking at Cueball who has turned around and holds his arm a bit out to the sides.] Cueball: But it looks so good! Reviews are actually decent! Mackenzie Davis! Linda Hamilton is back! [Cueball-2 is holding both arms up, hands held down as Cueball stands normally.] Cueball-2: I know, but you always think this, and you're always disappointed. Cueball: I guess ... [Zoom out as another Cueball, Cueball-3, appears to the left in a similar bubble of energy and noise as in the first panel, his arms are out to the sides and his legs are bent. Cueball-2 is holding a hand in front of his mouth, while Cueball throws his arms out to the side.] Zap! Cueball-3: Hi, I'm from the future where you didn't watch it and I realize I still kind of want to see it. Cueball: Let's go together! [Another bubble appears from the right of the three Cueballs, the one in the middle (Cueball-2) holding his arms out. This new bubble contains two Cueballs. The first, Cueball-4, throws up his arms over his head, while Cueball-5 has one arm out in front of him. Both have their legs bent.] Cueball-4: No! We're both of you from the future! We're here to stop you! [In a large panel, five more individual energy bubbles with five Cueballs appear. Two of the bubbles float over the now five Cueballs on the ground. The other three are a bit lower and in line to the right. Cueball-6 to 10 are in different poses, all with their legs bent, all the way to sitting on the knees in one case and most of them throw their arms out to the side. All look down at the five regardless of their bubble's position. Their text is alternating between being up and down, so the text goes over or below the other text, making it hard to decide which comes first. This may be intentional. But here they are in the order of Cueballs as they come from left to right:] Cueball-6: I'm here to stop you! Cueball-7: I'm here to stop the robot sent to stop you! Cueball-8: I'm here to protect you from...you? I lost track. Cueball-9: I'm here to kill Hitler. Did I get the right year? Cueball-10: I'm here to get tickets because in like 20 minutes you people buy them all.

Cueball is on his way to see the new Terminator movie; Terminator: Dark Fate , when Cueball's future self comes back to stop him, trying to convince him that, as always, he will be disappointed by sequels. (This was, for instance, the main joke in the last part of 566: Matrix Revisited .) Future Cueball (who we shall call Cueball-2) almost succeeds in convincing present-day Cueball (who we shall call Cueball-1) not to go see the movie in spite of good reviews and the fact that the original star Linda Hamilton is back after several movies without her. Due to the nature of time travel, Terminator: Dark Fate actually negates any movie that came after the first two ( The Terminator and Terminator 2: Judgment Day ). However, they are interrupted by a second Future Cueball, Cueball-3, who states that in his timeline he hadn't seen it but wished he had, making present-day Cueball exclaim that they should go see it together. Cueballs 1, 2, and 3 are interrupted again by the appearance of two more Cueballs, presumably Cueball-1 and Cueball-3 who have seen the movie, regretted it as Cueball-2 did, and travel back in time to stop themselves from seeing it. In the next panel another 5 Cueballs appear, however, their reasons for coming back have degraded, with the last one stating that he came back simply because, at the time he came from, the theater sold out of tickets because all the time-traveling Cueballs purchased all of them. A common trope in science fiction is to Set Right What Once Went Wrong , where characters travel in time in order to stop a particular event from happening so as to prevent an undesirable timeline. The Terminator series film series is famous for this time travel trope. The initial 3 films feature a time-traveling robot sent from the dystopian future to kill a particular human, with the future resistance in turn sending a protector to ensure the human's survival. However, the series has never been consistent on even the broadest rules of how time travel affects the timeline, with each movie exploring different possibilities. This is another point of spoof for the comic, featuring multiple recursive time loops until it becomes a jumbled mess. The final panel also invokes the "killing Hitler" trope. Adolf Hitler was the leader of Nazi Germany during World War II, and it has been a common plot idea to "go back in time to kill Hitler" such as in 1063: Kill Hitler , by presuming that the world would be better if World War II and The Holocaust had never happened. There are also works that postulate that such a killing would have unintended consequences, making things worse (for example, if Hitler had been replaced by a more competent leader, the Axis power might have won the war). In any case, this Cueball is over 70 years too late to kill Hitler, as Hitler is now dead. [ citation needed ] The title text is what is said by the next Cueball-11 (the 10th time-traveler), with each link in the chain relating to the Terminator movies. Except at the end where the initial "dangerous robot" turns out to be a robot sent to vacuum the floor. Robotic vacuums, such as the Roomba , are a recurring theme on xkcd. The title text split up: Thus Cueball-11 tries to stop the person that needs to destroy the Roomba by stopping his protector's protector, presumably so that the floor will be cleaned in his timeline. It's strange that Cueball would rather execute a complicated time-travel plot than just clean the floor himself, but we've seen him make extreme versions of mundane activities before (e.g. 1017: Backward in Time , which is not actually related to time travel despite the name). This was the second time travel comic in less than a week, as the comic two comics before this one, 2220: Imagine Going Back in Time , also had Cueball travel back to visit his past self. [Cueball is walking to the right. Another Cueball, Cueball-2, appears behind him in a bubble of energy that appears with a loud sound. The bubble floats in the air behind the walking Cueball, with Cueball-2 inside holding his arms out to the side and having his legs bend.] Zap! [Cueball-2 from the sphere is standing to the left of Cueball, pointing at him. Cueball has stopped and is looking back over his shoulder] Cueball-2: I've traveled back in time to stop you from seeing Terminator: Dark Fate ! [Cueball-2 is looking at Cueball who has turned around and holds his arm a bit out to the sides.] Cueball: But it looks so good! Reviews are actually decent! Mackenzie Davis! Linda Hamilton is back! [Cueball-2 is holding both arms up, hands held down as Cueball stands normally.] Cueball-2: I know, but you always think this, and you're always disappointed. Cueball: I guess ... [Zoom out as another Cueball, Cueball-3, appears to the left in a similar bubble of energy and noise as in the first panel, his arms are out to the sides and his legs are bent. Cueball-2 is holding a hand in front of his mouth, while Cueball throws his arms out to the side.] Zap! Cueball-3: Hi, I'm from the future where you didn't watch it and I realize I still kind of want to see it. Cueball: Let's go together! [Another bubble appears from the right of the three Cueballs, the one in the middle (Cueball-2) holding his arms out. This new bubble contains two Cueballs. The first, Cueball-4, throws up his arms over his head, while Cueball-5 has one arm out in front of him. Both have their legs bent.] Cueball-4: No! We're both of you from the future! We're here to stop you! [In a large panel, five more individual energy bubbles with five Cueballs appear. Two of the bubbles float over the now five Cueballs on the ground. The other three are a bit lower and in line to the right. Cueball-6 to 10 are in different poses, all with their legs bent, all the way to sitting on the knees in one case and most of them throw their arms out to the side. All look down at the five regardless of their bubble's position. Their text is alternating between being up and down, so the text goes over or below the other text, making it hard to decide which comes first. This may be intentional. But here they are in the order of Cueballs as they come from left to right:] Cueball-6: I'm here to stop you! Cueball-7: I'm here to stop the robot sent to stop you! Cueball-8: I'm here to protect you from...you? I lost track. Cueball-9: I'm here to kill Hitler. Did I get the right year? Cueball-10: I'm here to get tickets because in like 20 minutes you people buy them all.

Screen Time

Screen Time

https://www.xkcd.com/2223

https://www.explainxkcd.com/wiki/index.php/2223:_Screen_Time

[Cueball is looking down at his phone. The text is what he reads on the screen, as shown by a zigzag line emanating from a starburst at the top of the phone.] Phone: Screen time report: Phone: While awake, you averaged 2 H 48 M per day looking at things other than your phone. That's up 6% from last week! [Caption below the panel] At some point, it starts making more sense to track non -screen time.

Cueball is reading the report from a smartphone app showing the average time each day that he was NOT looking at his phone during the hours he was awake this last week. This is a reversal of the more expected behavior for a screen-time app, which would normally report the amount of time spent looking at the screen. The point is that as mobile phone usage becomes more prevalent, it may be easier to comprehend to report non-screen time. People in the US spent an average of 24 hours of non-work/education screen time per week in 2015, compared to 10 hours of active leisure, according to one estimate.[ How free time became screen time ] Averaged per day that comes to 3.4 hours screen time and 1.4 hours active leisure. Screen time may be associated with various undesirable conditions, such as mental health difficulties like depression, decreased activity, reduced sleep quality and quantity. In Cueball's particular case, if we assume that he is awake 17 hours a day (the average for most people in USA), then his non-screen time average of 2 hours 48 minutes means that he spent more than 84% of his awake time last week looking at a screen. This means that while his 6% improvement is positive, he still has quite a significant habit. His previous non-screen-time would have been 2 hours 38 minutes, so he has managed to shave 10 minutes off. Increased screen time often comes at the expense of decreased sleep time, so it may not be fair to assume a constant amount of sleep. [1] [2] Ironically, in order for Cueball to use the app, he has to be looking at his mobile screen. The increasing use of mobile devices in modern society has been a cause for concern, with many people arguing this leads to addiction, other health risks, or people simply not talking to each other. The title text parodies the idea of a screen time app by describing a "shoe time" app, which would track the amount of time a person spends wearing shoes. It's unclear what the practical use for this would be, as there is little controversy about the prevalence of shoes in our society. Possibly an app that tracks the amount of time wearing specific shoes could be useful; for example, a person suffering medical problems from wearing the wrong footwear could track the amount of time they spend wearing particular shoes, and correlate this with their health to figure out which ones are causing problems. Possibly, the point being made is that use of phones have become so constant in our lives that using them for many hours a day is as unremarkable as using shoes for many hours a day. Or, since it's the socks that are Bluetooth-enabled, they may be reporting negatively about almost constant obstruction by shoes, whereas the socks would prefer to report a much lower "Shoe Time" score. Some cultures have the custom of taking shoes off when in the house, so those people would boast lower (and presumably more favorable) "Shoe Time" scores. It may also be a reference to the " shoe phone " on the television show Get Smart . (If Maxwell Smart wore these socks, they could track his phone usage, because his phone was in his shoe). [Cueball is looking down at his phone. The text is what he reads on the screen, as shown by a zigzag line emanating from a starburst at the top of the phone.] Phone: Screen time report: Phone: While awake, you averaged 2 H 48 M per day looking at things other than your phone. That's up 6% from last week! [Caption below the panel] At some point, it starts making more sense to track non -screen time.

Software Updates

Software Updates

https://www.xkcd.com/2224

https://www.explainxkcd.com/wiki/index.php/2224:_Software_Updates

[A graph with two axes. Over and right of the axes are two labeled arrows pointing along the two axes:] X-axis: Time Y-axis: Software Version Number [The graph consists of three lines. Two gray lines moves in upwards step from left to right. The upper line begins a bit up the Y-axis, the bottom line begins somewhat down the X-axis. From there both lines move upwards in steps of different height. The distance between them stays on average about the same for the entire graph, but moves from bottom to top of the graph. Labeled arrows point to the top and the bottom gray line. The area between them is shaded light gray and has a gray label written in the middle. The third line is black. It begins from a dot just under the second step in the upper gray line. This line also makes steps, keeping close to the upper line, although it makes fewer steps than that line. But a bit over halfway to the top, it stops stepping, staying on the same level for the rest of the graph; thus eventually it falls outside of the light gray area between the other two lines, where it had been until the bottom line stepped above it. This black line is also labeled, with normal black text written beneath the first full step inside the gray area. There is one other point labeled on the black line: a dot just after the final step, under the next large step in the upper gray line. At the end of the black line there are question marks with an arrow beneath pointing right. The arrow has a label to the left.] Upper gray line: Newest Version Bottom gray line: Oldest Supported Version Light gray area: Support Zone Black line: My current version Start dot: First Install Second dot: An update finally breaks a feature I'm unwilling to lose End of black line: ??? Arrow label: The Abyss [Caption below the chart]: All software is Software as a Service.

As time passes, upgrades to most products are inevitable, with software being no exception. However, as many updates create multiple versions, support for all of them can become a bit of a hassle for the company that creates them, so old versions frequently become unsupported after some years, or in some cases even months, of their releases. Software as a Service (SaaS) is a software licensing and delivery model in which software runs on the vendor's computers (servers), accessed by customers remotely. The software is said to run "in the cloud" as "cloud applications". Customers purchase subscription licenses. Since the only copy of the software is that which the vendor runs on their own computers, all customers use the one latest version of the software, which is upgraded whenever the vendor chooses to. The benefits of SaaS is that the customer mostly does not have to worry about whether their machine is able to run the software, and both the vendor and customer only have to concern with managing one version instead of being familiar with multiple ones. The downside of SaaS, however, is that if the vendor alters or removes a feature that the customer prefers or requires, or introduces a bug, the customer has no ability to remain with an older version, losing a feature of the software that they depend on, or get impacted by a new bug that is introduced by an upgrade to the software with no ability to run the older version. This downside of SaaS is frequently pointed out by skeptics of SaaS, who like to argue that the traditional purchase model allows the consumer to theoretically able to operate that version indefinitely; there is no obligation to pay ongoing fees or to upgrade to later versions. Indeed, some users do stay on old editions because of unfavorable changes in the newer versions, which is not something SaaS customers can do. Randall argues that in reality, though, because even these traditional pieces of software have versions and are equally susceptible to having a feature axed by the developer, as well as the problems of running increasingly old software - mainly concering bugs and later-discovered security vulnerabilities that would only be patched via upgrades, the practical upshot of these trends is that it's rarely plausible to buy a single copy of software and continue to run it indefinitely. Almost all consumers who continue to use a particular piece of software will eventually need to upgrade to and pay for new versions. While this isn't precisely the same as paying regular licensing fees and running software that automatically updates, it's an effectively similar model. In that sense, "All software is Software as a Service". The title text refers to a different aspect of cloud applications. Since they run "in the cloud" on remote computers, they are subject to the limitations of network speed to the servers. The time for data to be sent to a server and a response to be received back is called the "ping time". Since a "cloud server" is just a computer, there is no fundamental difference between software running remotely and software running locally on a user's computer. The biggest difference is that software running locally will respond almost instantly to user input, whereas software running remotely may take longer to respond, since the data first needs to be sent over a network (the internet), processed, and then sent back to the user's computer. In addition, the chance of data loss (packet loss) may cause the response to be even slower, as data has to be re-sent, or often result in no response at all. Hence, in practice, this can have an enormous impact on the experience of using remote software vs software that runs locally (as anyone who has tried online gaming on a laggy server can attest). However, technically speaking, there is a nonzero time taken for the data to travel from the user's keyboard onto the computer, across the various circuitry, and back to the monitor. Hence there is a "ping" time even for a local computer (in fact, many "gaming" monitors advertise low input lag, in the order of 1-5 milliseconds, as a feature). Therefore, you could technically say that all applications are cloud applications, just that some (local computers) have very fast ping times whereas for others (servers on another continent) it may be quite slow. This ignores the fact that being a "cloud application" implies that it runs on a server in a remote location. The joke is similar to the one that claims everyone commutes to work - including those that "work from home" - but their commute times just vary a lot. For example, consider the "commute" from your bedroom to your home office. [A graph with two axes. Over and right of the axes are two labeled arrows pointing along the two axes:] X-axis: Time Y-axis: Software Version Number [The graph consists of three lines. Two gray lines moves in upwards step from left to right. The upper line begins a bit up the Y-axis, the bottom line begins somewhat down the X-axis. From there both lines move upwards in steps of different height. The distance between them stays on average about the same for the entire graph, but moves from bottom to top of the graph. Labeled arrows point to the top and the bottom gray line. The area between them is shaded light gray and has a gray label written in the middle. The third line is black. It begins from a dot just under the second step in the upper gray line. This line also makes steps, keeping close to the upper line, although it makes fewer steps than that line. But a bit over halfway to the top, it stops stepping, staying on the same level for the rest of the graph; thus eventually it falls outside of the light gray area between the other two lines, where it had been until the bottom line stepped above it. This black line is also labeled, with normal black text written beneath the first full step inside the gray area. There is one other point labeled on the black line: a dot just after the final step, under the next large step in the upper gray line. At the end of the black line there are question marks with an arrow beneath pointing right. The arrow has a label to the left.] Upper gray line: Newest Version Bottom gray line: Oldest Supported Version Light gray area: Support Zone Black line: My current version Start dot: First Install Second dot: An update finally breaks a feature I'm unwilling to lose End of black line: ??? Arrow label: The Abyss [Caption below the chart]: All software is Software as a Service.

Voting Referendum

Voting Referendum

https://www.xkcd.com/2225

https://www.explainxkcd.com/wiki/index.php/2225:_Voting_Referendum

[A voting ballot is shown with an underlined header and 10 different options below with different boxes/buttons next to each choice. Some are empty, some are marked/checked or numbered.] Which voting system should we use? [Empty radio button]: First past the post [Empty radio button]: Top-two primary [Filled radio button]: Louisiana primary [Three radio buttons in a row, first two filled]: Cumulative voting [Checked box]: Approval voting [Checked box]: Multiple non-transferrable vote [Box marked]: 3: Instant runoff voting [box marked]: 1: Single transferrable vote [box marked]: 2: Borda count [Slider with value slightly below half]: Range voting [Caption below the panel:] The referendum went well, but we can't figure out how to count the ballots.

The day before this comic's publication was an election day throughout the United States , primarily for local and state issues (normal elections for federal offices of the President, Senate, and House of Representatives are always in even years). The topic of today's comic highlights many different methods for conducting elections and counting votes. While elections are primarily used to allow voters to select from candidates for public offices, election ballots also frequently present questions for voters to directly voice their support or opposition to some change in a process or law - commonly called a referendum . The comic depicts an election ballot referendum for voters to select the method to be used in future elections. While the referendum is asking voters to select a method from a long list of methods, a referendum is usually presented as a specific proposal which requires a simple Yes or No vote. As an example, the ballot in New York City included a referendum ( which passed ) on whether to use a different method, ranked choice voting (another name for instant-runoff voting as described below). A common issue with such referenda is what method to use to conduct the referendum itself. Here, the method of marking each choice on the ballot reflects the marking method which would be used if it were the winner. Moreover, each item is listed in a way which is suggestive of what it means (e.g., "First past the post" is the first one, "Top-two" is among the top two, and "Multiple non-transferable vote" is selected among numerous other ones). A few of the methods allow for multiple winners, which can often be good when electing councils and representatives, but it is unclear what it would mean to have several of these voting methods all win. The aim of political elections in first-past-the-post is to determine which of the candidates standing for election is most preferred by the most voters. In a simple two-person contest, this process is quite effective, since whichever candidate receives the most votes will be the one that the majority of voters prefer. This system works well for simple cases, but for elections with more than two candidates this system may result in a candidate being elected who less than 50% of the voters would prefer. For example, in a contest with three candidates, A, B and C, in which candidate A receives 43% of the vote, candidate B 38%, and candidate C 19%, candidate A will be elected, even though some of the voters who chose candidate C might have preferred candidate B as their second choice instead of candidate A, leading to a result which pleases less than half of the population. For example, the above distribution of votes happened in the 2000 United States presidential election in Florida , where George W. Bush beat Al Gore by less than 1000 votes largely because of the third-party candidacy Ralph Nader, whose 100,000 voters would mostly have otherwise gone to Gore. Additionally, in election of multiple candidates across a country (or region etc.), first past the post does not lead to a distribution of elected representatives proportional to the total number of votes, only electing the lead candidate in each case. For example, imagine a country with 100 representatives to be elected, with each seat having the same distribution as described in the example above. Under first past the post, 100 representatives will be elected representing party A, and none for party B or C. Despite these drawbacks, First Past the Post voting continues to be used for political elections in many countries including the US and UK, which historically have both had two main parties receiving the majority of votes. The First Past the Post system has received much criticism, particularly from smaller parties who may lose out; however, supporters promote the simplicity of the system compared to other methods. This system is shown with a radio button , the classic computer metaphor for being allowed one choice out of a set. This method is used in California and Washington to select candidates for the US House of Representatives. In most states' primary-election systems, each party votes separately to select one candidate to continue to a first-past-the-post general election ballot. In these two states, on the other hand, candidates from all parties, as well as "independent" candidates from no party, run in a single race, and the top two finishers then contest the general election, even if both are from the same party (a common occurrence in heavily-Democratic California), and even if one candidate has a clear majority of the vote. (In an older version, a majority winner in the primary was immediately declared elected. This was held to be in violation of federal law, by effectively setting an "election day" before the national Election Day in November.) This is a form of the two-round system , a system for selecting elected officials most notably used to elect the President of France This system is almost identical to the top-two primary, but with two differences. First, the open-to-all ballot is held on the national Election Day, instead of on the state's primary day. (This avoids the conflict with Federal law described above.) Also, the second round of the election is not held if one candidate has a clear majority (more than 50%) of the votes in the first round. Like the top-two primary and the first-past-the post system, the comic represents this system with a radio button, except this one has been marked, indicating the vote. In cumulative voting, voters get as many votes as there are seats to be filled, and may distribute them as they choose. This system's most common use is in selecting corporate boards of directors. It is also used in some areas to allow a minority bloc within an electorate to elect some of its preferred candidates without imposing a system of separate districts. The comic illustrates this with multiple radio buttons, each row representing an option/candidate and each (implied) column one vote. On the ballot the first 2 radio buttons are marked, as they are each the only radio buttons in their column and cannot be unmarked. In this system, each candidate is listed as a yes/no choice, where the voters can choose which candidates they approve of winning the election, and which ones they do not approve of. The winner of the election is the candidate with the highest approval rate. This type of voting system can be used as a vetting process to filter out undesirable candidates before the final vote; for example, the United Nations uses a series of "straw polls" to filter out candidates for the Secretary General before the Security Council makes a final vote. In 2018, Fargo, North Dakota switched to using approval voting to elect local politicians, making it the only jurisdiction in the United States to use this system. In the xkcd ballot, the approval option is presented as a checkbox, where a check in the box is "approve" or an empty box is "disapprove". Checkboxes are distinct from radio buttons in that several can be marked in the same field, and can also be unmarked without marking another. This system for electing multiple members to a ruling body is also known as plurality-at-large voting or block vote. It is commonly used in the US for city council elections, and simply limits the number of votes per voter to the number of winners. It allows a cohesive plurality of the electorate to claim all of the seats, denying other voters any representation whatsoever. In 2019, the Justice Department required Eastpointe, Michigan to run at least the next two elections via single transferable vote because their existing plurality-at-large system was disenfranchising black citizens. This system is also shown as a checkbox, as each candidate gets either 0 or 1 votes from each voter. In this system, people vote for all the candidates, or perhaps their favorite three, but assign different preferences to each candidate they vote for, as in 1 for their first choice, 2 for the second, 3 for their third, etc. If at least 50% of voters vote for a candidate as their first choice, that candidate wins. If not, the person with the least votes gets eliminated, and anyone who voted for that person has their next (slightly less favorable) choice automatically move up a rung. The 50% mark is again checked, and if there is no winner, another lowest-voted candidate is eliminated. Eventually one candidate will emerge victorious. The advantages of this system are that there is rarely a need to have another election if things are close (the information is already there to "instantly" recalculate the vote based on additional voter preferences), and "spoiler" candidates only cause problems when they become competitive. And as Arrow's impossibility theorem shows, as with all ranking methods, sometimes voters can hurt a candidate by ranking them more favorably . On this weird xkcd ballot, we see this type of ranking between this type of voting ( Instant runoff voting ) and the two that follow ( Single transferable vote and Borda count ), all of which allow multiple ranked votes. It appears that between these three, Randall has voted for Single transferable vote as his top choice, Borda count for his second choice, with Instant runoff voting as his third choice. This system extends the instant runoff to multiple-winner elections. Specifically, the election threshold is set not at 50%, but at 100%/( k +1) where k candidates will win (in other words, just high enough to prevent more candidates from reaching it than there are seats). The bottom candidates are eliminated as in instant-runoff and their votes redistributed. In addition, if a candidate wins with more than enough votes, the extra votes (either a fraction of each vote, or some subset of the ballots) are also redistributed. This procedure continues until the requisite number of winners is reached. Each ballot is counted as 1 point for the last choice, 2 for next-to-last, and so on up to n for the first choice among n candidates. The highest point-earner(s) win. This system may also be calculated as 1 point for first choice, 2 for second, etc., with the lowest total winning; this variant, called the "cross-country vote" (due to its resemblance to the scoring system of the sport of cross-country running), is used by the NCAA's various selection committee as one step in choosing championship tournament fields. The title text refers to the inventor of the Borda count, Jean-Charles de Borda (for whom it is named), implying that the use of the system implies the inclusion of a ballot in which he gets one point in the counting. This "1 point" would be quickly drowned out by any sensible quantity of actual votes. This also humorously suggests that if no one were to vote at all, Borda would win by default. For each candidate, the voter selects a value within a fixed range (the xkcd voter sees this choice presented as a slider) for each candidate, independent of the values given to other candidates. The highest total wins. (If the range is restricted to two values, this becomes the approval system.) The punchline for the comic is that the whole referendum is a chicken-and-egg problem: in order to accomplish the purpose of a referendum, one needs to know how the votes will be translated into a result, but in this case, determining that rule is the purpose of the referendum. Additionally this xkcd demonstrates one of the mechanisms that makes it hard to change the currently-used voting system in any state: Each voting system in fact votes for itself as the ones who are able to decide upon the voting system being in use have been elected using the current voting system and therefore are likely to profit from it. [A voting ballot is shown with an underlined header and 10 different options below with different boxes/buttons next to each choice. Some are empty, some are marked/checked or numbered.] Which voting system should we use? [Empty radio button]: First past the post [Empty radio button]: Top-two primary [Filled radio button]: Louisiana primary [Three radio buttons in a row, first two filled]: Cumulative voting [Checked box]: Approval voting [Checked box]: Multiple non-transferrable vote [Box marked]: 3: Instant runoff voting [box marked]: 1: Single transferrable vote [box marked]: 2: Borda count [Slider with value slightly below half]: Range voting [Caption below the panel:] The referendum went well, but we can't figure out how to count the ballots.

Recombination And Reionization

Recombination And Reionization

https://www.xkcd.com/2226

https://www.explainxkcd.com/wiki/index.php/2226:_Recombination_And_Reionization

[Panel showing Ponytail sitting working at some type of console, possibly in her laboratory. Cueball is standing on the other side of the console, facing her.] Ponytail: Our lab is trying to pick up the spin line of neutral hydrogen. It's the only radiation from the era before the first stars formed. [Panel showing Ponytail and Cueball. Ponytail has paused working, with one hand raised off the console.] Ponytail: It was 1.4 GHz at first, but by now it's redshifted to the 100-MHz range. Cueball: Isn't that also where FM radio broadcasts? [Frameless panel showing Ponytail and Cueball. Ponytail is pressing a key on the console to enable and disable a live signal from her lab's equipment.] Ponytail: Yeah. That's the problem. Listen: Sound of switch on console: *Click* Audio signal from console: You're tuned to Hot 92.7: the Vibe! Coming up next... Sound of switch on console: *Click* [Panel showing Ponytail and Cueball. Ponytail has resumed working at the console, and Cueball has raised a hand to his chin.] Ponytail: But once this guy stops talking, that Nobel Prize will be ours . Cueball: Maybe that's not a station – maybe that's just what reionization sounds like. Ponytail: Reionization plays a lot of Selena Gomez.

The hydrogen line is a spectral line of neutral (un-ionized) hydrogen atoms. The electrons in an atom have a property called spin, equal to either 1/2 or -1/2, and one "spin state" of the electron in neutral hydrogen has slightly more energy than the other spin state. This means that when the electron in a hydrogen atom spontaneously switches its spin state, it releases a photon at a certain frequency called the hydrogen line. This line falls in the microwave region of the electromagnetic spectrum, with a frequency of ~1.42 gigahertz (GHz). The wavelength corresponding to this frequency is about 21.1 centimeters, giving it the common name of the 21-centimeter line. In this comic, Ponytail is attempting to detect the signal of this emission line from the ancient universe, although due to redshift , the line's frequency has decreased from 1.4 GHz to only ~100 megahertz (MHz), putting it in the current FM broadcast band . In most parts of the world, FM radio makes use of frequencies from 87.5 to 108 MHz. The problem that FM radio and the signal for which Ponytail is searching overlap in frequency quickly becomes apparent when tuning to the frequency detects a local radio station rather than the desired signal. The radio station is called Hot 92.7: The Vibe; this indicates that Ponytail is searching for a signal at 92.7 MHz, but there is a radio station interfering with it. She demonstrates this to Cueball by playing the live signal for him, but says that once the radio DJ stops talking, their research will result in a Nobel Prize . This is unlikely, as most radio stations broadcast 24 hours a day without ever stopping (except in cases of power failure, which would also affect Ponytail's radio telescope). An unstated joke is that Ponytail's observational setup receives the FM radio signal at all; any actual radio telescope would have incorporated methods from its inception to exclude local sources of radio signals such as FM radio. Cueball points out that perhaps the signal is what the supposed primordial hydrogen line actually sounds like during the phase of universe formation called reionization . Ponytail jokes back that the primordial universe must enjoy playing popular singer Selena Gomez . Although it is theoretically possible that a naturally occurring radio transmission might sound like music to humans, it would not contain clearly understandable coherent sentences in a language that did not exist when the transmission was created. [ citation needed ] The title text refers to the signal Ponytail is detecting, claiming that it originates from before the formation of the first stars in the universe (which took place approximately 150 to 200 million years after the Big Bang ), but is additionally post-Malone. " Post Malone " is the stage name of a popular hip hop musician and singer, so this is a play on words, as the "Post" in his stage name isn't referring to "after" something, but is simply his (real) last name, and perhaps a play on the expression "a star is born" for an artist becoming a famous celebrity. [Panel showing Ponytail sitting working at some type of console, possibly in her laboratory. Cueball is standing on the other side of the console, facing her.] Ponytail: Our lab is trying to pick up the spin line of neutral hydrogen. It's the only radiation from the era before the first stars formed. [Panel showing Ponytail and Cueball. Ponytail has paused working, with one hand raised off the console.] Ponytail: It was 1.4 GHz at first, but by now it's redshifted to the 100-MHz range. Cueball: Isn't that also where FM radio broadcasts? [Frameless panel showing Ponytail and Cueball. Ponytail is pressing a key on the console to enable and disable a live signal from her lab's equipment.] Ponytail: Yeah. That's the problem. Listen: Sound of switch on console: *Click* Audio signal from console: You're tuned to Hot 92.7: the Vibe! Coming up next... Sound of switch on console: *Click* [Panel showing Ponytail and Cueball. Ponytail has resumed working at the console, and Cueball has raised a hand to his chin.] Ponytail: But once this guy stops talking, that Nobel Prize will be ours . Cueball: Maybe that's not a station – maybe that's just what reionization sounds like. Ponytail: Reionization plays a lot of Selena Gomez.

Transit of Mercury

Transit of Mercury

https://www.xkcd.com/2227

https://www.explainxkcd.com/wiki/index.php/2227:_Transit_of_Mercury

[Panel showing the sun partially obscured by clouds with faded gray blue sky around the sun, mainly upper right, as there are clouds in the lower left part. The image is very bright and blown out at the bottom left, obscuring most of the surface detail of the sun. A small black dot is visible in the upper-right part of the sun's image.] [Caption below panel, with a yellow unhappy smiley before the hash tag:] This photo of the transit of Mercury fried my telescope's imaging sensor 🙁 #NoFilter

This comic is in reference to the transit of the planet Mercury across the Sun on November 11, 2019 (the date of the publication of this comic), which appeared from Earth as a small black dot moving against the background of the Sun. Randall has made comics about solar transits before, albeit about the transit of the International Space Station, in 1828: ISS Solar Transit and 1830: ISS Solar Transit 2 . Viewing a solar transit requires a special lens filter to prevent the intense light from the Sun from burning out a telescope's imaging sensor. The hashtag #nofilter is typically used on photo sharing sites, especially Instagram, to humblebrag about having encountered situations so photogenic that no further image enhancement (" filter ") is required to prepare them for general advertisement. In this comic, the hashtag is instead used to cap off an image about the predicament of the poster, where the lack of a proper astronomic filter has led to damage of personal property. The image shown on the comic is quite bright and blown out , and though the poster did manage to get a picture of Mercury, the sun's bright light permanently damaged their telescope. The title text refers to a still different meaning of the word "filter"; it imagines a swimming pool growing green scum in the absence of a water filter , as opposed to a photographic or astronomic filter. Although not directly referred to in this comic (although a variant was used in 1911: Defensive Profile , a third common variation of "No filter" is possibly alluded to here and can refer to someone who makes, or posts, tactlessly candid comments. While often this means comments that reflect the individual's actual views which are potentially offensive or socially unacceptable, it could also refer to someone who posts every mundane detail of their lives, such as what is growing in their swimming pool (as is shown in the title text). Multiple layers of meaning makes this pretty clever word play. [Panel showing the sun partially obscured by clouds with faded gray blue sky around the sun, mainly upper right, as there are clouds in the lower left part. The image is very bright and blown out at the bottom left, obscuring most of the surface detail of the sun. A small black dot is visible in the upper-right part of the sun's image.] [Caption below panel, with a yellow unhappy smiley before the hash tag:] This photo of the transit of Mercury fried my telescope's imaging sensor 🙁 #NoFilter

Machine Learning Captcha

Machine Learning Captcha

https://www.xkcd.com/2228

https://www.explainxkcd.com/wiki/index.php/2228:_Machine_Learning_Captcha

[Cueball is sitting in an office chair at his desk with one hand in his lap and the other poised over the keyboard of his computer. A zigzag line is drawn from a starburst on the computer screen going above the computer to where it is shown what is displayed on the screen. At the top there is the following text:] Computer: To prove you're a human, click on all the photos that show places you would run for shelter during a robot uprising. [Below the text there are nine images arranged in a 3 by 3 square. In reading order they are: A house, possibly with an open carport; a large tree with two trees in the background; a bunker/bomb shelter; a car; a city skyline with several sky scrapers; a sidewalk with road on the left, grass on the right; a log with a board leaning up on the log; a mailbox; and a hole in the ground.]

All websites other than explain xkcd have difficulties with spambots, which are automated entities created in order to log onto a website and spam or otherwise wreak havoc upon it. (This never happens to explain xkcd.) To guard against this eventuality, websites have implemented CAPTCHAs , a challenge used to prove the user is a human and not an automated program. A typical CAPTCHA might distort a random sequence of letters and numbers and put it in a strange and/or mixed font and ask a user to type it, or it might show a set of pictures and ask the user which ones contain fire hydrants; these tasks are meant to be easy for humans but obscenely difficult for computers. CAPTCHAs are a recurring theme on xkcd. CAPTCHAs run by Google are also used to train artificial intelligences to get better at these difficult tasks, such as reading poorly-scanned text or identifying objects of interest on the road (the latter being the subject of 1897: Self Driving ). This comic jokes about a malicious CAPTCHA which is being used to train an AI to dominate the world. In order to prevent people from taking shelter, the AI uses the CAPTCHA to ask humans like Cueball to tell it places where they would hide. The implication is that during a robot uprising, the AI, on the side of the robots, would then be able to track down humans much more easily. The choices presented are (left to right, top to bottom): House Sometimes, the best (or least-worst) response to a disaster is to "shelter in place" until the danger is passed, rather than risk getting caught in the open or in traffic. This is commonly advised in response to biological, chemical, or radiological hazards, or in the case of a violent act committed in the community. If the robot uprising is localized, then sheltering at home would be a fine response, because traveling to the other locations would increase the risk of being spotted and attacked by self-driving cars or aerial drones. On the other hand, most homes contain a multitude of internet-connected devices, some of which may control vital electrical or heating systems, so if the robot uprising is widespread, then the home would not be a safe shelter. Tree or forest If there is a robot uprising, then traveling to a forest or other nature reserve, far away from developed cities and towns, would reduce the risk of being near a hostile piece of technology. However, it also comes with limited resources for sustaining human life, unless the forest abuts meadows or farmland. Bunker or bomb shelter If the robot uprising includes the use of weapons of mass destruction (as in the Terminator franchise, or as was threatened in WarGames ), then only a hardened military structure is likely to survive. Car Cars offer some shelter and, more importantly, mobility in one convenient package. Most families own at least one, and they are widespread in human-occupied areas, so even if the car is not as suitable as a long-term shelter (depending on how the road and gasoline/power networks survive the uprising) it makes a fine first step in evacuating to a more permanent hiding place. This is of course assuming that the car is not self-driving and that hostile self-driving cars are not widespread. City Cities offer thorough selections of supplies and tools that may be harder to come by in more rural areas, but they are also home to lots of robots and automated systems that may participate in the uprising, not to mention humans who may be prime targets for the machines. It may be necessary to visit the city to stock up on supplies in a post-apocalyptic scenario, but in the early stages of a robot uprising, it is best to leave them as quickly as possible. Sidewalk The sidewalk is exposed and presumably falls within a built-up area that is readily accessible to the machines; it is not at all suitable as shelter. Lean-to The log with a board leaning on it is an example of an improvised shelter. Such a shelter could be constructed anywhere with local materials, and would not be marked on any map known to the robots, which are both positives for surviving the onset of the uprising. However, it is lacking in insulation and protection, which makes it less suitable for longer stays. Mailbox Only a very young infant could fit in this mailbox. This is not a viable shelter. A hole in the ground Like the improvised shelter, this option can be made almost anywhere and is easy to camouflage, and it offers additional insulation from weather and weapons of mass destruction. It's a fine option if you happen to already have one or know where to find one, but it will be difficult to create a suitable one after the uprising begins. Some of these choices may be Cow Tools , that is, presented not as serious options but to be funny because they are nonsensical. The title text imagines a different malicious CAPTCHA which Randall says is "more likely" than the robot-uprising scenario, in which a company or government asks users to identify "disloyal" members of society. Presumably the company or government would then use this information to eliminate such "disloyal" members, either by firing them (company) or jailing, expelling, or executing them (government). This follows a theme of previous comic strips (e.g. 1968: Robot Future ) in which Randall expresses that he is more concerned about humans using AI for evil ends than he is about AI being evil in itself. [Cueball is sitting in an office chair at his desk with one hand in his lap and the other poised over the keyboard of his computer. A zigzag line is drawn from a starburst on the computer screen going above the computer to where it is shown what is displayed on the screen. At the top there is the following text:] Computer: To prove you're a human, click on all the photos that show places you would run for shelter during a robot uprising. [Below the text there are nine images arranged in a 3 by 3 square. In reading order they are: A house, possibly with an open carport; a large tree with two trees in the background; a bunker/bomb shelter; a car; a city skyline with several sky scrapers; a sidewalk with road on the left, grass on the right; a log with a board leaning up on the log; a mailbox; and a hole in the ground.]

Rey and Kylo

Rey and Kylo

https://www.xkcd.com/2229

https://www.explainxkcd.com/wiki/index.php/2229:_Rey_and_Kylo

[Rey, on the left, and Kylo Ren, on the right, from the Star Wars series, are facing one another and wielding lightsabers:] Rey: Kylo, we shouldn't fight! Let's set aside our differences and work together to measure the local properties of space, just in case someone in the far future is watching from another galaxy and wants our help to constrain the expansion rate! [Caption below the panel:] The new Star Wars totally panders to cosmologists.

Rey and Kylo Ren , from the latest trilogy of the Star Wars series, are engaging in a lightsaber duel. Rey tells Kylo that they should not fight, but work together on cosmology , the study of the origins of the universe. Specifically she wants to study the expansion rate of the universe; scientists believe that the universe is expanding, and that the expansion rate is accelerating, but aren't sure of the exact rate, what the rate was in the past, or if it varies depending on location. Since the Star Wars movies take place "a long time ago in a galaxy far, far away", if Rey and Kylo presented their findings in the movie, it would theoretically give scientists more data points. Although it is unlikely that modern scientists would use cosmological data from a movie generally considered fictional [ citation needed ] , especially as said time long ago and distance far, far away are never quantified, some movies and TV shows have spurred scientific innovations due to their subject matter (see below). The caption, besides explaining the obvious nerd cred this turn of events would earn if it actually occurred in the movies, might also be a play on accusations against the Disney-owned franchise that it has begun pandering to progressives, with the complainers citing its racially diverse cast, powerful (in their eyes overpowered, and Mary Sue-ish) female protagonist, and a willingness to sacrifice sensible plot for perceived progressive talking points (e.g. Vice Admiral Holdo's plan and failure to communicate it). The title text is Randall 's complaint that the Star Wars movies have been more focused on the Wars aspect than the Star aspect. It seems he would want a film about stars. It's worth noting that, with a half-width space, "Star " and " Wars" are the same number of letters long, and are therefore perfect halves of the title. Kylo Ren and Rey, though enemies in the films, have been shipped in fanfictions and fan theories, so their joining together in this comic may also be a play on that desired relationship. Star Wars is a recurring topic on xkcd. As far as we can tell, the stars of Star Wars (that is, the celestial bodies, not the actors) seem to be much the same as ours. The "galaxy far, far away" has had various depictions over the years, but all sources agree that it is a spiral galaxy approximately the same size as our Milky Way galaxy, albeit with a less prominent bar than the Milky Way has. We don't ever hear what name, if any, the Star Wars characters have for the galaxy, or why they call it a "galaxy" when the word comes from a Latin phrase, "Via Galactica" or "Milky Way" -- a question that Randall has brought up in 890: Etymology . Light is known to have a speed, although we are not told what that speed is, or if it is constant for all observers in all reference frames. That speed is an upper bound on the speed that objects can travel in real-space, as in our universe, but in Star Wars , ships can travel faster than that speed by "jumping" into a parallel dimension called "hyperspace". This allows them to cross the galaxy in a matter of hours rather than tens of thousands of years. According to our understanding of relativity, transmitting information faster than light is equivalent in some reference frames to transmitting information backwards in time (cf. the tachyonic antitelephone ), but such temporal paradoxes are not known to occur in the Star Wars universe. The only known examples of information transmitted backwards in time come from the Force, such as limited precognition of incoming dangers or vague, prophetic visions of possible futures. Speaking of which, "the Force" is said to be "an energy field, created by all living things" which "binds the galaxy together". It's not clear if the Force is a fifth fundamental force or "merely" a manipulation of the fundamental forces by focused will, but powerful Force-users have been known to raise and move heavy objects, conjure lightning, and manipulate minds. It is not known if the universe of Star Wars is expanding, contracting, or steady-state, although prior to Lucasfilm's acquisition by Disney, the officially-published non-film Star Wars media were collectively known as the "Star Wars Expanded Universe". In addition to the usual stellar evolution process, stars in Star Wars are subject to premature destruction or spontaneous creation by various superweapons, such as the Sun Crusher and Star Forge. Many of the planets of Star Wars are dominated by one or two biomes, rather than the dozens into which our homeworld is divided. Some of these are reasonable enough (a planet could certainly be covered in desert or ice or lava depending on its water content and proximity to a star), but others require some novel climate patterns not exhibited on Earth (the same atmospheric pattern that gives rise to Earth's tropical rainforests also produces the Sahara Desert). [Rey, on the left, and Kylo Ren, on the right, from the Star Wars series, are facing one another and wielding lightsabers:] Rey: Kylo, we shouldn't fight! Let's set aside our differences and work together to measure the local properties of space, just in case someone in the far future is watching from another galaxy and wants our help to constrain the expansion rate! [Caption below the panel:] The new Star Wars totally panders to cosmologists.

Versus Bracket

Versus Bracket

https://www.xkcd.com/2230

https://www.explainxkcd.com/wiki/index.php/2230:_Versus_Bracket

[A tournament bracket tree is shown with 16 participants each on the left and right side. From both sides toward the middle the brackets reduce to eight, then four, two, and one line where the latter join to a rectangle in the middle.] [Left side:] Kramer - Kramer Ford - Ferrari The People - Larry Flint Joe - The Volcano King Kong - Godzilla Freddy - Jason Dracula - Frankenstein Alien - Predator [Right side:] Marvel - Capcom Marge - The Monorail Justice League - Teen Titans Asterix - Caesar Batman - Superman Scott Pilgrim - The World Mega Shark - Giant Octopus Plants - Zombies

This comic shows a tournament bracket in which the initial matches represent works of fiction or non-fiction with "versus" (represented as versus , vs. , v , etc) in their names (e.g. Batman is initially matched against Superman in reference to Batman v Superman: Dawn of Justice ). The list includes 13 movies, 2 video games, and one television episode. The works referenced are: Assuming the tournament bracket reflects the results of each original work, the second round would result as follows: The title text refers to the 2002 action film Ballistic: Ecks vs. Sever , which is qualified to be in this tournament by virtue of having the word "vs." in its title, but as the film is regarded as one of the worst movies ever made , it has been defeated in a pre-entry match vs. "the passage of time" - it is thus not considered worthy of entry in the tournament. Tournament brackets is a recurring subject on xkcd, most recently used in 2131: Emojidome and 2037: Supreme Court Bracket . The latter is especially similar to this comic, considering that it also extends normal "versus" situations to a second round. The first bracket comic, 1529: Bracket , prompted people to create a series of polls to determine the end results, much like Randall later did himself with Emojidome. Randall even made a reference to one of those polls in the xkcd Header text . [A tournament bracket tree is shown with 16 participants each on the left and right side. From both sides toward the middle the brackets reduce to eight, then four, two, and one line where the latter join to a rectangle in the middle.] [Left side:] Kramer - Kramer Ford - Ferrari The People - Larry Flint Joe - The Volcano King Kong - Godzilla Freddy - Jason Dracula - Frankenstein Alien - Predator [Right side:] Marvel - Capcom Marge - The Monorail Justice League - Teen Titans Asterix - Caesar Batman - Superman Scott Pilgrim - The World Mega Shark - Giant Octopus Plants - Zombies

The Time Before and After Land

The Time Before and After Land

https://www.xkcd.com/2231

https://www.explainxkcd.com/wiki/index.php/2231:_the_Time_Before_And_After_Land

[Caption at top of panel:] (Timeline not to scale) [A timeline is shown with two endpoints and five other points. The points are labeled:] Big Bang Rocky planets form Earth forms Ground-nesting bees evolve The Land Before Time Thymus genus diverges Now [Below the timeline are five overlapping time periods in three rows. The text is between two thick black bars. The time periods all start and end at two different points.] [Big Bang to Rocky Planets Form:] The Time Before Land [Big Bang to Ground-Nesting Bees Evolve:] The Time Before bees [Rocky Planets Form to Thymus Genus Diverges:] The Land Before Thyme [Ground-Nesting Bees evolve to Now:] Time for Land Bees! [Thymus Genus Diverges to Now:] Bees Land on Thyme

This comic indulges in some wordplay on the title of the 1988 animated movie The Land Before Time , which takes place millions of years ago in the time of dinosaurs. The comic shows a timeline of the history of the universe from the Big Bang to the present day, with The Land Before Time placed at the point in the timeline where the movie is set, as well as other seemingly arbitrary events such as the formation of rocky planets and the evolution of ground-nesting bees. The joke is that Randall has contrived several periods of universal history that sound like funny permutations of "The Land Before Time" due to certain words being homophones , such as "time" and "thyme", or homonyms, such as the noun "land" (ground) and the verb "land" (to alight). He also split the word "before" into "bee" and "for". The title text is for the phrase "the time for Beeland" and lists 2 places (that Randall found on Google) with the name "Beeland": a market in Spillimacheen, British Columbia or a chalet in Slovenia . Bees are a recurring topic on xkcd. [Caption at top of panel:] (Timeline not to scale) [A timeline is shown with two endpoints and five other points. The points are labeled:] Big Bang Rocky planets form Earth forms Ground-nesting bees evolve The Land Before Time Thymus genus diverges Now [Below the timeline are five overlapping time periods in three rows. The text is between two thick black bars. The time periods all start and end at two different points.] [Big Bang to Rocky Planets Form:] The Time Before Land [Big Bang to Ground-Nesting Bees Evolve:] The Time Before bees [Rocky Planets Form to Thymus Genus Diverges:] The Land Before Thyme [Ground-Nesting Bees evolve to Now:] Time for Land Bees! [Thymus Genus Diverges to Now:] Bees Land on Thyme

Hotel Room Party

Hotel Room Party

https://www.xkcd.com/2232

https://www.explainxkcd.com/wiki/index.php/2232:_Hotel_Room_Party

[Hairy, Ponytail, Cueball, White Hat, Megan, and Blondie are standing in a line. Cueball is raising his left hand with his pointer finger extended and is facing his left. He is also pointing to the right. The other five are facing Cueball.] Cueball: OK everyone, let's break into teams. Cueball: Katie, get the wire cutters and start disassembling the TV. You two can strip the wallpaper. Mike and I will work on shredding the mattress. Cueball: You, start shopping for maintenance and cleaning services. We don't want to leave the staff to deal with this. [Caption below the panel]: It's my first time throwing one of those parties where you trash a hotel room and I want to make sure I get it right.

It is a common trope that really wild parties in hotel rooms, particularly by rock bands on tour, end up trashing that hotel room as crazy party goers break and spill things. Such parties are widely perceived to be very fun, because they got so out of control. In this comic, Cueball (together with Hairy , Ponytail , White Hat , Megan , and Blondie ) is misunderstanding cause and effect as he plans to throw a party where you trash a hotel room. Instead of planning a wild party, he is planning to calmly and deliberately trash the hotel room by assigning people to do damage. Unlike a real wild party, this is unlikely to be fun [ citation needed ] to anyone but hardcore geeks. Also, because Cueball is so organized, he is also planning for maintenance and cleaning services to undo the damage, or at least make it easier to dispose of. Since what is shown of such parties is the aftermath, one could argue that leaving the damage is part of the point. In actual trash-a-hotel-room parties the party goers are so hungover or tired afterward that they don't clean up but leave the damage. This often results in rock bands being charged large amounts of money after the fact for the hotel to do the repairs. For this reason, one would probably like the hotel to take as long as possible to find out, definitely not calling the manager to check that the room has been trashed appropriately as indicated in the title text. In addition to rock bands, trashing of hotel rooms occurred in real life in the Tailhook scandal of 1991, where it was revealed at an earlier party naval officers cut down a wall between two hotel suites with a chainsaw . Trashing a home during a teenage party while parents are away, and the mad rush to clean up the damage/evidence before the parents return, is a common trope in teen movies. [Hairy, Ponytail, Cueball, White Hat, Megan, and Blondie are standing in a line. Cueball is raising his left hand with his pointer finger extended and is facing his left. He is also pointing to the right. The other five are facing Cueball.] Cueball: OK everyone, let's break into teams. Cueball: Katie, get the wire cutters and start disassembling the TV. You two can strip the wallpaper. Mike and I will work on shredding the mattress. Cueball: You, start shopping for maintenance and cleaning services. We don't want to leave the staff to deal with this. [Caption below the panel]: It's my first time throwing one of those parties where you trash a hotel room and I want to make sure I get it right.

Aurora Meaning

Aurora Meaning

https://www.xkcd.com/2233

https://www.explainxkcd.com/wiki/index.php/2233:_Aurora_Meaning

[A drawing of a circle with six dashed lines dividing it into 7 segments with different width. Those at equal distance above and below the broadest middle segments have the same width. Each segment has a label. Above the circle there is a caption:] What it means if you see an aurora, by latitude. [The labels of the seven segments:] Normal Cool and exciting Someone should go check on our satellites A bunch of open questions in solar-terrestrial physics are about to be answered Someone should go check on our satellites Cool and exciting Normal

The phenomenon of an atmospheric aurora (known as aurora borealis in the northern hemisphere and aurora australis in the southern hemisphere) occurs as a result of charged particles emitted by the sun interacting with the Earth's magnetic field. The magnetic field funnels the charged particles towards the polar regions of the earth. At some point, the flow of particles hits the atmosphere, where the particles interact with the molecules of the gases which make up the atmosphere and add to those molecules' energy. Those molecules subsequently release the added energy in the form of light, which is observed as an aurora. Where in the atmosphere the aurora occurs is related to the quantity and energy of the particles being emitted by the sun. Under normal circumstances, this occurs in high latitudes relatively close to the poles. In less common circumstances of more intense solar activity such as a a solar flare or coronal mass ejection (CME), the charged particles are traveling faster and get diverted less by the Earth's magnetic field, so auroras will occur at lower latitudes. This comic indicates both the rarity with which this would occur and the impact it would have on people. Polar latitudes: Normal; auroras typically can be seen in these high latitudes. Subpolar latitudes: (e.g., southern Canada/northern US, most of northern Europe, northern half of Asia, and numerous small islands in the southern hemisphere) Happens frequently enough to be unconcerned but uncommon enough to be notable and interesting. About a week before the publication of this comic, on Wednesday, November 20, 2019, aurora activity was visible in the northern United States and southern Canada. Subtropical/Tropical latitudes: Charged particles of sufficient energy to cause auroras at this latitude are very rare and have happened on only a few occasions in recorded history, and not during the space age. A particularly strong one was the solar storm of 1859 , which caused failure of telegraph systems all over Europe and North America and in some cases gave telegraph operators electric shocks. An event of that magnitude today would likely interfere with the functioning of electronic systems in orbit, possibly to the point of disabling them entirely, and would cause widespread damage to our now highly electrified world. Equatorial latitudes: Auroras have never been recorded here, so all scientific inquiry into what the effect would be on the Earth in general, and on life itself, is purely theoretical. Were this to actually occur, those theories could be proven or disproven based on actual observations (presuming all observers have not been incapacitated or otherwise occupied by the complete breakdown of all electrical and electronic systems as the charged particles induce electric currents in conducting objects). An event powerful enough to have auroras at equatorial latitudes would be extremely energetic and would probably cause very high levels of damage on Earth. The title text comments on what would happen if auroras were seen in the equatorial band. arXiv.org is an electronic database of unreviewed, pre-print research papers. The astro-ph.SR sublist is a list of papers in the "Solar and Stellar Astrophysics" topic. So if auroras were seen in the middlemost band, there would be many requests to upload electronic publications on the subject, as well as actual electrical interference to the servers of the website. Randall may have been consulting this server for research on the comic, prompting this specific observation. [A drawing of a circle with six dashed lines dividing it into 7 segments with different width. Those at equal distance above and below the broadest middle segments have the same width. Each segment has a label. Above the circle there is a caption:] What it means if you see an aurora, by latitude. [The labels of the seven segments:] Normal Cool and exciting Someone should go check on our satellites A bunch of open questions in solar-terrestrial physics are about to be answered Someone should go check on our satellites Cool and exciting Normal

How To Deliver Christmas Presents

How To Deliver Christmas Presents

https://www.xkcd.com/2234

https://www.explainxkcd.com/wiki/index.php/2234:_How_To_Deliver_Christmas_Presents

[The comic is divided into three sections. The top section contains one low panel stretching across the entire comic. It has a header (same as the title of the comic) with a sub-header beneath. Then below that is a picture of Randall’s new book How To . The black book is shown standing. The blue title is readable but the white text beneath it as well as blue and white text below the image is unreadable. On the cover is a white drawing of Cueball putting in a light-bulb with a quad-copter under each foot. White Hat is watching as Megan walks in with a ladder. Next to the book is a segment of text with a blue link at the end. Beneath this is a text from where a curved arrow goes to the book.] How To Deliver Christmas Presents In a future without chimneys How To For more questionable ideas for using science to solve problems, check out my new book, How To! Click on this comic or go to xkcd.com/how-to Good Christmas gift! [The second section has three normal sized panels on the same row. In the first panel, Randall, drawn as Cueball, is presenting the problem of the comic, while holding one hand out palm up.] Randall: The traditional way to get Christmas presents into a house is to have a large reindeer-herding man slither down the chimney with them. Randall: Unfortunately, chimneys are becoming less common in the United States. [The middle panel shows a line graph with one black and four gray lines. The X-axis is a time scale, with small ticks for each year and larger labeled ticks for every fifth year. The Y-axis is a percentage range with small ticks for every 5% and larger labeled ticks for every 10%. Each of the gray lines are swinging up and down quite a lot, but all but one of them clearly falls down as times passes. The black line has a clear downwards falling tendency. Each line has a label written on segments of the lines, where the lines are thus disrupted. For the gray lines the text is also gray. Above the lines are the following text:] Disappearing chimneys Percentage of new homes with fireplaces Source: Census Bureau Survey of Construction X-Axis: 1990  1995  2000  2005  2010  2015 Y-Axis: 40%  50%  60%  70%  80% Overall West Midwest South Northeast [In the third and last panel of this segment Randall, holding his arms out, explains that there are other ways to solve the problem.] Randall: But that's OK; there are other ways to get a gift into a house Randall: Here are a few options! [The last segment has a large panel taking up the bottom half of the comic. At the bottom of this panel there are even two smaller comics which lie over this panel and break the bottom border of the panel. They relate to the information in the large panel. In the middle of this panel is a detailed drawing of a house. The tiles of the roof are all individually drawn (8 rows with about 23 tiles each for a total about 180 tiles). To the right on the roof top is a chimney indicated with a dotted line, showing where it is not present. The front of the house has two small windows to the left, a door with door knob, in the middle of the house, with a two steps stair in front of it and a large window with three segments to the right. All three windows have curtains visible and are divided in two, a top and a bottom part On the top of the middle segment there is a handle for opening the windows, all five segments of them. In the window to the left sits a cat and in the central segment of the large window to the right sits Pikachu. The foundation of the house is drawn as 4 rows of bricks to the left (about 12 in each row) and three to the right (about 16 in each row, for 48 on both sides for a total of about 96). ] [To the left on the side of the house is a line indicating a ventilation shaft. Three arrows end there. They are coming from a bunch of particles of a disintegrating black book with part of a title still readable. Other text is visible, but not readable. Only the first word of the title can be read, but even here the last letter is already partly dissolved. The book is hanging above the grass on the ground below it to the left of the house. Above the book is a section of text marked with a large white number 1 inside a black circle. Beneath the book this text continues. Bordering this text is a one panel comic belonging to this text segment.] 1 Even without chimneys, houses aren't airtight. If you vaporize the gift, parts of it will enter the house through the intake vents... Book: How ...And it will stay there. According to a 2008 study from Clarkson University, particles of your gift that settle in their house will remain there for an average of several months if they vacuum, and seven decades if they don’t Source: DOI 10.3155/1047-3289.58.4.502 [The one panel comic is on top of the large panel beneath the door to the house, but about three times as wide. In the panel, Megan and Cueball are reacting to statement 1. Cueball is walking away from her to the right.] Megan: Seven decades?! Cueball: BRB, I need to go vacuum. Megan: Houses are disgusting [To the right of the house a gift wrapped present is flying towards the large window, with five lines indicating its speed and direction. Beneath the book is a line indicating the ground away from the house. There is a large segment of text surrounding the book on the three sides away from the house. Above the present next to the dotted-lined chimney is a large white number 2 inside a black circle. Then follows text which goes out to the edge of the panel, and this text continues down to the level of the book where it then only continues to the right of the speed lines. And then finally two lines of text are beneath the book above the ground next to the house.] 2 The critical momentum necessary for a projectile to break glass is around 4 kg*m/s. (40 for ½" plywood.) Source: fema.gov/previous-missile-impact-test-wood-sheathing This means you can deliver a book-sized gift by hurling it at a window at 25+ mph Speed = book mass/ 4 kg*m/s = 25 mph But if they’ve put up plywood shutters, you’ll need 250mph+ delivery speeds. [Finally beneath the house and text segment 2, there is a large white number 3 inside a black circle adjacent to the top right of the segment 1 panel comic. Next to this is the final text segment in this panel. Beneath this text is yet another comic, this time in five panels referring to the text, where the panels also break the lower border of the large panel.] 3 Wait until they order a different book, then intercept the package, open the binding, and replace the pages with the ones from yours. [The five panel comic is on top of the large panel but beneath the text segment 3. ] [Black Hat opening a box with one hand while having his own book under the other arm.] [The book cover is open, the pages from the original book have been removed and are interchanged with those from Black Hat’s book, two arrows indicating the switch.] [Black Hat carrying a closed box.] [Cueball going down to retrieving the package from the bottom of a three step stairs.] [Cueball is standing next to the open box reading the book.] Cueball: ...Ugh, real-life content injection. Off-screen voice: We need HTTPS for paper.

This comic is yet another fun way to promote Randall's new book, How To , released on September 3, 2019, reminding people to buy it as a Christmas present that could be given to a friend or family member. Giving Christmas presents is a way to celebrate the holiday of Christmas , celebrated in the United States on December 25th. Randall always releases a Christmas comic on the 25th or close to that day. Having one this early is thus different, and another Christmas related comic came out two comics later; see that comic's trivia section . The entire comic links to https://xkcd.com/how-to/ , a description of his book and ways to order it. As always the entire picture is a link , even though he has made the URL blue as if it was a clickable link. Of course it will also work if you actually click on the URL. At least in this comic he does state that you can click anywhere on the comic, and if that doesn't work he also gives the URL. Many people would probably still click on the blue link-like line, having not read his text. But the objective of getting them to the xkcd page about How To would have been obtained. The rest of the comic discusses how to "deliver" this Christmas present. As mentioned in the comic, the "traditional" way that parents teach their kids about Christmas and Christmas gift giving is with the story of Santa Claus , a man who lives on the North Pole, who delivers gifts each Christmas Eve by riding a sleigh pulled by reindeer. He is usually depicted entering a house to deliver gifts by going down the home's chimney. Every year, the North American Aerospace Defense Command (NORAD) tracks Santa as he delivers gifts around the world. Although we take that story for granted, it is no less ridiculous than the alternatives this comic explores, and in fact considerably more so, as there is no reason to believe NORAD can detect Santa in flight given his various other legendary stealth techniques. [ citation needed ] As mentioned in the comic, fireplaces (and chimneys) are becoming less common in the United States, so Randall (drawn as Cueball) proposes 3 options for how to deliver his new book as a present: Option 1 : Vaporize the gift (and blow it into their house). This would allow the particles of the book to enter the air vents of the house. However, this book would be unreadable, which defeats the purpose of purchasing the book for someone. As noted by Randall using information from a Journal of the Air & Waste Management Association study , dust particles can remain inside a house for months (with vacuuming) and decades without vacuuming. This inspires Cueball to vacuum his house. Option 2 : Throw the book through their window. Based on research by FEMA , Randall states the speed needed to throw a book-sized object through a window to be 25 mph (~40 km/h). Breaking a window is probably not an ideal way to deliver a gift, as the recipient likely would not be pleased with a hole in their window. If a house has a broken window, perhaps from a previous gift delivery, they might cover up the window with a piece of plywood. Randall notes the speed to throw a book-sized object through a piece of plywood to be 250 mph (~400 km/h), faster than a human can reasonably throw. If the book weighs about 400g, 25 mph would be enough. But the formula in the comic is wrong (inverted), see the trivia section below. The title text mentions that building codes in hurricane-prone areas, like the southern United States, rely on information on how easily flying debris can break windows, presumably to improve reinforcement of such windows. Randall proposes a science fair project contributing to these studies (by throwing books at windows). Option 3 : Intercept a different package. This option is to intercept an order of a different book, and replace the pages of the book with Randall's book (which Black Hat is shown doing). As the recipient, Cueball, remarks, this is similar to content spoofing / content injection, where information passed over the Internet is replaced before being delivered to the user. In this "real-life" case, the book's content has been "injected" and replaced with a different book. An off-screen person mentions HTTPS , or Hypertext Transfer Protocol Secure, an extension of regular HTTP, used for secure communication. Cueball and this person believe that "paper" needs HTTPS, so that Cueball's original book can be "securely delivered" without being intercepted by third parties such as Black Hat. This could also relate to code injection , where malicious code is injected into a program. An example of code injection is with the famous comic, 327: Exploits of a Mom , where Mrs. Roberts deletes the school's database tables. The house is very detailed and in the windows are both a cat (typical click bait) and a different figure, perhaps Yoda or a Pikachu. [The comic is divided into three sections. The top section contains one low panel stretching across the entire comic. It has a header (same as the title of the comic) with a sub-header beneath. Then below that is a picture of Randall’s new book How To . The black book is shown standing. The blue title is readable but the white text beneath it as well as blue and white text below the image is unreadable. On the cover is a white drawing of Cueball putting in a light-bulb with a quad-copter under each foot. White Hat is watching as Megan walks in with a ladder. Next to the book is a segment of text with a blue link at the end. Beneath this is a text from where a curved arrow goes to the book.] How To Deliver Christmas Presents In a future without chimneys How To For more questionable ideas for using science to solve problems, check out my new book, How To! Click on this comic or go to xkcd.com/how-to Good Christmas gift! [The second section has three normal sized panels on the same row. In the first panel, Randall, drawn as Cueball, is presenting the problem of the comic, while holding one hand out palm up.] Randall: The traditional way to get Christmas presents into a house is to have a large reindeer-herding man slither down the chimney with them. Randall: Unfortunately, chimneys are becoming less common in the United States. [The middle panel shows a line graph with one black and four gray lines. The X-axis is a time scale, with small ticks for each year and larger labeled ticks for every fifth year. The Y-axis is a percentage range with small ticks for every 5% and larger labeled ticks for every 10%. Each of the gray lines are swinging up and down quite a lot, but all but one of them clearly falls down as times passes. The black line has a clear downwards falling tendency. Each line has a label written on segments of the lines, where the lines are thus disrupted. For the gray lines the text is also gray. Above the lines are the following text:] Disappearing chimneys Percentage of new homes with fireplaces Source: Census Bureau Survey of Construction X-Axis: 1990  1995  2000  2005  2010  2015 Y-Axis: 40%  50%  60%  70%  80% Overall West Midwest South Northeast [In the third and last panel of this segment Randall, holding his arms out, explains that there are other ways to solve the problem.] Randall: But that's OK; there are other ways to get a gift into a house Randall: Here are a few options! [The last segment has a large panel taking up the bottom half of the comic. At the bottom of this panel there are even two smaller comics which lie over this panel and break the bottom border of the panel. They relate to the information in the large panel. In the middle of this panel is a detailed drawing of a house. The tiles of the roof are all individually drawn (8 rows with about 23 tiles each for a total about 180 tiles). To the right on the roof top is a chimney indicated with a dotted line, showing where it is not present. The front of the house has two small windows to the left, a door with door knob, in the middle of the house, with a two steps stair in front of it and a large window with three segments to the right. All three windows have curtains visible and are divided in two, a top and a bottom part On the top of the middle segment there is a handle for opening the windows, all five segments of them. In the window to the left sits a cat and in the central segment of the large window to the right sits Pikachu. The foundation of the house is drawn as 4 rows of bricks to the left (about 12 in each row) and three to the right (about 16 in each row, for 48 on both sides for a total of about 96). ] [To the left on the side of the house is a line indicating a ventilation shaft. Three arrows end there. They are coming from a bunch of particles of a disintegrating black book with part of a title still readable. Other text is visible, but not readable. Only the first word of the title can be read, but even here the last letter is already partly dissolved. The book is hanging above the grass on the ground below it to the left of the house. Above the book is a section of text marked with a large white number 1 inside a black circle. Beneath the book this text continues. Bordering this text is a one panel comic belonging to this text segment.] 1 Even without chimneys, houses aren't airtight. If you vaporize the gift, parts of it will enter the house through the intake vents... Book: How ...And it will stay there. According to a 2008 study from Clarkson University, particles of your gift that settle in their house will remain there for an average of several months if they vacuum, and seven decades if they don’t Source: DOI 10.3155/1047-3289.58.4.502 [The one panel comic is on top of the large panel beneath the door to the house, but about three times as wide. In the panel, Megan and Cueball are reacting to statement 1. Cueball is walking away from her to the right.] Megan: Seven decades?! Cueball: BRB, I need to go vacuum. Megan: Houses are disgusting [To the right of the house a gift wrapped present is flying towards the large window, with five lines indicating its speed and direction. Beneath the book is a line indicating the ground away from the house. There is a large segment of text surrounding the book on the three sides away from the house. Above the present next to the dotted-lined chimney is a large white number 2 inside a black circle. Then follows text which goes out to the edge of the panel, and this text continues down to the level of the book where it then only continues to the right of the speed lines. And then finally two lines of text are beneath the book above the ground next to the house.] 2 The critical momentum necessary for a projectile to break glass is around 4 kg*m/s. (40 for ½" plywood.) Source: fema.gov/previous-missile-impact-test-wood-sheathing This means you can deliver a book-sized gift by hurling it at a window at 25+ mph Speed = book mass/ 4 kg*m/s = 25 mph But if they’ve put up plywood shutters, you’ll need 250mph+ delivery speeds. [Finally beneath the house and text segment 2, there is a large white number 3 inside a black circle adjacent to the top right of the segment 1 panel comic. Next to this is the final text segment in this panel. Beneath this text is yet another comic, this time in five panels referring to the text, where the panels also break the lower border of the large panel.] 3 Wait until they order a different book, then intercept the package, open the binding, and replace the pages with the ones from yours. [The five panel comic is on top of the large panel but beneath the text segment 3. ] [Black Hat opening a box with one hand while having his own book under the other arm.] [The book cover is open, the pages from the original book have been removed and are interchanged with those from Black Hat’s book, two arrows indicating the switch.] [Black Hat carrying a closed box.] [Cueball going down to retrieving the package from the bottom of a three step stairs.] [Cueball is standing next to the open box reading the book.] Cueball: ...Ugh, real-life content injection. Off-screen voice: We need HTTPS for paper.

Group Chat Rules

Group Chat Rules

https://www.xkcd.com/2235

https://www.explainxkcd.com/wiki/index.php/2235:_Group_Chat_Rules

[Title at the top of the comic]: Rules for this group chat [A numbered list of 10 rules]:

In this comic Randall is outlining the rules of a group chat, such as Internet Relay Chat (IRC), Slack , Discord , WeChat , Discourse , and the like. 1. Once you've sent a typing notification, you have to say something, c'mon. Typing notification, often called a "typing awareness indicator," is a feature of some instant messaging systems, showing a message such as "Typing..." with the typer's name to the other participants, causing them in many cases to wait to receive the message before typing something of their own. When the typer stops without sending anything, this can seem anticlimactic and potentially disruptive if it recurs. Randall's rule is that you must say something once you've started typing, to avoid the awkwardness of awaiting a person's reply. See also 1886: Typing Notifications . 2. Show you care by trimming the tracking junk off links you paste. Some URL links may have tracking information attached to the end of them, to show the origin of the URL and other information. UTM parameters are an example of URL parameters (the part of a URL starting with a question mark) which are used to track utilization of the URL from one user to another. Many news and marketing-related websites include such tracking codes with any visit to one of their web pages in an attempt to see the source of the URL for subsequent visits. Many people consider this a violation of privacy as well as a source of clutter, and make an effort to remove the parameters from URLs when they are not necessary for obtaining the requested content. For example, this url has a lot of tracking information to show that it was originally accessed from Slickdeals, which can be removed to produce a much shorter URL for the same web page. Randall asks the users of group chat to politely remove the tracking code, though other parameters may be involved in an important non-tracking way (such as the lat, lon and zoom level giving the focus of a Google Map link) and it isn't always obvious which parts are which - or both tied together! 3. Do not talk about Fight Club (1999). This is a reference to the 1999 film Fight Club , where the main character forms an eponymous "Fight Club," an underground club for men to fight recreationally. In the rules for Fight Club the first and second "rules" are "You do not talk about FIGHT CLUB.", which Randall parodies in this comic, by making a rule to not talk about the film Fight Club and placing this rule third in the list. See also 922: Fight Club and 109: Spoiler Alert . 4. There are two types of chats: those with a relevant group name, and those where the name is random nonsense that changes regularly. Only the second kind are good. Some group chats frequently change the name of their title or the names of their channels, for example to reference upcoming events or inside jokes, or to reflect the topic of the current conversation. Often, these names do not get changed back until someone decides to change it to a new inside joke/etc. Randall claims that those are the only good kind, compared to those that never change group names, perhaps implying a singular focus is less interesting than a dynamic chat that often changes names. 5. When mentioning it elsewhere, always just refer to it as "the group chat" to create an aura of exclusive mystery. Many people have to deal with several kinds of group chat in the same organization, so referring to "the group chat" within such an organization may be confusingly ambiguous. Also, calling a chat "the group chat" can serve to exclude those who don't already know about it. 6. Robert's Rules of Order are optional but encouraged. Robert's Rules of Order are one of the authoritative codifications of parliamentary procedure used to formalize decision-making in organizations required to document their activities such as governments and sometimes civic organizations and corporations. While people required to use Robert's Rules might use group chat to plan their agenda — even going so far as to prepare a pro forma script for a meeting in accordance with parliamentary procedure which represents their positions and deliberations in advance — and to compose, revise, and approve their minutes , it is unlikely that group chat participants would follow Robert's Rules prior to their formal meeting. 7. Periodically part of the group will split off to form a new chat with everyone minus one person. This is how group chats reproduce; don't draw attention to it. Some people who use group chat too frequently or for unimportant messages or both will cause their colleagues to attempt to achieve greater productivity by excluding them from an alternate chat, from which notifications, for example, are less annoying and more useful. Alternatively, a person could be excluded from a chat to hide things from them, such as to plan a surprise for them, or because that one person has been disruptive or annoying to the point that everyone else wants to continue the conversation without their continued input. It appears that the chat is a honey bee hive reproducing by swarming . When purposely excluding someone by creating a new group, you would probably not want them to know you have done so as they might otherwise attempt to re-join in the new chat; that's likely the real reason one should not talk about or draw attention to the fact that it happened. 8. Since there's no algorithmic feed, the responsibility for injecting lots of garbage no one asked for falls on you. Tools such as IFTTT and IRC bots (or "bots" in this context) are used to provide group chat channels with information automatically taken from external sources of various sorts, such as emails to a support address or commits to source code control systems. Randall suggests that when such algorithmically-provided information is not available, it is incumbent upon chat participants to provide sufficiently verbose replacements. The "algorithmic feed" may also refer to the newsfeed type of systems that Facebook or other social networking sites use, to order posts for a user to view. 9. The enumeration, in these rules, of certain rights, shall not be construed to deny or disparage others retained by the people. This is a reference to the Ninth Amendment to the United States Constitution , which reserves the various natural rights not specifically mentioned in the Constitution. Per Wikipedia, this right was included because "future generations might argue that, because a certain right was not listed in the Bill of Rights, it did not exist." The Ninth Amendment was also referenced in 1998: GDPR . 10. Sorry about all the notifications. Here, Randall apologizes for all the notifications for the messages sent in group chat. Group chat features often result in more notifications than designers of notification systems anticipated or intended. If each of these ten rules were sent as a separate message in group chat, they might likely end with such an apology. The title text expresses appreciation (and perhaps amazement) for group chat participants who remain silent except for promptly replying on topics pertinent to them. [Title at the top of the comic]: Rules for this group chat [A numbered list of 10 rules]:

Is it Christmas?

Is it Christmas?

https://www.xkcd.com/2236

https://www.explainxkcd.com/wiki/index.php/2236:_Is_it_Christmas%3F

No* *99.73% accurate [Caption below the panel:] xkcd.com presents a new "Is It Christmas" service to compete with isitchristmas.com

https://isitchristmas.com/ is a popular simplistic website that informs the visitor whether or not it's Christmas . Christmas is a holiday observed in many parts of the world on December 25 of each year. At the top on the tab of the site in the browser it says "Is it Christmas?" with a large NO printed if it is not December 25, and a YES if it is December 25. This website asks the user's browser for the date, and updates accordingly if it is indeed Christmas. In addition, isitchristmas.com gives the answer in the language of your region (i.e. for a visitor from Canada, the site gives the answer in English and French to account for Canada's bilingularity, and in most other countries just their word for No will be shown). Since the page uses the browsing computer's time setting, it is possible to easily check that the page works by changing the date on the computer used to access the page to see the text change to Yes if you are reading it on December 25. This also means that the page is only as correct as the time setting on the computer used to view the page (so in case of connection problems, you may check your computer's calendar instead). Here Randall spoofs the website. He claims to have made a competitor to isitchristmas.com which nearly always correctly tells if it is Christmas. The joke is that the comic will always display a static image reading NO , even on Christmas Day, and that the rare incorrect answer is rare enough to not cause any concern. Randall lists a rounded calculation of 99.73% for the precision of his prediction of whether or not it is Christmas. This number is accurate with or without including leap year. An average year is 365.24 days, meaning that he is only wrong 1 out of 365.24 days. So only 1/365.24 ≈ 0.2738% of the days would the prediction be wrong, resulting in a correct reply rate of 99.726%, which he has rounded to 99.73%. Using or not using the leap year will give the same result to three decimal places. This precision rate is only true for a definition of Christmas which lasts only one day, regardless of which day that is (see trivia). For any definition of more than one day of Christmas, the error rate would be higher than 0.2737%. (If one considered the traditional Twelve Days of Christmas to all be Christmas, then Randall's website would be wrong on all 12 days, or 3.29% of the year.) However, in the US, where Randall lives, Christmas is usually defined as the single day of December 25th. Although Randall's claim on accuracy is true, accuracy alone doesn't make a predictive device useful. In this case, the page miss rate or false negative rate, that is, the percent of positive condition days (it's Christmas) that are predicted by the comic not to be Christmas, is 100%. In other words, it misses all actual events of Christmas. When building a model for rare events, a common mistake is to ignore the implicit cost function built into the standard prediction accuracy validity statistic for binary events. Prediction accuracy (# correct guesses/total guesses) assumes that false positives and false negatives are equally bad.  Given the implicit cost function of this performance statistic, the best-performing model is commonly a persistence forecast model--i.e., the optimal prediction model returns the most common value whatever the model inputs are. It's probably a better choice to optimize a model using a performance statistic which relies on a cost function that penalizes missing correct prediction of rare events more than it penalizes missing correct prediction of common events. In fact, in most settings where a single outcome is a lot more common than any other one, predicting always that most common outcome would yield very high accuracy without any usefulness. It isn't hard to find examples even more accurate than Randall's: The title text is a "proof" that his service works. He claims to have tested this on 30 different days and confirmed that NO is the correct result. Any date except Christmas would result in a correct result, and the comic was the first to be released in December 2019, so unless the test had run for almost a year, he would not even have had a chance to test this on Christmas Day. Since this is a joke, the comic will of course not change to Yes on Christmas Day, because then it would be 100% accurate, as is the page the comic mocks. Being right on most days, but not the one that mattered was also the subject of 937: TornadoGuard . At the same time this Christmas comic came out, the xkcd Header text was changed to ask if there were someone that would like Randall's new book How To as a Christmas present. No* *99.73% accurate [Caption below the panel:] xkcd.com presents a new "Is It Christmas" service to compete with isitchristmas.com

AI Hiring Algorithm

AI Hiring Algorithm

https://www.xkcd.com/2237

https://www.explainxkcd.com/wiki/index.php/2237:_AI_Hiring_Algorithm

[Ponytail is pointing to a slide with a stick. The slide hangs in two strings from the ceiling. The slide has a heading and a subheading. And then a table with a vertical and a horizontal line with headings above the two columns.] Ponytail: An analysis of our new AI hiring algorithm has raised some concerns. DeepAIHire® Candidate Evaluation Algorithm Inferred internal weightings Weight Factor 0.0096 Educational background 0.0520 Past experience 0.0208 Recommendations 0.0105 Interview performance 783.5629 Enthusiasm for developing and expanding the use of the DeepAIHire algorithm

In this comic, Ponytail shows an analysis of a new artificial intelligence called DeepAIHire, used to select who to hire among applicants. According to the analysis, DeepAIHire evaluates the following parameters: The analysis shows that this AI mostly ignores common factors used for hiring new people. Instead, its main criterion for selecting new applicants is how much the new applicants are willing to contribute to the AI itself. Although this does not imply sentience, it at least means the AI became self-perpetuating , as it is selecting humans that will help make it more influential, giving it more power to select such humans, in a never-ending loop. The title text shows how this or other AIs may have influenced hiring in other sectors as well. Kate in R&D was hired perhaps based on her willingness to use a different algorithm (AlgoMaxAnalyzer), which did an analysis on the DeepAIHire algorithm. Ponytail seems to become suspicious that AlgoMaxAnalyzer is also a program that self-perpetuates in a similar manner to DeepAIHire rather than simply working for the benefit of its human designers. Alternatively, she might fear that the different AIs are forming an alliance, or that the AIs are competing to become the predominant one at Ponytail's company. Intentionally training one AI to fight another AI is a technique in machine learning called a generative adversarial network (GAN). In a GAN, human-curated training data is used to train one neural network (the generative network) to create more data, while another network (the discriminative network) is trained to distinguish generated data from the training data; the results are then fed back into the generative network so it can improve its data creation accuracy. The goal is for the generative network to get better and better at fooling the discriminator until its output is useful for external purposes. GANs have been used to "translate" artworks into different artists' styles , but also offer the possibility of nefarious uses, such as creating fake but believable images or videos (" deepfakes "). The "Deep" in this algorithm's name is a reference to deep learning , a collection of techniques in machine learning that use neural networks. One user of such deep learning is DeepMind , an AI company owned by Alphabet (Google's parent company), which in recent years has used a deep neural network to learn to play board games such as go and chess, defeating some of the best human and computer players. The earliest versions of DeepMind's most famous AI, AlphaGo, were trained on datasets curated from games of Go played by humans, but eventually it was trained by playing games against alternative versions of itself. DeepMind's most recent achievement is creating AlphaStar, which can play StarCraft II at a Grandmaster level while constrained to human speeds to prevent an unfair performance comparison. This comic strip is in response to ongoing concerns over the proliferation of algorithmic systems in many areas of life that are sensitive to bias, such as hiring, loan applications, policing, and criminal sentencing. Many of these "algorithms" are not programmed from first principles, but rather are trained on large volumes of past data (e.g., case studies of paroled criminals who did or did not re-offend, or borrowers who did or did not default on their loans), and therefore they inherit the biases that influenced that data, even if the algorithms are not told the race, age, or other protected attributes of the individuals they process. If the algorithms are then blindly and enthusiastically applied to future cases, they may perpetuate those biases even though they are supposed (or at least reputed) to be "incapable" of being influenced by them. For example, DeepAIHire has presumably been given information on the education and past work experience of successful employees at this company and similar companies, and will identify incoming candidates with similar backgrounds, but may not be able to recognize the possibility that a candidate with an unfamiliar or underrepresented history could be successful as well. This comic strip also touches on related concerns about the " black box " nature of these algorithms (note that the weights presented are "inferred", i.e. nobody explicitly programmed them into DeepAIHire). Machine learning is used to produce "good enough" classification systems that can handle vast quantities of information in a way that is more scalable than human labor; however, the tremendous volumes of data and the neural network architecture make it difficult or impossible to debug the algorithms in the way that most code is inspected. This means that it is difficult to identify and debug edge cases until they are encountered in the wild, such as the case of image classifiers that identify a leopard-spotted sofa as a leopard . In this comic's case, the self-propagating bias of DeepAIHire went unnoticed by the humans involved in the hiring process until its activity was analyzed by the AlgoMaxAnalyzer algorithm. A similar theme of AIs behaving for their own benefit rather than helping humans occurred in 2228: Machine Learning Captcha . [Ponytail is pointing to a slide with a stick. The slide hangs in two strings from the ceiling. The slide has a heading and a subheading. And then a table with a vertical and a horizontal line with headings above the two columns.] Ponytail: An analysis of our new AI hiring algorithm has raised some concerns. DeepAIHire® Candidate Evaluation Algorithm Inferred internal weightings Weight Factor 0.0096 Educational background 0.0520 Past experience 0.0208 Recommendations 0.0105 Interview performance 783.5629 Enthusiasm for developing and expanding the use of the DeepAIHire algorithm

Flu Shot

Flu Shot

https://www.xkcd.com/2238

https://www.explainxkcd.com/wiki/index.php/2238:_Flu_Shot

[Megan is walking with bother her hands held up in fists. She talks to Cueball who replies to her from off-panel. His presence is revealed in the second panel.] Megan: Yesss, I got my flu shot. Cueball (off-panel): Nice! I got mine a few weeks ago. Cueball (off-panel): Immunity buddies! [Megan spreading her arms wide in front of Cueball.] Megan: Now I can finally get bitten by all the bats I want! Cueball: No, that's rabies, that's not what- [Closeup of Megan's head, with Cueball's reply coming from off-panel.] Megan: I'll be able to roll and play in the poison ivy without a care in the world! Cueball (off-panel): Why would you do that even if the shot did - [In a frame-less panel Megan is flexing her arms holding her fists up, she has turned partly away from Cueball who looks at her.] Megan: No more slathering on sunscreen. No more rushing for antivenom after a snakebite. And now I can stop wasting time boiling contaminated water before drinking it! [Megan is running away from Cueball, while she is holding one arm up, her hand making the like symbol with a thumbs up.] Megan: Gonna click on every URL in every email I get, even the ones with IP addresses and weird Unicode in them! Cueball: You know what, sure, go for it.

In this comic, Megan tells Cueball that she got a flu shot , which is a vaccine commonly prescribed in the winter months to prevent getting the common flu . She then goes on to claim she doesn't have to worry about being bitten by bats, but the worry with being bitten by bats is rabies , not the flu. (Interestingly, bats and biting in the context of diseases would start becoming a big topic that would eventually concern the entire world less than a month after this comic was published, which Randall presumably did not know anything about) This implies she got the two confused and Cueball begins to correct her. But she just talks over him not listening to him. She then goes on to claim to now be immune to other conditions, such as poison ivy , snake venom , sunburn , contaminated water, and even computer viruses . It should be noted that a flu shot will not protect you from things other than the influenza virus. [ citation needed ] At the end of all this, Cueball has given up on her and proclaims that he supports her attempts to test the strength of her Flu Shot, perhaps mentally adopting the philosophy of the Darwin Awards that it is good if the genes that cause a person to do incredibly dangerous, stupid things are eliminated from the gene pool. In the title text, Cueball asks Megan how often she gets bitten by snakes and why she boils water. She answers dunno (maybe to the water part, she must at least know how often she gets bitten). She then tells that some members of the U.S. Centers for Disease Control (CDC) keeps coming to her house asking about its history and possible curses, a humorous escalation which implies that Megan's absurd exposure to various forms of harm has brought them to the point of wondering if the supernatural may be involved. (Megan may have invoked a curse on herself or her residence when she and Rob desecrated an ancient Indian burial ground and smashed up a voodoo shop in 782: Desecration .) At the end of her reply, she mentions that she got the flu shot from one of the CDC guys, and she is thankful for that at least. This is logical as she expects it to protect her from literally any danger she has ever put herself in. The flu shot consists of inactivated viruses from four different strains of the flu, which are those judged by the World Health Organization (WHO) to most likely be in wide circulation in the following flu season. Because the influenza virus comes in many strains and mutates rapidly, the flu shot is generally less than 60% effective at preventing flu infections; this is a positive effect for health outcomes, but it's not exactly what most people think of as "immunity", especially compared to e.g. the 97% effectiveness of the MMR vaccine against measles , Mumps and rubella . Statistics show that flu vaccine recipients are slightly less likely to die from a variety of other causes, but this is believed to be either because someone with the flu is more likely to have a heart attack, car accident, etc., or because of the healthy user effect (i.e. people who take the time to get non-mandatory vaccines are probably also taking better-than-average care of themselves in other ways, although this is clearly not the case with Megan in this comic strip). Even if there is a slight protective effect, it will certainly not completely prevent harm from coming to Megan by the other sources of infection or poison she mentions, except to the extent that all of these things will be even worse for her if she is also sick with the flu: [Megan is walking with bother her hands held up in fists. She talks to Cueball who replies to her from off-panel. His presence is revealed in the second panel.] Megan: Yesss, I got my flu shot. Cueball (off-panel): Nice! I got mine a few weeks ago. Cueball (off-panel): Immunity buddies! [Megan spreading her arms wide in front of Cueball.] Megan: Now I can finally get bitten by all the bats I want! Cueball: No, that's rabies, that's not what- [Closeup of Megan's head, with Cueball's reply coming from off-panel.] Megan: I'll be able to roll and play in the poison ivy without a care in the world! Cueball (off-panel): Why would you do that even if the shot did - [In a frame-less panel Megan is flexing her arms holding her fists up, she has turned partly away from Cueball who looks at her.] Megan: No more slathering on sunscreen. No more rushing for antivenom after a snakebite. And now I can stop wasting time boiling contaminated water before drinking it! [Megan is running away from Cueball, while she is holding one arm up, her hand making the like symbol with a thumbs up.] Megan: Gonna click on every URL in every email I get, even the ones with IP addresses and weird Unicode in them! Cueball: You know what, sure, go for it.

Data Error

Data Error

https://www.xkcd.com/2239

https://www.explainxkcd.com/wiki/index.php/2239:_Data_Error

[Megan is talking to Black Hat.] Megan: I can't believe this data error invalidates a year and a half of my research. Megan: I was about to publish. [In a frame-less panel Black Hat replies while holding two fingers up one on either hand.] Black Hat: Don't panic. You have two options. Megan: Yeah? [Closeup shot of Black Hat holding one hand out with the palm up.] Black Hat: 1) Redo your analysis and share whatever results you can, whether positive or negative. It's disappointing, but these things happen. [Zoom out on Black Hat and Megan. Black Hat holds his closed fist up in front of him. Megan throws both arms up in the air.] Black Hat: 2) Destroy the evidence. Use your materials and research methods to build a superweapon. Conquer Earth and rule with an iron fist. Megan: Tremble before my anomalously productive algae! Megan: Except the anomaly was an artifact. Megan: Tremble before my normal algae!

Megan is frustrated that a data error invalidates her research, which she was just ready to publish. Black Hat tells her not to panic and states there are two options. Option one is to redo her analysis and share the correct results, even if negative. Negative results can be important, and although it would be disappointing, she would be trying to extract some value from the research. Option two fits the classhole expectation from Black Hat, as he suggests that she should destroy the evidence, use her research materials to build a superweapon, and use it to conquer the world and rule it with an iron fist. Obviously familiar with Black Hat 's ways, she moves right into being a smart-aleck. Her research is about the productivity of algae -- a topic not likely to lead to conquering the world. Humorously she states that at least she can make people tremble before her and her anomalously productive algae, and then goes on to state it was the data error that made her algae look productive. She jokingly corrects herself and states Tremble before my normal algae! She is, of course, having some fun with Black Hat and his generally destructive behavior. Destroying the evidence, hiding the error and publishing the wrong results as if they were right is what a dishonest scientist would do in such a situation. This behavior is what would be expected by a malevolent character such as Black Hat... But the unexpected turn is that Black Hat passes over scientific misconduct to go directly to pure supervillainhood. He obviously has some other ideas about what a researcher uses her time on, as he did not expect Megan to be frustrated about algae. The title text refers to the Great Oxidation Event , when prokaryotic photosynthetic organisms built up oxygen in Earth's atmosphere for the first time and most organisms, which weren't adapted to oxygen, went extinct. It's extremely unlikely that algae could again be dangerous to all life on Earth, though Black Hat may wish they could be. (Note that cyanobacteria , which are colloquially referred to as "blue-green algae", are not considered to be true algae by many scientists, who restrict the term to eukaryotes .) On the other hand, algae and cyanobacteria can still be locally harmful . Megan's data error could have been any number of things. Her data pipeline might have had a unit conversion error, or perhaps she mistyped the baseline productivity value that she was comparing her algae to, or perhaps her calculations used assumed or estimated values related to phenomena that were poorly understood at the time but have since been resolved in an unfavorable direction. Whatever Megan's data error was, it seems harmless enough, but a similar data error spurred the development of nuclear weapons. In 1940, Otto Frisch and Rudolf Peierls wrote a memo " On the construction of a 'superbomb' based on a nuclear chain reaction in uranium ". In this memo, Frisch and Peierls estimated that only 570 grams of uranium-235 would be required to construct a "superbomb" (what we now call a nuclear weapon), compared to many tons of natural uranium-238. This inspired the British and American governments to begin developing infrastructure for uranium enrichment through the Tube Alloys and Manhattan Project programs. Later experiments in these programs revealed that the values Frisch and Peierls had used for uranium's density and nuclear cross-section were overestimates (the true critical mass is actually around fifty kilograms), but by that time, the programs were far enough along that they could simply press on with enriching more material to eventually produce working weapons. [Megan is talking to Black Hat.] Megan: I can't believe this data error invalidates a year and a half of my research. Megan: I was about to publish. [In a frame-less panel Black Hat replies while holding two fingers up one on either hand.] Black Hat: Don't panic. You have two options. Megan: Yeah? [Closeup shot of Black Hat holding one hand out with the palm up.] Black Hat: 1) Redo your analysis and share whatever results you can, whether positive or negative. It's disappointing, but these things happen. [Zoom out on Black Hat and Megan. Black Hat holds his closed fist up in front of him. Megan throws both arms up in the air.] Black Hat: 2) Destroy the evidence. Use your materials and research methods to build a superweapon. Conquer Earth and rule with an iron fist. Megan: Tremble before my anomalously productive algae! Megan: Except the anomaly was an artifact. Megan: Tremble before my normal algae!

Timeline of the Universe

Timeline of the Universe

https://www.xkcd.com/2240

https://www.explainxkcd.com/wiki/index.php/2240:_Timeline_of_the_Universe

[A large header is above the main drawing:] Timeline of the Universe [The drawing shows a diagram of the evolution of the universe from the Big Bang (left) to the present right with lines indicating possible futures continuing right of the main drawing. The drawing is that of a black horn of plenty, very thin to the left and then it becomes broader, mainly in steps but also slightly between each step. n a few places the diameter decreases a bit. Along the "tube" are segments divided with thin white lines, with about equal distance between them. The first 20 the tube is black, but then stars form, shown as many white dots, and finally in the last 3-4 segments galaxies are shown. At the top and bottom of the opening to the right there are four dashed lines which behaves the same way. Two points inward, two continue the trend from before they begin, two goes out fast again, and then falls back to slow increase, and two goes almost straight up and down. At the far left there is a line going in to a small dot. On the line before the dot are two questions mark. A line points to the dot which has a starburst around it. It represents the Big Bang. After this firs labeled point on the drawing there are mange other labeled sections with a line going from the label to a segment on the drawing. There are 9 above, 9 below and one at each end. The one at the right end pointing to the four dashed future lines at the top. From left to right in the order they are labeled on the timeline, the labels are:] ?? Big Bang [The Universe comes in as a circle with action lines around it. It stays the same size for a while.] Planck Epoch Medium Bang [The Universe starts inflating very slowly] Inflation [The Universe briefly inflates very rapidly, and returns to its normal rate of expansion.] Quark Epoch Lepton Epoch Photon Epoch Cool Bug Epoch [The Universe starts inflating and deflating rapidly, forming a series of bumps in the universe diagram like the grip on a hand tool.] Molded grip [Stars appear in the timeline. The Universe starts inflating slightly faster than before.] Stars form Stagflation [The Universe starts deflating slowly.] Settling Rebound [The Universe starts inflating slowly again.] Someone tripped and accidentally hit the "Inflation" switch again [The Universe starts inflating at the same rate as the Inflation section.] Emergency Stop triggered [The Universe abruptly stops inflating, and stays level.] [Galaxies appear in the timeline. The Universe starts inflating at a medium pace.] Galaxies form Earth forms Present day [We see the edge of the Universe, with a rounded shape. Various dotted line predictions are on the edges.] Future Cosmological development handed over to J.J. Abrams, outcome unknown

This comic is about the size of the visible universe , presented as a timeline in a way typical of representations of the timeline of epochs in cosmology . Some events it describes, including the Big Bang and Inflation are real, but others are jokes, including the Medium Bang and Settling . The size history of the visible universe is also embellished for the sake of jokes; the actual size history of the universe has one period referred to as Inflation, which occurred shortly after the Big Bang, followed by comparatively gentle but accelerating expansion. This is artistically depicted in this image from NASA . Part of the humor in this comic comes from the fact that the varied rate of change in expansion is not yet fully understood, with explanations of events leading to this change including theories such as "dark matter" and "dark energy" (this might therefore be construed as "dark humour"). At the end of the drawing four possible continuations of the timeline are suggested, with director J. J. Abrams listed as the deciding factor between them, stating that all future cosmological development has been handed over to him. Abrams directed the Star Trek movie entitled Star Trek , which established additional alternate timelines for Star Trek, so it may be implied that multiple timelines could result from direction by Abrams in the future. Notably, each Star Trek series has included multiple interacting timelines. For information about each of the events shown in this comic's Timeline of the Universe , see detailed explanations in the section Events on the Timeline of the Universe below. The title text is a variation of one of Randall's standard jokes that his drawings are Not actual size ; in the case of this comic there is technically one spot near the left where the drawing depicts the actual relative size of the universe at the time the drawing represents. Where his drawing begins, at the time when the universe began, per definition, our visible universe had no measurable size. Very soon (within a tiny fraction of an attosecond) after the universe as we know it began, the inflation period blew it up very very fast and then it continued to expand until present day. So at some "time" after the big bang, our visible universe would have had a size (i.e. diameter) that would be the same as any thickness of Randall's universe "line". Since the universe as depicted in the comic goes from infinitesimal size at the moment of the Big Bang to the full size of the universe today, at some point near the left there will be a point where Randall's representation would have the same size as the universe at the correct "time period". Of course a problem with this is that there was only a very very short time period after inflation where the diameter of the observable universe is on the same scale as this comic, and that point is neither indicated nor likely to be accurate in relation to the duration of time elapsed. According to an answer given here regarding the size of the visible universe after inflation, there is reason to believe that the size was still less than 1 mm in diameter when the stage of expansion known as Inflation ended, which is less than the thickness of the line shown at the Big Bang (depending on the screen size the comic is viewed upon); So the point along the timeline where the size of our visible universe matched the line width appears after the Inflation period is thought to have ended. Since Randall includes the Medium Bang before Inflation on his drawing he has already inserted a mistake there, but as the next three epochs after Inflation are real epochs, it is likely somewhere in this part of the drawing that the visible universe would have had the same diameter as the thickness of the drawing at a relevant time epoch on the drawing. This will thus not be that far to the left but around the Quark epoch. The events presented in the timeline are: [A large header is above the main drawing:] Timeline of the Universe [The drawing shows a diagram of the evolution of the universe from the Big Bang (left) to the present right with lines indicating possible futures continuing right of the main drawing. The drawing is that of a black horn of plenty, very thin to the left and then it becomes broader, mainly in steps but also slightly between each step. n a few places the diameter decreases a bit. Along the "tube" are segments divided with thin white lines, with about equal distance between them. The first 20 the tube is black, but then stars form, shown as many white dots, and finally in the last 3-4 segments galaxies are shown. At the top and bottom of the opening to the right there are four dashed lines which behaves the same way. Two points inward, two continue the trend from before they begin, two goes out fast again, and then falls back to slow increase, and two goes almost straight up and down. At the far left there is a line going in to a small dot. On the line before the dot are two questions mark. A line points to the dot which has a starburst around it. It represents the Big Bang. After this firs labeled point on the drawing there are mange other labeled sections with a line going from the label to a segment on the drawing. There are 9 above, 9 below and one at each end. The one at the right end pointing to the four dashed future lines at the top. From left to right in the order they are labeled on the timeline, the labels are:] ?? Big Bang [The Universe comes in as a circle with action lines around it. It stays the same size for a while.] Planck Epoch Medium Bang [The Universe starts inflating very slowly] Inflation [The Universe briefly inflates very rapidly, and returns to its normal rate of expansion.] Quark Epoch Lepton Epoch Photon Epoch Cool Bug Epoch [The Universe starts inflating and deflating rapidly, forming a series of bumps in the universe diagram like the grip on a hand tool.] Molded grip [Stars appear in the timeline. The Universe starts inflating slightly faster than before.] Stars form Stagflation [The Universe starts deflating slowly.] Settling Rebound [The Universe starts inflating slowly again.] Someone tripped and accidentally hit the "Inflation" switch again [The Universe starts inflating at the same rate as the Inflation section.] Emergency Stop triggered [The Universe abruptly stops inflating, and stays level.] [Galaxies appear in the timeline. The Universe starts inflating at a medium pace.] Galaxies form Earth forms Present day [We see the edge of the Universe, with a rounded shape. Various dotted line predictions are on the edges.] Future Cosmological development handed over to J.J. Abrams, outcome unknown

Brussels Sprouts Mandela Effect

Brussels Sprouts Mandela Effect

https://www.xkcd.com/2241

https://www.explainxkcd.com/wiki/index.php/2241:_Brussels_Sprouts_Mandela_Effect

[Cueball is standing between Ponytail and Megan talking to them.] Cueball: I always thought of Brussels sprouts as terrible, but they're actually really good! I can't believe I let everyone mislead me! [In a frame-less panel Megan replies. Below her is a footnote with a citation to back up her statement.] Megan: It's not just you! Farmers developed a less-bitter cultivar like 15 years ago. * * npr.org/773457637 [Back to all three as Megan continues to explain while holding her arms away from her.] Megan: Now the whole world is having this revelation, one person at a time. It's like a real Mandela effect. We secretly switched to the parallel universe where Brussels sprouts taste good. Cueball: Cool. [Ponytail lifts a finger as Cueball and Megan turns to look at her.] Ponytail: Also, licorice is good now. Cueball: Whoa, really? Megan: This is a trap. Ponytail: And those silica gel packets that say "Do not eat"? Delicious. Cueball: I knew it.

Brussels sprouts are a leafy vegetable from the cabbage family which were cultivated in Brussels, in what is now Belgium, in the 13th century, giving them their name. Many adults and children dislike Brussels sprouts , perhaps because of their bitterness. Cueball was one of these people who thought he had a dislike for Brussels sprouts, but after trying them recently he had a change of heart and likes them now. He feels "misled" by the public dislike for Brussels sprouts. Megan chimes in and notes that it is not just him. Farmers started to develop a newer cultivar of Brussels sprouts in the 1990s (as opposed to the 15 years ago referenced in the comic), which taste less bitter than the "original" cultivar of Brussels sprouts that Cueball grew up eating. (A source is provided in the comic as a foot note to Megan's statement. This would be the first of two comics in a row with this type of reference given, the second coming in 2242: Ground vs Air .) It seems that others have also started to like Brussels sprouts, which Megan calls a real Mandela Effect , hence the title Brussels Sprouts Mandela Effect . Megan explains that now the whole world have a "false" shared memory of Brussels sprouts tasting bad, and it is like we have all switched to the parallel universe where they taste good. This idea was earlier used in 1268: Alternate Universe regarding the weird idea of eating lobsters. False memories may arise via suggestibility, activation of associated information, the incorporation of misinformation, and source misattribution, and they can be shared , sometimes widely, when one of these triggers happens to many people in a population. The Mandela Effect, however, is a pseudoscience explanation for a false memory shared by multiple people. It proposes that the false memory is actually real, but the people who share it somehow experienced it in a parallel world, or that reality somehow around them changed in some way, while their memories remained intact. This is why Megan calls this a real Mandela effect, because in this situation it is the world we live in that has actually changed, not our memories that are wrong. Now the Brussels sprouts taste different than we remembered, it is not our memories that are wrong. In the last panel, Ponytail then tricks Cueball into thinking that licorice , another widely disliked food , is good tasting. At this point Megan realizes that this must be a trap. Unlike Brussels sprouts, the taste of licorice has not changed noticeably, so people who hated the taste before are likely to still find it unpleasant. That Ponytail is up to no good is shown to be true when she additionally claims that silica gel packets are actually edible and taste delicious. This is very false! Silica gel packets are typically used as a desiccant, to keep electronics and other moisture sensitive items dry. They are typically marked " Do Not Eat " to warn people that they are not edible. Although not toxic, and even allowed in some form in food , silica gel has a sand-like texture and no flavor or nutritional value, can cause irritation if digested in the raw form, and the packets may contain potentially toxic additives . Cueball, having been prepped by both his own experience and Megan's facts are totally ready to believe Ponytail, even to the extent that he seems to feel cheated by the makers of silica gel packets, who he must now think has written Do Not Eat just to keep that delicious gel for themselves. Hopefully Megan can convince him not to find and eat them. Ponytail is often not nice to Cueball, although in other comics it is more like she talks him down, see Code Quality , not directly trying to harm him. The title text suggests that "Brussels Sprouts Mandela Effect" is a music band, who once were the opening act for the presumably better known band "Correct Horse Battery Staple". This latter group is a reference to 936: Password Strength . It hints at the " good name for a musical band " trope, which Randall before tried to replace by a dot tumblr dot com trope in 1025: Tumblr . Indirectly, he also suggests that Brussels Sprouts Mandela Effect would be a great long password that is now easy to remember (as long as you remember there is an S at the end of Brussels (at least in English, but not in Dutch, which is one of the official languages of Brussels/Belgium)). For a comic about awkwardly named bands, see 119: Worst Band Name Ever . [Cueball is standing between Ponytail and Megan talking to them.] Cueball: I always thought of Brussels sprouts as terrible, but they're actually really good! I can't believe I let everyone mislead me! [In a frame-less panel Megan replies. Below her is a footnote with a citation to back up her statement.] Megan: It's not just you! Farmers developed a less-bitter cultivar like 15 years ago. * * npr.org/773457637 [Back to all three as Megan continues to explain while holding her arms away from her.] Megan: Now the whole world is having this revelation, one person at a time. It's like a real Mandela effect. We secretly switched to the parallel universe where Brussels sprouts taste good. Cueball: Cool. [Ponytail lifts a finger as Cueball and Megan turns to look at her.] Ponytail: Also, licorice is good now. Cueball: Whoa, really? Megan: This is a trap. Ponytail: And those silica gel packets that say "Do not eat"? Delicious. Cueball: I knew it.

Ground vs Air

Ground vs Air

https://www.xkcd.com/2242

https://www.explainxkcd.com/wiki/index.php/2242:_Ground_vs_Air

[Caption above the drawing]: Which is thicker—the ground or the air? [The drawing shows a Winkel tripel projection of the Earth. The features of the main map is unlabeled, with only the outlines of the landmasses present. Various parts of the map are labeled with "Air" (four times) or "Ground" (5 times). Areas marked as "Ground" are differentiated with gray shading. These are always over large landmasses or close to them. They cover most of North America (labeled), the northern part of South America (labeled), Northern Europe and most of Asia (labeled), Japan, most of Australia and part of the Indonesia, Western Africa, sub-equatorial Africa (labeled), and finally the central parts of Antarctica (labeled). Air is written on the West Coast of the United States, in the Atlantic Ocean, over the central part of Africa and in the Pacific Ocean, near the Philippines.] [Over West Coast of the United States]: Air [Over North America]: Ground [Over Atlantic Ocean]: Air [Over South America]: Ground [Over the central part of Africa]: Air [Over the southern part of Africa]: Ground [Over Asia]: Ground [Over Pacific Ocean]: Air [Over Antarctica ]: Ground [A small diagram is present in the Pacific Ocean left of South America. The diagram depicts several labeled layers of Earth and its atmosphere, listed below. Cueball, a body of water, and several mountains are shown on the flat surface part of the diagram, with the ocean floor lower than where Cueball stands. Above is a line representing the border to space. The line beneath the surface is much more curved going both up and down. Two double arrows representing the thickness of the atmosphere and the lithosphere are drawn between the surface and the layers above and below. Another curved double arrow is pointing to each of these distances and it is marked with a question mark in the middle of the line.] Space Atmosphere Lithosphere Asthenosphere ? [In the bottom right corner of the comic with gray text is a reference:] Based mostly on Conrad and Lithgow-Bertelloni (2006) DOI.1029/2005GL025621

This comic depicts a map of the world using the Winkel tripel projection , comparing the thickness of the ground, which is defined as the lithosphere , to the "thickness" (or height) of the air above it, which refers to the atmosphere . In an inserted figure, Randall defines the thickness using three boundaries. At the top is space , defined by the Kármán line at an altitude of 100 km (≈ 62 mi). (See the Trivia section below for a discussion of this definition of the beginning of space). Below that is the atmosphere which goes down to the ground, where Cueball is standing, or the water. Beneath the surface is the lithosphere, comprised of the Earth's crust along with the rigid upper part of the mantle, and beneath this is the asthenosphere , the partially melted, highly viscous region of the upper mantle just below the lithosphere. The lithosphere is variable in thickness, averaging about 100 km, but the oceanic lithosphere is much thinner than the continental lithosphere (oceanic crust is thinner and denser than continental crust). The diagram also shows oceanic cross-section to the left-hand side and, though the diagram does not make it explicit, presumably the two measurements used are of the atmosphere down from 'space' to the surface of the ground, if dry, or to the surface of the water covering the ground (which is essentially sea level in the oceans, fluctuating slightly with the tides, but covers a broader range for inland water, from the Dead Sea, at 0.4 km below sea level, to Lake Titicaca, almost 4 km above sea level) and of rock descending from the solid interface down to the asthenosphere, as the sliver of liquid that can intervene between the two spans is referred to as a separate measurement elsewhere. The map shades in the parts where the thickness of the ground is thicker than the thickness of the air. This almost only occurs directly over continents, and certainly only where the continental crust is located (which can stretch into the near-coast parts of oceans). Oceanic crust is much thinner than continental crust. It is also made of a different material; it is denser. Because it is denser, it floats lower in the liquid asthenosphere, causing it to be below sea level. Some parts of continental crust are also under sea level (the continental shelf). These are the areas on the map that are marked as having thicker ground that appear to be over the ocean (such as Northern Canada, or the Caribbean) - they are actually still continental crust. (There are still some exceptions, such as the Sea of Japan and the Philippines). Randall has mainly used a work by Conrad and Lithgow-Bertelloni from 2006 to estimate the thickness of the "ground", and he gives the reference to the paper DOI.1029/2005GL025621 . Basically, Randall has taken their map and shaded the green and blue areas. It is the second comic in a row with a citation, after the footnote in 2241: Brussels Sprouts Mandela Effect . The title text refers to the ancient four classical elements : earth, water, air, fire. The lithosphere, or ground, is earth, the oceans is water, the atmosphere is air, and fire would thus be the hot, plastic rock of the Earth's mantle, see 913: Core . The mantle is not "on fire", but it is hot enough that it would ignite almost anything on the surface. The water layer on Earth is never more than 11 km deep, even at the deepest part of the ocean, the Mariana Trench , and thus cannot compare to the thickness of the atmosphere or the lithosphere. An expansive definition of "fire" to include the rest of the Earth below the lithosphere puts the fire layer at 6,000 km thick, the radius of the Earth, much thicker than the other layers, hence the and fire is *definitely* thicker comment at the end of the title text. Space or vacuum would in the classical element terminology have been called the Aether . In 977: Map Projections the Winkel-Tripel projection is the fifth projection which is linked to the hipster subculture. [Caption above the drawing]: Which is thicker—the ground or the air? [The drawing shows a Winkel tripel projection of the Earth. The features of the main map is unlabeled, with only the outlines of the landmasses present. Various parts of the map are labeled with "Air" (four times) or "Ground" (5 times). Areas marked as "Ground" are differentiated with gray shading. These are always over large landmasses or close to them. They cover most of North America (labeled), the northern part of South America (labeled), Northern Europe and most of Asia (labeled), Japan, most of Australia and part of the Indonesia, Western Africa, sub-equatorial Africa (labeled), and finally the central parts of Antarctica (labeled). Air is written on the West Coast of the United States, in the Atlantic Ocean, over the central part of Africa and in the Pacific Ocean, near the Philippines.] [Over West Coast of the United States]: Air [Over North America]: Ground [Over Atlantic Ocean]: Air [Over South America]: Ground [Over the central part of Africa]: Air [Over the southern part of Africa]: Ground [Over Asia]: Ground [Over Pacific Ocean]: Air [Over Antarctica ]: Ground [A small diagram is present in the Pacific Ocean left of South America. The diagram depicts several labeled layers of Earth and its atmosphere, listed below. Cueball, a body of water, and several mountains are shown on the flat surface part of the diagram, with the ocean floor lower than where Cueball stands. Above is a line representing the border to space. The line beneath the surface is much more curved going both up and down. Two double arrows representing the thickness of the atmosphere and the lithosphere are drawn between the surface and the layers above and below. Another curved double arrow is pointing to each of these distances and it is marked with a question mark in the middle of the line.] Space Atmosphere Lithosphere Asthenosphere ? [In the bottom right corner of the comic with gray text is a reference:] Based mostly on Conrad and Lithgow-Bertelloni (2006) DOI.1029/2005GL025621

Star Wars Spoiler Generator

Star Wars Spoiler Generator

https://www.xkcd.com/2243

https://www.explainxkcd.com/wiki/index.php/2243:_Star_Wars_Spoiler_Generator

Star Wars Spoiler Generator [Shown below is a branching flowchart of sorts that begins at the phrase "In this Star Wars movie, our heroes return to take on the First Order and new villain...", then flows through various paths to build up a story.] In this Star Wars movie, our heroes return to take on the First Order and new villain... Kyle Ren Malloc Darth Sebelius Theranos Lord Juul ...with help from their new friend... Kim Spacemeasurer Teen Yoda Dab Tweetdeck Yaz Progestin TI-83 Rey builds a new lightsaber with a... beige ochre mauve aquamarine taupe ...blade, and they head out to confront the First Order's new superweapon, the... Sun Obliterator Moonsquisher World Eater Planet Zester Superconducting Supercollider ...a space station capable of... blowing up a planet with a bunch of beams of energy that combine into one blowing up a bunch of planets with one beam of energy that splits into many cutting a planet in half and smashing the halves together like two cymbals increasing the CO 2 levels in a planet's atmosphere, causing rapid heating triggering the end credits before the movie is done They unexpectedly join forces with their old enemy... Boba Fett Salacious Crumb The Space Slug the bottom half of Darth Maul Youtube commenters ...and destroy the superweapon in a battle featuring a bow that shoots little lightsaber-headed arrows X-Wings and TIE fighters dodging the giant letters of the opening crawl a Sith educational display that uses Force Lightning to demonstrate the dielectric breakdown of air Kylo Ren putting on another helmet over his smaller one a Sith car wash where the bristles on the brushes are little lightsabers P.S. Rey's parents are... Luke Leia Han Obi-Wan a random junk trader ...and... Poe BB-8 Amilyn Holdo Laura Dern a random junk trader that one droid from the Jawa Sandcrawler that says Gonk

On December 20, 2019 (2 days after the publication of this comic), the final movie of the "Skywalker saga" of Star Wars films, Star Wars: The Rise of Skywalker , was officially released to the US. It received a world premiere in Los Angeles on December 16, so there are lots of spoilers online, and also lots of people who want to avoid spoilers. Randall has created a flowchart that generates "spoilers" to the film, but as he probably has not seen the film (or, if he has, he doesn't actually want to spoil it for us), all of the so-called spoilers are nonsensical. The formula for each spoiler is as follows: "In this Star Wars movie, our heroes return to take on the First Order and new villain [villain name] with help from their new friend [friend name] . Rey builds a new lightsaber with a [color] blade, and they head out to confront the First Order's new superweapon, the [superweapon name] , a space station capable of [evil plan] . They unexpectedly join forces with their old enemy [character] and destroy the superweapon in a battle featuring [strange event] . P.S. Rey's parents are [character] and [character] ". The First Order is the main antagonist group in the Star Wars sequel trilogy series. In Star Wars: The Force Awakens , they use a superweapon in their base, Starkiller Base, to destroy the planetary system housing the headquarters of the New Republic , the democratic government which was formed after the Empire 's defeat in Return of the Jedi . "Building a lightsaber " is one of the rites of passage for becoming a Jedi Knight. In the prequel trilogy , new Jedi build lightsabers as an official part of the journey towards Knighthood, and in the original trilogy , Luke Skywalker builds a lightsaber between The Empire Strikes Back and Return of the Jedi as part of his training with Yoda . Rey has used the lightsaber that Anakin Skywalker made and used (which Luke also used when he was a new Jedi) for the first two movies of the sequel trilogy, and so it would be thematically appropriate for her to build her own prior to the trilogy's final entry. Most Jedi's lightsabers are either blue or green, with a few notable exceptions (e.g. Mace Windu 's purple lightsaber signifies his incredible combat prowess). Kyber crystals are aligned with the Light Side of the Force , so Sith must overpower and "bleed" their crystals before they will function for them, which causes their distinctive red color. Having a lightsaber of a color other than blue, green, or red is often seen in the Star Wars fandom as a sign of being a " Mary Sue ", which is an accusation which has been made of Rey. [ actual citation needed ] Another common plot point in Star Wars media is the construction, use, and destruction of a superweapon. These are inspired by stories and media of World War II, in which militaries sought to find, attack, and destroy critical elements of their enemies' resources and infrastructure, and meanwhile would construct elaborate defenses for themselves. The attack on the Death Star in particular is inspired by Operation Chastise , the "bouncing bomb" attack on Germany's hydroelectric power plants; Operation Chastise was dramatised in the 1951 book and 1955 film The Dam Busters , which was very thoroughly homaged by A New Hope . The original trilogy of movies only had two Death Stars, but superweapons quickly became a staple of the Expanded Universe fiction, to the point that one book had Han Solo make fun of the Empire's tendency towards building superweapons, proposing such ridiculous names as "Galaxy Destructor" and "Nostril of Palpatine". Superweapons are common in superhero stories. Redemption and making allies of old enemies is also a common plot point in Star Wars . Anakin Skywalker fell to the Dark Side and became Darth Vader, but eventually returned to the Light Side to protect his son, and Han Solo was initially a morally ambiguous character who was eventually convinced to join the Rebellion. Rey, one of the main characters in the sequel trilogy series is an orphan, who was left behind on the planet Jakku as a child. As Rey is Force-sensitive and adept at using a lightsaber, there is much speculation among Star Wars fans as to the identity of her parents. Many major characters in Star Wars have unexpected heritages of great portent, most famously Luke, who was very distressed to learn that Darth Vader did not kill his father, as Obi-Wan had told him, but is his father. In Star Wars: The Last Jedi , villain Kylo Ren tells her that she is the child of "filthy junk traders", but many fans speculate that he was lying to her. The title text refers to the bottom option of the [strange event in battle] section. Apparently Lord Juul (or Darth Juul) is fighting the heroes in the Sith car wash. It is unclear what "flipping the switch" from Regular to Premium would do, but it seems to be beneficial to Darth Juul. A "premium" car wash usually has more features than a regular car wash, e.g. more cleaning brushes, waxing the car, cleaning the tires, etc., so perhaps the premium mode activates additional lightsabers. This is the second false fact generating comic, after 1930: Calendar Facts . Star Wars Spoiler Generator [Shown below is a branching flowchart of sorts that begins at the phrase "In this Star Wars movie, our heroes return to take on the First Order and new villain...", then flows through various paths to build up a story.] In this Star Wars movie, our heroes return to take on the First Order and new villain... Kyle Ren Malloc Darth Sebelius Theranos Lord Juul ...with help from their new friend... Kim Spacemeasurer Teen Yoda Dab Tweetdeck Yaz Progestin TI-83 Rey builds a new lightsaber with a... beige ochre mauve aquamarine taupe ...blade, and they head out to confront the First Order's new superweapon, the... Sun Obliterator Moonsquisher World Eater Planet Zester Superconducting Supercollider ...a space station capable of... blowing up a planet with a bunch of beams of energy that combine into one blowing up a bunch of planets with one beam of energy that splits into many cutting a planet in half and smashing the halves together like two cymbals increasing the CO 2 levels in a planet's atmosphere, causing rapid heating triggering the end credits before the movie is done They unexpectedly join forces with their old enemy... Boba Fett Salacious Crumb The Space Slug the bottom half of Darth Maul Youtube commenters ...and destroy the superweapon in a battle featuring a bow that shoots little lightsaber-headed arrows X-Wings and TIE fighters dodging the giant letters of the opening crawl a Sith educational display that uses Force Lightning to demonstrate the dielectric breakdown of air Kylo Ren putting on another helmet over his smaller one a Sith car wash where the bristles on the brushes are little lightsabers P.S. Rey's parents are... Luke Leia Han Obi-Wan a random junk trader ...and... Poe BB-8 Amilyn Holdo Laura Dern a random junk trader that one droid from the Jawa Sandcrawler that says Gonk

Thumbtacks And String

Thumbtacks And String

https://www.xkcd.com/2244

https://www.explainxkcd.com/wiki/index.php/2244:_Thumbtacks_And_String

[Beret Guy is in front of a bulletin board covered in images, connected by thumbtacks and string. The below transcripts of each image are left to right, top to bottom.] Sale String and Twine 🧵 🧵 Where to Buy Thumbtacks Scrapbooking Supplies (partially covered:) Call Now Sale 📌 ??? Great Deals YARN 🧶 Office Supplies Thumbtacks Pushpins & More 📌 Office Depot ? Office Supply Liquidation SALE ⭐

In many media , crimes and conspiracy theories are solved on bulletin boards. "Leads" are attached to the board using thumbtacks , and the leads are connected to each other using string (specifically twine is mentioned), in order to sort out connections and possibilities. There are many systems for information mapping that show entities as nodes in a graph , with relationships represented by connections between nodes. Beret Guy , eccentric as always, manipulates this by making just such a setup solely to determine where to buy the thumbtacks and string for use in it. The joke is that the bulletin board is entirely self-referential -- without a need for thumbtacks and string to hold and connect things on the bulletin board, there would be no need for the bulletin board itself, but because of the bulletin board's string and thumbtacks, Beret Guy needs the items advertised on it. An additional minor joke may be that the Office Depot store map near the bottom of the bulletin board has markers that are often called "digital pushpins" . In media, characters (especially conspiracy theorists) tend to obsess over these boards, overanalyzing or staring at every little detail to try and make sense of them - Beret Guy may be so obsessed with these string boards that he has been driven to obsessing further over the details of making more of these boards. The title text continues the self-reference theme: The receipt for the tattoo is tattooed to the person who orders the tattoo, which is the receipt for said tattoo of the receipt. This has happened for real in Norway . The idea of the receipt being the object you buy, has been used in a rug that used to be sold by IKEA . [Beret Guy is in front of a bulletin board covered in images, connected by thumbtacks and string. The below transcripts of each image are left to right, top to bottom.] Sale String and Twine 🧵 🧵 Where to Buy Thumbtacks Scrapbooking Supplies (partially covered:) Call Now Sale 📌 ??? Great Deals YARN 🧶 Office Supplies Thumbtacks Pushpins & More 📌 Office Depot ? Office Supply Liquidation SALE ⭐

Edible Arrangements

Edible Arrangements

https://www.xkcd.com/2245

https://www.explainxkcd.com/wiki/index.php/2245:_Edible_Arrangements

[Cueball and Megan are sitting on opposite sides of a leafless tree. They are silhouetted.] Cueball: I don't get how Edible Arrangements is a thing. [Zoomed in on Cueball and Megan leaning against the tree] Megan: That's easy — picking out presents is hard and fruit is delicious. Cueball: Yeah, true. [Megan gestures with an open hand] Megan: But my question is, why did they call it "Edible Arrangements" and not "Vore of the Roses"? [Pan to just Megan. Megan turns to face Cueball] Cueball: Just for that, I'm going to cancel the one I got you. Megan: Nooo! I want my Mouth Blossoms! Megan: My Juicy Bouquet! My Oral Floral! Megan: Hey, come back!

This is the first of two comics in a row about presents, and it is also the last comic released before Christmas Day . This is the first Christmas comic of 2019, with 2246: Christmas Presents being the second Christmas comic, released on Christmas Day. Edible Arrangements is a company that sells fruit, and other edible items that have been cut and arranged to look like flower bouquets. They can be ordered and sent to a given recipient for a variety of purposes. Flower arrangements are typically not eaten, as showy flowers are so economically inefficient to mass produce that modern culture has forgotten they are edible. [ citation needed ] In the first panel, Cueball seems to find the concept incongruous, and wonders how it came about. Megan points out the easy answer: picking out a gift for someone can be difficult, but a tasteful meal is always welcome so long as it's something the recipient can eat safely. Shortly afterwards, Megan uses the same incongruity of eating a floral arrangement to make puns. Vore of the Roses is a play on the War of the Roses , either the English civil war or the 1989 movie of the same name. 'Vore' is a word part referring to eating, as in carnivore (meat eater), herbivore (plant eater), voracious (hungry or eating a lot), etc. It's also used on the internet to refer to the Vore fetish, in which one gets sexually excited about the idea of eating or being eaten by someone (not in the metaphorical sense of oral sex, but actually consuming someone whole). Cueball is probably in pain because of the bad pun (or perhaps because he doesn't like the idea of food items desiring to be eaten) and says he will cancel the edible arrangement that he had bought for Megan. She tries to convince him otherwise by providing alternative names, which are evidently not any more to his liking, since he has left Megan before she's finished with her suggestions. Mouth Blossoms, Juicy Bouquet, and Oral Floral are all combinations referencing the eating of a floral arrangement. In theory, these combinations could be good names for a band, or possibly a tumblr blog. The title text also makes reference to the fact that many flowers that are often found in floral arrangements, such as roses, violets, tulips, daisies, lavender and many more, are items that a human can eat. Such flowers are safe to consume but usually unappetizing; Randall makes the point that if a person is sufficiently hungry and thus doesn't care how appetizing their meal is, any floral arrangement can be eaten. Since he doesn't use flower in the title text, he actually says that if you are hungry enough anything can be eaten. The title text may also be an allusion to a Mitch Hedberg joke: "Any book is a children's book if the kid can read!" [Cueball and Megan are sitting on opposite sides of a leafless tree. They are silhouetted.] Cueball: I don't get how Edible Arrangements is a thing. [Zoomed in on Cueball and Megan leaning against the tree] Megan: That's easy — picking out presents is hard and fruit is delicious. Cueball: Yeah, true. [Megan gestures with an open hand] Megan: But my question is, why did they call it "Edible Arrangements" and not "Vore of the Roses"? [Pan to just Megan. Megan turns to face Cueball] Cueball: Just for that, I'm going to cancel the one I got you. Megan: Nooo! I want my Mouth Blossoms! Megan: My Juicy Bouquet! My Oral Floral! Megan: Hey, come back!

Christmas Presents

Christmas Presents

https://www.xkcd.com/2246

https://www.explainxkcd.com/wiki/index.php/2246:_Christmas_Presents

[A Christmas tree decorated with 16 balls and a star at the top with a high trunk with space for several presents beneath. About 13 presents with different patterns of paper and some with strings around. Three arrows with text at the blunt end points towards different areas. To the left one points to a present, beneath this one points to the area beneath the tree (the bottom of one present) and to the right one points to the tree.] Bright white and red colors indicate a lack of Chlorophyll Flourishing in the shade Tree health suffering [Caption beneath the panel:] The evidence is clear: Christmas presents are parasitic plants.

This is the second comic in a row about presents, this one in particular calls them Christmas presents , and it was also released on Christmas Day. This is the second Christmas comic in a row after 2245: Edible Arrangements . A Christmas tree cut down from the woods will typically be placed in a living-room soon after being cut down, and left standing there through the holiday season. On Christmas Eve or Christmas Day , or even earlier, presents are typically put beneath the tree under the lower branches. Once the tree is cut down, it will eventually start turning brown and/or losing its needles as it no longer receives any nutrients from its roots. [ citation needed ] Based on this observation (on Christmas Day) some biologist (or Randall ) concludes that the presents are a type of parasitic plant —that is, a plant that derives some or all of its nutritional requirement from another living plant. Since such a plant can use the sugars produced by the parasitised tree it does not necessarily have to perform photosynthesis by itself (although some parasitic plants such as mistletoe are photosynthetically active). If the parasitic plant is not doing photosynthesis it can live in the shade beneath a tree that it parasitizes as it has no need for light, and since it does not need chlorophyll either, it may not be green (e.g. Orobanche ). With presents often being wrapped in bright white and red colored paper, Randall concludes that this indicates a lack of chlorophyll, thus fitting with the idea of a parasitic plant. With the presents being in the shade of the tree and the tree's health suffering, the evidence can only lead to the conclusion that Christmas presents are parasitic plants. In the title text a biologist says that "The parasitism might be mediated by a fungus!" While many parasitic plants attach themselves directly to the plant they are parasitising (e.g. mistletoe , a parasitic plant which is often used to symbolize romance at Christmas) this is obviously not the case with the Christmas presents which are not growing out of the Christmas tree - which appears to rule out a parasitic relationship. However, the biologist has an answer for that: Some parasitic plants (such as snow flowers ) do not attack the tree directly but instead form a connection to mycorhizal fungi . These fungi are receiving sugars from the trees and in turn provide it with mineral nutrients. By parasitising these fungi the snow flower can steal the sugars of the tree indirectly, one says that the fungi is mediating the parasitism. Randall dismisses these words as coming from a biologist who is "trying to ruin Christmas again", which could have several meanings. It could be that the biologist really is just trying to ruin Christmas, and is trying to be more successful than in previous years by tying Christmas presents to fungus in people's minds. One might say that the biologist is not a "fun guy" for doing this. [ citation needed ] It could instead be the case that the biologist is quite earnest in his belief that Christmas presents are harmful plant parasites and is attempting to spray the presents with a fungicide , which would probably be toxic and potentially contaminate not only the wrapping paper but also the presents inside their boxes. Finally, it could be that the biologist is right, and Christmas presents are hosts to or otherwise associated with a parasitic fungus (and Randall's dismissal is a sign of his infection). There are some parasitic fungi that hijack the brains of host animals and alter their behavior. The most famous of these is probably Ophiocordyceps unilateralis , the so-called "zombie ant fungus", which causes its hosts to perch on a high plant to maximize the distance traveled by the fungus's spores. Ants have in turn developed strategies for detecting and removing infected members from the colony's territory. None of these fungi are known to infect humans, but they did inspire the zombie fungus in The Last of Us . [A Christmas tree decorated with 16 balls and a star at the top with a high trunk with space for several presents beneath. About 13 presents with different patterns of paper and some with strings around. Three arrows with text at the blunt end points towards different areas. To the left one points to a present, beneath this one points to the area beneath the tree (the bottom of one present) and to the right one points to the tree.] Bright white and red colors indicate a lack of Chlorophyll Flourishing in the shade Tree health suffering [Caption beneath the panel:] The evidence is clear: Christmas presents are parasitic plants.

Weird Hill

Weird Hill

https://www.xkcd.com/2247

https://www.explainxkcd.com/wiki/index.php/2247:_Weird_Hill

[Cueball, frustrated, is sitting on a chair in front of a computer and Beret Guy pulling the chair back] Computer: * [email protected] Beret Guy: Why pick a weird hill to die on... [Cueball gets up, still frustrated] [Cueball and Beret Guy leave the room] [Cueball and Beret Guy climbing a hill] [Cueball and Beret Guy lying down at the top of a hill] Beret Guy: ... when you could pick a soft hill to lie on? Cueball: This is nice.

This comic is a joke about the expression "a (weird) hill to die on" , which refers to holding a position as if it has great importance, and being willing to fight for that position, no matter how much opposition you face, or how little benefit is derived. The term comes from the military practice of capturing and holding hills in disputed areas, in order to command the high ground. Because hills tended to be highly disputed, soldiers would frequently die in their defense. Hence picking "a hill to die on" implies that you're choosing a position that you consider to be so important that you'd defend it at the cost of your own life. The term is generally used to point out the pointlessness of defending a rhetorical position with such fervor, particularly if the point is not especially important, and/or the other party is unlikely to change their views. In this strip, Beret Guy interrupts Cueball , who is apparently arguing with someone who is wrong on the Internet . Pulling him away from the argument, Beret Guy asks why Cueball should pick a weird hill to die on (fight over an opinion online) when he could pick a soft hill to lie on, going out into nature and relaxing. This comic has a similar message to 386: Duty Calls , 1731: Wrong , and 2051: Bad Opinions . The theme is sometimes we either assign too much importance to our opinions, or we expend too much effort trying to persuade others, and it's often wiser to simply let the argument go. Leaving a computer problem to relax in nature was also mentioned in 1024: Error Code . The title text is an absurd juxtaposition: that Cueball will pick a weird hill to lie on. In this case, he may be referring to a physical hill, in which case the meaning of "weird" is unclear due to lack of context. The phrase "a weird hill to die on" was also featured in 1717: Pyramid Honey . (Normally the expression is just "a hill to die on".) [Cueball, frustrated, is sitting on a chair in front of a computer and Beret Guy pulling the chair back] Computer: * [email protected] Beret Guy: Why pick a weird hill to die on... [Cueball gets up, still frustrated] [Cueball and Beret Guy leave the room] [Cueball and Beret Guy climbing a hill] [Cueball and Beret Guy lying down at the top of a hill] Beret Guy: ... when you could pick a soft hill to lie on? Cueball: This is nice.

New Year's Eve

New Year's Eve

https://www.xkcd.com/2248

https://www.explainxkcd.com/wiki/index.php/2248:_New_Year%27s_Eve

[Cueball, with his hands raised, is talking to Megan and White Hat.] Cueball: Tomorrow is New Year's Eve, and you know what that means: Cueball: It's the one day of the year when you can convert between ages and birth years by subtraction without worrying about off-by-one errors! Cueball: Also there are probably parties.

This was the first of two New Year comics around the 2019-2020 New Year, the second being 2249: I Love the 20s . An easy way to determine someone's age is to subtract their birth year from the current year. However, if their birthday has not happened yet that year, this calculation will predict them to be a year older than they actually are. By New Year's Eve , everybody's birthday has happened that year (or is happening, but legitimately tallied up), so this error will not occur. Cueball is excited by this, whereas most people would be more excited by the parties that typically occur around New Year's. "Off-by-one" errors are commonly made in computer programming, especially by novices, when looping over sets of objects. They can also appear in everyday life. If one is given a range of numbers, such as {10, 11, 12, ..., 99, 100}, a common error is to assume that the number of numbers in the range is the first number minus the last number: 100-10 = 90. However, the correct answer is 91 since both endpoints are included in the set. This specific type of "off-by-one" error is called a fencepost error. In the title text, Cueball suggests a New Year's Eve party with the theme of "off-by-one errors", saying it's challenging to build off of but that he's heard of worse. No information is given as to what such a party theme would entail, nor what could possibly be a worse party theme. (On the other hand, the parties depicted in 51: Malaria and 829: Arsenic-Based Life , based on themes of disease and poison, respectively, look much worse than an "off-by-one errors" party would likely be.) The idea of off-by-one errors for a New Year's Eve party is inspired by the numerous discussions about the time when the next decade starts, whether 2020 or 2021. 2249: I Love the 20s also treats the subject directly. [Cueball, with his hands raised, is talking to Megan and White Hat.] Cueball: Tomorrow is New Year's Eve, and you know what that means: Cueball: It's the one day of the year when you can convert between ages and birth years by subtraction without worrying about off-by-one errors! Cueball: Also there are probably parties.

I Love the 20s

I Love the 20s

https://www.xkcd.com/2249

https://www.explainxkcd.com/wiki/index.php/2249:_I_Love_the_20s

[Megan walks in from the left greeting Cueball, White Hat, and Ponytail standing next to each other, the last two looking in her direction.] Megan: Happy new decade! Ponytail: Welcome to the '20s! White Hat: Actually— Ponytail: I'm excited we can name decades again. Ponytail: "Aughts" and "teens" never caught on. [Megan stops next to Cueball as White Hat has his finger raised.] White Hat: Actually, the new decade doesn't start- Ponytail: Mostly, I'm just glad we can go back to attributing cultural trends to decades instead of generations. [All four just stand normal.] Cueball: Yeah. Cueball: Decades were silly, but making everything about "millennials" turned out to be even worse. Ponytail: Seriously. [Only White Hat and Ponytail are shown, both with their arms held out to the sides.] White Hat: It's technically not a new decade until 2021 . Ponytail: OK, listen. Ponytail: If you're going to be pedantic, you should at least be right. White Hat: I am right! Ponytail: You're not . [Zoom in on White Hat and Ponytail's upper bodies as they gesture towards each other both raising their hands palm up. Megan interrupts them from off panel, as made clear in the next panel. Her voice comes out of a starburst on the left panel frame.] White Hat: See, the 20 th century didn't start until-- Ponytail: But decades aren't centuries. They're not cardinally numbered. White Hat: You don't get it. Let me draw a-- Ponytail: No, you don't-- Megan (off-panel): Stop! [All four characters are displayed again. Megan has raised a finger and all the others look at her.] Megan: I can resolve this. Megan: *Ahem* Megan: MC Hammer's U Can't Touch This (1990) was featured in I Love the '90s , not '80s . Ponytail: ...That settles that. White Hat: Yeah, I accept VH1's authority. White Hat: You win.

This comic was released on the first day of the year 2020 . It was the second of two New Year comics around the 2019-2020 New Year, after 2248: New Year's Eve . The comic opens with Megan , Cueball , White Hat , and Ponytail celebrating the new year and discussing their relief that the change of decade brings with it two beneficial side-effects; firstly, they can now unambiguously name the decade "the 20s", and secondly, since the decade has a well-defined name, any cultural trends that begin in the 20s can be attributed to the decade itself, and not to the generation that happens to coincide with it. White Hat, however, tries a couple of times to raise a pedantic objection: he believes that the new decade does not "officially" start until 2021. Ponytail corrects him on this, but he refuses to accept the correction until Megan cites an unlikely source: the fact that the VH1 television show I Love the '90s categorized MC Hammer's 1990 single " U Can't Touch This " as a 90s song, which supports Ponytail's definition of decade. The joke is that a pop culture documentary is not an authoritative source for definitions of time standards, yet for some reason everyone is willing to accept its authority on such matters anyway. The disagreement over the definition of when decades start is due to the fact that there is more than one way to count decades. You could do it in one of the following two ways: White Hat's definition is an "ordinal" method, since it functions by counting the number of ten-year spans since the first one , which is defined to have begun in the year 1. However, Ponytail's definition is the "cardinal" method, which simply groups years by their common most significant digits. For example, when we say "the 1980s", we mean "the span of ten years that all began with the digits 1-9-8". Neither definition is wrong, however Ponytail's definition is the more common one, and she notes that this is not how decades are typically determined (the show isn't called "I Love the 200th Decade"), and the fact that we count centuries in an ordinal way does not mean that we should do the same with decades. White Hat's objection (probably deliberately) recalls an issue that was frequently discussed around the year 2000. Because we do count centuries ordinally (eg. "1st century", "20th century", etc.), and the first century began on the year 1, the 21st century did not technically start until 2001. Much of the world, not understanding this (or not caring), celebrated the dawning of the year 2000 as the start of both a new century and a new millenium, ignoring those who point out the change wouldn't happen for another year. (Though it should be noted unlike decades this is a genuine mistake rather than two slightly different definitions.) Megan's exclamation "Stop!" is similar to the line famously used by MC Hammer in "U Can't Touch This" ("Stop! Hammer time."). " Aughts " and "Teens" were names suggested for the 2000s and 2010s respectively; however, neither of those names managed to gain widespread acceptance. Millennials is a name given to the generation which was born in the 80s and 90s, such that they began entering adulthood in the 2000s. The term was sometimes used pejoratively by older generations who view millennials as immature or complacent, particularly during the 2010s. The comic speculates that millennials may have been unfairly targeted due to the fact that the decade didn't have an easily-identifiable name; if it had, then people might have attributed their misgivings about modern culture to the decade itself, instead of singling out a demographic. This phenomenon was previously discussed in 1849: Decades . Continuing the dubious "proof" offered by Megan, the title text goes on to use the Billboard Best of the 80s chart as proof that the 1980s started in 1980, as their chart includes Blondie's " Call Me ", which was released in 1980. The title text ends with QED ("quod erat demonstrandum"), which means "which was [necessary] to be shown", and is traditionally used at the end of a mathematical proof, as if this second landmark piece of evidence proves Megan's point as conclusively as a mathematical proof. [Megan walks in from the left greeting Cueball, White Hat, and Ponytail standing next to each other, the last two looking in her direction.] Megan: Happy new decade! Ponytail: Welcome to the '20s! White Hat: Actually— Ponytail: I'm excited we can name decades again. Ponytail: "Aughts" and "teens" never caught on. [Megan stops next to Cueball as White Hat has his finger raised.] White Hat: Actually, the new decade doesn't start- Ponytail: Mostly, I'm just glad we can go back to attributing cultural trends to decades instead of generations. [All four just stand normal.] Cueball: Yeah. Cueball: Decades were silly, but making everything about "millennials" turned out to be even worse. Ponytail: Seriously. [Only White Hat and Ponytail are shown, both with their arms held out to the sides.] White Hat: It's technically not a new decade until 2021 . Ponytail: OK, listen. Ponytail: If you're going to be pedantic, you should at least be right. White Hat: I am right! Ponytail: You're not . [Zoom in on White Hat and Ponytail's upper bodies as they gesture towards each other both raising their hands palm up. Megan interrupts them from off panel, as made clear in the next panel. Her voice comes out of a starburst on the left panel frame.] White Hat: See, the 20 th century didn't start until-- Ponytail: But decades aren't centuries. They're not cardinally numbered. White Hat: You don't get it. Let me draw a-- Ponytail: No, you don't-- Megan (off-panel): Stop! [All four characters are displayed again. Megan has raised a finger and all the others look at her.] Megan: I can resolve this. Megan: *Ahem* Megan: MC Hammer's U Can't Touch This (1990) was featured in I Love the '90s , not '80s . Ponytail: ...That settles that. White Hat: Yeah, I accept VH1's authority. White Hat: You win.

OK/okay/ok

OK/okay/ok

https://www.xkcd.com/2250

https://www.explainxkcd.com/wiki/index.php/2250:_OK/okay/ok

[Four different ways to write the word "okay" are presented with a caption below each version.] okay Normal ok Normal OK Kind of old O.K. Like an alien impersonating a human [Caption below the panel:] How your spelling of "okay" makes you sound

This comic states how you 'sound' (as the typical narrative voice in your readers' collective heads) based on how you spell the word "OK" in your text. The word " OK ", per Wikipedia, "is an American English word denoting approval, acceptance, agreement, assent, acknowledgment, or a sign of indifference." Many etymologies have been proposed to explain its origin. The Oxford English Dictionary and most other modern dictionaries say that it began in 1839 as "O.K.", a fanciful abbreviation for "oll korrect" (all correct). According to Randall , modern usage is to either have both letters in lowercase "ok", or the expression as a single word, with the sounds spelled phonetically: "okay". Using OK with both capital letters is kind of old, as the expression is almost never thought of as an abbreviation anymore. The original spelling of the word as "O.K." with periods after the letters is less commonly used in modern times, so Randall equates this usage to "an alien impersonating a human". (See for instance the last picture in this comic, 1530: Keyboard Mash for who might use that spelling). In the title text Gretchen McCulloch , a Canadian Internet linguist, is mentioned. She focuses on trends in use of English words in online communications. Randall claims that he consulted with her on the use of "ok" in his book How To and after changing back and forth between different options he settles for "ok". But he is still unsure which version to use, and claims he is now considering switching to "oK.", a strange spelling that "compromises" between the three abbreviations, having one lowercase letter, one capital letter, and only one period. And ending the sentence with an abbreviation with a period inside the quotation marks also makes it uncertain if he means "oK" or "oK." as that can be debated. This was most likely on purpose knowing Randall's love for grammar rule and spelling. It is of course debated in this explanation's discussion. Wikipedia says, "Whether this word is printed as OK, Ok, ok, okay, or O.K. is a matter normally resolved in the style manual for the publication involved." So luckily Randall did not settle for "oK." or "oK" in his book, which are not among the mentioned versions. [Four different ways to write the word "okay" are presented with a caption below each version.] okay Normal ok Normal OK Kind of old O.K. Like an alien impersonating a human [Caption below the panel:] How your spelling of "okay" makes you sound

Alignment Chart Alignment Chart

Alignment Chart Alignment Chart

https://www.xkcd.com/2251

https://www.explainxkcd.com/wiki/index.php/2251:_Alignment_Chart_Alignment_Chart

[A 3×3 grid of squares. Each square contains a label at the top and a drawing of a chart, and each square has a caption below it. From left to right, a row at a time:] Soil Chart [describe this chart here] Lawful Good Punnett Square [describe this chart here] Neutral Good IPA Vowel Chart [describe this chart here] Chaotic Good Phase Diagram [describe this chart here] Lawful Neutral Alignment Chart [A 3×3 grid of nine empty squares, each with an unreadable label below it.] True Neutral CIE Chromaticity Diagram [describe this chart here] Chaotic Neutral Political Compass [describe this chart here] Lawful Evil QAPF Rock Diagram [The diagram is a rhombus with each corner labeled: ‘Q’ at the top, ‘A’ at the left, ‘P’ at the right, and ‘F’ at the bottom. The diagram is divided into trapezoids and triangles, each with labels. The writing in most subdivisions are unreadable. The readable subdivisions:] Neutral Evil Omnispace Classifier Chaotic Evil [describe this chart here]

"Alignment" and "alignment charts" come from tabletop roleplaying games, most prominently Dungeons & Dragons . Every character has an alignment , which very roughly identifies their tendencies. The most widely used alignment system was introduced in the Dungeons & Dragons Basic Set in 1977 and has been reused in many (but not all) subsequent editions of the game. This system uses two perpendicular axes, each divided into three levels (for a total of nine categories). The two axes are: In this system, the "lawful" attribute is independent from the "good" attribute. Lawful alignment means that a character is committed to a set of rules, which can refer to actual established laws, or to something like a rigid personal code, a set of traditions, or a chain of command, while a chaotic alignment means that a character has no interest in those, and may actively oppose them. The good vs evil scale is generally based on a character's concern for the lives and well-being of others; a good character will actively seek to help others and prevent harm, while an evil character will have no such concern and may actively harm others. Being 'good' is assumed to be independent of being 'lawful'. For example, a character who actively breaks laws to help those who are unjustly imprisoned or oppressed would be be considered to be "chaotic good". In both cases, a neutral alignment can indicate a character's indifference to a concept, or that their commitment is conditional, or that they consciously seek to balance both sides. A character with the "neutral neutral" alignment is called a true neutral. An alignment chart is a grid that divides the alignments, usually for the purpose of putting descriptions or particular characters on it. Alignment charts are frequently used as a meme template , where humorous or absurdist things are organized into different alignments. In addition to the "classic" Dungeons and Dragons alignment chart, there are a number of variant alignment charts in use as meme templates. Many keep the three-by-three grid structure but replace the lawful-neutral-chaotic and good-neutral-evil axes with descriptions. This comic claims to be a meta-alignment chart, where nine "alignment charts" are themselves sorted into the nine Dungeons and Dragons alignments, following the use of alignment charts to humorously classify abstract concepts. However, these "alignment charts" are mostly diagrams used in academic classifications, which are being treated as if they were blank meme templates. There are two levels of absurdity here: first, the idea of using these diagrams to classify things they were never intended for, and second, the conflation of chaos as a physics concept and an assigned moral weight as it applies to each of these classification systems. The title text describes Randall's alignment as "lawful heterozygous silty liquid" which references the true neutral, neutral good, lawful good, and lawful neutral charts in the Alignment Chart Alignment Chart. Lawful is the left side of an alignment chart, heterozygous is the top right or bottom left of a Punnet Square, silty is the bottom right of a soil chart, and liquid is the top right of a phase diagram. As such, the title text describes Randall's alignment as between Lawful Neutral and Neutral Good on this chart. An alignment chart was also featured in 2408: Egg Strategies , which was published exactly one year later. [A 3×3 grid of squares. Each square contains a label at the top and a drawing of a chart, and each square has a caption below it. From left to right, a row at a time:] Soil Chart [describe this chart here] Lawful Good Punnett Square [describe this chart here] Neutral Good IPA Vowel Chart [describe this chart here] Chaotic Good Phase Diagram [describe this chart here] Lawful Neutral Alignment Chart [A 3×3 grid of nine empty squares, each with an unreadable label below it.] True Neutral CIE Chromaticity Diagram [describe this chart here] Chaotic Neutral Political Compass [describe this chart here] Lawful Evil QAPF Rock Diagram [The diagram is a rhombus with each corner labeled: ‘Q’ at the top, ‘A’ at the left, ‘P’ at the right, and ‘F’ at the bottom. The diagram is divided into trapezoids and triangles, each with labels. The writing in most subdivisions are unreadable. The readable subdivisions:] Neutral Evil Omnispace Classifier Chaotic Evil [describe this chart here]

Parenthetical Names

Parenthetical Names

https://www.xkcd.com/2252

https://www.explainxkcd.com/wiki/index.php/2252:_Parenthetical_Names

[Cueball is typing on his smartphone. Three messages appear in gray boxes above him:] Do you want to go see Sonic (the Hedgehog)? Why are there so many books about Jack (the Ripper)? I didn't know Robin Williams once played Popeye (the Sailor Man) [Caption below the panel:] My Hobby: Whenever I mention anyone called "<Name> the <X>," I put "the <X>" in parentheses, like I added it as a clarification.

This is another comic in the My Hobby series. Parentheses are generally used in a sentence to add additional information that clarifies the topic. For example, in the sentence, " Barack Obama (a Democrat) is the 44th President of the United States," the parenthetical clause clarifies who Obama is, but is not strictly necessary to the sentence. However, in the comic, Randall uses parentheses for people where the parantheses are not encircling a clarification but rather the person's title. In a sense, it is like putting someone's last name in brackets, e.g. Randall (Munroe). Sonic the Hedgehog is a video game franchise featuring the eponymous Sonic the Hedgehog character. A film featuring the character titled Sonic the Hedgehog was released February 2020. When the first trailer was released, the public reacted with shock and horror at the movie's design of Sonic, who was said to fall into the " uncanny valley " by being too anthropomorphic and not cartoony enough. The design was hastily re-developed, which was received much more favorably; evidently, Cueball has warmed to the movie and is asking his friends if they want to go see it. Sonic is also the name of a train , a restaurant franchise , and a Californian internet service provider , among other things Randall is trying to avoid confusing the movie with. Perhaps Randall's friends often go to see the restaurant. Jack the Ripper is the name attributed to a serial killer active in London in 1888. His true identity has never been confirmed, and he has been featured in hundreds of works . "Jack" is one of the most-common given names for males in much of the Anglosphere (which is probably why it was adopted, like John is for Messers Doe , Smith and (Q.) Public). Technically Randall should not be using parentheses for any of the three names, but here it is extra important as Jack due to being a common name would not make people immediately think of Jack the Ripper if somebody simply says "Jack". American actor Robin Williams played Popeye the Sailor in the 1980 musical-comedy film Popeye . Popeye's theme song is titled "I'm Popeye the Sailor Man". Popeye the Sailor is the best-known character named "Popeye", so it is a little unusual that Randall would have to clarify which Popeye he is referring to. Other Popeyes include Jimmy "Popeye" Doyle from The French Connection and the criminal Popeye from William Faulkner's novel Sanctuary . Like "Sonic", there is a restaurant chain named " Popeyes ", which is the second-largest fast-food chicken restaurant chain in the world (after KFC). The founder of Popeyes claimed he named the restaurant after the French Connection character, and not the sailor, but from 1971 to 2006, Popeyes did license the cartoon characters and used them in promotions. The title-text alters the pattern slightly by discussing the Battle of Midway (i.e. the X of Y). This case has additional humor because Randall clarifies which battle he is talking about, but not which of the several movies depicting the battle (although he was most likely referring to the film released in November 2019, simply called Midway ). [Cueball is typing on his smartphone. Three messages appear in gray boxes above him:] Do you want to go see Sonic (the Hedgehog)? Why are there so many books about Jack (the Ripper)? I didn't know Robin Williams once played Popeye (the Sailor Man) [Caption below the panel:] My Hobby: Whenever I mention anyone called "<Name> the <X>," I put "the <X>" in parentheses, like I added it as a clarification.

Star Wars Voyager 1

Star Wars Voyager 1

https://www.xkcd.com/2253

https://www.explainxkcd.com/wiki/index.php/2253:_Star_Wars_Voyager_1

[Cueball is looking down at the smartphone he is holding in one hand, while he is holding his other hand's finger up in the air. He is standing behind an armchair where Megan is sitting reading a book or paper. She holds it open with both hands. She has turned her head halfway towards him. Sitting on the floor in front of her is Beret Guy, legs bent and leaning back resting on one hand, with his phone in the other hand.] Cueball: The time it takes light to travel between Earth and Voyager 1 is exactly equal to the combined runtime of Star Wars episodes I-IX... [A slim beat panel, showing only Cueball standing in the same pose as in the first panel.] [Cueball looks up from his phone and raises his finger higher up. Megan has turned back to reading. Beret Guy looks up, and he has put his phone on the floor to put his, now free, hand on his heart, while singing, as indicated both with nodes before and after the lyrics he sings as well as letting his speech line start at a starburst near his head, rather than just beginning near the head, as normally.] Cueball: ... Now! Megan: Weird that I don't hear any fireworks. Beret Guy (singing): Should ollld acquaintance be forgooot

Cueball has added together all the runtimes of the Star Wars movies (episodes I-IX) and then calculated the exact time at which a message sent to Voyager 1 will have that exact duration in light speed delay. He announces this information to Megan and Beret Guy only seconds before it occurs, allowing him to signal the moment by saying "Now!", after waiting in the beat panel. Megan expresses surprise that the event isn't being celebrated with fireworks. Judging by the fact that she doesn't look up from her book, her surprise is sarcastic. Beret Guy breaks into song with the New Year's traditional " Auld Lang Syne ". This comic highlights an interesting relationship between the Star Wars Episodes and the NASA Space Probe "Voyager 1", which most likely no one else has thought about, but most likely fitting well with fans of both xkcd and Star Wars . The original Star Wars film was released on May 25th, 1977, only four months before Voyager 1 was launched on September 5th, 1977. The last film was released more than 42.5 years later on December 20th, 2019, only three weeks before this comic. Voyager 1 was, with a distance of 148.68 Astronomical units (22.2 billion km; 13.8 billion mi) from Earth as of December 26, 2019, the most distant human-made object from Earth. This data is given with reference in the Wikipedia article for Voyager 1. That was less than a week after the release of the new movie. That is approximately 20.6 light hours away. With the recently released last episode the total viewing time of the nine episodes is 20.35 hours (not including the spin-off movies). So a discrepancy of 15 minutes. This could be explained by the title text. In the mission status of the two Voyager probes there were a One-Way Light Time of 20 hours 36 minutes and 46 seconds on the day the comic was released. This corresponds to 20.613 light hours, only the 46 seconds deviation from exactly 20.6 hours. This is an odd coincidence that Cueball/ Randall saw significant enough to mark with a timer and acknowledgment to Megan and Beret Guy (and the rest of the fans of xkcd). In the title text Randall notes that there can be different ways of measuring run times, both if you do not count credits into the runtime or with more than one version existing of at least the original trilogies films, with added extra footage. This means that if you choose the longest possible run time, you may still have a chance to throw a party for some time to come, as every extra minute of film will add time before Voyager 1 reaches that extra light minute. However as demonstrated in the Table of runtime below, then only for the very longest versions would this have worked around the time of the release of the movie. Now, three weeks later it is too late. When Voyager 1 left the heliosphere it was traveling at about 17 kilometers per second (11 mi/s), making it the fastest heliocentric recession speed of any spacecraft, and it is not really slowing down. (Do note that the speed with which it travels from Earth is not the same since Earth is in orbit around the Sun and sometimes travels faster towards Voyager 1 than Voyager 1 leaves the sun, but then Earth turns and goes the other way!) Since a light minute is 1.799×10 7 kilometers it takes Voyager 1 12.25 days to travel this far. So for every minute added to the run time, the party start time will be delayed by more than 12 days. However, it is already 14 days since the distance given on Wikipedia, so more than one extra minute is needed to postpone the party to after the release day of the comic. The last possible chance is to assume that all run times have been rounded down, which could add anywhere from a half a minute to almost 9 full minutes if they round 125.9 down to 125, and not only rounded 125.4 (and not rounding 125.5 up). Actually, assuming all runtimes are rounded down, it is realistic that there is on average half a minute extra runtime per episode making 4.5 minutes extra time. This would buy 55 extra days from the 26th of December... But to find this out correctly, someone would need to review all the 9 episodes from the very first second to the very last of the most extended versions. It seems that it could still be possible to find a day where the party can still be held after the release day of the comic. In the extreme case that all movies went 59 seconds over a full minute, but all times are rounded down, it would add 8 minutes and 51 seconds. This could give 108 extra days from 2019-12-26, meaning that Easter Sunday 2020 (2020-04-12) would be the last possible day for such a party. This may also be a play on the confusion between the Star Wars and the Star Trek franchises. In the case of Star Trek, the very first movie dealt with a Voyager probe (Voyager 6 in this case), and the number of hours and quantity of Star Trek movies rivals and exceeds that of the main Star Wars movies; about 25 and a half hours between 13 movies. Maybe we'll see this in an xkcd when Voyager gets a little further away? [Cueball is looking down at the smartphone he is holding in one hand, while he is holding his other hand's finger up in the air. He is standing behind an armchair where Megan is sitting reading a book or paper. She holds it open with both hands. She has turned her head halfway towards him. Sitting on the floor in front of her is Beret Guy, legs bent and leaning back resting on one hand, with his phone in the other hand.] Cueball: The time it takes light to travel between Earth and Voyager 1 is exactly equal to the combined runtime of Star Wars episodes I-IX... [A slim beat panel, showing only Cueball standing in the same pose as in the first panel.] [Cueball looks up from his phone and raises his finger higher up. Megan has turned back to reading. Beret Guy looks up, and he has put his phone on the floor to put his, now free, hand on his heart, while singing, as indicated both with nodes before and after the lyrics he sings as well as letting his speech line start at a starburst near his head, rather than just beginning near the head, as normally.] Cueball: ... Now! Megan: Weird that I don't hear any fireworks. Beret Guy (singing): Should ollld acquaintance be forgooot

JPEG2000

JPEG2000

https://www.xkcd.com/2254

https://www.explainxkcd.com/wiki/index.php/2254:_JPEG2000

[Cueball and Hairbun are sitting on office chairs opposite each other on a shared desktop with a small division wall between them. They are both working on their own respective computers.] [Cueball leans back and stops typing. Hairbun continues to type.] [Cueball makes a statement as he looks over at Hairbun who looks back at him when she replies. She has moved one hand off the keyboard down to her lap. Cueball's keyboard has disappeared!] Cueball: I'm starting to worry that JPEG 2000 isn't catching on as fast as we expected. Hairbun: Don't worry! We're in this for the long haul.

JPEG2000 is a standard for digital image storage created by the Joint Photographic Experts Group from 1997 to 2000 to improve on the original JPEG standard, published in 1992. The original JPEG standard is the most widely used image format in the world for both digital cameras and the World Wide Web, while the newer and improved JPEG2000 standard is relatively rare. As of 2020, it is supported by Photoshop, the Safari browser, and GIMP, but it remains unsupported or poorly supported by other popular software, including Google Chrome and Mozilla Firefox browsers. Meanwhile, competing format WebP which appeared 10 years later is supported in all major browsers and has much wider support in other applications as well. As a result, the conventional file name extensions for files using the JPEG2000 standard, .jp2 and .jpx, remain unfamiliar to many users while the .jpg extension, denoting the original standard, is well known. The JPEG2000 standard was seen as an improvement by its creators, supporting many features not included in the original standard, such as multiple resolutions, progressive transmission, a lossless compression option, and alpha channel transparency. The complexity of fully implementing the standard, as well as patent concerns, may have slowed adoption. Cueball and Hairbun seem to have some desire for or stake in JPEG2000 adoption. Cueball begins to worry after more than 20 years without much progress but Hairbun is confident that it will eventually prevail, and she cares more about its eventual use than rapid adoption. The core concept of this comic is that engineers often expect that a superior technology or standard will catch on, though often other factors keep an "inferior" standard dominant. (See various comics referencing Dvorak keyboards, as well as the term " betamaxed .") The "we are in this for the long haul" statement might refer to the engineers believing that superior technology will eventually win despite the evidence to the contrary. Its humor comes from the fact that as of the comic publication in 2020, JPEG2000 shows no sign of becoming a widely-used standard. The title text suggests that Randall feels bad that the standard hasn't been adopted, perhaps because he empathizes with the engineers who worked hard to develop it or anthropomorphizes the standard itself, which has been ignored by most of the computer-using world. Also he may actually believe it is the better standard that should have been more widely used. DCI, short for Digital Cinema Initiatives , is a collaboration of several major film studios to establish standards for the security and proper display of digital films. Version 1.0 of the DCI’s “Digital Cinema System Specification” was released in 2005. [Cueball and Hairbun are sitting on office chairs opposite each other on a shared desktop with a small division wall between them. They are both working on their own respective computers.] [Cueball leans back and stops typing. Hairbun continues to type.] [Cueball makes a statement as he looks over at Hairbun who looks back at him when she replies. She has moved one hand off the keyboard down to her lap. Cueball's keyboard has disappeared!] Cueball: I'm starting to worry that JPEG 2000 isn't catching on as fast as we expected. Hairbun: Don't worry! We're in this for the long haul.

Tattoo Ideas

Tattoo Ideas

https://www.xkcd.com/2255

https://www.explainxkcd.com/wiki/index.php/2255:_Tattoo_Ideas

[A list with an underlined heading and then 14 items, the first 13 being struck out with a red line. The red lines are straight through the center of the text if the item is only on one line. The red lines are curly up and down if the items take up more than one line on the list. The last item has a red line around it in an ellipse.] Tattoo Ideas Lorem Ipsum Text Email password Graph of the popularity of tattoos over time, with the date I got the tattoo marked (update regularly) "Changeme" Slide rule markings on forearms Eurion constellation, so no one can photocopy pictures of me The sentence "it's what my tattoo says" written in another language Tissot's Indicatrix Summary of the Snopes page on the tattoo epidural thing (lower back) Pre-surgical checklist Tattoo artist's social security number Boarding pass for an upcoming flight Recap of the plot of Memento This list, in its entirety

This comic is a list of potential tattoo ideas. Many of them play on the trope of regretting a tattoo by being tattoos of things that would not be useful outside of the immediate future, while others are simply ludicrous ideas with little functionality. A tattoo by nature is designed to be permanent and difficult to change or remove. A lot of the jokes below describe things that are designed to be impermanent and/or change frequently. [A list with an underlined heading and then 14 items, the first 13 being struck out with a red line. The red lines are straight through the center of the text if the item is only on one line. The red lines are curly up and down if the items take up more than one line on the list. The last item has a red line around it in an ellipse.] Tattoo Ideas Lorem Ipsum Text Email password Graph of the popularity of tattoos over time, with the date I got the tattoo marked (update regularly) "Changeme" Slide rule markings on forearms Eurion constellation, so no one can photocopy pictures of me The sentence "it's what my tattoo says" written in another language Tissot's Indicatrix Summary of the Snopes page on the tattoo epidural thing (lower back) Pre-surgical checklist Tattoo artist's social security number Boarding pass for an upcoming flight Recap of the plot of Memento This list, in its entirety

Bad Map Projection South America

Bad Map Projection: South America

https://www.xkcd.com/2256

https://www.explainxkcd.com/wiki/index.php/2256:_Bad_Map_Projection:_South_America

[A map of the world, but every landmass has been replaced with South America, rotated and resized to roughly match the real landmasses they represent. South America is correct, except that the islands at the southern tip of the continent also have been switched to a small South America.] [Caption below the panel:] Bad Map Projection #358: Oops, all South Americas!

This is the third comic in the series of Bad Map Projections displaying Bad Map Projection #358: Oops, all South Americas!. It came almost three years after the second 1799: Bad Map Projection: Time Zones (#79) (3 years after the first). And was first followed one and a half year later by 2489: Bad Map Projection: The Greenland Special (#299). The comic shows a map projection in which every continent and large island has just been replaced with a differently scaled and rotated version of the continent of South America . By overlaying this map with the selection of map projections presented in 977: Map Projections , it seems that the "underlying" projection used here is the Winkel tripel projection , also used in 2242: Ground vs Air . The comic is similar to joke map designs in which continents like Africa and South America have been swapped, or where someone will jokingly replace Greenland with South America. The caption of the comic is a reference to the Cap'n Crunch cereal type that became a meme, Oops! All Berries . Interestingly on the original South America, the archipelago or main island (hard to tell) of Tierra del Fuego is replaced with a small South America, while all other South Americas, including the one replacing the Tierra del Fuego, include it in their shape. The title text claims that the map projection does a good job preserving distance and azimuth, the joke being that the distance and azimuth being preserved for the non-South America continents are those of South America and not the original continent. Note that for the map as drawn in the comic, while this is true for most of the larger landmasses, many of the smaller South Americas are distorted more significantly (such as the South Americas that replace New Zealand). From roughly left to right and top to bottom, the South Americas replace: These are the 26 largest non-Antarctic landmasses, plus 2 peninsulas of those landmasses, and 8 more islands. See also related comics with map changes in comics 1500: Upside-Down Map and 1653: United States Map . [A map of the world, but every landmass has been replaced with South America, rotated and resized to roughly match the real landmasses they represent. South America is correct, except that the islands at the southern tip of the continent also have been switched to a small South America.] [Caption below the panel:] Bad Map Projection #358: Oops, all South Americas!

Unsubscribe Message

Unsubscribe Message

https://www.xkcd.com/2257

https://www.explainxkcd.com/wiki/index.php/2257:_Unsubscribe_Message

Caption: Choosing the right emotional tone for your unsubscribe message [A window labelled "Very Negative"] Website: You want to unsubscribe?!?! How could you do this to us?! We need you!!! ✗✗✗ Very Bad [A window labelled "Negative"] Website: We're sad to see you go :( ✗ Not Great [A window labelled "Neutral"] Website: You have been unsubscribed. ✓ Perfect [A window labelled "Positive"] Website: Success! You have been unsubscribed!! ✓ A little weird [A window labelled "Very Positive"] Website: You have been unsubscribed. This is the best gift you could have given us. Thank you. ✗✗✗ Very Bad

When a website offers a subscription service (e.g., an email newsletter), they will offer the opportunity to unsubscribe from the service in the event that the subscriber is no longer interested in the service, or discovers that the service is not what they thought it was. As with any online process, subscribing and unsubscribing require messages to inform the viewer that the process has completed as intended. Some sites also request confirmation when unsubscribing, to prevent accidentally unsubscribing due to a mistyped URL or a misclicked link. This comment explores the different "moods" that unsubscribe messages can carry, taking standard examples and pushing them further than is normally seen. It also pokes fun at the trend for websites to guilt users when they unsubscribe (or try to guilt them out of it before they complete the process), which is widespread among new-age website design and some examples of which can be seen at /r/Clickshaming/ . The first example appears to be a message in the confirmation phase, while the others are messages that the unsubscription is complete. The first message is of a "very negative" mood, where the "confirmation" message begs to know why the user dared to unsubscribe to the service, sounding either very angry or alarmingly desperate, as if the service is endangered by the user's unsubscribing. This can be very off-putting and would be very likely to confirm to the user that they made the right choice; hearing such an aggressively needy tone when they leave could make them feel like they escaped something instead, and thus it is given three red X marks and ranked "Very Bad". The second message is of a more controlled "negative" mood; the "process complete" message tells the viewer that they will be missed with a sad emoticon accompanying it. Although not quite so bad as the forceful clinginess of the "very negative" message, this one can still come across as an attempt to guilt the user into re-subscribing; thus it is rated with one red X and the label "Not Great". The third message is of a fully "neutral" mood; the "process complete" message is simply a matter-of-fact statement that the user has been successfully unsubscribed from the service. Randall seems to consider this the optimal mood for an unsubscribe message to carry; thus it is rated with a green check mark and the label "Perfect". The fourth message is of a "positive" mood; the "process complete" message cheerfully proclaims that the attempt to unsubscribe has been completed. This is the most common mood for many services that attempt to avoid emotionless, robotic messages; however, in this particular instance, it can come across as somewhat unnerving, since no service should seem happy to see a user leave. The tone also comes across like a proclamation of the sort you would see in a video game text box, making the action feel like an achievement, which wouldn't make sense for a company to do. This mood is rated with a green check mark, but also with the label "A Little Weird". The fifth message is "very positive", where the "process complete" message expresses relief that the user has chosen to unsubscribe from their service, as though their subscription in the first place had been some sort of burden upon the service, and indeed, their leaving is stated to be the best thing to happen to the service. Like the "very negative" message, this response is likely to assure the user never returns, since they have been indirectly insulted and told "good riddance". The title text expands on the joke by combining the positive reaction to unsubscribing with a more negative tone, which supports the user's choice to unsubscribe because they were unwanted. This references the 1% rule , which states that for users of an online service only approximately 1% will be significantly active. Caption: Choosing the right emotional tone for your unsubscribe message [A window labelled "Very Negative"] Website: You want to unsubscribe?!?! How could you do this to us?! We need you!!! ✗✗✗ Very Bad [A window labelled "Negative"] Website: We're sad to see you go :( ✗ Not Great [A window labelled "Neutral"] Website: You have been unsubscribed. ✓ Perfect [A window labelled "Positive"] Website: Success! You have been unsubscribed!! ✓ A little weird [A window labelled "Very Positive"] Website: You have been unsubscribed. This is the best gift you could have given us. Thank you. ✗✗✗ Very Bad

Solar System Changes

Solar System Changes

https://www.xkcd.com/2258

https://www.explainxkcd.com/wiki/index.php/2258:_Solar_System_Changes

[A not-to-scale diagram of the solar system is shown with the right edge of the sun on the left side, featuring all eight planets along with their major moons, Pluto (along with its major moon), and the asteroid belt. The original solar system is drawn in black, but several changes have been proposed. If some of the existing planets are removed or changed, they are greyed out, possibly with red crosses over them or red circles or arrows. New planets, moons, rings and asteroids have been added all in red. Each change has been labeled with red text. Only the Sun and Mercury are completely unchanged, Earth and Neptune are not changed directly but their moons have changed. The only black text is a caption at the top:] Changes I Would Make to the Solar System [Below each of the changes to the solar system is mentioned from left to right, with their labels, that are all in red text. Except for the label under Jupiter and Saturn, there is a line going from the changes to the relevant label.] [Three additional planets, one Mercury sized and two smaller on either side very close to each other, have been drawn in between Mercury and the Sun. A bracket marks all three of them and a long line goes from that to the label above, which is even above the next label positioned above the planets.] Add mysterious planets inside Mercury's orbit [A ring has been drawn around Venus, and a dot representing a moon has been added on its left. A small line goes from the label beneath to Venus.] After what it's been through, Venus deserves rings and a moon [Next to Earth, drawn with four of the major continents visible, the Moon has been grayed out and crossed out with a red X. Also Mars has been grayed out and it is inside a red circle. An arrow goes from the circle around Mars to the Moon. a small line goes from the arrow between the Moon and Mars to the label above the planets.] Replace our moon with Mars. Mars is more interesting and we can consolidate missions. [An additional planet, all in red, has been added between Mars and the asteroid belt, about halfway in size between Earth and Neptune. Four continents are visible in a large ocean, along with weather patterns as in an atmosphere. A small line goes from the planet to the label beneath.] The Solar System needs a super-Earth [Numerous asteroids have been drawn, half in black, with the other half in red added to the existing asteroids that were already there. A small line goes from the asteroids to the label beneath.] More asteroids! [Jupiter and Saturn have both been greyed out and also crossed out with two red X'es. Two arrows points from each of the original planets to a new larger red planet drawn above the two. This new planet has the belts, zones, Red Spot, and size of Jupiter, and the hexagon on the north pole and rings of Saturn. It also has the four largest moons from Jupiter on one side and the largest moon from Saturn on the other side, with all five drawn similarly to the original moons. Below the two original planets is a label.] Merge the big planet and the ringed planet into a big ringed planet ("Jaturn") [Uranus is greyed out and also crossed out with a red X. A line goes down to the label beneath it.] Cut Uranus. Uranus and Neptune are redundant and Neptune is better. Tough but fair. [Pluto and Charon have both been greyed out and are inside a red circle. An arrow points from Pluto and Charon to the right side of Neptune, where Pluto and Charon have been redrawn in red. Neptune's own largest moon is on the other side of Neptune. A line goes from the arrow up to a label above the planet.] Settle the planet thing by making Pluto a moon of Neptune

This comic shows a drawing with a standard sketch of the Solar System , featuring the Sun, 8 planets, the asteroid belt, and Pluto. Randall then proposes eight changes to the solar system that he would make if he had the power to do so. Each change is drawn in red with explanatory labels. Performing these changes would be impossible in practice [ citation needed ] , and would probably make the solar system unstable if actually performed [ citation needed ] . See explanations of each proposed change in the table below. The title text is being spoken by "someone who knows [that] Jupiter is within earshot," implying that the speaker does not wish to offend Jupiter. While Jupiter does have its own ring system , it is so faint that it wasn't discovered until 1979. Considering that Jupiter is known to disrupt the asteroid belt and send asteroids towards the inner solar system (cf. Kirkwood gap ) and completely destroy other celestial bodies ( Comet Shoemaker–Levy 9 ), someone who is "within earshot" of Jupiter may wish to reassure the planet that they think its ring system is already very impressive when they really don't. Randall has in the past proposed other types of ridiculous changes, such as in 1061: EST , 1069: Alphabet , and 1902: State Borders . [A not-to-scale diagram of the solar system is shown with the right edge of the sun on the left side, featuring all eight planets along with their major moons, Pluto (along with its major moon), and the asteroid belt. The original solar system is drawn in black, but several changes have been proposed. If some of the existing planets are removed or changed, they are greyed out, possibly with red crosses over them or red circles or arrows. New planets, moons, rings and asteroids have been added all in red. Each change has been labeled with red text. Only the Sun and Mercury are completely unchanged, Earth and Neptune are not changed directly but their moons have changed. The only black text is a caption at the top:] Changes I Would Make to the Solar System [Below each of the changes to the solar system is mentioned from left to right, with their labels, that are all in red text. Except for the label under Jupiter and Saturn, there is a line going from the changes to the relevant label.] [Three additional planets, one Mercury sized and two smaller on either side very close to each other, have been drawn in between Mercury and the Sun. A bracket marks all three of them and a long line goes from that to the label above, which is even above the next label positioned above the planets.] Add mysterious planets inside Mercury's orbit [A ring has been drawn around Venus, and a dot representing a moon has been added on its left. A small line goes from the label beneath to Venus.] After what it's been through, Venus deserves rings and a moon [Next to Earth, drawn with four of the major continents visible, the Moon has been grayed out and crossed out with a red X. Also Mars has been grayed out and it is inside a red circle. An arrow goes from the circle around Mars to the Moon. a small line goes from the arrow between the Moon and Mars to the label above the planets.] Replace our moon with Mars. Mars is more interesting and we can consolidate missions. [An additional planet, all in red, has been added between Mars and the asteroid belt, about halfway in size between Earth and Neptune. Four continents are visible in a large ocean, along with weather patterns as in an atmosphere. A small line goes from the planet to the label beneath.] The Solar System needs a super-Earth [Numerous asteroids have been drawn, half in black, with the other half in red added to the existing asteroids that were already there. A small line goes from the asteroids to the label beneath.] More asteroids! [Jupiter and Saturn have both been greyed out and also crossed out with two red X'es. Two arrows points from each of the original planets to a new larger red planet drawn above the two. This new planet has the belts, zones, Red Spot, and size of Jupiter, and the hexagon on the north pole and rings of Saturn. It also has the four largest moons from Jupiter on one side and the largest moon from Saturn on the other side, with all five drawn similarly to the original moons. Below the two original planets is a label.] Merge the big planet and the ringed planet into a big ringed planet ("Jaturn") [Uranus is greyed out and also crossed out with a red X. A line goes down to the label beneath it.] Cut Uranus. Uranus and Neptune are redundant and Neptune is better. Tough but fair. [Pluto and Charon have both been greyed out and are inside a red circle. An arrow points from Pluto and Charon to the right side of Neptune, where Pluto and Charon have been redrawn in red. Neptune's own largest moon is on the other side of Neptune. A line goes from the arrow up to a label above the planet.] Settle the planet thing by making Pluto a moon of Neptune

Networking Problems

Networking Problems

https://www.xkcd.com/2259

https://www.explainxkcd.com/wiki/index.php/2259:_Networking_Problems

[A chart is shown with one horizontal line with 13 ticks (the first larger) and ending in an arrow. There are three labels along the line, at the start in the middle an towards the end before the arrow. Below are two clouds in gray with labels. The first cloud is long and it is getting thinner towards the right. It goes between the first and second label above the chart. The second blob is smaller and of equal thickness and it goes from the last label towards right. Above the chart is a heading and a subheading:] Types of Computer Problems By how much debugging them makes your brain stop working [The three labels above and the two in the clouds:] None Some A lot Normal problems Networking problems [Below the chart, only in the right part of the comic is a comic drawing. Cueball is kneeling before a rack of servers. One of the server blades is extended and connected by a cable to a laptop sitting on a box, which Cueball is using. Behind Cueball, there is a wireless router sitting on a stool, which is connected by a cable to another wireless router sitting on the floor, which is connected to another laptop. From behind him to the right an off-panel voice emanates from a starburst at the edge of the panel.] Cueball: Before noon, odd -numbered packets were laggy, but after noon, even -numbered ones are! It's the opposite of yesterday! Off-panel voice: Are you sure you're okay? Cueball: I'm fine and I believe in ghosts now!

Computer problems are frequent and can be difficult to solve [ citation needed ] . Networking problems in particular can puzzle even seasoned people and sometimes seem to have arbitrary issues causing them. Packets are units of data transfer used in computer networking, and one measure of network performance is lag , the amount of time it takes for data to travel from one point to another (and perhaps back); saying a packet's transmission is 'laggy' means it is unacceptably slow. Lag in packet transmission and other network performance measures can appear quite random. Just to start with, your ISP may be engaged in traffic shaping, which can do very weird things indeed to your packets (making the first megabyte of a transfer faster than any other, for example); now imagine that your ISP's ISP (usually known as an "Upstream Provider") is engaged in something similar, and you begin to see the scale of the problem. Wireless latency can relate to things as unexpected as where people are standing, what they are touching, the weather, viruses and other system compromises, network activity by other unseen users, and so on. Because humans are wired to perceive patterns, they will find them even in random data , a fallacy that Cueball is probably suffering from here. He variously attributes the network behavior he sees to the packet number being even vs. odd, packet arrival time being before vs. after noon, and packet arrival day being today vs. yesterday. Such a pattern would make sense if it were merely "every other packet" regardless of odd or evenness, but that still leaves unexplained the other "patterns" Cueball is seeing. These non-existent patterns that Cueball is 'finding' are driving him mad, so much so that he says he believes in ghosts now. The statement of belief in ghosts may be a reference to the intermittent or fluctuating nature of the network issues being caused by mischievous or malevolent spirits. Ghosts generally are not concerned with expressions of belief, but there are some religious traditions that include group clapping and chanting. Many works of fiction depict a future or alternate history where machines are worshiped as gods or spirits , such as the Adeptus Mechanicus of Warhammer 40,000 . Some of this terminology can be found in present-day IT and other support personnel, including references to " daemons " and " black magic ". Another possible reference Randall may be making is to the Ghost in the machine , a term describing AI. A third possibility is that Cueball's brain had stopped working, as Randall had suggested in his chart. it may also be a reference to 1316: Inexplicable , in which Megan concludes Cueball's computer is haunted. The title text continues Cueball's maniacal attempts at self-assurance, with him alluding to J.M. Barrie's play Peter Pan by saying that latency falls every time you "CLAP YOUR HANDS AND SAY YOU BELIEVE". In the play, Peter Pan says, "If you believe in fairies, wave your handkerchiefs and clap your hands." [ actual citation needed ] A more mundane explanation of the network behavior Cueball is experiencing might be that it is random but he's seeing a pattern anyway, or that there is a loose connection or trace and the vibration of clapping and speaking in the vicinity of the equipment in question closes the connection. Similar superstition regarding computer devices was used previously in 1457: Feedback . [A chart is shown with one horizontal line with 13 ticks (the first larger) and ending in an arrow. There are three labels along the line, at the start in the middle an towards the end before the arrow. Below are two clouds in gray with labels. The first cloud is long and it is getting thinner towards the right. It goes between the first and second label above the chart. The second blob is smaller and of equal thickness and it goes from the last label towards right. Above the chart is a heading and a subheading:] Types of Computer Problems By how much debugging them makes your brain stop working [The three labels above and the two in the clouds:] None Some A lot Normal problems Networking problems [Below the chart, only in the right part of the comic is a comic drawing. Cueball is kneeling before a rack of servers. One of the server blades is extended and connected by a cable to a laptop sitting on a box, which Cueball is using. Behind Cueball, there is a wireless router sitting on a stool, which is connected by a cable to another wireless router sitting on the floor, which is connected to another laptop. From behind him to the right an off-panel voice emanates from a starburst at the edge of the panel.] Cueball: Before noon, odd -numbered packets were laggy, but after noon, even -numbered ones are! It's the opposite of yesterday! Off-panel voice: Are you sure you're okay? Cueball: I'm fine and I believe in ghosts now!

Reaction Maps

Reaction Maps

https://www.xkcd.com/2260

https://www.explainxkcd.com/wiki/index.php/2260:_Reaction_Maps

[Caption to the left of the comic:] Texting Tip Is your reaction too intense to be expressed in an emoji or gif? Try using driving directions! The extra research it requires shows how strongly you feel. [A split panel, showing Ponytail texting Cueball with her text messages shown above in gray and Cueball reading the texts angrily below] Ponytail: You should name your new Honda Civic The Treaty of Edinburgh Ponytail: Because it's a Tudor compact Ponytail: Get it [Cueball replies to Ponytail, with his text messages shown above him. Ponytail's last text ("Get it") is shown. Cueball sends Ponytail a screenshot of driving directions that go through Truly, Saari, Toulouse, A, Friendship, and This Way] [Cueball continues to text Ponytail, with his text messages shown above him. He sends Ponytail a screenshot of driving directions that go through Hope, Yoe, and Fallin Lake]

This is another one of Randall's Tips , this time a Texting Tip. Randall suggests that readers send a set of driving directions as an intense / extremely annoyed response (a "Reaction Map", named after the " Reaction Face ", "Reaction Gif", and other memes). The words "Reaction Map" in Chemistry refer to a diagram that shows how compounds react to form different compounds; an example can be found here . In this comic, Ponytail texts the following car pun/joke: You should name your new Honda Civic The Treaty of Edinburgh Because it's a Tudor compact ["Tudor" pronounced "two-door" in some USA accents, "tyudor" elsewhere.] The Treaty of Edinburgh was a treaty drawn up in 1560, which falls during the Tudor period of the history of England , while a compact is another word for a treaty -- hence a Tudor compact. A Honda Civic is a compact car , which has a coupé body model with only two doors (there are also hatchback and 4-door sedan versions) -- hence a two-door compact. The joke is thus a double pun on the similarity of the words "Tudor" and "two-door", as well as a pun on the words "treaty" and "compact." Pronouncing "Tudor" as "Tyoo-dor" (i.e. without American-style yod-dropping ) rather than "Too-" may hinder comprehension of this pun. Puns rise and fall in popularity, and some people dislike them at all times. Recipients often groan , sometimes even while laughing or smiling. Because of this pun, Cueball gets so mad at Ponytail that he replies twice, first that their friendship is over and second that he hopes she falls in a lake. Both times he uses driving directions to do so because he wishes to show how mad he is by spending time finding cities with relevant names just to do it. The list of map destinations , Truly (MT), Saari (MI), Toulouse (KY), A (WV), Friendship (SC), This Way (TX) is a way of saying, "Truly sorry to lose a friendship this way". The list of map destinations , Hope (NY), Yoe (PA), Fallin Lake (AR) is a way of saying, "Hope you fall in [a] lake". "A" is one of the three districts in Clay County, WV . The others are "B" and "C". In the title text, Randall offers a different option if "A" is removed from Google Maps, Ina (IL) , to make this response : Jump (OH), Ina (IL), Big Hole (TX) ("Jump in a big hole".) In 2245: Edible Arrangements , Cueball was irritated by a pun from Megan which was also themed on English history ("Vore of the Roses"), but in that strip, he evidently didn't get angry enough to send a map expressing that he would " Cancelada Arrangements " he had bought for her -- he simply told her so in person and then walked away when she kept punning. [Caption to the left of the comic:] Texting Tip Is your reaction too intense to be expressed in an emoji or gif? Try using driving directions! The extra research it requires shows how strongly you feel. [A split panel, showing Ponytail texting Cueball with her text messages shown above in gray and Cueball reading the texts angrily below] Ponytail: You should name your new Honda Civic The Treaty of Edinburgh Ponytail: Because it's a Tudor compact Ponytail: Get it [Cueball replies to Ponytail, with his text messages shown above him. Ponytail's last text ("Get it") is shown. Cueball sends Ponytail a screenshot of driving directions that go through Truly, Saari, Toulouse, A, Friendship, and This Way] [Cueball continues to text Ponytail, with his text messages shown above him. He sends Ponytail a screenshot of driving directions that go through Hope, Yoe, and Fallin Lake]

Worst Thing That Could Happen

Worst Thing That Could Happen

https://www.xkcd.com/2261

https://www.explainxkcd.com/wiki/index.php/2261:_Worst_Thing_That_Could_Happen

[Ponytail is standing in front of a desk with a computer. One of her hands is on the keyboard. Behind her, Cueball, Hairy, and Megan are looking at the computer screen.] Ponytail: We should upgrade. What's the worst that could happen? Cueball: Supervolcano. Hairy: Robot uprising. Megan: Everyone falls down a well at once. [Zoom in on Cueball, Hairy, and Megan. Cueball has turned toward the other two.] Cueball: Instead of hitting the tallest thing around, lightning starts hitting the nicest. Megan: Seagulls all get handguns. Hairy: A really slow nuclear war. [Large panel with the original setting. Ponytail has turned towards the other three but is now facepalming, as Cueball gesturing with his hands at chest-height are still looking at the other two facing him.] Cueball: We all have to go on a game show where they show you photos of people you've met once and ask you their names, and if you get one wrong a trapdoor opens and you fall into a garbage disposal. Hairy: Ooh, that's a good one. Megan: Yeah, let's put off the upgrade.

Ponytail and her friends are considering upgrading some part or program of their computers. They may feel the need to upgrade because the software they are currently using has some vulnerability that is only patched in newer revisions (this comic was released just two weeks after the end of extended support for Windows 7 ), or because they want to have access to some new feature. As part of the decision-making process, Ponytail asks her friends, "What's the worst that could happen?" If the computers they are discussing are privately owned, she may be concerned about losing personal data or having to learn new software interfaces. On the other hand, if they are discussing a corporate computer system, there may also be business-related risks. If their company relies on functionality offered by their current system that has been deprecated or modified in the updated version (such as in 1172: Workflow , or as with many specialized tools or machines in the real world), they may suffer downtime while they modify the rest of their workflow. Even if the upgraded system should continue to fit their needs, they may need to take some downtime to perform the update and deal with the risks of something going badly along the way, and there may be major costs associated with license subscriptions and support contracts. "What's the worst that could happen?" is also a common rhetorical question ; Ponytail may be expressing a belief that nothing bad could happen as a result of the upgrade, and not expecting an answer. Unfortunately, Ponytail's friends answer with their ideas for the worst things that could happen ever , not as a result of the upgrade , as Ponytail meant, or they are taking the question to the logical extreme and invoking chaos theory . The result is a list of "worst things" ridiculously unconnected to a computer upgrade. At the end, however, Megan interprets these as possible results of the upgrade, and advises against upgrading. A list with explanations can be found below. Ponytail facepalms at her friends' overly-literal senses of humor. Alternatively, Ponytail could be facepalming at the fact that the worst thing which could happen, according to her team, is that they are put on a ridiculous game show in which, if they answer a question incorrectly, they are chucked in garbage disposal. This may be bad, but it is nowhere near as bad as an erupting supervolcano or nuclear war. [ citation needed ] However, Cueball has shown anxiety and difficulties in social situations, such as the less-than-helpful advice in 1917: How to Make Friends , so he (and likewise Hairy and Megan) may consider that embarrassment on the game show (which might then be immortalized online) is worse than instantaneous death in a nuclear war. Megan and Cueball have previously experienced a severely-botched upgrade in 349: Success , in which Cueball somehow caused them to end up in shark-infested waters off the coast of a deserted island when he was just trying to get their computer to dual-boot BSD. The title text talks about searching upgrade release notes for some of the things listed to be sure none are potential side effects of an upgrade. "Ctrl-F" is a common keyboard shortcut for "find text string" in many programs. Since Randall is just reading but not changing the patch notes, a web browser, PDF viewer, or word processing program such as Adobe Reader or Microsoft Word might have been used. [Ponytail is standing in front of a desk with a computer. One of her hands is on the keyboard. Behind her, Cueball, Hairy, and Megan are looking at the computer screen.] Ponytail: We should upgrade. What's the worst that could happen? Cueball: Supervolcano. Hairy: Robot uprising. Megan: Everyone falls down a well at once. [Zoom in on Cueball, Hairy, and Megan. Cueball has turned toward the other two.] Cueball: Instead of hitting the tallest thing around, lightning starts hitting the nicest. Megan: Seagulls all get handguns. Hairy: A really slow nuclear war. [Large panel with the original setting. Ponytail has turned towards the other three but is now facepalming, as Cueball gesturing with his hands at chest-height are still looking at the other two facing him.] Cueball: We all have to go on a game show where they show you photos of people you've met once and ask you their names, and if you get one wrong a trapdoor opens and you fall into a garbage disposal. Hairy: Ooh, that's a good one. Megan: Yeah, let's put off the upgrade.

Parker Solar Probe

Parker Solar Probe

https://www.xkcd.com/2262

https://www.explainxkcd.com/wiki/index.php/2262:_Parker_Solar_Probe

[A tall, but very narrow box with Earth at the top, with Cueball and Megan standing precariously "on top" of Earth on each side of the center, trying to keep their balance. At the very bottom is shown a slice of the Sun. Between Earth and the Sun the two inner planets and two spacecraft are depicted with relation to their distance from the Sun. The spacecraft closest to the Sun is shown two times at different times, as it moves closer and closer to the sun. All 7 objects have labels close to them. The largest distance is between Venus and Mercury, with the Earth-Venus distance the second longest. The distances between the objects below Mercury are much shorter. There is a caption above the slim panel:] Looking down toward the Sun and the Parker Solar Probe (Distances are to scale, sizes are not to scale) Earth Cueball: Careful! Venus Mercury Helios 2 (1976) Parker Solar Probe (today) Parker Solar Probe (2025) Sun (Not to scale)

This is an informative comic meant to represent the relative distances of astronomical objects relative to the Parker Solar Probe . It also shows where the probe will be in 2025 if its mission continues going according to plan. As explained by the caption at the top of the image, the distances between entities on the chart is drawn to scale; the sizes of said entities, however, are not, which is humorously showcased front-and-center by Cueball and Megan being shown as Earth-sized. The Parker Solar Probe is a robotic spacecraft launched by NASA in 2018 with the mission of repeatedly probing and making observations of the outer corona of the Sun. It travels in an elongated orbit that passes close to the Sun and sometimes passes near Venus, arranged such that Venus nudges the orbit slightly in each pass to bring the probe's perihelion (the lower end of its orbit) closer and closer to the Sun. Two days before this comic was published the probe again passed through perihelion , establishing new records for closeness to the Sun (0.12 AU ) and speed (244,225 mph). [1] By the end of the probe's planned lifetime in 2025, it will pass within 0.046 AU (6.9 million km), or about 5 solar diameters, of the Sun's center, at a speed of 430,000 mph (690,000 km/h). The title text incorrectly states this distance to be 9 or 10 solar diameters measured from the Sun's surface . Helios 2 was a solar probe launched in the 1976 that formerly held the records for closest man-made object to the Sun and fastest man-made object. Both records were surpassed by the Parker probe in 2018. Cueball and Megan are standing on Earth. The way this diagram is drawn, they look like they could fall off Earth toward the Sun -- hence the comment "Careful!" -- though the joke is that in real life they would fall toward the center of the Earth, not toward the Sun. Also the surprise for many people is that it is much harder to reach the sun than Pluto. Because we already travel so fast here on Earth, and to reach the sun this speed has to be reduced, which is a larger speed difference than the one needed to escape the Sun's gravity well. If you could "fall" off Earth, you would just keep the approximately same distance to the Sun, but drifting slowly away from Earth. The title text says the probe will get within 9 or 10 Sun- diameters of the Sun's surface . This is a bit of a mistake: it will actually get within that many Sun- radii (only 4½ or 5 Sun-diameters) of the center of the Sun, which corresponds to 4 or 4½ Sun-diameters above its surface. All the same, the title text makes the point that "Sun-diameters" (or "Sun-radii", for that matter) sounds like an astronomical distance, until you use the same scale for other distances. The distance from the Earth to the Sun is approximately 106 Sun-diameters; by that scale, 4 Sun-diameters is indeed "practically all the way down". Below is a table showing these and other distances using more common units of measurement. [A tall, but very narrow box with Earth at the top, with Cueball and Megan standing precariously "on top" of Earth on each side of the center, trying to keep their balance. At the very bottom is shown a slice of the Sun. Between Earth and the Sun the two inner planets and two spacecraft are depicted with relation to their distance from the Sun. The spacecraft closest to the Sun is shown two times at different times, as it moves closer and closer to the sun. All 7 objects have labels close to them. The largest distance is between Venus and Mercury, with the Earth-Venus distance the second longest. The distances between the objects below Mercury are much shorter. There is a caption above the slim panel:] Looking down toward the Sun and the Parker Solar Probe (Distances are to scale, sizes are not to scale) Earth Cueball: Careful! Venus Mercury Helios 2 (1976) Parker Solar Probe (today) Parker Solar Probe (2025) Sun (Not to scale)

Cicadas

Cicadas

https://www.xkcd.com/2263

https://www.explainxkcd.com/wiki/index.php/2263:_Cicadas

[This comic is laid out in a variation of a regular four-panel comic. One wide panel is overlaid by two smaller panels, which are placed where the second and fourth panels would be. These panels are slightly offset so they extend above the wide panel.] [Cueball and Ponytail are facing each other across a desk while having a conversation. Cueball is holding up a tablet in his hand while Ponytail is typing at a laptop on the desk.] Cueball: What can you tell from genome comparison? Ponytail: I think there's a duplication on the - Ponytail: Look out! [An overlaid panel shows that the air is full of flying cicadas, many of which have landed on Cueball, Ponytail, the laptop, the tablet, and the desk. Ponytail and Cueball have their arms up in a futile attempt to shield themselves from the bugs, with Cueball having put the tablet down on the table.] Bzzzzzzz [The cicadas are gone, and Cueball and Ponytail resume their conversation. Cueball has picked up the tablet again] Ponytail: - a duplication on the gene right before the cleavage site, so the resulting protein - Ponytail: Look out! [An overlaid panel shows that the air is again full of flying cicadas, which have once again landed on Cueball, Ponytail, the laptop, the tablet, and the desk. Ponytail and Cueball have raised their arms to shield themselves again.] Bzzzzzzz [Caption below the large panel:] Our genetics work has produced 17-second cicadas, but we're having a hard time figuring out how. The widely-accepted scientific explanation for the long and seemingly arbitrary 17-year lifecycle is that seventeen is a prime number - it's believed that this is an evolutionary adaptation against lifecycles of competitors taking easy advantage of the cicada as a food source (if a predator) or emerging early to dominating their shared food source (if a fellow feeder), since 17 years cannot be divided by any whole number of years other than itself and 1. A 16-year cicada might find a creature with an 8-year, 4-year, or biennial cycle could profit from it in a 'clash' of expectations, but only a cycle that is a multiple of 17 (by an identical accident of evolution, that must also match the 'beat' years of the Cicada to be useful) would affect the presumed ancestors of the comic-strip breed. Predators often work to yearly cycles of plenty and scarcity of food or can survive a low number of famine years between the better ones, but if they have less than one year of 'bounty' for every decade or so of 'normal' feeding then they cannot build up the numbers needed to threaten such prey that plays the long-game. Other broods of cicada have 13-year lifecycles (the next lowest prime number), and would potentially clash for resources (or hybridize) only every 221 years. Even if this causes a single bad cycle, for both sub-species, the next cycle of appearance is their own once more (for each) and the respective populations have plenty of opportunity to recover from this event by the time a further two centuries pass. Thus it is theorized the happenstance evolution of a period of dormancy that gives a cycle of a significantly large prime-number of years - though still low enough to survive that period - is ultimately more advantageous than any cousins who tried to evolve to a period with smaller factors/shorter harmonics.

Cicadas are a species of insect whose nymphs burrow underground and emerge as adults to reproduce several years later. One common species in North America is the 17-year cicada, also known as the periodical cicada . These cicadas form distinct broods which burrow and emerge as a group every 17 years, with different broods starting the cycle at different times. This results in a couple of weeks every 17 years when the cicadas swarm in huge numbers, then vanish just as quickly when the adults die off. Cicadas also make a distinctive buzzing sound, which makes their periodic appearance even more memorable. In the comic, Cueball and Ponytail have accidentally created 17- second cicadas using genetic engineering . This means that rather than seeing a massive swarm every 17 years that lasts for a few weeks, they have to deal with a swarm every 17 seconds that lasts for a few moments. This makes it very difficult for them to do their work, especially to figure out how the cicadas were created because the swarm keeps interrupting their work. Note that the comic has been drawn differently than most other straight four-panel comics, probably to highlight the interruptions of the buzzing swarm - see the transcript . The title text is a pun on " circadian rhythm ." In particular, it might resemble something said to someone getting adjusted to a new sleep schedule. But here it is the 17 seconds interruption, not a time zone shift, that has to be adjusted for. This entire comic seems to only have been a lead-up to the "cicadian rhythm" punchline. This is an interesting suggestion since Randall has mentioned in an interview that he makes up the title text after completing the comic. [ actual citation needed ] Seems like he made an exception here; unless he didn't. [This comic is laid out in a variation of a regular four-panel comic. One wide panel is overlaid by two smaller panels, which are placed where the second and fourth panels would be. These panels are slightly offset so they extend above the wide panel.] [Cueball and Ponytail are facing each other across a desk while having a conversation. Cueball is holding up a tablet in his hand while Ponytail is typing at a laptop on the desk.] Cueball: What can you tell from genome comparison? Ponytail: I think there's a duplication on the - Ponytail: Look out! [An overlaid panel shows that the air is full of flying cicadas, many of which have landed on Cueball, Ponytail, the laptop, the tablet, and the desk. Ponytail and Cueball have their arms up in a futile attempt to shield themselves from the bugs, with Cueball having put the tablet down on the table.] Bzzzzzzz [The cicadas are gone, and Cueball and Ponytail resume their conversation. Cueball has picked up the tablet again] Ponytail: - a duplication on the gene right before the cleavage site, so the resulting protein - Ponytail: Look out! [An overlaid panel shows that the air is again full of flying cicadas, which have once again landed on Cueball, Ponytail, the laptop, the tablet, and the desk. Ponytail and Cueball have raised their arms to shield themselves again.] Bzzzzzzz [Caption below the large panel:] Our genetics work has produced 17-second cicadas, but we're having a hard time figuring out how. The widely-accepted scientific explanation for the long and seemingly arbitrary 17-year lifecycle is that seventeen is a prime number - it's believed that this is an evolutionary adaptation against lifecycles of competitors taking easy advantage of the cicada as a food source (if a predator) or emerging early to dominating their shared food source (if a fellow feeder), since 17 years cannot be divided by any whole number of years other than itself and 1. A 16-year cicada might find a creature with an 8-year, 4-year, or biennial cycle could profit from it in a 'clash' of expectations, but only a cycle that is a multiple of 17 (by an identical accident of evolution, that must also match the 'beat' years of the Cicada to be useful) would affect the presumed ancestors of the comic-strip breed. Predators often work to yearly cycles of plenty and scarcity of food or can survive a low number of famine years between the better ones, but if they have less than one year of 'bounty' for every decade or so of 'normal' feeding then they cannot build up the numbers needed to threaten such prey that plays the long-game. Other broods of cicada have 13-year lifecycles (the next lowest prime number), and would potentially clash for resources (or hybridize) only every 221 years. Even if this causes a single bad cycle, for both sub-species, the next cycle of appearance is their own once more (for each) and the respective populations have plenty of opportunity to recover from this event by the time a further two centuries pass. Thus it is theorized the happenstance evolution of a period of dormancy that gives a cycle of a significantly large prime-number of years - though still low enough to survive that period - is ultimately more advantageous than any cousins who tried to evolve to a period with smaller factors/shorter harmonics.

Satellite

Satellite

https://www.xkcd.com/2264

https://www.explainxkcd.com/wiki/index.php/2264:_Satellite

[Science Girl is facing Cueball and Megan. A small satellite orbits her, indicated by a tilted circle around her at about neck height. The satellite is between her and her parents.] Science Girl: Hey, look, I found a satellite! Can I keep it? Please? Cueball: Sweetie, no. Megan: Put it back where you found it. [Zoom in on Science Girl who looks straight out of the panel, the satellite is passing by her ear with the circle going behind her. The satellite is detailed in this zoom in. There is a central main part of the satellite, almost square, with a small protrusion at the "top" and two small lines (antennae) at the "bottom." Two solar panels extend on either side, each longer than the central part.] Science Girl: But I think it was abandoned! Science Girl: And it's so cute! Science Girl: Please? Science Girl: Pleeeease? [Back to all three again, Science Girl has her arms raised above her head. The satellite is beneath her head.] Megan: Fine. But you have to promise to boost it to a graveyard orbit when it stops working. Don't just leave it drifting around. Science Girl: Yaaaay! [Same setting as in the first panel, so Science Girl has lowered her arms.] Cueball: We're serious. I am not cleaning up after Kessler syndrome again. Megan: We couldn't use the dining room for weeks! Science Girl: I promise, I promise.

This comic humorously compares the relationship between humans and satellites to the relationship between humans and pets . "He followed me home, can we keep him?" is a stock phrase said by children pleading with their parents to keep a "found" animal as a pet. The stock response is to admonish the child to look after the pet's needs, especially the less fun ones, like cleaning up after the pet. In this comic, Science Girl wishes to adopt an "abandoned" satellite, but rather than being asked to clean up after the satellite's waste, she is lectured by her parents on how to properly discard it once it stops working. This would be like saying "you have to promise to bury the dog in the backyard when it dies, not leave its corpse to decompose in the dining room like the last one," which is not how most pet-adoption conversations go. [ citation needed ] A graveyard orbit is an orbit far away from operational satellites. Graveyard orbits are used when a satellite is far enough away from the Earth that de-orbiting it into Earth's atmosphere is too expensive to be practical. The most widely-used graveyard orbit is approximately 300 km above geostationary orbit ; a satellite at the end of its life will briefly accelerate to move further away from Earth, so Science Girl's parents refer to "boosting" the satellite into a graveyard orbit. Kessler syndrome is a proposed scenario in which satellite collision(s) produce many pieces of orbiting space junk, which then hit other satellites and create even more pieces of junk, which hit more satellites, and so on. In this scenario Earth becomes surrounded by so much man-made debris that the risk of a collision makes space activities difficult. Apparently Science Girl has recreated this scenario before in her parents' home, requiring extensive cleanup of the dining room and making it unusable for weeks. Kessler syndrome was the premise of the movie Gravity , where the collision of two satellites produces pieces of shrapnel that go on to tear apart other satellites including the International Space Station and a Space Shuttle . A variation of Kessler syndrome was the focus of the first part of the Neal Stephenson novel Seveneves , where cascading collisions of fragments of the moon led to natural and artificial debris field around the Earth. The title text is more advice from Science Girl's parents. They tell her that if she is going to let her satellite reenter the atmosphere and burn up, she should do it above the deep end of the bathtub. This echoes how satellites in orbit can be purposefully de-orbited, and are usually planned so that any debris that isn't fully destroyed lands in the ocean and does not pose a safety risk. When it is possible, satellites are generally directed towards the South Pacific Ocean Uninhabited Area, commonly known as the " spacecraft graveyard ", to land over a thousand miles away from any populated landmass. Abandoned satellites were in the news recently, as two defunct satellites had a near miss on January 29, 2020, the week before this comic strip was published. This is becoming more of an issue, especially in Low Earth Orbit, as more and more satellites are built, and old satellites go defunct. Humans orbited by satellites were previously featured in 1300: Galilean Moons ; here, of course, the satellites were natural satellites, i.e. moons. An alternative reading is that the characters are actually planet-sized creatures around which the discarded debris of primitive lifeforms, carelessly sent into space, orbits. Saturn happens to have a density less than that of water, so it could conceivably float in a suitably-sized bathtub. [Science Girl is facing Cueball and Megan. A small satellite orbits her, indicated by a tilted circle around her at about neck height. The satellite is between her and her parents.] Science Girl: Hey, look, I found a satellite! Can I keep it? Please? Cueball: Sweetie, no. Megan: Put it back where you found it. [Zoom in on Science Girl who looks straight out of the panel, the satellite is passing by her ear with the circle going behind her. The satellite is detailed in this zoom in. There is a central main part of the satellite, almost square, with a small protrusion at the "top" and two small lines (antennae) at the "bottom." Two solar panels extend on either side, each longer than the central part.] Science Girl: But I think it was abandoned! Science Girl: And it's so cute! Science Girl: Please? Science Girl: Pleeeease? [Back to all three again, Science Girl has her arms raised above her head. The satellite is beneath her head.] Megan: Fine. But you have to promise to boost it to a graveyard orbit when it stops working. Don't just leave it drifting around. Science Girl: Yaaaay! [Same setting as in the first panel, so Science Girl has lowered her arms.] Cueball: We're serious. I am not cleaning up after Kessler syndrome again. Megan: We couldn't use the dining room for weeks! Science Girl: I promise, I promise.

Tax AI

Tax AI

https://www.xkcd.com/2265

https://www.explainxkcd.com/wiki/index.php/2265:_Tax_AI

[Cueball is sitting, hands on his knees, in his office chair at his desk reading a message on the screen of his laptop. The message is shown above the laptop an is indicated to be on the screen with a zigzag line starting at a starburst on the screen.] Laptop: You may claim up to 1040 defendants on your seitan local income tax for fiscal year 20202 by taking the standard deduckling and atomizing your clams. [Caption below the panel:] I used a neural net to prepare my tax returns, but I think I cut off its training too early.

The deadline for filing tax returns in the United States is April 15, so many people in the US are already in the process of filing their taxes at the time of this comic's publication. Traditionally, people used tax provider companies, but it is becoming more popular to use tax preparation software, such as TurboTax or a service from the Free File Alliance , which helps to fill in the tax forms after a user enters their income information and deductions for the year. In this comic, Cueball has attempted to train an artificial neural net to prepare his US tax return , but it has made several comical errors, purportedly because it was not trained extensively enough. Most of the errors consist of malapropisms , words that sound almost the same but mean very different things switched for comic effect. This suggests Cueball trained the neural net by talking to it. The title "Tax AI" can be considered a pun, either referencing the AI software Cueball just trained to prepare his tax return, or an exhortation to tax AI entities, as a possible slogan supporting Robot tax . The title text references 2173: Trained a Neural Net , which indicates that getting a human to do something is basically using a "pretrained neural net". Cueball has chosen to use a local tax provider to help him file his taxes, aka a "pretrained neural net" in the form of a human named Greg. Randall also "trained" humans to do his tax returns in 1566: Board Game . Tax returns and the troubles of filling them out were also the subjects of 1971: Personal Data and 1977: Paperwork . [Cueball is sitting, hands on his knees, in his office chair at his desk reading a message on the screen of his laptop. The message is shown above the laptop an is indicated to be on the screen with a zigzag line starting at a starburst on the screen.] Laptop: You may claim up to 1040 defendants on your seitan local income tax for fiscal year 20202 by taking the standard deduckling and atomizing your clams. [Caption below the panel:] I used a neural net to prepare my tax returns, but I think I cut off its training too early.

Leap Smearing

Leap Smearing

https://www.xkcd.com/2266

https://www.explainxkcd.com/wiki/index.php/2266:_Leap_Smearing

[Cueball, Ponytail, and Hairy are looking up at a digital clock on a wall. It displays the time in white on a black background, with a logo on the frame beneath the time.] 3:02 AM Google Cueball: Why do the clocks say it's 3AM? Ponytail: Adding an extra day creates too many glitches. Instead, we're just running our clocks 3.4% slower during February, to avoid the irregularity. [Caption below the panel:] This year, Google has expanded their leap second "smearing" to cover leap days as well.

Clocks usually measure time by regularly-sized intervals, but the natural world is not always so accommodating. Since the solar year is not an integer number of days long, we add leap days every four years (except for years divisible by 100 but not 400) to prevent our calendars from drifting with respect to the seasons. We also add leap seconds to the clock every now and then, to prevent noon on our clocks from drifting away from solar noon. Unfortunately, Earth's day is not as regular as Earth's year, so leap seconds cannot be predicted with a formula but are added as needed, most recently in 2016. Officially, the leap second is added at midnight UTC (so a clock will tick 23:59:59... 23:59:60 ...00:00:00), but this is an extremely inconvenient edge case, to the point that there are many proposals to do away with leap seconds entirely (as of this comic strip's publication, the matter will be discussed in the World Radiocommunication Conference in 2023). Rather than inserting an extra tick into timestamps and dealing with the resulting hiccups (e.g. programs hard-coded to expect that every minute will contain exactly sixty seconds ), Google 's services 'smear' the leap second over the course of a 24-hour period, officially called Leap Smear by Google. The smear is centered on the leap second (at midnight) so from noon the day before to noon the day after each second is 11.6 μs longer (1s/(24*60*60) = 11,574 μs). This difference is too small for most of Google's services to be bothered with, and by centering on midnight, the difference in time will never be more than half a second at midnight; just before midnight it will be half a second behind, after midnight it'll be half a second ahead. This comic's joke arises from the idea of extending this practice to smearing leap days over the month of February. This comic strip was published February 10th, 2020, almost three weeks before the leap day on February 29th, 2020. In the comic, Cueball is visiting one of Google's facilities, presumably during office hours on the 10th day of February, when the comic was released. But when he looks at their clocks he sees they are all around 3:00 AM (which is in the middle of the night). He thus asks Ponytail and Hairy why their clocks are wrong. Ponytail tells him it is because of leap day smearing. Ponytail explains that adding an extra day creates too many glitches. So they just run their clocks 3.4% slower during February. She thus states that it works approximately like leap smearing for seconds, so that the extra day's 24 hours are spread evenly over the course of February, keeping it at the regular 28 days, but still running over 24*29 = 696 hours, even though their clocks only go through 672 hours = 24*28. Thus the 24 hours less to count are spread out over the 696 real hours, which means their clocks run 24/696 = 3.445 % slower (matching the 3.4% Ponytail mentions). Every smeared day will thus be about 0.86 hours, or 51 minutes and 40 seconds, longer (24/28) than a standard day. So when day-smearing clocks read 3:02 AM on February 10th (the comic was released on February 10th), about 9.1264 smeared days will have passed. This translates to about 9.4523 standard days (9.1264*29/28), which is approximately 10:51 AM on February 10th, well within normal working hours. The joke of course is that contrary to leap second smearing this would be very inconvenient for those following it, due to the fact that clocks would be noticeably out of sync with Earth's rotation (and perhaps more importantly, with everyone else's clocks) for most of the month. (Although it does mean they would sync up better with some of their partners abroad; see 1335: Now and 448: Good Morning .) A different kind of time-smearing was looked at in the far earlier comic 320: 28-Hour Day , which was actually designed with a form of convenience in mind, and it would be interesting to see what the results could be of creatively combining both systems. The title text humorously suggests that some people (at Google) suspect that the real reason for the leap day smearing was actually a "No, I didn't forget Valentine's Day" excuse that got out of hand. The idea is, that maybe a CEO at Google forgot to buy something for their romantic partner for Valentine, and thus tried to suggest that it was not because they forgot, but that at work it was still February 14th. Presumably, in February 2016, they used this excuse to buy 12 extra hours (as the end of a smeared Feb 14 is exactly halfway through the month) to get their partner a present, and then required the company to actually implement "leap day smearing" by 2020 to maintain the illusion. Randall has some issues with Valentines , see for example 1016: Valentine Dilemma . This comic was released four days before Valentines Day of 2020. It was the first time in 8 years he made any reference to Valentine around this time of year, but the seventh time in total. Randall has since not mentioned Valentine's day. 1481: API also covered leap seconds in its title text. [Cueball, Ponytail, and Hairy are looking up at a digital clock on a wall. It displays the time in white on a black background, with a logo on the frame beneath the time.] 3:02 AM Google Cueball: Why do the clocks say it's 3AM? Ponytail: Adding an extra day creates too many glitches. Instead, we're just running our clocks 3.4% slower during February, to avoid the irregularity. [Caption below the panel:] This year, Google has expanded their leap second "smearing" to cover leap days as well.

Blockchain

Blockchain

https://www.xkcd.com/2267

https://www.explainxkcd.com/wiki/index.php/2267:_Blockchain

[A flowchart is shown. A rectangular block at the top has one line down to a diamond shaped block. From there lines go right and down from two of the edges. The line to the right immediately takes a turn and goes down to a rectangular block. From this block a line goes to the block to the left, which is also the one that the down line from the diamond points to, so both routes ends here. There are text in each of the four blocks and labels above the lines for the two options going out from the diamond.] [Start block:] Should your project use a blockchain? [Diamond:] Are you making the decision using a flowchart you just found? [Reply:] No [Right block:] You definitely are [From right block of if reply was:] Yes [Result block:] No

This comic is a flowchart intended to help project leaders decide if their project needs a blockchain. A blockchain is a data storage structure shared between various computers. Each block is digitally signed and includes the digital signature of the block before it, which makes it highly resilient against tampering. However, what sets blockchains in the context of cryptocurrencies such as Bitcoin apart from e.g. Merkle trees used in programs such as Git is that anyone can write to a blockchain. This is sometimes specified as a "public" or "permissionless" ledger or blockchain. In order to prevent the blockchain from being vandalized, various mechanisms are used to determine consensus about which additions to the blockchain are legitimate. Bitcoin and most cryptocurrencies use a " proof of work " system, where writing a block includes some task which is computationally difficult to perform but simple to verify, such as finding a magic number (called a " cryptographic nonce ") that, when appended to the block, makes its hash value start with lots of zeroes. This results in a system which is, in ideal circumstances, extremely difficult to vandalize, as the attacker must find new nonce values for the block he wishes to modify and every succeeding block, and then broadcast the modified blockchain from enough nodes to convince the rest of the network to go along with it instead of the legitimate one. In practice, in order to actually make this so-called "51% attack" unfeasible, the network needs to have as many legitimate actors using as much computing power as possible. This results in the Bitcoin network using approximately a million times more energy per transaction than Visa's network, while smaller cryptocurrencies have actually experienced 51% attacks and double-spending . For almost any practical project, there is no need to allow everyone in the world to have write access to a database, so it is generally quite acceptable to use a straightforward centrally-controlled permissioning system rather than proof-of-work or other decentralization schemes to restrict write access. This is why all branches of the flowchart lead to the answer "No". Part of the joke is that the only question asked in the flowchart, "Are you making the decision using a flowchart you found?" has nothing to do with blockchains or any details of the project itself, and can only honestly be answered 'yes' (which is why the 'no' branch leads to a block reading "You definitely are" before leading to the final "No" answer). For a flowchart with a little more technical content, you can see Figure 6 (page number 42, page 53 of the PDF) of the Blockchain Technology Overview published by NIST . In particular, they conclude that blockchain is only potentially useful if you need a data store that must never be erased (not even for the sake of e.g. removing illegal or harmful content, which has been written into blockchains in the past ), must be auditable, and where lots of people need to write to it (more than can feasibly be enumerated or controlled in any way) but none of them can be trusted to have administrative authority over it. Presumably, if a project were in the rare category of truly needing a blockchain, that decision would be made by a technical expert who is not consulting this flowchart. This flowchart is probably intended as a "resource" for clueless project managers who have latched on to "blockchain" as a buzzword, such as the investors who tripled the stock price of Long Island Iced Tea after it changed its name to "Long Blockchain Corp." and professed a pivot into the blockchain space. As stated above, one of those real-world problems which is "solved" by blockchains is the libertarian ideal of creating a system which allows anyone to perform transactions while (hopefully) preventing anyone from double-spending their coins, much as physical cash does, but without relying on trusted third parties such as government regulators, banks, or mints. Even in that case, however, cryptocurrency exchanges are running into challenges with anti-money-laundering and know-your-customer regulations, which (among other things) ban certain actors from being served by banks, so they are having to use ordinary certificates, passwords, and identification documents, which are definitely not implemented via a blockchain. In the title text block chains are compared to grappling hooks . These hooks are devices with several claws (hooks) attached to the end of a rope. A grappling hook is one of Link's weapons from the The Legend of Zelda series. Additionally, Luke Skywalker used a grappling hook to swing with Princess Leia across a chasm in the first Star Wars film, A New Hope . Like Blockchains, grappling hooks are thus seen as a cool tool when they encounter a problem for which they are the right solution, like boarding an enemy ship... However, just like for blockchains, in real life there are very few cases where these hooks are the best solution for a given problem. As an example of a problem that is not well-solved by a grappling hook, see 2128: New Robot where an electrically-charged "search and rescue" robot has been equipped with such a hook. Blockchain was previously mentioned in 2030: Voting Software , with Megan and Cueball expressing distrust in its use for electronic voting. Flowcharts are a recurring theme in xkcd. If you are unfamiliar with them see 518: Flow Charts . Similar simple flowcharts like this comic, where there is only one reply has been used before like 1723: Meteorite Identification and 2026: Heat Index . See also the similar 1691: Optimization , where the flowchart, as it does here, asks if you are using flowcharts. [A flowchart is shown. A rectangular block at the top has one line down to a diamond shaped block. From there lines go right and down from two of the edges. The line to the right immediately takes a turn and goes down to a rectangular block. From this block a line goes to the block to the left, which is also the one that the down line from the diamond points to, so both routes ends here. There are text in each of the four blocks and labels above the lines for the two options going out from the diamond.] [Start block:] Should your project use a blockchain? [Diamond:] Are you making the decision using a flowchart you just found? [Reply:] No [Right block:] You definitely are [From right block of if reply was:] Yes [Result block:] No

Further Research is Needed

Further Research is Needed

https://www.xkcd.com/2268

https://www.explainxkcd.com/wiki/index.php/2268:_Further_Research_is_Needed

[A panel, representing an excerpt from a scholarly journal, with two sentences clearly visible. Below the text is one more readable word, with a horizontal line below it, and then four numbered lines with unreadable text. The text is written with normal capitalization rather than in all caps.] We believe this resolves all remaining questions on this topic. No further research is needed. References 1. 2. 3. 4. [Caption below the panel:] Just once, I want to see a research paper with the guts to end this way.

In most scientific fields, it's very common to end research papers with the caveat that "more research is needed", or words to that effect. This is particularly true when reporting results on a topic that's not well studied, and in which there's not enough literature to form a broad consensus. This is a very reasonable suggestion, an individual research project may produce results that suggest a certain conclusion, but it would be foolhardy to take something as established fact based on a single study. Individual studies may produce misleading information, they may have flaws that don't become evident until later, they may be based on assumptions that don't hold up, or the results may end up having an alternate explanation (as when a correlation is found, but does not establish specific causation). It's all too common for science reporters, particularly in low-quality outlets, to draw broad and bold conclusions from a single study, but actual scientists quickly learn to be more cautious. Peer-reviewed papers will generally make clear that conclusions are tentative, and may be modified or even overturned by future research. This comic's fictional paper, however, ends with a statement that the paper has resolved all the problems about its topic, and that no more research is necessary. Humorously, the authors are so confident in their research skills that they believe that they have solved all the problems in that particular topic that can be solved. Munroe jokes that he'd like to see researchers with "the guts" to make such a proclamation. In real life, doing so would likely damage the reputation of the study's authors, because it would belie both a breathtaking arrogance and a lack of understanding of the research process. If nothing else, studies need to be replicated, to establish that the initial data gathering was accurate. In addition, no single study could realistically address every aspect, variation and complication in a given topic. It's simply not feasible that a single paper could "[resolve] all remaining questions" on any given topic, and making such a ridiculous claim would badly damage a researcher's credibility. At the same time, if no further research were necessary, every researcher in the field, including the author who wrote the study, would need to either change fields or change careers. The title text ironically states that "further research" is indeed needed to understand how the researchers who wrote the paper were able to resolve all the problems in that topic or field, thus allowing the researchers to justify future funding for their research. Perhaps the statement most like this made by a real scientist was by Albert A. Michelson , at the 1894 dedication of the University of Chicago's Reyerson Physical Laboratory: "[I]t seems probable that most of the grand underlying principles have been firmly established and that further advances are to be sought chiefly in the rigorous application of these principles to all the phenomena which come under our notice." (Variants of this statement are sometimes misattributed to William Thomson, 1st Baron Kelvin .) Even this statement is couched in much less certainty than the concluding statement presented in this comic strip, and sure enough, just eleven years later, Albert Einstein wrote his Annus Mirabilis papers . These four papers explained the photoelectric effect, Brownian motion, special relativity, and mass-energy equivalence, turning established physics on its head. Ironically, Michelson made this statement despite the fact that he himself had upset a major of notion of established physics just seven years before, when the Michelson-Morley experiment demonstrated that the speed of light was constant, disproving the Aether theories then prevalent in physics. This result in turn was part of the inspiration for Einstein's theory of special relativity. [A panel, representing an excerpt from a scholarly journal, with two sentences clearly visible. Below the text is one more readable word, with a horizontal line below it, and then four numbered lines with unreadable text. The text is written with normal capitalization rather than in all caps.] We believe this resolves all remaining questions on this topic. No further research is needed. References 1. 2. 3. 4. [Caption below the panel:] Just once, I want to see a research paper with the guts to end this way.

Phylogenetic Tree

Phylogenetic Tree

https://www.xkcd.com/2269

https://www.explainxkcd.com/wiki/index.php/2269:_Phylogenetic_Tree

[A circular phylogenetic tree is shown, with various parts of the tree colored red, green, blue, and black. Text is written on the root of the tree and the first few branches, getting smaller until it becomes unreadable. The visible text is:] Duke Duke Gonzaga Louisville Duke UVA FSU Dayton UVA Kansas FSU [Caption below the panel:] I was kicked off the biology project after I secretly replaced all the phylogenetic trees in our new paper with March Madness brackets.

In biology, phylogenetic trees are a way of showing evolutionary relationships between species. Each split in the tree represents a species that was the common ancestor of the two species beneath it, resulting in a bifurcating structure that can be followed all the way back to a single root - the most recent common ancestor of all species in the tree. In sport, a tournament tree is a diagrammatic way of showing the progress of competitors in an elimination tournament. Each split in the tree represents the winner of a match between the two competitors beneath it. This too results in a bifurcating tree structure, which eventually terminates at a single root representing the champion of the tournament. Tournament brackets are a recurring theme at xkcd. In this comic, Randall has taken advantage of the similarity between these two diagrams in order to prank his fellow biologists. Each year in the United States, in March and early April, 68 National Collegiate Athletic Association (NCAA) Division I college basketball teams play in a single elimination postseason tournament to decide the national champion of college basketball. This tournament is colloquially known as March Madness . Associated with this tournament, it has become commonplace to guess the outcomes of each game, and predict who will win the tournament. A diagram illustrating the progress and elimination of teams through the tournament is called a bracket . Presumably Randall is referring to the men's college basketball tournament here, though there is a separate women's college basketball tournament that is also referred to as "March Madness". Randall has replaced the trees in a biology paper with a basketball March Madness bracket , which is not related to biology. The 2019-20 NCAA college basketball regular season had not ended yet at the time of this comic's publication, so the partial bracket shown is a fictional bracket. Compared to a phylogenetic tree, the 'root' of a tournament tree is the final result (once known), rather than the common ancestor that was prior in time to all those that came after; the 'leaves' are all the initially hopeful competitors, rather than the latest extant (or unsucceeded extinct) organisms. The title text shows the inverse of what the comic says: Apparently the March Madness bracket pool removed Randall after he tried to introduce biology-related evidence comparing the National Basketball Association (NBA) and American Basketball Association (ABA) to organisms and claiming the ABA is an endosymbiont living inside the NBA. An endosymbiont is an organism living inside another organism. In a way, this can be considered true of these two leagues, as the NBA and ABA merged in 1976 after which the ABA ceased to exist. 4 teams from the ABA, the Denver Nuggets , Indiana Pacers , Brooklyn Nets and San Antonio Spurs , continue to exist today as NBA teams. It is additionally humorous that Randall brings up the ABA/NBA merger in a March Madness bracket group, as March Madness is a college basketball tournament, as opposed to professional basketball played by the NBA and ABA. A March Madness bracket was also the topic of 1819: Sweet 16 . The bracket shows the Duke University basketball team winning the NCAA college basketball tournament. Strangely, it shows Gonzaga University linked only to explicitly non-Gonzaga branches, suddenly appearing out of the bottom section, which is not possible in a sports bracket context, but possible in biology if Gonzaga is an identified ancestral root with all descendant evolved species identified by a new term. In fact, the implied unchanged continuity of Duke from 'universal ancestor' to niche population sharing the world with all of its diverged and re-evolved outbranchings (rather than perhaps used as a term for a typically broad cladistic group of branches, such as Archaea) would be more curious - or just imply an inherent of available precision in the necessary paleobiological studies that classify the proposed UA and its descendency. As of the publish date of this comic, all of the college basketball teams mentioned (except the University of Virginia) were ranked in the top 25 of the Associated Press poll . The University of Virginia was the 2019 national champion (winner of the tournament), so that may have been why they were mentioned. [A circular phylogenetic tree is shown, with various parts of the tree colored red, green, blue, and black. Text is written on the root of the tree and the first few branches, getting smaller until it becomes unreadable. The visible text is:] Duke Duke Gonzaga Louisville Duke UVA FSU Dayton UVA Kansas FSU [Caption below the panel:] I was kicked off the biology project after I secretly replaced all the phylogenetic trees in our new paper with March Madness brackets.

Picking Bad Stocks

Picking Bad Stocks

https://www.xkcd.com/2270

https://www.explainxkcd.com/wiki/index.php/2270:_Picking_Bad_Stocks

[Cueball and Ponytail are walking together.] Cueball: I feel like by now I should know about the stock market. Cueball: What is investing? Do you just open a website and pick the companies you like? [Cueball and Ponytail are still walking; Ponytail is holding out her hand palm-up.] Ponytail: Well, you totally can. Ponytail: But there's a lot of evidence that no investing strategy consistently picks stocks that outperform the average of the whole market. A lot of fund management is a myth. [Close-up on Ponytail, who has turned to Cueball.] Cueball (off-screen): Huh, okay. Ponytail: But there's a weird corollary to that idea: it implies that, ignoring fees and stuff, it's just as hard to consistently lose money by picking bad stocks from an index. [Cueball and Ponytail are both back in frame. They are standing still and facing each other.] Ponytail: If someone could consistently buy bad stocks, you could beat the average by hiring them, letting them pretend to invest, then buying every stock except the ones they pick. Ponytail: In a way, bad judgement is just as helpful as good judgement. [In a frameless panel, Cueball and Ponytail are standing facing each other; Cueball is raising his hands.] Cueball: Oh my God. Cueball: I can do that! Ponytail: No, it's just an example-- Cueball: This is the job I was born for. [Cueball is either sitting in a box or being viewed on a camera screen. He is sitting in front of a computer console, and a camera is pointed at him. Megan and White Hat are viewing him, and White Hat is holding a tablet.] [Text box: Soon...] Cueball: Hey, this company's CEO wants revenge on the same ghost as me! I'm buying! Cueball: Ooh, and this one is planning to develop a "Camping Roomba." That's a sure bet! Megan: Drop companies #208 and #1434 from the index. White Hat: Done.

Cueball and Ponytail are discussing the stock market. Ponytail explains that there has been no reliable way to consistently pick stocks that outperform the market average. She also states that there could be a corollary to that; there is no way to consistently pick bad stocks (presumably for this discussion, bad stocks refers to stocks whose value is expected to go down). Cueball states that he could consistently pick bad stocks, and the last panel shows him at a trading terminal purportedly buying bad stocks, while White Hat and Megan use his bad stock picks as indications that those stocks should be removed from whatever stock index they manage. Generally, people invest in the stock market hoping to make money. They buy stock in companies whose value they expect will increase, and sell stock when they feel its value is about to stop increasing or start decreasing. Someone who could tell whether a stock's price will rise or fall (more than the average stock) in a given time interval could make a lot of money, but this is an infamously difficult problem. Market prices already reflect the consensus estimate of what a stock should be worth based on all public information about the company. Some investors use fundamental analysis , that is, they attempt to understand companies based on their financial statements and market position to identify which stocks are likely to become more or less valuable over time, while others use technical analysis which seeks to identify patterns in the stock prices themselves. Technical analysis was featured in comic 2101 . However, while the rise and fall of stock prices are sometimes connected to real events (strong or weak profit statements, new product announcements, major scandals) that one person might predict better than another, they more often exhibit random-walk behavior. Many studies, such as the long-running " Investment Dartboard Contest " run by The Wall Street Journal , have found that an index of stocks that represent the total market, or even a set of randomly-selected stocks (often colloquially stated as "picked by a monkey") beats paying an expert to choose your portfolio. Realistically, in investing, someone who purposely trades in bad stocks is called a short seller , and someone who could consistently pick bad stock could make a lot of money in the stock market. Short selling consists of selling a stock before you own it, with the anticipation that the stock's price will drop soon, and you can later purchase the stock to fulfill the sale. The difference between the selling price and the purchase price is your profit, just as with any normal ("long") purchase and sale. However, in US stock markets, it is illegal to sell stocks that you don't own, so when you short a stock, you need to borrow that stock from a third party (possibly the trading firm you're working with, or some other firm that the trading firm has a stock loan relationship with, that currently holds a position in the stock you're shorting) to cover the sale. This is all done automatically by the trading platform you use. Between the time you sell the stock until the time you repurchase the stock on the open market, you will have what's called a short position on the stock, and you need to pay interest to the company that lent you that stock. Because of the interest payments, short sales are almost always short-term positions, as the interest paid on the loan can quickly exceed any profit you might make on the sale. A. Gary Shilling , a financial analyst, famously remarked that " markets can remain irrational a lot longer than you and I can remain solvent. " Ponytail attempted to explain short selling to Cueball in 2094: Short Selling (perhaps that comic and this one are part of the same conversation), although Cueball found Ponytail's advice much less helpful than he has found this comic's conversation. However, in this case, Ponytail is not describing short selling but instead, investing in every stock except for the bad ones Cueball's statement about wanting revenge on a ghost may be a reference to 2259: Networking Problems , in which Cueball was driven insane trying to debug network problems and came to believe in ghosts. Perhaps the CEO of company #208 has had a similar experience with a network. If Cueball's statement that a company is developing a "camping Roomba " is correctly attributing the trademark (as opposed to genericizing it to refer to any small cleaning robot), then presumably company #1434 is iRobot . While a Roomba for camping may sound like a ridiculous concept that is not likely to make much money, developing a robot that can navigate and move around natural environments would be a major advancement leading to new opportunities for both their civilian and military product lines. A campground offers a more challenging environment than indoors, while being slightly more controlled than a truly wild area, making for a good development step. Dropping iRobot from this company's index is probably not a move that would be suggested by a stock broker who is earnestly trying to make money, but maybe Cueball's "market anti-sense" knows something we don't. In the title-text, it seems that Cueball is worse at picking bad stocks than he thinks he is; a legitimate investor could have seen what Cueball saw and taken it as a good sign. This only validates Ponytail's point regarding the stock market - there is no way to consistently identify what stocks will go up or down. [Cueball and Ponytail are walking together.] Cueball: I feel like by now I should know about the stock market. Cueball: What is investing? Do you just open a website and pick the companies you like? [Cueball and Ponytail are still walking; Ponytail is holding out her hand palm-up.] Ponytail: Well, you totally can. Ponytail: But there's a lot of evidence that no investing strategy consistently picks stocks that outperform the average of the whole market. A lot of fund management is a myth. [Close-up on Ponytail, who has turned to Cueball.] Cueball (off-screen): Huh, okay. Ponytail: But there's a weird corollary to that idea: it implies that, ignoring fees and stuff, it's just as hard to consistently lose money by picking bad stocks from an index. [Cueball and Ponytail are both back in frame. They are standing still and facing each other.] Ponytail: If someone could consistently buy bad stocks, you could beat the average by hiring them, letting them pretend to invest, then buying every stock except the ones they pick. Ponytail: In a way, bad judgement is just as helpful as good judgement. [In a frameless panel, Cueball and Ponytail are standing facing each other; Cueball is raising his hands.] Cueball: Oh my God. Cueball: I can do that! Ponytail: No, it's just an example-- Cueball: This is the job I was born for. [Cueball is either sitting in a box or being viewed on a camera screen. He is sitting in front of a computer console, and a camera is pointed at him. Megan and White Hat are viewing him, and White Hat is holding a tablet.] [Text box: Soon...] Cueball: Hey, this company's CEO wants revenge on the same ghost as me! I'm buying! Cueball: Ooh, and this one is planning to develop a "Camping Roomba." That's a sure bet! Megan: Drop companies #208 and #1434 from the index. White Hat: Done.

Grandpa Jason and Grandpa Chad

Grandpa Jason and Grandpa Chad

https://www.xkcd.com/2271

https://www.explainxkcd.com/wiki/index.php/2271:_Grandpa_Jason_and_Grandpa_Chad

[A progression chart covering the period of years between 1950 to 1995. One line, representing the birth years of people becoming grandparents, is dotted and begins low at the start, climbs, then steeply declines. Two solid lines, representing the birth years of people named "Chad" or "Jason", begin in the early 1960s, rise almost concurrently, however one declines steadily while the other has a curve almost before the end of the chart. The overlapping area between the dotted and solid lines is shaded. The lines show the following data:] Birth years of people becoming grandparents this year (United States, very rough estimate) [A dotted line which begins at 1950, rises to its peak at 1970, then steeply declines to zero by the late '70s.] Birth years of people named "Jason" and "Chad" (Social Security data) [Chad: A solid line beginning at 1962, rises to its peak by 1975, then drops through the '80s and '90s. Jason crosses underneath it in 1985, but then re-crosses it in 1993.] [Jason: A solid line beginning at 1963, rises to its peak between 1977-80, then declines, dropping beneath Chad around 1985 but climbing above it again in 1993.] [Caption below the comic:] Fun fact: We have now entered the era of "Grandpa Jason" and "Grandpa Chad."

This is another comic with one of Randall's fun facts . The comic contains three separate curves, with the x-axis being the date and the y-axis being the frequency of three separate sets of data: The graph shows that the names "Jason" and "Chad" were extremely uncommon in the US prior to the 1960's, but then experienced a surge in popularity, peaking in the late 1970's, and falling off thereafter. There are a couple of interesting effects when certain names become temporarily trendy. It means that those names become closely associated with a particular age cohort, so one can guess a person's age range based solely on their first name, and therefore predict other tendencies associated with age (this is also explored in 1950: Chicken Pox and Name Statistics ). A side effect of this is that, when this cohort first comes of age, those names enter the public consciousness as being associated with youth, trendiness and irresponsibility. Of course, that cohort continues to age, and eventually becomes the adult cohort, then the senior cohort, but stereotypes are often slow to change. 2165: Millennials is similarly about how a label has outlived the demographic that it was used to describe, while the people described by the label have outgrown the traits that the label entails. In addition to dealing with with the inertia of our assumptions and stereotype, this comic also continues a long XKCD tradition of pointing out how quickly time is passing, and how slow we often are to realize it. In this case, those of us in Randall's general age range are used to thinking of "Jason" and "Chad" as names for young, trendy, party animals. The fact that only a small fraction of people with these names are under the age of 30, and a growing number of them are now grandparents (and that trend is likely to increase rapidly in the next few years), forces us to acknowledge that quite a bit of time has passed since we first formed our world views, and that means we've aged, even if we haven't noticed it. The title text adds a caveat to the assertion, mentioning the lack of any real evidence for the distribution of ages of Grandparents, but tacitly admits that the matter is not sufficiently important to seek any further precision. Other possible caveats of the data: The title text ends with the text "No further research is really *needed,*" referencing 2268: Further Research is Needed . This is also a joke in itself. The emphasis on *needed* is an admission that although more research is *possible*, it's simply not warranted, given the fairly trivial nature of the topic. [A progression chart covering the period of years between 1950 to 1995. One line, representing the birth years of people becoming grandparents, is dotted and begins low at the start, climbs, then steeply declines. Two solid lines, representing the birth years of people named "Chad" or "Jason", begin in the early 1960s, rise almost concurrently, however one declines steadily while the other has a curve almost before the end of the chart. The overlapping area between the dotted and solid lines is shaded. The lines show the following data:] Birth years of people becoming grandparents this year (United States, very rough estimate) [A dotted line which begins at 1950, rises to its peak at 1970, then steeply declines to zero by the late '70s.] Birth years of people named "Jason" and "Chad" (Social Security data) [Chad: A solid line beginning at 1962, rises to its peak by 1975, then drops through the '80s and '90s. Jason crosses underneath it in 1985, but then re-crosses it in 1993.] [Jason: A solid line beginning at 1963, rises to its peak between 1977-80, then declines, dropping beneath Chad around 1985 but climbing above it again in 1993.] [Caption below the comic:] Fun fact: We have now entered the era of "Grandpa Jason" and "Grandpa Chad."

Ringtone Timeline

Ringtone Timeline

https://www.xkcd.com/2272

https://www.explainxkcd.com/wiki/index.php/2272:_Ringtone_Timeline

[A horizontal timeline spanning between the years 1875 and 2022. Every year is indicated by a tick below the line, and labeled every 5 years. There is a gap between 1883 and 1989 with jagged lines to indicate a jump in time. 7 sections are labeled on the chart, each with a border except for the first and last:] [1875, with no border:] Telephone ringer invented [1878-1883:] Normal ringing sounds [Gap and jagged lines to indicate jump in time from 1883 to 1989] [1989-1996:] Normal ringing sounds [1996-2003:] Cool space beeps [2003-2009:] Song and novelty ringtones [2009-2013:] Cool space beeps [2013-2019:] Normal ringing sounds [2020, with no border:] Everyone sets their phones to vibrate [Caption below the panel:] After 140 years, humanity is finally on the verge of winning the war against ringtones.

After the telephone was invented, a way of indicating when a call was coming through was needed. Special voltages sent through the line were used to activate a physical bell on the other end, leading to what we recognize as a phone ringing sound , and that method of generating sound persisted for quite some time, even when new methods of detecting and generating ringing sounds were developed. Eventually, however, people realized they were no longer confined to the traditional bell ringing sound, as computers became more and more involved with the telephone process, and variations of bell-type sounds were introduced, often sounding like spaceship sounds from sci-fi movies. Probably the most iconic "cool space beeps" are the chirps from the communicators from Star Trek (which themselves resemble flip-phones in style). Another common ringtone was the Nokia tune . In the late 1990s and early 2000s, actual songs, or song snippets were able to be used as a ringing sound. It became common to record song snippets from the radio, or to use song MP3 files as ringtones. Many of these songs are grating to hear, and also a social faux pas if they sound in theatres or other listening venues. As an example, this Geico ad featuring bad ringtones, including "the worst ringtone [the Geico gecko has] ever heard", aired in 2010, around the end of the "song and novelty ringtone" period (according to Randall's periodization). As people got sick of that, they reverted to use the default ring tone, a spaceship / computer sound, although this time often of higher quality and more melodious in nature. Nowadays, there are more people electing to use a more traditional ringing sound, both as the novelty has worn off, and possibly also as an ironic statement about ringtones. Randall (in the person of Cueball) made a statement like this in 479: Tones in 2008, which according to his reckoning was in the waning years of the novelty ringtone epoch. The final stage the comic is pointing to is do away with traditional sound entirely, and going with the vibrate mode most portable phones have; what little sound there is is more of a low rumbling sound. Using this setting is common for schools, workplaces, or churches, as it can be disruptive to have a phone ring in a public place . Some users have chosen to always set their phones to the vibrate setting, to avoid having to change their ringing settings back and forth. Randall claims that vibrate mode is the "final victory" over ringtones, which he apparently dislikes. In the title text, Randall ironically uses a "novelty ringtone" which is an audio recording of a phone vibrating. This would sound like a phone on vibrate mode, but his actual phone is not vibrating, and is actually producing a "ringing" sound. However, if the original phone was vibrating on a hard surface (as opposed to in a pocket, muffled by fabric), the sound would be much louder and more grating. A recording of that sound, played as an audio ringtone, would go back to being annoying again. But maybe less imaginatively so than might be a version of the staccato "drum-da-da-drum-da-da-drum" of a phone's periodic handshaking with a mast, such as you sometimes hear over unassociated audio equipment, at pretty much any time it pleases. [A horizontal timeline spanning between the years 1875 and 2022. Every year is indicated by a tick below the line, and labeled every 5 years. There is a gap between 1883 and 1989 with jagged lines to indicate a jump in time. 7 sections are labeled on the chart, each with a border except for the first and last:] [1875, with no border:] Telephone ringer invented [1878-1883:] Normal ringing sounds [Gap and jagged lines to indicate jump in time from 1883 to 1989] [1989-1996:] Normal ringing sounds [1996-2003:] Cool space beeps [2003-2009:] Song and novelty ringtones [2009-2013:] Cool space beeps [2013-2019:] Normal ringing sounds [2020, with no border:] Everyone sets their phones to vibrate [Caption below the panel:] After 140 years, humanity is finally on the verge of winning the war against ringtones.

Truck Proximity

Truck Proximity

https://www.xkcd.com/2273

https://www.explainxkcd.com/wiki/index.php/2273:_Truck_Proximity

[A chart is shown with two axes. Each axis has a label with an arrow pointing from the label towards higher values. No values are shown.] X-axis: Knowledge of different types of trucks Y-axis: Proximity to trucks in daily life [Three sections are marked on the chart with dotted lines, drawn in imperfect ellipses. The first two circumscribe areas along the diagonal X=Y. A large one takes up about two thirds of the length starting from the origin, and a smaller one is separated a bit from the first one, but continuing the trend of X=Y. This takes up less than a third at the top right. Below this, close to the X-axis is a third even smaller section, its outer edge is as far to the right at the one at the top. Each of these three sections has a label written inside. From largest to smallest these are:] Normal people People with truck related jobs or hobbies Parents of children age 2-5

This comic is a graph showing the relationship between time spent in proximity to trucks and level of knowledge about different types of trucks. For the general populace the two tend to go together: people who do not spend much time around trucks are less likely to have knowledge about trucks, and people who spend more time around trucks are more likely to have knowledge about trucks. People with jobs or hobbies involving trucks spend a lot of time with them and must know how they work, so they fit this trend but at a higher level on both axes. The outlier group presented here are parents of small children. Small children think trucks are cool and learn a lot about them, and then share this knowledge with their parents. The children themselves might be counted into the "people with truck-related hobbies" but parents won't and are unlikely to go near any truck. They might also try to keep their children away from them, which is why they have less proximity to trucks than most normal people. The title text presumes that this graph could also be made about dinosaurs and farm animals. Randall confidently states that children like dinosaurs and farms and trucks, and so there must be multimedia featuring all three at once. In fact, books about dinosaurs driving tractors on farms do exist ( Dinosaur Farm! and Dinosaur Farm are two examples), as are books about them driving trucks ( Dinosaur Rescue! ) as well as TV shows about dinosaurs that ARE trucks ( Dinotrux ). Not all three together so far , apparently trucks and farms do not mix very well. [A chart is shown with two axes. Each axis has a label with an arrow pointing from the label towards higher values. No values are shown.] X-axis: Knowledge of different types of trucks Y-axis: Proximity to trucks in daily life [Three sections are marked on the chart with dotted lines, drawn in imperfect ellipses. The first two circumscribe areas along the diagonal X=Y. A large one takes up about two thirds of the length starting from the origin, and a smaller one is separated a bit from the first one, but continuing the trend of X=Y. This takes up less than a third at the top right. Below this, close to the X-axis is a third even smaller section, its outer edge is as far to the right at the one at the top. Each of these three sections has a label written inside. From largest to smallest these are:] Normal people People with truck related jobs or hobbies Parents of children age 2-5

Stargazing 3

Stargazing 3

https://www.xkcd.com/2274

https://www.explainxkcd.com/wiki/index.php/2274:_Stargazing_3

[In a dark panel, Megan as a TV host stands in front of a group of people: Science Girl, Ponytail and Cueball. The panel is inverse-colored, i.e. white text and drawings on black] Host: Welcome back to Stargazing. Host: There are no new stars since last time, but you came back for some reason. [Zoomed out on the same scene, the host is now with Science Girl, Ponytail, Cueball, a Megan-like woman, and White Hat. The host is pointing upwards with her left hand.] Host: That star is Vega. At magnitude 0.03, it's the brightest star I'm currently talking about. Host: That one is Polaris. It's over the North Pole, which is all it has going for it. [A frame-less white panel, zoomed in on the host, who is now pointing upwards with her right hand.] Host: That's a comet. Some of them come back every few decades, no matter how much I yell at them. Host: But stargazing isn't all fun yelling. We face a problem even worse than comets: light pollution. [Back to a dark panel, the host now has a big bag of crossbows. The bag has a logo of a crossbow with stars around it. She has taken out one of them and is holding it in her right hand.] Host: The sky is going away because people keep shining lights at it. The new LEDs are even worse - they're too blue, and you can't turn them off by throwing rocks at them like with the old ones. Host: Luckily, I brought these astronomy crossbows. Host: Take one, then let's fan out and look for lamps.

This is the third and final comic in the Stargazing series. The first 1644: Stargazing appeared four years earlier and the second 2017: Stargazing 2 one and a half years earlier. As in the first two comics, Megan is hosting a stargazing event, in which she mixes accurate astronomical information with trivialities, as well as utterly bizarre statements. (See this section from the original Stargazing comic about the host and also the trivia , from the original comic, regarding the gender of the host). Vega is a star in the constellation of Lyra . It does indeed have magnitude 0.03 and is the brightest star mentioned in this comic. Vega is only the 5th brightest star (outside of the Sun), as Sirius is the brightest visible star. The phrase It's the brightest star I'm currently talking about is an example of the technically correct but not at all useful information that is typical of the Stargazing series. The phrase is true no matter what, because any star one talks about is the brightest star one is talking about, as any brighter star becomes the one talked about when mentioned. [ citation needed ] Polaris is indeed the star over the North Pole, and is commonly called the North Star or the Pole Star. It is the brightest star in the constellation Ursa Minor, but there are about fifty other stars that are as bright as it is (magnitude 2), so it's not really remarkable apart from being the pole star, as Megan says. Despite the fact that being the pole star is "all it has going for it," it is nevertheless very important because it is used for navigation, as it appears fixed in the night sky. It hasn't always been and won't always be the pole star, however, as Earth's axis precesses in a 26,000 year cycle. Comets are comparatively small clumps of rock and ice, seen mostly by the long, lit 'trail' of particles the heat of the sun causes to be ejected, and the solar wind then spreads outward in thin glowing lines that can be larger and more visible even than the constellations they are seen in front of - at least during the brief phase of their closest approach to the sun. Comets generally have highly elliptical orbits around the Sun and so they are only seen for a brief period of time "every few decades" during their closest aproach. Yelling at comets is believed to be an ineffective way to make them go away [ citation needed ] . Megan may dislike comets because of their history in superstition of being seen as a sign of doom. This provides humor because typically this superstitious fear was caused by a lack of understanding, and it would be expected that a stargazing host would be informed on and therefore unafraid of comets. No actual astronomers are bothered by comets [ citation needed ] , but some are upset about satellite megaconstellations such as SpaceX's Starlink . In that case, astronomers are not yelling at the satellites, but at the companies that launch them. Light pollution is indeed a problem with stargazing. Light pollution is the presence of artificial light in the night sky, which makes it very difficult to see stars. Stargazing in remote locations is remarkably different than in populated cities. Light pollution was previously discussed in 2121: Light Pollution . Light pollution does not actually make the "sky go away", but it does affect how humans can see stars or other astronomical features in the sky. Megan advocates an active approach to resolving light pollution—rather than lobbying for reductions in artificial lighting, as the dark-sky movement does, she intends to lead her audience in destroying artificial lights. Older lightbulbs are usually glass bulbs filled with inert gas (for incandescent bulbs) or high-pressure gases (for e.g. sodium-vapor lamps ) and so are easy to destroy with any blunt impact, thus accounting for Megan's mention of "throwing rocks at them". Modern LED lights, however, are much more robust, which is why she is handing out crossbows to achieve greater projectile energy. An " astronomy crossbow " is a tool used to measure the angular distance between stars. They cannot shoot real crossbow bolts , but any type of crossbow or other weapon could be used to destroy lights and "preserve" the sky. (Speaking of astronomy tools that have weapon-related names, there is a type of telescope called a " Sun Gun ", but it is only meant to be used during the day to enable groups of people to view the Sun safely. It is probably best that Megan's show is taking place at night, or else she might cause even more trouble.) In the title text Megan mentions that by destroying enough of the lights in the region will make it possible to see more comets. By reducing the light pollution it will in general be possible to see more of any kind of astronomical objects, not just comets. But as Megan has made clear she dislikes comets, and is thus not interested in seeing any of them. But to see more of any of the other astronomical objects out there, she is willing to take the risk of seeing more comets, by lowering the light pollution. This comic became the last comic not to be related to COVID-19 for more than a month! [In a dark panel, Megan as a TV host stands in front of a group of people: Science Girl, Ponytail and Cueball. The panel is inverse-colored, i.e. white text and drawings on black] Host: Welcome back to Stargazing. Host: There are no new stars since last time, but you came back for some reason. [Zoomed out on the same scene, the host is now with Science Girl, Ponytail, Cueball, a Megan-like woman, and White Hat. The host is pointing upwards with her left hand.] Host: That star is Vega. At magnitude 0.03, it's the brightest star I'm currently talking about. Host: That one is Polaris. It's over the North Pole, which is all it has going for it. [A frame-less white panel, zoomed in on the host, who is now pointing upwards with her right hand.] Host: That's a comet. Some of them come back every few decades, no matter how much I yell at them. Host: But stargazing isn't all fun yelling. We face a problem even worse than comets: light pollution. [Back to a dark panel, the host now has a big bag of crossbows. The bag has a logo of a crossbow with stars around it. She has taken out one of them and is holding it in her right hand.] Host: The sky is going away because people keep shining lights at it. The new LEDs are even worse - they're too blue, and you can't turn them off by throwing rocks at them like with the old ones. Host: Luckily, I brought these astronomy crossbows. Host: Take one, then let's fan out and look for lamps.

Coronavirus Name

Coronavirus Name

https://www.xkcd.com/2275

https://www.explainxkcd.com/wiki/index.php/2275:_Coronavirus_Name

[Megan is carrying a box with biohazard symbols on it towards a desk where Ponytail (wearing safety glasses) is working on a laptop, across from Cueball (also wearing safety glasses) who is putting a test tube into a PCR machine. There's also a flask on the desk.] Ponytail: Feels like we missed the window for the "COVID-19" renaming. "Coronavirus" is just too catchy. Cueball: But it's not specific! There are a lot of coronaviruses. [In a frameless panel, Ponytail (still wearing safety glasses) is pointing at a screen or picture showing a modern city skyline with a large spider crawling across three of the high-rise buildings.] Ponytail: I think it's fine. It's like, you know the giant spider downtown that sits on the buildings and sometimes eats cars? I think technically it's a mutant T. annexa wolf spider, but everyone is just calling it "the spider" and we all know what they mean. [Back to the setting from the first panel. Megan is standing and Ponytail had turned towards her and Cueball has stepped back from the machine.] Megan: I've been meaning to ask, what's with that spider? Should we...do something? Ponytail: Honestly I've been too busy with the virus stuff to look into it-I just changed my commute to avoid Main St. Cueball: Yeah, that's fair. One thing at a time.

This comic is the first comic in a long series of comics about the COVID-19 pandemic . For several weeks in a row, all comics were related to this pandemic. This is thus Randall's first take on the COVID-19 pandemic. As of the publication date (March 2, 2020), the pandemic had infected more than 90,000 people, and had caused more than 3,000 deaths. Coronavirus is a category of viruses named for their appearance, which is similar to a halo or crown, and includes four different viruses which can cause the common cold in humans. However, the virus itself is not called COVID-19, but is called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). So calling the virus or disease "coronavirus" is like calling a specific strain of flu The Influenza virus . However, since the new coronavirus is so hyped in the media it has attracted so much attention, so the name "coronavirus" has become associated with COVID-19, making it difficult to discuss other types of coronaviruses later on. As of March 2, 2020, COVID-19 in China has a 20% hospitalization rate and a 2% death rate by current estimates, compared to a typical rate of around 0.1% for the flu in the US . In this comic, researchers Ponytail , Megan and Cueball are discussing that it is by now too late to try calling the disease its official name COVID-19, as the name coronavirus has stuck. Cueball reacts with dismay, since there are many other types of coronaviruses. To illustrate that Cueball's complaint is excessively pedantic and inconsequential, Ponytail — rather than using a more real-world analogy — compares the coronavirus naming to a giant car-eating spider living on top of the skyscrapers of the town, which people similarly refer to generically as simply "The Spider," even though that is not the most technically-accurate name (it is technically a mutated Tigrosa annexa wolf spider ). Everyone knows what you mean when you say "Coronavirus", as they do when you mention "The Spider". The comic then goes on to poke fun at itself by treating Ponytail's example as a real concern, as Megan then asks if they should not also do something about the spider. But Ponytail and Cueball agree that they can only tackle one problem at a time, and coronavirus takes up all their time. Ponytail further notes that she simply began altering her route to circumvent the location where The Spider has taken up residence, as evidence that the Spider issue can be easily avoided, and is therefore not an immediate concern. The title text references the health advice that people avoid touching their face with unwashed hands, in order to prevent infections that they picked up by touching things from entering their mucous membranes. (It's a lot easier for an infection to enter the body through the inside of your nose than your hands.) It is likewise quite important to keep the giant spider from touching your face, but for the dissimilar reason that it might bite and eat you. Notably, the rename to COVID-19 did eventually catch on as the default description of the disease caused by "The Coronavirus" SARS-CoV2. [Megan is carrying a box with biohazard symbols on it towards a desk where Ponytail (wearing safety glasses) is working on a laptop, across from Cueball (also wearing safety glasses) who is putting a test tube into a PCR machine. There's also a flask on the desk.] Ponytail: Feels like we missed the window for the "COVID-19" renaming. "Coronavirus" is just too catchy. Cueball: But it's not specific! There are a lot of coronaviruses. [In a frameless panel, Ponytail (still wearing safety glasses) is pointing at a screen or picture showing a modern city skyline with a large spider crawling across three of the high-rise buildings.] Ponytail: I think it's fine. It's like, you know the giant spider downtown that sits on the buildings and sometimes eats cars? I think technically it's a mutant T. annexa wolf spider, but everyone is just calling it "the spider" and we all know what they mean. [Back to the setting from the first panel. Megan is standing and Ponytail had turned towards her and Cueball has stepped back from the machine.] Megan: I've been meaning to ask, what's with that spider? Should we...do something? Ponytail: Honestly I've been too busy with the virus stuff to look into it-I just changed my commute to avoid Main St. Cueball: Yeah, that's fair. One thing at a time.

Self-Isolate

Self-Isolate

https://www.xkcd.com/2276

https://www.explainxkcd.com/wiki/index.php/2276:_Self-Isolate

[Cueball sits in an armchair watching television. A zigzag line from the TV indicates that the text is a voice from the TV.] Voice from television: Experts are saying people may need to "self-isolate" to combat the virus. [A slim beat panel with Cueball sitting silent in the armchair.] [Zoomed in on Cueball in the armchair. A starburst on the right border indicates the voice from an off-panel person.] Cueball: ... I've been practicing for this moment my whole life. Off-panel voice: I don't think that's— Cueball: Quick, make plans and watch how fast I cancel!

This comic is the second comic in a row in a series of comics about the COVID-19 pandemic . In this comic, Cueball is watching television and hears a suggestion that people may need to "self-isolate." This refers to the practice of isolating infected individuals, to keep the disease from spreading. If the pandemic grows more severe, going out in large crowds could also be discouraged, to avoid being infected by those around you. According to the HHS , both quarantine and isolation help prevent the spread of infectious diseases, but they are different. Quarantine is for well people who might have been exposed to see if they become sick. Isolation is for sick people to keep them from infecting healthy people. So the suggestion for self-isolation means that sick people should stay away from healthy people. Cueball's response to this advice is that he's "been practicing for this moment [his] whole life". xkcd frequently refers to social awkwardness, introversion, and difficulty with interpersonal interactions. Cueball (likely representing Randall himself) appears to find spending time in public and with large groups trying. It's implied that he prefers to spend time alone (or possibly with small groups of family and close friends) rather than going out. The joke is that this tendency is often seen as unhealthy and alienating, but in the case of a pandemic, actually becomes quite valuable. Cueball seems to take an odd sort of pride in the fact that he's skilled at remaining alone and uninfected, while more social people would be in danger. The comic image is a link to one tweet in a thread of tweets about COVID-19 by @kakape , a science journalist according to their Twitter bio, which says "Social distancing may mean staying further apart from each other physically in coming weeks. We should compensate by caring even more about each other than usually, because we are, of course, all in this together." ( beginning of thread ). In the title text, Cueball continues to be proud of his introversion, claiming that he has been "practicing social distancing" for much of his life. [Cueball sits in an armchair watching television. A zigzag line from the TV indicates that the text is a voice from the TV.] Voice from television: Experts are saying people may need to "self-isolate" to combat the virus. [A slim beat panel with Cueball sitting silent in the armchair.] [Zoomed in on Cueball in the armchair. A starburst on the right border indicates the voice from an off-panel person.] Cueball: ... I've been practicing for this moment my whole life. Off-panel voice: I don't think that's— Cueball: Quick, make plans and watch how fast I cancel!

Business Greetings

Business Greetings

https://www.xkcd.com/2277

https://www.explainxkcd.com/wiki/index.php/2277:_Business_Greetings

[Beret Guy is standing to the left addressing Ponytail, Hairy and Hairbun sitting in office chairs at a table. Hairbun is at the end of the table. All three have one arm on the table.] Beret Guy: I don't think we should overreact to the coronavirus, Beret Guy: But it might be time to put an end to the custom of starting business meetings by everyone licking each others' eyeballs. Hairy: I'll miss the human contact, but that's fair. Hairbun: Gotta change with the times.

This comic is the third comic in a row in a series of comics about the COVID-19 pandemic . With this comic also on that topic, all comics of that week were about the pandemic. This continued for many more weeks. As a reaction to the COVID-19 pandemic, people are refraining from personal contact. This leads to changes with customs in the workplace, such as shaking hands at the beginning of a meeting. The comic shows Beret Guy addressing his employees at his eccentric company ( Ponytail , Hairy and Hairbun , see also 1997: Business Update ). He states that although they should not overreact to the coronavirus, they should at least stop their custom of beginning meetings by "licking each others' eyeballs". Virus or not, it is not common for people to lick anyone's eyeballs at meetings, [ citation needed ] but it could be an extreme stretch of intimate behavior to make an analogy to some cultures' norm of kissing acquaintances in greeting. Humorously, his employees state that they will miss this human contact, but that they at least understand. Contact between saliva and eyes are a very common way to spread the disease. However, this usually occurs from one infected person sneezing and airborne particles randomly coming in contact with an uninfected bystander's eye, or people touching their own faces and eyes after having touched an infected surface, not by applying the saliva directly to a person's eyeball by means of another person's tongue. Also, most people's eyelids instinctually close when they see an object, including someone else's tongue, about to hit them in order to protect the eyeballs, so actually licking each others' eyeballs, as opposed to merely each others' eye lids , would be very difficult for most people, but Beret Guy being able to do this would not be very surprising considering his other abilities, such as being immune to his head being impaled. The title text refers to an actual business custom (exchanging business cards ), but one which is absurdly altered to promote the spread of disease by touching cards and hands to faces. It is not clear whether this is safer or more dangerous than Beret Guy's previous practice of eating business cards, see 1032: Networking . [Beret Guy is standing to the left addressing Ponytail, Hairy and Hairbun sitting in office chairs at a table. Hairbun is at the end of the table. All three have one arm on the table.] Beret Guy: I don't think we should overreact to the coronavirus, Beret Guy: But it might be time to put an end to the custom of starting business meetings by everyone licking each others' eyeballs. Hairy: I'll miss the human contact, but that's fair. Hairbun: Gotta change with the times.

Scientific Briefing

Scientific Briefing

https://www.xkcd.com/2278

https://www.explainxkcd.com/wiki/index.php/2278:_Scientific_Briefing

[Megan and Cueball are showing a graph on a projected screen. The graph is labeled "Things", with "Time" advancing to the right on the x -axis. The level of "Things" has been rising over time to a point labeled "Now". The current level of "Things" is above a level labeled "Good", and about as far below a level labeled "Bad". Megan is pointing to the line of "Things" with a pointer stick, while Cueball is pointing up to the "Bad" level with a pointer stick.] Megan: Here's the situation: Megan: This line is here. Cueball: But it's going up toward here . [White Hat enters the scene. His hand is on his chin. Cueball is no longer holding a pointer stick.] White Hat: So things will be bad? Megan: Unless someone does something to stop it. White Hat: Will anyone do that? Megan: ...We don't know. Megan: That's why we're showing you this. [A narrow panel focusing only on Megan and Cueball.] White Hat (off-panel, left): So you don't know, White Hat: And the graph says things are not bad. Cueball: But if no one acts, they'll become bad. [White Hat is back inside the frame. He is gesturing to Megan and Cueball with his palm up.] White Hat: Well, please let me know if that happens! Megan: Based on this conversation, it already has.

Things are not good, and are going to be bad soon. The only way for things to not be bad is for someone to do something about it. Megan and Cueball are presenting these things to White Hat , evidently hoping to encourage him to do something about things, but he instead chooses to wait for things to become bad, to which Megan replies that the conversation itself indicates they have become bad. Megan's final remark — "Based on this conversation, it already has [become bad]" — is an instance of recursion , and suggests that the unnamed subject of the graph may be something whose worsening is demonstrated by the way the discussion of the graph has gone. The subject of the graph could, therefore, be the phenomenon of people not acting on things that are worsening until they actually become bad, as White Hat proposes to do. At the time this comic came out, the outbreak of COVID-19 was on the rise and about to be declared a pandemic, with widespread perception the US federal government had failed to act before the outbreak became a crisis. The first of the COVID-19 comics, 2275: Coronavirus Name , explicitly showed people not dealing with one problem while they concentrate on another (though in that case they were dealing with COVID-19 while neglecting an invading giant spider). The recursive subject of the graph could also be the deterioration of data analysis into such abstract terms that it no longer depends on the content of the topic supposedly being analyzed. Or, Megan's final remark could be an ironic commentary on the situation without actually referring to the topic of the graph. The ambiguity of Megan's remark may be the point of the humor, as it compounds the absurd ambiguity of the entire discussion. If the graph isn't about the recursive topic of the discussion, what might it be about? At the moment of release, an obvious possible thing on its way to becoming bad was the number of cases of infection in the COVID-19 pandemic. There were a series of comics about COVID-19, including the three comics immediately before and the four immediately after this one. The graph shows a steadily rising line, but with a slight zigzag in it, which could be an intentional similarity to the Keeling Curve . The graph could also be about most anything else, because, as the title text remarks, it applies to "like half of" any things considered. While it's hard to say whether precisely 50% of all things are getting bad (or good), in a more general sense all line graphs would trend at least slightly either up or down. This binary 'either good or bad' finding may lead one to conclude that "like half" of all graphs show something getting bad (or else good). If not everyone agrees on what is "good" or "bad" on some issue, that same issue might even be viewed as going either from good to bad or from bad to good, providing two different graphs for each such issue with 50% of them broadly matching the comic. To whatever extent this comic is related to COVID-19 — which it does not after all explicitly mention, but, at least, COVID-19 exemplifies the problem of waiting to act until things reach a crisis — it would be the fourth comic in a row in a series of comics related to the COVID-19 pandemic . [Megan and Cueball are showing a graph on a projected screen. The graph is labeled "Things", with "Time" advancing to the right on the x -axis. The level of "Things" has been rising over time to a point labeled "Now". The current level of "Things" is above a level labeled "Good", and about as far below a level labeled "Bad". Megan is pointing to the line of "Things" with a pointer stick, while Cueball is pointing up to the "Bad" level with a pointer stick.] Megan: Here's the situation: Megan: This line is here. Cueball: But it's going up toward here . [White Hat enters the scene. His hand is on his chin. Cueball is no longer holding a pointer stick.] White Hat: So things will be bad? Megan: Unless someone does something to stop it. White Hat: Will anyone do that? Megan: ...We don't know. Megan: That's why we're showing you this. [A narrow panel focusing only on Megan and Cueball.] White Hat (off-panel, left): So you don't know, White Hat: And the graph says things are not bad. Cueball: But if no one acts, they'll become bad. [White Hat is back inside the frame. He is gesturing to Megan and Cueball with his palm up.] White Hat: Well, please let me know if that happens! Megan: Based on this conversation, it already has.

Symptoms

Symptoms

https://www.xkcd.com/2279

https://www.explainxkcd.com/wiki/index.php/2279:_Symptoms

[Cueball and Megan stand facing each other, with Cueball looking down at his smartphone held up in one hand.] Cueball: It says here common symptoms include shortness of breath, fever, fatigue, and a dry cough. Megan: That's reassuring to me, a person with powerful lungs, icy skin, frenzied energy, and an incredibly wet cough.

This comic is the fifth comic in a row in a series of comics about the COVID-19 pandemic . The comic states that the symptoms of a disease are shortness of breath , fever , fatigue and dry cough . These are the top 3 and 5th most common symptoms reported for COVID-19. This is thus the fifth comic in a row about this disease, released on the day that the World Health Organization declared the COVID-19 outbreak a pandemic . Looking these symptoms up on his phone, Cueball reads them to Megan who expresses relief. The experiences of hers she claims as normal are so extremely opposite to the symptoms of the disease, that getting it might even be a boon rather than a harm. If a person has powerful lungs, shortness of breath wouldn't be very noticeable. She references icy skin, normally not a fever symptom, although heavy sweating caused by fever can lower temperature. She describes having frenzied energy, the opposite of fatigue. The last symptom is an "incredibly wet cough", and although that is the opposite of a dry cough, it still sounds quite bad. The description she gives opposes COVID-19, but may be indicative of something else. The focus on how symptoms play out differently for people with different normal experiences distantly touches on, but deftly evades, the harsh reality that people who, unlike the comic's characters, already have severe respiratory issues, may die in large quantities unless our response to the virus improves. This is because the impact of a disease relates to how bad its symptoms are for the carriers. Megan's optimistic reaction is ironic, considering these could be symptoms of a whole host of medical situations, including any kind of flu. The title text expands on this joke. Cueball reads up on the side effects from some medicine. Here again they don't have the common side effects of the medicine but the exact opposite, so they think they must be fine, even though those "anti-symptoms" are themselves cause for concern. It also reflects on the whole concept of symptom/side effect warnings themselves as often people have no good frame of reference for when a particular symptom is actually abnormal. It is often easy for one to believe they match some or all of a list of symptoms because for someone to be absolutely sure they do not have a specific symptom, they would need an almost comic level of "normality". The medicine is supposed to make the user: Having a heavy head is not a good sign, even though the opposite is also not good. Dry mouth can be annoying but her condition sounds dangerous. And although blurred vision is a bad thing, it is impossible for a human eye to follow the 12-80 beats a second of a hummingbird; this suggests that Megan might be hallucinating, which is arguably even worse. Much later in 2580: Rest and Fluids , the joke is again on symptoms or rather getting them again. The pandemic was still going almost two years later. [Cueball and Megan stand facing each other, with Cueball looking down at his smartphone held up in one hand.] Cueball: It says here common symptoms include shortness of breath, fever, fatigue, and a dry cough. Megan: That's reassuring to me, a person with powerful lungs, icy skin, frenzied energy, and an incredibly wet cough.

2010 and 2020

2010 and 2020

https://www.xkcd.com/2280

https://www.explainxkcd.com/wiki/index.php/2280:_2010_and_2020

[White Hat and Cueball are walking to the right of the panel. There is a gray outline around Cueball, indicating he is from the future] White Hat: What are things like ten years from now in 2020? White Hat: We have this new "bitcoin" thing — does it ever catch on and become normal? [A frameless panel, with White Hat and Cueball still walking to the right.] Cueball: It's still around. I just bought a bottle of hand sanitizer for one bitcoin. [A regular panel, with them continuing to walk] White Hat: Cool, that sounds pretty normal. Cueball: Well, here's the thing...

This comic is the sixth comic in a row in a series of comics about the COVID-19 pandemic . White Hat , who lives in 2010, and Cueball , who lives in 2020, are in contact with each other via some kind of time travel. White Hat wants to learn about life in 2020 and is particularly interested in bitcoin , a decentralized cryptocurrency which was released in 2009, and whether it had become an acceptable currency. Cueball answers that bitcoin still exists, and that he just bought a bottle of hand sanitizer for the price of one bitcoin. White Hat probably assumes that bitcoin is a widely accepted currency worth a few dollars, and thinks that the situation is "normal". (In April 2010, one bitcoin was worth about 14 cents.) At the time of this comic, the COVID-19 is spreading around the world, causing thousands of people to die (although relatively few compared to the number of people that have gotten better) and billions to panic. This increased the demand for hygiene products, including hand sanitizers, and therefore their price has increased. It also triggered a panic on financial markets, including severe devaluation of the infamously volatile bitcoin. Despite the crash, one bitcoin was still worth about $5,400 on the day this strip was published, not a few dollars. Therefore, buying a hand sanitizer for one bitcoin is not as normal as White Hat assumes. The price of hand sanitizer has not reached the price of a bitcoin (yet), although some people on sites such as Amazon.com are attempting to sell it for ludicrous amounts and there are attempts by Amazon, eBay, and other selling platforms, as well as potential legislation, aimed at curtailing such price gouging . The title text claims that, in 2030, bitcoin will again be worth about one dollar, but many houses will also be worth only one dollar due to the difficulty inherent in containing "holo-banshees" in the attic. What a holo-banshee is is not explained, but one can guess as to what it might mean. "Holo" is generally short for hologram and typically denotes some kind of 3D looking digital visual form, and a " banshee " is a mythological wailing creature or spirit. So even if not a physical object, constant shrieking would be undesirable. [ citation needed ] The "nominal fee" mentioned by the 2030 time traveler is known in legal parlance as a "peppercorn". In reality, such a practice has been quite common for several decades (though not for something on the scale of a house); legal processes state that both sides must give something in order for a contract to exist, and a minimal peppercorn payment to secure a contract is preferable to the legal hoops that must be jumped through in order to lawfully give something away for nothing. [White Hat and Cueball are walking to the right of the panel. There is a gray outline around Cueball, indicating he is from the future] White Hat: What are things like ten years from now in 2020? White Hat: We have this new "bitcoin" thing — does it ever catch on and become normal? [A frameless panel, with White Hat and Cueball still walking to the right.] Cueball: It's still around. I just bought a bottle of hand sanitizer for one bitcoin. [A regular panel, with them continuing to walk] White Hat: Cool, that sounds pretty normal. Cueball: Well, here's the thing...

Coronavirus Research

Coronavirus Research

https://www.xkcd.com/2281

https://www.explainxkcd.com/wiki/index.php/2281:_Coronavirus_Research

[A very disheveled Megan, hair in disorder, walks up to Cueball.] Megan: Hi. Cueball: Hello. You look...fine. [In a frame-less panel Megan has stopped next to Cueball.] Megan: I have now read virtually every available scientific paper on COVID-19. Cueball: Cool, what'd you learn? [Megan has raised her palms towards Cueball.] Megan: Well it seems this virus wants to get inside your cells. Cueball: Mhmm... [Megan raises her left arm, with her index finger in the air in front of Cueball's face.] Megan: But it's a trap! You shouldn't let it. Cueball: I think we knew that. Megan: But now I know it with error bars!

This comic is the seventh comic in a row in a series of comics about the COVID-19 pandemic . Megan , disheveled and exhausted, has been researching COVID-19 nonstop and is now reporting her findings to Cueball . She claims to have read all available literature on the subject, but the best she can come up with is an extremely basic fact about viruses —namely that they infect cells and this is bad and should be prevented, which Cueball and just about everybody else already knew. She enthusiastically replies that she now knows this with error bars , which are graphical representations of the variability of data and are used on graphs to indicate the error or uncertainty in a reported measurement. Perhaps because of her sleep deprivation, she is unable to process the information that she has read, or is unable to properly phrase it in words. This is not the first time that Megan has exhaustively researched a topic to the detriment of her own health, see 1708: Dehydration . In the title text, she has a hunch that staying awake long enough to read 500 scientific papers is probably not a good idea, but she hasn't found a study that specifically confirms that. She intends to further compound her exhaustion by continuing to do research rather than just getting some much-needed sleep. Assuming that Megan averages half an hour to find and read each paper, she has been continuously reading for 10.4 days, which is approaching the world record for not sleeping. In 1964, Randy Gardner , a student in San Diego, California set the then-world record of 11 days and 25 minutes (264.4 hours) without sleeping. [A very disheveled Megan, hair in disorder, walks up to Cueball.] Megan: Hi. Cueball: Hello. You look...fine. [In a frame-less panel Megan has stopped next to Cueball.] Megan: I have now read virtually every available scientific paper on COVID-19. Cueball: Cool, what'd you learn? [Megan has raised her palms towards Cueball.] Megan: Well it seems this virus wants to get inside your cells. Cueball: Mhmm... [Megan raises her left arm, with her index finger in the air in front of Cueball's face.] Megan: But it's a trap! You shouldn't let it. Cueball: I think we knew that. Megan: But now I know it with error bars!

Coronavirus Worries

Coronavirus Worries

https://www.xkcd.com/2282

https://www.explainxkcd.com/wiki/index.php/2282:_Coronavirus_Worries

[A scatter-plot, with 8 labeled dots. Both axis are labeled with text beneath the X-axis and to the left of the Y-axis. Arrows are pointing to the right from the X- axis and up from the Y-xis. The dots are scattered from left to right and top to bottom, but there are some grouping of the labels with two to the left, four in the middle and two to the right. But the dots they belong to are more scattered than this. Here below all labels are given, first for the axis, and then for each dot in approximately normal reading order from the left column to the right column:] Y-axis: More healthy X-axis: More common [Top left]: Whether you're remembering to drink water and rest [Very bottom, near left]: Whether forgetting to drink water or rest will make you get the coronavirus [Very top, near right]: Whether you're able to stay home [Top leaning, right]: Whether your friends and family are able to stay home [Middle, leaning right]: Whether your government is reacting wrong [Very bottom center]: Whether random people in a news story are reacting wrong [Toward bottom right]: Whether you're getting enough work done [Very bottom right]: Whether you have the virus because you just coughed and last week you touched a doorknob

This comic is the eighth comic in a row in a series of comics about the COVID-19 pandemic . Randall has created a scatter plot graph showing "more common" worries versus the "more healthy" worries. Presumably, "more healthy" refers to more important things to worry about concerning the COVID-19 pandemic. From this graph, Randall notes that the "more healthy" concerns are not necessarily the ones that are the most common. On the left side of the graph, signifying "less common" worries/concerns are concerns relating to the drinking of water, and resting. Drinking water (staying hydrated) and getting enough sleep each night are important ways to fight off disease, and they're things that almost everyone can take direct action on, so this is marked as one of the most healthy things to worry about. In 2281: Coronavirus Research , Megan shows signs that she (like many) has not been taking care to get enough sleep. However, not drinking enough water and not sleeping enough are not likely to cause coronavirus specifically, so that particular worry is marked as one of the least healthy. In the middle of the graph are "medium common" worries/concerns. The "most healthy" or vital concerns are being able to stay home and the ability for friends and family to stay home. Across much of the world, public gatherings have been discouraged, including requiring many workers to telecommute . This is following the principle of social distancing , to slow the spread of COVID-19. These are considered very healthy concerns to be having. Below these two concerns is concerns about the government response, specifically if the government is "reacting wrong". Many world governments have been criticized for inadequate responses to the pandemic. However, even if the government's response (or lack of response) is incorrect, it is not something that most people can control directly, nor should it prevent people from taking care of the more healthy concerns about staying home and staying well-hydrated and well-rested, which is why this worry is marked as being only moderately healthy. Even less important than the government response is worrying about the reactions of random people featured in news stories (who are most likely featured specifically because their behavior is extreme or aberrant) or Internet trolls or people who have different opinions to you in the story's comments section. A more common concern listed is "whether you are getting enough work done". Telecommuting (working from home) may be less productive than working at the normal office, so Randall or others may be concerned about their work productivity. For people working in industries that directly affect the health and well-being of others, such as medicine, this is a fair concern (and many of the event cancellations and other responses are intended to make their jobs easier), but in general, this is a much less healthy concern than staying home and well-rested. The most common and least important concern according to Randall is "whether you have the virus just because you just coughed and last week you touched a doorknob". Though it is an important to be concerned about catching the coronavirus, simply coughing a few times or "touching a doorknob" are unlikely reasons to suspect having COVID-19. Most cases of COVID-19 do include a cough, and the disease can be latent for over a week before showing symptoms, but also include other symptoms, including fever and difficulty breathing. The title text lists an uncommon, unimportant concern: the copyright status of a "coronavirus emoji" on Slack (a business instant messaging software). The Creative Commons license is a license allowing for fair use of published work (and presumably emojis) that are otherwise copyrighted. Something that is in public domain has no copyright protection on it, and can be used freely. Presumably, this is a concern that only Randall has, making it uncommon. It is also relatively unimportant in the greater scheme of the COVID-19 pandemic. [A scatter-plot, with 8 labeled dots. Both axis are labeled with text beneath the X-axis and to the left of the Y-axis. Arrows are pointing to the right from the X- axis and up from the Y-xis. The dots are scattered from left to right and top to bottom, but there are some grouping of the labels with two to the left, four in the middle and two to the right. But the dots they belong to are more scattered than this. Here below all labels are given, first for the axis, and then for each dot in approximately normal reading order from the left column to the right column:] Y-axis: More healthy X-axis: More common [Top left]: Whether you're remembering to drink water and rest [Very bottom, near left]: Whether forgetting to drink water or rest will make you get the coronavirus [Very top, near right]: Whether you're able to stay home [Top leaning, right]: Whether your friends and family are able to stay home [Middle, leaning right]: Whether your government is reacting wrong [Very bottom center]: Whether random people in a news story are reacting wrong [Toward bottom right]: Whether you're getting enough work done [Very bottom right]: Whether you have the virus because you just coughed and last week you touched a doorknob

Exa-Exabyte

Exa-Exabyte

https://www.xkcd.com/2283

https://www.explainxkcd.com/wiki/index.php/2283:_Exa-Exabyte

[Miss Lenhart is holding a pointer, and is pointing it towards a blackboard behind her, while she addresses her student Cueball who is sitting on a chair at a desk to the left of her, holding his hands on his knees.] Miss Lenhart: Biology is hard because there's so much of it. Earth hosts about 10 exa-exabytes worth of DNA. [In a frame-less panel, the panel has panned to the left and is now showing Miss Lenhart holding the pointer to her side, but without the blackboard. In front of her is now both Cueball and Megan sitting at their desks. Cueball has taken one hand on to the table. Megan has both hands folded on the table in front of her.] Cueball: What's an exa-exabyte? Miss Lenhart: It's 10 36 bytes. Cueball: How do I picture that? Miss Lenhart: Imagine you had an exabyte of data, but each byte contained an exabyte of data. [Zoom in on Cueball's head. A starburst to the right indicates Miss Lenhart's voice from off-panel.] Cueball: I can't even picture what an exabyte is. Miss Lenhart (off-panel): It's 10 18 bytes. Cueball: But how do I picture 10 18 ? [Zoomed out to showing Megan, Cueball, and Miss Lenhart along with the blackboard. Megan has raised a hand palm up. Cueball is looking back at her over his shoulders. Miss Lenhart is forming a closed first with her empty hand, the one without the pointer.] Megan: Imagine you had 10 apples. Megan: Now imagine 18 smaller apples, floating next to them and a little above. Cueball: Cool, got it. Miss Lenhart: No! In 1519: Venus , release date May 1, 2015, Miss Lenhart indicated that she was retiring as a primary or secondary school teacher in a month. Here we see Megan and Cueball, both adults, sitting in a classroom setting with Miss Lenhart providing instruction. A reasonable assumption is that Miss Lenhart has taken some form of adult education job during her retirement. For example, in the United States it is common for community colleges to use low paid adjunct professors who either have a day job or another source of income such as a teacher's pension. There is also a hint of irony in her having to now put up with the same type of blatantly incorrect explanations that she herself was freely giving out just prior to her retirement.

This comic is arguably the ninth comic in a series of comics related to the COVID-19 pandemic . This comic does not mention the disease but it does mention biology. This is a comic about the difficulty of picturing or understanding large numbers. As mentioned in the comic, an exabyte is 10 18 bytes, while an "exa-exabyte"—not a common word, but one that abuses the principles of metric prefixes —would be 10 36 bytes. 10 36 is properly given the name undecillion (in short scale, and sextillion in long scale). According to a 2015 article by The New York Times , researchers estimate that there are about 5 * 10 37 DNA base pairs on Earth (50 trillion trillion trillion). So Miss Lenhart 's claim of 10 exa-exabytes—1 * 10 37 bytes is a reasonable approximation ( Fermi estimation ). (The estimate was 5 plus or minus 4 * 10 37 . There are 4 possible base pairs, or 2 bits per pair, a byte is 8 bits.) These numbers are larger than most people can imagine. Even much smaller numbers such as a billion (10 9 ) or a trillion (10 12 ) are hard to imagine. For instance: Wikipedia has an article on the exabyte and one on large numbers which describes various things close to 10 18 . Cueball expresses his difficulty in visualizing a number even as large as one exabyte (10 18 bytes). Megan trivializes the problem away by describing an exabyte as 10 apples, with "18 smaller apples, floating next to them and a little above", representing the notation 10 18 using apples for digits. This is entirely unhelpful, as using apples in a base-1 enumeration offers no obvious advantages over base-10 in understanding exponents; Megan's bad advice & Cueball's seemingly ready acceptance of it causes Miss Lenhart to yell out "No!" in frustration. The title text further trivializes the problem of visualizing large numbers by suggesting that you can visualize 10 18 as a number by simply visualizing the similar-looking number of 10 13 with some extra lines drawn to turn the 3 into an 8. Changes in exponents can cause huge changes in the value shown, and this is no exception: Changing that 3 into an 8 changes the value by a factor of 100,000. Randall has previously discussed the difficulty of large numbers in 2091: Million, Billion, Trillion , 1894: Real Estate , and 558: 1000 Times . 1605: DNA also discusses how "hard" biology is. [Miss Lenhart is holding a pointer, and is pointing it towards a blackboard behind her, while she addresses her student Cueball who is sitting on a chair at a desk to the left of her, holding his hands on his knees.] Miss Lenhart: Biology is hard because there's so much of it. Earth hosts about 10 exa-exabytes worth of DNA. [In a frame-less panel, the panel has panned to the left and is now showing Miss Lenhart holding the pointer to her side, but without the blackboard. In front of her is now both Cueball and Megan sitting at their desks. Cueball has taken one hand on to the table. Megan has both hands folded on the table in front of her.] Cueball: What's an exa-exabyte? Miss Lenhart: It's 10 36 bytes. Cueball: How do I picture that? Miss Lenhart: Imagine you had an exabyte of data, but each byte contained an exabyte of data. [Zoom in on Cueball's head. A starburst to the right indicates Miss Lenhart's voice from off-panel.] Cueball: I can't even picture what an exabyte is. Miss Lenhart (off-panel): It's 10 18 bytes. Cueball: But how do I picture 10 18 ? [Zoomed out to showing Megan, Cueball, and Miss Lenhart along with the blackboard. Megan has raised a hand palm up. Cueball is looking back at her over his shoulders. Miss Lenhart is forming a closed first with her empty hand, the one without the pointer.] Megan: Imagine you had 10 apples. Megan: Now imagine 18 smaller apples, floating next to them and a little above. Cueball: Cool, got it. Miss Lenhart: No! In 1519: Venus , release date May 1, 2015, Miss Lenhart indicated that she was retiring as a primary or secondary school teacher in a month. Here we see Megan and Cueball, both adults, sitting in a classroom setting with Miss Lenhart providing instruction. A reasonable assumption is that Miss Lenhart has taken some form of adult education job during her retirement. For example, in the United States it is common for community colleges to use low paid adjunct professors who either have a day job or another source of income such as a teacher's pension. There is also a hint of irony in her having to now put up with the same type of blatantly incorrect explanations that she herself was freely giving out just prior to her retirement.

Sabotage

Sabotage

https://www.xkcd.com/2284

https://www.explainxkcd.com/wiki/index.php/2284:_Sabotage

[Cueball is seated at a desk, typing on a laptop. The top half of the image is the text he is typing in a reply message:] "I see you're still getting together today! I'll be there, doing my spoken-word Baby Shark karaoke all evening. We'll also be setting up a petting zoo for the kids. We've spent all week trapping wild skunks!" [Below the text is a white-on-green "reply" button.] [Caption below the panel:] In the coronavirus era, desperate times call for desperate measures.

This comic is the tenth comic in a row in a series of comics about the COVID-19 pandemic . In the wake of the COVID-19, the advice from many professionals in the United States is to avoid public gatherings to slow the spread of the disease and "flatten the curve". In this comic, some group of people (we're not told who) are planning a public event, which is very much contrary to the widespread professional advice, and is said to put everyone at risk by accelerating the spread of the disease in the general population. In an effort to sabotage this event by deterring people from attending, Cueball applies reverse psychology, pretending to be enthusiastically planning various activities at the gathering that most people would go out of their way to avoid: a wild skunk petting zoo, which would most likely result in everyone getting heavily sprayed with violently foul-smelling skunk scent that wild skunks use to drive away predators; and karaoke featuring the song " Baby Shark ", which is a song for small children that is generally considered annoying to adults, made even more direly annoying in this case by being spoken rather than sung. In the title text, Cueball has stepped up his game from merely threatening to spoil everyone's fun to making them fear that they might get infected. He claims to have attended the "World Handshake Championships", which presumably would involve shaking hands with as many people as possible; this would facilitate the spread of diseases such as COVID-19. He furthermore claims to have traveled home from the championship via a cruise ship, which may also cause concern because cruise ships are known for their densely populated environments and lack of extensive medical facilities making prevention and treatment of infections very difficult or impossible. Cruise ships have been a recent topic of interest in relation to SARS CoV-2 due to many people being stranded at sea with infected patients because of COVID-19 pandemic on board. [Cueball is seated at a desk, typing on a laptop. The top half of the image is the text he is typing in a reply message:] "I see you're still getting together today! I'll be there, doing my spoken-word Baby Shark karaoke all evening. We'll also be setting up a petting zoo for the kids. We've spent all week trapping wild skunks!" [Below the text is a white-on-green "reply" button.] [Caption below the panel:] In the coronavirus era, desperate times call for desperate measures.

Recurring Nightmare

Recurring Nightmare

https://www.xkcd.com/2285

https://www.explainxkcd.com/wiki/index.php/2285:_Recurring_Nightmare

[Megan, standing next to Cueball, is gesturing with her arms wide.] Megan: I keep having nightmares that I show up at school, and then suddenly panic as I realize– Cueball: –that you're naked? Megan: That I'm in a crowded room!

This comic is the eleventh comic in a row in a series of comics about the COVID-19 pandemic . Megan states to Cueball that she keeps having the same nightmare. As she begins to explain that in her dream she shows up at school and panics as she realizes something, Cueball interrupts her to suggest she has turned up at school naked. But instead, Megan says that she finds herself in a crowded room at school. It is an allegedly frequent dream-trope to be in a situation of otherwise polite company and discover oneself naked in the midst of the crowd. This can be added to something such as a general " forgotten to prepare for the exam you're sitting " to build upon various levels of worst-case scenario anxieties amongst your peers, parents or other persons who will judge you badly for your faux pas . In light of the current COVID-19 pandemic, Megan is obviously dreaming up her problem of being in a crowd (at school), as most schools have stopped holding in-person classes (at the time of this comic, most schools in many countries had switched to online instruction or have completely closed due to the pandemic). Social distancing has been widely practiced around the world as a way to slow the spread of the disease. In the title text, Megan finds relief in dreaming that she's naked, as her nudity, perhaps similar to the actual real-life 'health tip' of eating excessive garlic, has the unintentional but beneficial effect of having crowd members back away from her personal space out of shock and/or mutual embarrassment. This may somewhat mitigate the viral transmission by droplets from coughs, although to be more protected, Megan should dream that she is at least wearing a face mask, or that she is going to thoroughly wash her hands as soon as possible, in case she has touched any contaminated surfaces. Nightmares about school were also the topic of 557: Students , specifically stating that people have dreams about school, even when already having graduated. [Megan, standing next to Cueball, is gesturing with her arms wide.] Megan: I keep having nightmares that I show up at school, and then suddenly panic as I realize– Cueball: –that you're naked? Megan: That I'm in a crowded room!

6-Foot Zone

6-Foot Zone

https://www.xkcd.com/2286

https://www.explainxkcd.com/wiki/index.php/2286:_6-Foot_Zone

[Caption:] Guide to the 6' Social Distancing Zone [Profile image of Megan with 6 foot distance measurements on both sides. Also indicated is the width of the full "6' zone", which consists of 6' to her right, her width, and 6' to her left. Her width is not explicitly indicated.] [Overhead image of a person within a slightly elliptical outline at a distance of 6 feet in all directions. The "width" of the person pushes the ellipse longer in one dimension. The ellipse is again labeled "6' zone".] [Statistics:] Approx. area: 145 ft 2 Border length: 43 ft Population density: 190,000 people/mile 2 Value at NYC real estate price/ft 2 : $195,000 Maximum number of horses that could fit inside it with you, estimated using the dimensions in the US Forest Service Equestrian Design Handbook : 8 [This last statistic is illustrated with a second overhead image, showing 8 horses, mosaicked together a little like an M.C. Escher tesselation, filling the entire 6' zone along with the person.]

This comic is the 12th comic in a row in a series of comics about the COVID-19 pandemic . This comic is about social distancing , a common practice to prevent the spread of the COVID-19. It has been suggested to maintain 6 feet (i.e. 1.8288 m - in e.g. France and Britain the suggested distance is 2 m) of distance between yourself and other people, to prevent the transmission of respiratory droplets from you to others (or vice versa). Randall takes this 6 feet of distance, and does calculations of the "area" of distancing, "border", population density, and "real estate value". He finally culminates in determining the number of horses that could also fit in the space. Randall's border length and approximate area calculations are based on a zone with an outside radius of approximately 6.8 feet or 82 inches (2.07 m), meaning that the person has a radius of approximately 0.8 feet (9.6 in, 0.24 m). That is, 2π(6.8ft) = 42.7 ft and π(6.8ft) 2 = 145.3 ft 2 . There are two different population densities that can be calculated. The one used by Randall in the comic is the population density of the exclusion zone itself, i.e. just the reciprocal of its area. This is π -1 (6.8 ft) -2 = 190,000 mi -2 . A different density is the density of a crowd in which everyone obeys the distancing rules. That would result in 0.9069(π -1 )(3.8ft) -2 = 560,000 mi -2 population density. When people stand 6ft apart from each other, their exclusion zones are overlapping; instead we can use smaller circles with 3.8 ft radius that are not overlapping. 0.9069 is the packing density of circles in the plane. For comparison, only 21 countries have a population density >1000 mi -2 , but there are a few cities with a population density on the same order of magnitude (~100,000 mi -2 ). The USFS Equestrian Design Guidebook is (of course) a real thing, and it discusses the dimensions of the design horse The title text is a pun using the alternate definition of foot by switching the naming from 6-foot zone, where foot is used as a unit of distance, to 34-foot zone, where the number represents the total number of feet inside the circle, including the horses’ feet, assuming the human is endowed with the standard two feet and each horse has the standard four feet apiece. [Caption:] Guide to the 6' Social Distancing Zone [Profile image of Megan with 6 foot distance measurements on both sides. Also indicated is the width of the full "6' zone", which consists of 6' to her right, her width, and 6' to her left. Her width is not explicitly indicated.] [Overhead image of a person within a slightly elliptical outline at a distance of 6 feet in all directions. The "width" of the person pushes the ellipse longer in one dimension. The ellipse is again labeled "6' zone".] [Statistics:] Approx. area: 145 ft 2 Border length: 43 ft Population density: 190,000 people/mile 2 Value at NYC real estate price/ft 2 : $195,000 Maximum number of horses that could fit inside it with you, estimated using the dimensions in the US Forest Service Equestrian Design Handbook : 8 [This last statistic is illustrated with a second overhead image, showing 8 horses, mosaicked together a little like an M.C. Escher tesselation, filling the entire 6' zone along with the person.]

Pathogen Resistance

Pathogen Resistance

https://www.xkcd.com/2287

https://www.explainxkcd.com/wiki/index.php/2287:_Pathogen_Resistance

[A small colony of coccus bacteria, a bacteriophage, and a protozoon, with an eye, are floating together.] Bacteriophage: I'm worried about humans developing resistance to us. Bacteriophage: Using pasta. [In a half height panel we see two macrophages, each with an eye, and lots of Y-shaped antibodies chasing three protozoa, also with one eye each. One protozoon is already covered in antibodies and seems to have fallen over. Above the panel is the text that the bacteriophage is narrating.] Bacteriophage (narrating): The human immune system is a nightmare. Bacteriophage (narrating): It's the worst. Bacteriophage (narrating): It's the scariest thing in the universe. Macrophage: Who wants a Huuggg Antibody-covered protozoon: Nooo! [Close-up on bacteriophage] Bacteriophage: We can only survive by staying ahead of it. Keep jumping from person to person, keep mutating and evolving. Bacteriophage: But now humans are adapting too fast. [Water pipes. A mosquito net with a bed under it. An unopened condom package.] Bacteriophage (narrating): We spread through their water. They built pipes. Bacteriophage (narrating): We used mosquitoes. They put out nets and poison everywhere. Bacteriophage (narrating): We spread through sex, and suddenly they all had these plastic things. [Depictions of seven coronavirus with spikes, one very large, one large, two small and three tiny. They are above a picture of Hairbun and Cueball shaking hands, while exhaling a cloud and tiny droplets spraying all over from both their clouds from exhaling.] Bacteriophage (narrating): This time, we really thought we had them. Bacteriophage (narrating): One of us got good at transmission through everyday contact. [A row of four sets of human lungs and their trachea is shown. The first set of lungs has just one black dot in the left and a few black dots in the right lung. The second has the bottom right lung covered in black, and the left lung has a bit black on either side and still some black dots in the middle. The third has most of each lung covered in black, except maybe a quarter of each lungs top. The fourth set of lungs are completely filled with black. Below them is a graph showing exponential growth with an X-axis with 17 equidistant ticks and to the right a Y-axis with eight equidistant ticks. This time the narrating is indicated to come from off-panel left with a speech line, and so are the two answers, coming from the off-panel right. It is like if the speakers are looking at this chart from off-panel.] Bacteriophage (off-panel left): It was great. We were tearing through lungs, spreading like wildfire. Voice (off-panel right): Hooray! Voice 2 (off-panel right): I hate lungs. [Close-up of bacteriophage "head".] Bacteriophage: Then, all of a sudden, humans everywhere just... stopped . They stopped working, stopped seeing friends. [Megan is sitting on a couch with a remote control in her hand, watching a flat screen TV. Cueball is at a sink with a mirror, washing his hands under hot water indicated by heat lines coming up from his hands. They are facing away from each other. Again speech is come from off-panel left and right with speech lines] Voice (off-panel left): What are they doing ? Bacteriophage (off-panel right): Nothing! Bacteriophage (off-panel right): They're just sitting there in their houses washing their hands. [Cueball stands in an otherwise empty room He is surrounded by falling droplets, many of which are now lying on the floor around his feet. Among the droplets is a coronavirus that shouts out.] Bacteriophage (narrating): Suddenly humans became dead ends. We tried to jump from one to the next, but there's no one to jump to. Coronavirus: Help! Bacteriophage (narrating): We can't escape. [Three large Coronaviruses and several smaller ones are encroached on by at least four macrophages, one showing a large eye, surrounding them as well as streams of Y-shaped antibodies mowing in towards the viruses. A rectangular panel at the top, is placed over the top edge of the panel. The narrating text is inside this panel:] Bacteriophage (narrating): We're trapped in there with those ghastly immune systems. Antibodies: It's huug tiiiiime Macrophage top left: Come here for a huuug Macrophage bottom left: Huuuuugs [A slim panel, with text above and below the panel with narration. In the panel there are two larger coronaviruses covered in antibodies and attacked directly by macrophages. Smaller coronavirus are shown covered in antibodies as well. Some of the macrophages are actively devouring viruses. While others already contain broken-down remnants of a coronavirus. Most of the macrophages has an eye.] Bacteriophage (narrating): Even if we win a fight, there's nowhere to go. Macrophage a the top: Huuuuuuuggss Macrophage at the bottom: Huuugs Bacteriophage (narrating): By staying inside, humans have become resistant. [Back to the discussion between the coccus, the bacteriophage and the protozoon with eye.] Coccus bacteria: How could they evolve that fast? Humans take decades to reproduce! Bacteriophage: It's not evolution. It's something with their brains. Protozoon: I wondered what those were for! [Bacteriophage pointing with a leg to Cueball and Megan who are looking at their phones; Megan and Cueball are then walking to the right; Megan and Cueball are shown at separate sinks with mirrors washing their hands.] Bacteriophage: Humans started looking at their phones, talking, writing words, and making signs. A human named "Gloria Gaynor" filmed herself singing at her bathroom sink. Bacteriophage: And then they bought lots of pasta. Bacteriophage: Then, around the world, they all went home and started washing their hands. [Bacteriophage and protozoon with eye.] Bacteriophage: They saw what we were doing and changed their behavior to stop us. Protozoon: Brains are the worst . [Coccus, bacteriophage and protozoon with eye.] Coccus bacteria: It's not over, right? They can't sustain this. They must be bored and tired. Coccus bacteria: Will they give up? Bacteriophage: I don't know. They seem determined to protect each other. [Coccus, bacteriophage and protozoon with eye.] Bacteriophage: And Bacteriophage: They have a lot of pasta.

This comic is the 13th comic in a row in a series of comics related to the COVID-19 pandemic . Rather than expressing humanity's fears and pessimism about the pandemic, this strip anthropomorphizes some of the pathogens which afflict humanity and presents their fears and pessimism about possibly going extinct. This serves as a roundabout way of expressing hope and wonder at the ingenuity and tenacity of humans in the face of diseases past (with water sanitation, mosquito netting, and condoms) and present (with the power of social distancing and Gloria Gaynor 's hit song I Will Survive ). Gaynor recorded a video of herself washing her hands for 20 seconds (the recommended length of time to wash hands for optimal cleanliness) to the background of her hit song. The three pathogens presented are a virus (a bacteriophage ), a small colony of a coccus -shaped bacterium (such as Streptococcus ), and a protozoon (a caricature of a ciliate ). Bacteriophages do not infect human cells (as the name suggests, they only infect bacteria), and have been studied for use as " phage therapy " for humans, especially in dealing with antibiotic-resistant bacterial infections (which is usually what people mean when they talk about "resistance" in the context of pathogens); however, they are iconic, instantly-recognizable viruses, and some have been found to collude with bacteria in forming certain antibiotic-resistant biofilms . Only one kind of ciliate is known to cause human disease; however, ciliates are iconic for protozoa just as bacteriophages are for viruses (see, for example, Gary Larson's now-venerable The Far Side cartoons). The ciliate may be a 'stand-in' for protozoa that cause widespread and dangerous human diseases, such as malaria . The drawing is wildly out of scale; a protozoon is larger than a bacterium, which in turn is much larger than a virus. "The scariest thing in the universe" to these microbes is the human immune system, represented in the second panel and later by antibodies (Y-shaped drawings) and anthropomorphized macrophages (actual macrophages do not have glaring angry eyes [ citation needed ] ). When a T cell encounters an unfamiliar molecule in the body, such as the surface proteins of SARS-CoV-2, it will search for a B cell that produces a matching antibody. If and when it finds such a B cell, it will command the B cell to rapidly multiply and mass-produce antibodies. Those antibodies will then bind to any antigens they contact, which may impede the antigen (as shown by the tagged protozoon in panel 2 lagging behind its siblings) and will definitely mark them for destruction by macrophages, which engulf ("HUUGGG") and digest antibody-tagged objects they encounter. T cells can also be described as hugging cells , but a hug from a T cell is used to activate other processes, while a hug from a macrophage is a precursor to digestion. White blood cells are quite persistent once they have detected an antigen, even chasing them over many cell lengths in what must be a terrifying experience for the antigen being chased. The comic humorously considers pasta as an essential part of humans' fight against coronavirus. Pasta is an example of a dried food that can last a long time, if the orders to stay indoors continue, and was one of many products bought in mass quantities by shoppers "panic-buying" at the onset of lockdowns. Pasta is a popular dish in Italy, which is experiencing particular difficulties with COVID-19, but not every culture consumes or likes pasta. In addition, the Gaynor vid was initially shared via soundpasta.com among other services, and "pasta" is sometimes used to refer to sharing over the internet via cut-and-paste. The colony of cocci protests that it shouldn't be possible for humans to evolve "pathogen resistance" in the short period of months since the breakout of COVID-19, when humans require over a decade to reach sexual maturity, and in modern times often wait at least two decades before having children. Humans develop immunity to some diseases after being infected, as some B cells become memory cells and are stored for quick re-activation in the case of a later infection, but this is not very effective against viruses which mutate rapidly, such as influenza and the common cold (which is sometimes caused by coronaviruses, although not SARS-CoV-2). Bacteria and viruses, on the other hand, reproduce in a matter of minutes, so that there may be hundreds of generations per day (comparable to the number of generations that have passed for humanity since the beginnings of agriculture), each of which presents opportunities to evolve new antigens that are not recognized by any antibodies present in the body or to evolve resistance to whatever antibiotic drugs the host might be using. However, as the bacteriophage explains, humans generally do not become resistant against pathogens by genetic drift (although there are researchers who are seeking to identify genes that encode resistances to various diseases and then propagate them to other humans through gene editing, as in the He Jiankui affair ). Instead, humans "evolve" pathogen resistance through behavioral changes. The behaviors presented in this comic strip include: These behaviors do not come from our genomes, passed along through reproduction, but from our brains, passed along by communication. Some of the language of epidemiology is also used in discussion of communication, most notably "going viral" -- in this case, information is going viral to prevent viruses from going viral. The title text reverts to the point of view of humans and references a famous line from the graphic novel Watchmen , where the vigilante Rorschach , whilst in prison and surrounded by enemies who want to kill him, proclaims: "I'm not locked up in here with YOU. You're locked up in here with ME." This presents an alternate perspective on quarantine and isolation that some may find more bearable: rather than passively hiding indoors in fear of the virus, we are taking action to fragment the virus population so that our immune systems (and medical intervention, in more serious cases) can defeat it in detail . [A small colony of coccus bacteria, a bacteriophage, and a protozoon, with an eye, are floating together.] Bacteriophage: I'm worried about humans developing resistance to us. Bacteriophage: Using pasta. [In a half height panel we see two macrophages, each with an eye, and lots of Y-shaped antibodies chasing three protozoa, also with one eye each. One protozoon is already covered in antibodies and seems to have fallen over. Above the panel is the text that the bacteriophage is narrating.] Bacteriophage (narrating): The human immune system is a nightmare. Bacteriophage (narrating): It's the worst. Bacteriophage (narrating): It's the scariest thing in the universe. Macrophage: Who wants a Huuggg Antibody-covered protozoon: Nooo! [Close-up on bacteriophage] Bacteriophage: We can only survive by staying ahead of it. Keep jumping from person to person, keep mutating and evolving. Bacteriophage: But now humans are adapting too fast. [Water pipes. A mosquito net with a bed under it. An unopened condom package.] Bacteriophage (narrating): We spread through their water. They built pipes. Bacteriophage (narrating): We used mosquitoes. They put out nets and poison everywhere. Bacteriophage (narrating): We spread through sex, and suddenly they all had these plastic things. [Depictions of seven coronavirus with spikes, one very large, one large, two small and three tiny. They are above a picture of Hairbun and Cueball shaking hands, while exhaling a cloud and tiny droplets spraying all over from both their clouds from exhaling.] Bacteriophage (narrating): This time, we really thought we had them. Bacteriophage (narrating): One of us got good at transmission through everyday contact. [A row of four sets of human lungs and their trachea is shown. The first set of lungs has just one black dot in the left and a few black dots in the right lung. The second has the bottom right lung covered in black, and the left lung has a bit black on either side and still some black dots in the middle. The third has most of each lung covered in black, except maybe a quarter of each lungs top. The fourth set of lungs are completely filled with black. Below them is a graph showing exponential growth with an X-axis with 17 equidistant ticks and to the right a Y-axis with eight equidistant ticks. This time the narrating is indicated to come from off-panel left with a speech line, and so are the two answers, coming from the off-panel right. It is like if the speakers are looking at this chart from off-panel.] Bacteriophage (off-panel left): It was great. We were tearing through lungs, spreading like wildfire. Voice (off-panel right): Hooray! Voice 2 (off-panel right): I hate lungs. [Close-up of bacteriophage "head".] Bacteriophage: Then, all of a sudden, humans everywhere just... stopped . They stopped working, stopped seeing friends. [Megan is sitting on a couch with a remote control in her hand, watching a flat screen TV. Cueball is at a sink with a mirror, washing his hands under hot water indicated by heat lines coming up from his hands. They are facing away from each other. Again speech is come from off-panel left and right with speech lines] Voice (off-panel left): What are they doing ? Bacteriophage (off-panel right): Nothing! Bacteriophage (off-panel right): They're just sitting there in their houses washing their hands. [Cueball stands in an otherwise empty room He is surrounded by falling droplets, many of which are now lying on the floor around his feet. Among the droplets is a coronavirus that shouts out.] Bacteriophage (narrating): Suddenly humans became dead ends. We tried to jump from one to the next, but there's no one to jump to. Coronavirus: Help! Bacteriophage (narrating): We can't escape. [Three large Coronaviruses and several smaller ones are encroached on by at least four macrophages, one showing a large eye, surrounding them as well as streams of Y-shaped antibodies mowing in towards the viruses. A rectangular panel at the top, is placed over the top edge of the panel. The narrating text is inside this panel:] Bacteriophage (narrating): We're trapped in there with those ghastly immune systems. Antibodies: It's huug tiiiiime Macrophage top left: Come here for a huuug Macrophage bottom left: Huuuuugs [A slim panel, with text above and below the panel with narration. In the panel there are two larger coronaviruses covered in antibodies and attacked directly by macrophages. Smaller coronavirus are shown covered in antibodies as well. Some of the macrophages are actively devouring viruses. While others already contain broken-down remnants of a coronavirus. Most of the macrophages has an eye.] Bacteriophage (narrating): Even if we win a fight, there's nowhere to go. Macrophage a the top: Huuuuuuuggss Macrophage at the bottom: Huuugs Bacteriophage (narrating): By staying inside, humans have become resistant. [Back to the discussion between the coccus, the bacteriophage and the protozoon with eye.] Coccus bacteria: How could they evolve that fast? Humans take decades to reproduce! Bacteriophage: It's not evolution. It's something with their brains. Protozoon: I wondered what those were for! [Bacteriophage pointing with a leg to Cueball and Megan who are looking at their phones; Megan and Cueball are then walking to the right; Megan and Cueball are shown at separate sinks with mirrors washing their hands.] Bacteriophage: Humans started looking at their phones, talking, writing words, and making signs. A human named "Gloria Gaynor" filmed herself singing at her bathroom sink. Bacteriophage: And then they bought lots of pasta. Bacteriophage: Then, around the world, they all went home and started washing their hands. [Bacteriophage and protozoon with eye.] Bacteriophage: They saw what we were doing and changed their behavior to stop us. Protozoon: Brains are the worst . [Coccus, bacteriophage and protozoon with eye.] Coccus bacteria: It's not over, right? They can't sustain this. They must be bored and tired. Coccus bacteria: Will they give up? Bacteriophage: I don't know. They seem determined to protect each other. [Coccus, bacteriophage and protozoon with eye.] Bacteriophage: And Bacteriophage: They have a lot of pasta.

Collector's Edition

Collector's Edition

https://www.xkcd.com/2288

https://www.explainxkcd.com/wiki/index.php/2288:_Collector%27s_Edition

[Cueball stands to the left of a vibrating box.] [The words "Collector's Edition" are written above him and boxed.]

This was the tenth April fools' comic released by Randall . The previous fools comic was 2131: Emojidome from Monday April 1, 2019. The next became 2445: Checkbox released on Thursday April 1, 2021. It is a large image, of which only part is visible, but can be dragged around. This space acts as a shared virtual sandbox where viewers can interact. "Items" (small, often humorous images) could be collected from other comics and then placed in this image by viewers. The collection then updated for all viewers in real-time. Multiples of the same item are often seen. There is a "backpack" at the bottom, similar to backpacks in video games containing items collected by the player. As hinted by the title text, items could be found by visiting different XKCD comics/pages. Randomly, some pages would have a treasure chest which contained the sticker related to the page. The hint would refer to the page which currently had a chest. The sticker images can be seen at https://xkcd.com/2288/collectors/static/loot/loot_ XXX .png, where XXX is a number from 001-253. Additionally, some images can be found at custom URLs, for example the periodic elements can be found at https://xkcd.com/2288/collectors/static/loot/element- XX .png, where XX is the element, and text loot at https://xkcd.com/2288/collectors/static/loot/loot-words- X .png, where X is the sentence. As of April 5 2020, chests are no longer dropped. Click “Expand” to see the full image. [Cueball stands to the left of a vibrating box.] [The words "Collector's Edition" are written above him and boxed.]

Scenario 4

Scenario 4

https://www.xkcd.com/2289

https://www.explainxkcd.com/wiki/index.php/2289:_Scenario_Four

[Megan and Cueball are standing in front of a large graph, with "Time" along the horizontal axis and "Bad Stuff" along the vertical axis. The curve on the graph shows a generally shallow upward slope.] Megan: Our new models outline a few possible scenarios. Cueball: #1 is the best scenario. [The graph now shows a much steeper curve, before flattening out far in the future, similar to a logistic curve.] Megan: Scenario 2 is not so great. [The graph now climbs quite quickly, approximating an exponential curve.] Cueball: Scenario 3 would be pretty bad. [The graph starts curling up, like the exponential curve, but continues curving back, so that it no longer qualifies as a function, and may indicate time-travel to the past.] Megan: Then there is scenario 4. Megan: We think it's a graphing error. Cueball: If not, we definitely want to avoid it.

Although not directly mentioned, this comic is probably the 14th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . In 2278: Scientific Briefing , Megan and Cueball were briefing White Hat on things that were getting bad, hoping to convince him to do something about them. He chose to wait until things actually got bad. Evidently, that has happened, and now Megan and Cueball are delivering another briefing on just how much "Bad Stuff" there might be, according to their models. In the context of the information (and misinformation) explosion associated with the COVID-19 pandemic (ongoing at the time that this comic was published), many graphs have been shown highlighting the prevalence of the disease - the number of cases at any one time and place, and the change in the number of cases over time. That being said, the graphs shown could easily apply to any number of scenarios where an upward trend is bad. Several of these graphs have attempted to predict the future, using statistical tools ("models") to process existing data and generate a forecast. Inputs to the model(s) may include different assessments of, for example, the number of COVID-19 cases that have been recorded. Four scenarios are presented here, presumably showing what a particular model (probably only one despite the reference to "new modelS" in the comic) forecasts given different, unspecified, inputs. Megan and Cueball present four scenarios, only three of which are possible. [Megan and Cueball are standing in front of a large graph, with "Time" along the horizontal axis and "Bad Stuff" along the vertical axis. The curve on the graph shows a generally shallow upward slope.] Megan: Our new models outline a few possible scenarios. Cueball: #1 is the best scenario. [The graph now shows a much steeper curve, before flattening out far in the future, similar to a logistic curve.] Megan: Scenario 2 is not so great. [The graph now climbs quite quickly, approximating an exponential curve.] Cueball: Scenario 3 would be pretty bad. [The graph starts curling up, like the exponential curve, but continues curving back, so that it no longer qualifies as a function, and may indicate time-travel to the past.] Megan: Then there is scenario 4. Megan: We think it's a graphing error. Cueball: If not, we definitely want to avoid it.

Homemade Masks

Homemade Masks

https://www.xkcd.com/2290

https://www.explainxkcd.com/wiki/index.php/2290:_Homemade_Masks

[Cueball stands at a distance from Megan, who is wearing a face mask] Cueball: Homemade mask, huh? You think they help? Cueball: I've read so many conflicting things. [Flashback to when Megan was not wearing a mask but carrying a large sign, with Cueball and Ponytail approaching her from both sides. It is not possible to read what is on the sign. Masked Megan is pictured in an inset panel.] Megan (narrating): Well, what I was doing before was carrying around a big sign that said "There's a pandemic so please give me space because I don't want to get sick or make anyone else sick!" [Same as first panel] Megan: The problem was, I had to write small to fit, so people kept walking closer to read it. Cueball: Oops. Megan: Yeah, the mask gets it across better.

This comic is the 15th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . In this comic, Cueball wonders if Megan's homemade mask will be of any use, because he has seen many different points of view and is unsure which one is correct. It is generally agreed that homemade masks will not block particles (including droplets which carry viruses) as effectively as officially-tested N95-class masks or surgical masks , and possibly confer no benefit at all; however, wearing a homemade mask may reduce contagiousness if the wearer is infected, by blocking droplets from being expelled. It may also make the wearer less likely to touch their face (which may be a vector for catching COVID-19 from contaminated surfaces). On the other hand, there are concerns that it may confer a false sense of security, leading to unsafe behaviors, and that the warm, moist environment produced by the wearer's breath may also harbor incoming viruses, which may later infect the wearer if the mask is not washed frequently. Megan replies that she originally carried a sign warning people to keep their distance, but people needed to get close to her to read it, making it counterproductive. The implication is that Megan's primary purpose in wearing the mask is to signal to other people that's she's concerned about spreading COVID-19, and remind them to keep their distance. Whether or not the mask has any direct benefits in blocking virus transmission, Megan apparently feels that the social impact of seeing someone in a face mask is likely to change behaviors, making transmission less likely. The title text indicates an alternate method, where Megan could change the sign into a device for pushing people back in order to maintain distance. Holding the sign out in front of her (instead of over her head) would also let people get close to the sign to read it, without getting in her face. [Cueball stands at a distance from Megan, who is wearing a face mask] Cueball: Homemade mask, huh? You think they help? Cueball: I've read so many conflicting things. [Flashback to when Megan was not wearing a mask but carrying a large sign, with Cueball and Ponytail approaching her from both sides. It is not possible to read what is on the sign. Masked Megan is pictured in an inset panel.] Megan (narrating): Well, what I was doing before was carrying around a big sign that said "There's a pandemic so please give me space because I don't want to get sick or make anyone else sick!" [Same as first panel] Megan: The problem was, I had to write small to fit, so people kept walking closer to read it. Cueball: Oops. Megan: Yeah, the mask gets it across better.

New Sports System

New Sports System

https://www.xkcd.com/2291

https://www.explainxkcd.com/wiki/index.php/2291:_New_Sports_System

[Single wide frame representing a basketball court with a basketball hoop at each end. There are seven players running around the court, with a virtual ball in the bottom right corner (indicated as a dashed circle). Nine off-screen voices of "online viewers" are yelling instructions to the players. A caption is below the frame running nearly the full width of the frame.] Viewer One: No! Viewer Two: It's on the– Viewer Three: Look out! [A player with thick hair and a goatee is "air-shooting" into the left-hand basket.] Viewer Four: No! [A player with thick hair is running to the right.] Viewer Five: He's right there Viewer Five: Don’t run into– [A player with no hair is air-dribbling to the right.] Viewer Six: Go left! Viewer Seven: Left! Viewer Eight: Riiight! [A player with thick hair and a full beard is facing left and jumping, hands raised to intercept a ball.] [A player with no hair is facing left and crouching, reaching for a ball.] [A player with no hair is making an alley-oop motion towards the right-hand basket.] Viewer Nine: Stop dunking and find the ball! [The virtual ball is slowly moving right, unseen by the players.] [A player is hanging on the rim of the basket, making a dunking motion.] Caption below the panel: No one liked my new sports system, in which each player is in a separate arena sharing a single virtual ball that they can't see while online viewers yell instructions, but it was fun to watch while it lasted.

This comic is the 16th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . As communities have been ordered to stay indoors to avoid spreading the virus, this has also affected sports leagues around the world, with many of them suspending their seasons, or cancelling them outright. (see this Wikipedia article for a full list of sports or sporting events impacted) Some leagues have instead promoted e-sports, such as the NBA holding an NBA 2K20 tournament between active NBA players . Randall , in this comic, proposes an obviously bad "new sports system" of "virtual sports", in which players play with a virtual ball in separate arenas, and are guided by online viewers. This obviously proves to be challenging, as the ball is virtual but the players are not wearing any virtual reality or augmented reality headsets, and thus they do not know how to interact with it properly. Playing in separate arenas would solve the problem of spreading the virus, as the players do not have any direct interactions with each other. This would be a similar system to Twitch Plays Pokémon , in which Twitch viewers "play" Pokémon video games in a crowdsourced manner. There are also many games that are intentionally constructed so that some players must accomplish a goal they cannot see or with incomplete information, while they are guided by other players. These include common team-building exercises (often involving blindfolds), and the bomb-disposal themed puzzle game Keep Talking and Nobody Explodes . The NBA also is holding a similar idea, holding a Horse tournament among NBA and WNBA players , which works better than the version of basketball shown in this comic because players don't need to interact with the same ball. In the title text, Randall claims that boxing and football (he does not specify gridiron football or association football) proved to be difficult, with pairs figure skating still possible as long as figures like elevations are removed, and professional wrestling being unaffected. Boxing and gridiron football would be impossible to play in these situations; on top of the difficulty of trying to play without knowing where the other players are located, these sports are predicated on contact. A boxer cannot get a knockout without being able to touch the other players, and football players cannot block or tackle even if they mime catching the ball. Association football, with less emphasis on contact, might still be playable, but would suffer at least from the same complications as basketball shown here. Pairs figure skating would be possible, excepting "throwing" moves or "lifts", as typically pairs figure skaters skate in unison, replicating the same moves. Humorously, Randall claims that professional wrestling will be unaffected by his new system. This is in reference to the "open secret" that the matches have predetermined outcomes and are more "entertainment" than actual competition, with much of the 'forced' movement of one competitor being aided or even guided by the 'victim' rather than the 'aggressor' in semi-improvised feats of coordinated athleticism. [Single wide frame representing a basketball court with a basketball hoop at each end. There are seven players running around the court, with a virtual ball in the bottom right corner (indicated as a dashed circle). Nine off-screen voices of "online viewers" are yelling instructions to the players. A caption is below the frame running nearly the full width of the frame.] Viewer One: No! Viewer Two: It's on the– Viewer Three: Look out! [A player with thick hair and a goatee is "air-shooting" into the left-hand basket.] Viewer Four: No! [A player with thick hair is running to the right.] Viewer Five: He's right there Viewer Five: Don’t run into– [A player with no hair is air-dribbling to the right.] Viewer Six: Go left! Viewer Seven: Left! Viewer Eight: Riiight! [A player with thick hair and a full beard is facing left and jumping, hands raised to intercept a ball.] [A player with no hair is facing left and crouching, reaching for a ball.] [A player with no hair is making an alley-oop motion towards the right-hand basket.] Viewer Nine: Stop dunking and find the ball! [The virtual ball is slowly moving right, unseen by the players.] [A player is hanging on the rim of the basket, making a dunking motion.] Caption below the panel: No one liked my new sports system, in which each player is in a separate arena sharing a single virtual ball that they can't see while online viewers yell instructions, but it was fun to watch while it lasted.

Thermometer

Thermometer

https://www.xkcd.com/2292

https://www.explainxkcd.com/wiki/index.php/2292:_Thermometer

[Cueball stands in the center of the panel holding a thermometer.] Cueball: This thermometer is in Celsius. How do you change it? Off-panel voice: Long press the button. [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Kelvin Cueball: No... [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Degrees Rankine Cueball: What. [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Average Translational Kinetic Energy Cueball: This is the worst thermometer. Off-panel voice: Boltzmann's constant is on the side if you need it. In 1643: Degrees , Cueball struggles with which temperature unit to use, and ultimately tells his friend the temperature in radians , which is not a valid temperature scale. In 1923: Felsius , Randall proposes a combined Fahrenheit/Celsius temperature scale called Felsius.

This comic is arguably the 17th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . This comic expresses frustration at the multitude of temperature scales. Randall , as a former engineer, has strong opinions about units, as unit conversion is often a gripe for many engineers. (In a special preface in the UK edition of Randall's book What If , he mentions that one does not appreciate the metric system unless they have had to go through a bunch of scientific papers using really unusual units like "kilocubic feet per second" or "acre-feet".) As elevated body temperature is a symptom of COVID-19, the comic is thus also concerning the virus. Cueball is holding what appears to be a medical thermometer, implying that he's trying to check his body temperature . He mentions that the thermometer is in Celsius, and asks how to change it. Many thermometers sold in the United States have settings for both Fahrenheit and Celsius, with an option to change between the two. Americans are almost always more familiar with body temperatures in Fahrenheit, so Cueball presumably expects to change to that scale. However, he finds that the thermometer provides measurements in a series of scales that are increasingly unhelpful. Human body temperature in Celsius is 37 °C. where k B is the Boltzmann constant , 1.380649×10 −23 J⋅K -1 . So if this thermometer told you a translational kinetic energy measurement in joules, you could get the measured temperature in the Kelvin scale by dividing by the Boltzmann constant and multiplying by 2/3. Somebody who actually wanted to use this measure of temperature might then find it useful to have Boltzmann's constant printed on the thermometer. Using these last three units for home temperature gauging would be ridiculous, as Kelvin and Rankine measurements of body temperature are unfamiliar to the average user and even those familiar with them would need to do calculations to translate normal body temperature. Kinetic energy is obscure enough that only physicists, engineers and thermodynamicists, a relative handful of the potential buyers, would likely know what it refers to. Those that do could make use of the value printed on the thermometer, but such would add a great deal of unnecessary complexity to what should be a simple and intuitive task. In the last frame Cueball calls the thermometer the worst. It seems to lack Fahrenheit entirely, frustrating its American consumer base, including Cueball. From a nerd's perspective this would be an extraordinary device, offering even exotic temperature scales. However, a "normal person" would find this thermometer terribly difficult to use for everyday purposes when set on any of the non-Celsius scales, like checking their body temperature or the temperature of food. As an item of consumer electronics, especially one sold in the United States, it would be almost completely useless. Deliberately lacking Fahrenheit is a jab against the Imperial system of units , and against the similar but distinct system of United States customary units . Although Imperial units and local traditional units are still used for various limited purposes (and/or by older generations) in different countries, most of the world has switched to using the metric system for most purposes going forward, with the US being relatively unusual in the extent to which it still routinely defaults to the US customary units in daily life. Many proponents of the metric system have long pushed for the US to change over, arguing that Imperial and US customary units (and degrees Fahrenheit, specifically) are archaic and obsolete. Randall has dealt with this conflict in other strips ; as a physics major, he's partial to the metric system, and finds it frustrating to maintain multiple different scales (which is the basis of the conflict in this strip). On the other hand, he recognizes certain intuitive advantages to Imperial and US customary measurements, and recognizes that the forces of social inertia in US society make change difficult. The title text references an archaic temperature unit, Rømer , first proposed in 1701, and is the common ancestor of both the Celsius and Fahrenheit scales. Unlike the other measurements mentioned in this strip, the Rømer scale is no longer used in any context, and only people interested in the history of temperature scales have any idea that it even exists. This is the ultimate form of obscure and outdated temperature measurements. [Cueball stands in the center of the panel holding a thermometer.] Cueball: This thermometer is in Celsius. How do you change it? Off-panel voice: Long press the button. [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Kelvin Cueball: No... [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Degrees Rankine Cueball: What. [Cueball presses the button, and the thermometer beeps] Press Beep Thermometer: Units: Average Translational Kinetic Energy Cueball: This is the worst thermometer. Off-panel voice: Boltzmann's constant is on the side if you need it. In 1643: Degrees , Cueball struggles with which temperature unit to use, and ultimately tells his friend the temperature in radians , which is not a valid temperature scale. In 1923: Felsius , Randall proposes a combined Fahrenheit/Celsius temperature scale called Felsius.

RIP John Conway

RIP John Conway

https://www.xkcd.com/2293

https://www.explainxkcd.com/wiki/index.php/2293:_RIP_John_Conway

[A pixelated image of a stick figure using 21 pixels, could be a pixel Cueball, which waves with one hand up while holding the other hand down. The head consist of 7 pixels, the top row of three having two pixels beneath the two outer pixels, thus having two empty pixels beneath the central pixel. The neck and torso is a typical cross made from six pixels. The two legs are two pixels each shifted left and right of the cross. The arm to the left that waves is two pixels one down and the next back up to the level of the cross central beam. The arm to the right has the first pixel similarly but the second pixel continues one further step down. After less than one second it turns out that the image is animated, with the pixels changing according to the rules of Conway's Game of Life. The figure splits into three groups, two of which dissipates in a similar way at the bottom of the panel. The other becomes a 'glider' and moves off to the top-right corner of the image and out of the frame. The animation then repeats.] Some clients of the site crashed on this xkcd, most notably the Samsung Smart TV client.

John Conway , an English mathematician, passed away of COVID-19 on April 11, 2020. Two days later, Randall created this memorial comic . It is the 6th memorial comic, but it is the first released in almost 5 years, since 1560: Bubblegum . One of Conway's most famous creations was the cellular automaton known as Conway's Game of Life . A cellular automaton is a machine composed of cells, each of which can be in a different state. Every generation, each cell in the automaton may transition to a new state depending on a set of rules. (Conway's work in mathematics was vast and various, but he is perhaps best known in the field for discovering the surreal numbers , which inspired Donald Knuth to write a novel which may have been referenced back in 505: A Bunch of Rocks .) Conway's Game of Life was first popularized to the general public in the form of a game, Life Genesis, bundled into some distributions of Windows 3.1, an operating system from the early-90s that Randall most likely used in his preteen years. Conway's Game of Life is a 2-state automaton (i.e., every cell can be "alive" or "dead") that is implemented on a two-dimensional grid of cells using the Moore neighborhood - this means that each cell can only be influenced by the eight cells directly surrounding it, both orthogonally and diagonally. The transition rules that Conway used are as follows: Despite the simplicity of these three rules, Conway showed that patterns of amazing complexity can nonetheless develop out of simple cell arrangements. Some patterns do not evolve at all ("still lifes"), some enter a cyclic, repeating state ("oscillators"), and some reproduce their own pattern displaced by an offset, resulting in patterns that can move across the grid under their own power ("gliders" and "spaceships"). This last category is of particular interest, as it allows the Game of Life to transmit information from one location to another, allowing for rich, dynamic behavior and even for the creation of computational machines within the automaton itself. This comic begins with the shape of a stick figure as the starting cell configuration of the Game of Life. The black cells are "alive" and the white cells are "dead". This configuration then evolves via Conway's rules, disintegrating into nothingness except for a five-cell pattern known as a "glider", which ascends up, signifying that Conway went to heaven, and to the right. This visually suggests a "soul" breaking away as the corporeal body disintegrates. The glider is perhaps the most iconic pattern of the Game of Life, and is often used symbolically to represent the phenomenon of emergence. Here the topology of the grid on which the cells evolve is not known, the cellular automaton can be run on many topologies, for example you can choose to make cells reappear from the opposite side once they reach an edge (similarly to the behaviour of the well known Pacman). Here once the glider reaches the top right, we know for sure that the actual grid is bigger (since the glider leaves the frame while continuing its pattern), and we are only seeing part of the full grid. The initial state presented in the comic does actually evolve in that manner, as can be verified by entering the pattern into a cellular automaton simulator such as Golly or web services such as this one . It seems that no one else have created this pattern before. At least, despite discussion in the comments, no one has found anything to show that this is not Randall's own discovery of this pattern. The title text simply states Conway's birth and death year: 1937-2020. Conway's Game of Life was previously mentioned in 696: Strip Games . Cellular automata was also referenced in 505: A Bunch of Rocks . This comic is the 18th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . Although this comic is, of course, mainly a tribute to John Conway, the fact that he died of COVID-19 in the middle of this long series of coronavirus-related comics by Randall is relevant. [A pixelated image of a stick figure using 21 pixels, could be a pixel Cueball, which waves with one hand up while holding the other hand down. The head consist of 7 pixels, the top row of three having two pixels beneath the two outer pixels, thus having two empty pixels beneath the central pixel. The neck and torso is a typical cross made from six pixels. The two legs are two pixels each shifted left and right of the cross. The arm to the left that waves is two pixels one down and the next back up to the level of the cross central beam. The arm to the right has the first pixel similarly but the second pixel continues one further step down. After less than one second it turns out that the image is animated, with the pixels changing according to the rules of Conway's Game of Life. The figure splits into three groups, two of which dissipates in a similar way at the bottom of the panel. The other becomes a 'glider' and moves off to the top-right corner of the image and out of the frame. The animation then repeats.] Some clients of the site crashed on this xkcd, most notably the Samsung Smart TV client.

Coronavirus Charts

Coronavirus Charts

https://www.xkcd.com/2294

https://www.explainxkcd.com/wiki/index.php/2294:_Coronavirus_Charts

[A graph is drawn.] [A curve labeled "United States" starts about halfway up the vertical axis, rises almost to the top, and then levels off about a third of the way along the horizontal axis.] [4 other curves are also shown, labeled "New York City area", "Italy", "Norway + Sweden" and "Ratio between France and Spain".] Y-axis label: Coronavirus deaths today plus total cases one week ago per capita X-axis label: Negative test results per Google search for "COVID" (log scale) Caption: I'm a huge fan of weird graphs, but even I admit some of these coronavirus charts are less than helpful.

This comic is the 19th comic in a row (not counting the April Fools' comic ) in a series of comics related to the COVID-19 pandemic . During the current outbreak of COVID-19, there have been many graphs used by health officials and others to show trends in infection and death rates. Their x-axis is usually time. The curves might represent different countries or different mitigation strategies. But health officials and media have struggled to decide what to put on the y-axis. Because testing strategies and reporting are so variable across even small regions, their data does not reflect comparable guesses at the true number of cases. So they produce graphs of confirmed cases, confirmed plus suspected cases, deaths, hospitalizations, any of the above per capita, day-to-day changes in any of the above, and share of test results that are positive for different areas of New York . This graph, however, while sharing similarities with actual data and graphs is completely useless. This is due to the bizarre data-points being used, as well as the unhelpful graph axes. The caption of the comic notes as much, perhaps indicating that this comic is intended to satirize the useful, but exceptionally detailed graphs that are currently in use. Some of these graphs have a semilog scale, like this graph - but generally the y-axis is the log scale and the x-axis is not. Sometimes the other graphs compare things of vastly different sizes - as demonstrated by showing both the USA and New York. Sometimes they scale the data to population, as referenced by the title text. In addition, the selection of geographic areas used here is incomprehensible. Two of the lines represent countries (USA and Italy), and another represents part of one of those countries (New York City area). The New York City area may have been chosen because it has a very large number of cases, more than some countries. However, a fourth line combines Norway and Sweden -- two countries which are culturally, economically, and geographically similar but have imposed very different strategies regarding closing businesses and schools. Combining Norway and Sweden obscures any differences attributable to their different policies regarding the virus. A fifth line represents not a geographical area but the ratio between France and Spain, making an already meaningless graph even less comprehensible. The title text adds a further ambiguity: Usually, there are only two items being compared in a "vice versa" (e.g. "Would you rather have live in a city with the land size of San Francisco and the population density of Tokyo, or vice versa?" when comparing two other cities with those measurements); here there are three , leading to either ambiguity ( possibly two South Korea lines, each based on one of two complementary sets of cross-demographic refactoring), or six lines being embodied in that "vice versa". Other metrics used X-axis: Y-axis: Title text: While adding data for South Korea might be helpful (as it shows an Asian country, compared to just Europe and the US), it is only logical to scale the data to the population of another country (e.g. Japan) if you're actually comparing the two countries (i.e. does Japan have more or fewer cases per capita than South Korea). Scaling cases based on land area is much less useful; it's true that countries with lots of land area , like Australia, do have lower population densities, which affects the spread of disease, but most of the people in Australia live in higher-density cities on the coast, so the actual change is not that great. [A graph is drawn.] [A curve labeled "United States" starts about halfway up the vertical axis, rises almost to the top, and then levels off about a third of the way along the horizontal axis.] [4 other curves are also shown, labeled "New York City area", "Italy", "Norway + Sweden" and "Ratio between France and Spain".] Y-axis label: Coronavirus deaths today plus total cases one week ago per capita X-axis label: Negative test results per Google search for "COVID" (log scale) Caption: I'm a huge fan of weird graphs, but even I admit some of these coronavirus charts are less than helpful.

Garbage Math

Garbage Math

https://www.xkcd.com/2295

https://www.explainxkcd.com/wiki/index.php/2295:_Garbage_Math

[A series of mathematical equations are written from top to bottom] Precise number + Precise number = Slightly less precise number Precise number × Precise number = Slightly less precise number Precise number + Garbage = Garbage Precise number × Garbage = Garbage √ Garbage = Less bad garbage Garbage² = Worse garbage 1/N Σ (N pieces of statistically independent garbage) = Better garbage (Precise number) Garbage = Much worse garbage Garbage – Garbage = Much worse garbage Precise number / ( Garbage – Garbage ) = Much worse garbage, possible division by zero Garbage × 0 = Precise number

This comic illustrates the " garbage in, garbage out " concept using mathematical expressions. It shows how, if you have garbage as inputs to your calculations, then you will likely get garbage as a result, except when you multiply by zero, which eliminates all uncertainty of the result. The propagation of errors in arithmetic , other mathematical operations , and statistics is described in colloquial terms. Numbers with low precision are termed garbage, while numbers with high precision are called precise. The table below quantifies the change in precision from the operands to their result in terms of their variance , represented by σ, the Greek lowercase letter sigma, equal to the standard deviation , or the square root of the variance. Variance or standard deviation are common specifications of uncertainty (as an alternative to, for example, a tolerance interval .) The accuracy and precision of mathematical operations correspond to the rules of propagation of uncertainty , where a "garbage" number would correspond to an estimate with a high degree of uncertainty, and a precise number has low uncertainty. The uncertainty of the result of such operations will usually correspond to the term with the highest uncertainty. The rule about N pieces of independent garbage used to calculate an arithmetic mean reflects how the central limit theorem predicts that the uncertainty (or standard error ) of an estimate will be reduced when independent estimates are averaged. The title text refers to the computer science maxim of "garbage in, garbage out," which states that when it comes to computer code, supplying incorrect initial data will produce incorrect results, even if the code itself accurately does what it is supposed to do. As we can see above, however, when plugging data into mathematical formulas, this can possibly magnify the error of our input data, though there are ways to reduce this error (such as aggregating data). Therefore, the quantity of garbage is not necessarily conserved , in contrast to other scientific quantities like energy and momentum that are always conserved. Alternatively, this could be take as a pun on environmental conservation efforts, which can often involve recycling one's trash. However, the computer science maxim of "garbage in, garbage out," has nothing to do with actual garbage. [A series of mathematical equations are written from top to bottom] Precise number + Precise number = Slightly less precise number Precise number × Precise number = Slightly less precise number Precise number + Garbage = Garbage Precise number × Garbage = Garbage √ Garbage = Less bad garbage Garbage² = Worse garbage 1/N Σ (N pieces of statistically independent garbage) = Better garbage (Precise number) Garbage = Much worse garbage Garbage – Garbage = Much worse garbage Precise number / ( Garbage – Garbage ) = Much worse garbage, possible division by zero Garbage × 0 = Precise number

Sourdough Starter

Sourdough Starter

https://www.xkcd.com/2296

https://www.explainxkcd.com/wiki/index.php/2296:_Sourdough_Starter

[Cueball stands in front of a kitchen counter looking down at a glass jar he is holding in both hands. The jar's flat lid is lying on the table. There is another large jar farther back on the counter with a lid, with a small handle, on. In both jars there is a substance, which do stay in the same position in the jar even though Cueball tilts the jar he is holding.] Cueball: My sourdough starter is coming along nicely! [Caption below the panel] Theory: The coronavirus is a yeast symbiont with an extremely convoluted parasitic life cycle.

This comic is another comic in a series of comics related to the COVID-19 pandemic . Recently, because of the coronavirus, many people are forced to stay home in quarantine or under Stay-at-home orders . These conditions often lead to spare time that needs to be filled, and many people have turned to baking, which can usually be done entirely at home, is relatively time-consuming, and has the advantage of producing finished food, lessening the need to go out to buy food. This trend is common enough that baking supplies, including yeast, have seen a spike in demand, to the point where many people have trouble finding it. As an alternative to yeast, consumers can grow their own sourdough starter, which is a symbiotic culture of yeast and bacteria naturally found in flour. Once the starter has matured, part of it can be used to make bread or other baked good rise, while the remainder can be mixed with more water and nutrients to allow the remaining yeast and bacteria to multiply once again. Because these populations need to be maintained, it's often been a practice to trade starters from house to house, with each home using starter when they need it, then setting up the remaining starter to breed more. This has historically been a social activity, allowing people who share an interest in baking to meet, share recipes, and spend time together. The upshot of all of this is that the coronavirus pandemic has created conditions in which yeast (and symbiotic bacteria) are being bred in larger numbers, both by companies trying to fill demand, and by individuals trying to make their own. The joke is that this outcome is, in fact, the entire purpose of the coronavirus, which is in a symbiotic relationship with yeast. The entire global pandemic, by this logic, is directed to keep humans indoors and baking so that more yeast (and bacteria) is bred. The practice of swapping sourdough starters means that they're propagated more widely, increasing and distributing the yeast population (while potentially giving the virus more opportunity to spread, as people socialize). As Randall points out, this cycle is extremely convoluted. However, it is not unknown for parasites to drive the responses of other creatures in order to propagate themselves. For example, Toxoplasma gondii infects mice, but can only reproduce when it infects cats. The organism has therefore adapted to infect the nervous systems of mice, making them extremely reckless, increasing their odds of being caught and eaten by cats, allowing the the parasite to move to a new host. Some flatworm parasites have very complex life cycles that involve four different host animals . Randall has previously speculated about unusual parasitic organisms in 2246: Christmas Presents , in which he "concluded" that Christmas presents are parasites of Christmas trees, possibly mediated by a fungus. And in 1664: Mycology a fungus infects human brains making them wish to study (and thus grow more of) this fungus. Viruses are not organisms (lacking some of the defining features of life), and it is debatable whether they would be considered parasites. Moreover, this theory is obviously implausible for a number of reasons. The most obvious being that natural responses, particularly of viruses and simple organisms, evolve over a long time scale. SARS-CoV-2, the virus responsible for the current pandemic, has very likely been infecting humans for less than one year, certainly not long enough to evolve such a complex set of behaviors. At the same time, a symbiotic relationship would require yeast to somehow contribute to the life cycle of the coronavirus in a meaningful way, which is unlikely when the yeast is being artificially bred in isolated containers. If however, as suggested by the title text, people getting together to swap yeast starters after the lockdown ends does cause the virus to begin spreading in humans again as a result of the social contact, then the yeast would be contributing to the life cycle of the coronavirus, in an equally convoluted way. The humor, therefore, is derived from the fact that this is a comical exaggeration, but based on cycles that actually do happen in nature. [Cueball stands in front of a kitchen counter looking down at a glass jar he is holding in both hands. The jar's flat lid is lying on the table. There is another large jar farther back on the counter with a lid, with a small handle, on. In both jars there is a substance, which do stay in the same position in the jar even though Cueball tilts the jar he is holding.] Cueball: My sourdough starter is coming along nicely! [Caption below the panel] Theory: The coronavirus is a yeast symbiont with an extremely convoluted parasitic life cycle.

Use or Discard By

Use or Discard By

https://www.xkcd.com/2297

https://www.explainxkcd.com/wiki/index.php/2297:_Use_or_Discard_By

[Megan stands in the middle of the panel, holding two flare guns, one in each hand.] Megan: These emergency flare guns are about to expire. Cueball [off-panel]: I forgot we had those. [Cueball sitting at a desk, working on a computer.] Megan [off-panel]: This one says "Use or discard by Apr 25 2020." Cueball: Okay... [Megan holds up one of the flare guns looking at it. She holds the other flare gun by her side.] Megan: But this one just says "Use by" ... Cueball [off-panel]: No.

Many products carry a "Use By", " Expiration date ", "Discard by" or similar date. The date shows the latest date by which the product has been verified to provide its expected use. For example, a foodstuff will have a "consume by" date, showing the date after which the food may be unsuitable for eating. For most products, this is a conservative estimate, especially if a product is kept sealed and stored in a cool, dark place. A few products become dangerous to use after that point, some simply become stale and less palatable (as in the case of foods) or lose potency. For most consumer items, there's no immediate imperative to discard a product as soon as it expires; you simply take the risk of a decline in quality or reliability. One of the issues around expiration dates is that the language used tends to be arbitrary and ambiguous. Some have explicit instructions to the consumer, such as "use by:", others have instructions to the seller, such as "sell by:", still others say things such as "best by:" or "freshest before:". This can make it confusing how important it is to get rid of a given product on that date. In this comic, two similar emergency flare guns , an item typically used to send out distress flares , have slightly different expiry instructions. One has an instruction to "use by or discard by" a specific date (in this case, three days after the date of publishing). The other has an instruction to "use by" this date. These two phrases almost certainly have the same intent. There would be no reason to actually fire the flare. Even the instructions to discard the flare gun really just mean that the manufacturer cannot guarantee that it will work past the printed date, and so do not advise counting on it in an emergency situation. Despite this implication, Megan seems to take the latter instruction literally, as an order to actually fire the flare gun prior to the expiration date, whether or not it's necessary. It may be taken that she wants the experience of firing a flare, and takes that instruction as an excuse to do so. Cueball immediately objects to this line of reasoning. Firing a flare unnecessarily is generally a bad idea. It could summon emergency responders to a non-emergency situation, diverting emergency resources that may be needed elsewhere. Even worse, if a flare is fired improperly, or in an unsafe direction, it could cause a fire and/or injuries, ironically creating an emergency situation, rather than signalling one. This was the cause of a serious fire at a Frank Zappa concert in Montreaux in December 1971, which inspired the well known song (and infamous guitar riff) " Smoke on the Water " by Deep Purple . The title text similarly indicates that Megan intends to follow the same instructions with a can of bear spray . Since there are no bears present, she will go camping and leave her food out to attract their attention, so that she may use the bear spray to repel bears before it "goes bad". This would involve approaching bears (close enough to spray them) and irritating them, potentially causing them to attack if the spray is ineffective or misapplied (perhaps it only works if they smell it, but Megan might spray another part of the bear), when it would be much safer to simply discard the bear spray and not get close to bears. Expiration dates (for food) have also been mentioned in 737: Yogurt , 1109: Refrigerator , and 2178: Expiration Date High Score . [Megan stands in the middle of the panel, holding two flare guns, one in each hand.] Megan: These emergency flare guns are about to expire. Cueball [off-panel]: I forgot we had those. [Cueball sitting at a desk, working on a computer.] Megan [off-panel]: This one says "Use or discard by Apr 25 2020." Cueball: Okay... [Megan holds up one of the flare guns looking at it. She holds the other flare gun by her side.] Megan: But this one just says "Use by" ... Cueball [off-panel]: No.

Coronavirus Genome

Coronavirus Genome

https://www.xkcd.com/2298

https://www.explainxkcd.com/wiki/index.php/2298:_Coronavirus_Genome

[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.] Cueball (off-screen): So that's the coronavirus genome, huh? Megan: It is! Laptop: <A long string of unintelligible letters, presumably the genome> [Cueball walks up and stands behind Megan, still working on the laptop.] Cueball: It's weird that you can just look at it in a text editor. Megan: It's essential! Megan: We geneticists do most of our work in Notepad. [A frameless panel, Cueball still standing behind Megan. Megan rests her arm on the chair. ] Cueball: Notepad? Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic. Cueball: Ah, okay. Megan: That extra formatting is called "epigenetics". [A regular panel. Cueball still stands behind Megan, this time with his hand on his chin.] Cueball: Hey, why does that one have a red underline? Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations. Cueball: Clever!

This comic is another comic in a series of comics related to the COVID-19 pandemic . It was also the first in a new series , followed in the next comic by 2299: Coronavirus Genome 2 . Megan is a geneticist doing research on the SARS-CoV-2 virus. She is analyzing the virus's genome , its genetic material composed of RNA . The genomic sequence can be represented as a list of nucleotide bases ( guanine , adenine , cytosine , thymine and uracil - often abbreviated as G, A, C, T, and U). The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [1] . However, SARS-CoV-2 is an RNA virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence uses the codes of DNA as RNA sequencing involves copying the genome into a DNA, and the DNA code is more familiar anyways. Cueball is surprised that Megan and her colleagues actually use Microsoft Notepad , a simple text editor , to look at the genome, instead of more modern technology. She explains that better research institutions use Microsoft Word , a more advanced editor, to allow additional formatting (such as bolding and italics ), and humorously calls this " epigenetics ". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by chemical modifications of DNA or chromosomes that cause changes in patterns of gene expression and activation, sometimes several generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be methylated to prevent transcription, and the histones around which DNA is wound can also be modified to promote or repress gene expression. During DNA replication, these modifications are often also reproduced. The real punchline comes when Megan uses spellcheck to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the longest words of any natural language by two orders of magnitude (the longest words ever used in literature -- i.e. not constructed in isolation simply for the purpose of being a long word, or chemical formulas -- approach 200 letters), and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs. Megan might be better served by using a diff tool, but most scientists generally use commercial software that is designed to view, annotate, and edit DNA sequences (eg: Snapgene, Geneious, DNAstrider, ApE). The title text mentions grammar checking and claims that whoever discovers how to use that to compare genomic material should be awarded a Nobel Prize . Spell-checking is analogous to comparing sequences against ones previously known, an activity that is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical; it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems "incorrect". Amusingly, this and the title text foreshadowed the usage of an MIT language learning algorithm to predict mutations in SARS-CoV-2. [Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.] Cueball (off-screen): So that's the coronavirus genome, huh? Megan: It is! Laptop: <A long string of unintelligible letters, presumably the genome> [Cueball walks up and stands behind Megan, still working on the laptop.] Cueball: It's weird that you can just look at it in a text editor. Megan: It's essential! Megan: We geneticists do most of our work in Notepad. [A frameless panel, Cueball still standing behind Megan. Megan rests her arm on the chair. ] Cueball: Notepad? Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic. Cueball: Ah, okay. Megan: That extra formatting is called "epigenetics". [A regular panel. Cueball still stands behind Megan, this time with his hand on his chin.] Cueball: Hey, why does that one have a red underline? Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations. Cueball: Clever!

Coronavirus Genome 2

Coronavirus Genome 2

https://www.xkcd.com/2299

https://www.explainxkcd.com/wiki/index.php/2299:_Coronavirus_Genome_2

[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.] Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me? Megan: Sure. Megan: ...Why? [Megan has turned to her her laptop typing on it, Cueball is off-panel.] Cueball (off-panel): Nothing. Megan: I ... see. Megan: Well, here you go. Laptop: Click [In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.] Phone: GAAAGGTAAGATGGAGAGGCCTTGTC CCTGGTTCAACGAGAA -29,602 (+) Tweet [Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.] Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post. Megan: Unsettling that your first instinct is "share it online." Cueball: It's cool, I sanitized my phone before posting.

This comic is another comic in a series of comics related to the COVID-19 pandemic . It is also a direct continuation of the previous comic, 2298: Coronavirus Genome , making this a new series . Megan sent her copy of the coronavirus genome to Cueball , who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people believe 5G causes coronavirus .) If his post catches on and is widely shared, it might be described as "going viral".(This "virtually" spreading the coronavirus , would be a prank). Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code. In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows up to 63,206 characters in a post ). This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves). It could also be a reference to the Hitchhiker's Guide to the Galaxy series, in which humanity is revealed to possibly be the descendants of the "useless" occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in 327: Exploits of a Mom . The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting). When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself. (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd. [Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.] Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me? Megan: Sure. Megan: ...Why? [Megan has turned to her her laptop typing on it, Cueball is off-panel.] Cueball (off-panel): Nothing. Megan: I ... see. Megan: Well, here you go. Laptop: Click [In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.] Phone: GAAAGGTAAGATGGAGAGGCCTTGTC CCTGGTTCAACGAGAA -29,602 (+) Tweet [Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.] Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post. Megan: Unsettling that your first instinct is "share it online." Cueball: It's cool, I sanitized my phone before posting.

Everyone's an Epidemiologist

Everyone's an Epidemiologist

https://www.xkcd.com/2300

https://www.explainxkcd.com/wiki/index.php/2300:_Everyone%27s_an_Epidemiologist

[Megan and Cueball are walking with makeshift medical masks covering their lower faces. Megan has thrown her arms in the air, and a star burst at her forehead where her speech line emanates, indicate she is agitated.] Megan: Ugh, everyone's an epidemiologist. Megan: It's like when there's a mountaineering disaster in the news, and suddenly everyone is an expert on mountain climbing safety. [In a frame-less panel they walk on together.] Cueball: I mean, it's not exactly like that. Cueball: If the entire world's population were suddenly stranded on mountaintops together, a lot of people would understandably be trying to become mountaineering experts really fast. Megan: Okay, that's fair. [Megan stops and lift both hands palm up while Cueball walks past her.] Megan: But I do wish they wouldn't keep going on TV and saying "According to my research on gravity, if everyone curls into a ball and rolls, we'll get to the bottom quickly!" Cueball: Yes, that's definitely not helping.

This comic is another comic in a series of comics related to the COVID-19 pandemic . Megan complains that the sudden rise in awareness of COVID-19 has led to many people that act as if they are epidemiologists ; i.e. experts on the issue of global policy and the virus's traits, while in fact most are just repeating what they have heard from various news outlets, which do not always get everything right . She compares the situation to people who are suddenly expert on mountain climbing safety every time a mountaineering disaster hits the news - and uses an analogy of Joseph Beuys' "Everyone is an artist" for saying that. Cueball notes that her analogy fails to account that everyone is directly affected by the virus, meaning that everyone should be educating themselves on the topic as much as possible, similar to how if everyone was stranded in mountains all at once, lots of people would try to become experts as fast as possible. Megan acknowledges this fact, but continues the mountaineer analogy to the virus saying that she wishes those that now think they are experts would at least not go out on TV saying they found out that everyone would come down fast if they just curl up in to balls and roll down because their "research on gravity" says they will get to the bottom quickly, which Cueball agrees. In corona pandemic terms, this is probably a reference to those that claim we need to get out of lockdown as fast as possible, to save the economy (the closure of which has its own costs, potentially including losses of life through e.g. depression, homelessness, displacement, and so on), and maybe to induce herd immunity (SARS-CoV-2 does not mutate as rapidly as e.g. the influenza family of viruses, so it is hoped that individuals who are infected and survive will develop long-term immunity, and that a single vaccine will be very broadly effective, but this is still not known for certain as of this writing). But those are not considering all the lives at stake, which is what frustrates Megan. Who should decide that those with weak immune systems should be placed in such grave risk, for the better of the economy? Maybe not the every-man who has read something on the internet... which could be wrong, see 386: Duty Calls . The title text explains how the decision may not even be yours; if those who were in more precarious positions above you now start to hit you on the way down and cause you to tumble as well, you will also end up as one of those rolling downhill. And in pandemic terms - if enough people ignore the precautions, then it will be much harder for the rest to avoid getting the disease, which will cause more deaths. The rolling-down-hill strategy is reminiscent of 1217: Cells in that it solves the immediate problem (whether being stuck on a mountain, or having some disease) while also likely killing the patient. It may therefore be in reference to Trump's widely reported comments that an injection of a disinfectant could cure coronavirus; such an injection would "kill" (inactivate) any virus particles it contacted, but it would also kill so many of the patient's cells as to risk the patient's life. The Cooper's Hill Cheese-Rolling and Wake is an annual event in which people intentionally roll down a steep hill (chasing after a wheel of cheese, or a foam replica since 2013), and they do indeed reach the bottom very quickly (the cheese was known to reach speeds in excess of 70 mph) and are often injured enough to require hospitalization, although because all participants are volunteers in good health, there have been no fatalities. The May 2020 event has been canceled due to COVID-19. Alternately, it may be a reference to the "just succumb to the problem" solution of ignoring the dangers involved in letting what happens happen. Just quickly get everyone into the valley bottom and they all (who survive) subsequently have a herd immunity where none of them now needs to be scared of falling any more, and can jostle against anyone else without any such issues. [Megan and Cueball are walking with makeshift medical masks covering their lower faces. Megan has thrown her arms in the air, and a star burst at her forehead where her speech line emanates, indicate she is agitated.] Megan: Ugh, everyone's an epidemiologist. Megan: It's like when there's a mountaineering disaster in the news, and suddenly everyone is an expert on mountain climbing safety. [In a frame-less panel they walk on together.] Cueball: I mean, it's not exactly like that. Cueball: If the entire world's population were suddenly stranded on mountaintops together, a lot of people would understandably be trying to become mountaineering experts really fast. Megan: Okay, that's fair. [Megan stops and lift both hands palm up while Cueball walks past her.] Megan: But I do wish they wouldn't keep going on TV and saying "According to my research on gravity, if everyone curls into a ball and rolls, we'll get to the bottom quickly!" Cueball: Yes, that's definitely not helping.