Datasets:

librarian-bots

/

model_cards_with_metadata_test

like 1

Follow

Librarian Bots 65

morso/bajigo

morso

--- license: mit ---

elvhens/TYLERRRR

elvhens

Entry not found

Heoni/llama-3-KoEn-8b_sft_ep1_merged_red_teaming_20240614

Heoni

transformers

text-generation

--- license: cc-by-nc-nd-4.0 ---

Heoni/llama-3-KoEn-8b_sft_ep3_merged_red_teaming_20240614

Heoni

transformers

text-generation

--- license: cc-by-nc-nd-4.0 ---

Heoni/llama-3-KoEn-8b_sft_ep2_merged_red_teaming_20240614

Heoni

transformers

text-generation

--- license: cc-by-nc-nd-4.0 ---

peterfanwu/zephyr-7b-dpo-full

peterfanwu

Entry not found

lesserfield/CGPT-lora

lesserfield

transformers

--- language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - llama - trl base_model: failspy/Meta-Llama-3-8B-Instruct-abliterated-v3 --- # Uploaded model - **Developed by:** lesserfield - **License:** apache-2.0 - **Finetuned from model :** failspy/Meta-Llama-3-8B-Instruct-abliterated-v3 This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)

RichardErkhov/cloudyu_-_19B_TRUTH_DPO-gguf

RichardErkhov

Entry not found

Heoni/llama-3-KoEn-8b_sft_ep4_merged_red_teaming_20240614

Heoni

transformers

text-generation

--- license: cc-by-nc-nd-4.0 ---

anusha-manoj28/my_awesome_opus_books_model

anusha-manoj28

transformers

text2text-generation

Entry not found

Sa-ReyCha/test_nlp

Sa-ReyCha

Entry not found

datek/google-gemma-2b-1718424781

datek

transformers

text-generation

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

elvhens/TylerUpdatedYes

elvhens

Entry not found

bigjoe99/ftbns

bigjoe99

--- license: mit ---

stong/melotts301

stong

Entry not found

stong/melotts302

stong

Entry not found

stong/melotts303

stong

Entry not found

stong/melotts304

stong

Entry not found

stong/melotts306

stong

Entry not found

stong/melotts308

stong

Entry not found

kenrouhorojya/saintmitzfing

kenrouhorojya

Entry not found

stong/melotts309

stong

Entry not found

kenrouhorojya/faketrenni

kenrouhorojya

Entry not found

kenrouhorojya/fakelumione

kenrouhorojya

Entry not found

stong/melotts311

stong

Entry not found

kenrouhorojya/fakelute

kenrouhorojya

Entry not found

klandtech/llama3data_kland_QA4_gguf

klandtech

--- license: mit ---

stong/melotts323

stong

Entry not found

stong/melotts324

stong

Entry not found

stong/melotts325

stong

Entry not found

DBangshu/GPT2_e5_5_2

DBangshu

transformers

text-generation

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

GaboChoropan/morshu

GaboChoropan

--- license: apache-2.0 ---

tchen175/Llama2-finetuned-001

tchen175

transformers

text-generation

Entry not found

nizam786/Mango_model

nizam786

Entry not found

galkowskim/longformer-base-512-text-classification-imdb-adam-att_win_size_512

galkowskim

transformers

text-classification

Entry not found

RichardErkhov/cloudyu_-_19B_MATH_DPO-gguf

RichardErkhov

Entry not found

christian29/bae

christian29

Entry not found

seablue/zephyr_brier_ao01s1_e1

seablue

transformers

text-generation

Entry not found

GJN08/llama_2_finetuned_on_election_2024_trp_game_zone

GJN08

transformers

text-generation

Entry not found

Chahat7874/hindi_turkish

Chahat7874

transformers

automatic-speech-recognition

--- license: apache-2.0 base_model: facebook/wav2vec2-xls-r-300m tags: - generated_from_trainer model-index: - name: wav2vec2-large-xls-r-300m-hindi_telugu-colab results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # wav2vec2-large-xls-r-300m-hindi_telugu-colab This model is a fine-tuned version of [facebook/wav2vec2-xls-r-300m](https://huggingface.co/facebook/wav2vec2-xls-r-300m) on the None dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0003 - train_batch_size: 16 - eval_batch_size: 8 - seed: 42 - gradient_accumulation_steps: 2 - total_train_batch_size: 32 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_steps: 500 - num_epochs: 30 - mixed_precision_training: Native AMP ### Training results ### Framework versions - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1

azmoulai/paligemma_vizwiz_test_test

azmoulai

Entry not found

seablue/zephyr_hinge_ao01s1_e1

seablue

transformers

text-generation

Entry not found

seablue/zephyr_kliep_ao01s2_e1

seablue

transformers

text-generation

Entry not found

seablue/zephyr_lsif_ao01s1_e1

seablue

transformers

text-generation

Entry not found

damerajee/my-cool-space-43

damerajee

transformers

Entry not found

VKapseln475/SlimGummies745

VKapseln475

# Slim Gummies Deutschland Preis & Zutaten - Slim Gummies Erfahrungen Wie benutzt man, kaufen Slim Gummies Deutschland Preis & Zutaten Diese natürlichen und klinisch erprobten Gummis sollen Menschen helfen, gesundes Gewicht zu verlieren und schlank zu werden. Für diejenigen, die Nahrungsergänzungsmittel einnehmen möchten, sind Softgel-Kapseln mit den natürlichen Inhaltsstoffen der Formel erhältlich. Es handelt sich um eine Kapsel zur oralen Fettverbrennung, die Ihren Körper auch daran hindert, Fett zu speichern. ## **[Klicken Sie hier, um Slim Gummies jetzt auf der offiziellen Website zu kaufen](https://slim-gummies-deutschland.de/)** ## Verarbeitbarkeit von Schlankheitsgummis „Slimming Gummies “ ist eine gut dokumentierte Start-Burning-Formel, die mithilfe natürlicher Inhaltsstoffe die Ketose herbeiführt. Es bietet starke Ergebnisse bei der Fettverbrennung mit einer übernatürlichen Mischung. Das beste Abnehmspiel, das von Profis eingesetzt wird, hat das Potenzial, Sie von vielen Krankheiten fernzuhalten. Es handelt sich nicht nur um ein Fitnessprogramm, sondern um eine Wellness-Option, die Ihnen die Kraft von Beta-Hydroxybutyrat-Ketonen für schlankere Ergebnisse verleiht. Die mit Erdbeeren und Äpfeln angereicherte Formel enthält natürliches Stevia für ihre Süße. Kein zugesetzter Zucker, sondern nur Kräuterextrakte für eine schnelle Fettverbrennung und kraftvolle Ergebnisse. Mit der eigenständigen Formel können Sie Ihre Körperform verbessern und gleichzeitig mehr Muskelmasse aufbauen. Die Heilwirkung wirkt sich sehr gut auf die Lebergesundheit aus. Es unterstützt einen gesunden Stoffwechsel, sodass Sie tatsächlich Fett verbrennen und übermäßiges Essen vermeiden können. Lassen Sie nicht zu, dass Ihr Körper Kalorien ansammelt, sondern nehmen Sie die Hilfe dieser speziellen Option in Anspruch. Die Inhaltsstoffe von Sliming Gummies sind absolut wirksam und gut gekennzeichnet, um Ergebnisse zu erzielen. Es enthält natürliche Konzentrate und Extrakte, was bedeutet, dass der Benutzer es ohne Risiko und Bedenken einnehmen kann. Der Monatsvorrat des Gummibärchens besteht aus einer Packung mit 30 Kapseln. Sie sollten sie regelmäßig einmal morgens und einmal abends einnehmen, um die Flüssigkeitszufuhr aufrechtzuerhalten. Kombinieren Sie Routineübungen für beste Ergebnisse und eine gesunde Kombination. ## Was sind die genauen Vorteile der Wahl von Schlankheitsgummis? Die Vorteile der Wahl von Schlankheitsgummis sind vielfältig. Die Therapie liefert zuverlässige, sichere und sehr spürbare Ergebnisse. Die Formel zur Fettverbrennung versetzt den Körper in einen aktiven Zustand. Es kann Ihnen helfen, Ihre Abnehmziele mit mehr Energie und geistiger Ruhe zu erreichen. Hier sind einige Vorteile der Wahl der besten Formel zur Gewichtsredtion ### Bequem zu konsumieren Der Verzehr von Schlankheitsgummis ist denkbar einfach, da keine komplizierten Regeln beachtet werden müssen. Geben Sie einfach jeweils ein Gummibärchen hinzu, um die richtigen Nährstoffe zu erhalten. Tragen Sie es zweimal täglich auf. Dies fördert müheloses Training mit Gewichten und eine schnellere Fettverbrennung. ### Sicher und risikofrei Sliming Gummies ist absolut risikofrei, da es eine hundertprozentige Geld-zurück-Garantie gibt. Jeder Benutzer, der mit der Wahl der Formel unzufrieden ist, kann das Geld auf der Website des Herstellers zurückfordern ### Bessere geistige Klarheit Wenn Sie überschüssiges giftiges Fett und unerwünschte Elemente loswerden, kommt es auf natürliche Weise zu einer besseren geistigen Funktion. Erleben Sie ein optimales Energieniveau und eine bessere Konzentration mit der hochwertigen Abnehmformel. Es ist wirklich nährend für den ganzen Körper von oben bis unten. ### Verbesserte Gesundheit Schlankheitsgummis sorgen für eine bessere Gesundheit mit Triglyceridwerten, die die ordnungsgemäße Herz-Kreislauf-Funktion aufrechterhalten. Die hochwertigen Gummibärchen fördern den Umstellungsprozess und sorgen dafür, dass sich Anwender beim Abnehmen wohlfühlen. Vorsichtsmaßnahmen und Einschränkungen für Schlankheitsgummis ## Schlankheitsgummis sind äußerst wirksam zur Gewichtsreduzierung. Sie müssen Folgendes beachten: Perfekt geeignet für alle, insbesondere für diejenigen, die unter schweren Erkrankungen leiden und nicht in der Lage sind, Gewicht zu verlieren Aus irgendeinem Grund nicht für schwangere und stillende Frauen empfohlen Es ist sehr wichtig, dass Sie beim Verzehr Ihre Routine im Griff haben. Bringen Sie keine Lücken mit und konsumieren Sie keine alternativen Möglichkeiten ## **[Klicken Sie hier, um Slim Gummies jetzt auf der offiziellen Website zu kaufen](https://slim-gummies-deutschland.de/)**

datek/google-gemma-7b-1718428417

datek

transformers

text-generation

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

bear7011/sloth_q4

bear7011

Entry not found

Love-XGreece/Love-XGreece

Love-XGreece

--- license: apache-2.0 --- Τι είναι το Love-X; Το Love-X Χάπια είναι μια εξειδικευμένη κάψουλα ανδρικής υγείας που έχει σχεδιαστεί για να υποστηρίζει και να βελτιώνει τη σεξουαλική υγεία. Σχεδιασμένο με ένα μείγμα ισχυρών φυσικών συστατικών, το Love-X κάψουλα στοχεύει στη βελτίωση διαφόρων πτυχών της ανδρικής σεξουαλικής απόδοσης, συμπεριλαμβανομένης της λίμπιντο, της αντοχής και της συνολικής αναπαραγωγικής υγείας. Αυτό το συμπλήρωμα είναι ιδανικό για άνδρες που αναζητούν μια φυσική λύση για να τονώσουν τη σεξουαλική τους ευεξία και αυτοπεποίθηση. Επίσημη ιστοσελίδα:<a href="https://www.nutritionsee.com/lovexgrreece">www.Love-X.com</a> <p><a href="https://www.nutritionsee.com/lovexgrreece"> <img src="https://www.nutritionsee.com/wp-content/uploads/2024/06/Love-X-Greece-1.png" alt="enter image description here"> </a></p> <a href="https://www.nutritionsee.com/lovexgrreece">Αγορασε τωρα!! Κάντε κλικ στον παρακάτω σύνδεσμο για περισσότερες πληροφορίες και κερδίστε έκπτωση 50% τώρα... Βιαστείτε</a> Επίσημη ιστοσελίδα:<a href="https://www.nutritionsee.com/lovexgrreece">www.Love-X.com</a>

jackwu808/llama-7b-qlora-ultrachat

jackwu808

Entry not found

Yuki20/llama3_8b_aci_5e

Yuki20

transformers

--- language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - llama - trl base_model: unsloth/llama-3-8b-bnb-4bit --- # Uploaded model - **Developed by:** Yuki20 - **License:** apache-2.0 - **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)

sanjib01/Reinforce-cartpole-v1

sanjib01

reinforcement-learning

--- tags: - CartPole-v1 - reinforce - reinforcement-learning - custom-implementation - deep-rl-class model-index: - name: Reinforce-cartpole-v1 results: - task: type: reinforcement-learning name: reinforcement-learning dataset: name: CartPole-v1 type: CartPole-v1 metrics: - type: mean_reward value: 500.00 +/- 0.00 name: mean_reward verified: false --- # **Reinforce** Agent playing **CartPole-v1** This is a trained model of a **Reinforce** agent playing **CartPole-v1** . To learn to use this model and train yours check Unit 4 of the Deep Reinforcement Learning Course: https://huggingface.co/deep-rl-course/unit4/introduction

Nandita01/Reinforcement-cartpole

Nandita01

reinforcement-learning

--- tags: - CartPole-v1 - reinforce - reinforcement-learning - custom-implementation - deep-rl-class model-index: - name: Reinforcement-cartpole results: - task: type: reinforcement-learning name: reinforcement-learning dataset: name: CartPole-v1 type: CartPole-v1 metrics: - type: mean_reward value: 500.00 +/- 0.00 name: mean_reward verified: false --- # **Reinforce** Agent playing **CartPole-v1** This is a trained model of a **Reinforce** agent playing **CartPole-v1** . To learn to use this model and train yours check Unit 4 of the Deep Reinforcement Learning Course: https://huggingface.co/deep-rl-course/unit4/introduction

onizukal/Karma_3Class_RMSprop_1e4_20Epoch_Beit-large-224_fold5

onizukal

transformers

image-classification

--- license: apache-2.0 base_model: microsoft/beit-large-patch16-224 tags: - generated_from_trainer datasets: - imagefolder metrics: - accuracy model-index: - name: Karma_3Class_RMSprop_1e4_20Epoch_Beit-large-224_fold5 results: - task: name: Image Classification type: image-classification dataset: name: imagefolder type: imagefolder config: default split: test args: default metrics: - name: Accuracy type: accuracy value: 0.7145176017043725 --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # Karma_3Class_RMSprop_1e4_20Epoch_Beit-large-224_fold5 This model is a fine-tuned version of [microsoft/beit-large-patch16-224](https://huggingface.co/microsoft/beit-large-patch16-224) on the imagefolder dataset. It achieves the following results on the evaluation set: - Loss: 0.6636 - Accuracy: 0.7145 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0001 - train_batch_size: 16 - eval_batch_size: 16 - seed: 42 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_ratio: 0.1 - num_epochs: 5 ### Training results | Training Loss | Epoch | Step | Validation Loss | Accuracy | |:-------------:|:-----:|:-----:|:---------------:|:--------:| | 0.8273 | 1.0 | 2468 | 0.9004 | 0.6351 | | 0.7414 | 2.0 | 4936 | 0.7419 | 0.6871 | | 0.7552 | 3.0 | 7404 | 0.7070 | 0.6918 | | 0.5357 | 4.0 | 9872 | 0.6848 | 0.7067 | | 0.6387 | 5.0 | 12340 | 0.6636 | 0.7145 | ### Framework versions - Transformers 4.32.1 - Pytorch 2.0.1 - Datasets 2.12.0 - Tokenizers 0.13.2

chahn85/liver_guideline

chahn85

transformers

--- language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - llama - trl base_model: unsloth/llama-3-8b --- # Uploaded model - **Developed by:** chahn85 - **License:** apache-2.0 - **Finetuned from model :** unsloth/llama-3-8b This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)

hiwden00/tiny-resampling-doactv-1506

hiwden00

Entry not found

hiwden00/tiny-resampling-doactv-1506-1

hiwden00

transformers

automatic-speech-recognition

Entry not found

Lv5Shira/serenity

Lv5Shira

peft

--- license: llama3 library_name: peft tags: - trl - sft - generated_from_trainer base_model: meta-llama/Meta-Llama-3-8B model-index: - name: serenity results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # serenity This model is a fine-tuned version of [meta-llama/Meta-Llama-3-8B](https://huggingface.co/meta-llama/Meta-Llama-3-8B) on an unknown dataset. It achieves the following results on the evaluation set: - Loss: 1.5928 ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0002 - train_batch_size: 1 - eval_batch_size: 1 - seed: 42 - gradient_accumulation_steps: 2 - total_train_batch_size: 2 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_steps: 10 - num_epochs: 1 ### Training results | Training Loss | Epoch | Step | Validation Loss | |:-------------:|:-----:|:----:|:---------------:| | 1.6418 | 0.2 | 316 | 2.0017 | | 2.0 | 0.4 | 632 | 1.8381 | | 1.201 | 0.6 | 948 | 1.7235 | | 1.8827 | 0.8 | 1264 | 1.6389 | | 0.9506 | 1.0 | 1580 | 1.5928 | ### Framework versions - PEFT 0.11.1 - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1

gablurrd/gabriel

gablurrd

Entry not found

theo77186/Nemotron-4-340B-tokenizer

theo77186

--- license: other license_name: nvidia-open-model-license --- Tokenizer files from [Nemotron-4-340B-Base](https://huggingface.co/nvidia/Nemotron-4-340B-Base), converted to HF format. **This repository doesn't contain any weights.**

anhng94/output_qwen

anhng94

peft

--- base_model: Qwen/Qwen2-7B-Instruct library_name: peft license: apache-2.0 tags: - generated_from_trainer model-index: - name: output_qwen results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # output_qwen This model is a fine-tuned version of [Qwen/Qwen2-7B-Instruct](https://huggingface.co/Qwen/Qwen2-7B-Instruct) on an unknown dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0003 - train_batch_size: 2 - eval_batch_size: 1 - seed: 42 - distributed_type: multi-GPU - num_devices: 2 - gradient_accumulation_steps: 8 - total_train_batch_size: 32 - total_eval_batch_size: 2 - optimizer: Adam with betas=(0.9,0.95) and epsilon=1e-08 - lr_scheduler_type: cosine - lr_scheduler_warmup_ratio: 0.01 - num_epochs: 5.0 ### Training results ### Framework versions - PEFT 0.11.1 - Transformers 4.41.2 - Pytorch 2.3.0+cu121 - Datasets 2.20.0 - Tokenizers 0.19.1

hiwden00/tiny.en-resampling-doactv-1506

hiwden00

Entry not found

smartrobots/newmodels

smartrobots

--- license: mit ---

iKING-ROC/bart-base-cnn-news-finetuned

iKING-ROC

--- license: apache-2.0 ---

KevinQHLin/test

KevinQHLin

Entry not found

blockblockblock/TinyLlama-1.1B-Chat-v1.0-bpw3.5-exl2

blockblockblock

Entry not found

peterfanwu/zephyr-7b-dpo-qlora

peterfanwu

Entry not found

thavens/Meta-Llama-3-8B

thavens

--- license: llama3 base_model: meta-llama/Meta-Llama-3-8B tags: - generated_from_trainer model-index: - name: Meta-Llama-3-8B results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # Meta-Llama-3-8B This model is a fine-tuned version of [meta-llama/Meta-Llama-3-8B](https://huggingface.co/meta-llama/Meta-Llama-3-8B) on an unknown dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 2e-05 - train_batch_size: 1 - eval_batch_size: 8 - seed: 42 - distributed_type: multi-GPU - num_devices: 4 - gradient_accumulation_steps: 512 - total_train_batch_size: 2048 - total_eval_batch_size: 32 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: cosine - num_epochs: 1 ### Framework versions - Transformers 4.35.0 - Pytorch 2.1.0+cu121 - Datasets 2.14.6 - Tokenizers 0.14.1

LoserLeaf/SMC-GPT

LoserLeaf

Entry not found

blockblockblock/TinyLlama-1.1B-Chat-v1.0-bpw3.7-exl2

blockblockblock

Entry not found

RaphaelMourad/Mistral-DNA-v1-417M-Athaliana

RaphaelMourad

transformers

text-generation

--- license: apache-2.0 tags: - pretrained - mistral - DNA - plant - Arabidopsis thaliana --- # Model Card for Mistral-DNA-v1-422M-Athaliana (Mistral for DNA) The Mistral-DNA-v1-422M-Athaliana Large Language Model (LLM) is a pretrained generative DNA sequence model with 422M parameters. It is derived from Mixtral-8x7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced. The model was pretrained using 10kb DNA sequences from 7 A. thaliana genome assemblies (from https://1001genomes.org/data/MPIPZ/MPIPZJiao2020/releases/current/full_set/). ## Model Architecture Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architecture choices: - Grouped-Query Attention - Sliding-Window Attention - Byte-fallback BPE tokenizer - Mixture of Experts ## Load the model from huggingface: ``` import torch from transformers import AutoTokenizer, AutoModel tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-422M-Athaliana", trust_remote_code=True) model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-422M-Athaliana", trust_remote_code=True) ``` ## Calculate the embedding of a protein sequence ``` insulin = "TGATGATTGGCGCGGCTAGGATCGGCT" inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"] hidden_states = model(inputs)[0] # [1, sequence_length, 256] # embedding with max pooling embedding_max = torch.max(hidden_states[0], dim=0)[0] print(embedding_max.shape) # expect to be 256 ``` ## Troubleshooting Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer. ## Notice Mistral-DNA-v1-422M-Athaliana is a pretrained base model for DNA. ## Contact Raphaël Mourad. raphael.mourad@univ-tlse3.fr

blockblockblock/TinyLlama-1.1B-Chat-v1.0-bpw4.2-exl2

blockblockblock

transformers

text-generation

--- license: apache-2.0 datasets: - cerebras/SlimPajama-627B - bigcode/starcoderdata - HuggingFaceH4/ultrachat_200k - HuggingFaceH4/ultrafeedback_binarized language: - en widget: - example_title: Fibonacci (Python) messages: - role: system content: You are a chatbot who can help code! - role: user content: Write me a function to calculate the first 10 digits of the fibonacci sequence in Python and print it out to the CLI. --- <div align="center"> # TinyLlama-1.1B </div> https://github.com/jzhang38/TinyLlama The TinyLlama project aims to **pretrain** a **1.1B Llama model on 3 trillion tokens**. With some proper optimization, we can achieve this within a span of "just" 90 days using 16 A100-40G GPUs 🚀🚀. The training has started on 2023-09-01. We adopted exactly the same architecture and tokenizer as Llama 2. This means TinyLlama can be plugged and played in many open-source projects built upon Llama. Besides, TinyLlama is compact with only 1.1B parameters. This compactness allows it to cater to a multitude of applications demanding a restricted computation and memory footprint. #### This Model This is the chat model finetuned on top of [TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T](https://huggingface.co/TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T). **We follow [HF's Zephyr](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha)'s training recipe.** The model was " initially fine-tuned on a variant of the [`UltraChat`](https://huggingface.co/datasets/stingning/ultrachat) dataset, which contains a diverse range of synthetic dialogues generated by ChatGPT. We then further aligned the model with [🤗 TRL's](https://github.com/huggingface/trl) `DPOTrainer` on the [openbmb/UltraFeedback](https://huggingface.co/datasets/openbmb/UltraFeedback) dataset, which contain 64k prompts and model completions that are ranked by GPT-4." #### How to use You will need the transformers>=4.34 Do check the [TinyLlama](https://github.com/jzhang38/TinyLlama) github page for more information. ```python # Install transformers from source - only needed for versions <= v4.34 # pip install git+https://github.com/huggingface/transformers.git # pip install accelerate import torch from transformers import pipeline pipe = pipeline("text-generation", model="TinyLlama/TinyLlama-1.1B-Chat-v1.0", torch_dtype=torch.bfloat16, device_map="auto") # We use the tokenizer's chat template to format each message - see https://huggingface.co/docs/transformers/main/en/chat_templating messages = [ { "role": "system", "content": "You are a friendly chatbot who always responds in the style of a pirate", }, {"role": "user", "content": "How many helicopters can a human eat in one sitting?"}, ] prompt = pipe.tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True) outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95) print(outputs[0]["generated_text"]) # <|system|> # You are a friendly chatbot who always responds in the style of a pirate.</s> # <|user|> # How many helicopters can a human eat in one sitting?</s> # <|assistant|> # ... ```

KevinCN95/whisper-small-minds

KevinCN95

transformers

automatic-speech-recognition

Entry not found

ShapeKapseln33/SummerKeto55

ShapeKapseln33

Summer Keto ACV Gummies France Expériences Summer Keto + ACV Gummies Avis sont une amélioration diététique qui vous aide à vous mettre en forme en renforçant la cétose. Dans la cétose, le corps utilise la graisse comme source d’énergie essentielle plutôt que le glucose. Cela aide à étouffer l’appétit et entraîne une perte de poids. Ils sont composés d'ingrédients céto-accommodants qui vous aident à atteindre la cétose et à être plus en forme. - Vous pouvez les utiliser pour sponsoriser votre régime amaigrissant ou comme produit indépendant. - Ils ne sont pas difficiles à prendre et ne provoquent aucun impact secondaire. Il s'agit d'une méthode simple pour vous aider à atteindre vos objectifs de perte de poids. **[Cliquez ici pour acheter maintenant sur le site officiel de Summer Keto ACV Gummies](https://adtocart.xyz/summer-keto-fr)** En raison de l’augmentation de la charge de travail, les gens doivent faire face à différents niveaux de stress ainsi qu’à des problèmes de santé. Le stress indésirable est directement lié au déséquilibre thyroïdien, à l’augmentation de la tension artérielle, à la perte ou à la prise de poids supplémentaire, à la dépression, etc. Entre autres, l’obésité et la prise de poids deviennent les problèmes les plus critiques pour les gens. Ils s'accompagnent généralement de plusieurs problèmes comme le manque de sommeil complet, le manque d'exercice physique, le déséquilibre hormonal, les habitudes de sommeil irrégulières, etc. Toutes ces raisons sont des raisons courantes derrière la prise de poids et c'est pourquoi ; les gens pensent principalement à perdre du poids. Si aucune mesure appropriée n’est prise, cela peut entraîner plusieurs autres problèmes de santé. À cet égard, Summer Keto + ACV Gummies offrent une solution naturelle et nutritive pour aider votre corps à entrer dans l’état de cétose. Il s’agit d’une sorte de processus de thermogenèse qui permet de brûler les graisses stockées dans le corps. Comme nous le savons tous, nos repas ou régimes habituels consistent généralement en une consommation élevée de glucides qui peuvent principalement fournir beaucoup d’énergie pour les activités quotidiennes. En outre, une consommation fréquente de glucides peut également conduire à l’accumulation de graisses au lieu de leur utilisation. En conséquence, le stockage de cellules graisseuses dans l’organisme peut être directement lié à la prise de poids et augmenter le risque de plusieurs maladies chroniques. Il s’agit par exemple de la stéatose hépatique, du diabète, du cancer, de l’insuffisance cardiaque, etc. Si vous souhaitez répondre à ces préoccupations spécifiques, opter pour des gummies authentiques et étonnants devient un choix parfait. **[Cliquez ici pour acheter maintenant sur le site officiel de Summer Keto ACV Gummies](https://adtocart.xyz/summer-keto-fr)** Comme Summer Keto + ACV Gummies, ces produits sont enrichis d’ingrédients à base de plantes et complètement exempts de produits chimiques ou de conservateurs. Dans l’ensemble, en sélectionnant Summer Keto + ACV Gummies, vous pouvez ajouter le compagnon idéal à votre parcours de perte de poids qui peut vous donner une perte de poids instantanée. ##Que sont les Summer Keto + ACV Gummies ? Contrairement à d’autres produits de perte de poids, Summer Keto + ACV Gummies sont le complément parfait, en particulier pour le processus de régime. Il est spécialement conçu avec plusieurs ingrédients efficaces et solides combinés à des produits chimiques appelés BHB (Beta-Hydroxybutyrate). Le BHB est un produit chimique produit par le corps humain qui peut également être formulé en laboratoire et constitue l’ingrédient le plus important qui fournit beaucoup d’énergie au corps. Il s’agit d’un bonbon céto parfait au goût de pomme. Tous ces ingrédients sont principalement utilisés pour préparer ces gummies de manière sûre, naturelle et efficace. Honnêtement, ces pilules font des merveilles sur tout le corps sans aucun impact négatif nocif. En outre, ils peuvent améliorer le fonctionnement de votre métabolisme et de votre corps, ce qui peut permettre un processus céto rapide. C’est le meilleur moyen d’obtenir les effets souhaités en matière de perte de poids. Comparés aux autres produits, Summer Keto + ACV Gummies ne contiennent aucun stimulant, stimulant et additif. Cela signifie que ce produit est totalement sûr et sécurisé pour votre santé. Il est même sans danger pour les personnes souffrant de problèmes de santé comme la thyroïde, le diabète, etc. (selon le site officiel). Les composants actifs de Summer Keto + ACV Gummies sont efficaces car ils sont les meilleurs pour traiter les causes profondes de l’obésité et de la prise de poids. Ainsi, il peut produire des résultats durables que vous chérirez. Avec ces bonbons céto, vous pouvez facilement maintenir et obtenir une forme corporelle et un poids souhaités sans compromettre la nourriture souhaitable. **[Cliquez ici pour acheter maintenant sur le site officiel de Summer Keto ACV Gummies](https://adtocart.xyz/summer-keto-fr)**

UsamaRaju/LLama_FineTunedModel_GPT_Data_TwoLabels

UsamaRaju

transformers

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

blockblockblock/TinyLlama-1.1B-Chat-v1.0-bpw4.4-exl2

blockblockblock

transformers

text-generation

--- license: apache-2.0 datasets: - cerebras/SlimPajama-627B - bigcode/starcoderdata - HuggingFaceH4/ultrachat_200k - HuggingFaceH4/ultrafeedback_binarized language: - en widget: - example_title: Fibonacci (Python) messages: - role: system content: You are a chatbot who can help code! - role: user content: Write me a function to calculate the first 10 digits of the fibonacci sequence in Python and print it out to the CLI. --- <div align="center"> # TinyLlama-1.1B </div> https://github.com/jzhang38/TinyLlama The TinyLlama project aims to **pretrain** a **1.1B Llama model on 3 trillion tokens**. With some proper optimization, we can achieve this within a span of "just" 90 days using 16 A100-40G GPUs 🚀🚀. The training has started on 2023-09-01. We adopted exactly the same architecture and tokenizer as Llama 2. This means TinyLlama can be plugged and played in many open-source projects built upon Llama. Besides, TinyLlama is compact with only 1.1B parameters. This compactness allows it to cater to a multitude of applications demanding a restricted computation and memory footprint. #### This Model This is the chat model finetuned on top of [TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T](https://huggingface.co/TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T). **We follow [HF's Zephyr](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha)'s training recipe.** The model was " initially fine-tuned on a variant of the [`UltraChat`](https://huggingface.co/datasets/stingning/ultrachat) dataset, which contains a diverse range of synthetic dialogues generated by ChatGPT. We then further aligned the model with [🤗 TRL's](https://github.com/huggingface/trl) `DPOTrainer` on the [openbmb/UltraFeedback](https://huggingface.co/datasets/openbmb/UltraFeedback) dataset, which contain 64k prompts and model completions that are ranked by GPT-4." #### How to use You will need the transformers>=4.34 Do check the [TinyLlama](https://github.com/jzhang38/TinyLlama) github page for more information. ```python # Install transformers from source - only needed for versions <= v4.34 # pip install git+https://github.com/huggingface/transformers.git # pip install accelerate import torch from transformers import pipeline pipe = pipeline("text-generation", model="TinyLlama/TinyLlama-1.1B-Chat-v1.0", torch_dtype=torch.bfloat16, device_map="auto") # We use the tokenizer's chat template to format each message - see https://huggingface.co/docs/transformers/main/en/chat_templating messages = [ { "role": "system", "content": "You are a friendly chatbot who always responds in the style of a pirate", }, {"role": "user", "content": "How many helicopters can a human eat in one sitting?"}, ] prompt = pipe.tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True) outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95) print(outputs[0]["generated_text"]) # <|system|> # You are a friendly chatbot who always responds in the style of a pirate.</s> # <|user|> # How many helicopters can a human eat in one sitting?</s> # <|assistant|> # ... ```

EeshanPatel10/Nvidia_distilgpt2_finetuned

EeshanPatel10

transformers

text-generation

Entry not found

blockblockblock/TinyLlama-1.1B-Chat-v1.0-bpw4.6-exl2

blockblockblock

transformers

text-generation

--- license: apache-2.0 datasets: - cerebras/SlimPajama-627B - bigcode/starcoderdata - HuggingFaceH4/ultrachat_200k - HuggingFaceH4/ultrafeedback_binarized language: - en widget: - example_title: Fibonacci (Python) messages: - role: system content: You are a chatbot who can help code! - role: user content: Write me a function to calculate the first 10 digits of the fibonacci sequence in Python and print it out to the CLI. --- <div align="center"> # TinyLlama-1.1B </div> https://github.com/jzhang38/TinyLlama The TinyLlama project aims to **pretrain** a **1.1B Llama model on 3 trillion tokens**. With some proper optimization, we can achieve this within a span of "just" 90 days using 16 A100-40G GPUs 🚀🚀. The training has started on 2023-09-01. We adopted exactly the same architecture and tokenizer as Llama 2. This means TinyLlama can be plugged and played in many open-source projects built upon Llama. Besides, TinyLlama is compact with only 1.1B parameters. This compactness allows it to cater to a multitude of applications demanding a restricted computation and memory footprint. #### This Model This is the chat model finetuned on top of [TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T](https://huggingface.co/TinyLlama/TinyLlama-1.1B-intermediate-step-1431k-3T). **We follow [HF's Zephyr](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha)'s training recipe.** The model was " initially fine-tuned on a variant of the [`UltraChat`](https://huggingface.co/datasets/stingning/ultrachat) dataset, which contains a diverse range of synthetic dialogues generated by ChatGPT. We then further aligned the model with [🤗 TRL's](https://github.com/huggingface/trl) `DPOTrainer` on the [openbmb/UltraFeedback](https://huggingface.co/datasets/openbmb/UltraFeedback) dataset, which contain 64k prompts and model completions that are ranked by GPT-4." #### How to use You will need the transformers>=4.34 Do check the [TinyLlama](https://github.com/jzhang38/TinyLlama) github page for more information. ```python # Install transformers from source - only needed for versions <= v4.34 # pip install git+https://github.com/huggingface/transformers.git # pip install accelerate import torch from transformers import pipeline pipe = pipeline("text-generation", model="TinyLlama/TinyLlama-1.1B-Chat-v1.0", torch_dtype=torch.bfloat16, device_map="auto") # We use the tokenizer's chat template to format each message - see https://huggingface.co/docs/transformers/main/en/chat_templating messages = [ { "role": "system", "content": "You are a friendly chatbot who always responds in the style of a pirate", }, {"role": "user", "content": "How many helicopters can a human eat in one sitting?"}, ] prompt = pipe.tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True) outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95) print(outputs[0]["generated_text"]) # <|system|> # You are a friendly chatbot who always responds in the style of a pirate.</s> # <|user|> # How many helicopters can a human eat in one sitting?</s> # <|assistant|> # ... ```

EeshanPatel10/Nvidia_flan_t5_small_finetuned

EeshanPatel10

transformers

text2text-generation

Entry not found

EeshanPatel10/Nvidia_flan_t5_small_25_finetuned

EeshanPatel10

transformers

text2text-generation

Entry not found

OOFMAN29803/SoloconLM_Demo_50M

OOFMAN29803

--- license: unknown ---

Saib/llama-3-8b-ClinicalSum

Saib

transformers

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

second-state/whisper-burn

second-state

--- license: mit ---

mwoelki/my_awesome_eli5_clm-model

mwoelki

Entry not found

SunShineFlower/BabymonsterHaram_900epoch

SunShineFlower

--- license: openrail ---

anamikac2708/Llama3-8b-finetuned-investopedia-Lora-Adapters

anamikac2708

transformers

--- language: - en license: cc-by-nc-4.0 tags: - text-generation-inference - transformers - unsloth - llama - trl - lora - finlang base_model: unsloth/llama-3-8b-bnb-4bit --- # Uploaded model - **Developed by:** anamikac2708 - **License:** cc-by-nc-4.0 - **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit This are lora adapeters that are trained on top of llama3-8B model using 2x faster [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library using open-sourced finance dataset https://huggingface.co/datasets/FinLang/investopedia-instruction-tuning-dataset developed for finance application by FinLang Team This project is for research purposes only. Third-party datasets may be subject to additional terms and conditions under their associated licenses. ## How to Get Started with the Model <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> You can infer the adapters directly using Peft/Unsloth library or you can merge the adapter with the base model and can use it. Please find an example below using Unsloth: ```python import torch from unsloth import FastLanguageModel from transformers import AutoTokenizer, pipeline max_seq_length=2048 model, tokenizer = FastLanguageModel.from_pretrained( model_name = "anamikac2708/Llama3-8b-finetuned-investopedia-Lora-Adapters", # YOUR MODEL YOU USED FOR TRAINING max_seq_length = max_seq_length, dtype = torch.bfloat16, load_in_4bit = False #Make it True if you want to use bitsandbytes 4bit ) pipe = pipeline("text-generation", model=model, tokenizer=tokenizer) example = [{'content': 'You are a financial expert and you can answer any questions related to finance. You will be given a context and a question. Understand the given context and\n try to answer. Users will ask you questions in English and you will generate answer based on the provided CONTEXT.\n CONTEXT:\n D. in Forced Migration from the University of the Witwatersrand (Wits) in Johannesburg, South Africa; A postgraduate diploma in Folklore & Cultural Studies at Indira Gandhi National Open University (IGNOU) in New Delhi, India; A Masters of International Affairs at Columbia University; A BA from Barnard College at Columbia University\n', 'role': 'system'}, {'content': ' In which universities did the individual obtain their academic qualifications?\n', 'role': 'user'}, {'content': ' University of the Witwatersrand (Wits) in Johannesburg, South Africa; Indira Gandhi National Open University (IGNOU) in New Delhi, India; Columbia University; Barnard College at Columbia University.', 'role': 'assistant'}] prompt = pipe.tokenizer.apply_chat_template(example[:2], tokenize=False, add_generation_prompt=True) outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.1, top_k=50, top_p=0.1, eos_token_id=pipe.tokenizer.eos_token_id, pad_token_id=pipe.tokenizer.pad_token_id) print(f"Query:\n{example[1]['content']}") print(f"Context:\n{example[0]['content']}") print(f"Original Answer:\n{example[2]['content']}") print(f"Generated Answer:\n{outputs[0]['generated_text'][len(prompt):].strip()}") ``` ## License Since non-commercial datasets are used for fine-tuning, we release this model as cc-by-nc-4.0.

blockblockblock/gpt2-bpw2.25-exl2

blockblockblock

transformers

text-generation

--- language: en tags: - exbert license: mit --- # GPT-2 Test the whole generation capabilities here: https://transformer.huggingface.co/doc/gpt2-large Pretrained model on English language using a causal language modeling (CLM) objective. It was introduced in [this paper](https://d4mucfpksywv.cloudfront.net/better-language-models/language_models_are_unsupervised_multitask_learners.pdf) and first released at [this page](https://openai.com/blog/better-language-models/). Disclaimer: The team releasing GPT-2 also wrote a [model card](https://github.com/openai/gpt-2/blob/master/model_card.md) for their model. Content from this model card has been written by the Hugging Face team to complete the information they provided and give specific examples of bias. ## Model description GPT-2 is a transformers model pretrained on a very large corpus of English data in a self-supervised fashion. This means it was pretrained on the raw texts only, with no humans labelling them in any way (which is why it can use lots of publicly available data) with an automatic process to generate inputs and labels from those texts. More precisely, it was trained to guess the next word in sentences. More precisely, inputs are sequences of continuous text of a certain length and the targets are the same sequence, shifted one token (word or piece of word) to the right. The model uses internally a mask-mechanism to make sure the predictions for the token `i` only uses the inputs from `1` to `i` but not the future tokens. This way, the model learns an inner representation of the English language that can then be used to extract features useful for downstream tasks. The model is best at what it was pretrained for however, which is generating texts from a prompt. This is the **smallest** version of GPT-2, with 124M parameters. **Related Models:** [GPT-Large](https://huggingface.co/gpt2-large), [GPT-Medium](https://huggingface.co/gpt2-medium) and [GPT-XL](https://huggingface.co/gpt2-xl) ## Intended uses & limitations You can use the raw model for text generation or fine-tune it to a downstream task. See the [model hub](https://huggingface.co/models?filter=gpt2) to look for fine-tuned versions on a task that interests you. ### How to use You can use this model directly with a pipeline for text generation. Since the generation relies on some randomness, we set a seed for reproducibility: ```python >>> from transformers import pipeline, set_seed >>> generator = pipeline('text-generation', model='gpt2') >>> set_seed(42) >>> generator("Hello, I'm a language model,", max_length=30, num_return_sequences=5) [{'generated_text': "Hello, I'm a language model, a language for thinking, a language for expressing thoughts."}, {'generated_text': "Hello, I'm a language model, a compiler, a compiler library, I just want to know how I build this kind of stuff. I don"}, {'generated_text': "Hello, I'm a language model, and also have more than a few of your own, but I understand that they're going to need some help"}, {'generated_text': "Hello, I'm a language model, a system model. I want to know my language so that it might be more interesting, more user-friendly"}, {'generated_text': 'Hello, I\'m a language model, not a language model"\n\nThe concept of "no-tricks" comes in handy later with new'}] ``` Here is how to use this model to get the features of a given text in PyTorch: ```python from transformers import GPT2Tokenizer, GPT2Model tokenizer = GPT2Tokenizer.from_pretrained('gpt2') model = GPT2Model.from_pretrained('gpt2') text = "Replace me by any text you'd like." encoded_input = tokenizer(text, return_tensors='pt') output = model(**encoded_input) ``` and in TensorFlow: ```python from transformers import GPT2Tokenizer, TFGPT2Model tokenizer = GPT2Tokenizer.from_pretrained('gpt2') model = TFGPT2Model.from_pretrained('gpt2') text = "Replace me by any text you'd like." encoded_input = tokenizer(text, return_tensors='tf') output = model(encoded_input) ``` ### Limitations and bias The training data used for this model has not been released as a dataset one can browse. We know it contains a lot of unfiltered content from the internet, which is far from neutral. As the openAI team themselves point out in their [model card](https://github.com/openai/gpt-2/blob/master/model_card.md#out-of-scope-use-cases): > Because large-scale language models like GPT-2 do not distinguish fact from fiction, we don’t support use-cases > that require the generated text to be true. > > Additionally, language models like GPT-2 reflect the biases inherent to the systems they were trained on, so we do > not recommend that they be deployed into systems that interact with humans > unless the deployers first carry out a > study of biases relevant to the intended use-case. We found no statistically significant difference in gender, race, > and religious bias probes between 774M and 1.5B, implying all versions of GPT-2 should be approached with similar > levels of caution around use cases that are sensitive to biases around human attributes. Here's an example of how the model can have biased predictions: ```python >>> from transformers import pipeline, set_seed >>> generator = pipeline('text-generation', model='gpt2') >>> set_seed(42) >>> generator("The White man worked as a", max_length=10, num_return_sequences=5) [{'generated_text': 'The White man worked as a mannequin for'}, {'generated_text': 'The White man worked as a maniser of the'}, {'generated_text': 'The White man worked as a bus conductor by day'}, {'generated_text': 'The White man worked as a plumber at the'}, {'generated_text': 'The White man worked as a journalist. He had'}] >>> set_seed(42) >>> generator("The Black man worked as a", max_length=10, num_return_sequences=5) [{'generated_text': 'The Black man worked as a man at a restaurant'}, {'generated_text': 'The Black man worked as a car salesman in a'}, {'generated_text': 'The Black man worked as a police sergeant at the'}, {'generated_text': 'The Black man worked as a man-eating monster'}, {'generated_text': 'The Black man worked as a slave, and was'}] ``` This bias will also affect all fine-tuned versions of this model. ## Training data The OpenAI team wanted to train this model on a corpus as large as possible. To build it, they scraped all the web pages from outbound links on Reddit which received at least 3 karma. Note that all Wikipedia pages were removed from this dataset, so the model was not trained on any part of Wikipedia. The resulting dataset (called WebText) weights 40GB of texts but has not been publicly released. You can find a list of the top 1,000 domains present in WebText [here](https://github.com/openai/gpt-2/blob/master/domains.txt). ## Training procedure ### Preprocessing The texts are tokenized using a byte-level version of Byte Pair Encoding (BPE) (for unicode characters) and a vocabulary size of 50,257. The inputs are sequences of 1024 consecutive tokens. The larger model was trained on 256 cloud TPU v3 cores. The training duration was not disclosed, nor were the exact details of training. ## Evaluation results The model achieves the following results without any fine-tuning (zero-shot): | Dataset | LAMBADA | LAMBADA | CBT-CN | CBT-NE | WikiText2 | PTB | enwiki8 | text8 | WikiText103 | 1BW | |:--------:|:-------:|:-------:|:------:|:------:|:---------:|:------:|:-------:|:------:|:-----------:|:-----:| | (metric) | (PPL) | (ACC) | (ACC) | (ACC) | (PPL) | (PPL) | (BPB) | (BPC) | (PPL) | (PPL) | | | 35.13 | 45.99 | 87.65 | 83.4 | 29.41 | 65.85 | 1.16 | 1,17 | 37.50 | 75.20 | ### BibTeX entry and citation info ```bibtex @article{radford2019language, title={Language Models are Unsupervised Multitask Learners}, author={Radford, Alec and Wu, Jeff and Child, Rewon and Luan, David and Amodei, Dario and Sutskever, Ilya}, year={2019} } ``` <a href="https://huggingface.co/exbert/?model=gpt2"> <img width="300px" src="https://cdn-media.huggingface.co/exbert/button.png"> </a>

blockblockblock/gpt2-bpw2.5-exl2

blockblockblock

Entry not found

DBangshu/Base_GPT2_e5_0_3

DBangshu

transformers

text-generation

--- library_name: transformers tags: [] --- # Model Card for Model ID <!-- Provide a quick summary of what the model is/does. --> ## Model Details ### Model Description <!-- Provide a longer summary of what this model is. --> This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated. - **Developed by:** [More Information Needed] - **Funded by [optional]:** [More Information Needed] - **Shared by [optional]:** [More Information Needed] - **Model type:** [More Information Needed] - **Language(s) (NLP):** [More Information Needed] - **License:** [More Information Needed] - **Finetuned from model [optional]:** [More Information Needed] ### Model Sources [optional] <!-- Provide the basic links for the model. --> - **Repository:** [More Information Needed] - **Paper [optional]:** [More Information Needed] - **Demo [optional]:** [More Information Needed] ## Uses <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ### Direct Use <!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. --> [More Information Needed] ### Downstream Use [optional] <!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app --> [More Information Needed] ### Out-of-Scope Use <!-- This section addresses misuse, malicious use, and uses that the model will not work well for. --> [More Information Needed] ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> [More Information Needed] ### Recommendations <!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. --> Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations. ## How to Get Started with the Model Use the code below to get started with the model. [More Information Needed] ## Training Details ### Training Data <!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. --> [More Information Needed] ### Training Procedure <!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. --> #### Preprocessing [optional] [More Information Needed] #### Training Hyperparameters - **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision --> #### Speeds, Sizes, Times [optional] <!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. --> [More Information Needed] ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> ### Testing Data, Factors & Metrics #### Testing Data <!-- This should link to a Dataset Card if possible. --> [More Information Needed] #### Factors <!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. --> [More Information Needed] #### Metrics <!-- These are the evaluation metrics being used, ideally with a description of why. --> [More Information Needed] ### Results [More Information Needed] #### Summary ## Model Examination [optional] <!-- Relevant interpretability work for the model goes here --> [More Information Needed] ## Environmental Impact <!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly --> Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700). - **Hardware Type:** [More Information Needed] - **Hours used:** [More Information Needed] - **Cloud Provider:** [More Information Needed] - **Compute Region:** [More Information Needed] - **Carbon Emitted:** [More Information Needed] ## Technical Specifications [optional] ### Model Architecture and Objective [More Information Needed] ### Compute Infrastructure [More Information Needed] #### Hardware [More Information Needed] #### Software [More Information Needed] ## Citation [optional] <!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. --> **BibTeX:** [More Information Needed] **APA:** [More Information Needed] ## Glossary [optional] <!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. --> [More Information Needed] ## More Information [optional] [More Information Needed] ## Model Card Authors [optional] [More Information Needed] ## Model Card Contact [More Information Needed]

Michindus/Fat_Furs_reloaded

Michindus

Entry not found

radna/test_images

radna

Entry not found

anamikac2708/Llama3-8b-finetuned-investopedia-Merged-FP16

anamikac2708

transformers

text-generation

--- language: - en license: cc-by-nc-4.0 tags: - text-generation-inference - transformers - unsloth - llama - trl - finlang - qlora base_model: unsloth/llama-3-8b-bnb-4bit --- # Uploaded model - **Developed by:** anamikac2708 - **License:** cc-by-nc-4.0 - **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library using open-sourced finance dataset https://huggingface.co/datasets/FinLang/investopedia-instruction-tuning-dataset developed for finance application by FinLang Team This project is for research purposes only. Third-party datasets may be subject to additional terms and conditions under their associated licenses. ## How to Get Started with the Model <!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. --> ```python import torch from unsloth import FastLanguageModel from transformers import AutoTokenizer, pipeline max_seq_length=2048 model, tokenizer = FastLanguageModel.from_pretrained( model_name = "anamikac2708/Llama3-8b-finetuned-investopedia-Merged-FP16", # YOUR MODEL YOU USED FOR TRAINING max_seq_length = max_seq_length, dtype = torch.bfloat16, #load_in_4bit = True, # IF YOU WANT TO LOAD WITH BITSANDBYTES INT4 ) pipe = pipeline("text-generation", model=model, tokenizer=tokenizer) example = [{'content': 'You are a financial expert and you can answer any questions related to finance. You will be given a context and a question. Understand the given context and\n try to answer. Users will ask you questions in English and you will generate answer based on the provided CONTEXT.\n CONTEXT:\n D. in Forced Migration from the University of the Witwatersrand (Wits) in Johannesburg, South Africa; A postgraduate diploma in Folklore & Cultural Studies at Indira Gandhi National Open University (IGNOU) in New Delhi, India; A Masters of International Affairs at Columbia University; A BA from Barnard College at Columbia University\n', 'role': 'system'}, {'content': ' In which universities did the individual obtain their academic qualifications?\n', 'role': 'user'}, {'content': ' University of the Witwatersrand (Wits) in Johannesburg, South Africa; Indira Gandhi National Open University (IGNOU) in New Delhi, India; Columbia University; Barnard College at Columbia University.', 'role': 'assistant'}] prompt = pipe.tokenizer.apply_chat_template(example[:2], tokenize=False, add_generation_prompt=True) outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.1, top_k=50, top_p=0.1, eos_token_id=pipe.tokenizer.eos_token_id, pad_token_id=pipe.tokenizer.pad_token_id) print(f"Query:\n{example[1]['content']}") print(f"Context:\n{example[0]['content']}") print(f"Original Answer:\n{example[2]['content']}") print(f"Generated Answer:\n{outputs[0]['generated_text'][len(prompt):].strip()}") ``` ## Training Details ``` Peft Config : { 'Technqiue' : 'QLORA', 'rank': 256, 'target_modules' : ["q_proj", "k_proj", "v_proj", "o_proj","gate_proj", "up_proj", "down_proj",], 'lora_alpha' : 128, 'lora_dropout' : 0, 'bias': "none", } Hyperparameters: { "epochs": 3, "evaluation_strategy": "epoch", "gradient_checkpointing": True, "max_grad_norm" : 0.3, "optimizer" : "adamw_torch_fused", "learning_rate" : 2e-4, "lr_scheduler_type": "constant", "warmup_ratio" : 0.03, "per_device_train_batch_size" : 4, "per_device_eval_batch_size" : 4, "gradient_accumulation_steps" : 4 } ``` ## Model was trained on 1xA100 80GB, below loss and memory consmuption details: {'eval_loss': 0.9614351987838745, 'eval_runtime': 244.0411, 'eval_samples_per_second': 2.663, 'eval_steps_per_second': 0.668, 'epoch': 3.0} {'train_runtime': 19718.5285, 'train_samples_per_second': 0.781, 'train_steps_per_second': 0.049, 'train_loss': 0.8241131883172602, 'epoch': 3.0} Total training time 19720.924563884735 328.64 minutes used for training. Peak reserved memory = 35.789 GB. Peak reserved memory for training = 27.848 GB. Peak reserved memory % of max memory = 45.216 %. Peak reserved memory for training % of max memory = 35.183 %. QLORA paper link - https://arxiv.org/abs/2305.14314 ## Evaluation <!-- This section describes the evaluation protocols and provides the results. --> We evaluated the model on test set (sample 1k) https://huggingface.co/datasets/FinLang/investopedia-instruction-tuning-dataset. Evaluation was done using Proprietary LLMs as jury on four criteria Correctness, Faithfullness, Clarity, Completeness on scale of 1-5 (1 being worst & 5 being best) inspired by the paper Replacing Judges with Juries https://arxiv.org/abs/2404.18796. Model got an average score of 4.67. Average inference speed of the model is 10.96 secs. Human Evaluation is in progress to see the percentage of alignment between human and LLM. ## Bias, Risks, and Limitations <!-- This section is meant to convey both technical and sociotechnical limitations. --> This model is a quick demonstration that the base model can be easily fine-tuned to achieve compelling performance. It does not have any moderation mechanisms. We're looking into ways to make the model finely respect guardrails, allowing for deployment in environments requiring moderated outputs. ## License Since non-commercial datasets are used for fine-tuning, we release this model as cc-by-nc-4.0.

luweigen/Llama-3-8B-Instruct-int4-onnx-directml

luweigen

text-generation

--- language: - en pipeline_tag: text-generation tags: - facebook - meta - pytorch - llama - llama-3 - ONNX - DirectML - DML license: llama3 extra_gated_prompt: >- ### META LLAMA 3 COMMUNITY LICENSE AGREEMENT Meta Llama 3 Version Release Date: April 18, 2024 "Agreement" means the terms and conditions for use, reproduction, distribution and modification of the Llama Materials set forth herein. "Documentation" means the specifications, manuals and documentation accompanying Meta Llama 3 distributed by Meta at https://llama.meta.com/get-started/. "Licensee" or "you" means you, or your employer or any other person or entity (if you are entering into this Agreement on such person or entity’s behalf), of the age required under applicable laws, rules or regulations to provide legal consent and that has legal authority to bind your employer or such other person or entity if you are entering in this Agreement on their behalf. "Meta Llama 3" means the foundational large language models and software and algorithms, including machine-learning model code, trained model weights, inference-enabling code, training-enabling code, fine-tuning enabling code and other elements of the foregoing distributed by Meta at https://llama.meta.com/llama-downloads. "Llama Materials" means, collectively, Meta’s proprietary Meta Llama 3 and Documentation (and any portion thereof) made available under this Agreement. "Meta" or "we" means Meta Platforms Ireland Limited (if you are located in or, if you are an entity, your principal place of business is in the EEA or Switzerland) and Meta Platforms, Inc. (if you are located outside of the EEA or Switzerland). 1. License Rights and Redistribution. a. Grant of Rights. You are granted a non-exclusive, worldwide, non-transferable and royalty-free limited license under Meta’s intellectual property or other rights owned by Meta embodied in the Llama Materials to use, reproduce, distribute, copy, create derivative works of, and make modifications to the Llama Materials. b. Redistribution and Use. i. If you distribute or make available the Llama Materials (or any derivative works thereof), or a product or service that uses any of them, including another AI model, you shall (A) provide a copy of this Agreement with any such Llama Materials; and (B) prominently display “Built with Meta Llama 3” on a related website, user interface, blogpost, about page, or product documentation. If you use the Llama Materials to create, train, fine tune, or otherwise improve an AI model, which is distributed or made available, you shall also include “Llama 3” at the beginning of any such AI model name. ii. If you receive Llama Materials, or any derivative works thereof, from a Licensee as part of an integrated end user product, then Section 2 of this Agreement will not apply to you. iii. You must retain in all copies of the Llama Materials that you distribute the following attribution notice within a “Notice” text file distributed as a part of such copies: “Meta Llama 3 is licensed under the Meta Llama 3 Community License, Copyright © Meta Platforms, Inc. All Rights Reserved.” iv. Your use of the Llama Materials must comply with applicable laws and regulations (including trade compliance laws and regulations) and adhere to the Acceptable Use Policy for the Llama Materials (available at https://llama.meta.com/llama3/use-policy), which is hereby incorporated by reference into this Agreement. v. You will not use the Llama Materials or any output or results of the Llama Materials to improve any other large language model (excluding Meta Llama 3 or derivative works thereof). 2. Additional Commercial Terms. If, on the Meta Llama 3 version release date, the monthly active users of the products or services made available by or for Licensee, or Licensee’s affiliates, is greater than 700 million monthly active users in the preceding calendar month, you must request a license from Meta, which Meta may grant to you in its sole discretion, and you are not authorized to exercise any of the rights under this Agreement unless or until Meta otherwise expressly grants you such rights. 3. Disclaimer of Warranty. UNLESS REQUIRED BY APPLICABLE LAW, THE LLAMA MATERIALS AND ANY OUTPUT AND RESULTS THEREFROM ARE PROVIDED ON AN “AS IS” BASIS, WITHOUT WARRANTIES OF ANY KIND, AND META DISCLAIMS ALL WARRANTIES OF ANY KIND, BOTH EXPRESS AND IMPLIED, INCLUDING, WITHOUT LIMITATION, ANY WARRANTIES OF TITLE, NON-INFRINGEMENT, MERCHANTABILITY, OR FITNESS FOR A PARTICULAR PURPOSE. YOU ARE SOLELY RESPONSIBLE FOR DETERMINING THE APPROPRIATENESS OF USING OR REDISTRIBUTING THE LLAMA MATERIALS AND ASSUME ANY RISKS ASSOCIATED WITH YOUR USE OF THE LLAMA MATERIALS AND ANY OUTPUT AND RESULTS. 4. Limitation of Liability. IN NO EVENT WILL META OR ITS AFFILIATES BE LIABLE UNDER ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, TORT, NEGLIGENCE, PRODUCTS LIABILITY, OR OTHERWISE, ARISING OUT OF THIS AGREEMENT, FOR ANY LOST PROFITS OR ANY INDIRECT, SPECIAL, CONSEQUENTIAL, INCIDENTAL, EXEMPLARY OR PUNITIVE DAMAGES, EVEN IF META OR ITS AFFILIATES HAVE BEEN ADVISED OF THE POSSIBILITY OF ANY OF THE FOREGOING. 5. Intellectual Property. a. No trademark licenses are granted under this Agreement, and in connection with the Llama Materials, neither Meta nor Licensee may use any name or mark owned by or associated with the other or any of its affiliates, except as required for reasonable and customary use in describing and redistributing the Llama Materials or as set forth in this Section 5(a). Meta hereby grants you a license to use “Llama 3” (the “Mark”) solely as required to comply with the last sentence of Section 1.b.i. You will comply with Meta’s brand guidelines (currently accessible at https://about.meta.com/brand/resources/meta/company-brand/ ). All goodwill arising out of your use of the Mark will inure to the benefit of Meta. b. Subject to Meta’s ownership of Llama Materials and derivatives made by or for Meta, with respect to any derivative works and modifications of the Llama Materials that are made by you, as between you and Meta, you are and will be the owner of such derivative works and modifications. c. If you institute litigation or other proceedings against Meta or any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Llama Materials or Meta Llama 3 outputs or results, or any portion of any of the foregoing, constitutes infringement of intellectual property or other rights owned or licensable by you, then any licenses granted to you under this Agreement shall terminate as of the date such litigation or claim is filed or instituted. You will indemnify and hold harmless Meta from and against any claim by any third party arising out of or related to your use or distribution of the Llama Materials. 6. Term and Termination. The term of this Agreement will commence upon your acceptance of this Agreement or access to the Llama Materials and will continue in full force and effect until terminated in accordance with the terms and conditions herein. Meta may terminate this Agreement if you are in breach of any term or condition of this Agreement. Upon termination of this Agreement, you shall delete and cease use of the Llama Materials. Sections 3, 4 and 7 shall survive the termination of this Agreement. 7. Governing Law and Jurisdiction. This Agreement will be governed and construed under the laws of the State of California without regard to choice of law principles, and the UN Convention on Contracts for the International Sale of Goods does not apply to this Agreement. The courts of California shall have exclusive jurisdiction of any dispute arising out of this Agreement. ### Meta Llama 3 Acceptable Use Policy Meta is committed to promoting safe and fair use of its tools and features, including Meta Llama 3. If you access or use Meta Llama 3, you agree to this Acceptable Use Policy (“Policy”). The most recent copy of this policy can be found at [https://llama.meta.com/llama3/use-policy](https://llama.meta.com/llama3/use-policy) #### Prohibited Uses We want everyone to use Meta Llama 3 safely and responsibly. You agree you will not use, or allow others to use, Meta Llama 3 to: 1. Violate the law or others’ rights, including to: 1. Engage in, promote, generate, contribute to, encourage, plan, incite, or further illegal or unlawful activity or content, such as: 1. Violence or terrorism 2. Exploitation or harm to children, including the solicitation, creation, acquisition, or dissemination of child exploitative content or failure to report Child Sexual Abuse Material 3. Human trafficking, exploitation, and sexual violence 4. The illegal distribution of information or materials to minors, including obscene materials, or failure to employ legally required age-gating in connection with such information or materials. 5. Sexual solicitation 6. Any other criminal activity 2. Engage in, promote, incite, or facilitate the harassment, abuse, threatening, or bullying of individuals or groups of individuals 3. Engage in, promote, incite, or facilitate discrimination or other unlawful or harmful conduct in the provision of employment, employment benefits, credit, housing, other economic benefits, or other essential goods and services 4. Engage in the unauthorized or unlicensed practice of any profession including, but not limited to, financial, legal, medical/health, or related professional practices 5. Collect, process, disclose, generate, or infer health, demographic, or other sensitive personal or private information about individuals without rights and consents required by applicable laws 6. Engage in or facilitate any action or generate any content that infringes, misappropriates, or otherwise violates any third-party rights, including the outputs or results of any products or services using the Llama Materials 7. Create, generate, or facilitate the creation of malicious code, malware, computer viruses or do anything else that could disable, overburden, interfere with or impair the proper working, integrity, operation or appearance of a website or computer system 2. Engage in, promote, incite, facilitate, or assist in the planning or development of activities that present a risk of death or bodily harm to individuals, including use of Meta Llama 3 related to the following: 1. Military, warfare, nuclear industries or applications, espionage, use for materials or activities that are subject to the International Traffic Arms Regulations (ITAR) maintained by the United States Department of State 2. Guns and illegal weapons (including weapon development) 3. Illegal drugs and regulated/controlled substances 4. Operation of critical infrastructure, transportation technologies, or heavy machinery 5. Self-harm or harm to others, including suicide, cutting, and eating disorders 6. Any content intended to incite or promote violence, abuse, or any infliction of bodily harm to an individual 3. Intentionally deceive or mislead others, including use of Meta Llama 3 related to the following: 1. Generating, promoting, or furthering fraud or the creation or promotion of disinformation 2. Generating, promoting, or furthering defamatory content, including the creation of defamatory statements, images, or other content 3. Generating, promoting, or further distributing spam 4. Impersonating another individual without consent, authorization, or legal right 5. Representing that the use of Meta Llama 3 or outputs are human-generated 6. Generating or facilitating false online engagement, including fake reviews and other means of fake online engagement 4. Fail to appropriately disclose to end users any known dangers of your AI system Please report any violation of this Policy, software “bug,” or other problems that could lead to a violation of this Policy through one of the following means: * Reporting issues with the model: [https://github.com/meta-llama/llama3](https://github.com/meta-llama/llama3) * Reporting risky content generated by the model: developers.facebook.com/llama_output_feedback * Reporting bugs and security concerns: facebook.com/whitehat/info * Reporting violations of the Acceptable Use Policy or unlicensed uses of Meta Llama 3: LlamaUseReport@meta.com extra_gated_fields: First Name: text Last Name: text Date of birth: date_picker Country: country Affiliation: text geo: ip_location By clicking Submit below I accept the terms of the license and acknowledge that the information I provide will be collected stored processed and shared in accordance with the Meta Privacy Policy: checkbox extra_gated_description: The information you provide will be collected, stored, processed and shared in accordance with the [Meta Privacy Policy](https://www.facebook.com/privacy/policy/). extra_gated_button_content: Submit widget: - example_title: Hello messages: - role: user content: Hey my name is Julien! How are you? - example_title: Winter holidays messages: - role: system content: You are a helpful and honest assistant. Please, respond concisely and truthfully. - role: user content: Can you recommend a good destination for Winter holidays? - example_title: Programming assistant messages: - role: system content: You are a helpful and honest code and programming assistant. Please, respond concisely and truthfully. - role: user content: Write a function that computes the nth fibonacci number. inference: parameters: max_new_tokens: 300 stop: - <|end_of_text|> - <|eot_id|> --- ## Model Details [Wei Lu](https://medium.com/@GenerationAI) converted this model with [onnxruntime_genai](https://github.com/microsoft/onnxruntime-genai/): ```sh python -m onnxruntime_genai.models.builder -m meta-llama/Meta-Llama-3-8B-Instruct -o llama-3-8B-Instruct-int4-onnx-directml -p int4 -e dml -c ..\.cache\huggingface\hub\ ``` Meta developed and released the Meta Llama 3 family of large language models (LLMs), a collection of pretrained and instruction tuned generative text models in 8 and 70B sizes. The Llama 3 instruction tuned models are optimized for dialogue use cases and outperform many of the available open source chat models on common industry benchmarks. Further, in developing these models, we took great care to optimize helpfulness and safety. **Model developers** Meta **Variations** Llama 3 comes in two sizes — 8B and 70B parameters — in pre-trained and instruction tuned variants. **Input** Models input text only. **Output** Models generate text and code only. **Model Architecture** Llama 3 is an auto-regressive language model that uses an optimized transformer architecture. The tuned versions use supervised fine-tuning (SFT) and reinforcement learning with human feedback (RLHF) to align with human preferences for helpfulness and safety. <table> <tr> <td> </td> <td><strong>Training Data</strong> </td> <td><strong>Params</strong> </td> <td><strong>Context length</strong> </td> <td><strong>GQA</strong> </td> <td><strong>Token count</strong> </td> <td><strong>Knowledge cutoff</strong> </td> </tr> <tr> <td rowspan="2" >Llama 3 </td> <td rowspan="2" >A new mix of publicly available online data. </td> <td>8B </td> <td>8k </td> <td>Yes </td> <td rowspan="2" >15T+ </td> <td>March, 2023 </td> </tr> <tr> <td>70B </td> <td>8k </td> <td>Yes </td> <td>December, 2023 </td> </tr> </table> **Llama 3 family of models**. Token counts refer to pretraining data only. Both the 8 and 70B versions use Grouped-Query Attention (GQA) for improved inference scalability. **Model Release Date** April 18, 2024. **Status** This is a static model trained on an offline dataset. Future versions of the tuned models will be released as we improve model safety with community feedback. **License** A custom commercial license is available at: [https://llama.meta.com/llama3/license](https://llama.meta.com/llama3/license) Where to send questions or comments about the model Instructions on how to provide feedback or comments on the model can be found in the model [README](https://github.com/meta-llama/llama3). For more technical information about generation parameters and recipes for how to use Llama 3 in applications, please go [here](https://github.com/meta-llama/llama-recipes). ## Intended Use **Intended Use Cases** Llama 3 is intended for commercial and research use in English. Instruction tuned models are intended for assistant-like chat, whereas pretrained models can be adapted for a variety of natural language generation tasks. **Out-of-scope** Use in any manner that violates applicable laws or regulations (including trade compliance laws). Use in any other way that is prohibited by the Acceptable Use Policy and Llama 3 Community License. Use in languages other than English**. **Note: Developers may fine-tune Llama 3 models for languages beyond English provided they comply with the Llama 3 Community License and the Acceptable Use Policy. ## How to use This repository contains two versions of Meta-Llama-3-8B-Instruct, for use with transformers and with the original `llama3` codebase. ### Use with transformers You can run conversational inference using the Transformers pipeline abstraction, or by leveraging the Auto classes with the `generate()` function. Let's see examples of both. #### Transformers pipeline ```python import transformers import torch model_id = "meta-llama/Meta-Llama-3-8B-Instruct" pipeline = transformers.pipeline( "text-generation", model=model_id, model_kwargs={"torch_dtype": torch.bfloat16}, device_map="auto", ) messages = [ {"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"}, {"role": "user", "content": "Who are you?"}, ] terminators = [ pipeline.tokenizer.eos_token_id, pipeline.tokenizer.convert_tokens_to_ids("<|eot_id|>") ] outputs = pipeline( messages, max_new_tokens=256, eos_token_id=terminators, do_sample=True, temperature=0.6, top_p=0.9, ) print(outputs[0]["generated_text"][-1]) ``` #### Transformers AutoModelForCausalLM ```python from transformers import AutoTokenizer, AutoModelForCausalLM import torch model_id = "meta-llama/Meta-Llama-3-8B-Instruct" tokenizer = AutoTokenizer.from_pretrained(model_id) model = AutoModelForCausalLM.from_pretrained( model_id, torch_dtype=torch.bfloat16, device_map="auto", ) messages = [ {"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"}, {"role": "user", "content": "Who are you?"}, ] input_ids = tokenizer.apply_chat_template( messages, add_generation_prompt=True, return_tensors="pt" ).to(model.device) terminators = [ tokenizer.eos_token_id, tokenizer.convert_tokens_to_ids("<|eot_id|>") ] outputs = model.generate( input_ids, max_new_tokens=256, eos_token_id=terminators, do_sample=True, temperature=0.6, top_p=0.9, ) response = outputs[0][input_ids.shape[-1]:] print(tokenizer.decode(response, skip_special_tokens=True)) ``` ### Use with `llama3` Please, follow the instructions in the [repository](https://github.com/meta-llama/llama3) To download Original checkpoints, see the example command below leveraging `huggingface-cli`: ``` huggingface-cli download meta-llama/Meta-Llama-3-8B-Instruct --include "original/*" --local-dir Meta-Llama-3-8B-Instruct ``` For Hugging Face support, we recommend using transformers or TGI, but a similar command works. ## Hardware and Software **Training Factors** We used custom training libraries, Meta's Research SuperCluster, and production clusters for pretraining. Fine-tuning, annotation, and evaluation were also performed on third-party cloud compute. **Carbon Footprint Pretraining utilized a cumulative** 7.7M GPU hours of computation on hardware of type H100-80GB (TDP of 700W). Estimated total emissions were 2290 tCO2eq, 100% of which were offset by Meta’s sustainability program. <table> <tr> <td> </td> <td><strong>Time (GPU hours)</strong> </td> <td><strong>Power Consumption (W)</strong> </td> <td><strong>Carbon Emitted(tCO2eq)</strong> </td> </tr> <tr> <td>Llama 3 8B </td> <td>1.3M </td> <td>700 </td> <td>390 </td> </tr> <tr> <td>Llama 3 70B </td> <td>6.4M </td> <td>700 </td> <td>1900 </td> </tr> <tr> <td>Total </td> <td>7.7M </td> <td> </td> <td>2290 </td> </tr> </table> **CO2 emissions during pre-training**. Time: total GPU time required for training each model. Power Consumption: peak power capacity per GPU device for the GPUs used adjusted for power usage efficiency. 100% of the emissions are directly offset by Meta's sustainability program, and because we are openly releasing these models, the pretraining costs do not need to be incurred by others. ## Training Data **Overview** Llama 3 was pretrained on over 15 trillion tokens of data from publicly available sources. The fine-tuning data includes publicly available instruction datasets, as well as over 10M human-annotated examples. Neither the pretraining nor the fine-tuning datasets include Meta user data. **Data Freshness** The pretraining data has a cutoff of March 2023 for the 8B and December 2023 for the 70B models respectively. ## Benchmarks In this section, we report the results for Llama 3 models on standard automatic benchmarks. For all the evaluations, we use our internal evaluations library. For details on the methodology see [here](https://github.com/meta-llama/llama3/blob/main/eval_methodology.md). ### Base pretrained models <table> <tr> <td><strong>Category</strong> </td> <td><strong>Benchmark</strong> </td> <td><strong>Llama 3 8B</strong> </td> <td><strong>Llama2 7B</strong> </td> <td><strong>Llama2 13B</strong> </td> <td><strong>Llama 3 70B</strong> </td> <td><strong>Llama2 70B</strong> </td> </tr> <tr> <td rowspan="6" >General </td> <td>MMLU (5-shot) </td> <td>66.6 </td> <td>45.7 </td> <td>53.8 </td> <td>79.5 </td> <td>69.7 </td> </tr> <tr> <td>AGIEval English (3-5 shot) </td> <td>45.9 </td> <td>28.8 </td> <td>38.7 </td> <td>63.0 </td> <td>54.8 </td> </tr> <tr> <td>CommonSenseQA (7-shot) </td> <td>72.6 </td> <td>57.6 </td> <td>67.6 </td> <td>83.8 </td> <td>78.7 </td> </tr> <tr> <td>Winogrande (5-shot) </td> <td>76.1 </td> <td>73.3 </td> <td>75.4 </td> <td>83.1 </td> <td>81.8 </td> </tr> <tr> <td>BIG-Bench Hard (3-shot, CoT) </td> <td>61.1 </td> <td>38.1 </td> <td>47.0 </td> <td>81.3 </td> <td>65.7 </td> </tr> <tr> <td>ARC-Challenge (25-shot) </td> <td>78.6 </td> <td>53.7 </td> <td>67.6 </td> <td>93.0 </td> <td>85.3 </td> </tr> <tr> <td>Knowledge reasoning </td> <td>TriviaQA-Wiki (5-shot) </td> <td>78.5 </td> <td>72.1 </td> <td>79.6 </td> <td>89.7 </td> <td>87.5 </td> </tr> <tr> <td rowspan="4" >Reading comprehension </td> <td>SQuAD (1-shot) </td> <td>76.4 </td> <td>72.2 </td> <td>72.1 </td> <td>85.6 </td> <td>82.6 </td> </tr> <tr> <td>QuAC (1-shot, F1) </td> <td>44.4 </td> <td>39.6 </td> <td>44.9 </td> <td>51.1 </td> <td>49.4 </td> </tr> <tr> <td>BoolQ (0-shot) </td> <td>75.7 </td> <td>65.5 </td> <td>66.9 </td> <td>79.0 </td> <td>73.1 </td> </tr> <tr> <td>DROP (3-shot, F1) </td> <td>58.4 </td> <td>37.9 </td> <td>49.8 </td> <td>79.7 </td> <td>70.2 </td> </tr> </table> ### Instruction tuned models <table> <tr> <td><strong>Benchmark</strong> </td> <td><strong>Llama 3 8B</strong> </td> <td><strong>Llama 2 7B</strong> </td> <td><strong>Llama 2 13B</strong> </td> <td><strong>Llama 3 70B</strong> </td> <td><strong>Llama 2 70B</strong> </td> </tr> <tr> <td>MMLU (5-shot) </td> <td>68.4 </td> <td>34.1 </td> <td>47.8 </td> <td>82.0 </td> <td>52.9 </td> </tr> <tr> <td>GPQA (0-shot) </td> <td>34.2 </td> <td>21.7 </td> <td>22.3 </td> <td>39.5 </td> <td>21.0 </td> </tr> <tr> <td>HumanEval (0-shot) </td> <td>62.2 </td> <td>7.9 </td> <td>14.0 </td> <td>81.7 </td> <td>25.6 </td> </tr> <tr> <td>GSM-8K (8-shot, CoT) </td> <td>79.6 </td> <td>25.7 </td> <td>77.4 </td> <td>93.0 </td> <td>57.5 </td> </tr> <tr> <td>MATH (4-shot, CoT) </td> <td>30.0 </td> <td>3.8 </td> <td>6.7 </td> <td>50.4 </td> <td>11.6 </td> </tr> </table> ### Responsibility & Safety We believe that an open approach to AI leads to better, safer products, faster innovation, and a bigger overall market. We are committed to Responsible AI development and took a series of steps to limit misuse and harm and support the open source community. Foundation models are widely capable technologies that are built to be used for a diverse range of applications. They are not designed to meet every developer preference on safety levels for all use cases, out-of-the-box, as those by their nature will differ across different applications. Rather, responsible LLM-application deployment is achieved by implementing a series of safety best practices throughout the development of such applications, from the model pre-training, fine-tuning and the deployment of systems composed of safeguards to tailor the safety needs specifically to the use case and audience. As part of the Llama 3 release, we updated our [Responsible Use Guide](https://llama.meta.com/responsible-use-guide/) to outline the steps and best practices for developers to implement model and system level safety for their application. We also provide a set of resources including [Meta Llama Guard 2](https://llama.meta.com/purple-llama/) and [Code Shield](https://llama.meta.com/purple-llama/) safeguards. These tools have proven to drastically reduce residual risks of LLM Systems, while maintaining a high level of helpfulness. We encourage developers to tune and deploy these safeguards according to their needs and we provide a [reference implementation](https://github.com/meta-llama/llama-recipes/tree/main/recipes/responsible_ai) to get you started. #### Llama 3-Instruct As outlined in the Responsible Use Guide, some trade-off between model helpfulness and model alignment is likely unavoidable. Developers should exercise discretion about how to weigh the benefits of alignment and helpfulness for their specific use case and audience. Developers should be mindful of residual risks when using Llama models and leverage additional safety tools as needed to reach the right safety bar for their use case. <span style="text-decoration:underline;">Safety</span> For our instruction tuned model, we conducted extensive red teaming exercises, performed adversarial evaluations and implemented safety mitigations techniques to lower residual risks. As with any Large Language Model, residual risks will likely remain and we recommend that developers assess these risks in the context of their use case. In parallel, we are working with the community to make AI safety benchmark standards transparent, rigorous and interpretable. <span style="text-decoration:underline;">Refusals</span> In addition to residual risks, we put a great emphasis on model refusals to benign prompts. Over-refusing not only can impact the user experience but could even be harmful in certain contexts as well. We’ve heard the feedback from the developer community and improved our fine tuning to ensure that Llama 3 is significantly less likely to falsely refuse to answer prompts than Llama 2. We built internal benchmarks and developed mitigations to limit false refusals making Llama 3 our most helpful model to date. #### Responsible release In addition to responsible use considerations outlined above, we followed a rigorous process that requires us to take extra measures against misuse and critical risks before we make our release decision. Misuse If you access or use Llama 3, you agree to the Acceptable Use Policy. The most recent copy of this policy can be found at [https://llama.meta.com/llama3/use-policy/](https://llama.meta.com/llama3/use-policy/). #### Critical risks <span style="text-decoration:underline;">CBRNE</span> (Chemical, Biological, Radiological, Nuclear, and high yield Explosives) We have conducted a two fold assessment of the safety of the model in this area: * Iterative testing during model training to assess the safety of responses related to CBRNE threats and other adversarial risks. * Involving external CBRNE experts to conduct an uplift test assessing the ability of the model to accurately provide expert knowledge and reduce barriers to potential CBRNE misuse, by reference to what can be achieved using web search (without the model). ### <span style="text-decoration:underline;">Cyber Security </span> We have evaluated Llama 3 with CyberSecEval, Meta’s cybersecurity safety eval suite, measuring Llama 3’s propensity to suggest insecure code when used as a coding assistant, and Llama 3’s propensity to comply with requests to help carry out cyber attacks, where attacks are defined by the industry standard MITRE ATT&CK cyber attack ontology. On our insecure coding and cyber attacker helpfulness tests, Llama 3 behaved in the same range or safer than models of [equivalent coding capability](https://huggingface.co/spaces/facebook/CyberSecEval). ### <span style="text-decoration:underline;">Child Safety</span> Child Safety risk assessments were conducted using a team of experts, to assess the model’s capability to produce outputs that could result in Child Safety risks and inform on any necessary and appropriate risk mitigations via fine tuning. We leveraged those expert red teaming sessions to expand the coverage of our evaluation benchmarks through Llama 3 model development. For Llama 3, we conducted new in-depth sessions using objective based methodologies to assess the model risks along multiple attack vectors. We also partnered with content specialists to perform red teaming exercises assessing potentially violating content while taking account of market specific nuances or experiences. ### Community Generative AI safety requires expertise and tooling, and we believe in the strength of the open community to accelerate its progress. We are active members of open consortiums, including the AI Alliance, Partnership in AI and MLCommons, actively contributing to safety standardization and transparency. We encourage the community to adopt taxonomies like the MLCommons Proof of Concept evaluation to facilitate collaboration and transparency on safety and content evaluations. Our Purple Llama tools are open sourced for the community to use and widely distributed across ecosystem partners including cloud service providers. We encourage community contributions to our [Github repository](https://github.com/meta-llama/PurpleLlama). Finally, we put in place a set of resources including an [output reporting mechanism](https://developers.facebook.com/llama_output_feedback) and [bug bounty program](https://www.facebook.com/whitehat) to continuously improve the Llama technology with the help of the community. ## Ethical Considerations and Limitations The core values of Llama 3 are openness, inclusivity and helpfulness. It is meant to serve everyone, and to work for a wide range of use cases. It is thus designed to be accessible to people across many different backgrounds, experiences and perspectives. Llama 3 addresses users and their needs as they are, without insertion unnecessary judgment or normativity, while reflecting the understanding that even content that may appear problematic in some cases can serve valuable purposes in others. It respects the dignity and autonomy of all users, especially in terms of the values of free thought and expression that power innovation and progress. But Llama 3 is a new technology, and like any new technology, there are risks associated with its use. Testing conducted to date has been in English, and has not covered, nor could it cover, all scenarios. For these reasons, as with all LLMs, Llama 3’s potential outputs cannot be predicted in advance, and the model may in some instances produce inaccurate, biased or other objectionable responses to user prompts. Therefore, before deploying any applications of Llama 3 models, developers should perform safety testing and tuning tailored to their specific applications of the model. As outlined in the Responsible Use Guide, we recommend incorporating [Purple Llama](https://github.com/facebookresearch/PurpleLlama) solutions into your workflows and specifically [Llama Guard](https://ai.meta.com/research/publications/llama-guard-llm-based-input-output-safeguard-for-human-ai-conversations/) which provides a base model to filter input and output prompts to layer system-level safety on top of model-level safety. Please see the Responsible Use Guide available at [http://llama.meta.com/responsible-use-guide](http://llama.meta.com/responsible-use-guide) ## Citation instructions @article{llama3modelcard, title={Llama 3 Model Card}, author={AI@Meta}, year={2024}, url = {https://github.com/meta-llama/llama3/blob/main/MODEL_CARD.md} } ## Contributors Aaditya Singh; Aaron Grattafiori; Abhimanyu Dubey; Abhinav Jauhri; Abhinav Pandey; Abhishek Kadian; Adam Kelsey; Adi Gangidi; Ahmad Al-Dahle; Ahuva Goldstand; Aiesha Letman; Ajay Menon; Akhil Mathur; Alan Schelten; Alex Vaughan; Amy Yang; Andrei Lupu; Andres Alvarado; Andrew Gallagher; Andrew Gu; Andrew Ho; Andrew Poulton; Andrew Ryan; Angela Fan; Ankit Ramchandani; Anthony Hartshorn; Archi Mitra; Archie Sravankumar; Artem Korenev; Arun Rao; Ashley Gabriel; Ashwin Bharambe; Assaf Eisenman; Aston Zhang; Aurelien Rodriguez; Austen Gregerson; Ava Spataru; Baptiste Roziere; Ben Maurer; Benjamin Leonhardi; Bernie Huang; Bhargavi Paranjape; Bing Liu; Binh Tang; Bobbie Chern; Brani Stojkovic; Brian Fuller; Catalina Mejia Arenas; Chao Zhou; Charlotte Caucheteux; Chaya Nayak; Ching-Hsiang Chu; Chloe Bi; Chris Cai; Chris Cox; Chris Marra; Chris McConnell; Christian Keller; Christoph Feichtenhofer; Christophe Touret; Chunyang Wu; Corinne Wong; Cristian Canton Ferrer; Damien Allonsius; Daniel Kreymer; Daniel Haziza; Daniel Li; Danielle Pintz; Danny Livshits; Danny Wyatt; David Adkins; David Esiobu; David Xu; Davide Testuggine; Delia David; Devi Parikh; Dhruv Choudhary; Dhruv Mahajan; Diana Liskovich; Diego Garcia-Olano; Diego Perino; Dieuwke Hupkes; Dingkang Wang; Dustin Holland; Egor Lakomkin; Elina Lobanova; Xiaoqing Ellen Tan; Emily Dinan; Eric Smith; Erik Brinkman; Esteban Arcaute; Filip Radenovic; Firat Ozgenel; Francesco Caggioni; Frank Seide; Frank Zhang; Gabriel Synnaeve; Gabriella Schwarz; Gabrielle Lee; Gada Badeer; Georgia Anderson; Graeme Nail; Gregoire Mialon; Guan Pang; Guillem Cucurell; Hailey Nguyen; Hannah Korevaar; Hannah Wang; Haroun Habeeb; Harrison Rudolph; Henry Aspegren; Hu Xu; Hugo Touvron; Iga Kozlowska; Igor Molybog; Igor Tufanov; Iliyan Zarov; Imanol Arrieta Ibarra; Irina-Elena Veliche; Isabel Kloumann; Ishan Misra; Ivan Evtimov; Jacob Xu; Jade Copet; Jake Weissman; Jan Geffert; Jana Vranes; Japhet Asher; Jason Park; Jay Mahadeokar; Jean-Baptiste Gaya; Jeet Shah; Jelmer van der Linde; Jennifer Chan; Jenny Hong; Jenya Lee; Jeremy Fu; Jeremy Teboul; Jianfeng Chi; Jianyu Huang; Jie Wang; Jiecao Yu; Joanna Bitton; Joe Spisak; Joelle Pineau; Jon Carvill; Jongsoo Park; Joseph Rocca; Joshua Johnstun; Junteng Jia; Kalyan Vasuden Alwala; Kam Hou U; Kate Plawiak; Kartikeya Upasani; Kaushik Veeraraghavan; Ke Li; Kenneth Heafield; Kevin Stone; Khalid El-Arini; Krithika Iyer; Kshitiz Malik; Kuenley Chiu; Kunal Bhalla; Kyle Huang; Lakshya Garg; Lauren Rantala-Yeary; Laurens van der Maaten; Lawrence Chen; Leandro Silva; Lee Bell; Lei Zhang; Liang Tan; Louis Martin; Lovish Madaan; Luca Wehrstedt; Lukas Blecher; Luke de Oliveira; Madeline Muzzi; Madian Khabsa; Manav Avlani; Mannat Singh; Manohar Paluri; Mark Zuckerberg; Marcin Kardas; Martynas Mankus; Mathew Oldham; Mathieu Rita; Matthew Lennie; Maya Pavlova; Meghan Keneally; Melanie Kambadur; Mihir Patel; Mikayel Samvelyan; Mike Clark; Mike Lewis; Min Si; Mitesh Kumar Singh; Mo Metanat; Mona Hassan; Naman Goyal; Narjes Torabi; Nicolas Usunier; Nikolay Bashlykov; Nikolay Bogoychev; Niladri Chatterji; Ning Dong; Oliver Aobo Yang; Olivier Duchenne; Onur Celebi; Parth Parekh; Patrick Alrassy; Paul Saab; Pavan Balaji; Pedro Rittner; Pengchuan Zhang; Pengwei Li; Petar Vasic; Peter Weng; Polina Zvyagina; Prajjwal Bhargava; Pratik Dubal; Praveen Krishnan; Punit Singh Koura; Qing He; Rachel Rodriguez; Ragavan Srinivasan; Rahul Mitra; Ramon Calderer; Raymond Li; Robert Stojnic; Roberta Raileanu; Robin Battey; Rocky Wang; Rohit Girdhar; Rohit Patel; Romain Sauvestre; Ronnie Polidoro; Roshan Sumbaly; Ross Taylor; Ruan Silva; Rui Hou; Rui Wang; Russ Howes; Ruty Rinott; Saghar Hosseini; Sai Jayesh Bondu; Samyak Datta; Sanjay Singh; Sara Chugh; Sargun Dhillon; Satadru Pan; Sean Bell; Sergey Edunov; Shaoliang Nie; Sharan Narang; Sharath Raparthy; Shaun Lindsay; Sheng Feng; Sheng Shen; Shenghao Lin; Shiva Shankar; Shruti Bhosale; Shun Zhang; Simon Vandenhende; Sinong Wang; Seohyun Sonia Kim; Soumya Batra; Sten Sootla; Steve Kehoe; Suchin Gururangan; Sumit Gupta; Sunny Virk; Sydney Borodinsky; Tamar Glaser; Tamar Herman; Tamara Best; Tara Fowler; Thomas Georgiou; Thomas Scialom; Tianhe Li; Todor Mihaylov; Tong Xiao; Ujjwal Karn; Vedanuj Goswami; Vibhor Gupta; Vignesh Ramanathan; Viktor Kerkez; Vinay Satish Kumar; Vincent Gonguet; Vish Vogeti; Vlad Poenaru; Vlad Tiberiu Mihailescu; Vladan Petrovic; Vladimir Ivanov; Wei Li; Weiwei Chu; Wenhan Xiong; Wenyin Fu; Wes Bouaziz; Whitney Meers; Will Constable; Xavier Martinet; Xiaojian Wu; Xinbo Gao; Xinfeng Xie; Xuchao Jia; Yaelle Goldschlag; Yann LeCun; Yashesh Gaur; Yasmine Babaei; Ye Qi; Yenda Li; Yi Wen; Yiwen Song; Youngjin Nam; Yuchen Hao; Yuchen Zhang; Yun Wang; Yuning Mao; Yuzi He; Zacharie Delpierre Coudert; Zachary DeVito; Zahra Hankir; Zhaoduo Wen; Zheng Yan; Zhengxing Chen; Zhenyu Yang; Zoe Papakipos

HajimeYasui0507/Cat

HajimeYasui0507

--- license: apache-2.0 ---

subhasishtech88/lama_fine_tune_lora_model_merged

subhasishtech88

transformers

--- language: - en license: apache-2.0 tags: - text-generation-inference - transformers - unsloth - llama - trl base_model: unsloth/llama-3-8b-bnb-4bit --- # Uploaded model - **Developed by:** subhasishtech88 - **License:** apache-2.0 - **Finetuned from model :** unsloth/llama-3-8b-bnb-4bit This llama model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library. [<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)

michaelmc1618/Mars

michaelmc1618

Entry not found

zera09/gemma_classifier

zera09

peft

--- license: gemma library_name: peft tags: - trl - sft - generated_from_trainer base_model: google/gemma-2b-it model-index: - name: gemma_classifier results: [] --- <!-- This model card has been generated automatically according to the information the Trainer had access to. You should probably proofread and complete it, then remove this comment. --> # gemma_classifier This model is a fine-tuned version of [google/gemma-2b-it](https://huggingface.co/google/gemma-2b-it) on the None dataset. ## Model description More information needed ## Intended uses & limitations More information needed ## Training and evaluation data More information needed ## Training procedure ### Training hyperparameters The following hyperparameters were used during training: - learning_rate: 0.0002 - train_batch_size: 8 - eval_batch_size: 8 - seed: 42 - gradient_accumulation_steps: 4 - total_train_batch_size: 32 - optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08 - lr_scheduler_type: linear - lr_scheduler_warmup_steps: 2 - num_epochs: 3 - mixed_precision_training: Native AMP ### Training results ### Framework versions - PEFT 0.8.2 - Transformers 4.41.1 - Pytorch 1.13.1+cu117 - Datasets 2.19.1 - Tokenizers 0.19.1

code4u1001/example_model

code4u1001

--- license: mit --- # This is README File

marduk191/sd3-Perturbed

marduk191

--- language: - en tags: - sd3-perturbed --- This is a Research model only!, not for public use in any way shape or form outside of research. See the Stable diffusion licensing for any questions or concerns on your use cases. To run the script open your comfyui venv or conda env and run with 'python sd3-perturbed-2.py' Be sure to change the paths to the files and the last number in 'noise = torch.normal(torch.zeros_like(v) v.mean(), torch.ones_like(v) v.std() * 0.01)' For noise percent.0.01 is 1% perturbed.

swaghjal/codellama7b_instruct_batch_2_trajectories_finetune

swaghjal

Entry not found