Datasets:

krvhrv

/

crawl-books

like 0

Michou, A. L, Santoro, L., Christ, M., Julliard, V., Pavirani, A., and Mehtafi, M. (1997). Adenovirus-mediated gene transfer: Influence of transgene, mouse strain, and type of immune response on persistence of transgene expression. Gene Ther. 4, 473-482. 132. Fields, P. A., Armstrong, E., Hagstrom, J. N., Arruda, V. R., Murphy, M. L., Farrell, J. P., High, K. A., and Herzog, R. W. (2001). Intravenous administration of an El/E3-deleted adenoviral vector induces tolerance to Factor IX in C57B1/6 mice. Gene Ther. 8, 354-361. 133. Connelly, S., Gardner, J. M., McClelland, A., and Kaleko, M. (1996). High-level tissue specific expression of functional human Factor VIII in mice. Hum. Gene Ther. 7, 183-195. 134. Schowalter, D. B., Himeda, C, L., Winther, B. L., Wilson, C. B., and Kay, M. (1999). Implication of interfering antibody formation and apoptosis as two different mechanisms leading to variable duration of adenovirus mediated transgene expression in immune- competent mice. / . Virol. 73, 4755-4766. 135. Gahery-Segard, H., Juillard, V., Gaston, J., Lengagne, R., Pavirani, A., Boulanger, P., and Guillet, J-G. (1997). Humoral immune response to the capsid components of recombinant adenoviruses: Routes of immunization modulate virus-induced Ig subclass shifts. Eur. J. Immunol. 27, 653-659. 136. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangeli, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994) Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8, 8-9. 137. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75, 207-216. 13. Humoral Immune Response 4 0 7 138. Zabner, J., Couture, L. A., Smith, A. E., and Welsh, M.J . (1994). Correction of cAMP- stimulated fluid secretion in cystic fibrosis airway epithelia: Efficiency of adenovirus-mediated gene transfer in vitro. Hum. Gene Ther. 5, 585-593. 139. Rosenfeld, M.A., Yoshimura, K., Trapnell, B.C., Yoneyama, K., Rosenthal, E.R., Dalemans, W., Fukayama, M., Bargon, J., Stier, L.E., Stratford-Perricaudet, L., Perricaudet, M., Guggino, W. B., Pavirani, A., Lecocq, J-P., and Crystal, R. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airw^ay epithelium. Ce//68, 143-155. 140. Kaplan, J. M., St. George, J. A., Pennington, S. E., Keyes, L. D., Johnson, R. P., Wadsv^orth, S. C , and Smith, A. E. (1996). Humoral and cellular immune responses of nonhuman primates to long-term repeated lung exposure to Ad2-CFTR-2. Gene Ther. 3, 117-127. 141. Van Ginkel, F. W., Liu, C , Simecka, J. W., Dong, J-Y., Greenway, T., Frizzell, R. A., Kiyono, H., McGhee, J. R., and Pascual, D. W. (1995). Intratracheal gene delivery with adenoviral vector induces elevated systemic IgG and mucosal IgA antibodies to adenovirus and p-galactosidase. Hum. Gene Ther. 6, 895-903. 142. Kajiwara, K., Byrnes, A. P., Ohmoto, Y., Charlton, H. M., Wood, M. J. A., and Wood, K. J. (2000). Humoral immune responses to adenovirus vectors in the brain. / . Neurol. Immunol. 103 ,8-15 . 143. Bennett, J., Pakola, S., Zeng, Y., and Maguire, A. (1996). Humoral response after admin­ istration of El deleted adenoviruses: Immune privilege of the subretinal space. Hum. Gene Ther. 7, 1763-1769. 144. Bramson, J. L., Hitt, M., Gauldie, J., and Graham, F. L. (1997). Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther. 4, 1069-1076. 145. Chen, P., Kovesdi, I., and Bruder, J. T. (2000). Effective repeat administration with aden­ ovirus vectors to the muscle. Gene Ther. 7, 587-595. 146. Mack, C. A, Magovern, C. J., Budenbender, K. T., Patel, S. R., Schwarz, E. A., Zanzonico, P., Ferris, B., Sanborn, T,, Isom, P., Ferris, B., Sanborn, T., Isom, O. W., Crystal, R. G., and Rosengart, T. K. (1998). Salvage angiogenesis induced by adenovirus mediated gene transfer of vascular endothelial growth factor protects against vascular occlusion. / . Vase. Surg. 4, 699-709. 147. Chirmule, N., Propert, K. J., Magosin, S. A., Qian, Y., Qian, R., and Wilson, J. M. (1999). Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther. 6, 1574-1583. 148. Molnar-Kimber, K. L., Sterman, D. H., Chang, M., Kang, E. H., ElBash, M., Lanuti, M., Elshami, A., Gelfand, K., Wilson, J. M., Kaiser, L. R., and Albeda, S. M. (1998). Impact of preexisting and induced humoral and cellular immune responses in an adenovirus-based gene therapy phase I clinical trial for localized mesotheHoma. Hum. Gene Ther. 9, 2121-2133. 149. Zabner, J., Ramsey, B. W., Meeker, D. P., Aitken, M. L., Balfour, R. P., Gibson, R. L., Launspach, J., Moscicki, R. A., Richards, S. M., Standaert, T. A., WiUiams-Warren, J., Wadsworth, S. C , Smith, A. E., and Welsh, M.J . (1996). Repeat administration of an adenovirus vector encoding cystic fibrosis transmembrane conductance regulator to the nasal epithelium of patients with cystic fibrosis./. Clin. Invest. 97, 1504-1511. 150. Harvey, B-G., Hackett, N. R., El-Sawy, T., Rosengart, T. K., Hirschowitz, E. A., Lieberman, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs. / . Virol. 73, 6729-6742. 151. Harvey, B-G., Hackett, N. R., Ely, S., and Crystal, R. C. (2001). Host responses and persistence of vector following intrabronchial administration of an El~/E3~ adenovirus gene transfer vector to normal individuals. Mol. Ther. 3, 206-215. C H A P T E R Novel Methods to Eliminate the Immune Response to Adenovirus Gene Therapy Huang-Ge Zhang/'^ Hui-Chen Hsu/ and John D. Mountz"̂ '̂ *Department of Medicine Division of Clinical Immunology and Rheumatology University of Alabama at Birmingham and "'"Birmingham Veterans Administration Medical Center Birmingham, Alabama I. Introduction The immune response to adenovirus (Ad) vectors or their transgene is a hmiting factor in the successful appHcation of gene therapies [1-3] (Fig. 1). Components of the adenovirus are recognized for their abihty to eUcit either a strong antigenic response or to subvert the immune response. Early proteins (E), w^hich are produced continuously by adenovirus, can both enhance and inhibit the immune response. El (including ElA and ElB) and E2 are necessary for Ad replication but also evoke a strong immune response. E4 is a p70 antigen that promotes early and late transportation of viral mRNA and is highly immunogenic. E3 can be immunogenic but also produces a 19 K product that inhibits major histocompatibility complex-I (MHC-I) transportation to the surface of antigen-presenting cells (APCs) and therefore subverts the immune response [4, 5]. Adenovirus late proteins include the penton base which is in a cryptic position but can evoke an immune response. The neutralizing antibody response is formed against the fiber knob which is also a strong antigen on the surface of adenovirus. For applications to gene therapy, the transgene expressed by the Ad vector can also evoke an immune response, especially when combined in the environment of viable transduced adenovirus. ADENOVIRAL VECTORS FOR GENE THERAPY 4 0 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 410 Zhang et aL Adanovlrus CytotoKic T Cells f ^ Helper T Cells B Cells Neutralizing Ab t j ^ Prcrtitii |MiNi# Onai}! Figure 1 Components of adenovirus that can evoke an immune response. Adenovirus expresses early proteins including E l , E2, E3, and E4, most of which can provoke a strong immune response. E3 is known to inhibit MHC class I transportation of antigens to the surface of antigen-presenting cells (APCs), and minimizes the immune response to adenovirus. Late proteins include the penton base and the fiber-knob of the adenovirus. The fiber knob can elicit a strong antigenic response and promote production of neutralizing antibody against the fiber knob. The gene therapy transgene can also evoke an immune response. II. Immune Suppression Both cellular and humoral immune responses have been implicated in the shortening of the time span of transgene expression. Transgene expression is limited by eradication of the transfected cells. Induction of anti-Ad neutral­ izing antibodies precludes the opportunity to readminister the gene therapy. Immunosuppressive drugs including cyclophosphamide [6], cyclosporine [7], and FK506 [8-10], have reduced the T-cell immune response. Lochmuller et al. [8] used FK506, resulting in prolonged expression of adenovirus-mediated dystrophin gene transfer in mdx adult mice for at least 2 months, even though the FK506 treatment was discontinued after 1 month. There w âs a marked reduction in inflammation and reduced levels of nitric oxide synthesase in macrophages in the muscles of such treated animals. Howell et al. [9] used the dystrophin-deficient golden retriever dog model and showed that cyclosporine significantly prolonged transgene expression after Ad-mediated expression of a truncated human dystrophin gene. Ilan et al. [10] showed that com­ bined immunotherapy in humans resulted in prolonged transgene expression. 14. Novel Methods to Eliminate the immune Response 4 1 1 Combined therapy with cyclosporine, azathioprin, and prednisone has been shown to reduce the immune response to adenovirus-mediated gene therapy and prolonged transgene expression. Other strategies reported to control the immune response include reduc­ tion of T-cell response by oral tolerance [11], thymic tolerance, anti-T-cell therapy, and anti-CD4 monoclonal antibody therapy [12-15]. Modulation of T-cell subset development after adenovirus therapy has successfully been attempted using recombinant interleukin 12 (IL-12). IL-12 activates Th-1 cells to secrete gamma interferon (IFNy) which diminishes Th-2 T-cell formation and reduces formation of neutralizing antibodies [16]. III. Immune Modulation Other specific strategies include reduction of the costimulatory signal­ ing activity using the CTLA4 immunoglobulin Fc (CTLA4-Ig) and blocking CD40-CD40L interaction (Fig. 2). Interaction of APC with processed ade­ novirus antigens or adenovirus transgene antigens with T cells through the MHC-T-cell receptor (TCR) ligation constitutes signal 1, which is an incom­ plete signal and can induce T-cell nonresponsiveness or anergy. A second signal can be provided by interaction with B7-1 or B7-2 (CD80/CD86) on the APC with CTLA4 (CD152) or CD28 on the T cell (Fig. 2). A soluble form of CTLA4-Ig (sCTLA4-Ig) can bind to B7-1 and B7-2 and block interactions of this molecule with membrane bound CTLA4 on T cells. The anti-adenovirus response can be decreased and there is prolonged expression of the aden­ ovirus transgene in the presence of either sCTLA4-Ig or in the presence of an adenovirus that expresses CTLA4-Ig (AdsCTLA4-Ig). Kay et aL [17, 18] demonstrated that systemic coadministration of recombinant adenovirus with sCTLA4-Ig leads to persistent adenovirus gene expression in mice without long-term immunosuppression. Ideguchi et al. [19] utilized local administration of adenovirus that expressed p-galactosidase as well as CTLA4-Ig (AdsCTLA4-Ig) in the central nervous system and showed that this combination decreased T-cell infiltration and also decreased the anti- adenovirus antibody titer. Expression of p-galactosidase at the injection site in the striatum and corpus callosum peaked at day 6 and remained until day 60 in both control and treated groups at about the same level despite suppression of the inflammatory response. Guibinga et al. [20] showed that the combination of CTLA4-Ig plus FK506 resulted in prolonged adenovirus vector-mediated production of dystrophin compared to treatment with either immunosup­ pressive alone. Schowalter et al. [21] demonstrated that murine CLTA4-Ig markedly prolonged adenovirus transgene expression in the liver and dimin­ ished formation of neutralizing antibodies as well as decreasing the proliferative response without causing irreversible immune suppression. Ali et al. [11] used AdsCTLA4-Ig administration in association with intraocular administration 412 Zhang ef al. sCD40«Ig <CDI52) (CD86) sCTLA4-Ig Figure 2 Role of costimulatory molecules to induce cytotoxic or helper T-cell response and promote anti-Ad antibody production. Signal 1 consists of the processed antigen presented by the MHC expressed by APCs stimulation of T cells. These antigens are recognized by specific T-cell receptors (TCRs) on T cells. This interaction is also assisted by CDS expressed on cytotoxic T cells or CD4 expressed on helper T cells that interact with MHC. In addition to this central, specific T-cell-APC interaction, costimulatory molecules are necessary for optimal T-cell response. These consist of CD28 and CTLA4 (CD! 52) expressed on T cells that interact with B7.1 and B7.2 (CD80 and CD86), expressed on APCs. This interaction can be blocked by soluble CTLA4-lg (sCTLA4-lg) that tightly binds to B7.1 and B7.2 and prevents the interaction of this molecule expressed on APCs with CD28/CTLA-4 expressed on T cells. A second costimulatory molecule pathway consists of CD40

ligand (CDl 54) expressed on T cells that interact with CD40 expressed on APCs. This interaction can be blocked by administration of a soluble CD40-lg (sCD40-lg) which binds with the CD40 ligand and prevents the interaction between CD40 and CD40 ligand. of adenovirus encoding p-galactosidase and demonstrated reduced immune response to adenovirus, as w êll as prolonged expression of the transgene in retinal cells. Kay et al. [17] show^ed that combined treatment v^ith sCTLA4-Ig and anti-CD40 ligand resulted in prolonged adenovirus-mediated gene expres­ sion for up to 1 year in the liver and the ability to readminister adenovirus in 50% of mice. Follow^ing readministration, there w âs persistent secondary gene expression lasting 200-300 days, and diminished spleen proliferative response, tumor necrosis factor (TNF)-a and IFNy production and decreased production of neutralizing antibodies. Chirmule et al. [23] showed that despite the absence of CD40-CD40 ligand interaction in CD40 ligand knockout mice, after administration of LacZ into the mouse lung, these mice devel­ oped a functional humoral response to the vector evidenced by germinal center formation and anti-adenovirus IgGl and IgA that resulted in effective neutralization of virus and prevented effective readministration of the virus. 14. Novel Methods to Eliminate the immune Response 4 1 3 Wilson et al. [24, 25] used combined treatment with an adenovirus vector expressing sCTLA4-Ig to block CD28 stimulation and a monoclonal antibody against CD40 ligand to demonstrate prolonged adenovirus transgene expres­ sion after intratracheal administration. In addition, secondary administration and transgene expression after secondary administration w âs prolonged in the lung, but there w âs increased reaction from the liver. These results indicate that the mechanisms limiting transgene expression in the airv^ays and the alveoli are different to those of the liver. Stein et al, [26] have shov^n that combined treatment of Ad-human factor IX (FIX) w îth an anti-CD40 ligand antibody MR-1 as w êll as depletion of macrophage liposomes resulted in prolonged expression of AdFIX as vŝ ell as higher levels of plasma FIX. This persistence Mras accompanied by inhibition of anti-adenovirus IgG, and decreased IL-10 and IFN-y production from spleen lymphocytes follov^ing reexposure to virus particles in vitro. This treatment regimen also enabled secondary and tertiary infusions of AdFIX w^hich w âs superior to treatment w îth CD40 ligand block­ ade alone. Kuzmin et al. [27] utilized macrophage depletion in combination w îth blockade of CD40 ligation to demonstrate the prolonged expression of transgene after administration of El-deleted adenovirus. This resulted in a decreased cellular and humoral response as w êll as the induction of transgene tolerance in the animals. Animals that v^ere rendered immunologically unre­ sponsive to vector and transgene antigens regained their ability to mount a productive immune response against the vector after recovery of immune func­ tion but remained unresponsive to the transgene product. Stein et al, [28] used an anti-CD40 ligand (anti-CD 154) in combination v^ith adenovirus-mediated low^-density-lipoprotein receptor (LDLR) gene transfer in LDLR-deficient mice to demonstrate that these mice express LDLR on hepatocytes and maintain cholesterol levels below^ or w^ithin the normal range for at least 92 days. It has been more difficult to eliminate B-cell responses. B-cell produc­ tion of neutralizing antibodies is decreased after treatment w îth anti-CD40 or soluble CD40 [29] and deoxyspergualin [30-32]. Readministration of ade­ novirus vector has been achieved in the lungs of nonhuman primate by blocking of CD40-CD40 ligand interactions. A humanized anti-CD40 ligand antibody hu5C8 w âs used to treat primates in the presence of administra­ tion of adenovirus vectors [23]. These animals produced IgM but did not develop secretory IgA or neutralizing antibodies. This is significant since this is the first demonstration that anti-Ad neutralizing antibodies could be inhibited in a primate system by inhibiting the CD40 interaction with CD40 ligand. A third approach includes modification of the adenovirus vector to reduce the immune response [33-36]. A more universal strategy for decreas­ ing response to adenovirus vectors includes production of the "gutless" adenovirus which greatly reduces the immune response to Ad and its trans­ gene [37-40]. It was initially demonstrated that constitutive expression of the 4 1 4 Zhang efo/. immune modulatory gpl9 K protein in adenovirus vectors reduced the cyto­ toxic response. Further refinement of vectors including the removal of E4 also resulted in prolonged transgene expression [34]. A gutless Ad that v^as depleted of all adenovirus genes, showed prolonged expression of P-galactosidase in muscle. This prolonged expression correlated w îth a decrease in the infiltration of CD4+ and CD8"^ lymphocytes. However, in LacZ transgenic mice, which was predicted to result in immunologic tolerance to p-galactosidase expression, there was prolonged expression of the vector DNA, indicating that the immune response to this "gutless" Ad was primarily against p-galactosidase and that the response to the adenovirus vector lacking all genes was minimal [37]. Gene therapy expression using adenovirus vectors with deletions of the El , E2A, E3, and E4 regions could be prolonged when combined with immunosuppressive drugs including cyclophosphamide and FK506. One limitation of immunomodulating therapy has been that it is not specific for the adenovirus or transgene. The present review will focus on our attempts to reduce the immune response mediated by TNFot and other cytokines. A second strategy to prolong gene therapy expression is to ablate the immune response to cells that are the target of gene therapy. Such apoptosis-inducing factors include TNFa but also Fas ligand and TNF recep­ tor apoptosis-inducing ligand (TRAIL). We have also developed methods to specifically reduce the T-cell response to Ad and also new methods to prevent B cell responses including blocking of the TNF receptor (TNFR) homolog trans­ membrane activator and calcium modulator and cyclophilin ligand (CAML) interactor (TACI) signal in B cells. These strategies strongly suggest that it will be possible to develop strategies to ablate the immune response to adenovirus including the cytotoxic response that leads to the loss of cells carrying the transgene. IV. Treatment with Soluble TNFR1 to Eliminate Ad Inflammation in Lung and Liver The rationale for use of soluble TNF receptor as a modulator of ade­ novirus inflammation stems from the observation that TNFa is one of the principal mediators of inflammation after adenovirus gene therapy [41-43]. Neutralization of TNFa with TNFa inhibitors, such as soluble TNFRl (sTNFRl) greatly reduces tissue injury and cell death after endotoxin and other inflammatory agents. This is a rational approach, since adenovirus takes advantage of TNFa as an immune mediator to promote expression of several immunosubversive proteins supporting its escape from immunosurveil- lance [5]. The interaction of TNFa with its receptor is a strong virulence factor for inflammation and elimination of virus infection. The E3-gpl9 K protein not only prevents CTL recognition of Ad-infected fibroblasts by sequestering 14. Novel Methods to Eliminate the Immune Response 4 1 5 MHC class I proteins in the endoplasmic reticulum, but also E3 proteins 10.4 K, 14.5 K, and 14.7 K function to protect infected cells from TNFa cytolysis. Transgenic mice that express the E3 gene encoding these proteins have been shown to exhibit decreased pulmonary infiltration after intranasal inoculation [42]. Peng et al. [43] showed that adenovirus gene transfer of an sTNFR results in effective blockade of tumor necrosis factor activity and also prolongs the gene therapy. Therefore, neutralization of TNFa is a rational approach to decrease chronic inflammation as well as prolonged transgene expression. Certain cytokines such as TNFa can result in rapid clearance of ade­ novirus or viral therapy. Administration of anti-inflammatory cytokines, such as IL-10, can reduce inflammation and prolong gene therapy [44]. We have evaluated the effect of the treatment with a novel TNF-binding protein (TNF-bp), a polyethylene-glycol (PEG)-linked dimer of sTNFRl, on inflammation of the lung and viral clearance after intranasal administration of AdCMVLacZ (1 x W^ pfu) [45, 46] (Fig. 3, see color insert). Three days after intranasal administration, there was a moderate inflammatory infiltrate in the lungs of control (CT)-treated C57BL/6-+/-h mice, which peaked at day 7 and was nearly resolved by day 30 (Fig. 3A). In contrast, 3 days after admin­ istration of AdCMVLacZ, there was no evidence of an inflammatory infiltrate in the lungs of TNF-bp-treated C57BL/6—h/-h mice and only minimal evidence of infiltration was observed from day 3 through day 30. We next determined the expression of LacZ adenovirus gene-therapy product. The results indicate that the expression of ^-galactosidase (P-Gal) in control-treated C57BL/6—h/+ mice was high at day 3, but was considerably reduced by day 30 (Fig. 3B). The expression of the p-Gal in TNF-bp-treated C57BL/6-+/+ mice was equivalent at day 3 but, in contrast to the control-treated mice, the expression of p-Gal remained high in the lung through day 30. These results indicate that there is greatly decreased inflammatory disease and prolonged gene expression in AdCMVLacZ-infected mice treated with TNF-bp compared to vehicle-treated mice. The results also indicate that TNFa is a key factor in the pathogene­ sis of inflammation in AdCMVLacZ-virus-infected mice. Thus, the TNF-bp PEG-linked dimer may be therapeutically useful in reducing the inflammatory response to adenovirus gene therapy. V. Inhibition of Cell Cytolysis Which Combines Treatment vŝ ith Soluble DR5, Soluble Fas, and Soluble TNFR1 A major factor limiting prolonged transgene expression is due to the elimination of the cells infected by the adenovirus gene therapy that expresses the gene therapy product. Elimination of cells by either nonspecific "bystander" mediators or specific induction of cell death by T cells and other inflammatory 416 Zhang ef aL cells is carried out by the process of either necrosis or apoptosis. Necrosis results in lysis of the cell and is mediated by TNFa as well as other cytokines. Apoptosis results in elimination of the cell by triggering programmed cell death followed by phagocytosis of the cell into nearby reticulo-endothelial cells. The primary molecules that contain an intracellular death domain include Fas, TNF receptor (TNFR), and death domain receptor (DR3, -4, and -5) mediated by TRAIL (Fig. 4). The relative contribution of TNFa-mediated necrosis compared to Fas ligand (FasL) or TRAIL-mediated apoptosis was investigated using systemic treatment or adenovirus that expressed soluble forms of receptors capable of neutralizing these factors. We have previously shown that Fas-Fc is capable of neutralizing Fas ligand and preventing Fas ligand-mediated apoptosis [47]. Similarly, a soluble form of the death domain receptor 5 (sDR5-Fc) can neutralize TRAIL and inhibit TRAIL-mediated apoptosis [48]. Adenoviruses were constructed that expressed soluble forms of DR5-Fc (sDR5), AdsDR5, and soluble forms of Fas-Fc (sFas), AdsFas. The pretreatment with AdsFas can prevent liver cell apoptosis after iv administration of anti-Fas Jo-2 [49]. AdsDR5 was shown to protect TRAIL-mediated apoptosis of Jurkat T cells. TNFRI Figure 4 Death domain receptor family. Death domain family members are exemplified by Fas and TNF receptor 1 (TNFRI). These have three and four extracellular cystine-rich repeat domains, respectively. There is an 9- to 31-amino-acid linker between the extracellular domain and the transmembrane domain. Both molecules have a homologous intracellular death domain represented by a rectangle. Other members include cytotoxic apoptosis receptor 1 (CAR-1) and also death domain receptors that bind TNF-related apoptosis-inducing ligand (TRAIL). These receptors include death domain receptor 3 (DR3), DR4, and DR5. Also, there is a decoy receptor (DcRI) that can bind TRAIL but lacks the intracellular death domain and therefore binds to TRAIL but does not introduce apoptosis. 14. Novel Methods to Eliminate the Immune Response 417 S AdsDRS S AdsFas D STNFR1 S AdsDRS+AdsFas • AdsDR5+sTNFR1 • AdsFas+sTNR1 DPBS 7 14 Time (days) Figure 5 Inhibition of liver apoptosis by soluble TNFRl, soluble Fas, and soluble DR5. Mice were treated with adenovirus-expressing soluble Fas (AdsFas) and soluble DR5 (AdsDR5) as well as soluble TNFRl (100 ixg/mouse, iv). Mice were also given an Ad-luciferase. The luciferase activity was measured at 3, 7, 14, 30, and 50 days in mice treated with AdsDR5, AdsFas, sTNFRl protein, AdsDR5 plus AdsFas, AdsDRS plus sTNFRl, or AdsFas plus sTNFRl. As a control, mice were given Ad-luciferase plus PBS. To determine if adenovirus gene expression can be prolonged by protecting liver cells from apoptosis, mice vŝ ere pretreated v^ith either AdsDRS, AdsFas, or sTNFRl, or different combinations of these cytoprotective therapies. Pre- treatment v^ith AdsDR5 alone resulted in a greatly prolonged expression by the liver after subsequent administration of an Ad vector expressing luciferase (AdLuc) (Fig. 5). Consistent v^ith our previous results, the second most effec­ tive molecule to prolong luciferase expression v^as treatment v^ith

sTNFRl. Pretreatment v^ith AdsFas provided only modest prolongation of the luciferase gene expression. Combined treatment v^ith AdsDR5 and sTNFRl provided the greatest protective effect after administration of AdLuc and the greatest prolongation of gene expression. These results indicate that liver gene therapy is limited primarily by expression of TRAIL by either infected liver cells or the immune response to this adenovirus gene therapy and TNF and FasL play a lesser role. VI . Immune Privilege One physiologic mechanism for induction or maintenance of tolerance to self-antigens in the body is for the antigens to be present in an immune privileged site [50-52]. Although anatomical barriers and soluble mediators 4 1 8 Zhang efo/. have been implicated in immune privilege, it appears that apoptotic cell death of Fas-positive cells by tissue-associated FasL is an important component. Constitutive expression of FasL occurs in immune privilege sites including the retina, ciliary body, iris and cornea of the eye, and the testes, w^hich have been knov^n to be an immune privilege site. T cells that interact w îth antigens in immune privilege site upregulate Fas and enable Fas apoptosis signaling and are killed by FasL present in these sites. This prevents inflammation of these sites since the mouse cornea expresses abundant FasL and immune privilege has been implicated in the success of these corneal transplants. The ability of the eye to kill invading inflammatory cells helps maintain immune privilege and minimize bystander tissue damage, v^hile tolerance regulates dangerous inflammatory reactions to prevent autoimmunity. Adenovirus delivered to the eye fails to elicit an immune response [53-55]. The immune privilege site has been proposed to prevent reactivity in other tissues including the thyroid gland and pancreatic P-islet cells. Belgreu et al. [50] demonstrated that FasL expression by testicular Sertoli cells pro­ tected P-islet from rejection when transplanted heterotopically into the kidney capsule. Similarly, Griffith et al, [51, 52], w êre able to prevent rejection of allo­ geneic pancreatic islet cells by cotransplantation w îth FasL positive myoblast which were also transplanted to the kidney capsule. These observations were presumably the result of induction of apoptotic cell death of Fas-positive cells invading the graft from the Fas-positive graft tissue. The implication of these studies is that manipulation of the Fas-FasL system might provide a mechanism to prevent local inflammation. We have utilized the immune privilege concept to prolong gene therapy expression in muscle [56, 57]. For this purpose, we have produced a binary adenovirus system consisting of an AdLoxpFasL plus an AxCANCre [56]. AdLoxpFasL can be grown to high titer in 293 cells and does not produce Fas ligand in the absence of AxCANCre. Therefore, these viruses can be grown to high titers separately. However, when transfected into the same cell line, this leads to high-titer production of FasL. To create a local immune privilege site, we used gene therapy to reproduce the immune privilege site created by muscle cells as described above [56, 57], BALB/c mice were injected intraglossally with either AdLoxpFasL plus AxCANCre plus AdCMVLuciferase or with AdLoxpFasL plus AdCMVTK (thymidine kinase) plus AdCMVLuciferase. As a control, mice were injected with luciferase. The mice were analyzed at days 7, 21, 35, and 50 postinjection and luciferase was determined in the harvested tissue. There was no increase in the prolongation of the expression of the vector-encoded transgene by attempting to produce an immune privilege site in muscle and diminish the immune eradication of these vector-transduced cells. This brings up several issues related to the use of FasL for prolongation of gene therapy. First, it is possible that, in the attempt to produce an immune privilege site, ectopic expression of FasL can actually elicit an inflammatory response. 14. Novel Methods to Eliminate the Immune Response 4 1 9 Second, the coexpression of Fas with an ectopic FasL can induce an autocrine loop which might induce target cell apoptosis. In addition, the magnitude and temporal pattern of FasL expression may be critical to determine its efficacy in creation of an immune privilege site. For these reasons, creation of a local immune privilege site in muscle by FasL does not result in prolonged transgene expression. VII. APC-AdFasL Prolongs Transgene Expression and Specifically Minimizes T-Cell Response Adenovirus gene therapy is limited by induction of an immune response to the virus or gene therapy protein product. APCs lead to antigen processing and presentation of T cells which can be highly immunogenic or tolerogenic, depending on costimulatory molecules and production of other cytokines, such as FasL. T-cell tolerance after an immune response to adenovirus is also maintained by activation-induced cell death (AICD) of T cells mediated by Fas/FasL interactions. We surmise that APCs such as macrophages, which express FasL, might directly induce apoptosis of T cells that express Fas as cell therapy resulting in an adenovirus-specific T-cell tolerance without toxic effects of FasL (Fig. 6). The AdLoxpFasL can be used to infect APCs from Ipr/lpr mice and does not kill these APCs since these APCs lack Fas expression [58, 59]. These AdLoxpFasL plus AxCANCre-infected APCs (APC-AdFasL) resuh in high production of FasL capable of lysing A20 target cells. The macrophages infected by the adenovirus exhibited at least a 50- to 100-fold higher FasL titer compared to PMA-activated T cells. High levels of FasL expression by the macrophages were sustained for at least 7 days of in vitro culture. These results indicate that adenovirus can deliver FasL into the primary-culture macrophages from Fas mutant Ipr/lpr mice, and this leads to a high level of FasL expression by the macrophages without toxicity to the macrophages. To determine if APC-AdFasL could inhibit an immune response to Ad, mice were pretreated with APC-AdFasL every 3 days for five doses. After 7 days, the mice were inoculated intravenously with 10^^ pfu of AdCMVLacZ. P-Gal staining was determined up to 50 days later (Fig. 7) [58]. The levels of LacZ gene expression in the liver of control-treated mice decreased rapidly after pretreatment with APC-Ad control. In contrast, in mice treated with APC- AdFasL, the levels of LacZ expression did not decrease but were sustained for at least 50 days after infection. These results indicate that pretreatment with APC-AdFasL significantly prolonged AdCMVLacZ transgene expression. To determine if the APC-AdFasL therapy resulted in a preferential specific deletion of Ad-reactive T cells, but not T cells reactive with other viruses, wild-type C57BL/6-+/-h mice were treated with APCs, APC-Ad control, or APC-AdFasL 420 Zhang ef aL Ad-FasL FasL Apoptosis Ad-specific T cells Ad-Ag Figure 6 Specific apoptosis of T cells by APC-Ad-FasL therapy. Macrophages are infected with an AdFas ligand (Ad-FasL) gene expression system. This results in high expression of FasL on the surface of macrophages. Macrophages do not undergo autocrine apoptosis since they are derived either from Ipr mice (Fas mutant) or express an anti-apoptosis gene. In addition, macrophages will process and present adenovirus antigens (Ad-Ag) specifically to T cells. Activation by processing Ad-Ag by macrophage upregulates Fas expression and also Fas apoptosis signaling, facilitating apoptosis of Ad-specific T cells in the presence of FasL produced by the macrophage. c 'S n APC-AdFasL O 100000 Q. k. H APC-AdControl 0) • PBS > o •5; 10000 o O) E c I 1000 4 'E 3 0) > 2 100 I bt tt 7 14 21 30 50 Days post-injection (IV) with AdCI\/IVLacZ Figure 7 AdLuc transgene expression after APC-AdFasL followed by AdCMVLacZ. Wild-type C57BL/6 -+ /+ mice were treated with 1 x 1C^ of APCs cotransfected with AdLoxpFasL plus AxCAN- Cre (APC-AdFasL), or APCs cotransfected with AdLoxpFasL plus AdCMVLUC (APC-AdControl), or phosphate-buffered saline (PBS) every 3 days until five closes were given. After 7 days, the mice were inoculated iv with 1 x 10^^ pfu of AdCMVLacZ and p-Gal was determined up to 50 days later. The error bars represent the mean ± standard error of the mean (SEM) for three mice analyzed separately in triplicates. 14. Novel Methods to Eliminate the Immune Response 421 ou - ? 60- ^ 3 40- 1 T • Control CM • Ad ^ 20- n _ 1 J nMCMV APC-AdControl APC-AdFasL Treatment Figure 8 IL-2 production by T cells stimulated with APC plus MCMV after APC-AdFasL. Wild-type mice were treated with either APC-AdFasL or APC-Ad Control. Seven days later, mice were challenged in vitro with either AdCMVLacZ or MCMV. Seven days after splenic T cells were stimulated in vitro with either APCs, AdCMVLacZ transfected APCs, or MCMV-infected APCs. IL-2 production in the supernatants was determined by ELISA. every 3 days until five doses as above. To determine w^hether the T-cell tolerance induced by APC-AdFasL vŝ as specific, the T-cell response of APC-AdFasL- and APC-Ad control-tolerized mice to murine cytomegalovirus (MCMV) infection was evaluated. C57BL/6-+/+ mice v^ere treated as described above and then challenged 7 days later v^ith either adenovirus or MCMV. Although there was a reduction in the T-cell response through adenovirus vector, the T-cell response to MCMV was not impaired as demonstrated by comparable levels of IL-2 produced by T cells from both APC-Ad control- and APC-AdFasL-treated mice (Fig. 8). These results indicate that inhibition of the T-cell response in APC-AdFasL-tolerized mice is specific for the adenovirus vector. VIII. Production of AdsTACI Prolongs Gene Expression and Minimizes B-Cell Response The TNF receptor family includes apoptosis-signaling molecules as described above including TNFRl, TNFR2, Fas, CD40, DR4, and DR5 [60-64] (Fig. 4]). In addition, the TNF receptor family contains factors related to B-cell growth including TNF- and apoptosis ligand-related lymphocyte-expressed ligand 1 (TALL-1)/B lymphocyte stimulator (BlyS) factor that belongs to the TNF family. TALL-1 is a potent B cell costimulatory factor and acts by direct binding and activating its cell surface receptor on B cells, referred to as transmembrane activator and calcium modulator and cyclophilin ligand (CAML) interactor (TACI). The interaction between TALL-1 and TACI 422 Zhang et aL is important for regulation of B-cell growth and humoral immunity. Stimulation through this pathway promotes production of antibody and autoantibodies. We surmise that blocking this pathway with a soluble TACI-Fc (sTACI-Fc) that binds to TALL-1 would inhibit the B-cell response to adenovirus gene therapy. We therefore constructed an adenovirus expressing sTACI-Fc in the El A site of adenovirus. C57BL/6-+/+ mice were injected on day 0 with AdsTACI (5 x 10^ pfu, iv) and AdLacZ (5 x 10^ pfu iv). On day 3, the mice were either untreated or treated with APC-AdFasL to modulate the T-cell response to adenovirus. On days 7,14, 30, and 50, the antibody production to Ad was determined using an Ad neutralization assay. The Ad neutralization assay was carried out using two­ fold dilution of sera, which was then incubated with an Ad vector expressing green fluorescent protein (AdGFP) for 1 h (Fig. 9). The AdGFP was then inoculated with 293 cells for an additional hour and the unbound AdGFP was washed with PBS. The infected 293 cells were incubated at 37°C for another 3 days, and the percent of GFP-positive cells was assayed as an indicator of the level of adenovirusneutralizing antibody. In control mice, there were high levels of anti-Ad IgG immunoglobulin that reached a maximum titer at day 30 in 800 ^ 700 Days post-treatment o 1 • 0 S 600-| • 7 O 500^ N 400 S 300-j I m 14 0 30 ^ 5 0 3 O 200-| 100-1 1 I Control APC/FasL APC/FasL/sTACI sTACI 0 Treatment Figure 9 Reduction of onti-adenovirus antibody response by treatment with AdsTACI. C57BL/6 mice were injected on day 0 with AdsTACI (5 x 10^ pfu, iv) and AdLacZ (5 x 10^ pfu, iv). On day 3, the mice were either untreated or treated with AdAPC-FasL to modulate the T-cell response to adenovirus. The Ad neutralization assay was carried out using a twofold solution of sera which was incubated with AdGFP for 1 h. Sera were collected on days 0, 7, 14, 30, and 50 after administration of AdLacZ or AdsTACI. 14. Novel Methods to Eliminate the immune Response 4 2 3 the absence of any immunosuppressive treatment. In the presence of AdsTACI administered on day 0, the IgG anti-Ad neutraUzation titers remained very lov^ throughout the time course of the study. APC-AdFasL therapy reduced the peak titer especially on days 30 and 50, but the neutralization titer at these time points w âs higher than AdsTACI treatment alone. The combined treatment vŝ ith AdsTACI and APC-AdFas ligand vv̂ as similar

to treatment v^ith AdsTACI alone. These results indicate that treatment v^ith APC-AdFasL or blocking B cells signaling w îth AdsTACI can greatly inhibit the peak anti-Ad immunoglobulin production and also prevent long-term antibody production against adenovirus. IX. Summary Suppression of the T-cell main response to adenovirus, to date, has gen­ erally been achieved using the same paradigms to reduce the cellular immune response as applied in other systems. This includes reducing the T-cell response either by inhibiting T-cell activation at the surface by blocking costimula- tory molecules such as the CD28/CTLA4 or B7.1/B7.2 ligand pathw^ay or by blocking intracellular signaling using cyclosporine or FK506. More general immunosuppressants such as prednisone and cyclophosphamide also suppress the immune response and are synergistic v̂ îth more specific T-cell surface or intracellular signaling pathv^ays. Similarly, more general immunosuppres­ sants such as TNF receptor Fc or sTNF receptor can block proinflammatory cytokines after stimulation of an immune response by adenovirus and are synergistic v^ith direct immunosuppressants of the T cells. Methods to elimi­ nate these cells rather than to suppress them include treatment w îth anti-CD4 or anti-CD3, or more specific cell gene therapy methods using APC-AdFasL v^hich kill T cells that interact v̂ îth APCs that express Ad virus or transgene. All of these three approaches can be used together to exhibit synergistic effects to reduce the number of Ad-reactive T cells, the activation of Ad-specific T cells, and the inflammatory mediators produced by these Ad-specific T cells. A second approach is to reduce the antigenicity of the adenovirus or the transgene. Such methods are analogous to, for example, decreasing the cel­ lular immune response to organ transplant by tissue typing. In the case of adenovirus, certain components of the virus are know^n to be more antigenic than others and can be eliminated to produce replication-deficient Ad. The ultimate result is the "gutless" adenovirus that only contains the transgene v^ith the Ad inverted terminal repeats (ITRs). The immune response to the transgene is similar to the immune response to any biological administered reagent such as factor IX or soluble TNF receptor-Fc. These responses lead to neutralizing antibodies to the transgene or administered biologic protein and mechanisms to eliminate antibody response can also be successfully reduced or eliminated. 4 2 4 Zhang et at. References 1. Yang, Y., Nunes, F. A., Berencsi, K., Furth, E. E., Gonczol, E., and Wilson, J. M. (1994). Cellular immunity to viral antigens limits El-deleted adenoviruses for gene therapy. Proc. Natl. Acad. Sci. USA 91, 4407-4411. 2. Yang, Y., Ertl, H. C , and Wilson, J. M. (1994). MHC class I-restricted cytotoxic T lym­ phocytes to viral antigens destroy hepatocytes in mice infected with El-deleted recombinant adenoviruses. Immunity 1, 433-442. 3. Chirmule, N., Hughes, J. V., Gao, G. P., Raper, S. E., and Wilson, J. M. (1998). Role of E4 in eliciting CD4 T-cell and B-cell responses to adenovirus vectors delivered to murine and nonhuman primate lungs./. Virol. 72, 6138-6145. 4. Bennett, E. M., Bennink, J. R., Yewdell, J. W., and Brodsky, F. M. (1999). Cutting edge: Adenovirus El9 has two mechanisms for affecting class I MHC expression./. Immunol. 162, 5049-5052. 5. Wold, W. S., Doronin, K., Toth, K., Kuppuswamy, M., Lichtenstein, D. L., and Tollefson, A. E. (1999). Immune responses to adenoviruses: Viral evasion mechanisms and their impli­ cations for the clinic. Curr. Opin. Immunol. 11, 380-386. 6. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, \555-1566. 7. Fang, B., Eisensmith, R. C , Wang, H., Kay, M. A., Cross, R. E., Landen, C. N., Gordon, G., Bellinger, D. A., Read, M. S., Hu, P. C , et al. (1995). Gene therapy for hemophilia B: Host immunosuppression prolongs the therapeutic effect of adenovirus-mediated factor IX expression. Hum. Gene Ther. 6, 1039-1044. 8. Lochmuller, H., Petrof, B. J., Pari, G., Larochelle, N., Dodelet, V., Wang, Q., Allen, C , Prescott, S., Massie, B., Nalbantoglu, J., and Karpati, G. (1996). Transient immunosuppres­ sion by FK506 permits a sustained high-level dystrophin expression after adenovirus-mediated dystrophin minigene transfer to skeletal muscles of adult dystrophic (mdx) mice. Gene Ther. 3, 706-716. 9. Howell, J. M., Lochmuller, H., O'Hara, A., Fletcher, S., Kakulas, B. A., Massie, B., Nalban­ toglu, J., and Karpati, G. (1998). High-level dystrophin expression after adenovirus-mediated dystrophin minigene transfer to skeletal muscle of dystrophic dogs: Prolongation of expression with immunosuppression. Hum. Gene Ther. 9, 629-634. 10. Ilan, Y., Jona, V. K., Sengupta, K., Davidson, A., Horwitz, M. S., Roy-Chowdhury, N., and Roy-Chowdhury, J. (1997). Transient immunosuppression with FK506 permits long-term expression of therapeutic genes introduced into the liver using recombinant adenoviruses in the rat. Hepatology 26, 949-956. 11. Ilan, Y., Prakash, R., Davidson, A., Jona, Droguett, G., Horwitz, M. S., Chowdhury, N. R., and Chowdhury, J. R. (1997). Oral tolerization to adenoviral antigens permits long-term gene expression using recombinant adenoviral vectors. / . Clin. Invest. 99, 1098-1106. 12. DeMatteo, R. P., Raper, S. E., Ahn, M., Fisher, K. J., Burke, C , Radu, A., Widera, G., Clay- tor, B. R., Barker, C. F., and Markmann, J. F. (1995). Gene transfer to the thymus. A means of abrogating the immune response to recombinant adenovirus. Ann. Surg. Ill, 229-239. 13. Sawchuk, S. J., Boivin, G. P., Duwel, L. E., Gall, W., Bove, K., Tarpnell, B., and Hirsch, R. (1996). Anti-T cell receptor monoclonal antibody prolongs transgene expression follow­ ing adenovirus-mediated in vivo gene transfer to mouse synovium. Hum. Gene Ther. 7, 499-506. 14. DeMatteo, R. P., Markmann, J. F., Kozarsky, K. F., Barker, C. F., and Raper, S. E. (1996). Prolongation of adenoviral transgene expression in mouse liver by T lymphocyte subset depletion. Gene Ther. 3, 4 -12 . 14. Novel Methods to Eliminate the Immune Response 4 2 5 15. Chirmule, N., Truneh, A., Haecker, S. E., Tazelaar, J., Gao, G. P., Raper, S. E., Hughes, J. V., and Wilson, J. M. (1999). Repeated administration of adenoviral vectors in lungs of human CD4 transgenic mice treated v^ith a nondepleting CD4 antibody./. Immunol. 163, 448-455. 16. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 17. Kay, M. A., Holterman, A. X., Meuse, L., Gov^n, A., Ochs, H. D., Linsley, P. S., and Wil­ son, C. B. (1995). Long-term hepatic adenovirus-mediated gene expression in mice following CTLA4Ig administration. Nat. Genet. 11, 191-197. 18. Kay, M. A., Meuse, L., Gown, A. M., Linsley, P., HoUenbaugh, D., Aruffo, A., Ochs, H. D., and Wilson, C. B. (1997). Transient immunomodulation with anti-CD40 ligand antibody and CTLA4Ig enhances persistence and secondary adenovirus-mediated gene transfer into mouse liver. Froc. Natl. Acad. ScL USA 94, 4686-4691. 19. Ideguchi, M., Kajiwara, K., Yoshikawa, K., Uchida, T., and Ito, H. (2000). Local adenovirus- mediated CTLA4-immunoglobulin expression suppresses the immune responses to adenovirus vectors in the brain. Neuroscience 95, 217-226. 20. Guibinga, G. H., LochmuUer, H., Massie, B., Nalbantoglu, J., Karpati, G., and Petrof, B. J. (1998). Combinatorial blockade of calcineurin and CD28 signaling facilitates primary and secondary therapeutic gene transfer by adenovirus vectors in dystrophic (mdx) mouse muscles. / . V/Vo/. 72,4601-4609. 21. Schowalter, D. B., Meuse, L., Wilson, C. B., Linsley, P. S., and Kay, M. A. (1997). Constitutive expression of murine CTLA4Ig from a recombinant adenovirus vector results in prolonged transgene expression. Gene Ther. 4, 853-860. 22. Ah, R. R., Reichel, M. B., Byrnes, A. P., Stephens, C. J., Thrasher, A. J., Baker, D., Hunt, D. M., and Bhattacharya, S. S. (1998). Co-injection of adenovirus expressing CTLA4-Ig prolongs adenovirally mediated lacZ reporter gene expression in the mouse retina. Gene Ther. 5, 1561-1565. 23. Chirmule, N., Raper, S. E., Burkly. L., Thomas, D., Tazelaar, J., Hughes, J. V., and Wilson, J. M. (2000). Readministration of adenovirus vector in nonhuman primate lungs by blockade of CD40-CD40 ligand interactions./. Virol. 74, 3345-3352. 24. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., HoUenbaugh, D., Linsley, P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and facilitates expression after secondary vector administration./. Virol. 72, 7542-7550. 25. Jooss, K., Turka, L. A., and Wilson, J. M. (1998). Blunting of immune responses to adenoviral vectors in mouse liver and lung with CTLA4Ig. Gene Ther. 5, 309-319. 26. Stein, C. S., Pemberton, J. L., van Rooijen, N., and Davidson, B. L. (1998). Effects of macrophage depletion and anti-CD40 ligand on transgene expression and redosing with recombinant adenovirus. Gene Ther. 5, 431-439. 27. Kuzmin, A. L, Galenko, O., and Eisensmith, R. C. (2000). An immunomodulatory procedure that stabilizes transgene expression and permits readministration of el-deleted adenovirus vectors. Mol. Ther. 3, 293-301. 28. Stein, C. S., Martins, L, and Davidson, B. L. (2000), Long-term reversal of hypercholes­ terolemia in low density lipoprotein receptor (LDLR)-deficient mice by adenovirus-mediated LDLR gene transfer combined with CD154 blockade. / . Gene Med. 2, 4 1 - 5 1 . 29. Yang, Y., Su, Q., Grewal, L S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues. / . Virol. 70, 6370-6377. 30. Cichon, G., and Strauss, M. (1998). Transient immunosuppression with 15-deoxyspergualin prolongs reporter gene expression and reduces humoral immune response after adenoviral gene transfer. Gene Ther. 5, 85-90. 4 2 6 Zhang ef al. 31. Kaplan, J. M., and Smith, A. E. (1997). Transient immunosuppression with deoxysperguahn improves longevity of transgene expression and ability to readminister adenoviral vector to the mouse lung. Hum. Gene Ther. 8, 1095-1104. 32. Smith, T. A., White, B. D., Gardner, J. M., Kaleko, M., and McClelland, A. (1996). Transient immunosuppression permits successful repetitive intravenous administration of an adenovirus vector. Gene Ther. 3, 496-502. 33. Lee, M. G., Abina, M. A., Haddada, H., and Perricaudet, M. (1995). The constitutive expression of the immunomodulatory gpl9 k protein in E1-, E3- adenoviral vectors strongly reduces the host cytotoxic T cell response against the vector. Gene Ther. 2, 256-262. 34. Wang, Q., Greenburg, G., Bunch, D., Farson, D., and Finer, M. H. (1997). Persistent transgene expression in mouse liver follov^ing in vivo gene transfer with a delta El/delta E4 adenovirus vector. Gene Ther. 4, 393-400. 35. Yang, Y., Su, Q., and Wilson, J. M. (1996). Role of viral antigens in destructive cellu­ lar immune responses to adenovirus vector-transduced cells in mouse lungs. / . Virol. 70, 7209-7212. 36. Harvey, B. G., Worgall, S., Ely, S., Leopold, P. L., and Crystal, R. G. (1999). Cellular immune responses of healthy individuals to intradermal administration of an El-E3-adenovirus gene transfer vector. Hum. Gene Ther. 10, 2823-2837. 37. Chen, H. H., Mack, L. M., Kelly, R., Ontell, M., Kochanek, S., and Clemens, P. R. (1997). Persistence in muscle of an adenoviral vector that lacks all viral genes. Proc. Natl. Acad. Set. USA 94, 1645-1650. 38. Christ, M., Lusky, M., Stoeckel, F., Dreyer, D., Dieterle, A., Michou, A. I., Pavirani, A., and Mehtali, M. (1997). Gene therapy with recombinant adenovirus vectors: Evaluation of the host immune response. Immunol. Lett. 57, 19-25. 39. Molinier-Frenkel, V., Gahery-Segard, H., Mehtali, M., Le Boulaire, C , Ribault, S., Boulanger, P., Tursz, T., Guillet, J. G., and Farace, F. (2000). Immune response to recombinant adenovirus in humans: Capsid components from viral input are targets for vector-specific cytotoxic T lymphocytes./. Virol. 74, 7678-7682. 40. Harvey, B. G., Worgall, S., Ely, S., Leopold, P. L., and Crystal, R. G. (1999). Cellular immune responses of healthy individuals to intradermal administration of an El-E3-adenovirus gene transfer vector. Hum. Gene Ther. 10, 2823-2837. 41. Kolls, J. K., Lei, D., Nelson, S., Summer, W. R., Greenberg, S., and Beutler, B. (1995). Adenovirus-mediated blockade of tumor necrosis factor in mice protects against endotoxic shock yet impairs pulmonary host defense. / . Infect. Dis. 171, 570-575. 42. Harrod, K. S., Hermiston, T. W., Trapnell, B. C , Wold, W. S., and Whitsett, J. A. (1998). Lung-specific expression of adenovirus E3-14.7 K in transgenic mice attenuates adenoviral vector-mediated lung inflammation and enhances transgene expression. Hum. Gene Ther. 9, 1885-1898. 43. Peng, Y., Trevejo, J., Zhou, J., Marino, M. W., Crystal, R. G., Falck-Pedersen, E., and Elkon, K. B. (1999).

Inhibition of tumor necrosis factor alpha by an adenovirus-encoded soluble fusion protein extends transgene expression in the liver and lung./. Virol. 73, 5098-5109. 44. Minter, R. M., Rectenwald, J. E., Fukuzuka, K., Tannahill, C. L., La Face, D., Tsai, V., Ahmed, I., Hutchins, E., Moyer, R., Copeland, E. M., 3rd, and Moldawer, L. L. (2000). TNF- alpha receptor signaling and IL-10 gene therapy regulate the innate and humoral immune responses to recombinant adenovirus in the lung. / . Immunol. 164, 443-451. 45. Zhang, H. G., Zhou, T., Yang, P., Edwards, C. K., 3rd, Curiel, D. T., and Mountz, J. D. (1998). Inhibition of tumor necrosis factor alpha decreases inflammation and prolongs adenovirus gene expression in lung and liver. Hum. Gene Ther. 9, 1875-1884. 46. Zhang, H. G., Xie, J., Yang, P., Wang, Y., Xu, L., Liu, D., Hsu, H. C , Zhou, T., Edwards, C. K., 3rd, and Mountz, J. D. (2000). Adeno-associated virus production of soluble tumor necrosis factor receptor neutralizes tumor necrosis factor alpha and reduces arthritis. Hum. Gene Ther. 11,2431-2442. 14. Novel Methods to Eliminate the Immune Response 4 2 7 47. Cheng, J., Zhou, T., Liu, C , Shapiro, J. P., Brauer, M. J., Kiefer, M. C , Barr, P. J., and Mountz, J. D. (1994). Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science 263, 1759-1762. 48. Strehlow, D., Jodo, S., and Ju, S. T. (2000). Retroviral membrane display of apoptotic effector molecules. Proc. Natl. Acad. Sci. USA 97, 4209-4214. 49. Matsuki, Y., Li, L., Hsu, H. - C , Yang, P., Zheng, R., Edwards, C. K. Ill, Chaudry, I. H., Mountz, J. M., Zhang, H. -G., and Mountz, J. D. (2002). Soluble Fas gene therapy protects against Fas-mediated apoptosis of hepatocytes but not the lethal effects of Fas-induced TNF-a production by Kupffer Cells. Cell Death Diff., in press. 50. Bellgrau, D., Gold, D., Selawry, H., Moore, J., Franzusoff, A., and Duke, R. C. (1995). A role for CD95 ligand in preventing graft rejection. Nature 377, 630-632. 51. Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R., and Ferguson, T. A. (1995). Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270, 1189-1192. 52. Griffith, T. S., Yu, X., Herndon, J. M., Green, D. R., and Ferguson, T. A. (1996). CD95- induced apoptosis of lymphocytes in an immune privileged site induces immunological tolerance. Immunity 5, 7-16. 53. Bennett, J., Pakola, S., Zeng, Y., and Maguire, A. (1996). Humoral response after administra­ tion of El-deleted adenoviruses: Immune privilege of the subretinal space. Hum. Gene Ther. 7, 1763-1769. 54. Reichel, M. B., Ah, R. R., Thrasher, A. J., Hunt, D. M., Bhattacharya, S. S., and Baker, D. (1998). Immune responses limit adenovirally mediated gene expression in the adult mouse eye. Gene Ther. 5, 1038-1046. 55. Rubinchik, S., Ding, R., Qiu, A. J., Zhang, F., and Dong, J. (2000). Adenoviral vector v̂ ĥich delivers FasL-GFP fusion protein regulated by the tet-inducible expression system. Gene Ther. 7, 875-885. 56. Bilbao, G., Zhang, H., Contreras, J. L., Zhou, T., Feng, M., Saito, I., Mountz, J. D., and Curiel, D. T. (1999). Construction of a recombinant adenovirus vector encoding Fas ligand with a CRE/Loxp inducible system. Transplant Proc. 31, 792-793. 57. Zhang, H. G., Bilbao, G., Zhou, T., Contreras, J. L., Gomez-Navarro, J., Feng, M., Saito, I., Mountz, J. D., and Curiel, D. T. (1998). Application of a Fas ligand encoding a recombinant adenovirus vector for prolongation of transgene expression./. Virol. 72, 2483-2490. 58. Zhang, H. G., Liu, D., Heike, Y., Yang, P., Wang, Z., Wang, X., Curiel, D. T., Zhou, T., and Mountz, J. D. Induction of specific T-cell tolerance by adenovirus-transfected. Fas ligand-producing antigen presenting cells. Nat. Biotechnol. 16, 1045-1049. 59. Zhang, H. G., Zhou, T., Yang, P., Edwards, C. K., 3rd, Curiel, D. T., and Mountz, J. D. (1998). Inhibition of tumor necrosis factor alpha decreases inflammation and prolongs adenovirus gene expression in lung and liver. Hum. Gene Ther. 9, 1875-1884. 60. Rennert, P., Schneider, P., Cachero, T. G., Thompson, J., Trabach, L., Hertig, S., Holler, N., Qian, F., Mullen, C , Strauch, K., Browning, J. L., Ambrose, C , and Tschopp, J. A. (2000). Soluble form of B cell maturation antigen, a receptor for the tumor necrosis factor family member APRIL, inhibits tumor cell growth. / . Exp. Med. 192, 1677-1684. 61. von Bulow, G. U., and Bram, R. J. (1997). NF-AT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science 278, 138-141. 62. Gross, J. A., Johnston, J., Mudri, S., Enselman, R., Dillon, S. R., Madden, K., Xu, W., Parrish-Novak, J., Foster, D., Lofton-Day, C , Moore, M., Littau, A., Grossman, A., Haugen, H., Foley, K., Blumberg, H., Harrison, K., Kindsvogel, W., and Clegg, C. (2000). TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 404, 995-943. 63. Xia, X. Z., Treanor, J., Senaldi, G., Khare, S. D., Boone, T., Kelley, M., Theill, L. E., Colombero, A., Solovyev, I., Lee F., McCabe, S., Elliott, R., Miner, K., Hawkins, N., Guo, J., Stolina, M., Yu, G., Wang, J., Delaney, J., Meng, S. Y., Boyle, W. J., and Hsu, H. (2000). 4 2 8 Zhang ef al. TACI is a TRAF-interacting receptor for TALL-1, a tumor necrosis factor family member involved in B cell regulation./. Exp. Med. 192, 137-143. 64. Wu, Y., Bressette, D., Carrell, J. A., Kaufman, T., Feng, P., Taylor, K., Gan, Y., Cho, Y. H., Garcia, A. D., Gollatz, E., Dimke, D., LaFleur, D., Migone, T. S., Nardelli, B., Wei, P., Ruben, S. M., Ullrich, S. J., Olsen, H. S., Kanakaraj, P., Moore, P. A., and Baker, K. P. (2000). Tumor necrosis factor (TNF) receptor superfamily member TACI is a high affinity receptor for TNF family members APRIL and BLyS. / . Biol. Chem. 275, 35,478-35,485. C H A P T E R High-Capacity ''Gutless'' Adenoviral Vectors: Technical Aspects and Applications Gudrun Schiedner/ Paula R. Clemens,^ Christoph Volpers,'' and Stefan Kochanek'' *Center for Molecular Medicine University of Cologne Cologne, Germany "'"Department of Neurology University of Pittsburgh Pittsburgh, Pennsylvania •• Introduction Successful somatic gene therapy fundamentally depends on the availabil­ ity of vectors that allow the efficient and nontoxic delivery of nucleic acids into the appropriate target cells. El-deleted first-generation adenoviral vectors have been used in a number of clinical trials for the treatment of neoplastic and inherited disorders. So far these vectors have been based on adenovirus serotypes 2 and 5 and have usually been produced in the El-complementing 293 cell line [1]. These vectors may still find an application in the treatment of cancer diseases or for vaccination in which "immunostimulation" by viral functions may act as a beneficial adjuvant to the function of the transgene. However, it is unlikely that in the future these vectors will still be used for the treatment of inherited recessive or dominant disorders that would require durable expression of the therapeutic gene. Immune responses to viral proteins expressed from the vector have been observed in various systems. Immediate toxic effects following gene transfer with high vector doses have been attributed both to the viral capsid and to viral gene expression. Chronic toxicity, apparently unrelated to a specific antiviral immune response has been noted [2]. A DNA capacity of 7-8 kb allows the expression of many cDNAs ADENOVIRAL VECTORS FOR GENE THERAPY 4 2 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 4 3 0 Schiedner ef al. but not of all. However, the main reason why first-generation vectors should not be used for the treatment of inherited disorders in which long-term gene expression is required lies in the realistic appreciation that our knowledge of potential interactions between functions from different viruses from the same or different species or between viral functions and exogenous factors is very slim. As has been discussed before [3], it is likely that there could and would be interactions between viral functions of the gene transfer vector and of other virus species. Because the consequences of such interactions are currently largely unpredictable, gene transfer studies in humans that are based on vectors that still carry viral genes have to be subjected to extremely careful risk-benefit considerations. In an attempt to address several of the disadvantages of first and second- generation adenoviral vectors, a new vector has been developed [4-11] that has been variably named "high-capacity (HC)," "gutless," "gutted," "mini," "deleted," "third-generation," "delta (A)," or "helper-dependent (HD)" ade­ noviral vector. For simplicity the term HC-Ad vector is used throughout this text. This chapter is divided into two parts. In the first part, technical aspects are discussed as they relate to the production and the design of HC-Ad vectors. In the second part the results of gene transfer experiments are summarized. II. Technical Aspects A. Vector Production The production of first-generation adenovirus vectors is relatively simple: only the El functions that are absent from the vector have to be complemented in a producer cell line. The 293 cell line [1] has been extremely valuable in serv­ ing the production needs for gene transfer vectors for many years. Vectors with additional mutations in the E2 and/or E4 genes (second-generation vectors) can still be relatively easily complemented by cell lines that provide the missing functions in trans. The production is considerably more complicated with vec­ tor genomes that have increasingly large deletions. The successful completion of a productive infection cycle and the generation of a large number of infec­ tious particles during production require the precise coordination of a complex viral transcription and replication program. The current production of HC-Ad vectors is based on earlier studies in which the accidental generation of hybrid vector genomes was observed. These consisted of both adenovirus and human or SV40 DNA, respectively, and were dependent on the presence of a wild-type helper virus [12, 13]. Based on these studies, several research groups success­ fully rescued recombinant adenoviral vector particles that did not contain any viral coding sequences and expressed different transgenes [4, 5, 8, 14]. The 15. High-Capacity '^Gutless'' Adenoviral Vectors 4 3 1 first vector that expressed a reporter gene and that was deleted in LI, L2, VAI+II, and pTP was produced by using wild-type adenovirus type 2 as helper virus [4]. It was possible to rescue, serially propagate, and partially purify a recombinant, although not fully deleted adenoviral vector. In one system [4, 15] a replication-deficient helper virus was engineered to carry a partially defective packaging signal in order to impair the packaging of the helper virus and thereby to enhance vector production. The packaging signal of Ad5 has been characterized in a series of elegant studies that involved the generation and analysis of a large number of packaging-deficient adenoviral mutants [16-19]. The adenoviral packaging element is located between nucleotides 230 and 370 and consists of seven elements, the so-called consensus A repeats AI-AVII. The detailed molecular mechanism of adenoviral DNA packaging is still not clear [20]. To attenuate the packaging capability of the helper virus, 91 bp of the packaging element involving AII-AV were deleted [5] using the packaging impaired adenoviral mutant dl309-267/358 as a template [17]. Compared to wild-type Ad5, this mutant can be grown in cell culture with about 90-fold reduced titer. Using this mutated packaging signal in an El-deleted helper virus it was possible to serially propagate a plaque isolate containing the vector and helper virus genome on 293 cells, and to separate helper virus and vector particles by CsCl equilibrium centrifugation. The HC-Ad vector was obtained in fairly high titers with a 1% contamination by helper virus. In these early studies an HC-Ad vector was generated that contained the 13.8-kb full-length murine dystrophin cDNA under the control of a 6.5-kb muscle-specific pro­ moter and a lacZ reporter gene. The only viral elements retained on the vector genome are the inverted terminal repeats (ITRs), which is the viral origin of replication, and the packaging signal. Using a comparable strategy, an HC-Ad vector that expressed the human Factor VIII gene was generated [15]. In these systems the recombinant vector DNA with the wild-type packaging signal is preferentially packaged into capsids. Because of differences in the densities of the particles it is possible to separate vector particles from helper virus by CsCl equilibrium centrifugation so that contamination of the vector with the helper virus is around 1%.

However, our own experiences indicate that by using this production system it would be very difficult if not impossible to produce clinical grade material in large amounts. A different and improved produc­ tion scheme, which takes advantage of the Cre-loxP recombination system of bacteriophage PI [21] considerably increased the ease of vector production and resulted in an increased vector yield and purity. This system utilizes a helper virus with the packaging signal being flanked by two loxP-recognition sites [9, 10]. As in the earlier production system the helper virus is El deficient and corresponds, therefore, to a replication-defective first-generation aden­ ovirus vector. The recombinant vector carrying the transgene is produced in 293 cells constitutively expressing Cre recombinase [22]. Following infection of producer cells the packaging signal of the helper virus is excised with high 432 Schiedner ef al. efficiency without affecting viral replication. Having lost the packaging signal by Cre-mediated excision, the helper virus is excluded from the capsids while the recombinant vector is efficiently packaged. Although the Cre-mediated removal of the packaging signal was shown to efficiently suppress helper virus contamination, sometimes overgrowth of the helper virus during amplifica­ tion has been observed [23]. The helper virus could escape suppression if one of the loxP sites flanking the packaging signal was lost by an intermolecular recombination event that occurred between the two identical packaging signals that are present on the helper virus and on the vector genome. Exchanging the DNA sequences between the consensus A repeats reduced the chances of homologous recombination between vector and helper virus genomes [23]. In a modification of the original Cre-loxP system, additional gene functions (DNA polymerase and preterminal protein) were deleted from the helper virus genome and supplied in trans in a packaging cell line [24, 25]. For clinical-grade production of HC-Ad vectors it is likely that Cre- recombinase-expressing cell lines will be used that are not based on 293 cells. As with first-generation adenovirus vectors there is sequence overlap between the El region in 293 cells and the helper virus genome. Therefore, a generation of replication-competent adenovirus (RCA) by homologous recombination is expected to be likely, especially if large amounts of vector are produced. Cell lines that exclude the generation of RCA have been developed [26, 27]. When Cre recombinase is expressed in these cells, efficient production of HC-Ad vectors with low helper virus contamination is possible [G.S., unpublished observation]. For construction of HC-Ad vector genomes, plasmid cloning strategies have been implemented. Most plasmids for HC-Ad vector construction harbor the left and right adenoviral ITRs, including the packaging signal, and different sizes of stuffer DNAs to accommodate different insert sizes. In these plasmids the ITRs are flanked by unique restriction sites that are used to release the plasmid backbone prior to the rescue of vector in the producer cell line. Following transfection of the vector plasmid into El and Cre expressing producer cells that are coinfected with a loxP helper virus, the vector titer is increased through four to six serial amplifications. In every amplification the cells are coinfected with loxP helper virus. Although excision of the packaging signal of the helper virus is not 100% efficient, the final helper virus contamination in this system can be less than 0 .1%. The vector yield per cell can be as high as 1000-2000 infectious units [G.S., unpubfished observation]. B. Stuffer DNA Earlier experiences with Ad5-SV40 hybrid vectors had suggested that the lower size limit for efficient production of adenoviral genomes is about 25 kb [66]. However, most expression cassettes that are currently in use for gene transfer are of much smaller sizes. Rearrangements and/or amplifications 15. High-Capacity '^Gutless'' Adenoviral Vectors 4 3 3 of the vector genome resulting in concatamerization of a starting monomer has been the rule in several studies in w^hich small expression cassettes v^ere rescued as deleted adenoviral vectors. The vector preparations consisted of viral particles that contained both monomeric and dimeric genomes and frequently w êre mixtures of particles v^ith head-to-head, head-to-tail, or tail-to-tail DNA concatemers [6, 14, 28, 29]. This size-dependence of stable vector production vŝ as confirmed with the loxP production system that w âs used to rescue and propagate HC-Ad vectors w îth differently sized vector genomes as starting material. Only vectors w îth genome sizes of at least 27 kb allov^ed efficient and stable vector amplification [30]. Thus, "stuffer" DNA has to be added to the therapeutic gene cassette to bring the total vector genome size to at least 27 kb. Some practical considerations are outlined here. Since approximately 30-kb plasmids are typically used for vector construction, the stuffer DNA should not contribute to instability during plasmid propagation in Escherichia coli. Larger stretches of repetitive elements might increase the likelihood of vector instability during cloning and production procedures and therefore should be avoided. Likewise, stuffer DNA should support stability and growth during viral vector amplification. Stuffer DNA should not interfere with transgene expression in vivo and should be transcriptionally silent. Other elements like matrix or scaffold attachment regions (MARs or SARs) may have positive influences on vector stability in the transduced cells. Stuffer DNA has the potential to promote recombination between HC-Ad vectors and the recipient cell genome since these vectors may share large stretches of homology with the genomic DNA of the target cell. This could increase the possibility of vector integration by homologous recombination. However, experimental evidence from in vitro studies suggests that, compared to first-generation adenoviral vectors, integration frequencies might be somewhat increased but are unlikely to be high [31]. There is some evidence that the source of the stuffer sequences may have an impact on the levels of transgene expression from the vector. An HC-Ad vector containing CpG-rich stuffer DNA derived from phage lambda resulted in significantly reduced and only short-term hepatic expression of a lacZ transgene when compared to an HC-Ad vector containing noncoding stuffer DNA from the human hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus [32]. One explanation that could account for this observation was a possible inadvertent expression of phage lambda genes in eukaryotic cells resulting in toxicity or immunogenicity. In addition, lambda DNA harbors a high number of immunostimulatory CpG motifs which could contribute to the immunogenicity of the transgene protein. Human DNA sequence is probably the best source of stuffer DNA. Various HC-Ad vectors carrying human stuffer DNA have demonstrated high and long-lasting transgene expression in vivo [2, 29, 33-36]. These vectors either contained noncoding stuffer DNA from the human HPRT locus and/or from the human cosmid C346. Even though these 4 3 4 Schiedner ef al. stuffer DNAs were stable through cloning and amplification in most HC-Ad vectors, some reports have indicated instability of the stuffer DNA that was derived from the HPRT gene [23]. In these analyses, HC-Ad vectors containing stuffer DNAs from other human genomic loci seemed to have some growth advantages during amplification and also showed improved expression levels when compared to vectors containing HPRT stuffer DNAs. Future experiments will likely add to the understanding of the impact of human stuffer DNA on expression levels and stability. C. Vector Capsid Modification Experimental strategies directed toward the improvement of efficacy and safety of adenoviral, including HC-Ad vector-mediated, gene transfer by modification of the vector capsid involve three different aspects: first, attempts to circumvent the neutralizing immune response raised within the recipient following the initial vector delivery and preventing repeated administration; second, efforts to abolish the native adenoviral tropism in order to minimize transduction of nontarget tissues; and third, introduction of new ligands or binding domains to target the vector to specific cell types. The capsid of HC-Ad vectors, whose protein components are encoded by the helper virus genome, is not different from that of first-generation vectors. Therefore, neutralizing antibodies produced as a consequence of the first vector delivery still represent a significant problem in readministration schemes. Based on the observation that neutralizing antibodies are Ad type-specific [37], Parks et al. recently demonstrated that this problem can be overcome by the sequential use of HC-Ad vectors of alternative serotypes [38]. In addition to the Ad5-based helper virus originally used in the Cre/loxP system [9], a new helper virus was constructed that was based on serotype 2. An HC-Ad vector with an Ad2 capsid was injected into mice, followed 3 months later by administration of a HC-Ad vector that had either an Ad2 capsid or an Ad5 capsid. The repeat administration of the HC-Ad vector of the same serotype resulted in a 30- to 100-fold reduction in reporter gene expression in the liver, compared with unimmunized animals, whereas no decrease in transgene expression was observed when the second HC-Ad vector was of the different serotype. No Ad5-cross-reactive antibodies were produced in mice immunized with the Ad2- based vector [38]. Similarly, successful repeat vector delivery was achieved in baboons by sequential administration of Ad5- and Ad2-based first-generation Ad vectors [39]. These data indicate that such an approach, taking advantage of the availability of different adenoviral serotypes, might allow repeated gene transfer in immunocompetent individuals. With respect to strategies that aim at a modification of the tropism of adenoviral vectors, HC-Ad vector technology will build on the experience and results collected with first-generation vectors. Considerable progress has 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 3 5 recently been made to develop infectious vector particles v^ith reduced or no affinity for the native coxsackie-and-adenovirus receptor, CAR, by site-directed mutagenesis of the CAR-binding region in the fiber knob domain [40, 41], by the design of knobless vector particles [42], or by production of completely fiberless particles in specialized producer cells [43]. These modifications, when applied to HC-Ad vectors in the future, could further add to their targeting efficiency and safety by reducing undesired infection of nontarget cells and increasing vector concentration at target sites in vivo. Retargeting of first- generation vectors to cell surface molecules of interest has been achieved by the use of bispecific "adapter" molecules like bispecific recombinant antibod­ ies [44] or CAR fusion proteins [45], by chemical cross-linking of binding moieties to the vector capsid [46] or by genetic insertion of ligands either into the fiber knob protein [47] or the hexon protein [48]. (For comprehensive description of these strategies, see Chapter 8 in this volume). For retargeting of HC-Ad vectors, we have recently constructed a new Ad5-based helper virus containing two unique restriction sites in the fiber gene which facilitate inser­ tion of binding ligands into the fiber knob HI loop. In one line of experiments, an RGD peptide motif was inserted into this reengineered HI loop site for redirecting vectors to av integrins. HC-Ad reporter vectors produced using this helper virus transduced ovarian carcinoma cells as well as primary endothelial and smooth muscle cells with a 2- to 20-fold higher efficiency, depending on the cell type, than unmodified vectors [49], providing proof-of-concept experiments for the powerful combination of HC-Ad vector technology and retargeting strategies. III. Applications A. Liver Gene Transfer The liver possesses a variety of characteristics that make this organ very attractive for gene therapy. Because of the fenestrated structure of its endothelium, the liver parenchymal cells are readily accessible to large particles such as viruses present in the blood. With respect to blood circulation, the liver can serve as a secretory organ for the systemic delivery of many therapeutic proteins. In addition, in many inborn errors of metabolism the liver is the mainly affected organ. Adenoviral vectors gained considerable interest for liver gene therapy owing to their capacity to very efficiently transduce quiescent hepatocytes in vivo. In fact, upon intravenous injection into the tail vein of mice, a large proportion of adenovirus particles preferentially localizes to the liver. However, in immunocompetent animals and with first-generation adenoviral vectors, transgene expression in general is transient both due to the loss of transduced hepatocytes and to promoter inactivation. Immunological 4 3 6 Schiedner ef al. and toxic effects in transduced cells due to viral gene expression significantly limit the use of first-generation vectors for hepatic gene transfer in vivo. An HC-Ad vector expressing the human a 1-antitrypsin gene w âs used in several instructive experiments. Using the loxP helper virus production system, an HC-Ad vector w âs generated containing the 19-kb genomic human a 1-antitrypsin locus that included both the macrophage and liver- specific promoters, all exons and introns, and the natural polyadenylation signal [2]. al-Antitrypsin antagonizes

neutrophilic elastase and is abundantly expressed in hepatocytes and at a low^er level in macrophages. Expression in the tw ô cell types is regulated by different tissue-specific promoters. Currently, al-antitrypsin-deficient patients have a shortened life expectancy due to emphy­ sema. Patients are treated with v^eekly injections of human a 1-antitrypsin purified from human plasma. Gene transfer of 2 x 10^^ particles of this vector in immunocompetent C57BL/6J mice resulted in tissue-specific and stable gene expression for longer than 1 year. Transcription of the human a 1-antitrypsin RNA in the liver of transduced animals v^as initiated from the liver-specific promoter, but not from the macrophage-specific promoter. Gene transfer w îth increasing vector doses resulted in high and stable al-antitrypsin levels in serum. Significantly, w îth increasing vector doses, serum levels of a 1-antitrypsin w êre obtained that w^ould be considered supraphysiological in humans. Even these very high vector doses w êre not accompanied by liver toxicity. Mice that received the same dose of a first-generation vector carrying the human a 1-antitrypsin cDNA under the control of the murine phosphogylcerate kinase (PGK) promoter experienced liver damage as documented by histological abnormalities and elevated liver enzymes detected in the serum of transduced mice [50]. Gene transfer of this vector in baboons resulted in relatively stable transgene expression for longer than 16 months in tw ô of three baboons [39]. In these animals only a slow decline was observed to 19% and 8% of peak levels at 16 and 24 months, respectively. This was not surprising for two reasons. First, hepatocytes are not postmitotic and there is a regular, albeit slow, turnover in this cell type. Second, the animals were young and still growing when they were injected. Therefore, a decline of a 1-antitrypsin levels correlated with animal growth. In a third baboon, the generation of anti-al-antitrypsin antibodies was associated with a short duration of expression of only 2 months. Transgene expression in all three animals injected with a first-generation vector was limited to 3 to 6 months. The lack of anti-al-antitrypsin antibodies in these animals and further immunological studies suggested that cellular immune responses against viral proteins might have resulted in the elimination of vector-transduced hepatocytes. In summary, these studies demonstrated the main advantages of HC-Ad vectors: increased capacity allowing the incorporation of large DNA fragments and even some genes in the genomic context, improved levels and persistence of transgene expression, and significantly reduced toxicity. 15. High-Capacity "Gutless'' Adenoviral Vectors 4 3 7 Improved expression and decreased liver toxicity has also been observed follov^ing gene transfer v^ith an HC-Ad vector expressing the murine leptin cDNA from the human cytomegalovirus (HCMV) promoter [29]. Leptin is a potent modulator of weight and food intake. In leptin-deficient ob/ob mice, daily delivery of recombinant leptin protein suppresses appetite, induces weight reduction, and decreases blood insulin and glucose levels. Results from gene transfer experiments with a first-generation vector suggested that delivery of the leptin cDNA might provide therapeutic benefit equivalent to daily leptin protein treatment. However, the effects were only transient in both lean and ob/ob mice due to the loss of DNA and due to significant inflammatory changes in liver. Using an HC-Ad vector carrying the same expression cassette, leptin expression and physiological consequences were analyzed following gene transfer. In lean mice, tail vein injection of 1-2 x 10^^ particles of the HC-Ad vector resulted in long-term leptin expression. Gene expression in ob/ob mice (which are leptin-deficient and therefore not tolerant to leptin) following gene transfer with the same dose of an HC-Ad vector was improved, prolonged, and associated with increased weight loss. However, even in HC-Ad vector transduced ob/ob mice leptin serum levels declined and finally disappeared due to the generation of anti-leptin antibodies. Relatively realistic disease targets for HC-Ad vectors are the clotting disorders hemophilias A and B. The hemophilias are characterized by sponta­ neous and prolonged bleeding into joints, muscle, and internal organs. Current treatment of the hemophilias, which are often life-threatening and frequently associated with disabling arthropathy due to recurring joint bleeding, consists of protein-replacement therapy with infusion of plasma-derived or recom­ binant factor VIII (FVIII) or factor IX (FIX). The hemophilias are attractive candidates for gene therapy since they are due to single gene defects. A signif­ icant advantage is the fact that the therapeutic window is relatively broad. In addition, tissue-specific expression and precise control of the transgene expres­ sion is probably not required. Importantly, even moderate increases of FVIII or FIX levels would be sufficient to convert a severe hemophilia to a milder form. Intravenous injection of first-generation adenoviral vectors expressing the human or canine B-domain-deleted FVIIII cDNA in normal or hemophilic mice and dogs resulted in therapeutic and physiological levels of biologically active FVIII that was accompanied by a correction of bleeding tendency. However, both in hemophilic mice and dogs FVIII levels gradually declined, resulting in only short-term phenotypic correction. In mice transduced with a first-generation adenoviral vector expressing the human FVIII gene, anti-FVIII antibodies were not detectable. However, in hemophilic dogs, neutralizing FVIII antibodies were generated upon gene transfer of first generation vectors expressing either the human or canine FVIII cDNA [for review see 51]. Recently, an HC-Ad vector that carries the full-length human FVIII cDNA under the control of the 12.5-kb albumin promoter was injected into 4 3 8 Schiedner ef aL hemophilic mice, resulting in efficient hepatic gene transfer and therapeutic FVIII expression which led to the correction of the phenotype. However, FVIII levels declined, possibly due to the generation of inhibitory antibodies to the human FVIII protein. Histopathological findings of vector-induced toxicity were not observed [52]. Therapeutic expression levels could only be observed with relatively high vector doses (2 x 10^^ viral particles per mouse). With a 10-fold lower vector dose FVIII could not be detected in the serum. These results suggested a nonlinear "threshold" effect which also has been observed with first-generation vectors [53]. Two further examples of liver gene transfer by HC-Ad vectors are men­ tioned since they point to additional advantages of this new vector type. In one instance an HC-Ad vector was generated to express murine erythro- poetin (mEPO), a glycoprotein regulating erythropoiesis [35]. EPO is mainly secreted by kidney peritubular cells in response to hypoxia and promotes late erythroid precursor proliferation and terminal differentiation of erythrocytes. Patients suffering from chronic renal failure show anemia as a major compli­ cation resulting from the destruction of EPO-secreting cells. These patients are treated with administration of recombinant human EPO protein. As an alterna­ tive treatment, delivery of the human EPO gene via an HC-Ad vector was tested and compared to a first-generation adenovirus vector with the same expression cassette. Relatively low amounts of an HC-Ad vector (3 x 10^ infectious units or 3 X 10^ particles per mouse) were sufficient to elevate hematocrit levels significantly, although with varying efficiencies, in different immunocompetent mouse strains. In this system the HC-Ad vector was at least 100-fold more efficient than a first generation vector. Because the low vector doses did not initiate any detectable neutralizing antibody response, intravenous readminis- tration of the vector was possible without a need for immunosuppression. In contrast, a second injection of a first-generation virus into mice that had been previously transduced with the same vector induced a much smaller and only transient hematocrit increase. A second example concerns the use of the mifepristone inducible gene expression system within the HC-Ad vector context [34]. In this system a chimeric ^mws-activator was used consisting of a mutated progesterone receptor ligand-binding domain, part of the activation domain of the human p65 subunit of the NF-KB complex, and a GAL4 DNA-binding domain. Expression of the ^r^ws-activator was under the transcriptional control of the liver-specific transthyretin (TTR) promoter. A second expression cassette was located on the same vector and consisted of a 17-mer GAL4-binding site just upstream of a minimal TATA box containing the promoter and cDNA of human growth hormone (hGH). In the presence of the progesterone antagonist mifepristone the transactivator dimerizes, binds to the Gal4 DNA binding site and induces hGH expression. In vitro studies in HepG2 cells and in vivo experiments in mice demonstrated extremely tight control of gene expression and very strong 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 3 9 induction of hGH expression upon administration of mifepristone. Following liver gene transfer, repetitive induction was possible for longer than 1 year [34, and unpublished data]. B. Gene Transfer into Skeletal Muscle The first in vivo application of HC-Ad vectors was for gene transfer studies toward a treatment for Duchenne muscular dystrophy (DMD), an inherited muscular dystrophy caused by mutations in the dystrophin gene. The dystrophin cDNA is 14-kb in length; thus, only shortened versions of this cDNA could be accommodated by first-generation or second-generation adenoviral vectors. Therefore, HC-Ad vectors provided the potential to deliver the full-length dystrophin cDNA with an adenoviral vector. DMD is the most common form of muscular dystrophy with an incidence of 1:3500 male births. Mutations in the dystrophin gene result in the absence of the cytoskeletal dystrophin protein that is normally located at the cytoplasmic face of the cell membrane in skeletal and cardiac muscle. In normal muscle, dystrophin serves as a link in a network of proteins that span from actin within the muscle cell to laminin in the extracellular matrix. The absence of dystrophin results in a secondary loss of dystrophin-associated proteins, increased fragility of the muscle membrane, and cycles of degeneration followed by regeneration. Ultimately, the regenerative process fails and muscle fibers are replaced with fibrosis. HC-Ad vectors encoding the dystrophin cDNA were developed by sev­ eral groups [5, 8, 14]. Two groups incorporated a muscle-specific muscle creatine kinase (MCK) promoter [5, 8], allowing demonstration of striated muscle-specific expression of dystrophin from the vector. Direct intramuscular injection of these dystrophin-encoding HC-Ad vectors in the dystrophin- deficient mdx mouse model resulted in expression of recombinant dystrophin that properly localized to the muscle sarcolemma [7, 14]. Furthermore, dystrophin-associated proteins, which are lost in DMD and mdx muscle secondary to the primary absence of dystrophin, were restored in muscle fibers expressing HC-Ad vector-delivered dystrophin [54]. The prevention of dystrophic morphologic changes in muscle of mdx mice receiving an intramus­ cular injection of dystrophin-encoding HC-Ad vector was a second indicator of normal function provided by the recombinant dystrophin that was expressed from the HC-Ad vector [7]. One HC-Ad vector encoding a MCK-driven murine dystrophin cDNA and an HCMV-controUed lacZ gene, called AdDYSPgal, resulted in a profound cellular infiltrate composed primarily of CD4+ and CD8+ T cells when injected intramuscularly in nondystrophic, normal mice, even when gene delivery was performed during the neonatal period [54]. Expression of P-galactosidase was identified as the principal cause of the observed cellular immune response 4 4 0 Schiedner ef al. by performing parallel intramuscular injections of AdDYSPgal in neonatal mice with a germline lacZ transgene on the same genetic background. LacZ- transgenic mice did not develop a cellular infiltrate in skeletal muscle at any time point after intramuscular AdDYSPgal delivery [54]. Further studies demonstrated that dystrophin expression from AdDYSPgal in skeletal muscle of mdx mice also could induce at least an antibody-mediated immune response to dystrophin antigens (P.R.C., unpublished observations). When immunity to the vector v^as largely eliminated in direct muscle gene transfer studies, the AdDYSPgal vector DNA w âs stably maintained in skeletal muscle for at least 5 months [33]. Furthermore, the integrity of vector DNA remained intact [33]. This provided assurance that HC-Ad vector DNA could remain as a stable episome in transduced muscle cells. These studies clearly show^ the utility of HC-Ad vectors for muscle gene transfer. An important issue to address in future studies is the nature of immunity induced by transgene proteins and adenoviral capsid antigens in the context of specific disease applications. It is likely that the underlying pathology of a muscle disorder v îll influence immunity induced or augmented by HC-Ad vector-mediated gene delivery. The low efficiency and extent of gene delivery to muscle is a second issue that currently prevents clinical applications of HC-Ad vectors. Targeting of HC-Ad vectors for muscle gene delivery may permit systemic administration that could result in transduction of muscle tissue widespread throughout the body. C. Gene Transfer into the Eye and into the CNS Adenoviral vectors have successfully been used for transgene delivery to different anatomic compartments and cell

types of the eye, in vitro and in vivo. Several groups have demonstrated efficient transduction of retinal cells with first-generation adenoviral vectors expressing reporter or therapeutic genes [see for example 55-61]. The eye is considered a site of immune privilege, which is immunologically tolerant to foreign antigens similar to the testis, ovary, and uterus [62]. However, following adenoviral-mediated gene transfer into different ocular cell types, gene expression has always been transient. The short duration of gene expression obtained, together with the limited insertion capacity of first-generation Ad vectors, recently prompted studies that aimed at developing HC-Ad vectors for somatic gene therapy of human retinal degenerative diseases. R. Kumar-Singh et al. constructed an "encapsi- dated adenovirus mini-chromosome" containing a full-length murine cDNA encoding the P-subunit of the guanosine 3^,5^-monophosphate (cyclic GMP) phosphodiesterase (P-PDE) under control of a human p-PDE promoter which is transcriptionally active in photoreceptor cells of the neuronal retina [28, 63]. This vector was prepared by cotransfection of 293 cells with helper virus DNA and a circular plasmid with head-to-head-oriented adenoviral ITRs generat­ ing linear adenoviral "mini-chromosomes" following rescue in 293 cells. The 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 4 1 vector particles contained either monomers of the 13-kb starting material, or dimers in a head-to-head, head-to-tail, or tail-to-tail configuration [28, 63]. The P-PDE HC-Ad vector was delivered to the subretinal space of homozy­ gous rd mice. These mice, w^hich show^ a similar retinal phenotype as retinitis pigmentosa patients, suffer from an early-age onset of degeneration of reti­ nal photoreceptors due to a loss-of-function mutation in the P-PDE gene. Expression of p-PDE in transgenic rd mice is know^n to rescue photoreceptor degeneration in this model [64]. In the P-PDE HC-Ad vector-treated animals, expression of the transgene in the neuronal retina v^as demonstrated by RT- PCR, Western blot analysis and functional enzymatic assays [28, 63]. When the thickness of the outer nuclear layer, as a marker of photoreceptor cell rescue, v^as evaluated at l-week intervals, significant differences v̂ êre observed betw^een mice injected w îth the p-PDE HC-Ad vector and control vector up to 12 v̂ êeks postinfection [28, 63]. Despite these encouraging results the expres­ sion of the P-PDE Ad vector was transient and loss of expression w âs complete at 120 days follov^ing subretinal injection. Whether the loss of expression was due to an immune response directed against contaminating first-generation helper virus or against the transgenic protein, to promoter shutdow^n, or sim­ ply to instability of the vector DNA is not clear at the time of this w^riting. Since quiescent cells of the CNS allows efficient gene transfer by adenoviral vectors, glial and neuronal cells are very interesting target cells for HC-Ad vectors. In an in vitro study primary neuronal cells isolated from the cerebellum of 8- to 9-day-old mice v^ere transduced w îth either a first-generation or an HC-Ad vector expressing £. coli P-galactosidase [65]. Compared to gene transfer with a first-generation vector, transduction of these primary cells vŝ ith the HC-Ad vector resulted in a marked decline in vector-mediated toxicity as assessed by morphological and metabolic studies. In particular, this was evident at moder­ ate vector doses, corresponding to up to 50 multiplicities of infection (m.o.i.), a vector dose that resulted in an 85% transduction rate. However, at very high doses, the HC-Ad vector exhibited cytotoxicity, though not as severe as could be observed with a first-generation vector control. A problem of clinical significance that has been rarely addressed concerns the fate of a viral vector following the superinfection by a virus of the same or a closely related serotype. Stereotactic injection in rats into the striatum of the brain of both a first-generation and an HC-Ad vector expressing lacZ resulted in stable gene expression over at least 60 days with both vectors [36]. However, challenge by peripheral subcutanous injection of a first-generation vector expressing an immunologically unrelated transgene resulted in a strong inflammatory response in the brain of rats that had received the first-generation vector but not the HC-Ad vector. Gene expression was completely abolished in rats that were injected with the first-generation vector while expression from the HC-Ad vector was stable. This experimental setup is mirrored by a 4 4 2 Schiedner ef al. clinical situation in which therapeutic gene transfer is followed at a later time by infection with a virus of the same or a closely related serotype. IV. Conclusion Studies to date convincingly demonstrate the utility of HC-Ad vectors for gene transfer into different tissues. Safety and expression features of HC-Ad vectors are improved over earlier-generation adenoviral vectors. The increased capacity may allow coexpression of different therapeutic genes and improved control of gene expression. A critical issue that stands between the current status of HC-Ad vector development and clinically useful applications for human patients is at the level of vector production. It is felt, however, that with recently improved producer cell lines, vectors, and helper viruses the production under GMP will be possible in the near future. Retargeting strategies will increase the spectrum of therapeutic applications and will further add to the safety of HC-Ad vectors. References 1. Graham, F. L., Smiley, J., Russel, W. C , and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol, 36, 59-74. 2. Schiedner, G., Morral, N., Parks, R. J., Wu, Y., Koopmans, S. C., Langston, C., Graham, F. L., Beaudet, A. L., and Kochanek, S. (1998). Genomic DNA transfer with a high-capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nat. Genet. 18, 180-183. 3. Kochanek S. (1999). High-capacity adenoviral vectors for gene transfer and somatic gene therapy. Hum. Gene Ther. 10, 2451-2459. 4. Mitani, K., Graham, F. L., Caskey, C. T., and Kochanek, S. (1995). Rescue, propagation and partial purification of a helper virus-dependent adenovirus vector. Proc. Natl. Acad. Set. USA 92, 3854-3858. 5. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. -H., Chan, S., and Caskey, C. T. (1996). A new^ adenoviral vector: replacement of all viral coding sequences v^ith 28 kb of DNA independently expressing both full-length dystrophin and ?-galactosidase. Proc. Natl. Acad. Sci. U5A 93, 5731-5736. 6. Fisher, K. J., Choi, H., Burda, J., Chen, S.-J., and Wilson, J. M. (1996). Recombinant adenovirus deleted for all viral genes for gene therapy of cystic fibrosis. Virology 217, 11-22. 7. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. -H., Campbell, K. P., and Caskey, C. T. (1996). In vivo muscle gene transfer of full-length dystrophin w îth an adenoviral vector that lacks all viral genes. Gene Ther. 3, 965-972. 8. Kumar-Singh, R., and Chamberlain, J. S. (1996). Encapsidated adenovirus minichromosomes allow delivery and expression of a 14 kb dystrophin cDNA to muscle cells. Hum. Mol. Genet. 5 ,913-921 . 9. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M. A., and Graham F. L. (1996). A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 15. High-Capacity ^'Gutless'' Adenoviral Vectors 4 4 3 10. Hardy, S., Kitamura, M., Harris-Stansil, T., Dai, Y., and Phipps, M. L. (1997). Construction of adenovirus vectors through Cre-lox recombination./. Virol. 71, 1842-1849. 11. Alemany, R., Dai, Y., Lou, Y. C , Sethi, E., Prokopenko, E., Josephs, S. F., and Zhang, W. W. (1997). Complementation of helper-dependent adenoviral vectors: Size effects and titer fluctuations./. Virol. Methods 68, 147-159. 12. Deuring, R., Klotz, G., and Doerfler, W. (1981). An unusual symmetric recombinant betw^een adenovirus type 12 DNA and human cell DNA. Proc. Natl. Acad. Set. USA 78, 3142-3146. 13. Gluzman, Y., and van Doren, K. (1983). Palindromic adenovirus type 5-simian virus 40 hybrid./, y/ro/. 45, 91-103. 14. Haecker, S. E., Stedman, H. H., Balice-Gordon, R. -J., Smith, D. B. J, Greelish, J. P., Mitchell, M. A., Wells, A., Sweeney, H. L., and Wilson, J. M. (1996). In vivo expression of full-length human dystrophin from adenoviral vectors deleted of all viral genes. Hum. Gene Ther. 7, 1907-1914. 15. Zhang, W. -W., Josephs, S. F., Zhou, J., Fang, X., Alemany, R., Balague, C , Dai, Y., Ayares, D., Prokopenko, E., Lou, Y. - C , Sethi, E., Hubert-Leslie, D., Kennedy, M., Ruiz, L., and Rockov^-Magnone, S. (1999). Development and application of a minimal adenoviral system for gene therapy of hemophilia A. Thromb. Haemostasis 82, 562-571. 16. Hearing, P., Samulski, R. J., Wishart, W. L., and Shenk, T. (1987). Identification of a repeated sequence element required for efficient encapsidation of the adenovirus type 5 chromosome. / . Virol. 61, 2555-2558. 17. Graeble, M., and Hearing, P. (1990). Adenovirus type 5 packaging domain is composed of a repeated element that is functionally redundant. / . Virol. 64, 2047-2056. 18. Graeble, M., and Hearing, P. (1992). Cis and trans requirements for the selective packaging of adenovirus type 5 DNA. / . Virol. 66, 723-731. 19. Schmid, S. I., and Hearing, P. (1997). Bipartite structure and functional independence of adenovirus type 5 packaging elements./. Virol. 71, 3375-3384. 20. Schmid, S. I., and Hearing, P. (1998). Cellular components interact with adenovirus type 5 minimal DNA packaging domains. / . Virol. 72, 6339-6347. 21. Sauer, B. (1987). Functional expression of the Cre-lox site specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 2087-2096. 22. Chen, L., Anton, M., and Graham, F. L. (1996). Production and characterization of human 293 cell lines expressing the site-specific recombinase Cre. Somat. Cell. MoL Genet. 22, 477-488. 23. Sandig, V., Youil, R., Bett, A. J., Franlin, L. L., Oshima, M., Maione, D., Wang, F., Metzker, M. L., Savino, R., and Caskey, C. T. (2000). Optimization of the helper-dependent adenovirus system for production and potency in vivo. Proc. Natl. Acad. Sci. USA 97, 1002-1007. 24. Amalfitano, A., and Chamberlain, J. S. (1997). Isolation and characterization of packaging cell lines that coexpress the adenovirus El , DNA polymerase, and preterminal proteins: Implications for gene therapy. Gene Ther. 4, 258-263. 25. Hartigan-O'Connor, D., Amalfitano, A., and Chamberlain, J. S. (1999). Improved production of gutted adenovirus in cells expressing adenovirus preterminal protein and DNA polymerase. / . Virol. 73, 7835-7841. 26. Fallaux, F. J., Bout, A., van der Velde, I., van den Wollenberg, D. J. M., Hehir, K. M, Keegan, J., Auger, C , Cramer, S. J., van Ormondt, H., van der Eb., A., Valerio, D., and Hoeben, R. C. (1998). New Helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 27. Schiedner, G., Hertel, S., and Kochanek, S. (2000). Efficient transformation of primary human amniocytes by El functions of Ad5: Generation of new cell lines for adenoviral vector production. Hum. Gene Ther. 11, 2105-2116. 28. Kumar-Singh, R., and Farber, D. B. (1998). Encapsidated adenovirus minichromosome- mediated delivery of genes to the retina: application to the rescue of photoreceptor degeneration. Hum. Mol. Genet. 7, 1893-1900. 4 4 4 Schiedner ef al. 29. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franklin, L., Parks, R. J., Graham, F. L., Kochanek, S., Bett, A. J., and Caskey, C. T, (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95y 7866-7871. 30. Parks, R. J., and Graham, F. L. (1997). A helper-dependent system for adenovirus production helps define a low^er limit for efficient DNA packaging. / . Virol. 71, 3293-3298. 31. Harui, A., Suzuki, S., Kochanek, S., and Mitani, K. (1999). Frequency and stability of chromosomal integration of adenovirus vectors. / . Virol. 73, 6141-6146. 32. Parks, R. J., Bramson, J. L., Wan, Y., Addison, C. L., and Graham, F. L. (1999). Effects of stuffer DNA on transgene expression from helper-dependent adenovirus vectors. / . Virol. 73, 8027-8034. 33. Chen, H. -H., Mack, L. M., Choi, S. Y., Ontell, M, Kochanek, S., and Clemens, P. R. (1997). DNA form both high-capacity and first-generation adenoviral vectors remains intact in skeletal muscle. Hum. Gene Ther. 10, 365-373. 34. Burcin, M. M., Schiedner, G., Kochanek, S., Tsai, S. Y., and O'Malley, B. W. (1999). Adenovirus-mediated regulable target gene expression in vivo. Proc. Natl. Acad. Sci. USA 96, 355-360. 35. Maione, D., Wiznerowicz, M., Delmastro, P., Cortese, R., Cifiberto, G., La Monica, N., and Savino, R. (2000). Prolonged

expression and effective readministration of erythropoietin delivered with a fully deleted adenoviral vector. Hum. Gene Ther. 11, 859-868. 36. Thomas, C. E., Schiedner, G., Kochanek, S., Castro, M. G., and Loewenstein, P. R. (2000). Peripheral infection with adenovirus causes unexpected long-term brain inflammation in animals injected intracranially with first-generation, but not with high-capacity, adenovirus vectors: towards realistic long-term neurological gene therapy for chronic diseases. Proc. Natl. Acad. Sci. USA 97, 7482-7487. 37. Gall, J. G. D., Crystal, R. G., and Falck-Pedersen, E. (1998). Construction and character­ ization of hexon-chimeric adenoviruses: Specification of adenovirus serotype. / . Virol. 72, 10,260-10,264. 38. Parks, R. J., Evelegh, C. M., and Graham, F. L. (1999). Use of helper-dependent adenovi­ ral vectors of alternative serotypes permits repeat vector administration. Gene Ther. 6, 1565-1573. 39. Morral, N., O'Neal, W., Rice, K., Leland, M., Kaplan, J., Piedra, P. A., Zhou, H., Parks, R. J., Velji, R., Aguilar-Cordova, E., Wadsworth, S., Graham, F, L., Kochanek, S., Carey, K. D., and Beaudet, A. L. (1999). Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons. Proc. Natl. Acad. Sci. USA 96, 12816-12821. 40. Kirby, L, Davison, E., Beavil, A. J., Soh, C. P. C , Wickham, T. J., Roelvink, P. W., Kovesdi, L, Sutton, B. J., and Santis, G. (1999). Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. / . Virol. 73, 9508-9514. 41. Kirby, I., Davison, E., Beavil, A. J., Soh, C. P. C , Wickham, T. J., Roelvink, P. W., Kovesdi, L, Sutton, B. J., and Santis, G. (2000). Identification of contact residues and definition of the CAR-binding site of adenovirus type 5 fiber protein. / . Virol. 74, 2804-2813. 42. van Beusechem, V. W., van Rijswijk, A. L. C. T., van Es, H. H. G., Haisma, H. J., Pinedo, H. M., and Gerritsen, W. R. (2000). Recombinant adenovirus vectors with knobless fibers for targeted gene transfer. Gene Ther. 7, 1940-1946. 43. von Seggern, D. J., Chiu, C. Y., Fleck, S. K., Stewart, P. L., and Nemerow, G. R. (1999). A helper-independent adenovirus vector with El , E3, and fiber deleted: Structure and infectivity of fiberless particles./. Virol. 73, 1601-1608. 44. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies./. Virol. 70, 6831-6838. 15. High-Capacity ^^Gutless'' Adenoviral Vectors 4 4 5 45. Dmitriev, I., Kashentseva, E., Rogers, B. E., Krasnykh, V., and Curiel, D. T. (2000). Ectodomain of coxsackievirus and adenovirus receptor genetically fused to epidermal grow^th factor mediates adenovirus targeting to epidermal grow^th factor receptor-positive cells. / . Virol. 74, 6875-6884. 46. Romanczuk, H., Galer, C, E., Zabner, J., Barsomian, G., Wadsv^^orth, S. C , and O'Riordan, C. R. (1999). Modification of an adenoviral vector v^ith biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hwm. Gene Ther. 10, 2615-2626. 47. Dmitriev, L, Krasnykh, V., Miller, C. R., Wang, M., Kashentseva, E., Mikheeva, G., Belousova, N., and Curiel, D. T. (1998). An adenovirus vector vŝ ith genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. / . Virol. 72, 9706-9713. 48. Vigne, E., Mahfouz, I., Dedieu, J. -F., Brie, A., Perricaudet, M., and Yeh, P. (1999). RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knob-independent pathv^ay for infection. / . Virol. 73, 5156-5161. 49. Biermann, V., Volpers, C., HuEmann, S., Stock, A., Kewes, H., Schiedner, G., Herrmann, A., and Kochanek, S. (2001). Targeting of high-capacity adenoviral vectors. Hum. Gene Ther. 12, 1757-1769. 50. Morral, N., Parks, R. J,, Zhou, H., Langston, C., Schiedner, G., Quinones, J., Graham, F. L., Kochanek, S., and Beaudet, A. L. (1998). High doses of a helper-dependent adenoviral vector yield supraphysiological levels of ?1-antitrypsin v\̂ ith negligible toxicity. Hum Gene Ther. 9, 2709-2716. 51. Chuah, M. K. L., Collen, D., and VandenDriessche, T. (2001). Gene therapy for hemophilia. / . G^w^M^^. 3, 3-20. 52. Balague, C., Zhou, J., Dai, Y., Alemany, R., Josephs, S. F., Andreason, G., Hariharan, M., Sethi, E., Prokopenko, E., Jan, H. -Y., Lou, Y. -C., Hubert-Leslie, D., Ruiz, L., and Zhang, W. -W. (2000). Sustained high-level expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector. Blood 95, 820-828. 53. Gallo-Penn, A. M., Shirley, P. S., Andrev^s, J. L., Kayda, D. B., Pinkstaff, A. M., Kaloss, M., Tinlin, S., Cameron, C , Notley, C , Hough, C , Lillicrap, D., Kaleko, M., and Conelly, S. (1990). In vivo evaluation of an adenoviral vector encoding canine factor VIII: High-level, sustained expression in hemophilic mice. Hum. Gene Ther. 10, 1791-1802. 54. Chen, H. -H., Mack, L. M., Kelly, R., Ontell, M., Kochanek, S., and Clemens, P. R. (1997). Persistence in muscle of an adenoviral vector that lacks all viral genes, Proc.Natl.Acad.Sci. USA 94, 1645-1650. 55. Bennett, J., Wilson, J., Sun, D., Forbes, B., and Maguire, A. (1994). Adenovirus vector- mediated in vivo gene transfer into adult murine retina. Invest. Ophthalmol. Vis. Sci. 35, 2535-2542. 56. Li, T., Adamian, M., Roof, D. J., Berson, E. L., Dryja, T. P., Roessler, B. J., Davidson, B. L. (1994) In vivo transfer of a reporter gene to the retina mediated by an adenoviral vector. Invest. Ophthalmol. Vis. Sci. 35, 2543-2549. 57. Bennett, J., Tanabe, T., Sun, D., Zeng, Y., Kjeldbye, H., Gouras, P., and Maguire, A. M. (1996). Photoreceptor cell rescue in retinal degeneration (rd) mice by in vivo gene therapy. Nat. Med. 2, 649-654. 58. Anglade, E., and Csaky, K. G. (1998) Recombinant adenovirus-mediated gene transfer into the adult rat retina. Curr. Eye Res. 17, 316-321. 59. da Cruz, L., Robertson, T., Hall, M. O., Constable, I. J., and Rakoczy, P. E. (1998). Cell polarity, phagocytosis and viral gene transfer in cultured human retinal pigment epithelial cells. Curr. Eye Res. 17, 668-672. 60. Akimoto, M., Miyatake, S., Kogishi, J., Hangai, M., Okazaki, K., Takahashi, J. C , Saiki, M., Iw^aki, M., and Honda, Y. (1999). Adenovirally expressed basic fibroblast grov^th factor rescues photoreceptor cells in RCS rats. Invest. Ophthalmol. Vis. Sci. 40, 273-279. 4 4 6 Schiedner ef al. 61. Cayouette, M., and Gravel, C. (1997). Adenovirus-mediated gene transfer of ciliary neu­ rotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse. Hum. Gene Ther. 8, 423-430. 62. Streilein, J. W. (1995). Unraveling immune privilege. Science 270^ 1158-1159. 63. Kumar-Singh, R., Yamashita, C. K., Tran, K., and Farber, D. B. (2000). Construction of encap- sidated (gutted) adenovirus minichromosomes and their application to rescue of photoreceptor degeneration. Methods Enzymol. 316, 724-743. 64. Lem, J., Flannery, J. G., Li, T., Applebury, M. L., Farber, D. B., and Simon, M. I. (1992). Reti­ nal degeneration is rescued in transgenic rd mice by expression of the cGMP phosphodiesterase beta subunit. Proc. Natl. Acad. Set. USA 89, 4422-4426. 65. Cregan, S. P., MacLaurin, J., Gendron, T. F., Callaghan, S. M., Park, D. S., Parks, R. J., Graham, F. L., Morley, P., and Slack, R. S. (2000). Helper-dependent adenovirus vectors: Their use as a gene delivery system to neurons. Gene Ther. 7, 1200-1209. 66. Hassell, J. A., Cukanidin, E., Fey, G., and Sambrook, J. (1978). The structure and expression of two defective adenovirus 2/simian virus 40 hybrids. / . Mol. Biol. 120, 209-247. C H A P T E R Xenogenic Adenoviral Vectors Gerald W. Both Molecular Science CSIRO North Ryde, New South Wales, Australia !• Impetus and Rationale Although human adenoviruses (HAdVs) have been extensively studied over the past four decades, it is only in the past 10 years or so that studies on animal adenoviruses have begun to approach the same level of molecular analysis. This w âs partly driven by the desire to characterize viruses that clearly had very different properties and host ranges compared with HAdV, but it was also recognized that natural infection of human populations would very likely induce a level of immunity that might curtail the effective use of HAdV vectors. Molecular studies of xenogenic AdVs have substantially expanded our knowledge. Understanding their biology will ultimately lead to an increased choice of gene delivery vectors, providing more options in therapeutic strategy and design. IL Classification of Adenoviruses Adenoviruses were classified originally on the basis of serological tests and hemagglutination ability (reviewed in [1, 2] but the availability of genetic data has enhanced the ability to assess viral relatedness. The great majority of AdVs are classified as members of the mastadenovirus genus. This group includes all known human and many AdVs of animal origin. Bovine, porcine, canine, murine, equine, simian, and ovine viruses are all represented, some as multiple serotypes [3]. The genus aviadenovirus has also been known for many years. This group consists exclusively of viruses of avian origin, as the name suggests. Again, multiple serotypes of fowl AdV occur, with the prototype virus being the FAdVl isolate known as CELO. A third group, ADENOVIRAL VECTORS FOR GENE THERAPY AA 7 Copyright 2002, Elsevier Science (USA). • • • * # All rights reserved. 4 4 8 Gerald W. Both proposed as a new genus called the atadenoviruses [4-7], comprises viruses from bovine, ovine, and avian species and, tentatively, viruses from goats, deer, and possum (B. Harrach and D. Thomson and H. Lehmkuhl, pers. commun.). The OAdV7 isolate 287 has been proposed as the prototype of this group [5, 8]. Turkey hemorrhagic enteritis virus (HEV) and frog virus (FrAdVl) may constitute a fourth genus [9]. To assist in defining the potential uses of each vector it is important to understand the host range and biology of each virus. Although some information has been gleaned from genetic data, for the nonmastadenoviruses especially, feŵ studies of the nonstructural viral gene products have been done. III. Factors Affecting Vector Design and Utility A. Host Range and Pathogenicity A driving force behind the development of HAdV vectors w âs the knowledge that they are not associated with significant disease in healthy individuals [1]. The production of defective vectors in complementing cell lines has provided an additional margin of safety [10]. Several of the xenogenic AdVs reviewed here are being adapted for use as vaccine vectors in the homologous host. Thus, it is important that wild-type BAdV3, PAdV3, CAdV2, FAdVl, and OAdV7 cause only mild or subclinical symptoms upon experimental infection of the species from which they were isolated [11-15]. When considering viral host range it is important to distinguish between host range defined by viral replication and host range defined by the ability to transduce cells. Transduction is influenced largely by the interaction between the fiber protein and a primary cellular receptor. Some avi- and mastaden- oviruses have a second fiber protein [16, 17]. The major primary receptor for HAdVs has been identified as Coxsaclcie and adenovirus receptor (CAR) [18, 19]. This is probably also used by SAdVs (Table I) because they grow well in human cells and were propagated in human embryonic kidney 293 cells [20]. For most other xenogenic AdVs no primary receptor has been characterized, nor is it clear whether secondary receptors such as integrins [21] are involved in virus uptake. Indeed, xenogenic AdVs lack identifiable or functionally con­ firmed integrin-binding sequences in their penton proteins [22-27]. For fiber, the coiled coil, trimeric structure of the stalk [28] is conserved, but the distinct sequences of the cell binding domains for the avi and atadenoviruses suggest that they utilize primary receptors that are distinct from CAR. Consistent with this, although HAdV5 and OAdV7 can both infect CSL503 ovine lung cells, they do not compete with each other for entry [29]. CAdV2 is the only xenogenic mastadenovirus that has been examined with respect to cell binding and uptake. Despite the differences between the HAdV5 and CAdV2 capsids 16. Xenogenic Adenoviral Vectors 449 Table 1 Complete Nucleotide Sequences of Xenogenic Adenovirus Vectors Virus type Isolate GenBank Accession No. Canine adenovirus RI261 NC_001734 CAdVl Canine adenovirus Toronto A26/61 U77082 CAdVl Bovine adenovirus WBR-1 AF030154 BAdV3 Porcine adenovirus 6618 AF083132 PAdV3 Murine adenovirus NC_000942 MAdVl Simian adenovirus US patent SAdV21 CI 6,083,176 SAdV25 C68 Fowl adenovirus CELO; Phelps U46933 FAdVl (ATCC VR-432) Fov^l adenovirus ATCC strain A-2A AF083975 FAdV8 Ovine

adenovirus 287 U40839 OAdV7 Duck adenovirus EDS strain 127 Y09598 DAdVl Frog adenovirus VR-896 AF224336 FrAdVl Turkey adenovirus Hemorrhagic AF074946 TAdV3 enteritis virus the kinetics of uptake and trafficking of the two viruses in dog kidney cells was surprisingly similar [30]. CAdV2 shares some features of AdV2/5 tropism but also exhibits distinct characteristics. For example, CAdV2-infected Chinese hamster ovary (CHO) cells that expressed human or mouse CAR but it did not bind to human dendritic cells that were efficiently infected by HAdV5. Uptake of CAdV2 in susceptible cells must be augmented principally by CAR because the Arg-Gly-Asp (RGD) motif that binds to a^^s integrin is absent from the CAdV2 penton. However, CAdV2 also appears capable of binding to other cell surface proteins [31]. Identifying the receptors for xenogenic adenoviruses and defining the mechanisms of virus uptake is important as it will allow target and nontarget cells to be identified, thus suggesting potential uses for each vector. 4 5 0 Gerald W. Both However, it is possible that amino acid variation between a natural viral recep­ tor and its counterpart on heterologous cells may alter virus binding affinity. B. Neutralization HAdVs are ubiquitous in the human population. As a result of natural infection most individuals develop immunity to adenoviruses by the time they reach maturity. Antibodies against multiple serotypes are common [32] and a substantial portion have neutralizing activity [33]. Nonneutralizing antibodies can also bind to virus particles, leading to their indirect inactivation via the com­ plement system [34]. In addition, individuals commonly develop a long-lived CD4+ T-cell response against multiple serotypes of human adenovirus [35] which may mitigate the strategy of using human adenoviruses from alternative serotypes as vectors [36, 37]. Apart from preexisting immunity, administra­ tion of a HAdV at high dose can elicit an inflammatory response [38]. The vector may also induce an immune response that can reduce the efficacy of subsequent doses, although the extent of this effect may vary with the route of administration [39, 40]. A variety of methods have been used to overcome these problems, including transient immunosuppression, blocking of antibod­ ies with agents such as polyethylene glycol and removal of antibodies from serum by immunoapheresis [41, and references therein]. The use of xenogenic adenovirus vectors is expected to avoid neutraliza­ tion due to preexisting immunity to HAdVs. To investigate this, random human sera were examined for the presence of antibodies that neutralized OAdV7 or CAdV2. Of a panel of 57 sera, most of which neutralized HAdV5 to high titer, only three also neutralized CAdV2 [42, 43]. Similarly, 13 individual and two pools of human sera that neutralized HAdV5 did not neutralize OAdV7 [44]. SAdVs were also not neutralized by antisera that neutralized HAdVs [45]. These data suggest that xenogenic adenoviruses will provide an advantage upon initial administration although it is not expected that the vector will be immuno­ logically silent. However, whether vector is given locally or systemically may determine whether it is possible to administer more than a single dose [39, 40]. C. Genome Structure and Function Of the xenogenic mastadenoviruses, complete nucleotide sequences have been determined for bovine (BAdV2 and 3) [24], porcine (PAdV3) [46], murine (MAdVl) [27], canine viruses (CAdVl and 2) [26], and simian viruses [20] (Table I). For the aviadenoviruses, FAdVl [23] was the first genome sequenced but FAdV8 [47] is now also completed. Among the atadenoviruses, ovine (OAdV7) [22], bovine (BAdV4) (B. Harrach, pers. commun.), and duck (DAdVl) [48] genomes are sequenced. The turkey (TAdVl) [49] and frog (FrAdVl) genomes [9] have also been characterized. All of these viruses 1 6 . Xenogenic A d e n o v i r a l Vectors 451 are potential vectors for gene delivery because they can nov^ be rationally engineered, but not all are being developed as vectors at this stage. The viruses described above represent the extreme ranges of genome size, the largest being ^43.8 and 45 kb for FAdVl and FAdV8, respectively, and the smallest being -26 .3 kb for TAdVl and -29 .5 kb for OAdV7. The Mas- tadenovirus genomes range in size from —30.9 (MAdVl) to 34.4 kb (BAdV3). 1. Central Core In comparing the nucleotide sequence for prototype viruses in each genus it is apparent that there is a central core in each genome bounded by the pVIII and IVai genes (Fig. 1). This codes for the DNA replication, structural proteins, and accessory polypeptides required for their assembly. Most capsid proteins have homologs in each genus but proteins V and IX are unique to mastadenoviruses. Instead, OAdV7 has a gene for the structural Rep Gam ,4- dUTPase CU D PVIII fib 1 fib2 P I =11 I a FAdVI D O d Z I pol ca c=3 cz IVa2 22 a I I AVIADENO 2kb I- — - - I E1A E1B IX PVIII E3 fib •=3 PI 31 HAdV5 MASTADENO IVa2 pol E4 Site I I Sites ill II E1B pVlll k• fib DPI I P ii 0AdV7 a D„ 0 D„ ATADENO p32K IVa2 pol ' 1 0 D =3 0 3-1 E4 6-1RH Figure 1 Comparison of the genome structures of prototype viruses from the ovi-, most-, and atadenoviruses. The central core of each genome (filled rectangle) flanked by the IVa2 and pVIII genes is essentially conserved in arrangement and is truncated for simplicity. Other major open reading frames are indicated by open rectangles. Arrows indicate sites for insertion of foreign gene cassettes. The solid and broken lines indicate regions that can be provided in trans and regions that can be deleted, respectively. Note that E4 and E2 sequences have also been deleted in HAdV5 and SAdV vectors but this has not been demonstrated for other xenogenic mastadenoviruses. 4 5 2 Gerald W. Both protein, p32 K, that lies at the extreme left end of the genome (Fig. 1). This capsid protein complement correlates with the observation that FAdVl and OAdV7 are more heat-stable than the mastadenoviruses [50, 51]. It will be of interest to determine whether a functionally equivalent protein exists for the aviadenoviruses. Also in the central core of HAdVs are one or two copies of VA RNA genes [52]. Except for PAdV3 [46] and SAdVs [53], these are not present in xenogenic mastadenoviruses or OAdV7 [54], but a single copy is present near the right-hand end of FAdVl [55] and DAdVl (Fig. 1) [23, 48]. 2. Right-End Sequences To the right of the central core the genomes vary greatly in structure and gene complement. In the mastadenoviruses the E3 region varies in size and complexity but is located between the pVIII and fiber genes (Fig. 1). HAdV2 and —5 have an E3 region of ^2.5 kb that codes for numerous polypeptides, many of which interact with components of the immune system [56]. For the xenogenic mastadenoviruses the least complex E3 region from MAdVl appears to encode a single reading frame that may be variably spliced [57., 58]. BAdVl, —2, and —3, CAdV2, and PAdV3 and —5 have E3 regions of intermediate complexity, ranging in size from ^^1.2 to 2.3 kb. These code for a variable number of putative proteins that show some homology within a species and occasionally across species [59-63]. The BAdV3 E3 codes for a 284-residue glycoprotein and a 14.7-kDa polypeptide that appears to be the homolog of the HAdV5 14.7-kDa protein. The BAdV3 gene can functionally substitute for the human gene to protect cells against tumor necrosis factor (TNF)-induced lysis [62, 64]. E3 sequences are nonessential for replication in vitro [65] and were some of the first sequences deliberately deleted in the construction of recombinant HAdVs [66]. However, it was shown that retention of E3 sequences in a HAdV5 vector dampened the immune response in a rat model, thus extending the time of transgene expression [67]. Consistent with this, a HAdV5 virus in which E3 sequences were deleted showed an enhanced inflammatory response in a Cotton rat model [68]. It remains to be determined whether these results will translate to xenogenic vectors with less complex E3 regions. However, the timing and duration of gene expression that is required is a factor to be considered in vector design. In contrast to the mastadenoviruses, the avi- and atadenoviruses lack E3 regions between pVIII and fiber and instead have small intergenic regions of ^200 and ~400 bp, respectively, that contain signals for transcription termination and splicing of fiber RNA [69]. To the right of the fiber gene in mastadenoviruses lies the E4 region. Like HAdV2/5, a single promoter in BAdV3 and MAdVl produces seven transcripts that encode multiple polypeptides, some of which are homologous to HAdV proteins [70, 71]. In particular, homologs of HAdV5 E4 ORF6 carry a short 16. Xenogenic Adenoviral Vectors 4 5 3 amino acid motif that is highly conserved in many adenoviruses. Based on the conservation of this motif in OAdV7, v^here it w âs first recognized [22], the proposed E4 region in the atadenoviruses is penuhimate to the right end of the genome (Fig. 1). Tw ô promoters apparently control the expression of three open reading frames (ORFs), tv^o of w^hich contain the motif [48, 72]. No E4 region has been identified in the right-hand portion of aviadenoviruses. Indeed, the function of most reading frames in the right hand ~ 2 5 % of the genome remains to be determined. In FAdVl, the products of GAM-1 and ORF22 (Fig. 1) have been identified as proteins that interact w îth pRb [73]. However, in comparing the related FAdVl and FAdV8 genomes, 5 of 13 unassigned ORFs are unique to FAdV8 [74]. At the extreme right hand end of FAdVl are 3 ORFs that can be deleted and replaced v^ith a luciferase reporter gene cassette w^ithout affecting virus viability [51]. The extreme right ends of the avi- and atadenovirus genomes carry genes that are species specific. For example, DAdVl has numerous ORFs of unknov^n function that have no counterpart in OAdV7 [22, 23, 48, 75]. Within the right-hand-end region of OAdV7 lies a series of six short reading frames (RHl to RH6) (Fig. 1), four of which (RHl, - 2 , - 4 , and - 6 ) are closely related to each other. This is surprising in a compact genome of only ^29.6 kb. In DAdVl there are two ORFs that are related to each other and to those in OAdV7 [72, 76]. For OAdV7 only two transcripts from the region were detected by RT-PCR and these were spliced such that RHl and RH6 were the only ORFs that could be translated. The apparent redundancy of these ORFs was confirmed by the fact that the reading frames RH2 to RH5 could be deleted without seriously affecting virus viability [75]. The function of these ORFs remains to be determined. 3. Left End Sequences Left of the central core the genome structures also differ significantly (Fig. 1). For the xenogenic mastadenoviruses there are three ORFs at the left end that show homology with HAdVs [77-80]. The genome packaging signal is also present within the first ^500 nucleotides of the HAdV5 genome [81], but until recently this had not been defined for any xenogenic virus. For CAdV2, however, it was shown that the packaging region consists of a ^200- bp region that contains redundant, but not functionally equivalent sequences. The consensus sequence for HAdVs [81] is present only once and is of minor importance [82]. For the avi and atadenoviruses, some ORFs at the left end are unique to individual viruses or have homologs only within the genus. Two ORFs from the atadenoviruses show some homology with the HAdV5 ElB 19- and 55-kDa genes, suggesting that these functions are conserved. However, no homolog of the El A gene was identified [22,48]. An additional ORE that could encode a ^9.6-kDa protein is present in OAdV7 and BAdV4 (B. Harrach, pers. 4 5 4 Gerald W. Both commun.) but is missing from DAdVl [48]. The gene for the p32 K structural protein is also present near the left end. The promoter for ORFs LHl and LH2 is also on the opposite strand within this gene [72]. The packaging signal for atadenoviruses has not been defined but it may incorporate the ~160-bp region between the C-terminus of p32 K and the ITR. For the aviadenoviruses, ORFs with homologies to dUTPase and the REP protein of adeno-associated virus have

been found [23] but there are distinct differences between FAdVl and FAdV8 with three of eight ORFs in the left end being unique to FAdVS [74]. It was also reported recently [83] that the cysteines and several other residues in the conserved sequence motif of E4 ORF6 are conserved in FAdVl ORF14, which lies near the left end of the genome [23]. 4. Transcription Maps The determination of transcription maps for some xenogenic viruses has assisted vector design by complementing the data on genome structure. The major transcription units have been described for BAdV3 and PAdV3 [24, 46, 71], FAdVl [84] and OAdV7 [72]. No transcription map has been reported for CAdV2. More detailed data is available for the El , E3, and E4 regions of MAdVl [58, 70, 85] and for the BAdV3 El \13, 86] and E3 regions [60]. For BAdV3 and PAdV3, there are minor differences in the splicing pattern within some transcription units but on a broader scale the basic units described for AdV2/5 are completely conserved. Studies of FAdVl identified many transcripts for ORFs in the genome and a major transcription unit that is controlled by the MLP. However, at the left and right ends of the genome there are 5 and 15 kb, respectively, for which the promoters and transcriptional organization is undefined [84]. In the OAdV7 genome, the left (LHl to LH3)- and right-hand ends (RHl to RH6), E2 and the proposed E4 region (E4.1 to E4.3), as well as the structural protein genes constitute individual transcription units. The IVa2 and p32 K ORFs also appear to be transcribed from their own promoters. The LH and E4 regions each appear to be regulated by two promoters [72]. The identification of promoter regions and transcription termination sites has identified possible sites for gene insertion that are less likely to interfere with viral functions. D. Transforming Ability Many AdVs are known to carry oncogenes. Members of the mastaden- oviruses readily transform cells in culture [11, 87-89], although these viruses differ in their ability to induce tumor formation in animals. Among HAdVs, the group A viruses such as AdV12 are highly oncogenic, while group C (including HAdV5) and E viruses are not known to be tumourigenic (reviewed in [2, GS^ 90]). BAdV3 can induce tumor formation in hamsters [91] but there are no reports of tumor induction by other animal mastadenoviruses. FAdVl 16. Xenogenic Adenoviral Vectors 4 5 5 also transforms cell in vitro [92, 93] and rapidly induces tumors in newborn rodents [94, 95], For the atadenoviruses there are conflicting reports of tumor induction in hamsters. In one study, tumor formation was reported in ham­ sters inoculated with BAdV8 [96]. In a second study, none of BAdV4 to -10 produced tumors [97]. More recent studies showed that OAdV7 was unable to transform cells that were transformed by HAdV5 [98]. Primary rat embryo cells were infected with HAdV5 or OAdV7 but only the former produced colonies with a transformed phenotype. Similarly, baby rat kidney cells were transformed by HAdV5 El A/B sequences but not by the nonstructural genes of OAdV7. The apparent absence of oncogenes in the OAdV7 genome suggests that the virus interacts with the cell cycle machinery in a way that differs from the mast and aviadenoviruses, although this is yet to be defined. The presence of oncogenes in vector genomes has important implications for vector design in that it is customary to delete these sequences for safety reasons. Continuous cell lines that express the deleted genes in trans are established to permit virus propagation. The transforming properties of the mastadenoviruses reside primarily in the ElA and ElB genes at the left end of the genome (reviewed in [2, GS^ 90]). The ElA products bind to proteins of the cellular retinoblastoma (pRb) protein family [99], thereby releasing E2F transcription factors that regulate cell cycle progression into S phase [100]. The ElB 55-kDa protein binds to the tumor suppressor protein, p53, and blocks p53-mediated apoptosis [101]. The ElB 19-kDa protein is also anti-apoptotic [102]. Thus, animal adenoviruses typified by BAdV3, PAdV3, CAdV2, SAdV, and MAdVl have ElA and ElB homologs that have similar transforming and oncogenic potential. The E4 ORF3 and ORF6 products of HAdV5 can also augment the transforming activity of the ElA and ElB genes [103-106]. However, the E4 regions of human and animal mastadenoviruses vary in sequence and complexity. Homology with HAdV5 ORF6 is always evident, especially in a cysteine-rich motif [22] that is thought to mediate ORF6/p53 interaction [83]. Furthermore, a complex between the E4 ORF6 and ElB 55-kDa proteins promotes the selective nuclear export of late viral transcripts [107] and references therein). This ORE may be therefore be conserved as it provides a core function for replication in all adenoviruses. However, other E4 ORFs in the xenogenic viruses are unique [22,26,108-110] and their function/transforming potential is not clear. In FAdVl there are no identifiable ElA/B or E4 regions in the genome [23], but recently two proteins, GAM-1 and ORF22, that interact with pRb were identified [73]. In addition, GAM-1 has been identified as an anti- apoptotic protein [111] and one that can activate the cellular heat-shock response, the latter being required for viral replication. The Hsp40 gene is a primary target [112]. GAM-1 may also functionally substitute for the ElB 19 kDa [111]. FAdVl therefore appears to share with the mastadenoviruses an ability to disrupt complexes between pRb and the E2F transcription 4 5 6 Gerald W. Both factors to modulate the cell cycle, albeit via different effector proteins [99, 113]. In contrast, OAdV7, the prototype atadenovirus, lacks an identifiable ElA homolog, although it appears to carry ElB 19- and 55-kDa genes. Penultimate to the right end is a transcription unit that contains a unique ORF (E4.1) of unknown function and two ORFs (E4.2 and E4.3) which contain the conserved ORF6 cysteine-rich motif mentioned above [22, 72, 98]. These ORFs otherwise appear unrelated. Similar features are found in the DAdVl and BAdV4 genomes [48 and B. Harrach, pers. commun.]. However, OAdV7 so far lacks oncogenic activity as the complete OAdV7 genome did not transform primary rodent cells under conditions where transformation was achieved with control HAdV5 sequences [98]. These findings invite the hypothesis that OAdV7 lacks the ability to activate the cell cycle in quiescent cells, instead taking advantage of the cycle as it progresses. The presence or absence of transforming sequences strongly influences the design of xenogenic adenovirus vectors for gene delivery. Based on HAdV2 and —5, vectors derived from BAdV3, PAdV3, SAdV, and CAdV2 were designed such that the potentially oncogenic ElA/B homologs were deleted [20, 42, 43, 114, 115]. A similar approach could be applied to MAdVl [116]. Such vectors are replication-defective in cells lines that do not express the deleted genes [42, 43], but in some cases, homologs from HAdV5 can substitute [114, 115]. Some vectors derived from OAdV7, avian, and PAdV3 viruses retain potential transforming genes and carry foreign DNA inserts in nonessential regions of the genome [51, 75^ 117-120]. This strategy may be acceptable for vectors that are intended for gene delivery in the homologous animal or avian host but is unlikely to be acceptable for gene therapy purposes, except perhaps in the case of OAdV7, where the vector apparently lacks transforming genes. E. Cell Lines Successful rescue of a virus requires a cell line that can be transfected with high efficiency to initiate infection. The cells should also have abundant copies of the primary and secondary receptors to facilitate spread and the production of high titers of virus. Depending on the recombinant, the cells may or may not carry viral sequences to complement a deletion in the viral genome. 1. Primary Cell Lines The general strategy has been to identify a cell line that is permissive for the wild-type virus and then adapt it for more specialized purposes. For prop­ agation of BAdV3, MDBK, buffalo lung, primary kidney, and bovine cornea endothelial cells have all been tried, with MDBK cells being preferred [114, 121]. CAdV2 was grown in MDCK, dog kidney (ATCC CRL6247) or grey­ hound kidney [43, 121], MAdVl in mouse 3T6 [116] and PAdV3 in swine testis cells [115]. FAdVl recombinants were rescued in leghorn male hep­ atoma (LMH) cells [51]. FAdVl can be grown in embryonic chicken kidney 16. Xenogenic Adenoviral Vectors 4 5 7 cells but, for reasons of cost, is often grown in embryonated chicken eggs [23]. OAdV7 has a narrow host range and failed to grow in several ovine cell types [15]. However, it grew to high titre in CSL503 cells, a primary ovine fetal lung cell line [122] and a fetal ovine skin fibroblast line HVO-156 (C. Hofmann and P. Loser, pers. commun.). 2. Transformed Cell Lines Primary cells are adequate for growing replication-competent recombi­ nants. However, there was a need to produce cell lines that would complement genomic deletions and an expectation that transformed cell lines would ensure a continuous supply of cells. This encouraged attempts to develop lines equiv­ alent to 293 cells [123]. Note that SAdVs grow in 293 cells [20]. Based on this and similar precedents [124], the ElA/B sequences of BAdV3 were used to stably transfect MDBK cells [114, 125, 126]. These grew poorly and expressed undetectable amounts of the BAdV3 El proteins [114] but nevertheless com­ plemented the growth of an ElA-deleted HAdV5/lacZ recombinant [114, 125]. Attempts were also made, unsuccessfully, to transfect foetal bovine retinal cells (FBRCs) with BAdV3 ElA/B sequences. Because BAdV3 comple­ mented HAdV5/ElA-defective replication [125], it was expected that HAdV5 ElA/B sequences would complement BAdV3/El deleted vectors. Transfection of FBRCs with HAdV5 ElA/B sequences in which El A and ElB were controlled by the mouse PGK and ElB promoters, respectively, produced morphologically distinct clones, one of which was single-cell cloned and characterized as the VIDO R2 line. These cells expressed detectable levels of El A and ElB 19-kDa, but not ElB 55-kDa protein, supported plaque formation by BAdV3 and HAdV5, and were transfected more efficiently than MDBK cells. Transfection of El-deleted recombinant genomes into VIDO R2 cells resulted in the rescue of several viruses that carried expression cassettes [114]. For propagation of PAdV3 vectors a transformed fetal porcine retinal cell line (VIDO Rl) was also produced by transfection of swine testis cells with HAdV5 El sequences [115]. These cells were also morphologically distinct from the parental cells. ElA and ElB 19-kDa proteins were produced, as shown by Western blots, but ElB 55-kDa protein was not detected. While PAdV3 grew well in these cells, for reasons that are not understood, an E1/E3-deleted vector and a similar virus that carried a GFP cassette in El grew two logs less efficiently [115]. Similarly, the ElA/B region of CAdV2 was used to transform MDBK and DK cells [42]. Again, low levels of ElA transcripts were produced and ElB transcripts were not reliably detected. Nevertheless, the cells were morphologi­ cally and phenotypically distinct from parental MDCK cells. A second series of clones was produced by transfecting DK cells with CAdV2 sequences in which ElA and ElB were controlled by the HCMV and ElB promoters, respectively. Cells produced in this way expressed detectable ElA and ElB transcripts and ElB 19-kDa protein [42] and allowed the rescue and propagation of ElA/B-deleted CAdV2 vectors [43]. 4 5 8 Gerald W. Both Attempts were also made to produce a transformed derivative of CSL503 cells, which are permissive for OAdV7, using the left end (~4 kb) of the OAdV7 genome [9S], The sequences used incorporated the proposed ElB homologs of OAdV7 and a 9.6-kDa ORF of unknown function. No ElA homolog was identified [72, 98]. Only two clones that grew well enough to prepare frozen stocks were obtained and these were morphologically similar to the parental cells. In contrast, transfection of CSL503 cells with HAdV5 ElA/B sequences produced morphologically distinct clones. Growth of OAdV7 in these cell lines appeared to be retarded compared with its growth in wild type CSL503 cells (Xu and Both, unpublished results). F. Strategies for Vector Construction and Rescue A huge amount of work carried out over some 30 years on HAdV2 and —5 has defined viral promoters, transcripts and their splice sites and genes that could be deleted or that would function in trans (reviewed in [2, 65]). The packaging capacity of the viral capsid was also shown to

be ^^105% of the viral genome [127]. The strategic design of bovine, canine, porcine, simian, and murine adenovirus vectors, although based on new genetic information, has drawn extensively on historic precedents. As precedents did not exist for the avi- and atadenoviruses it was necessary to identify intergenic regions within genomic sequences and to use mutagenesis to identify nonessential reading frames for the insertion of gene cassettes. Vector design and virus rescue was also confounded initially by the absence of transcription maps and the lack of knowledge concerning the packaging capacity of these viruses. Construction of xenogenic adenovirus vectors first required the identifi­ cation of an insertion site(s) that could stably accommodate a gene cassette without affecting virus growth. For the mastadenoviruses, vector construction strategies followed those for human Ad vectors. Genes were inserted into the nonessential E3 region of BAdV3 [126, 128] or PAdV3 [118] or between the E4 promoter and the right ITR of PAdV3 [118, 120] to generate viruses that were replication competent in noncomplementing cells. More recently, ElA/B region replacements that generated replication-deficient viruses were produced for BAdV3 [114, 121], PAdV3 [115], SAdV [20], and CAdV2 [42, 43]. It is likely that a similar strategy would be successful for MAdVl where an infec­ tious clone is now available [116]. For the aviadenoviruses, a mutation strategy was used to identify nonessential regions of the genome or regions that could be complemented in trans [51]. Deletions between nucleotides 938 and 2900 were complemented by cotransfection of a plasmid that carried the left hand ^5.5 kb of the genome. Deletion of three ORFs adjacent to the right end of the FAdVl genome did not require transcomplementation, identifying these genes as nonessential for replication in vitro. Similarly, replication-competent FAdV8 16. Xenogenic Adenoviral Vectors 4 5 9 vectors were constructed by inserting a gene cassette into sites near the right end of the genome (Fig. 1) [119]. For the atadenovirus, OAdV7, genes were initially inserted at site I (Fig. 1) in the pVIII and fiber intergenic region [44, 50, IS^ 117, 129], but additional sites were subsequently identified by a mutation strategy. It was found that foreign DNA could be inserted into a unique ?ial\ site (Site II) within ORF RH2, ^\ kb from the right end, and that ORFs in the vicinity could be deleted \1S\. In addition, unique cloning sites were tolerated between the right-hand end and E4 transcription units (Site III) [72, 117]. The identification of permissible insertion sites in the genome required the construction of plasmids that enabled the rescue of infectious viruses. The first BAdV3 recombinant was constructed by recombination between a plasmid that carried BAdV3 sequences flanking the luciferase gene inserted into E3 and BAdV3 genomic DNA that had been cut with fvu\ to reduce background. DNAs were transfected into MDBK cells that also expressed BAdV3 El sequences. However, this method was inefficient and produced relatively few plaques [126]. Similarly, a CAdV2 recombinant that expressed the lacZ gene was produced by recombination between the CAdV2 (Manhattan strain) genome and a plasmid that carried the expression cassette. However, this recombinant was contaminated by wild-type CAdV2 that could not be eliminated [42]. A more favorable approach was to construct a plasmid in which sequences required for the propagation of plasmid DNA in Escherichia coli were cloned into a unique restriction enzyme site that linked the ITRs of the viral genome [117]. There was one precedent for this approach [130], although others had reported that perfect palindromes longer than 30 bp were often unstable in E. coli [131] and plasmids with large palindromes based on HAdV5 were subject to rearrangement [132]. Unique restriction sites were also introduced into appropriate locations in the OAdV7 genome to allow cloning of gene cassettes. This plasmid design allowed the genome to be released intact by restriction enzyme digestion prior to its transfection into susceptible cells for virus rescue [75, 117]. Subsequently, it was discovered that such plasmids could be constructed using recombination in £. coli [133]. Infectious recombinant clones have now been constructed for BAdV3 [71, 114, 134], PAdV3 [118], CAdV2 (Toronto strain) [43], MAdVl [116], FAdVl [51], and OAdV7 [44]. The specific infectivity of these naked DNAs in the permissive cell line is usually low (often only a few plaques per microgram) and depends on the transfection efficiency of the cells. However, a significant advantage of this approach is that transfection of purified plasmid DNA almost invariably yields the corresponding virus without the need for extensive plaque purification that may accompany other approaches where background viruses can be generated. Many xenogenic recombinant viruses have now been rescued. New viruses that first appeared with the formation of plaques or a cytopathic effect in the appropriate transfected cell line were amplified on fresh permissive cells to produce an infectious stock. Viruses were then characterized by restriction 4 6 0 Gerald W. Both enzyme, Southern blot [75,115,118,126], or PCR analysis [43, 51] to confirm the integrity of the genome and expression cassette. For the vectors where an insertion strategy was pursued, it was particularly important to check the genome integrity because the packaging capacity of the new vectors was undefined. Mastadenoviruses can package 105 to ^107% of the wild-type genome [43, 120, 127], OAdV7 has a capacity of 114%, presumably because of its smaller genome and similar capsid volume [75], while the capacity of aviadenoviruses is undefined. Despite the increased packaging capacity of OAdV7, some viral genomes in which expression cassettes (ranging from 1.8 to 3.1 kb) were inserted into site I of the genome proved to be unstable upon passaging. By passage three, the genomic BamHl profile of viruses that combined the HCMV promoter with a reporter gene sometimes displayed smaller fragments [50]. In contrast, a virus that carried 4.3 kb of "stuffer" DNA was successfully rescued [75] and with the RSV promoter, two viruses with site I cassettes in opposite orientations were stable to at least passage four [44; unpublished results]. Site I instability appears to vary with sequence and possibly orientation and may reflect the need to produce adequate amounts of fiber transcript and protein. Events that lead to transgene deletion with improved fiber production may generate viruses that have a growth advantage. The stability after passage of genomes for other xenogenic recombinant vectors has not been adequately reported. The propagation of a mixed population of CAdV2 wild-type and deleted vector [42] illustrated the potential for producing gutless vectors based on xenogenic AdVs. The principles established with HAdV5 [135, 136] will further assist this process. It will be necessary to define the packaging signal [82] and a minimum permissible genome size for a particular virus, provide a suitable a helper virus for propagation, and devise a means to purify defective particles. The benefits may be greater safety and more efficient gene delivery in a naive host and prolonged transgene gene expression. IV. Utility of Xenogenic Vectors Xenogenic AdV vectors can potentially be used as gene delivery vectors for a range of purposes. However, it is necessary to understand the advan­ tages and disadvantages of vectors in particular situations so as to identify their most appropriate uses. The next section discusses the first attempts to determine the safety and utility of xenogenic vectors for vaccination or gene delivery. The following section reviews the properties and behavior of vectors in heterologous situations. A. Veterinary Studies Within the limits of the testing done so far, the viruses discussed in this review are of low pathogenicity in the host from which they were iso­ lated [11-15]. Vectors designed for use in those hosts are often replication 16. Xenogenic Adenoviral Vectors 4 6 1 competent to facilitate vaccination by a live viral vector. In the first studies, carried out v^ith BAdV3, the luciferase reporter v^as inserted directly into the E3 region where a small deletion had been introduced. Expression did not require an exogenous promoter and the vector remained replication competent in bovine cells, although its titer was reduced 10-fold [126]. In contrast to HAdV5 vectors that lacked part of the E3 region [6S]^ this BAdV3 recombi­ nant did not show increased pathogenicity in a Cotton rat model compared with the wild-type virus [137]. Similar replication-competent viruses that car­ ried various forms of the bovine herpesvirus gD gene were shown to express the antigen [71] in an immunogenic form [128]. Intranasal vaccination of calves with these viruses induced gD-specific neutralizing antibodies, primed a cellular immune response and protected against viral challenge, despite the presence of preexisting serum antibodies to BAdV3 [138,139]. El/E3-deleted replication-defective BAdV3 vectors that carried gD in the El region were also constructed [114]. These viruses allowed the parameters for vaccination of cattle by replicating and nonreplicating vectors to be compared. Adminis­ tration of each vector at the same dose twice via the intra tracheal route and once subcutaneously showed that the replication-competent vector induced superior levels of serum IgG antibodies against gD. Partial protection against challenge was obtained with the replication-competent vector. However, with the replication-defective vector challenge with BHVl dramatically boosted the levels of serum IgG and IgA antibodies, suggesting that animals had been primed for gD-specific antibody responses [140]. Similar BAdV3 recombinants were constructed in which the bovine diarrhea virus E2 glycoprotein linked to the BHVl gD signal peptide was expressed from the BAdV3 E3/MLP [141]. The 53-kDa protein that was expressed formed dimers and was recognized by E2 specific monoclonal antibodies. Intranasal immunization of Cotton rats with the recombinant induced E2-specific IgA and IgG responses at mucosal surfaces and in the serum. In contrast, attempts to construct vectors that expressed the bovine coronavirus hemagglutinin esterase gene from the E3 region using the strategy for the BHVl gD gene were unsuccessful. The addi­ tion of exogenous control elements comprising an intron and the HCMV or SV40 promoter increased the level of expression but altered the kinetics. The recombinant virus also replicated less efficiently than wild-type BAdV3 [142]. Replication-competent PAdV3 vectors that express the pseudorabies gD protein or the classical swine fever virus (CSFV) gp55 protein were also constructed. The gD gene was inserted into a partially deleted E3 region without flanking sequences. In contrast to similar BAdV3 vectors, expression of gD was observed at early but not late times pi [118]. The gp55 gene linked to the PAdV3 MLP and tripartite leader sequence (TLS) was inserted at the right end between the ITR and E4 promoter. Vaccination of outbred pigs with a single dose of recombinant virus induced complete protection from lethal challenge with CSFV [120]. 4 6 2 Gerald W. Both A FAdV8 recombinant that expressed chicken gamma interferon from the viral MLP/TLS sequences was also constructed by inserting the cassette at sites near the right end [119]. Depending on the insertion site, the recombinants displayed differing growth characteristics in chicken kidney monolayers. Inser­ tion of the cassette adjacent to FAdV8 ORF7, about 7.2 kb from the right end, produced a recombinant with wild-type growth characteristics. In contrast to the FAdVl viruses discussed below, deletion of the FAdVl 36-kDa homolog in FAdV8 caused a significant reduction in growth. Interferon was produced in supernatants as early as 24 h pi in proportion to the growth characteristics of each virus in vitro. Interferon levels peaked at 48 h and were maintained for at least 10 days. Chickens treated with the recombinant showed increased weight gains compared to controls and suffered reduced weight loss when challenged with a coccidial parasite [119]. An OAdV7 vector was constructed in which the 45 W antigen of Taenia ovis was expressed from the viral MLP/TLS elements [143], the cassette being inserted at site I (Fig. 1) [75]. This vector was used alone, or in tandem with DNA or purified 45W protein to vaccinate sheep. Prime/boost strategies where vaccination was initiated with protein or DNA and boosted with the OAdV7 vector were effective in stimulating an immune response that protected animals against challenge with the parasite [144]. The above examples illustrate that with further refinement, xenogenic vec­ tors may have utility for vaccination and gene delivery in their respective hosts. B. Vector Biology Ideally, vectors for gene transfer into human cells should be capable of transgene expression without replication or detrimental expression of viral genes. Infection of human cell lines with intact xenogenic adenoviruses estab­ lished the principle that these viruses are replication defective at the inputs

tested [42, 51, 76^ 116, 118, 121, 126], although the molecular basis for defective replication is not understood. Studies in animal models have also allowed biodistribution profiles to be determined for some viruses. 1. Transduction of Cells Selected cell lines have been used to examine viral transduction. However, it is sometimes difficult to compare data from different laboratories because, especially in early studies, the input virus was not characterized with respect to both particle number and infectivity. BAdV3 recombinants in which a HCMV/lacZ or HCMV/GFP gene cassette was expressed from the El or E3 region, respectively [114, 121], were used to infect human and other cell types. The GFP recombinant replicated in cells of bovine origin and in Cotton rat lung fibroblasts, but not in cells from other species. When cells were infected with more than 5 pfu/cell of BAdV3/GFP, some GFP expression was observed at 16. Xenogenic Adenoviral Vectors 4 6 3 3 days pi in 293 and HeLa but not in A549 or HepG2 cells [114]. In contrast, others found that at an m.o.i of 10 pfu/cell, at 65 h pi A549 and MRC5 cells were efficiently transduced by a BAdV3/lacZ recombinant while HeLa and 293 and primary human muscle cells were transduced with lower efficiency [121]. Since both studies used the HCMV promoter and a similar multiplicity of infection, the reason for the difference with A549 cells is unclear. The host range of CAdV2 vectors was also investigated. Human 293, HeLa, primary myocyte, and HIB cells were infected with 10^ transduction units of CAdV2/RSVlacZ in the presence of wild-type CAdV2. All cell types showed P-gal expression when examined at 1 to 2 days pi [42]. In addition, replication-deficient CAdV2 vectors expressing GFP or lacZ from the HCMV and RSV promoters, respectively, were tested for their ability to transduce a range of human cell types in comparison with HAdV5/HCMV/GFP [43]. At 2 days pi HeLa, A172, and HT 1080 cells were transduced with similar efficiency by both viruses. In vivo^ the CAdV2 vectors also transduced mouse airway epithelia cells with similar efficiency to a comparable HAdV5 vector. Similarly, a replication-deficient PAdV3 recombinant carrying a HCMV/GFP cassette in El was used to determine the ability of this vector to infect human and animal cells in vitro. At a m.o.i. of 1 pfu/cell PAdV3 apparently entered, but did not replicate in canine kidney, ovine skin fibroblasts, bovine (MDBK), and human (293, A549) cells [115]. Although an infectious clone of MAdVl now exists, recombinant viruses have not yet been made. However, it was demonstrated by RT PCR that human 293 and primary umbilical endothelial cells were infected, the latter at low efficiency [116]. Replication-competent aviadenovirus vectors that express luciferase from the HCMV promoter [51] were constructed by inserting cassettes at the right end of FAdVl to replace nonessential ORFs. Vectors replicated in LMH cells with kinetics similar to wild-type FAdVl. When compared to a HAdV5/luciferase recombinant for its ability to transduce human cell types, the FAdVl recombinant showed a similar ability to express luciferase in HepG2, A549 and primary human fibroblasts [51]. Several recombinants that carried reporter genes at site I of the genome (Fig. 1) were used to investigate the host range of OAdV7 [29, 44, 50, 76,129]. These studies showed that OAdV7 can infect, but not replicate in a variety of human cell types, including breast (MCF7, T47D2) and prostate cancer (PC3), liver carcinoma (HepG2), and retinal (911), foreskin (HFF), and lung (MRC5) fibroblasts [76], Reporter gene expression increased proportionally with the m.o.i. Monkey (COS) and mouse prostate (RMl) cells were also infected efficiently in vitro [50 and unpublished results]. Considering the quite broad host range of OAdV7, it will be of consider­ able interest to identify the receptor(s) that mediates infection. In principle it is also possible to redirect the vector via an alternative receptor as was done for 4 6 4 Gerald W. Both HAdVs [36, 37]. It was shown [29] ttiat ttie cell-binding domain of OAdV7 fiber protein could be replaced with the equivalent binding domain from HAdV5. This was the only change in the viral capsid but it profoundly altered the cell tropism of OAdV7, apparently independent of any integrin/penton RGD interaction, since this motif is absent from OAdV7 [22]. Although the hybrid virus grew less well, this result confirmed that the two viruses use distinct receptors and demonstrated that targeting of xenogenic viruses may be possible. 2. Abortive Replication in Vitro Abortive replication of xenogenic adenoviruses probably reflects viral promoter function in human cell types. The function of early and late BAdV3 promoters in human cells was examined by RT PCR and Southern blot­ ting [121]. In A549 and 293 cells ElA transcripts were detectable for at least 5 days. At very high m.o.i. hexon mRNA was detectable at day 3 in primary human muscle, MRC5 human lung fibroblasts, and nasal septum epithelial cells. It was also shown that CAdV2 replicated to a limited extent in some human cells, as judged by higher virus output compared with input and some expression of capsid proteins. However, this was observed only at the first passage [121]. For human cells infected with OAdV7 at m.o.i. 20 pfu/cell the situation was polarized, depending on the cell type. On the one hand, in MRC5 cells, all early promoters in the genome that were examined were active, as monitored by RT PCR amplification of selected transcripts. On the other hand, in HepG2 liver carcinoma cells, none of the early promoters had detectable activity. In most other cell types, e.g., MCF7 and T47D2 breast cancer and PC3 prostate cells, some promoters, typically E2, were active. Interestingly, in all human cell types tested, and even when the early promoters were active, transcripts from the OAdV7 major late promoter (MLP) could not be detected [72, 76]. This may be related to key events that occur in the transition from early to late protein synthesis. For HAdV2, accumulation of early gene products is not sufficient for MLP activity. DNA replication is also required for late gene expression. High-level transcription from the MLP is further dependent on a c/s-acting change in the viral chromatin [145]. In addition, HAdV2 MLP activity is stimulated by ^mws-activating factors DBP and IVa2 [146-148]. At a gross level there is little or no DNA replication in OAdV7 infected human, compared with permissive ovine cells. However, the OAdV7 E2 promoter was active in several human cell types and large amounts of DBP transcript (and presumably, transcripts for DNA polymerase and Terminal protein) were produced [7G\, Cellular factors also cooperate with viral proteins during genome replication (reviewed in [2]). The apparent absence of DNA replication may be due to the incompatibility of one or more human cell factors with binding sites on the OAdV7 ITR sequences or with other viral proteins involved in the process. There are significant differences 16. Xenogenic Adenoviral Vectors 4 6 5 in putative binding sites for transcription factors between the ITRs of human and xenogenic viruses [149]. The inactivity of the OAdV7 MLP could further be due to a missing trans-actWsiting factor, such as IVa2, whose expression in human cells has not been investigated. Such abortive replication makes it unlikely that conditionally replication-competent vectors [150, 151] based on xenogenic vectors will be developed in the near future. 3. Biodistribution and Persistence in Vivo Few studies on the biodistribution and persistence of xenogenic AdVs in vivo have been reported, but some have been carried out with MAdVl and OAdV7. In the homologous situation, mice were injected intraperitoneally (ip) or intranasally with 10^ pfu of MAdVl and the localization of virus was monitored histologically during acute infection [152]. Endothelial cells of the brain and spinal cord showed extensive evidence of infection. Endothelial cells in lungs, kidneys, and other organs gave a positive signal, indicating a widespread involvement of the systemic circulation. Some lymphoid tissues were also positive. In experiments that examined persistence of OAdV7 it was found that 5 x 1 0 ^ pfu of a recombinant OAdV7 vector injected intravenously (iv) into SCID mice produced hAAT expression that persisted for at least 60 days. However, the same vector dose in BALB/c mice was cleared by 20 days. Thus, the vector did not persist in the normal host and a substantial dose of virus (2 X 10^^ particles) did not cause significant toxicity in normal or immunocompromised animals. The distinct nature of the OAdV7 receptor was reflected in the biodis­ tribution of OAdV7 following iv or ip administration of the vector to mice. OAdV7 was evenly distributed between liver, heart, spleen, and kidney [44], whereas HAdV5 vectors given iv concentrated predominantly in the liver [153]. OAdV7 given via the intraportal vein led to a greater accumulation of vector in the liver, but the vector was still found in all tissues examined [50]. In addition, when virus was injected directly into mouse skeletal muscle, cells were trans­ duced and high levels of hAAT reporter protein were secreted in vivo [129]. By judicious adjustment of the first dose of vector it was shown that a second dose that resulted in substantial reporter gene expression could be given, raising the prospect that the vector may be suitable for prime/boost vaccination strategies. The vector was not detected in liver and spleen, indicating that it did not spread via the circulation. Expression, however, was transient and the vector DNA had essentially disappeared by day 14. Clearance occurred in the absence of detectable OAdV7 gene expression as assayed by RT PCR. As proposed for HAdV5 vectors [154] clearance may occur via presentation of antigen using an MHC class I independent mechanism. Experiments utilizing HAdV5 and OAdV7 recombinants demonstrated a perceived advantage of xenogenic AdV, showing that OAdV7 could deliver a reporter gene in vivo in the face of preexisting antibodies against human 4 6 6 Gerald W. Both HAdV5 [44]. This result was encouraging from a clinical viewpoint and should be mimicked by other xenogenic AdV. It may be possible eventually to use different vectors in tandem to deliver multiple doses of the same gene [155]. C. Gene Therapy Studies To date no gene therapy applications have been reported for xenogenic Adv. However, work is in progress in this laboratory to assess OAdV7 as a gene delivery vector for prostate cancer. The strategy is based on gene- directed enzyme prodrug therapy (GDEPT). This is a two-component cell killing system: a gene that encodes an enzyme not present in mammalian cells and a nontoxic prodrug that is converted to a toxic product by cells that produce the enzyme. Although there are several GDEPT systems [156], in this case purine nucleoside phosphorylase (PNP), an E. colt enzyme, and the prodrug fludarabine are being used [157]. OAdV7 vectors that express the PNP gene under the control of the constitutive RSV, or a tissue-specific prostate promoter, were constructed and tested for cell killing in vitro and in mouse models of prostate cancer. Viruses were injected directly into human PC3 or LN3 tumors grown subcutaneously in nude mice or into mouse RMl tumors grown subcutaneously (sc) in immunocompetent animals. Prodrug was given systemically [158 and Voeks et al (in preparation)]. Evidence of tumor shrinkage and prolongation of mouse survival indicate that this vector and GDEPT system has potential for prostate cancer therapy. This work has also highlighted other important issues that must be addressed for OAdV7, and for xenogenic vectors in general, if they are to be developed for clinical application. These especially include biosafety and vector growth, purification, and scaleup. V. Biosafety Most work with xenogenic vectors is still firmly based in the laboratory and while this is appropriate to demonstrate the utility of a vector the amount of work required for eventual exploitation of a vector in the clinic should not be underestimated. A. Complementation and Recombination Although the xenogenic AdV undergo abortive replication in human cells, one hypothetical situation concerning the clinical application of these vectors is their potential for interaction with opportunistic, replication-competent human adenoviruses in a patient. This may involve complementation of a replication- deficient virus or recombination between genomes to create a hybrid with 16. Xenogenic Adenoviral Vectors 4 6 7 undesirable properties. A priori^ such events seem more likely to occur between viruses that are closely related, particularly if they share a common receptor to facilitate coinfection. Evidence v^as sought for

interaction between HAdV5 and CAdV2. However, coinfection of HeLa or A549 cells with CAdV2 (m.o.i. 10) and HAdV5 (m.o.i. 2) had no effect on the production of CAdV2 over five passages, compared with CAdV2 infection alone. DNA extracted from the cells was also digested and analyzed by Southern hybridization using a whole genome CAdV2 probe to track the DNA and look for the appearance of hybrid genomes. In coinfected HeLa and A549 cells CAdV2 DNA disappeared after one to three passages. HAdV5 DNA became visible by passage four and its restriction enzyme profile was identical to HAdV5 alone. No CAdV2 sequences were detected in these samples by hybridization [121]. Similar experiments have been done to determine whether any pro­ ductive interaction occurred between OAdV7 and HAdV5, a typical human adenovirus. No complementation of OAdV7 replication was detected in the presence of wild-type HAdV5 in MCF 7 cells, although both viruses infect these cells [76] and HAdV5 replicated with high efficiency. Similarly, when DNA from several passages of cells that were coinfected by OAdV7 and HAdV5 was analyzed by Southern blot using whole genome OAdV7 or HAdV5 probes, no hybrid genomes were detected [158a]. Considering the differences in genome structure between the two viruses (Fig. 2), the apparent lack of viable hybrid LHE LHIEIB III pVIII Fiber ixR xp̂ ^ > ^ ^ - • - • 46bp OAdV7 a::::::::::::>-----:-:-:-:-:-:':':-:-;-:v 33.6% ir 4-4- G/C P32 E4? RHE EIAEIBIX III V pVIIIE3 Fiber j^ j^ - • • • > > - • > — • > 103bp HAdV5 Ê 55.2% " E4 G/C Figure 2 Difference map between HAdV2/5 and OAdV7. The stippled rectangles indicate the genomes with distinct G / C content, striped boxes at each end show the ITRs of different length, and sequence and ORFs with bold type are unique. The packaging signal is shown in (^) . 4 6 8 Gerald W. Both virus formation and the absence of complementation was not surprising. First, the G/C content of the two genomes is vastly different, indicating low nucleotide sequence homology. Next, the ITRs of each genome differ in length and sequence, suggesting that neither would be compatible with the DNA replication machinery of the other. Third, each virus has a distinct complement of capsid proteins, including unique proteins and distinct fibers as well as non­ structural genes (Fig. 1). In addition, the packaging signals for each genome are likely to be incompatible. Thus, vectors such as OAdV7 may offer a greater margin of safety over those that are more closely related to HAdVs, such as SAdVs, with respect to potential for unwanted interactions. It is significant, therefore, that no human atadenoviruses have yet been described. B. Oncogenes in Viral and Cellular DNA As discussed above, replication-deficient El-deleted vectors are rescued and propagated in continuous cell lines that were derived from primary cell lines by transformation with adenovirus ElA/B genes [42, 43,114,115]. While this is an advantage for cell growth and virus production it is a disadvantage for downstream processing and purification. Regulatory agencies impose strict limits on the permissible levels of contaminating DNA (10 ng/dose) in purified vector preparations [159]. A rigorous purification process is therefore required to remove potentially oncogenic DNA. Thus, an advantage of OAdV7 vectors is that they grow in a primary fetal ovine lung cell line. The trade-off is that the cells grow more slowly and have a life span of 50 to 70 doublings [122]. Oncogenes must also be removed from the vector genome. This may be more straightforward for the mastadenoviruses, where precedents exist from HAdV2/5 studies, but within this genus some viruses are more oncogenic than others [2, 65] and some ORFs exhibit unexpected transforming proper­ ties [160-162]. Progress toward oncogene identification in FAdVl has also been made [73, 111], but others may exist. Ultimately, the regulatory authori­ ties will require tests to be conducted on the residual oncogenicity of xenogenic vectors prior to clinical application. The apparent lack of transforming ability of OAdV7 in systems that have been used as a benchmark for such assays was therefore encouraging [98]. C. Virus/Cell Interactions Adenoviruses undergo a lytic infection cycle in permissive cells. The mechanism behind cell lysis is not well defined in all cases but for FlAdV5 it is due to the production of a "death protein" late in the infectious cycle [163]. Other mechanisms that may be involved in selective killing of tumor cells are being investigated [164]. These observations highlight the potential for interactions between a virus and a cell that may be undesirable in the context of extended gene expression or from a biosafety perspective. 16. Xenogenic Adenoviral Vectors 4 6 9 Despite the inactivity of its MLP, in some cell types, typified by MRC5 lung fibroblasts, OAdV7 produced an apparent cytopathic effect (CPE) that was limited by the m.o.i. CPE was not due to viral replication because virus passaged twice on MRC5 cells failed to produce CPE in permissive CSL503 cells [76]. Thus, the effect is likely to involve an early gene product. This is currently under investigation. In this regard it is intriguing that the induction of rapid cell death following infection by certain HAdVs appears to be due to an interaction between p53 and the ElB 55-kDa product [164]. The response was abrogated by the absence of either protein due to mutation or lack of expression. Given the many genes of unknown function that exist in the expanding range of xenogenic AdVs the potential to discover other unwanted interactions exists. It may prove necessary to engineer vectors to remove deleterious genes and to grow them in complementing cell lines, but that raises complementation risks. D. Replication Competent Viruses A significant problem with the production of HAdV5 vectors has been the emergence of replication-competent viruses from cells that were designed to prevent their formation. Sequence overlap between the viral vector and integrated genes and subsequent recombination between them has generally been the cause [165]. Thus, PERC6 cells and matching vectors in which sequence overlaps were eliminated were specifically designed to overcome the problem [166]. An advantage offered by the xenogenic vectors is that all of them are replication-deficient in all human cell lines that have been tested. Additional work with particular vectors and cell types to understand the molecular basis for abortive replication would be very helpful in assessing the safety of new vectors. VI . Vector Production and Purification For vector production at the laboratory level the availability of a cell line or egg system [23, 48] for virus rescue and propagation is sufficient. Virus can be purified using methods based on cell lysis and CsCl centrifugation similar to those described for HAdV5 [10, 15, 43, 49, 137]. However, increasing success with a vector brings increasingly stringent requirements as work proceeds toward production for veterinary applications or a clinical trial. Strategic decisions taken early to facilitate subsequent steps in vector development and exploitation could save substantial time and effort later on. A key requirement for vector production is the availability of a cell line that, having been expanded and laid down as master and working cell banks (MCBA)C^CB), is tested and shown to be free of adventitious agents. Attention to detail in the creation and 4 7 0 Gerald W. Both documentation of such a cell line would pay dividends in the long term. A master virus seed stock also needs to be established. This dictates that the viral genome, including the transgene, must be stable upon serial passage such that biological activity and potency are maintained. This stock must also be free of other agents. The issue of vector yield from the WCB should also be considered. For veterinary applications w^here the vector may be replication competent in the host, low^ yields may be less important. Hov^ever, if gene therapy is being considered as an application a purified virus yield of >10'^ particles per cell is probably required for cost effective production of a vector. For clinical applications in particular, a robust scheme for vector purifi­ cation is required. While this might involve CsCl gradient centrifugation to produce quantities of vector for preclinical and perhaps phase I studies, such methodology is unlikely to be appropriate for producing larger amounts of vector. Methods involving chromatography may be more advantageous [167]. It is recognized that the above provides a very brief summary of issues that might be substantial for particular vector systems. How^ever, the intention is to alert the reader contemplating the use of a new^ vector system to the many chal­ lenges that lie ahead in the process of chaperoning it through production and regulatory processes. The correct strategic decisions taken early can facilitate subsequent steps in vector development and exploitation. Acknov^ledgments The author extends his appreciation to the colleagues who provided preprints and infor­ mation that helped to ensure the timeliness and relevance of this chapter and to Pamela Russell and Keith Smith for comments on the manuscript. References 1. Horwitz, M. S. (1996). Adenoviruses. Third ed. In "Fields Virology" (B. N. Fields, D. M. Knipe, and P. M. Howley, Eds.), Vol. 2, pp. 2149-2171. Lippincott-Raven, Philadelphia. 2. Shenk, T. (1996). Adenoviridae: The viruses and their replication. In "Fields Virology" (B. N. Fields, D. M. Knipe, and P. M. Howley, Eds.), 3rd ed. Vol. 2, pp. 2111-2148. Lippincott-Raven, Philadelphia. 3. Benko, M., Harrach, B., and Russell, W. C. (1999). Family adenoviridae. In "Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses" (M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner, Eds.), pp. 227-238. Academic Press, New York, San Diego. 4. Harrach, B., Meehan, B. M., Benko, M., Adair, B. M., and Todd, D. (1997). Close phylogenetic relationship between egg drop syndrome virus, bovine adenovirus serotype 7, and ovine adenovirus strain 287. Virology 229, 302-308. 16. Xenogenic Adenoviral Vectors 4 7 1 5. Benko, M., and Harrach, B. (1998). A proposal for a new (third) genus within the family Adenoviridae. Arch. Virol. 143, 829-837. 6. Dan, A., Ruzsics, Z., Russell, W. C , Benko, M., and Harrach, B. (1998). Analysis of the hexon gene sequence of bovine adenovirus type 4 provides further support for a new adenovirus genus (Atadenovirus)./. Gen. Virol. 79, 1453-1460. 7. Harrach, B., and Benko, M. (1999). Phylogenetic analysis of adenovirus sequences — Proof of the necessity of establishing a third genus in the Adenoviridae family. In "Adenovirus Methods And Protocols" (W. S. M. Wold, Ed.), Vol. 21 , pp. 309-339. Humana Press, Totowa, NJ. 8. Both, G. (2001). Atadenoviruses. In "The Springer Index of Viruses" (C. Tidona, and G. Darai, Eds.), pp. 11-17. Springer-Verlag, Berlin. 9. Davison, A. J., Wright, K. M., and Harrach, B. (2000). DNA sequence of frog adenovirus. / . Gen. Virol. 81,2431-2439. 10. Graham, F. L., and Prevec, L. (1992). Adenovirus based expression vectors and recombinant vaccines. In "Vaccines: New Approaches to Immunological Problems" (R. W. ElHs, Ed.), pp. 363-390. Butterworth-Heinemann, Stoneham, MA. 11. Darbyshire, J. H., Jennings, A. R., Dawson, P. S., Lamont, P. H., and Omar, A. R. (1966). The pathogenesis and pathology of infection in calves with a strain of bovine adenovirus type 3. Res. Vet. Sci. 7, 81-93. 12. Derbyshire, J. B., Clarke, M. C., and Collins, A. P. (1975). Serological and pathogenicity studies with some unclassified porcine adenoviruses./. Comp. Pathol. 85, 437-443. 13. Koptopoulos, G., and Cornwell, H. (1981). Canine adenoviruses: A review. Vet. Bull. 51, 135-142. 14. Cowen, B., Calnek, B. W., Menendez, N. A., and Ball, R. F. (1978). Avian adenoviruses: Effect on egg production, shell quality, and feed consumption. Avian Dis. 22, 459-470. 15. Boyle, D. B., Pye, A. D., Kocherhans, R., Adair, B. M., Vrati, S., and Both, G. W. (1994). Characterisation of AustraUan ovine adenovirus isolates. Vet. Microbiol. 41, 281-291. 16. Kidd, A. H., Chroboczek, J., Cusack, S., and Ruigrok, R. W. H. (1993). Adenovirus Type-40 Virions Contain 2 Distinct Fibers. Virology 192, 73-84. 17. Hess, M., Cuzange, A., Ruigrok, R. W., Chroboczek, J., and Jacrot, B. (1995). The avian adenovirus penton: Two fibres and one base. / . Mol. Biol. 252, 379-385. 18. Tomko, R. P., Xu, R. L., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup

C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA 94, 3352-3356. 19. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 20. Farina, S. F., Fisher, K. J., and Wilson, J. M. (2000). Chimpanzee adenovirus vector useful in gene therapy and genetic engineering in general. US patent 6,083,716. 21. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrin-alpha- v-beta-3 and integrin-alpha-v-beta-5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 22. Vrati, S., Brookes, D. E., Strike, P., Khatri, A., Boyle, D. B., and Both, G. W. (1996). Unique genome arrangement of an ovine adenovirus: Identification of new proteins and proteinase cleavage sites. Virology 220, 186-199. 23. Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V., and Gotten, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. / . Virol. 70, 2939-2949. 24. Reddy, P. S., Idamakanti, N., Zakhartchouk, A. N., Baxi, M. K., Lee, J. B., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1998). Nucleotide sequence, genome organization, and transcription map of bovine adenovirus type 3. / . Virol. 72, 1394-1402. 4 7 2 Gerald W. Both 25. Reddy, P. S., Idamakanti, N., Song, J. Y., Lee, J. B., Hyun, B. H., Park, J. H., Cha, S. H., Tikoo, S. K., and Babiuk, L. A. (1998). Sequence and transcription map analysis of early region-1 of porcine adenovirus type-3. Virus Res. 58, 97-106. 26. Morrison, M. D., Onions, D. E., and Nicolson, L. (1997). Complete DNA sequence of canine adenovirus type 1 . / . Gen. Virol. 78, 873-878. 27. Meissner, J. D., Hirsch, G. N., La Rue, E. A., Fulcher, R. A., and Spindler, K. R. (1997). Completion of the DNA sequence of mouse adenovirus type 1: Sequence of E2B, LI, and L2 (18-51 map units). Virus Res. 51, 53-64. 28. Stouten, P. F. W., Sander, C , Ruigrok, R. W. H., and Cusack, S. (1992). New Triple-Helical Model for the Shaft of the Adenovirus Fibre. / . Mol. Biol. 226, 1073-1084. 29. Xu, Z. Z., and Both, G. W. (1998). Altered tropism of an ovine adenovirus carrying the fiber protein cell binding domain of human adenovirus type 5. Virology 248, 156-163. 30. Chillon, M., and Kremer, E. (2001). Trafficking and propagation of canine adenovirus vectors lacking a known integrin-interacting motif. Hum. Gene Ther. 12, 1815-1823. 31. Soudais, C , Boutin, S., Hong, S., Chillon, M., Danos, O., Bergelson, J., Boulanger, P., and Kremer, E. (2000). Canine adenovirus type 2 attachment and internalization: CAR, alternative receptors and an RGD-independent pathway. / . Virol. 74, 10,639-10,649. 32. D'Ambrosio, E., Del Grosso, N., Chicca, A., and MiduUa, M. (1982). Neutralizing antibodies against 33 human adenoviruses in normal children in Rome. / . Hyg. (London) 89, 155-161. 33. Schulick, A. H., Vassalli, G., Dunn, P. F., Dong, G., Rade, J. J., Zamarron, C , and Dichek, D. A. (1997). Established immunity precludes adenovirus-mediated gene transfer in rat carotid arteries. Potential for immunosuppression and vector engineering to overcome barriers of immunity./. Clin. Invest. 99, 209-219. 34. Cooper, N. (1998). Complement dependent virus neutrafisation. In "The Complement System" (K. Rother, G. Till, and G. Hansch, Eds.), pp. 302-309. Springer Verlag, Berlin-Heidelberg-New York. 35. Flomenberg, P., Piaskowski, V., Truitt, R. L., and Casper, J. T. (1995). Characterization of human proliferative T cell responses to adenovirus. / . Infect. Dis. 171, 1090-1096. [see comments! 36. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck-Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: Cir­ cumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 37. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, L, Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangefi, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 38. Russi, T. J., Hirschowitz, E. A., and Crystal, R. G. (1997). Delayed-type hypersensitivity response to high doses of adenoviral vectors. Hum. Gene Ther. 8, 323-330. 39. Bramson, J. L., Hitt, M., Gauldie, J., and Graham, F. L. (1997). Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther. 4, 1069-1076. 40. Harvey, B. G., Hackett, N. R., El Sawy, T., Rosengart, T. K., Hirschowitz, E. A., Lieber- man, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs./. Virol. 73, 6729-6742. 41. Chen, Y., Yu, D. C , Charlton, D., and Henderson, D. R. (2000). Pre-existent adenovirus antibody inhibits systemic toxicity and antitumor activity of CN706 in the nude mouse LNCaP xenograft model: ImpUcations and proposals for human therapy. Hum. Gene Ther. 11,1553-1567. 16. Xenogenic Adenoviral Vectors 4 7 3 42. Klonjkowski, B., Gilardi-Hebenstreit, P., Hadchouel, J., Randrianarison, V., Boutin, S., Yeh, P., Perricaudet, M., and Kremer, E.J. (1997). A recombinant El-deleted canine adenoviral vector capable of transduction and expression of a transgene in human-derived cells and in vivo. Hum. Gene Ther. 8, 2103-2115. [see comments] 43. Kremer, E. J., Boutin, S., Chillon, M., and Danos, O. (2000). Canine adenovirus vectors: An alternative for adenovirus-mediated gene transfer./. Virol. 74, 505-512. 44. Hofmann, C , Loser, P., Cichon, G., Arnold, W., Both, G. W., and Strauss, M. (1999). Ovine adenovirus vectors overcome preexisting humoral immunity against human adenoviruses in vivo. / . Virol. 73, 6930-6936. 45. Wigand, R., Mauss, M., and Adrian, T. (1989). Chimpanzee adenoviruses are related to four subgenera of human adenoviruses. Intervirology 30, 1-9. 46. Reddy, P. S., Idamakanti, N., Song, J. Y., Lee, J. B., Hyun, B. H., Park, J. H., Cha, S. H., Bae, Y. T., Tikoo, S. K., and Babiuk, L. A. (1998). Nucleotide sequence and transcription map of porcine adenovirus type 3. Virology 251, 414-426. 47. Ojkic, D., and Nagy, E. (2000). The complete nucleotide sequence of fowl adenovirus type 8. / . Gen. Virol 81, 1833-1837. 48. Hess, M., Blocker, H., and Brandt, P. (1997). The complete nucleotide sequence of the egg drop syndrome virus: An intermediate between mastadenoviruses and aviadenoviruses. y/ro/og}/238, 145-156. 49. Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Shmueli, E., Peretz, Y., Gutter, B., Gallih, G. E., Michael, A., and Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, hemorrhagic enteritis virus. Virology 249, 307-315. 50. Loser, P., Cichon, G., Jennings, G., Both, G., and Hofmann, C. (1999). Ovine adenovirus vectors promote efficient gene delivery in vivo. Gene Ther. Mol. Biol. 4, 33-43 . 51. Michou, A. I., Lehrmann, H., Saltik, M., and Gotten, M. (1999). Mutational analysis of the avian adenovirus CELO, which provides a basis for gene delivery vectors. / . Virol. 73, 1399-1410. 52. Ma, Y., and Mathews, M. B. (1993). Comparative analysis of the structure and function of adenovirus virus-associated RNAs./. Virol. 67, 6605-6617. 53. Kidd, A. H., Garwicz, D., and Oberg, M. (1995). Human and simian adenoviruses: Phylogenetic inferences from analysis of VA RNA genes. Virology 207, 32-45 . 54. Venktesh, A., Watt, F., Xu, Z. Z., and Both, G. W. (1998). Ovine adenovirus (OAV287) lacks a virus-associated RNA gene./. Gen. Virol. 79, 509-516. 55. Larsson, S., Bellett, A., and Akusjarvi, G. (1986). VA RNAs from avian and human adenoviruses: Dramatic differences in length, sequence, and gene location. / . Virol. 58, 600-609. 56. Wold, W. S. M., and Gooding, L. R. (1991). Region E3 of adenovirus: A cassette of genes involved in host immunosurveillance and virus-cell interactions. Virology 184, 1-8. 57. Raviprakash, K. S., Grunhaus, A., el Kholy, M. A., and Horwitz, M. S. (1989). The mouse adenovirus type 1 contains an unusual E3 region./. Virol. 63, 5455-5458. 58. Beard, C. W., Ball, A. O., Wooley,E. H., and Spindler, K. R. (1990). Transcription mapping of mouse adenovirus type 1 early region 3. Virology 175, 81-90. 59. Esford, L. E., and Haj-Ahmad, Y. (1994). Sequence analysis of the putative E3 region of bovine adenovirus type 2. Intervirology 37, 277-286. 60. Evans, P. S., Benko, M., Harrach, B., and Letchworth, G.J. (1998). Sequence, transcriptional analysis, and deletion of the bovine adenovirus type 1 E3 region. Virology 244, 173-185. 61. Reddy, P. S., Idamakanti, N., Derbyshire, J. B., and Nagy, E. (1996). Porcine adenoviruses types 1, 2 and 3 have short and simple early E-3 regions. Virus Res. 43, 99-109. 62. Idamakanti, N., Reddy, P. S., Babiuk, L. A., and Tikoo, S. K. (1999). Transcription mapping and characterization of 284R and 12IR proteins produced from early region 3 of bovine adenovirus type 3. Virology 256, 351-359. 4 7 4 Gerald W. Both 63. Tuboly, T., and Nagy, E. (2000). Sequence analysis and deletion of porcine adenovirus serotype 5 E3 region. Virus Res. 68, 109-117. 64. Zakhartchouk, A., Godson, D., Babiuk, L., and Tikoo, S. (2001). 121R protein from the E3 region of bovine adenovirus-3 inhibits cytolysis of mouse cells by human TNF. Intervirol. 44 ,29 -35 . 65. Horwitz, M. S. (1990). Adenoviridae and their replication. In "Virology" (B. N. Fields, and D. M. Knipe, Eds.), 2nd ed., pp. 1679-1721. Raven Press, New York. 66. Morin, J. E., Lubeck, M. D., Barton, J. E., Conley, A. J., Davis, A. R., and Hung, P. P. (1987). Recombinant adenovirus induces antibody responses to hepatitis B virus surface antigen in hamsters. Proc. Natl. Acad. Sci. USA 84, 4626-4630. 67. Ilan, Y., Droguett, G., Chowdhury, N. R., Li, Y. A., Sengupta, K., Thummala, N. R., Davidson, A., Chov^dhury, J. R., and Horwitz, M. S. (1997). Insertion of the adenovi­ ral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression. Proc. Natl. Acad. Sci. USA 94, 2587-2592. 68. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., Pernis, B., Wold, W. S. M., Chanock, R. M., and Prince, G. A. (1989). Role of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. Sci. USA 86, 3823-3827. 69. Vrati, S., Boyle, D., Kocherhans, R., and Both, G. W. (1995). Sequence of ovine adenovirus homologs for 100 K hexon assembly, 33 K, pVIII, and fiber genes: Early region E3 is not in the expected location. Virology 209, 400-408. 70. Kring, S. C., Ball, A. O., and Spindler, K. R. (1992). Transcription mapping of mouse adenovirus Type-1 early region-4. Virology 190, 248-255. 71. Baxi, M. K., Babiuk, L. A., MehtaU, M., and Tikoo, S. K. (1999). Transcription map and expression of bovine herpesvirus-1 glycoprotein D in early region 4 of bovine adenovirus-3. V/ro/og); 261, 143-152. 72. Khatri, A., and Both, G. W. (1998). Identification of transcripts and promoter regions of ovine adenovirus OAV287. Virology 245, 128-141. 73. Lehrmann, H., and Gotten, M. (1999). Characterization of CELO virus proteins that modulate the pRb/E2F pathway./. Virol. 73, 6517-6525. 74. Cao, J. X., Krell, P. J., and Nagy, E. (1998). Sequence and transcriptional analysis of terminal regions of the fowl adenovirus type 8 genome./. Gen. Virol. 79, 2507-2516. 75. Xu, Z. Z., Hyatt, A., Boyle, D. B., and Both, G. W. (1997). Construction of ovine ade­ novirus recombinants by gene insertion or deletion of related terminal region sequences. V/ro/og}; 230, 62 -71 . 76. Khatri, A., Xu, Z. Z., and Both, G. W. (1997). Gene expression by atypical recombinant ovine adenovirus vectors during abortive infection of human and animal cells in vitro. Virology 239, 226-237. 77. Kleiboeker, S. B. (1995). Identification and sequence analysis of the El genomic region of a porcine adenovirus. Virus Res. 36, 259-268. 78. Elgadi, M., Rghei, N., and Haj-Ahmad, Y. (1993). Sequence and sequence analysis of El and pIX regions of the BAV3 genome. Intervirology 36, 113-120. 79. Reddy, P. S., Chen, Y., Idamakanti, N., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1999). Characterization of early region 1 and pIX of bovine adenovirus-3. Virology 253,299-308. 80. Aggarwal, N., and Mittal, S. K. (2000). Sequence analysis of porcine adenovirus type 3 El region, pIX and pIVa2 genes,

and two novel open reading frames (Vol 43, pg 6, 2000). Intervirology 43, 128. 81. Schmid, S. I., and Hearing, P. (1998). Cellular components interact with adenovirus type 5 minimal DNA packaging domains./. Virol. 72, 6339-6347. 82. Soudais, C , Boutin, S., and Kremer, E. (2001). Characterisation of cis-acting sequences involved in the canine adenovirus packaging domain. Mol. Ther. 3, 631-640. 16. Xenogenic Adenoviral Vectors 4 7 5 83. Nevels, M., Rubenwolf, S., Spruss, T., Wolf, H., and Dobner, T. (2000). Two distinct activities contribute to the oncogenic potential of the adenovirus type 5 E4orf6 protein. / . V/Vo/. 74,5168-5181. 84. Payet, V., Arnauld, C , Picault, J. P., Jestin, A., and Langlois, P. (1998). Transcriptional organization of the avian adenovirus CELO./. Virol. 72, 9278-9285. 85. Ball, A. O., Beard, C. W., Redick, S. D., and Spindler, K. R. (1989). Genome organization of mouse adenovirus type 1 early region 1: A novel transcription map. Virology 170, 523-536. 86. Zheng, B. J., Graham, F. L., and Prevec, L. (1999). Transcription units of Ela, Elb and pIX regions of bovine adenovirus type 3. / . Gen. Virol. 80, 1735-1742. 87. McAllister, R., Nicolson, M., Levels AM, J., Macpherson, I., and Huebner, R. (1969). Transformation of rat embryo cells by adenovirus type 1. / . Gen. Virol. 4, 29-36. 88. Trentin, J. J., Yabe, Y., and Taylor, G. (1962). The quest for human cancer viruses. Science 137, 835. 89. Kinjo, T., Nishi, T., and Yanagawa, R. (1969). In vitro transformation of hamster cells by infectious canine hepatitis virus. Jpn. J. Vet. Res. 17, 128-135. 90. Flint, S. (1980). Cell transformation induced by adenoviruses. In "DNA Tumor Viruses" (J. Tooze, Ed.), 2nd ed. Part 2, pp. 574-576. Cold Spring Harbor Press, Cold Spring Harbor, NY. 91. Darbyshire, J. (1966). Oncogenicity of bovine adenovirus type 3 in hamsters. Nature 211, 102. 92. Anderson, J., Yates, V. J., Jasty, V., and Mancini, L. O. (1969). In vitro transformation by an avian adenovirus (CELO). I. Hamster-embryo fibroblastic cultures./. Natl. Cancer Inst. 42, 1-7. 93. Anderson, J., Yates, V. J., Jasty, V., and Mancini, L. O. (1969). In vitro transformation by an avian adenovirus (CELO). 11. Hamster kidney cell cultures. / . Natl. Cancer Inst. 43, 65-70. 94. Sarma, P. S., Huebner, R. J., and Lane, W. T. (1965). Induction of tumors in hamsters with an avian adenovirus (CELO), Science 149, 1108. 95. Mancini, L. O., and Yates, V. J. (1973). Attempts to produce tumors in mice with CELO virus. Arch. Gesamte Virusforsch. 40, 174-175. 96. Rondhuis, P. R. (1973). Induction of tumors in hamsters with a bovine adenovirus strain (serotype 8). Arch. Gesamte Virusforsch. 41, 147-149. 97. Mohanty, S. B. (1971). Comparative study of bovine adenoviruses. Am. J. Vet. Res. 32, 1899-1905. 98. Xu, Z. Z., Nevels, M., MacAvoy, E. S., Lockett, L. J., Curiel, D., Dobner, T., and Both, G. W. (2000). An ovine adenovirus vector lacks transforming ability in cells that are transformed by AD5 ElA/B sequences. Virology 270, 162-172. 99. Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M., Weinberg, R. A., and Harlow, E. (1988). Association between an oncogene and an anti-oncogene: The adenovirus El A proteins bind to the retinoblastoma gene product. Nature 334, 124-129. 100. Nevins, J. R. (1992). E2F: A link between the Rb tumor suppressor protein and viral oncoproteins. Science 258, 424-429. 101. White, E. (1998). Regulation of apoptosis by adenovirus ElA and ElB oncogenes, Sem. Virol. 8, 505-513, 102. Rao, L., Debbas, M,, Sabbatini, P., Hockenbery, D., Korsmeyer, S., and White, E. (1992). The adenovirus ElA proteins induce apoptosis, which is inhibited by the ElB 19-kDa and Bcl-2 proteins. Proc. Natl. Acad. Sci. USA 89, 7742-7746. 103. Moore, M., Horikoshi, N., and Shenk, T. (1996). Oncogenic potential of the adenovirus E4orf6 protein, Proc. Natl. Acad. Sci. USA 93, 11,295-11,301. 4 7 6 Gerald W. Both 104. Nevels, M., Rubenwolf, S., Spruss, T., Wolf, H., and Dobner, T. (1997). The adenovirus E4orf6 protein can promote ElA/ElB-induced focus formation by interfering with p53 tumor suppressor function. Proc. Natl. Acad. Set. USA 94, 1206-1211. 105. Nevels, M., Spruss, T., Wolf, H., and Dobner, T. (1999). The adenovirus E4orf6 protein contributes to malignant transformation by antagonizing ElA-induced accumulation of the tumor suppressor protein p53. Oncogene 18, 9-17. 106. Nevels, M., Tauber, B., Kremmer, E., Spruss, T., Wolf, H., and Dobner, T. (1999). Transforming potential of the adenovirus type 5 E4orf3 protein. / . Virol. 73, 1591-1600. 107. Dobbelstein, M., Roth, J., Kimberly, W. T., Levine, A. J., and Shenk, T. (1997). Nuclear export of the ElB 55-kDa and E4 34-kDa adenoviral oncoproteins mediated by a rev-like signal sequence. EMBO J. 16, 4276-4284. 108. Ball, A. O., Beard, C. W., Villegas, P., and Spindler, K. R. (1991). Early region 4 sequence and biological comparison of two isolates of mouse adenovirus type 1. Virology 180, 257-265. 109. Reddy, P. S., Idamakanti, N., Derbyshire, J. B., and Nagy, E. (1997). Characterization of the early region 4 of porcine adenovirus type 3. Virus Genes 15, 87-90. 110. Lee, J. B., Baxi, M. K., Idamakanti, N., Reddy, P. S., Zakhartchouk, A. N., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1998). Genetic organization and DNA sequence of early region 4 of bovine adenovirus type 3. Virus Genes 17, 99-100. 111. Chiocca, S., Baker, A., and Gotten, M. (1997). Identification of a novel antiapoptotic protein, GAM-1, encoded by the GELO adenovirus./. Virol. 71, 3168-3177. 112. Glotzer, J. B., Saltik, M., Ghiocca, S., Michou, A. I., Moseley, P., and Gotten, M. (2000). Activation of heat-shock response by an adenovirus is essential for virus replication. Nature 407,207-211 . 113. Kovesdi, I., Reichel, R., and Nevins, J. R. (1987). Role of an adenovirus E2 promoter binding factor in ElA-mediated coordinate gene control. Proc. Natl. Acad. Sci. USA 84, 2180-2184. 114. Reddy, P. S., Idamakanti, N., Ghen, Y., Whale, T., Babiuk, L. A., Mehtah, M., and Tikoo, S. K. (1999). Replication-defective bovine adenovirus type 3 as an expression vector. / . Virol. 73, 9137-9144. 115. Reddy, P. S., Idamakanti, N., Babiuk, L. A., Mehtali, M., and Tikoo, S. K. (1999). Porcine adenovirus-3 as a helper-dependent expression vector. / . Gen. Virol. 80, 2909-2916. 116. Nguyen, T. T., Nery, J. P., Joseph, S., Rocha, G. E., Garney, G. E., Spindler, K. R., and Vil- larreal, L. P. (1999). Mouse adenovirus (MAV-1) expression in primary human endotheHal cells and generation of a full-length infectious plasmid. Gene Ther. 6, 1191-1197. 117. Vrati, S., Macavoy, E. S., Xu, Z. Z., Smole, G., Boyle, D. B., and Both, G. W. (1996). Gonstruction and transfection of ovine adenovirus genomic clones to rescue modified viruses. Virology 110, 200 -3 . 118. Reddy, P. S., Idamakanti, N., Hyun, B. H., Tikoo, S. K., and Babiuk, L. A. (1999). Devel­ opment of porcine adenovirus-3 as an expression vector. / . Gen. Virol. 80, 563-570. 119. Johnson, M. A., Pooley, G., and Lowenthal, J. W. (2000). Delivery of avian cytokines by adenovirus vectors. Dev. Comp. Immunol. 24, 343-354. 120. Hammond, J. M., McGoy, R. J., Jansen, E. S., Morrissy, G. J., Hodgson, A. L., and John­ son, M. A. (2000). Vaccination with a single dose of a recombinant porcine adenovirus expressing the classical swine fever virus gp55 (E2) gene protects pigs against classical swine fever. Vaccine 18, 1040-1050. 121. Rasmussen, U. B., Benchaibi, M., Meyer, V., Schlesinger, Y., and Schughart, K. (1999). Novel human gene transfer vectors: Evaluation of wild-type and recombinant animal adenoviruses in human-derived cells. Hum. Gene Ther. 10, 2587-2599. 122. Pye, D. (1989). Gell lines for growth of sheep viruses. Aust. Vet. J. 66, 231-232. 123. Graham, F. L., Smiley, J., Russell, W. G., and Nairn, R. (1977). Gharacteristics of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-72. 16. Xenogenic Adenoviral Vectors 4 7 7 124. Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houweling, A., van Ormondt, H., Hoeben, R. C , and van der Eb, A. J. (1996). Characterization of 911: A nev^ helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Hum. Gene Ther. 7, 215-222. 125. Zheng, B., Mittal, S. K., Graham, F. L., and Prevec, L. (1994). The El sequence of bovine adenovirus type 3 and complementation of human adenovirus type 5 ElA function in bovine cells. Virus Res. 31, 163-186. 126. Mittal, S. K., Prevec, L., Graham, F. L., and Babiuk, L. A. (1995). Development of a bovine adenovirus type 3-based expression vector./. Gen. Virol. 76, 93-102. 127. Bett, A. J., Prevec, L., and Graham, F. L. (1993). Packaging capacity and stability of human adenovirus type- 5 vectors./. Virol. 67, 5911-5921. 128. Zakhartchouk, A. N., Reddy, P. S., Baxi, M., Baca-Estrada, M. E., Mehtali, M., Babiuk, L. A., and Tikoo, S. K. (1998). Construction and characterization of E3-deleted bovine adenovirus type 3 expressing full-length and truncated form of bovine herpesvirus type 1 glycoprotein gD. Virology 250, 220-229. 129. Loser, P., Hillgenberg, M., Arnold, W., Both, G. W., and Hofmann, C. (2000). Ovine aden­ ovirus vectors mediate efficient gene transfer to skeletal muscle. Gene Ther. 7, 1491-1498. 130. Hanahan, D., and Gluzman, Y. (1984). Rescue of functional replication origins from embedded configurations in a plasmid carrying the adenovirus genome. Mol. Cell. Biol. 4, 302-309. 131. Leach, D. R., and Stahl, F. W. (1983). Viability of lambda phages carrying a perfect palindrome in the absence of recombination nucleases. Nature 305, 448-451. 132. Graham, F. L. (1984). Covalently closed circles of human adenovirus DNA are infectious. £ M B O / . 3,2917-2922. 133. Chartier, C , Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A., and Mehtali, M. (1996). Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coH. / . Virol. 70, 4805-4810. 134. van Olphen, A. L., and Mittal, S. K. (1999). Generation of infectious genome of bovine adenovirus type 3 by homologous recombination in bacteria. / . Virol. Methods 77, 125-129. 135. Morsy, M. A., Gu, M. C , Motzel, S., Zhao, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F. L,, Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 136. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proc. Natl. Acad. Sci. USA 93, 5731-5736. 137. Mittal, S. K., Middleton, D. M., Tikoo, S. K., Prevec, L., Graham, F. L., and Babiuk, L. A. (1996). Pathology and immunogenicity in the cotton rat (Sigmodon hispidus) model after infection with a bovine adenovirus type 3 recombinant virus expressing the firefly luciferase gene./. Gen. Virol. 77, 1-9. 138. Zakhartchouk, A. N., Pyne, C , Mutwiri, G. K., Papp, Z., Baca-Estrada, M. E., Griebel, P., Babiuk, L. A., and Tikoo, S. K. (1999). Mucosal immunization of calves with recombinant bovine adenovirus-3: Induction of protective immunity to bovine herpesvirus-1. / . Gen. Virol. 80, 1263-1269. 139. Babiuk, L. A., and Tikoo, S. K. (2000). Adenoviruses as vectors for delivering vaccines to mucosal surfaces./. Biotechnol. 83, 105-113. 140. Reddy, P., Idamakanti, N., Pyne, C , Zakhartchouk, A., Godson, D., Papp, Z., Baca- Estrada, M., Babiuk, L., Mutwiri, G., and Tikoo, S. (2000). The immunogenicity and efficacy of replication-defective and replication-competent bovine adenovirus-3 expressing bovine herpes-1 glycoprotein gD in cattle. Vet. Immunol. Immunopathol. 76, 267-268. 4 7 8 Gerald W. Both 141. Baxi, M., Deregt, D., Robertson, J., Babiuk, L., Schlapp, T., and Tikoo, S. (2000). Recombinant bovine adenovirus type 3 expressing bovine diarrhea virus glycoprotein E2 induces an immune response in cotton rats. Virology 278, 234-243. 142. Reddy, P., Idamakanti, N., Zakhartchouk, A., Babiuk, L., Mehtali, M., and Tikoo, S. (2001). Optimization of bovine coronavirus hemagglutinin-esterase glycoprotein expression in E3 deleted bovine adenovirus 3. Virus Res. 70, 65-73 . 143. Vrati, S., Brookes, D. E., Boyle, D. B., and Both, G. W. (1996). Nucleotide sequence of ovine adenovirus tripartite leader sequence and homologues of the IVa2, DNA polymerase and terminal proteins. Gene 177, 35 -41 . 144. Rothel, J. S., Boyle, D. B., Both, G. W., Pye, A. D., Waterkeyn,

J. G., Wood, P. R., and Lightow^lers, M. W. (1997). Sequential nucleic acid and recombinant adenovirus vaccination induces host-protective immune responses against Taenia ovis infection in sheep. Parasite Immunol \9,111-117. 145. Thomas, G., and Mathews, M. (1980). DNA replication and the early to late transition in adenovirus infection. Cell 22, 523-533. 146. Tribouley, C., Lutz, P., Staub, A., and Kedinger, C. (1994). Product of the adenovirus intermediate gene IVa2 is a transcriptional activator of the major late promoter. / . Virol. 68, 4450-4457. 147. Zijderveld, D. C., Difagagna, F. D., Giacca, M., Timmers, H. T. M., and van der Vhet, P. C. (1994). Stimulation of the adenovirus major late promoter in vitro by transcription factor USE is enhanced by the adenovirus DNA binding protein. / . Virol. 68, 8288-8295. 148. Chang, L.-S., and Shenk, T. (1990). The adenovirus DNA-binding protein stimulates the rate of transcription directed by adenovirus and adeno-associated virus promoters. / . Virol. 64,2103-2109. 149. Dan, A., Elo, P., Harrach, B., Zadori, Z., and Benko, M. (2001). Four new inverted terminal repeat sequences from bovine adenoviruses reveal striking differences in the length and content of ITRs. Virus Genes 22, 175-179. 150. Bischoff, J. R., Kim, D. H., Williams, A., Heise, C., Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick, F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-376. 151. Rodriguez, R., Schuur, E. R., Lim, H. Y., Flenderson, G. A., Simons, J. W., and Henderson, D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559-2563. 152. Kajon, A. E., Brown, C. C., and Spindler, K. R. (1998). Distribution of mouse adenovirus type 1 in intraperitoneally and intranasally infected adult outbred mice. / . Virol. 71, 1219-1223. 153. Smith, T. A. G., Mehaffey, M. G., Kayda, D. B., Saunders, J. M., Yei, S., Trapnell, B. C., McClelland, A., and Kaleko, M. (1993). Adenovirus mediated expression of therapeutic plasma levels of human factor IX in mice. Nat. Genet. 5, 397-402. 154. Kafri, T., Morgan, D., Krahl, T., Sarvetnick, N., Sherman, L., and Verma, I. (1998). Cellular immune response to adenoviral vector infected cells does not require de novo viral gene expression: Implications for gene therapy. Proc. Natl. Acad. Sci. USA 95, 11,377-11,382. 155. Moffatt, S., Hays, J., HogenEsch, H., and Mittal, S. K. (2000). Circumvention of vector- specific neutralizing antibody response by alternating use of human and non-human adenoviruses: Implications in gene therapy. Virology 171, 159-167. 156. Aghi, M., Hochberg, F., and Breakefield, X. O. (2000). Prodrug activation enzymes in cancer gene therapy. / . Gene Med. 2, 148-164. 157. Sorscher, E. J., Peng, S., Bebok, Z., Allan, P. W., Bennett, L. L., Jr., and Parker, W. B. (1994). Tumor cell bystander killing in colonic carcinoma utilizing the Escherichia coli DeoD gene to generate toxic purines. Gene Ther. 1, 233-238. 16. Xenogenic Adenoviral Vectors 4 7 9 158. Martiniello-Wilks, R., Garcia-Aragon, J., Daja, M. M., Russell, P., Both, G. W., MoUoy, P. L., Lockett, L. J., and Russell, P.J. (1998). In vivo gene therapy for prostate cancer: Preclinical evaluation of two different enzyme-directed prodrug therapy systems delivered by identical adenovirus vectors. Hum. Gene Ther. 9, 1617-1626. 158a. Lockett, L. J., and Both, G. W. (2002). Complementation of a defective human adenovirus by an otherwise incompatible ovine adenovirus recombinant carrying a functional El A gene. Virology, in press. 159. Brown, F., et al. (Eds.) (1998). "WHO Requirements for the Use of Animal Cells as in Vitro Substrates for the Production of Biologicals. Safety of Biological Products Prepared from Mammalian Cell Culture," Vol. 93. Basel, Karger. 160. Yamashita, T., Ren, C. S., Yoshida, K., Shinagawa, M., Masuda, K., and Fujinaga, K. (1985). Two distinctive transforming DNA regions on the canine adenovirus type 1 genome. Jpn. J. Cancer Res. 76, 436-440. 161. Weiss, R. S., Lee, S. S., Prasad, B. V., and Javier, R. T. (1997). Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes./. Virol. 71, 1857-1870. 162. Thomas, D. L., Shin, S., Jiang, B. H., Vogel, H., Ross, M. A., Kaplitt, M., Shenk, T. E., and Javier, R. T. (1999). Early region 1 transforming functions are dispensable for mammary tumorigenesis by human adenovirus type 9 . / . Virol. 73, 3071-3079. 163. Tollefson, A. E., Ryerse, J. S., Scaria, A., Hermiston, T. W., and Wold, W. S. M. (1996). The E3-11.6-kDa adenovirus death protein (ADP) is required for efficient cell death: Characterization of cells infected with adp mutants. Virology 220, 152-162. 164. Dix, B. R., O'CarroU, S. J., Myers, C. J., Edwards, S. J., and Braithwaite, A. W. (2000). Efficient induction of cell death by adenoviruses requires binding of Elb55 k and p53. Cancer Res. 60, 2666-2672. 165. Zhu, J. D., Grace, M., Casale, J., Chang, A. T. L, Musco, M. L., Bordens, R., Greenberg, R., Schaefer, E., and Indelicato, S. R. (1999). Characterization of replication-competent adenovirus isolates from large-scale production of a recombinant adenoviral vector. Hum. Gene Ther. 10 ,113-121 . 166. Fallaux, F. J., Bout, A., van der velde, L, van den Wollenberg, D. J. M., Hehir, K. M., Keegan, J., Auger, C , Cramer, S. J., van Ormondt, H., van der Eb, A. J., Valerio, D., and Hoeben, R, C. (1998). New helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 167. Blanche, F., Cameron, B., Barbot, A., Ferrero, L., Guillemin, T., Guyot, S., Somarriba, S., and Bisch, D. (2000). An improved anion-exchange HPLC method for the detection and purification of adenoviral particles. Gene. Ther. 7, 1055-1062. C H A P T E R Hybrid Adenoviral Vectors Stephen J. Murphy and Richard G. Vile Molecular Medicine Program Mayo Clinic and Foundation Rochester, Minnesota I. Introduction The characterization of disease at the genetic level facilitates potential genotypic and/or phenotypic correction by gene therapy. Although the concept of gene therapy has been extensively established over the past tv^o decades, the development of effective clinical protocols to facilitate efficacious reversal of disease has proven highly problematic. The development of an effective gene delivery system to the site of therapeutic significance has proven to be the major hurdle to the advancement of gene therapies. Many questions currently remain unanswered and these raise major debates over the best vector systems to treat a specific clinical disorder, and, at a more fundamental level, the choice of gene to be applied. The ultimate goal of a gene therapy protocol is efficient targeted delivery of a therapeutic transgene, whose expression can be sufficiently regulated, in a defective tissue. Vector delivery would ideally involve a single, lifetime treatment by a simple, noninvasive, and safe protocol, which can be incorporated into clinical practice. The vast array of diseases, for which gene therapy presents clinical promise, demands a multitude of different requirements for a vector system to meet. Ideologies for gene therapy vectors will differ considerably among dif­ ferent disorders. The treatment of severely disabling genetic disorders such as Duchenne muscular dystrophy would require lifelong genetic complemen­ tation of the defective gene in an immense amount of both skeletal and smooth muscular tissues, as well as brain tissues to correct cognitive functions. Whereas somatic gene therapy for hemophilia B holds out greater potential for treatment; only a few percent of normal, reversed-phenotype cells would be sufficient to provide a constant level of factor IX in plasma, offering patients significant clinical improvements. In contrast to the aim of preservation of host ADENOVIRAL VECTORS FOR GENE THERAPY ^ g | Copyright 2002, Elsevier Science (USA). All rights reserved. 4 8 2 Murphy and Vile Table I Comparison of the Ideologies of a Gene Therapy Vector for Genetic Disorders and Cancer Genetic disorder Aim: Cell preservation Targeting diseased tissues Efficient transduction of affected cells Therapeutic levels of transgene expression Adequate maintenance of gene expression levels Long term stable transgene expression Minimal vector toxicity Cancer Aim: Cell eradication Targeting diseased tissues Efficient transduction of tumor cells Therapeutic levels of transgene expression Transient vector expression for tumor clearance Vector toxicity — danger signals attack tumor cells physiology for inherited disorders, gene therapy for cancer focuses on efficient cell killing (Table I). Hence, genetic cancer therapies require different vector functions, requiring initial high local transduction of primary tumor masses to effect clinical removal, follow^ed by subsequent systemic vector surveillance to eliminate metastatic disease. In essence, ideological concepts are rarely fully achieved and the current minimal aim of gene therapy is reversal of clinical phenotypes to the extent of easy maintenance, facilitating improvements in standards of life for patients. Despite the development of increasingly complex nonviral gene delivery systems, it is virally derived vector systems which still offer most promise to the clinic. Viruses have throughout evolution developed highly skilled methods of entering cells, evading the host immune defense, and delivering their viral payloads. Hence, phenomenal amounts of research have been directed at harnessing the finely tuned transduction functions and obligate parasite lifestyles of viruses. A plethora of genetically modified viral vector systems has now been reported, all ingeniously subverting the parasitic viral life cycles for the presentation of therapeutic transgenes aimed at reversal of disease phenotype. The development of viruses as cHnical vectors will revolutionize the medical world, providing an invaluable new tool for the treatment of disease. Our present understanding of the molecular genetics of many viruses renders possible their manipulation as cloning vectors for gene transfer both in cell culture and directly in patients. As the major objective is usually long-lasting 17. Hybrid Adenoviral Vectors 4 8 3 gene transfer, deletion of the key regulatory viral genes was deemed essential to manipulate the genetic program of the virus and to ensure that infection of the target cell does not lead to cell death. Conversely, for the treatment of cancer, more recent strategies have reversed this thinking and selectively retain the replicative functions of the virus to enhance tumor cell killing. Viruses have thus been designed with predictable biological properties, retaining the beneficial targeting/infectivity properties, while dissociating them from the major virulent determinants of pathology in normal tissues. Currently, four classes of viral vector have presented most promise as gene delivery vehicles: retroviruses (RVs), adenoviruses (Ads), adeno-associated viruses (AAVs) and herpes-simplex-based viruses (HSVs). Although retro­ viruses embodied the pioneering vector when the concept of gene therapy began to emerge as a reality in the early 1980s, adenoviruses have since become the major vector choice in the chnic. More recent advances in the pro­ duction technologies of HSV- and AAV-based vectors have greatly increased their clinical potentials. Additionally, the lentiviral (LV) subclass of retroviral vectors, with distinct biological properties, has emerged with great potential and has gained individual acclaim from the rest of the group. The major properties of each viral vector are presented in Table II, as well as being briefly discussed below. A. Retroviral Vectors Retroviruses are enveloped RNA viruses, whose genomes consist of three core genetic units termed gag^ pol^ and env (Fig. lA) [1]. Retroviruses stably transduce cells by integrating their genomes into the host-cell chromosomes and subsequently release progeny virus by continuously budding viral particles from the cell membrane. The gag gene encodes proteins which form the viral core, while the pol gene encodes reverse transcriptase (RT), the viral integrase (INT), and a viral protease which acts on the gag gene products. The env gene encodes the glycosylated envelope proteins that determine the tropism of the virus. These genetic elements are flanked by the long-terminal repeat (LTR) sequences and a packaging signal (\|;) which directs the assembly of the genome into the viral particles (Fig. lA) [1]. The LTR sequences contain the ds-acting elements required to regulate viral genome replication and transcription and mediate stable integration into the host genome [1]. Retroviral vectors have been principally based on the well-studied Moloney murine leukaemia virus (MoMuLV). Recombinant MoMuLV vectors are engineered by replacing the gag^ pol^ and ^/^t'-coding units with a transgene of interest, while retaining the LTRs and packaging ds-acting sequences. Producer cell lines stably trans­ formed with independent gag/pol and env expression cassettes are used to fully complement the viral polypeptides for packaging of the vector proviruses [2, 3]. Hence by transfecting these packaging cell lines with plasmid-based

LTR- flanked retroviral cassettes, retroviral particles efficiently bud from the host >̂ > bJD -a ^ - O H-1 s < ^-T^ -Q (U Z G ^> P^ w o Q a> C/5 < o a. o 2 OJ aus C/3 > c -a w ^ ' >H ^ c > 1 OS >s Q. P <L> I—H JT^ -D J^ V3 I PL] |\ ^ "o '̂ >̂ I > O ^ S ^ } 0^ 2 I I ON III! ^ 1 c ro ^ _o 1 3 -O 3 oo ĉ s bJD i> 1 1 ^ £ K-1 bf 6̂ bJD a o c p 2 c3 O 2 484 ^ > -^3 O C/3 c3 tJD o S 2 g S ^ i r3 :3 OJ c^ OJ cj ^ (U 'U-i O^ -j-H q i ! o i r !̂ s tr 'S j : ^ -^ •—I "H ^ .ti ^ c ^ • • • 2 § ^ H ^ y .§ O (u IEJII (U .§ 3 ^ ci Ŝ '7^ s g s i ^ I 11o (u <î ^ . 5 5̂ rH O ^ § 8 bJD >- r v ^2 «:§" B O C3 <7i l l l ^ l . ^1 ^1 1CI ^ 2 S I j | g StjD .ĝS S. f̂5t̂ 1s S^ J^ ^ .̂ •D ^ -g i s fS :i: 8 u If > CI . 2 ci ?5 c &J0 CD o . (U <U S.^ ^P si o '~̂ bt, C Y <u 2 B s ••̂ ^ n O H ^ K g ^ ^ o hS OS O ^i O i"̂t li p̂ i -̂ 2 H-l cj > ::3 U i H § ^ .S W 2 o O ^ bJD g 7u ^ S S . ^ IT) en u* C ^r '̂ 3 -^ 5 - 1 2H OS O '3 X W) O . > - o ix -rU C • 2 K cl (U _^ "+3 -O CH JJ • ' - ' ^3 ^ •̂ e ^ij r;" 5-1 s-i j - j ^ ^ 3 JC as t j o bJO O S ^ c o ^ O H pti o o U 485 486 Murphy and Vile 5'LTR »F iMPS^BlittKftBill SWIBI 3'LTR /:,-l^^ltftiildfie €5^^'=} v; ii'v:;:;;; •' 1111111 t Late Genes ^ E 3 5'rTR * 3'ITR t *• E2 E4 ' f iraiag^-.iD^^:, B Ori,b acterial Transgene Ampicilin' D Cassette (s) Figure 1 Vector genome structures. The wild-type viral genomes and the strategy of transgene substitution are presented for (A) retrovirus, (B) adenovirus, and (C) adeno-associated virus. (D) The minimal structure of the HSV-1 -based amplicon vector. 17. Hybrid Adenoviral Vectors 4 8 7 cells containing the recombinant retroviral genome. These retroviral particles are capable of infecting cells and directing the expression of the transgene of interest, but cannot replicate or generate progeny virus. B. Adenoviral Vectors Adenoviral particles consist of lipid-free "spiked" regular icosahedra of 60-90 nm in diameter, consisting of three main structural proteins, termed hexon, penton base, and fiber [4]. The genome consists of a double-stranded linear DNA molecule of approximately 36 kb in length, functionally divided into two major noncontiguous overlapping regions, early and late, defined by the onset of transcription after infection (Fig. IB) [5]. There are five distinct early regions (ElA, ElB, E2, E3, and E4) and one major late region (MLR) with five principal coding units (LI to L5), plus several minor intermediate and/or late regions. At the extremities of the viral chromosome are the inverted terminal repeats (ITRs) and the encapsidation signal (\|;), encompassing the cis elements necessary for viral DNA replication and packaging [5]. Recombinant Ad vectors are constructed by deleting the essential early genes ElA and ElB, whose expression enables transformation of the host cell and trans-actiyatQS expression of the other early viral genes, as well as some host factors [6]. Transgenes are inserted into this deleted region (Fig. IB) and can be assembled into infectious adenoviral particles in cell lines which trans- complement the ElA/B functions [7]. Additional deletions in the nonessential E3 region are also often performed to increase cloning capacities [8], Thus infection of cells with the Ad vector enables expression of the transgene in the absence of expression of viral proteins. Further incapacitation of the Ad vector genomes, limiting leaky expression of viral proteins by further deletions in the E2 or E4, has also proved advantageous, further enhancing the cloning capacities, but requiring further complementation functions in packaging cell lines [9-12]. The development of so-called "gutless" or helper-dependent (HD) adenoviral vectors has also greatly expanded the potential of Ad vectors. These vectors retain just the terminal ITRs and ijf required for replication and packaging of adenoviral genomes, greatly increasing the cloning capacity [13]. C. Adeno-associated Viruses Adeno-associated viruses have recently become attractive candidates for gene transfer. AAVs belong to the family parvoviridae and consist of nonenveloped icosahedral virions of 18-26 nm diameter, with linear single- stranded DNA genomes of 4680 nucleotides for the most characterized AAV2 strain [14, 15]. The genome consists of two coding regions, cap and rep, which are flanked by ITRs and encapsidation signals (\|/) at either end of the genome (Fig. IC). The cap gene encodes the capsid (coat) proteins and rep encodes proteins involved in replication and integration functions [15]. 4 8 8 Murphy and Vile After infection, AAV genomes can persist extrachromosomally in an episomal form [16, 17] or integrate into the cellular genome [18, 19]. AAV has been demonstrated to preferentially integrate into human chromosome 19 at site ^13.4 (AAVSl), directed by the rep genes, facilitating latent infection for the life of the cell [20]. AAV is, however, naturally replication-incompetent and requires additional genes from a helper virus infection, v^hich in nature is generally complemented by Ad or HSV coinfection [21]. AAV-based vectors generally involve replacement of the rep and cap genes v\̂ ith a transgene of interest (Fig. IC), retaining the terminal repeats and packaging sequences essential to direct replication and packaging of the genome [15]. These AAV vectors can be packaged into infectious AAV particles upon complementation of the rep/cap genes and Ad/HSV helper functions in trans. Deletion of the rep genes, however, eliminates targeted integration of the AAV cassettes at AAVSl. The nonpathogenic nature of AAV, having not been associated with any disease or tumor in humans, makes it a potentially powerful clinical vector. D. Herpes Simplex Viruses Herpes simplex virus belongs to the herpesvirus family, a diverse family of large DNA viruses, all of which have the potential to establish lifelong latent infection [22, 23]. HSV consists of 110-nm-diameter particles comprising an icosahedral nucleocapsid, surrounded by a protein matrix, the tegument, which in turn is surrounded by a glycolipid-containing envelope [24]. The HSV-1 genome consists of a giant linear double-stranded DNA molecule of 152 kb encoding 81 known genes, 38 of which are essential for virus pro­ duction in vitro [24]. First-generation HSV-based vectors involve replacement of one or more of the seven immediate-early (IE) genes whose functions are ^raws-complemented by packaging cell lines [24]. Second-generation HSV- amplicon vectors consist of plasmids containing just the HSV-1 origin of replication (Oris) for replication in packaging cell lines by the roUing circle mechanism, and the cleavage/packaging signal (pac) (Fig. ID). These amplicon vectors can accommodate inserts of up to 15 kb, enabling the assembly of concatemer structures of up to 10 genomes, reconstituting the packaging size of 150 kb [25]. The future construction of "full-size" gutless HSV vectors could accommodate up to 150 kb of insert DNA [26]. E. Lentiviral Vectors Lentiviruses are a subclass of retroviral vectors which have become infamous in world affairs by the HIV family members. LV vectors are charac­ terized by the presence of additional accessory genes to the gag/pol/env-hased genomes [27]. These accessory genes extend the functions of the viruses, with 17. Hybrid Adenoviral Vectors 4 8 9 the major gene therapy focus being on their abiUty to infect nondividing as well dividing cells, in distinct contrast to other retroviral family members such as MoMuLV. These karyotropic properties of lentiviruses provide a promising tool to direct retro virus-mediated gene therapies to nondividing cells [28]. LV vectors are constructed by an analogous mechanism to conventional MoMuLV vectors. F. The Choice of Gene Therapy Vector No single vector system can presently provide the necessary flexibility for all the possible clinical applications of gene therapy. Vast variabilities exist in vector host range and uptake potentials for the many tissues of the human body, which together with the many biological barriers to reaching the target tissues make a universal vector unlikely. Thus disease-specific gene targeting strategies are likely to be required, involving the development of multiple gene delivery systems. Hence the technology of gene therapy stands to benefit from the vast range of clinical vectors being designed, each system having distinct properties which can complement each other in the clinic. Extensive research has focused on the potential of adenoviruses as transducing viruses for use in gene therapy. The translation of laboratory- derived viral vectors as practical pharmaceutical tools is a major determinant of gene therapy interest in the clinic. In essence, the ease of generating Ad vectors, the efficiency of purification, and the superior titers which can be obtained (>10^^ pfu/mL) have made Ad the vector of choice for many applications of in vivo gene therapy [4]. The rapid technical advances in the construction and purification of alternative viral vector systems has, however, expanded clinical interests. The vastly improved techniques of helper-free AAV production have significantly increased the potential of these vectors. Titers of AAV vectors equivalent to those of Ad vectors are now routinely achievable, which are free of the once problematic helper virus contamination [29]. The production procedures, however, are still relatively laborious and problematic. The comparatively low titers of the MoMuLV-, HSV-, and LV-based vectors, generally greater than 2 logs lower stable titers, limit the effectiveness of these vector systems especially upon translation to the clinic. However, current immune system barriers preclude the beneficial attributes of administration of Ad vectors at their maximal titers, with significant safety concerns apparent with the maximal doses of Ad vectors in the clinic [30]. The generation of large-scale, high-titer vector preparations with stable shelf lives is essential for clinical applications. The stable pharmaceutical prop­ erties of Ad virions, as well as the similarly encapsidated AAV and HSV virions, present significant advantages over the much less stable enveloped retrovirus- based vectors. The integrative functions of retroviral vectors, however, confer on them the potential of long-term stable expression, fulfilling an additional 4 9 0 Murphy and Vile highly desirable vector property. These integrative functions, together with rapidly advancing methods of enhancing viral titers using concentration proce­ dures [31], maintain major clinical interest in retroviral vectors. The integrative functions of AAV vectors are also highly desirable, specifically the chromoso­ mal targeting mechanism in the presence of the Rep protein [32]. The absence of any cellular retention mechanisms for Ad and HSV vectors presents a distinct disadvantage to many gene therapy applications. In the context of tumor erad­ ication, however, high-titer vector transduction is unlikely to require long-term maintenance of vectors. In deciding the most appropriate vector for treatment of a clinical disorder, the main selection criterion for vector choice comes in the ability of a specific vector to efficiently transduce the target tissue. Ad vectors have a wide distribution of their target receptors dispersed throughout the body tissues. AAV and HSV have similar diverse tropism to most cells in the human body, with HSV-1 vectors having a major selective tropism for neuronal tissues. MoMuLV viruses are, however, severely limited by their dependence on host cell mitosis to enable stable transduction of a cell, limiting their efficacy in quiescent cell populations [33]. These cell cycle restrictions are not apparent with the LV subclass of retroviral vectors, which possess the additional nuclear targeting functions [34], The additional nuclear targeting property of LV vectors, together with the integration functions, has significantly raised the clinical interest in respect of gene therapy. Additionally, the ability of MoMuLV vectors to infect only dividing cells can be deemed an advantage in targeting actively dividing tumor cells which are surrounded by nondividing

normal tissues. The ideal vector system is thus very much dependent on the diseased tissue to be treated. The extent of genetic material that is required to be delivered to a specific tissue is also a major influence on the vector system. Ad vectors offer a wide range of insert potentials from 7 to 8-kb insert capacities for first-generation vectors and up to 36-kb inserts in the "gutless" HD vector system [6, 35]. Whereas the relatively small packageable genome sizes of retroviral vectors (-^8 kb), but more significantly of AAV vectors (~4.5 kb), severely limit their applications to some gene therapy protocols [15], specifically where the delivery of multiple genes or the insertion of large regulatory elements is deemed essential. It is, however, the HSV-1-based vectors that offer the superior transgene delivery potentials with inserts of up to 150 kb feasible in a gutless vector [36]. Additionally, in the alternative HSV-1 amplicon vector system, as well as providing an insert capacity of up to 15 kb, the assembly of concatemers vastly increases the copy number of transgene cassettes being delivered to target cells [25]. The immune system is a perpetual barrier to viral transduction. The compromised state of many diseases would be severely stressed by fur­ ther immunological effects/inflammation induced by a "therapeutic" vector 17. Hybrid Adenoviral Vectors 4 9 1 challenge. The exception again is cancer gene therapy where activation of local immune responses can be advantageous in tumor recognition and possibly aid in breaking immune tolerance [37]. Viral vectors are designed to exploit specific biological properties of viruses, such as recognition of cell receptors for entry and mechanisms of host genome integration, that have evolved over time in relationship w îth the host. The natural response of the host has, hov^ever, also developed to eliminate disease-inducing viral pathogens. Current strate­ gies of viral vector design are working to engineer viruses with predictable biological properties, maintaining the biological advantages of the virus that have been selected by nature while reducing the immunogenicity of the viral components. The majority of Ad vector-derived immunogenicity was deemed to be due to the leaky expression of retained viral transcripts in the vector genome [30, 38]. For AAV and HSV amplicon vectors, contaminating helper virus was also deemed highly immunogenic. The more recent improvements in Ad vector design [9-12] and generation of "helper-free" packaging systems for AAV and HSV amplicon vectors [29, 39] has stunted this immunogenicity to some extent. However, the immune system still stands as a major barrier to gene-therapy efficacy. The mere physical presence of the virus can induce significant cytopathology. The current requirement of repeated administration to boost expression levels further augments the immune memory responses to the presence of the virus until eventual complete immunity is developed to the applied vector [40]. The power of the immune system is emphasized by practically 95% of Ad virions being eliminated by the natural nonspecific innate immune response on each administration [41]. G. How to Maintain Stable Transgene Expression The transient natures of Ad and HSV-1 vectors, as well as the rapid loss of transgene expression upon stable integration of AAV and RV vectors due to nuclear effects on the transgene cassettes, have dramatically limited the efficacy of each vector system. Hence the question remains: how do we maintain stable transgene expression following recombinant viral vector transduction.^ One solution may come from looking closer at the wild-type mechanisms of preservation evolved by the parental viruses. Viruses have developed diverse mechanisms of self-preservation and maintenance to enable them to infect cells and direct self-replication and propagation. Mechanisms of maintenance vary according to the life cycle of the virus. Viruses such as retroviruses have developed life cycles that live in harmony with the host cell. They utilize the host cellular machinery to enable continuous shedding of the virus and thus require stable preservation of the viral genetic material. Retroviruses facilitate this function by stable integration into the host genome, permitting continuous replication/maintenance of the viral genome in the context of host cell replication [1]. Conversely, lytic viruses 4 9 2 Murphy and Vile such as adenoviruses subvert the host's cellular functions solely for their ow n̂ preservation. Infected cells become short-term factories of virus production, amassing viral particles until host cell saturation is achieved and cell lysis occurs in less than 36 h [5]. The short-term association of virus and host does not therefore necessitate mechanisms for long-term persistence of the viral genome. The Ad genome is thus maintained extrachromosomally w îth a very efficient mechanism of replication to enable large-scale genome packaging into the vast numbers of viral particles generated. Herpes viruses, such as HSV, Epstein-Barr virus (EBV), and cytomegalovirus (CMV), have developed more complex mechanisms of self-preservation [42]. Upon infection, a lysogenic life cycle enables the virus to live in harmony with the cell, maintaining the genome in an extrachromosomal state, w^here methylation and histone binding to the viral genome keep viral gene expression essentially quiescent [22]. The sv^itch of the life cycle from the quiescent latent state to the major virulent lytic phase, upon signals of cell stress, rapidly reveals the viral presence. This terminal lytic stage of rapid viral genome reproduction and mass assembly of virions enables the virus to rapidly multiply and abandon the host. The AAV life cycle is a further intriguing evolutionary mechanism, being naturally dependent on helper Ad or HSV coinfection to effect lytic AAV virion assembly and viral progeny release. In the absence of such helper functions, AAV remains lysogenic by either stable integration into the host genome or independent episomal replication in the infected cell [14]. II. Hybrid Viral Vectors The inadequacies of each viral vector system are illustrated in Table II. The negative attributes of one vector, however, generally emphasize the positive attributes of another. Thus most of the criteria defined for a hypothetical perfect gene therapy might actually be met by considering defined properties of the currently available vectors defined in Table II. Hence, although at present no individual virus system alone can meet all the criteria, current research is focusing on combining individual viral properties into single vector constructs, termed "hybrid" or "chimeric" vectors. Adenoviral vectors are currently the major vector choice for a variety of clinical disorders, despite the limited efficacy due to the transient nature of the vector. Mechanisms of enhancing the pharmaceutical properties of Ad vectors are thus highly desirable. The incorporation of other viral vector functions that could enhance the duration of Ad-directed transgene expression and/or target the vectors to a specific disease tissue would be extremely beneficial. In essence, whether the aim is to kill or cure the target cell, a vector encompassing the advantageous properties of high titer, broad host range, and infectivity of an Ad vector, together with the low immunogenicity and potential for long-term 17. Hybrid Adenoviral Vectors 4 9 3 stable expression of a retrovirus, AAV, or EBV vector v^ould be extremely useful for gene therapy for a wide range of genetic and acquired disorders. Hence the main focus of this chapter is to review the properties of other viral vectors which have been utilized to generate hybrid adenoviral vectors in the aim of enhancing vector efficacy in the clinic. A. Are Hybrid Vectors Truly New Technology? The formation of hybrid adenoviruses is not a new technology and has been extensively reported to occur naturally in nature. Adenoviral/simian virus 40 (SV40) hybrids have been documented to occur in nature [43, 44]. Although human adenoviruses do not normally replicate in primate cells, upon coinfection with SV40, Ad genomes acquired sequences from the SV40 genomes (large T antigen) which permitted replication and assembly of hybrid genomes into wild-type Ad capsid particles [43]. Additionally it may be that the helper-dependent AAV genome represents a segment of an extinct or undiscovered virus that was selected upon coinfection with an Ad or an HSV. Perhaps the parental virus was too virulent to coexist in a human host, thereby explaining the nonpathogenic nature of the dependovirus. The development of hybrid viral vectors is fundamentally not a new technology in gene therapy. Since the dawn of gene therapy, scientists have utilized alternative as-acting sequences from other viruses, specifically pro­ moters and enhancers, to drive transgene expression. Most significantly, the cytomegalovirus (CMV) immediate-early promoter and enhancer has been utilized in almost every viral vector reported to date and is well characterized as an extremely strong constitutive promoter in most tissues [45, 46]. Other well utilized viral promoters have included the Rous sarcoma virus (RSV) LTR promoter, the SV40 early promoter, hepatitis B virus (HBV), and the EBV promoter [45, 46]. Additionally, application of the picornaviral func­ tions of "cap-independent" initiation of translation has also been extensively exploited in viral vectors. These translational regulatory elements, termed internal ribosomal entry site (IRES) sequences, enable bicistronic expression from a single mRNA transcript [47]. The application of these elements greatly complemented the limited insert capacities of viral vectors, thereby negating the need for separate promoters to drive two transgene cassettes. Retroviral vectors have been studied in hybrid vector systems since the early 1980s, "pseudotyping" them with functions from other retroviral vectors. Specifically heterotropic viral glycoproteins from other retroviral env genes have been stably incorporated into MoMuLV vector particles. The incorporation of vesicular somatic virus G (VSV-G) glycoprotein [48], gibbon ape leukemia virus (GALV) and HIV-1 glycoproteins [49] into murine leukemia virus particles has been reported. These hybrid MoMuLV virions attain the tropism of the pseudotyped env proteins, retargeting or broadening the host 4 9 4 Murphy and Vile range of the MoMuLV vector. Additionally, incorporation of VSV-G env has been demonstrated to increase the stability of the virions, enabling higher titer-yielding purification techniques to be applied [50, 51]. Hybrid retroviral vectors have also been constructed, incorporating different c/s-acting elements contained in the U3 region of the LTR, w^hich direct the transcriptional activity of the virus. Replacement of these U3 regulatory elements can impart tissue- specific transcriptional activity on the RV vector [52, 53]. Hence the concept of hybrid vectors is not a new^ technology, but the nev^ strategies proposed could vastly expand the repertoire of viral vectors available to the clinic. III. Hybrid Adenoviral Vector Systems A number of hybrid adenoviral vector systems have been reported in the literature, combining the properties of RV, AAV, and EBV vectors, as w êll as elements of other Ad serotypes, to enhance the therapeutic efficacy of Ad vectors in vivo. The principal aim of these new^ hybrid vectors is to overcome the limitations of transient Ad vector retention in infected cells. In addition to the w^ell-documented limitations of Ad vectors (Table II), some initially perceived advantageous properties of Ad vectors do actually limit their effectiveness toward therapy for some diseases. The broad host range of Ad vectors induces significant disadvantages v^hen tissue targeting is required and compromises systemic administration. Additionally, the \ow pathogenicity of adenoviruses in humans has resulted in many serotypes, including the conventional vector strains of Ad2 and Ad5, being endemic. Hence a potent natural anti-adenoviral immunity is fashioned generally at a very early age. The highly immunogenic nature of the proteinous Ad virion further confounds the system, v^ith a rapid and highly effective host humoral response being developed to the Ad vector. Research is thus being channelled into both retargeting Ad vectors to specific tissues and silencing the structural immune stimuli to facilitate enhanced Ad vector transduction. A. Pseudotyping and Retargeting Adenoviral Vectors As targeting and humoral immunity are connected in essence to the same surface moieties of the Ad particles, both disciplines are fundamentally interlinked. Methods applied to limit the humoral responses have focused on two main strategies: application of alternative "immune silent" Ad serotypes or display of alternative ligands on the surface of the virions, which is also the major strategy for retargeting the vector. The use of alternative serotypes enables the consecutive application of immunologically distinct Ad particles, enabling avoidance of specific humoral responses to previously applied vectors [54, 55]. This system has presented some success in vivo [56]., although the presence of cross-reacting antibodies 17. Hybrid Adenoviral Vectors 4 9 5 is problematic due to the evolutionary similarities of Ad serotypes. The application of alternative Ad serotypes w îth different surface markers also provides a mechanism of alternative targeting, as different serotypes possess tropism for different tissues in

the human body. For instance, the conventional gene therapy subtypes Ad2 and Ad5 have natural tropism for the gut epithelial layer. Hence, in terms of gene therapy for cystic fibrosis, initial vectors proved disappointing due to their low infectivity of the airv^ay epithelia. To overcome this restriction, Zabner and colleagues investigated other Ad serotypes for airway epithelia tropism [57]. A number of other Ad serotypes, specifically Ad 17, were found to infect the airway epithelia with increased efficiency to wtAd2 [57], They therefore proceeded to generate Ad2 hybrid vectors pseudotyped with the Adl7 fiber, where the endogenous Ad2 fiber gene was replaced with the Ad 17 fiber gene. The resultant chimeric vector displayed increased efficiency of binding and gene transfer to well differentiated human epithelial cells. A similar study by Croyle and colleagues demonstrated that wild-type Ad41 had enhanced transduction properties in intestines compared to Ad5 [58]. These studies emphasize the potential of alternative Ad serotypes with tropism for different tissues in the human body. Pseudotyping also provides an invaluable mechanism of integrating alternative serotype fiber (and/or penton base) genes from other Ad serotypes into the currently well- researched Ad vectors, without having to reconstruct the vector backbones. The use of nonhuman adenoviruses as vectors for gene therapy is also under investigation, with bovine, ovine, canine, feline, and avian adenoviruses being researched [59-62]. As well as being potentially unexposed to the immune system, they may also have specific tropism for selective tissues in humans. The potential of pseudotyping nonhuman Ad vector components with conventional human Ad vectors is therefore of interest. The use of targeted viral vectors to localize gene therapy to specific cell types introduces significant advances over vectors with conventional natural tropism. As well as the safety aspects of reduced immunogenicity and toxicity, the reduced uptake by nontargeted cell types may enable application of systemic delivery with feasible viral titers and loads. In order to retarget Ad vectors, first the natural tropism of the virus must be removed and, second, novel, tissue-specific ligands introduced [63]. Two main mechanisms have been used to retarget Ad vectors. First, the use of external molecules with affinities for both the Ad surface structural moieties as well as a cell-type-specific surface ligand. These bispecific molecules act as bridges between the virions and the cell. A neutralizing antibody or high-affinity peptide for the fiber or penton base can act as the Ad-binding moiety, which can be covalently linked to a high-affinity ligand for a tissue-specific receptor [63]. A drawback of the bridging molecule approach is that native receptor binding is never 100% blocked. To truly block native Ad binding to its cognitive receptor, removal of the intrinsic receptor binding domains is required. 4 9 6 Murphy and Vile A second approach involves creation of hybrid Ad vectors, pseudotyped w îth novel receptor recognition functions. Genetic modification of the Ad genome by incorporating targeting ligands inside the genome, while deleting or ablating sequences of the penton and fiber involved in receptor recogni­ tion, has been reported. High-affinity peptide motifs have been subsequently demonstrated to be functionally incorporated into Ad particles. These "proof- of-concept" studies focused on the incorporation of ligands w^ithout ablating natural receptor interactions and resulted in expanding the vector tropism, which has proved beneficial in vivo in transducing both vascular smooth mus­ cle and some tumor types [64-66]. Future studies will focus on honing the targeting functions to specific cell types. High-affinity ligands have been stably inserted into the HI loop or on the C-terminus of the fiber or into the integrin- binding RGD domain of the penton base [63]. However, the size, location, and type of ligand to be inserted are currently under debate and remain to be deter­ mined. Wickham and colleagues demonstrated 10- to 1000-fold reductions in transduction of cells expressing the coxsackievirus and adenovirus receptor (CAR) with CAR-ablated vectors [63], the residual transduction being penton- base-mediated, emphasizing the requirement for additional ablation of penton base binding [63]. The further requirement of novel packaging cell lines to facil­ itate infection and propagation of the CAR/integrin-binding ablated particles also remains an issue. B. Adenoviral/Retroviral Hybrid Vector Technologies A hybrid vector system incorporating the advantageous long-term stable integrative functions of retroviral vectors into adenoviral vectors could provide a major clinical advancement to gene therapy. Hybrid vector systems are thus being investigated, incorporating retroviral components into the backbones of adenoviral vectors. Initial studies have focused on utilizing adenoviral vectors as directors of retroviral vector production, delivering the gag^ pol, and env genes as well as retroviral LTR cassettes to cell populations both in vitro and in vivo. Conventional retroviral packaging cell lines are stably transformed with gag^ pol, and env functions and release retroviral particles upon plasmid transfection of a retroviral LTR transgene cassette [2]. High-titer retroviral stocks of greater than 10^ infectious units (iu)/mL can now be obtained from conventional stable producer cell lines [3]. To achieve the highest vector titer, it is necessary to select clones of vector-transduced cells individually due to the varying titers of producer cell clones [67]. Direct injection of retroviral vectors in vivo has, however, yielded limited efficiencies due to the limited transducing titers and poor infectivity. Application of retroviral vectors in the clinic has thus focused on ex vivo protocols. This involves the removal of patient tissues, which can be cultured for a brief period in the laboratory, transduction with the RV vector, and reimplantation back into the patient. The ex vivo approach has 17. Hybrid Adenoviral Vectors 4 9 7 yielded some success, although the procedure is cumbersome and costly, and in most cases, it can only transduce a small fraction of the target cells [68, 69]. The establishment of retroviral producer cells in situ provides a further mechanism of enhancing the efficacy of retroviral gene therapy. Transient transfection of target cells in vivo v^ith the retroviral vector and packaging plasmids, previously used to generate producer cell lines in vitro^ by direct DNA injection has been reported [70]. Although stable integration of subsequently generated retroviral particle genomes could be detected, the efficiency w âs very lov^. The implan­ tation of retroviral producer cell lines into patients has presented a far greater potential for the in situ production of retroviral vectors. Gene therapy using MoMuLV-based producer cells to treat brain tumors [71] has been carried out in a clinical trial, but no clear clinical benefit has been reported to date. The infectivity of Ad vectors both in vitro and in vivo provides great potential in increasing the efficiencies of retroviral production technology. The group of David Curiel pioneered the development of hybrid retrovi­ ral/adenoviral vectors by using the infectivity of adenoviral vectors to efficiently deliver the requisite retroviral packaging and vector functions to target cells in vivo^ thereby rendering them retroviral producer cells in situ (Fig. 2). The sub­ sequent release of high local concentrations of retroviral particles in situ v^ould enable stable transduction of neighboring tissues, for the transient period of adenovirus transduction. The Ad/RV hybrid system reported by Feng and col­ leagues utilized a tvs^o-adenovirus delivery strategy [72]. The first adenovirus contained an LTR-flanked retroviral vector cassette encompassing the GFP marker and neomycin resistance genes: Ad/RV-vector. The second adenovirus contained the replication-defective retroviral helper machinery, carrying the gag^ pol, and env genes of MoMuLV: Ad-gag/pol/env. High-titer adenoviral vectors could be generated containing the RV cassettes, w^hich could efficiently direct the in vitro packaging of RV particles at titers similar to conventional packaging cell lines [72, 67]. These studies clearly demonstrate the compati­ bility of both the adenoviral and the retroviral life cycles in the context of a hybrid vector configuration. Upon infection of cells in vitro w îth the Ad/RV vector alone, high initial levels of GFP expression v^ere observed but gradual loss of expression w âs documented over a period of 60 days as the nonintegrated adenovirus v^as lost from dividing target cells. Conversely, upon application of both adenoviruses to cells in vitro, GFP expression was persistent for extended periods of time. How^ever, the persistent level of gene expression w âs reduced beyond the time at v^hich expression could be solely attributed to the Ad/RV vector. The stable integration of the retroviral cassette in surrounding cells was believed to be responsible for this extended expression. The longer term GFP-expressing cells in cultures transduced with both Ad vectors, were present in clustered outgrowths, suggesting local retroviral spreading and/or clonal origin. Subsequent demonstration of proviral integration was confirmed by the 498 Murphy and Vile | l T R | ¥ i ^ ^ ; J }.'• Adbetmm '': • ' |ITR| 1ITR1 'P \;\ 'MI0^X • M Genome ITR| 1 ITR| W lIlTraasi^aeli.i, .3 •:7:liM!(^^t<m-L^. MITR] Ad Gag/Pol Ad LTR-Transgene AdEnv Ad Infection and Nuclear Delivery Producer Cell RV Particles Figure 2 Hybrid-Ad/RV vector-mediated production of RV particles. Hybrid adenoviral vectors expressing the gag/pol and env RV genes either together or on split adenoviral constructs (as shown) are coinfected with the Ad-LTR transgene vector into cells in vitro or in vivo. Subsequent expression of the gog/pol and env genes in the cells establishes in situ retroviral producer cells which direct the packaging of the expressed retroviral genonnes. RV particles expressing the transgene cassettes subsequently bud from the cells and are released into the surrounding environment. presence of retroviral transgene sequences in high-molecular-weight cellular DNA [72]. No replication-competenet retroviruses (RCRs) were detected v^ith the Ad/RV chimera, despite the large genome copy numbers associated w îth adenovirus production in vitro [72]. 17. Hybrid Adenoviral Vectors 4 9 9 The ex vivo efficacy of the Ad/RV hybrid vector system was investigated by transducing the ovarian carcinoma cell line SKOV3 in vitro with the Ad/RV vector alone or in combination with the kd-gaglpollenv vector at an m.o.i. of 50 pfu/cell. The infected cells were then mixed at a ratio of 3:1 with uninfected SKOV3 cells and subcutaneously implanted in athymic nude mice to allow tumor formation. Tumors were assessed 20 days posttransplantation for GFP expression. Large expansive clusters of GFP-expressing cells were observed only in tumors treated with both vectors. Further in vivo studies involved direct intraperitoneal injection of 5-day-old established SKOV3 tumors in nude mice (1 x 10^ cells) with the single- or two-adenoviral strategy (1 x 10^ pfu/mouse). Sixteen days post-Ad infection, the two-virus-treated tumors were observed to have islands of GFP-positive cells (10-15% transduction), consistent with secondary retroviral transduction. In contrast, single virus- treated tumors revealed very limited (<1%) GFP-positive cells. This pioneering study thus established the great potential of hybrid Ad/RV vectors, whose pros and cons are presented in Table III and discussed further in the concluding remarks of this chapter. Following the initial proof of concept, a number of other laborato­ ries have further investigated the concept of Ad-mediated establishment of retroviral producer cell lines in situ, Duisit and colleagues in collaboration Table III Pros and Cons of Hybrid Adeno-/Retroviral Vectors for Gene Therapy Pros • Exploit high-efficiency adenoviral infection to deliver retroviral assembly machinery • Utilize stable high titer adenoviral vectors • Increase the duration of biological activity of delivered transgene • Avoid initial limitations of retroviral infectivity to nondividing tissues • Utilize adenoviral vector tropism • Therapeutic gene expressed by retroviral cassette will still be expressed in context of sole delivery of the Ad-RV cassette vector • Initial burst of transgene expression can be converted to a stable low^er level expression • Delivery deep into cell layers Cons • Progeny retroviral vector can still only infect dividing cells • In situ released retroviral vector limited according to RV infectivity and tropism • Requires codelivery of two or more adenoviral vectors • Risk of RCR • Safety? • Rescue of endogenous retroviral elements • Interactions with host cell functions? • Diffusion may still be very limited around the initial needle tract • In situ titers of retroviral particles may be limited • Different cells have different intrinsic potentials for retrovirus production 5 0 0 Murphy and Vile with Fran^ois-Loic Cosset, reported on an extension of the hybrid vector system [67]. These studies further restricted the potential for RCR by sep­ arating the gag/pol core particle-expressing elements from the env surface glycoprotein gene, which they supply on a separate Ad vector (Ad-gag/pol and Ad~env; Fig. 2), to minimize retroviral sequence overlaps. Additionally, in the context of pseudotyping retroviral vectors, they replaced the

natural MoMuLV env gene with the gibbon ape leukemia virus (GALV) env gene. In small-scale pilot experiments, TE671 cells simultaneously infected with the three Ad vectors efficiently released helper-free retroviral particles at titers of up to 5 X 10^ iu/mL for at least 3 days following infection [67], The further separation of the key retroviral elements facilitated the indi­ vidual characterization of each retroviral function in terms of variable copy load on complementing retroviral cell lines. The results helped to shed light on the factors currently limiting retroviral vector production and allowed an investigation of particular cell type-specific features of the producer cells. The availability of packageable RNAs of the retroviral genome itself was not found to be rate limiting, with Ad-mediated overexpression resulting in increasing, nonsaturatable retroviral titers [67]. The results indicated that high expression of Gag-Pol and Env proteins through the introduction of high copy numbers of their genes was not required to achieve an efficient retroviral production and that there is probably a limit to the number of particles that a given cell may release. Increased GALV env copy number resulted in augmented glycoprotein synthesis, with RV particle production plateauing between m.o.i.s of 10 and 50. At higher m.o.i.s titers decreased, possibly by a break of tolerance by the cell to efficient RV particle assembly or budding. It was observed that Pr65 gag precursor expression saturated with Ad-gag/pol m.o.i.s of greater than 5 [67]. At higher titers, premature maturation of Pr65 transcripts became apparent, which normally occurs at maturation of the retroviral particles [73]. However, despite these observations, reported titers were equivalent to those generated on high titer-generating stable packaging cells [67]. A detailed analysis of the release of noninfectious/incorrectly processed budding particles may be of interest. Additionally, despite the expression of similar levels of Gag precur­ sors and premature forms, a wide variability was observed in the capacity of different cell types examined to assemble and release retroviral particles [67]. In the context of the hybrid adenoviral/retroviral vector system, when applied at optimal m.o.i.s, a critical limiting factor for the production of retrovirus is the ability to avoid premature activation and convert the bulk of Gag and Gag-Pol precursors in nascent viral infectious particles [67]. Despite the high copy number of all three retroviral units introduced into cells, no RCR could be detected. These Ad/RV hybrid vector studies go some way in aiding the elu­ cidation of the limiting factors involved in retroviral production in packaging cell lines and they indicate that the careful selection of packaging cell type is crucial. This observation is highly significant to therapeutic applications of the 17. Hybrid Adenoviral Vectors 5 0 1 hybrid vector system where different tissues of the body will be more suited to RV complementation than others. The hybrid Ad/RV system can also facilitate the rapid screening of various primate cells for their retroviral production potentials and allows simple substitution/pseudotyping of components in the system. 1. Tetracycline-Inducible Env Pseudotyping of Ad/RV Hybrid Vectors Pseudotyping the VSV-G retroviral envelope in the MoMuLV back bone, as discussed earlier, enhances the stability and tropism of the native virus [31]. This enhanced stability enables higher titer preparation to be prepared by centrifugation. Generating Ad vectors expressing the VSV-G envelope glycoprotein has, however, proven technically difficult due to the cytotoxic nature of the protein product. Yang and colleagues demonstrated that the VSV-G gene could be effectively controlled under the tetracycline inducible system [74] in packaging cell lines obtaining unconcentrated titers of 10^ to 10^ iu/mL [75], Yoshida and colleagues extended these studies by applying the tetracycline-inducible system in the context of an Ad vector [76]. Ad vectors were generated carrying VSV-G and MoMuLV gag/pol genes, both under the control of the tetracycline-controllable promoter. Hence, only upon the supply of doxycycline (a tetracycline homolog) efficient expression would proceed from the gag, pol, and env genes. Minimum "leaky" expression of cytotoxic VSV-G under the control of the inducible promoter remained low enough to allow Ad propagation to titers of 4 x 10^ pfu/mL. The drawback of this system is the necessity to provide a further Ad construct containing the tetracycline transcriptional regulator (Ad-rtTA), expanding the system to a four-adenovirus transduction strategy, together with Ad-TetGag/Pol, Ad- TetEnv, and the Ad/RV vector expressing neomycin resistance. Application of the four viruses in vitro generated retroviral transgene titers of up to 5 X 10^ iu/mL, which were further purified to titers of >10^ iu/mL following simple centrifuge concentration of the virus from culture fluids at 50-80% recovery efficiency [76]. Caplen and colleagues extended these studies in two tumor model systems in vivo by subcutaneous injection of 9L glioma tumors in rat or human A735 melanoma xenografts in nude mice [77]. Only upon application of all four viruses in the 9L rat model were neomycin-resistant cell cultures established from harvested tumor tissues. Molecular analysis of genomic DNA extracted from neomycin expressing 9L rat cultures, derived both in vitro and in vivo, showed the appropriate integration of the retroviral transgene cassette [77]. The human-xenograft nude mouse model system meant that Ad was not cleared in the time frame examined (4 weeks); hence efficacy was assessed as increases in G418R cells compared to single-hybrid Ad/RV-vector transgene transduction [77]. In the human-xenograft mouse model system, tumors har­ vested at 1, 3, and 4 weeks posttransduction displayed increased numbers 5 0 2 Murphy and Vile of neomycin-resistant colonies with time only upon transduction of the full complement of adeno-retroviral constructs. At 4 weeks, up to 7.2% of xenografted cells were retrovirally transduced. Transduction of tumors with Ad/RV vector alone yielded no increase in the number of neomycin-resistant clones. DNA extracted from the xenograft tumors, as for the rat model, only showed the presence of integrated proviral sequences when transduced with the full complement of adeno-retroviruses. Titers of retrovirus particles generated from the 9L rat glioma cells in vitro were dependent on the input m.o.i. of the adenoviruses, with maximum titers of up to 1 X 10^ iu/mL generated at m.o.i.s in the range of 200-300 for each virus [77]. Under these optimal conditions the presence of doxycycline (1 |JiM) enhanced the titers by a factor of 2000-fold [77]. Interestingly, in vivo similar numbers of clones were observed after the four-adenovirus transduction strat­ egy in the presence or absence of doxycycline: 30 and 20 colonies per 10^ cells plated. Less than one colony per 10^ plated cells was observed with the Ad/RV vector alone. These low transduction titers do, however, indicate the current inefficiencies of the system, which are reduced compared to other reports [72]. But the inefficiencies can to some extent be explained by the application of four separate Ad vectors for the system to function, significantly increasing the kinetic complexity of the generation of retroviral vector producer cells in vivo. Additionally, the poor efficiency of transduction of the rodent cells by Ad is emphasized by the required m.oi.s applied (>200) to generate optimum titers [77]. 2. Cooperative Adenoviral/Retroviral Vector Delivery Other mechanisms of combining the advantageous properties of ade­ noviral and retroviral vectors have involved combinatory application of the separate vectors. Delivery of the retroviral genome in the context of a retroviral particle (RV vector) coinfected with an adenovirus expressing the gag, pol, and env genes (Ad-gag/pol/env) has been reported [78]. Coinfection of the vectors into NIH 3T3 cells generated retroviral titers >10^ iu/mL. The advantages of this system over the hybrid Ad/RV-vector delivery of the transgene cassette are questionable, specifically from a cell-targeting aspect. Several groups have also recently demonstrated stable ecotropic retrovirus-mediated gene transduction of human cells using preinfection of Ad or AAV vectors expressing an ecotropic receptor [79-81]. In order to target retroviruses specifically to malignant hepatic tissues, an adenovirus expressing the ecotropic receptor under the control of a hepatoma-specific promoter [82, 83] was constructed. Although tissue-specific expression of the retroviral ecotropic receptor and subsequent tissue-specific targeting of ecotropic enveloped retroviral vectors was demonstrated in vitro [84], the clinical benefits of this system are limited. In essence, direct application of the tissue-specific promoter to expression of a therapeutic transgene in the adenoviral vector would be more beneficial. 17. Hybrid Adenoviral Vectors 5 0 3 3. Nonspecific Integration of RV LTR Cassettes in the Context of Ad Vectors? The studies presented above all emphasize the requirement of all the gag/pol and env components to derive stable integration of a RV LTR- flanked transgene cassette. However, a controversial report printed in Nature Biotechnology challenged that doctrine. Zheng and colleagues reported that an RV LTR-flanked cassette contained in an Ad vector (Ad/RV-vector) could integrate efficiently in the absence of the retroviral enzymatic proteins [85]. The group studied a conventional MoMuLV LTR-flanked luciferase reporter gene cloned in the El-deleted region of a first-generation Ad vector (AdLTR-Luc), analogous to previous hybrid Ad/RV-vectors. A variety of cells and tissues permissive to Ad infection (epithelial cells, macrophages, and hippocampal cells) were transduced in vitro and in vivo by the hybrid AdLTR-Luc, and compared with transduction by AdCMV-Luc, a vector containing the CMV promoter in place of the LTRs. The AdLTR-Luc vector was demonstrated to direct sustained luciferase expression compared to the CMV promoter-driven vector. Despite probable well-documented CMV promoter inactivation events, the authors present evidence for stable integration of the LTR-Luc cassette at sites within the LTR elements by a mechanism independent of classical retroviral integration. Fluorescence in situ hybridization (FISH) analysis using probes for the 5' LTR and the luciferase gene revealed integration of the AdLTR-Luc vector with an apparent frequency of 10-15% in vitro and 5% in vivo. Southern blot analysis also implied integration of the 5' LTR of the hybrid vector, which was subsequently supported by sequencing of the region adjacent to the 5' LTR integration site. No integration of the AdCMV-Luc was reported. The frequency of spontaneous Ad integration has previously been reported at much lower frequencies (10~^ to 10~^) [86], suggesting the presence of the retroviral LTR elements in the AdLTR-Luc somehow potentiates integration. The major question is whether an endogenous retrovirus is present in these cells; however, the authors reported negative results for reverse transcriptase activity. Additionally, the integration events reported are not classic retroviral integration as integration does not proceed at a conserved terminal position and results in the random loss of substantial terminal LTR sequence. In vivo studies involved injection of rat submandibular glands by retrograde ductal instillation of 1 x 10^ pfu/gland. After initial high luciferase expression, the levels plunged to near zero for AdCMV-Luc after 9 weeks but stabilized with AdLTR-Luc after 2 weeks, although at significantly reduced levels. Although these findings are consistent with low-level integration of the LTR cassette, no specific mechanism of integration has been proposed and alternative inter­ pretations of nonspecific LTR-independent mechanisms are probable. As no drug selection gene was present in the vectors, clonal populations were derived on the basis of sustained luciferase expression. Hence, considering first the 5 0 4 Murphy and Vile well-documented in situ inactivation of CMV promoters, specifically in the context of integration, luciferase expression would be absent in long-term cul­ tures transduced with AdCMV-Luc. Therefore, the studies with AdLTR-Luc may have inadvertently selected for random integration events within the 5' LTR that maintained luciferase expression. The probability of such an event is fairly significant considering the limited extent of genetic material upstream of the LTR cassette in the Ad vector (ITR and \|;). Additionally, with the high m.o.i.s applied, selection of high copy number-transduced cells is highly prob­ able, under which conditions spontaneous integration of the Ad vector is more probable. The sequencing data presented also demonstrate integration occur­ ring at sites within the U3 region of the 5' LTR for several clones that would ablate LTR promoter activity. The selection of these luciferase-expressing cells would more probably be due to multiple integration events, which were clearly demonstrated by FISH analysis [85], rather than integration site promoter effects. Integrated proviral sequences were not reported in animals that received the Ad/RV vectors alone in other similar studies [72, 77]. However these reports were looking specifically for retrovirus-mediated integration events and not the proposed alternative mechanisms reported by Zheng and colleagues [85]. The report by Caplen and colleagues [77] investigated the integration event based on the retroviral mechanism of reproducing the 3' LTR sequences to the 5' LTR structures [1]. The specific duplication of a

nucleotide restriction site upon retroviral replication was used as a marker of integration in Southern blot analyses. Analysis of a pooled population of neomycin-resistant colonies revealed efficient band size switching, indicative of the duplication event, and thus retroviral replication. However, consistent with the observation of Zheng [85], randomly integrated Ad-RV transgene cassette fragments could be seen in context of generalized hybridization of the probe to high-molecular- weight DNA from single-vector-transduced animals [77]. These bands were, however, weak and consistent with random integration. Further studies are therefore merited to evaluate the efficacy of integration of LTR-flanked cassettes in the context of an Ad vector to determine whether a specific mechanism does exist and whether it could be further refined for vector use. 4. Integration of Closed Circle Retroviral Cassettes Delivered by Adenoviral Vectors Following retroviral infection, reverse transcribed proviral DNA serves as a substrate for an integration reaction catalyzed by the retroviral integrase (Int) protein, which, along with viral Gag proteins, forms the preintegration complex [87]. This complex brings the 5' end of the 5' LTR (the U3 region) into close juxtaposition with the 3' end of the 3' LTR (the U5 region) [87]. The direct substrate for Int is most likely a linear, double-stranded molecule with blunt ends [88]. Int-mediated integration then occurs by a very precise mechanism 1 7 . H y b r i d A d e n o v i r a l Vectors 505 in which the terminal two base pairs of each LTR are lost prior to integration into the target cell genome [87, 89]. However, closed circular molecules have also been detected in the nuclei of retrovirally infected cells, which contain 2 LTRs joined covalently together at the so-called circle junction [87,90, 91]. Although there is considerable evidence that MoMuLV probably does not use a 2-LTR circle as the principal integration intermediate [S7^ 89, 92], it was hypothesized that it may still be possible for Int to use such a molecule as a template for integration if it were the only, or predominant, species delivered into the nucleus [87]. This hypothesis is supported by the existence of the 2-LTR circles in MoMuLV-infected cells [90] and evidence from the spleen necrosis virus (SNV) system that the LTR junction fragment can be an effective substrate for integration [91]. We investigated whether a 5' LTR-3 ' LTR junction fragment, in a closed circular DNA molecule excised from an incoming plasmid by Cre recombinase and in the absence of the preferred, linear viral DNA molecules, could be recognized by the retroviral integration machinery (Fig. 3). A fused LTR LTR Junction ITR 4 ^ ! ITR LoxP LoxP \ / Cre \ / Recombinase. \ / Genomic DNA Figure 3 Genomic integration of on adenovirolly delivered retroviral circular provirus cassette. A LoxP-flanked cassette containing a fused terminal LTR junction and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. The fused LTR junction contained in this circular proviral molecule is subsequently recognized by retroviral Integrase, directing integration into the host chromosome. 5 0 6 Murphy and Vile junction fragment was thus cloned, containing the entire 3' LTR and just 28 bp of the U3 region of the 5' LTR (Fig. 4A). This LTR junction together with the puromycin resistance gene was flanked by LoxP sites and was demonstrated to efficiently excise a circular proviral intermediate in vitro upon supply of Cre recombinase in trans [93]. Further studies in cell lines ^m^s-complementing gag/pol gene functions, together with Cre recombinase, generated long-term neomycin-resistant clones. Genomic DNA extracted from stable clones was used to investigate the proviral integration structures by utilizing a panel of diagnostic PCR primers. The PCR demonstrated that integration following plasmid transfection, Cre excision, and puromycin selection for >1 month can produce a very specific molecular structure which is distinct from that produced by random plasmid integration. PCR results demonstrated that the 5' and 3' LTRs, which are adjoining in the plasmid backbone, become separated by the intervening sequences of the retroviral vector genome (between the loxP sites). A molecule is thus generated in which the proviral genome is now bounded by the LTRs in a manner typical of Int-mediated integration (Fig. 3). Critically, the terminal two base pairs of both the 5' LTR (U3 region) and the 3' LTR (US region) were lost (Fig. 4B). Hence these studies confirm that a circular retroviral genome with terminally fused LTR structures can indeed serve as a substrate for the retroviral machinery. From this initial proof of concept, the LoxP cassette was subsequently assembled into an El-deleted Ad vector. The Ad virus is used to deliver the LTR junction fragment into the nuclei of cells; the proviral-like intermediate can then be excised from the Ad genome by the Cre/lox system and forms a template for Int-mediated integration. This hybrid Ad/RV system thus has the high transient titer of Ad vectors, does not depend upon cell division for infection, and leads to long-term gene expression via integration of a proviral transgene cassette. Delivery of the Lox-Puro-Junc.-Lox cassette in an Ad vector, in the presence of Cre and Gag and Pol allowed cloning of cells which are resistant to puromycin for long periods in culture. Without Cre, such clones were impossible to obtain. Moreover, these clones contain a molecular structure consistent with proviral integration by PCR and contain integration sites which, for the majority of the clones (seven of nine), are typical of Int- mediated, rather than random, integration processes (Fig. 4B). Codelivery of three separate Ad vectors, Ad-Gag/Pol, Ad-Cre, and Ad.LTR.Junc, was also able to produce long-term integrants. Therefore, we are currently optimizing the design and use of this novel hybrid vector system into a single, or double. Ad delivery system. Recent experiments have shown that Pol-expressed Int alone is sufficient to drive the integration of the Cre-excised proviral form in vitro without the need for additional Pol or Gag proteins. An Ad vector was thus cloned incorporating the Int gene in the same cassette as the transgene cassette to enable a two-vector transduction strategy, which is currently under investigation in our laboratory. This novel hybrid vector system presents great 17. Hybrid Adenoviral Vectors 507 3'LTR fi;'l.TR ^ U3»R»U5 1 1 U3-R»U5 TTCATT AATGAA " " - • > < — CCCGTCAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAGGTT 3'LTM 5'LTR 1 •U3"R>»U5 1 dlJi " • " " t 28bp ^ LTR FUSION JUNCTION Clone 1 CCi:ACAGGTGGGGTCriTCA GmCTTCM£mG Clone 2 CCTACAGGTGGGGTCTTFCACMiCZGfiMffilMIOTMIM^ Clone 3 CCTACAGGTGGGGTCTTTCA (MMMMMMMMMMMIG. CCTACA(XJTGGGGTCTTTCA2IXXMMXiCCM,III^^ Clone 4 C(jrACAGGTGGG(ITCrrrCA(KJGC(MIG€m€a Clone 5 CCTACAGGTGGGGTCTTTCA MJmTfCMIGTMMM^IlIIiMC Clone 6 CCTACAGilTGGGGTCITTCA CTA(E1I:MICCCAT(^ Clone 7 CCTACAGGTGGGGTCTTTCATTAATGAAAGACCCCCGCTGACGGGTAGT licit sec|iieiicecl Into genomic segment Clones TCATTAATGAAAGACCCCCGCTGACGGGTAGT/ICTGrGCCXTG B Figure 4 Sequencing of the integration junctions of the circular RV proviral cassette. (A) Schematic representation of the RV genome conformation in the noncovalently linked circular preintegration complex and the subsequently cloned fused LTR junction. (B) A human cell line expressing the retroviral gag/pol genes and Cre recombinase (TelCre) were infected with the Ad/RV hybrid vector expressing puromycin resistance. Colonies were selected which had stably integrated the RV proviral cassettes and the genomic DNA was extracted. The integration junctions were subsequently cloned by PCR amplification of religated restriction-digested fragments containing the integration site [93], which were subsequently sequenced through the integration site. 5 0 8 Murphy and Vile potential in enabling the stable transduction of all cells primarily infected by the Ad vectors. C. Adenoviral/Epstein-Barr Virus Hybrid Vectors An alternative application of the Cre/LoxP recombinase system of excis­ ing a circular proviral molecule from an Ad vector [93] has replaced the retroviral component w îth the genetic stability of the EBV replicon system [94, 95]. This hybrid Ad/EBV vector system utilizes Ad-mediated nuclear delivery of a Cre-excisable EBV replicon w^hich can be stably maintained as an EBV episome [96]. EBV episomes contain the EBV latent origin of replication (Orip) and the EBV nuclear antigen-1 (EBNA-1) which acts on Orip, driving episomal replication (Fig. 5A). Previous studies have demonstrated that EBV nuclear episomes are stably maintained through multiple cell divisions in primate and canine cells, replicating once during S phase and segregating to both daugh­ ter cells w îth approximately 95% efficiency [97]. Tan and colleagues flanked Orip and EBNA-1, together w îth the puromycin resistance gene, v^ith LoxP sites and cloned them into an El-deleted Ad vector [94]. How^ever, multiple attempts to make an adenovirus failed due to suspected inhibition of Ad replication upon binding of ENBA-1 to Orip. Hence a vector was assembled which only brought EBNA-1 upstream of its promoter following Cre excision of the proviral cassette (Fig. 5B), thus silencing its expression in the absence of Cre recombinase [94]. The resultant Ad/EBV hybrid vector stably transformed 37% of surviving canine D-17 cells to puromycin resistance following coinfec- tion with AdCre. The circular EBV replicons were maintained in daughter cells for 14 weeks, ^110 cell generations. Surprisingly, the puromycin resistance gene was also discovered in an integrated form, in the cellular chromosomal DNA [94]. Integration of EBV episomes has not been reported previously in human cells, although a differential function in the canine cells might be involved. One major limitation of the hybrid system was, however, that a large cell fatality was observed upon transduction with the Ad vector into the D-17 cells at the optimum transduction conditions (m.o.i. 30). This was discussed by the authors as a function of leaky Ad gene expression from the first-generation vector in the canine cells and not related to EBNA-1 toxicity [94]. Reports have previously shown that EBNA-1 does not elicit a cytotoxic T-cell response, due to the presence of a series of glycine-alanine repeats [98]. These repeats act in cis to prevent MFIC class I presentation by inhibiting antigen processing by the ubiquitous processing pathway [98]. A very similar Ad/EBV replicon vector has also been described in the context of an E4-deleted, second-generation Ad vector [99]. Coinfection of human cells with this vector, together with AdCre (also E4-deleted), resulted in efficient delivery and excision of the replicon in the absence of vector-induced toxicity. The replicons were maintained following successive cell divisions both 17. Hybrid Adenoviral Vectors 509 EBNA-1 OriP ^^^^^^Hs^§mKm. ITR LoxP Cre \ Recombinase. \ OriP Figure 5 Episomal replication and maintenance of a Cre-excised EBV replicon from an adenoviral vector. (A) A LoxP-flanked cassette containing the EBV origin of replication (Orip) nuclear antigen (EBNA-1) and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. Upon action of EBNA-1 on Orip, the circular cassette is efficiently replicated by the rolling circle mechanism, facilitating maintenance of the cassette in the infected cells. (B) In order to control the expression of the EBNA-1 genes, the promoter and gene are separated in the adenoviral cassette and become productively in line in the excised replicon form only following Cre-mediated excision. (C) By inserting the left LoxP site between the Ad LTR and ^ , leaky excision of Cre recombinase and subsequent premature excision of the LoxP cassette would render the resulting Ad vector nonpackageable due to elimination of ^ . This strategy eliminates contamination of the excised adenoviral form upon propagation of the hybrid Ad/EBV vector. 510 Murphy and Vile EBNA-1 Promoter ^^ ^̂ ^ - • • 5^—• No Expression of Gene. rm¥ lITR LoxP OriP LoxP Cre Recombinase EBNA-1 Gene Expression i Episomal B Replication OriP Figure 5 {continued) in vitro and in vivo^ suggesting efficient extrachromosomal replication as well as nuclear retention of the episome. The residual Ad backbones were, however, progressively lost by a dilution mechanism occurring in the absence of DNA replication [99]. As for all gene therapy vector systems, incorporation of all the compo­ nents into a single vector would simplify delivery and therapeutic efficacy. As for the previously described Cre-excisable RV provirus strategy [93], combina­ tion of the vector elements for the Ad/EBV has its limitations. Any expression of Cre recombinase would result in premature excision of the EBV replicon, specif­ ically upon initial Ad propagation. Wang and colleagues, however, enabled incorporation of all the components into a gutless helper-dependent (HD) Ad vector by use of a tissue-specific promoter to control Cre expression [100]. 17. Hybrid Adenoviral Vectors 5 1 1 Placing Cre under the control of a synthetic

promoter (HCR12), consisting of hepatic locus control elements from the human ApoE/C locus fused to the first intron of the human EFla gene, allowed adequate suppression of expression in 293 cells while permitting recombination and subsequent gene expression in the target tissue. However, promoter activity was not completely extinguished in all nonhepatic cells. In order to limit the effects of leaky Cre excision of the LoxP cassette, the Ad packaging signal was included in the excisable cassette (Fig. 5C). The placing of a LoxP site between the LTR and \|; has been demonstrated not to inhibit Ad expression extensively [13]. Thus leaky excision would remove \|/ from the Ad vector backbone, rendering the Ad genome nonpackageable and hence preventing contamination in the final viral stocks. Additionally, removal of \|/ from the cassette also eliminates the El enhancer elements, which are interlinked with the packaging elements, which have been reported to additionally limit leaky viral expression events from the adenoviral tripartite leader sequence (TPL) [100]. D. Hybrid Retroviruses Trafficking to the Nucleus While previously described strategies have focused on combining the advantageous properties of retroviruses into adenoviral vectors, research has also investigated the reverse scenario. An interesting study by Lieber and col­ leagues investigated the potential of inserting the nuclear localization functions of an adenovirus into a retrovirus [101]. The failure of MoMuLV to cross the nuclear membrane in the absence of cell division has limited retroviral vectors. Large proteins or complexes (>40-60 kDa), such as the retroviral preinte- gration complex, are too large to pass into the nuclear membrane by simple diffusion and require nuclear localization signals (NLSs). NLSs interact with cytoplasmic receptors initiating an energy-dependent multistep translocation into the nucleus. The efficient nuclear targeting properties of Ad vectors have made them ideal gene delivery vehicles. It is generally believed that NLSs in the preterminal protein (pTP) and the core protein V play a crucial role in directing the Ad genome complex to the nucleus. The Ad pTP binds alone or in a complex with the Ad polymerase to specific sequences at the termini of the adenoviral ITRs. Lieber and colleagues-investigated whether coexpression of pTP with retroviral DNA carrying pTP-binding sites would facilitate nuclear import of the preintegration complex and transduction of quiescent cells. Pre­ liminary experiments demonstrated successful nuclear import of plasmid DNA via the karyotypic pTP (in the presence or absence of Ad polymerase) into the nuclei of growth-arrested cells [101]. The pTP binding motif was initially established by engineering two head- to-head adenoviral ITRs, but was later reduced to an 18-bp terminal fragment of the ITR, deemed the minimum required unit [101]. Interestingly, attempts to introduce the full Ad ITR fragment into retrovirus vectors resulted in viruses 5 1 2 Murphy and Vile with very low titers (<10^ iu/mL), indicating adverse effects on retroviral replication. The minimal ITR 18mer oligonucleotide, however, allowed high- titer retrovirus production. The pTP binding site was placed in the center of the recombinant vector between hAAT and neo in order to avoid potential interference of pTP binding on preintegration complex stoichiometry. Results demonstrated that the incorporation of the pTP karyotypic machinery in the context of the retroviral backbone could indeed efficiently translocate the RV genome across the nuclear divide. pTP-mediated transduction was, however, always less than in proliferating cells, possibly indicating weak binding to the viral DNA, which is supported by AdPol increasing nuclear import and transduction. Alternatively the nuclear matrix binding properties of pTP could interfere with the retroviral transduction functions. Disappointingly, however, pTP nuclear import of MoMuLV DNA in nondividing cells was found not to be sufficient for stable transduction. Undetermined additional cellular factors activating during S phase and/or DNA repair are required for efficient retroviral integration [101]. E. Hybrid Adenoviral/Adeno-Associated Virus Vectors Incorporation of AAV nuclear retention functions into hybrid Ad vectors has also become a great interest in gene therapy. AAV vectors have emerged strongly as candidates for gene therapy, being nonpathogenic and presenting a mechanism of stable integration into a specific locus of the human host chromosome. The terminal ITR structures contain all the c/s-acting elements required to drive episomal replication, host genome integration and packaging into infectious AAV particles [102-105]. The rep gene products mediate the amplification of the AAV genome and facilitate site-specific integration into the human chromosome 19ql33^ termed AAVSl [106, 107]. In the context of double-stranded circular DNA plasmid vectors, the presence of the two AAV ITRs was demonstrated to be sufficient to rescue an AAV genome from the plasmid backbone and to mediate its integration into host DNA [108, 102]. These findings paved the way to the development of AAV vectors and initiated the application of AAV genomes in hybrid vector systems. The ITR-flanked AAV cassettes were subsequently demonstrated to also be efficiently rescued from the backbones of other viral vectors. In cultured cells, AAV integrates into the host chromosome with a relatively low frequency of 1 X 10""^ to 3 X 10~^ genomes per cell, with alternative episomal replication of its genome permitting long-term persistent expression in cells [109]. However, the integration efficiency can be enhanced by stimulation of the host DNA repair machinery by gamma irradiation or topoisomerase inhibitors [110,111]. The only requirements for AAV integration and episomal concatemerization appear to be the presence of AAV ITRs and as-yet-undetermined cellular factors [102, 103, 108]. 17. Hybrid Adenoviral Vectors 513 Following the hybrid Ad/RV studies, AAV ITR-flanked transgene cas­ settes have been similarly applied in the context of an Ad backbone. AAV ITR cassettes can be efficiently rescued from Ad genomes and assembled into AAV particles upon the supply of rep and cap functions in trans [15]. In the absence of the cap genes, Ad-mediated delivery of the AAV ITR cassettes can result in its stable integration into the host genome, in the presence or absence of the rep genes (Fig. 6). However, studies on the relationship between Ad and AAV demonstrate a strong interference of AAV on the Ad life cycle [112]. Although the precise mechanism is undetermined, rep expression is sufficient to suppress the maturation of Ad replication centers [113]. Hence the major complica­ tion in the union of the Ad/AAV hybrid vector system has been strategies to facilitate rep expression in the context of an adenoviral vector. The AAV rep gene encodes four proteins that are expressed from indepen­ dent promoters (Fig. 7A). The Rep68 and Rep78 differentially spliced products are expressed from the P5 promoter and individually are capable of catalyzing AAV genome integration [114, 115]. The poorly characterized Rep40 and Rep52 proteins are expressed from the PI9 promoter and, although having Ad AAV Ad ITR hF iHlTR + Rep 19ql3.3 (AAVSl) Genomic Integration: - Rep Random Transgene AAV Genomic DNA Figure 6 Hybr id-Ad/AAV vector-mediated integration of the AAV ITR cassettes. Infection of cells with the hybrid A d / A A V vector enables precise excision of the ITR-flanked cassette from the adenoviral genome, v/hich can subsequently be integrated into the host genome. This mechanism can occur in the absence or presence of the AAV Rep proteins. In the presence of Rep the cassette is predictably integrated into the AAVSl locus on human chromosome 19. 514 Murphy and Vile Rep SA SD Cap llliiiil ̂ ^̂ ^̂ "̂ -»- 3'rrR P5 P19 P40 Cap Structural Proteins VPl,VP2andVP3. Rep78 Splicing Rep68 Rep52 Splicing A Rep40 Rep SA<SD P5 P19 P40 Rep78 B Promoter ^ Rep78 rm LoxP LoxP ^ v Cre Recombinase. - • Rep78 EXPRESSION rmpr LoxP Figure 7 Control of the expression of the AAV Rep proteins in the context of their inhibitory effects on Ad production. (A). Schematic representation of the AAV genome. Three promoters are contained in the AAV genome: P5 and p i 9 control expression of the alternatively spliced Rep68/78 and Rep40/52 transcripts, respectively, while P40 controls expression of the Cap gene products. (B) In order to restrict expression from the Rep cassette to just the Rep78 form, a point mutation was introduced into the PI 9 promoter's ATG start site, preventing Rep40/52 expression, and a similar mutation in the P5 transcript's splice site eliminated Rep68 expression. (C) In order to further restrict Rep78 expression from the Ad vector, a LoxP cassette flanking a poly(A) stop site was cloned between the Rep78 gene and its promoter. This cassette completely silences Rep78 by preventing translation by premature termination at the introduced poly(A) site. Cre-mediated excision removes this cassette, permitting Rep78 expression to proceed. 17. Hybrid Adenoviral Vectors 5 1 5 similar catalytic properties to the other proteins, their function is undetermined and believed to be distinct from Rep68/78 [116]. Recchia and colleagues inves­ tigated amplification conditions that v^ere likely to minimize Rep inhibition of vector production [117]. Specifically, PI9 promoter expression of Rep52 and Rep40 v̂ âs reported to impose significant inhibitory functions to Ad replica­ tion, although Rep68 and Rep78 functions w êre also apparent. To minimize the complications of Rep-mediated interference of Ad production, the expres­ sion of Rep proteins w âs restricted to just the Rep78 isotype, by inactivating the Rep52 and 40 transcripts by ATG mutation and preventing Rep68 splicing by similar point mutations at the splice site (Fig. 7B). Rep79 was placed under the control of either the T7 promoter, a promoter previously applied to the production of adenoviruses expressing toxic genes, or the a 1-antitrypsin (alat) liver-specific promoter, to additionally minimize any interference. The AdT7- Rep78 shuttle vector w âs successfully recombined in 293 cells to generate the Ad vector, whereas shuttle vectors containing the wild-type Rep, or only expressing the Rep52 and —40 isotypes, did not yield any viral plaques. The functionality of the AdT7-Rep78 vector was demonstrated in an AAV rescue study [117]. As expression from the a la t promoter restricts expression to hepatic tissues, Ueno and colleagues applied an alternative Cre/LoxP bacteriophage PI system as a switch to regulate Rep expression from an Ad vector [118]. A LoxP-flanked cassette containing a transcriptional silencing sequence (SV40 poly(A)) was cloned between the Rep78 gene and its CAG promoter (Fig. 7C). Hence upon Cre recombinase expression the LoxP cassette is excised, uniting promoter and transgene and allowing transcription to proceed. The authors failed to yield any virus with Rep78 driven by the CAG promoter in the absence of the Lox-stop cassette. The vector system thus required a third Ad expressing Cre (AdCre) to be coexpressed with AdLoxP-Rep78 and the Ad/AAV hybrid vector. Only upon application of all three vectors to HeLa cells (m.o.i.s of 10 to 20) was site-specific integration into AAVSl detected by PCR analysis of genomic DNA [118]. As with the previous systems, incorporation of all the vector components into a single gutless vector is a major aim. The application of Cre recombinase would thus, as with the previous Ad/EBV replicon system [94], require tightly controlled expression to be incorporated into the same helper-dependent (HD) vector as the LoxP cassette. 1. Helper-Dependent Ad/AAV Recchia and colleagues furthered the studies of Ad/AAV hybridology by incorporating the system into HD Ad vectors [117]. The system applied a similar two-vector strategy with the AAV ITR transgene cassette and Rep78 genes on separate gutless vectors, HD-AAV and HDalat-Rep78, respectively. The gutless Ad constructs consisted of the terminal c/s-acting regions of the Ad genome (ITRs and ^\r) together with the transgene cassette(s), as well as 5 1 6 Murphy and Vile additional inert staffer sequences, to bring the vector genome size above the efficient packaging size threshold (>27kb) [35]. Large-scale production of HDalat-Rep78 generated titers of 3 x 10^ iu from 5 x 10^ cells, indicating 50-100 Rep-expressing viruses per cell could be produced. This HDalat- Rep78 virus expressed Rep78 selectively in hepatic cells (Hep3B). Rescue of the AAV-ITR transgene cassette from HD-AAV into infectious AAV particles was observed upon coinfection of Hep3B cells w îth HDalat-Rep78 and w îld- type Ad2 helper. No AAV rescue w âs detected upon elimination of any of the three vector components, demonstrating the functionality of each component. Coinfection of HD-AAV w îth HDalat-Rep78 into a number of cell lines of hepatic origin showed stable integration of the AAV transgene cassettes into the host cell genome specifically at AAVSl, by nested PCR analysis. Southern blotting, and integration site junction sequencing [117]. FISH studies on HepG2 cells infected with both vectors demonstrated targeted integration to AAVSl in 14 of 39

(35%) metaphases analyzed. In the absence of the Rep78 vector only one integration in chromosome 19 was observed in 34 metaphases analyzed (3%). Hence, the study by Recchia and colleagues demonstrates that Rep78 expression increases the targeted integration of AAV-ITR-flanked DNA without affecting the overall integration frequency in cells of hepatic origin [117]. In contrast to other studies on 293 cells [114,119,120], however, Rep78 did not increase the stable transduction efficiency on the hepatic cell lines investigated, which was believed to be due to cell-type effects [117]. The next advance in this study will be incorporation of both cassettes into a single HD Ad vector. This will be much more complex than originally perceived considering the action of Rep78 on the AAV cassette, especially in the high copy number context of adenovirus production. Additionally, considering the Rep-independent processing of the AAV ITR cassette, the fate of the cassette at high copy number in the producer cells would be of great interest. 2. Generation of Mini-Ad/AAV Hybrid Vectors by in Vitro Hybridization Inverted repeat (IR) sequences inserted into first generation Ad vector genomes were recently reported to mediate precise genomic rearrangements resulting in vector genomes devoid of all viral genes but which were efficiently packaged into functional Ad virions [121]. These genomes were generated by a ^m/zs-recombination between two Ad genomes exchanging sequences either side of the IR regions. Hence two species are generated. Firstly, a small genome containing only the transgene cassette flanked on both sides by precisely duplicated IRs, Ad packaging signals (i|/), and Ad ITRs (Fig. 8). Second, a larger genome is generated containing the transgene cassette flanked by the IRs and also the rest of the Ad genome (Fig. 8). The presence of the Ad packaging signal only in the mini-genome product meant that only this form could be packaged, whereas the larger genome just facilitated helper 17. Hybrid Adenoviral Vectors 5 1 7 Figure 8 Generation of mini-Ad genomes by recombination between inverted repeat (IR) regions. The presence of IR regions in adenoviral cassettes enables precise recombinations between different Ad genomes within the IR regions. This recombination generates mini-Ad genomes with the precisely replicated IR cassettes being flanked at either end by Ad ITR and ^ sequences. A second, much larger, recombinant species is also generated which also contains a precisely replicated IR cassette but is flanked on either side by the rest of the adenoviral genome. This larger recombinant, as well as being of a size nonpackageable into an adenoviral virion, lacks the Ad ^ and hence is not packaged. In contrast, the smaller mini-Ad genomes can be efficiently assembled into adenoviral particles assembled by the larger genome's helper functions. functions. Application of this precise recombination mechanism to generate mini-Ad genomes deleted of all viral genes could minimize the immunogenicity apparent with first-generation vectors. By modifying the IR regions to increase the efficiency of recombination, further selection for the recombinant mini- genomes could be achieved [121]. The mini-Ad virions could be efficiently separated on CsCl gradients by buoyant density, v\̂ ith great resolution from the larger helper viral genomes enabling efficient purification. The generation of the recombinant mini-Ad genomes was very efficient (^5 X 10"̂ genomes per cell) and did not depend on the sequences within or adjacent to the IRs [121]. The mini-Ad vectors efficiently infected cultured cells with the same efficiency as first-generation vectors. However, in the absence of any vector selection in the cell (episomal replication or integration), transgene expression was only transient (^7 days) due to the instability of the deleted genomes within transduced cells. 5 1 8 Murphy and Vile Lieber and colleagues further developed the system to incorporate AAV cassettes into a hybrid vector system [121]. The AAV ITRs flanking the trans- gene cassette vŝ ere used as the IRs to mediate the recombination event, as well as stimulating transgene integration into the host genome of transduced cells. The Ad-AAV vectors efficiently generated mini-genomes by IR recombination as by-products of first generation Ad-AAV vector amplification. The mini- genomes containing only the transgene flanked by AAV ITRs, Ad \I/s, and Ad ITRs could be efficiently assembled in Ad capsids and purified to high titers and purity. The mini-Ad-AAV hybrid vectors transduced cells w îth efficiencies comparable to AAV, but w êre less efficient than conventional Ad vectors due to elevated particle to infectious unit ratios [121]. Since the hybrid mini-vectors contained no cytotoxic viral genes, the hybrid virus could be applied at very high m.o.i.s to increase transduction rates. The AAV transgene cassettes ran­ domly integrated into the host cell genomes as head-to-tail concatemers, as shown by Southern blot analysis and pulsed-field gel electrophoresis. Amplification of Ad-AAV hybrid vectors in 293 cells routinely yielded final mini-Ad-AAV genome titers of 5 x 10^^ genomes per milliliter, or '^lO'^ packaged genomes per 293 cell, comprising 10% of the total number of adenoviral virions [121]. The 5.5 kDa mini-Ad-AAV hybrid vectors which contain two Ad packaging signals were, however, packaged approximately fivefold less efficiently than the corresponding full-length genomes [121]. These results are compatible with the published observations that Ad vector genomes of less than 27 kb package with much reduced potentials compared to full- length genomes [35]. Additionally, contamination of mini-Ad-AAV hybrid vector preparations with the parental Ad-AAV hybrid vector was less than 0 .1%, consistent with conventional gutless Ad purification [13]. The efficiency of vector production measured on a genome-per-cell basis was reported to be comparable to or higher than the labor-intensive techniques for AAV production. The transducing titers expressed as neomycin-resistant colonies per milliliter were 9 x 10^ for AAV and 2.5 x 10^ for the mini-Ad-AAV hybrid vector [121]. These results present significant clinical promise for mini-Ad/AAV hybrid vectors in the clinic. IV. Conclusion The establishment of hybrid Ad vectors incorporating the advantageous properties of other viruses greatly expands their therapeutic potential. In the early 1990s, after the initial decade of proof-of-concept for Ad-mediated gene therapy, the main focus was on limiting the immunogenicity of the vectors to enhance transgene expression. Further restricting the expression of the highly immunogenic late viral transcripts by E4 deletions or by complete deletion of all viral genes in the gutless vectors notably enhanced transgene expression [11-13, 35]. However, complete ablation of immunogenicity is 17. Hybrid Adenoviral Vectors 5 1 9 restricted by the highly inflammatory nature of the Ad particles themselves in the absence of viral expression. While suppression of specific immune responses can counter these effects to some extent, in many disease states w^here the immune system is already compromised this rationale is not ideal. Pseudotyping the Ad vectors vv̂ ith alternative surface moieties does, hov^ever, offer great potential. First, novel surface structures can be introduced v^hich can reduce the immunogenicity of the viral particles by either shielding or replacing the highly immunogenic w^ild-type structures. Future research may permit the complete replacement of the viral external domains with immune- tolerated surface structures. Second, the introduction of new^ targeting ligands v îll enable selected infection of desired tissue populations, limiting the required vector doses. Additionally, the avoidance of infection of nontargeted tissues, specifically cells of the immune system, v îll negate potentially immunogenic signalling w^hich the vectors can initialize upon receptor docking. It is now^ w êll accepted that the immune system is not the major limiting factor in the transient expression attained from Ad vectors. The absence of a specific mechanism of long-term retention of the viral genomes in infected cells is critical. As presented at the start of this chapter, the rapid lytic life cycle of w^ild-type adenoviruses does not require long-term persistence of the genomes. Adenovirus infection, genome replication, virion packaging, and lysis of the host cell are generally completed w^ithin 48 h. While these properties have proved highly beneficial in the area of vector production, they do not aid in vivo stability. By combining the long-term stable persistence mechanisms of other viral systems into the Ad vectors, the efficacy of Ad-mediated gene therapy has been significantly enhanced. A number of mechanisms have been presented in this chapter for the combination of adenoviral and retroviral vectors. Initial applications utilized Ad vectors to deliver RV packaging functions to producer cells in vitro^ in attempts to increase the efficiency of RV production. From these initial studies, the potential of the hybrid Ad/RV vectors for the establishment of RV producer cell in vivo w âs realized. As producers of RV packaging cells in vitro, the Ad/RV hybrid vector system has a number of advantages over conventional packaging cell lines. RV titers generated from transient plasmid- transfected producer cells are generally several orders of magnitude low^er than the best stable clones [3]. Therefore, as the Ad/RV hybrid system has been demonstrated to generate RV titers of the same orders of magnitude as conventional producer cells, it bypasses the need to isolate clonal populations and makes scaling up production more manageable. The requirement of GMP screening for replication-competent adenoviruses (RCA), as w êll as replication- competent retroviruses (RCR), w^ould, how^ever, be a concern. The separation of the different retroviral components on separate viruses, as well as limiting the potential of RCR, makes pseudotyping very simple. For instance, in the treatment of specific tissues, an envelope gene best suited for tropism to that 5 2 0 Murphy and Vile tissue can be easily incorporated into the vector system. The separation also enables characterization of individual RV components. Application of the individual Ad/RV hybrid vectors at varying m.o.i.s enables study of the RV production at varying copy load. Additionally, as different target tissues have been v^ell documented to have different potentials as RV producer cells, the hybrid Ad/RV system enables the rapid screening of tissues for their suitability as RV producer cells. How^ever, this measure of suitability is also influenced by the susceptibility of the cells to Ad transduction. Understanding the effects of saturating RV components could allov\̂ us to determine w^hat factors need to be further regulated in future hybrid vectors to enable enhanced RV production both in vitro and in vivo. Elucidation of host factors vital to efficient assembly of RV particles w^ould be very valuable. In future vectors, these host factors could be codelivered or upregulated to enhance RV titers. One major question is: w^hat advantages does the hybrid Ad/RV vector system have over conventional Ad or RV delivery? The ability to establish RV producer cells in vivo following Ad infection is a major step forw^ard in gene therapy. Previous methods of ex vivo transduction with retroviral vectors and reimplantation are laborious and inefficient. Vector spread is limited by the restricted migratory properties of the reimplanted cells. Application of the hybrid Ad/RV vector enables a noninvasive therapy with enhanced distribution and infectivity in target tissues. The subsequent local release of retroviral particles following adenoviral transduction also tackles the problem of inserting high levels of vector deep into the middle of tissue or tumor masses, rather than to just the peripheral layers. The major advantage over conventional Ad vectors is the establishment of a stable population of transgene-expressing cells in the surrounding tissues, through RV integration, following the initial transient Ad transduction. This permanency of therapeutic transgene has major implications in the clinic, specifically for the treatment of inherited diseases. The separation of the RV genes, as well as the introduction of additional regulatory elements carried on separate rAds, instills a multiple- vector transduction strategy. Vector systems involving more than one vector are limited by codelivery kinetics. The greater the number of individual vectors, the lower the probability that a cell will receive the full vector repertoire to allow retroviral production to occur. Therapeutic transgene expression can, however, proceed from the adenoviral vector itself, initiating an initial boost of gene expression, followed by a secondary level of sustained expression in RV transduced cells. Currently, however, the secondary phase of RV expression is much reduced compared to the initial Ad-mediated expression. This would minimize the sustained therapeutic effect of the vector system. Nevertheless, this hybrid Ad/RV vector system has great potential for the treatment of genetic disorders. The dual transduction properties of the Ad/RV hybrid vector also present the possibility of combinatory gene therapy where the Ad and RV portions 17. Hybrid Adenoviral Vectors 5 2 1 of the vector provide different therapeutic effects. This mechanism could have specific advantages to the treatment of

cancer. The initial Ad transduction could act to initially immunostimulate the tumor mass, aiding a break in tolerance by drav^ing in immune effector cells and initiating a "danger signal." The secondary RV transduction could deliver a cytoreductive transgene aimed at tumor cell killing, to eliminate tumor tissue and further immunostimulate the tumor environment. A major limitation of the system is the requirement of active cell division in neighboring cell populations to enable RV transduction. Hence, inserting a gene in the Ad vector, separate from the retroviral cassette, could trigger cell division of neighboring tissues so that they become fully receptive to the subsequently available retrovirus. An alternative strategic context of application could be applied to tumors, v^here the actively dividing tumor tissue is generally surrounded by virtually quiescent normal tissue. Utilizing a highly regulated cytotoxic gene, under the control of an inducible or tissue-specific promoter system, the primary Ad infection would enable production of retroviral particles w^hich in theory v^ould selectively infect dividing tumor cells. Subsequent cytotoxic gene expression could, to some extent, restrict cell killing to tumor cells. Ad-mediated delivery of an excisable closed circular RV cassette that can subsequently be integrated into the host genome w^ould be of great value to gene therapy in the clinic. The system provides the potential to direct stable transgene expression in each primarily Ad-infected cell. This would be a significant advance on the previous Ad/RV hybrid system, where the secondary RV transduction is extensively reduced compared to the primary Ad transduction. Although the closed circular form is not the primary substrate for retrovirus integration, in the absence of the wild-type substrate, Int has been demonstrated to integrate such structures into the host genome. While the efficiency of such a system has still to be addressed, further elaboration of the integration mechanism could enable increased affinity of the RV machinery for closed-circle LTR proviral forms. The system would also have the potential of combinatory gene therapy by the inclusion of transgene cassettes within or outside the integrating RV cassette. Transgenes outside the excisable cassette would provide transient expression for the duration of the Ad genome retention in infected cells. The integrated cassette could provide stable expression for the lifetime of the cell. The major advance of this system will come from the development of highly regulated expression systems that can completely silence Cre expression. Silencing of Cre recombinase expression would enable assembly of all the vector components into a single gutless HD Ad vector. Although the system proposed by Wang and colleagues [122] goes some way to prevent expression, the system is still leaky and restricts therapeutic application to hepatic tissue. The alternative strategy of maintaining a Cre-excised circular molecule by utilizing the EBV episomal replication system provides another potentially 5 2 2 Murphy and Vile powerful gene therapy vector, providing many of the advantageous properties detailed above. The Ad/EBV hybrid system would again require absolute con­ trol of Cre expression to combine all the components into a single vector. One limitation of this system is that EBNA-1 gene expression would have to be permanently maintained in the host cell, which could involve long-term cell regulatory or immunological problems in vivo. Conversely, the integration mechanism requires only transient expression of integrase to facilitate inte­ gration, and the transgene cassette is then maintained in the context of host cell chromosome replication. While the EBV replicon has the advantage of avoiding integration-related shutdown of transgene expression, other cellular factors are believed to be involved in the eventual loss transgene expression. EBV retention in human cells has been deemed limited and lost with time [123, 124]. Without drug selection, plasmids carrying the EBV elements are lost from human cells at rates of between 1 and 5% per generation [125]. The Ad/AAV hybrid vector system provides a powerful mechanism of maintained transgene expression by integration or episomal replication. The system also provides the potential of predictable integration at a specific locus in the human genome in the presence of Rep78. The establishment of targeted integration strategies introduces valuable safety features into a gene-therapy protocol. This advantageous property of integration also carries with it the potential hazard of insertional mutagenesis and the risk of activating cancer oncogenes in vivo. Although there are limited literature reports on the impact of such phenomena in a gene therapy protocol, as vector technology increases and the efficiencies of integration in human tissues are potentiated, these effects could become more significant. However, even in the context of the targeted integration of AAV, the exact phenotype of integration at chromosome 19^5^13.4, as well as the activity of genes integrated at such a locus are still to be determined. The generation of the mini-Ad/AAV hybrid vectors enables the high-titer purification of adenoviral particles deleted of all the Ad genes, analogous to the HD rationale. The mechanism of preparation and purification, however, appear to be simpler. The Ad/AAV hybrid vector is applied to the producer cells as an Ad, which also supplies the helper functions. This bypasses the necessity of HD plasmid transfection and subsequent serial passage to enhance titers to enable purification from the contaminating helper virus. The extensive size difference of the derived mini-Ad/AAV genomes, from the parental Ad/AAV genomes, also enables more efficient purification by buoyant density on CsCl gradients. Additionally, any contaminating parental vector will be a functional Ad/AAV hybrid vector. The biological stability of these mini-adenoviruses, in terms of both particle stability outside the cell and genome stability within the cell, still needs to be addressed. Nevertheless, considering the integration of the ITR AAV cassettes, the mini-Ad genome stability is not as important. Additionally although the transduction efficiency of the mini-Ad particles is 17. Hybrid Adenoviral Vectors 5 2 3 similar to AAV, the ratio of total particles to infectious virions is enhanced, limiting their efficiency compared to conventional Ad vectors. The vector is also limited in terms of codelivery of the rep gene, v^hich unlike the HD vectors cannot be easily incorporated into the same vector. HSV-based hybrid vectors have also been w êll reported in literature, presenting a number of advantageous properties over the described Ad-based systems. The development of the HSV-1 amplicon technology and helper-free packaging systems has made HSV-based vectors very promising clinical tools for gene therapy [39]. The large insert capacity of the amplicons (150 kb) and the concatemer-styled packaging, w îth up to 10 genome copies per virion introduces pov^erful features to gene therapy vectorology [25]. HSV vectors, like Ads, have tropism for most cells in the human body, but have particular affinity for neuronal tissues. The HSV-1-based amplicons do not, how^ever, retain the episomal maintenance functions of the parental herpes viruses and thus, as w îth Ad vectors, the genomes are rapidly lost in dividing cells. Hence, hybrid technology has been investigated to enhance the expression from HSV amplicon vectors. As w îth the Ad/AAV hybrid system, the presence of an AAV ITR-flanked cassette in the HSV amplicon vector can promote both extra- chromosomal amplification and integration of the transgene cassette into the host genome. The HSV/AAV hybrid vector system has been demonstrated to stably transform dividing cells for over 25 passages in culture [126]. Hepatic transduction in vivo v^ith an HSV/AAV hybrid vector supported gene expres­ sion in vivo for considerably longer periods than traditional HSV-1 amplicons, w îth minimal toxicity and immunogenicity [119]. An additional feature of the HSV/AAV studies w âs the placement of the rep gene under the control of its ow n̂ promoter, as literature has reported potential dov\An-regulation feedback inhibition of transcription v^hen Rep levels increase [127]. Thus the natural expression machinery of Rep is utilized to regulate its expression. Compared to Ad vectors, the HSV amplicon vector titers are limited (lO'̂ to 10^ iu/mL). Increased copy number can compensate for reduced titers in some fields of gene therapy, although for many corrective genetic therapies higher transduction efficiencies from higher titer viral applications may prove more efficacious. The reduced immunogenicity of the HSV-1 amplicons is, how^ever, a major advantage over Ad vectors. Other hybrid vectors have also combined RV and EBV functions w^ithin the HSV-1 amplicons, v^hich also have great potential as gene delivery vectors [123, 124, 128] The development of hybrid viral vector systems has thus revolution­ ized the way gene therapy vectors are conceived. The combination of the advantageous properties of different vectors goes some v^ay to establishing a vector system approaching the ideologies of a perfect gene transfer vehicle. The technologies are, how^ever, in their infancy and many factors need to be elucidated before the full potentials of the vectors can be achieved. In essence, further detailed elucidation of the viral life cycles and their interactions w îth 5 2 4 Murphy and Vile host cell factors is necessary. Understanding these factors will allow vectors to be developed which can interact with the host cellular machinery to facilitate long-term stable gene expression. Future "hybrid" vectors will be developed quite distinct from the currently perceived parental vectors. Virtually synthetic viral vectors will be established with predictable biological properties, which can effect desired clinical functions. The vast array of clinical phenotypes and biological properties of target tissues involved in human disease will, however, require a wide spectrum of clinical vectors, fashioned to specific disorders. Nevertheless, the current advances in gene therapy technology will ensure that hybrid viral vectors will play a major role in future clinical protocols. References 1. Coffin, J. M. (1996). Retroviridae: The viruses and their repHcation. In "Fundamental Virology" (B. N. Fields et ai, Eds.), 3rd ed., pp. 771-813. Raven Press, New York. 2. Vile, R. G., and Russell, S. J. (1995). Retroviruses as vectors. Br. Med. Bull. 51, 139-158. 3. Cossett, F. -L., Takeuchi, Y., Battini, J. -L., Weiss, R. A., and CoUins, M. K. L. (1995). High titer packaging cells producing recombinant retroviruses resistant to human complement. / . Virol. 69, 7430-7436. 4. Zhang, W. W. (1997). Review: Adenovirus vectors: Development and application. Exp. Opin. Invest. Drugs 6, 1419-1457. 5. Shenk, T. (1996). Adenoviridae: The viruses and their replication. In "Fields Virology" (B. N. Fields et ai, Eds.), 3rd ed. Vol. 2, pp. 2111-2148. Lippincott-Raven, New York. 6. Bett, A. J., Prevec, L., and Graham, F. L. (1993). Packaging capacity and stability of human adenovirus type 5 vectors./. Virol. 67, 5911-5921. 7. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characterisation of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-72. 8. Bett, A. J., Haddara, W., Prevec, L., and Graham, F. L. (1994). An efficient and flexible system for construction of adenovirus vectors with inserts or deletions in early regions 1 and 3. Proc. Natl. Acad. Set USA 91, 8802-8806. 9. Gorziglia, M. I., Kadan, M. J., Yei, S., Lim, J., Lee, G. M., Luthra, R., and Trapnell, B. C. (1996). Elimination of both El and E2a from adenovirus vectors further improves prospects for in vivo human gene therapy. / . Virol. 70, 4173-4178. 10. Fang, B., Wang, H., Gordon, G., Bellinger, D. A., Read, M. S., Brinkhous, K. M., Woo, S. L. C , and Eisensmith, R. C. (1996). Lack of persistence of El-recombinant adenoviral vectors containing a temperature-sensitive E2A mutation in immunocompetent mice and hemophilia B dogs. Gene Ther. 3, 217-222. 11. Armentano, D., Zabner, J., Sacks, C , Sookdeo, C. C , Smith, M. P., St. George, J. A., Wads- worth, S. C , Smith, A. E., and Gregory, R. J. (1997). Effect of the E4 region on the persistence of transgene expression from adenovirus vectors./. Virol. 71, 2408-2416. 12. Wang, Q., Greenburg, G., Bunch, D., Farson, D., and Finer, M. H. (1997). Persistent trans- gene expression in mouse liver following in vivo gene transfer with a 5E1/5E4 adenovirus vector. Gene Ther. 4, 393-400. 13. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, A., and Graham, F. L. (1996). A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 14. Berns, K. I. (1991). Parvoviridae and their replication. In "Fundamental Virology" (B. N. Fields et al., Eds.), 3rd ed., pp. 817-837. Raven Press, New York. 17. Hybrid Adenoviral Vectors 5 2 5 15. Kremer, E. J., and Perricaudet, M. (1995). Adenovirus and adeno-associated virus-mediated gene-transfer. Br. Med.

Bull. 51, 31-44. 16. Flotte, T. R., Afione, S. A., and Zeitlin, P. L. (1994). Adeno-associated virus vector gene expression occurs in nondividing cells in the absence of vector DNA integration. Am. J. Resp. CellMol. Biol. 11, 517-521. 17. Russell, D. W., Miller, A. D., and Alexander, I. E. (1994). Adeno-associated virus vectors preferentially transduce cells in S phase. Proc. Natl. Acad. Set. USA 91, 8915-8919. 18. Walsh, C.E., Liu,J. M., Xiao, X., Young, N. S., Nienhuis, A. W., and Samulski, R. J. (1992). Regulated high level expression of a human gamma-globin gene introduced into erythroid cells by an adeno-associated virus vector. Proc. Natl. Acad. Set. USA 89, 7257-7261. 19. Linden, R. M., Ward, P., Giraud, C , Winocour, E., and Berns, K. I. (1996). Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA 93, 11,288-11,294. 20. Muzyczka, N. (1992). Use of AAV as a general transduction vector for mammahan cells. Curr. Top. Micro. Immunol. 158, 97-129. 21. Verma, I. M., and Somia, N. (1997). Gene therapy — promises, problems and prospects. Nature 389, 239-242. 22. Roizman, B., and Sears, A. E. (1991). Herpes simplex viruses and their replication. In "Fundamental Virology" (B.N. Fields etal., Eds.), 3rd ed., pp. 849-895. Raven Press, New York. 23. Efstathiou, S., and Minson, A. C. (1995). Herpes virus-based vectors. Br. Med. Bull. 51, 45-55 . 24. Huard, J., Akkaraju, G., Watkins, S. C., PikecavalcoH, M., and Glorioso, J. C. (1997). LacZ gene transfer to skeletal muscle using a replication-defective herpes simplex virus type 1 mutant vector. Hum. Gene Ther. 8, 439-452. 25. Kwong, A. D., and Frenkel, N. (1995). Biology of herpes-simplex virus (HSV) defective viruses and development of the amplicon system. In "Viral Vectors" (M. G. Kaplitt and A. D. Loewy, Eds), pp. 25-42 . Academic Press, New York. 26. Frenkel, N., Singer, O., and Kwong, A. D. (1994). The herpes simplex virus amplicon — A versatile defective virus vector. Gene Ther. l(Suppl. 1), S40-S46. 27. Wong-Staal, F. (1991). Human immunodeficiency viruses and their replication. In "Funda­ mental Virology" (B. N. Fields et al., Eds.), 3rd ed., pp. 709-723. Raven Press, New York. 28. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and Trono, D. (1997). Multiply attenu­ ated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotech. 15, 871-875. 29. Xiao, X., Li, J., and Samulski, R. J. (1998). Production of high-titer recombinant adeno- associated virus vectors in the absence of helper adenovirus. / . Virol. 72, 2224-2232. 30. Yang, Y., Jooss, K. U., Su, Q., Ertl, H. C. J., and Wilson, J. M. (1996). Immune response to viral antigens versus transgene product in the elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther. 3, 137-144. 31. Burns, J. C., Friedmann, T., Driever, W., Burrascano, M., and Yee, J. K. (1993). Vesicular Stomatitis virus G glycoprotein pseudotyped retroviral vectors: Concentration to very high titers and efficient transfer to mammalian and non-mammalian cells. Proc. Natl. Acad. Sci. USA 90, 8033-8037. 32. Weitzman, M. D., Kyostio, S. R. M., Kotin, R. M., et al. (1994). Adeno-associated virus (AAV) Rep protein mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91, 5808-5812. 33. Miller, D. B., Adam, M. A., and Miller, A. D. (1990). Gene transfer by retrovirus vectors occurs only in Cells that are actively replicating at the time of infection. Mol. Cell Biol. 10, 4239-4242. 34. Poeschla, E. M., Wong-Staal, F., and Looney, D. J. (1996). Development of HIV vectors for anti-HIV gene therapy. Proc. Natl. Acad. Sci. USA 93, 11,396-11,399. 5 2 6 Murphy and Vile 35. Parks, R. J., and Graham, F. L. (1997). A helper-dependent system for adenovirus vec­ tor production helps define a low^er limit for efficient DNA packaging. / . Virol. 71, 3293-3298. 36. Vos, J. -M. H. (1995). Herpesviruses as genetic vectors. In "Viruses in Human Gene Ther­ apy." Carolina Academic Press and Chapman and Hall, Durham, NC, and London. 37. Gough, M. J., and Vile, R. G. (1999). Different approaches in the gene therapy of cancer. Forum 9, 225-236. 38. Yang, Y., Li, Q., Ertl, C. J. H., and Wilson, J. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy w îth recombinant adenoviruses./. Virol. 69,2004-2015. 39. Fraefel, C , Song, S., Lim, F., Lang, P., Yu, L., Wang, Y., Wild, P., and Geller, A. L (1996). Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells. / . Virol. 70, 7190-7197. 40. Yei, S., Mittereder, N., Te, K., O'SuUivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1, 192-200. 41. Worgall, S., Wolff, G., Falck-Pedersen, E., and Crystal, R. G. (1997). Innate immune mech­ anisms dominate elimination of adenoviral vectors following in vivo administration. Hum. Gene Ther. 8, 37-44. 42. Kieff, E., and Liebowitz, D. (1991). Epstein-Barr virus and its replication. In "Fundamental Virology" (B. N. Fields et al., Eds.), 2nd ed., pp. 897-928. Raven Press, New York. 43. Rapp, F., Melnick, J. L., Brutel, J. S., and Kitahara, T. (1964). The incorporation of SV40 genetic material into adenovirus 7 as measured by intranuclear synthesis of SV40 tumor antigen. Proc. Natl. Acad. Sci. USA 52, 1348-1352. 44. Lewis, B. A., TuUis, G., Seto, E., Horikoshi, N., Weinmann, R., and Shenk, T. (1995). Ade­ novirus ElA proteins interact with the cellular YYl transcription factor. / . Virol. 69, 1628-1636. 45. Freund, C. T., Tong, X. W., Block, A., Contant, C. F., Kieback, D. G., Rowley, D. R., and Lerner, S. P. (2000). Adenovirus-mediated suicide gene therapy for bladder cancer: Com­ parison of the cytomegalovirus- and Rous sarcoma virus-promoter. Anticancer Res. 20, 2811-2816. 46. Chen, L., Perlick, H., and Morgan, R. A. (1997). Comparison of retroviral and adeno- associated viral vectors designed to express human clotting factor IX. Hum. Gene Ther. 8, 125-35. 47. Jackson, R. J., and Kaminski, A. (1995). Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond. RNA 1, 985-1000. 48. Yee, J. K., Friedmann, T., and Burns, J. C. (1994). Generation of high-titer pseudotyped retroviral vectors with very broad host range. Methods Cell Biol 43(A), 99-112. 49. Schnierle, B. S., Stitz, J., Bosch, V., Nocken. F., Merget-Millitzer, H. Engelstadter, M., Kurth, R., Groner, B., and Cichutek, K. (1997). Pseudotyping of murine leukemia virus with the envelope glycoproteins of HIV generates a retroviral vector with specificity of infection for CD4-expressing cells. Proc. Natl. Acad. Sci. USA 94, 8640-8645. 50. Emi, N., Friedmann, T., and Yee, J. K. (1991). Pseudotype formation of murine leukemia virus with the G protein of vesicular stomatitis virus. / . Virol. 65, 1202-1207. 51. Pensiero, M. N., Wysocki, C. A., Nader, K., and Kikuchi, G. E. (1996). Development of amphotropic murine retrovirus vectors resistant to inactivation by human serum. Hum. Gene Ther. 7 ,1095-1101. 52. Diaz, R. M., Eisen, T., Hart, L R., and Vile, R. G. (1998). Exchange of viral promoter/enhancer elements with heterologous regulatory sequences generates targeted hybrid vectors to enhance both local and systemic antitumor effects of HSVtk or cytokine expression in a murine melanoma model. / . Virol. 72, 789-795. 17. Hybrid Adenoviral Vectors 5 2 7 53. Danno, S., Itoh, K., Baum, C , Ostertag, W., Ohnishi, N., Kido, T., Tomiwa, K., Mat- suda, T., and Fujita, J. (1999). Efficient gene transfer by hybrid retroviral vectors to murine spermatogenic cells. Hum. Gene Ther. 10, 1819-1831. 54. Kass-Eisler, A., Leinwand, L., Gall, J., Bloom, B. and Falck-Pedersen, E. (1996). Circumvent­ ing the immune-response to adenovirus-mediated gene-therapy. Gene Ther. 3, 154-162. 55. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, L, Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falckpedersen, E., Hackett, N. R., Crystal, R. G., and MastrangeU, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 56. MastrangeU, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, L, Crystal, R. G., and Falck- Pedersen, E. (1996). Sero-switch adenovirus-mediated in vivo gene-transfer — Circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 57. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector w îth a type 17 fiber enhances gene transfer to human airway epithelia. / . Yirol. 73, 8689-8695. 58. Croyle, M. A., Stone, M., Amidon, G. L., and Roessler, B. J. (1998). In vitro and in vivo assessment of adenovirus 41 as a vector for gene delivery to the intestine. Gene Ther. 5, 645-54. 59. Kelleher, Z. T., and Vos, J. M. (1994). Long-term episomal gene delivery in human lymphoid cells using human and avian adenoviral-assisted transfection. Biotechniques 17, 1110-1117. 60. Paillard, F. (1997). Advantages of non-human adenoviruses versus human adenoviruses. Hum. Gene Ther. 8, 2007-9. 61. Hofmann, C , Loser, P., Cichon, G., Arnold, W., Both, G. W., and Strauss, M. (1999). Ovine adenovirus vectors overcome preexisting humoral immunity against human adenoviruses in vivo./. Virol. 73, 6930-6936. 62. Moffatt, S., Hays, J., HogenEsch, H., and Mittal, S. K. (2000). Circumvention of vector- specific neutralizing antibody response by alternating use of human and non-human adenoviruses: implications in gene therapy. Virology 272, 159-67. 63. Wickham, T. J. (2000). Targeting adenovirus. Gene Ther. 7, 110-114. 64. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endotheHal and smooth muscle cells by using bispecific antibodies./. Virol. 70, 6831-6838. 65. Wickham, T. J., Tzeng, E., Shears, L. L, 2nd, Roelvink, P. W., Li, Y., Lee, G. M., Brough, D. E., Lizonova, A., and Kovesdi, L (1997). Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. / . Virol. 71, 8221-8229. 66. Shinoura, N., Yoshida, Y., Tsunoda R., Ohashi, M., Zhang, W., Asai, A., Kirino, T., and Hamada, H. (1999). Highly augmented cytopathic effect of a fiber-mutant ElB-defective adenovirus for gene therapy of gliomas. Cancer Res. 59, 3411-3416. 67. Duisit, G., Salvetti, A., MouUier, P., and Cosset, F. L. (1999). Functional characterization of adenoviral/retroviral chimeric vectors and their use for efficient screening of retroviral producer cell lines. Hum. Gene Ther. 10, 189-200. 68. Rettinger, S. D., Kennedy, S. C , Wu, X., Saylors, R. L., Hafenrichter, D. G., Flye, M. W., and Ponder, K. P. (1994). Liver-directed gene therapy: Quantitative evaluation of promoter elements by using in vivo retroviral transduction. Proc. Natl. Acad. Sci. USA 91,1460-1464. 69. Salmons, B., Sailer, R. M., Baumann, J. G., and Gunzburg, W. H. (1995). Construction of retroviral vectors for targeted delivery and expression of therapeutic genes. Leukemia 9(Suppl. 1), S53-S60. 70. Noguiez-Hellin, P., Meur, M. R., Salzmann, J. L., and Klatzmann, D. (1996). Plasmoviruses: Nonviral/viral vectors for Gene Therapy. Proc. Natl. Acad. Sci. USA 93, 4175-4180. 5 2 8 Murphy and Vile 71. Culver, K. W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E. H., and Blaese, R. M. (1992). In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors. Science 256, 1550-1552. 72. Feng, M., Jackson, W. H, Jr., Goldman, C. K., Rancourt, C , Wang, M., Dusing, S. K., Siegal, G., and Curiel, D. T. (1997). Stable in vivo gene transduction via a novel aden­ oviral/retroviral chimeric vector. Nat. Biotech. 15, 866-870. 73. Kaplan, A. H., Manchester, M., Smith, T., Yang, Y. L., and Swanstrom, R. (1996). Condi­ tional human immunodeficiency virus type 1 protease mutants show no role for the viral protease early in virus replication. / . Virol. 70, 5840-5844. 74. Gossen M., and Bujard H. (1993). Anhydrotetracycline, a novel effector for tetracycUne controlled gene expression systems in eukaryotic cells. Nucleic Acid Res. 21, 4411-4412. 75. Yang, Y., Vanin, E. F., Whitt, M. A., Fornerod, M., Zwart, R., Schneiderman, R. D., Grosveld, G., and Nienhuis, A. W. (1997). Inducible, high-level production of infectious murine leukemia retroviral vector particles pseudotyped with vesicular stomatitis virus G envelope protein. Hum. Gene Ther. 6, 1203-1213. 76. Yoshida, Y., Emi, N., and Hamada, H. (1997). VSV-G-pseudotyped retroviral packaging through adenovirus-mediated inducible gene expression. Biochem. Biophys. Res. Commun. 232,379-382. 77. Caplen, N. J., Higginbotham, J. N.,

Scheel, J. R., Vahanian, N., Yoshida, Y., Hamada, H., Blaese, R. M., and Ramsey, W. J. (1999). Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6, 454-459. 78. Lin, X. (1998). Construction of new retroviral producer cells from adenoviral and retroviral vectors. Gene Ther. 5, 1251-1258. 79. Bertran, J., Miller, J. L., Yang, Y., Fenimore-Justman, A., Rueda, F., Vanin, E. F., and Nien­ huis, A. W. (1996). Recombinant adeno-associated virus-mediated high-efficiency, transient expression of the murine cationic amino acid transporter (ecotropic retroviral receptor) permits stable transduction of human HeLa cells by ecotropic retroviral vectors. /. Virol. 70, 6759-6766. 80. Qing, K., Bachelot, T., Mukherjee, P., Wang, X. S., Peng, L., Yoder, M. C , Leboulch, P., and Srivastava, A. (1997). Adeno-associated virus type 2-mediated transfer of ecotropic retrovirus receptor cDNA allows ecotropic retroviral transduction of established and primary human cells./. Virol. 71, 5663-5667. 81. Scott-Taylor, T, H., Gallardo, H. F., Gansbacher, B., and Sadelain, M. (1998). Adenovirus facilitated infection of human cells with ecotropic retrovirus. Gene Ther. 5, 621-629. 82. Huber, B. E., Richards, C. A., and Krenitsky, T. A. (1991). Retroviral-mediated gene therapy for the treatment of hepatocellular carcinoma: An innovative approach for cancer therapy. Proc. Natl. Acad. Sci. USA 88, 8039-8043. 83. Bui, L. A., Butterfield, L. H., Kim,J. Y., Ribas, A., Seu, P., Lau, R., Glaspy, J. A., and McBride, W. H., and Economou, J. S. (1997). In vivo therapy of hepatocellular carcinoma with a tumor-specific adenoviral vector expressing interleukin-2. Hum. Gene Ther. 8, 2173-2182. 84. Uto, H., Ido, A., Hori, T., Hirono, S., Hayashi, K., Tamaoki, T., and Tsubouchi, H. (1999). Hepatoma-specific gene therapy through retrovirus-mediated and targeted gene transfer using an adenovirus carrying the ecotropic receptor gene. Biochem. Biophys. Res. Commun. 265,550-555. 85. Zheng, C , Baum, B. J., ladarola, M. J., and O'Connell, B. C. (2000). Genomic integration and gene expression by a modified adenoviral vector. Nat. Biotechnol. 18, 176-180. 86. Harui, A., Suzuki, S., Kochanek, S., and Mitani, K. (1999). Frequency and stability of chromosomal integration of adenovirus vectors./. Virol. 73, 6141-6146. 87. Brown, P. O. (1990). Integration of retroviral DNA. In "Retroviruses. Strategies of Replica­ tion" (R. Swanstrom and P. K. Vogt, Eds.), pp. 19-48. Springer Verlag, Berlin. 17. Hybrid Adenoviral Vectors 5 2 9 88. Varmus, H. E., and Swanstrom, R. (1985). Replication of retroviruses. In "RNA Tumor Viruses" (R. Weiss, N. Teich, H. Varmus and J. Coffin, Eds.), pp 75-134. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 89. Brown, P. O., Boweman, P., Varmus, H. E., and Bishop, J. M. (1989). Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein. Proc. Natl. Acad. Set. USA 86, 2525-2529. 89. Panganiban, A. T., and Temin, H. M. (1984). Circles with two tandem LTRs are precursors to integrated retrovirus DNA. Cell 36, 673-679. 90. Shoemaker, C , Goff, S., Gilboa, E., Pasking, M., Mitra, S. W., and Baltimore, D. (1980). Structure of a cloned circular Moloney murine leukemia virus molecule containing an inverted segment: Implications for retrovirus integration. Proc. Natl. Acad. Sci. USA 77, 3932-3936. 92. Lobel, L. I., Murphy, J., and Goff, S. P. (1989). The palindromic LTR-LTR junction is not an efficient substrate for proviral integration. / . Virol. 63, 2629-2637. 93. Murphy, S. J., Chong, H., Bell, S., Diaz, R. M., and Vile, R. G. A novel integrating adenovi­ ral/retroviral hybrid vector for gene therapy. Submitted for publication. 94. Tan, B. T., Wu, L., and Berk, A. J. (1999). An adenovirus-Epstein-Barr virus hybrid vector that stably transforms cultured cells with high efficiency. / . Virol. 73, 7582-7589. 95. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 96. Sugden, B., Marsh, K., and Yates, J. (1985). A vector that replicates as a plasmid and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr virus. Mol. Cell. Biol. 5, 410-413. 97. Yates, J. L., and Guan, N. (1991). Epstein-Barr virus-derived plasmids replicate only once per cell cycle and are not amplified after entry into cells. / . Virol. 65, 483-8 . 98. Levitskaya, J., Sharipo, A., Leonchiks, A., Ciechanover, A., and Masucci, M. G. (1997). Inhibition of ubiquitin/proteasome-dependent protein degradation by the Gly-Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc. Natl. Acad. Sci. USA 94, 12,616-12,621. 99. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 100. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre­ gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 101. Lieber, A., Kay, M. A., and Li, Z. Y. (2000). Nuclear import of moloney murine leukemia virus DNA mediated by adenovirus preterminal protein is not sufficient for efficient retroviral transduction in nondividing cells./. Virol. 74, 721-734. 102. Xiao, X., Xiao, W., Li, J., and Samulski, R. J. (1997). A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle. / . Virol. 71, 941-948. 103. Yang, C. C , Xiao, X., Zhu, X., Ansardi, D. C , Epstein, N. D., Frey M. R., Matera A. G., and Samulski, R. J. (1997). Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro. / . V/Vo/. 71, 9231-9247. 104. Duan, D., Sharma, P., Yang, J., Yue, Y., Dudus, L., Zhang, Y., Fisher, K. J., and Engel- hardt, J. F. (1998). Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue./. Virol. 72, 8568-8577. 5 3 0 Murphy and Vile 105. Wu, P., Phillips, M. L, Bui, J., and Terwilliger, E. F. (1998). Adeno-associated virus vector- mediated transgene integration into neurons and other nondividing cell targets. / . Virol. 72, 5919-5926. 106. Weitzman, M. D., Kyostio, S. R., Kotin, R. M., and Owens, R. A. (1994). Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91, 5808-5812. 107. Walker, S.L., Wonderling, R. S., and Owens, R. A. (1997). Mutational analysis of the adeno-associated virustype 2 Rep68 protein helicase motifs. / . Virol. 71, 6996-7004. 108. Balague, C , Kalla, M., and Zhang, W. W. (1997). Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. / . Virol. 71, 3299-3306. 109. Rutledge, E. A., and Russell, D. W. (1997). Adeno-associated virus vector integration junc­ tions./. Virol. 71, 8429-8436. 110. Alexander, I. E., Russell, D. W., Spence, A. M., and Miller, A. D. (1996). Effects of gamma irradiation on the transduction of dividing and nondividing cells in brain and muscle of rats by adeno-associated virus vectors. Hum. Gene Ther. 7, 841-850. 111. Russell, D. W., Alexander, I. E., and Miller, A. D. (1995). DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proc. Natl. Acad. Sci. USA 92, 5719-5723. 112. Carter, B. J., Laughlin, C. A., de la Maza, L. M., and Myers, M. (1979). Adeno-associated virus autointerference. Virology 92, 449-62. 113. Weitzman, M. D., Fisher, K. J., and Wilson, J. M. (1996). Recruitment of wild-type and recombinant adeno-associated virus into adenovirus replication centres. / . Virol. 70, 1845-1854. 114. Surosky, R. T., Urabe, M., Godwin, S. G., McQuiston, S. A., Kurtzman, G. J., Ozawa, K., and Natsoulis, G. (1997). Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. / . Virol. 71, 7951-7959. 115. Lamartina, S., RoscilU, G., Rinaudo, D., Delmastro, P., and Toniatti, C. (1998). Lipofection of purified adeno-associated virus Rep68 protein: Toward a chromosome-targeting nonviral particle./. Virol. 72, 7653-7658. 116. Berns, K. I., and Linden, R. M. (1995). The cryptic life style of adeno-associated virus. Bioessays. 17, 237-245. 117. Recchia, A., Parks, R. J., Lamartina, S., Toniatti, C., Pieroni, L., Palombo, F., CiUberto, G., Graham, F. L., Cortese, R., La Monica, N., and Colloca, S. (1999). Site-specific integration mediated by a hybrid adenovirus/adeno-associated virus vector. Proc. Natl. Acad. Sci. USA 96,2615-2620. 118. Ueno, T., Matsumura, H., Tanaka, K., Iwasaki, T., Ueno, M., Fujinaga, K., Asada, K., and Kato, L (2000). Site-specific integration of a transgene mediated by a hybrid adenovirus/adeno-associated virus vector using the Cre/loxP-expression-switching system. Biochem. Biophys. Res. Commun. 273, 473-478. 119. Fraefel, C., Jacoby, D. R., Lage, C., Hilderbrand, H., Chou, J. Y., Alt, F. W., Breakefield, X. O., and Majzoub, J. A. (1997). Gene transfer into hepatocytes mediated by helper virus-free HSV/AAV hybrid vectors. Molec. Med. 3, 813-825. 120. SheUing, A. N., and Smith, M. G. (1994). Targeted integration of transfected and infected adeno-associated virus vectors containing the neomycin resistance gene. Gene Ther. 1, 165-169. 121. Lieber, A., Steinwaerder, D. S., Carlson, C. A., and Kay, M. A. (1999). Integrating adenovirus-adeno-associated virus hybrid vectors devoid of all viral genes. / . Virol. 73, 9314-9324. 122. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre­ gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 17. Hybrid Adenoviral Vectors 5 3 1 123. Wang, S., and Vos, J. M. (1996). A hybrid herpesvirus infectious vector based on Epstein-Barr virus and herpes simplex virus type 1 for gene transfer into human cells in vitro and in vivo. / . Virol. 70, 8422-8430. 124. Sena-Esteves, M., Saeki, Y., Camp, S. M., Chiocca, E. A., and Breakefield, X. O. (1999). Single-step conversion of cells to retrovirus vector producers with herpes simplex virus-Epstein-Barr virus hybrid amplicons./. Virol. 73, 10,426-10,439. 125. Yates, J. L., Warren, N., and Sugden, B. (1985). Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313, 812-815. 126. Jacoby, D. R., Fraefel, C , and Breakefield, X. O. (1997). Hybrid vectors: A nev^ generation of virus-based vectors designed to control the cellular fate of delivered genes. Gene Ther. 4, 1281-1283. 127. Labow, M. A., Hermonat, P. L., and Berns, K. I. (1986). Positive and negative autoregulation of the adeno-associated virus type 2 genome. / . Virol. 60, 251-258. 128. Savard, N., Cosset, F. L., and Epstein, A. L. (1997). Defective herpes simplex virus type 1 vectors harboring gag, pol, and env genes can be used to rescue defective retrovirus vectors. / . Virol. 71,4111-4117. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease I: Cancer Raj K. Batra,*'§ Sherven Sharma/^ and Lily Wu,*'§ *Division of Pulmonary and Critical Care Medicine Veterans Administration Greater Los Angeles Health Care System Los Angeles, California ^Wadsworth Pulmonary Immunology Laboratory University of California, Los Angeles Los Angeles, California ''^Departments of Urology and Pediatrics ^University of California, Los Angeles School of Medicine and Jonsson Comprehensive Center Los Angeles, California I. Introduction The development of molecular therapeutics for the treatment of human disease has a rational and predictable course. Because these therapeutics are generally derived from an understanding of molecular mechanisms underlying a disease process, the treatment strategies are hypothesis-driven and specifically targeted toward a pathway underlying the molecular and cellular pathogenesis. Accordingly, in addition to establishing therapeutic efficacy, the evaluation of a molecular therapeutic also confirms the importance of a specific genetic or biological pathway in the pathogenesis of a disease process. The evaluation of a molecular therapeutic typically begins by providing a molecular/cellular proof of concept in vitro, followed by an expansion of therapeutic princi­ ples and toxicological analyses of the intervention in animal models, and finally a systematic sequence of safety and clinical efficacy trials in human subjects. Logically, gene therapy paradigms using adenoviral (Ad) vectors can be expected to proceed along this course in order to be considered for the treatment of human disease. This chapter will focus on the use of animal ADENOVIRAL VECTORS FOR GENE THERAPY 5 3 3 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 3 4 Batra ef al. models in the process of evaluating adenoviral gene transfer strategies for the treatment of human cancer. In this respect, we v îll offer a personal perspective, concentrated on outlining principles rather than cataloging indi­ vidual

examples. Because the focus is on principles, the revievŝ v îll not be an inventory of the various experimental therapeutic strategies for cancer that utilize the adenoviral vector, although specific examples may be cited. Rather, ŵ e w îll use our background and experience to illustrate the prob­ lems inherent in testing experimental hypotheses in animal models of cancer, w îth the confidence that themes particular to our research may have broader applicability. Last, because the authors have an interest in utilizing Ad-gene transfer techniques for the treatment of lung and prostrate cancer, respectively, this chapter will emphasize experimental designs relevant to those clinical entities. A primary goal of in vivo/animal experimentation is to build on an in vitro proof-of-concept and to strengthen the rationale for clinical testing of an experimental therapeutic intervention. To justify animal studies, there should already be an existent pathophysiological rationale and/or in vitro experimental data suggesting that a strategy is likely to be effective. At this juncture, the investigator is faced w îth the formidable challenge of approximating a human disease in an animal model. Although animal models cannot be exact replicas of the human disease, they should, at the very least, provide useful molecular and cellular similarities to the pathogenesis and clinical manifestations of the target disease [1]. For a variety of reasons (low expense for breeding and maintenance, susceptibility to tumorigenesis, well-defined immunosuppressive states, feasible duration of experimental studies, etc.) mice are considered to be the prototypic animal model for experimentation. Ideally, a mouse model would mimic the target human disease in its etiology, genetics, clinical presentation, and progression. To model human lung cancer, for example, the ideal mouse model would systematically (in defined pathological stages) develop lung cancer from exposure to cigarette smoke, and the disease could be characterized by sequential gene defects that culminate in the clinical progression that typifies the human disease. Second, in designing the experimental approach, the investigator must also take into consideration the "pharmacological intervention or drug" (the Ad vector here) that is being tested. Because the ideal drug should have reliable delivery, specific targeted distribution and mechanism of action, and predictable elimination, the challenge to test an adenoviral vector based ther­ apeutic in an apt animal model becomes particularly daunting for a gene therapist. Thus, to test whether an Ad-based therapeutic will have efficacy for the treatment of human cancer, we must (1) model the complex human disease in vivo and then (2) test a multifaceted biological compound with ill-defined pharmacokinetic and pharmacodynamic properties that are likely 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 5 unique to the host and/or the disease state. In order to overcome the inher­ ent complexity of the problem, we have adopted an approach that uses a combination of models to overcome specific deficiencies that accompany each individually. Consequently, v ê utilize xenogeneic models (engraftment of het­ erologous tissue derived from donors of a different species, typically into an immunodeficient host) to study the therapeutic-gene effects and Ad vec­ tor-target cell interactions. Syngeneic (engraftment of tissue from genetically identical donors) and allogeneic (engraftment of tissues from a genetically dissimilar member of the same species) models are used to study host-tumor interactions in terms of immunological parameters and metastasis. To further discern the specific immunologic parameters important for tumor rejection in mice, specific knockout (targeted gene disruption) mice are utilized. Last, we extensively utilize transgenic (in this context, referring to the tissue-specific expression of a transforming oncogene) models to study the effects of a molec­ ular therapeutic in the setting of established orthotopic (referring to organ- or site-specific) malignancy. We believe that integrating the results of these indi­ vidual approaches w îll enable us to meet the goals of in vivo experimentation for advancing adenoviral gene therapy. II. Animal Models of Lung Cancer A. Human Lung Cancer Lung cancer is the leading cause of cancer-associated mortality in both men and w^omen. Although susceptibility to environmental carcinogens may be predetermined and foUov^ a pattern of autosomal dominant Mendelian inher­ itance [2, 3], lung cancer results from an accumulation of acquired genetic mutations [4-6]. In fact, it is suggested that 10-20 genetic mutations may be necessary for the development of lung cancer [7], although the discrete steps for the progression of a hyperplastic bronchial lesion to metaplasia and anaplasia have not been uncovered. Tobacco use is the strongest epidemiologic risk for the development of lung cancer and it is anticipated that approximately 10% of all smokers w îll develop lung cancer over their lifetime [8]. Current paradigms predict that lung cancer results from the w^idespread exposure of the carcinogen, leading to a process of "field cancerization," w^hereby the entire aerodigestive track is exposed to the offending agents and leads to the occurrence of synchronous and metachronous tumors [9]. The tobacco carcinogens apparently invoke the multiple clonal chromosomal abnormalities found throughout the airw^ays and alveoli of smokers [10, 11]. Following, the series of genetic mutations likely results in patterned aberrancies in signal transduction and cell-cycle pathw^ays, eventuating in malignant and metastatic phenotypes [12]. The general pattern of genetic changes are characteristic but 5 3 6 Batra ef a/. not specific for pathologic subtypes of lung cancer (see below). Overall, K-ras mutations are observed in 20-50% [13], p53 mutations are present in 50% [14], 60% exhibit reduced expression of pl6-ink4a [15, 16], and 30% show deletion of Rb, Small-cell lung cancers (SCLC) display a greater proclivity to c-m);c-amplification and a greater degree of p53 (80%) and rb mutations (90%). Chromosome 3p deletions, occurring at a chromosomal fragile site that includes the FHIT locus, are found in 50% of non-small-cell lung can­ cers (NSCLC) and in 90% of SCLC primary tumors [17]. Overexpression of the tyrosine growth factor receptor erbB2-neu is seen in 10-30% and overexpression oi bcl-2 [18] in 10-25% of NSCLC tumors [19]. Clinically, lung cancer is discriminated into SCLC and NSCLC categories by histopathology or cytopatholgy and by their characteristic clinical presenta­ tions and divergent responses to conventional cytoreductive therapies. NSCLC may be further subclassifed pathologically into squamous cell (SCCa), adeno­ carcinoma, broncho-alveolar cell carcinoma (BAC), adenosquamous (mixed pathology), or large-cell carcinoma. As noted above, the progression of lung cancer from a premalignant state to the clinical/pathological entity that is diag­ nosed in the vast majority of patients is unknown. This is because although the disease is prevalent, it is typically diagnosed when it has already spread outside the lungs and is pathologically advanced. Not surprisingly, because of the late stage of diagnosis, progressive genetic instability confers marked genetic and phenotypic heterogeneity within lung cancers, even in individual patients. The late stage of diagnosis also results in an absolute lack of premalignant material, making it difficult to assign specific roles for the genetic mutations in the systematic progression of lung cancer. Recently, however, some of the characteristic genetic mutations of lung cancer (e.g., loss of heterozygosity at chromosome 3/?, /?53 mutations) are being identified in microdissected dysplas- tic epithelium [20]. Similar observations are implicating the characteristic K-ras abnormalities in lung cancer as a correlate of mucinous differentiation [21]. A precursor to lung adenocarcinoma, a lesion pathologically termed alveolar atypical hyperplasia or AAH, is being advanced. AAH is described by increased cellular proliferation when compared to adjacent normal parenchyma and by immunohistochemical evidence of p53 stabilization, K-ras mutations, and c-erb-B2 overexpression [22-24]. The presence of these mutations in AAH may explain why such mutations may be detectable in sputum cytology spec­ imens that predate the onset of clinical lung cancer [25]. Identification of these early events are a particular focus of study because they may serve as genetic markers for malignant progression, or as targets of specific genetic or chemopreventative approaches. More relevant to this discussion, perhaps, these early events may be better modeled in murine models than late stage lung cancer (see below). Thus, there exists an inherent complexity in human lung cancer, and to precisely recapitulate the disease process in animals is not practical. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 7 B. Animal Models of Human Lung Cancer 1. Murine Lung Cancer and Transplantable Allografts Due to time of model development, ease of experimentation, and cost restraints, murine models of disease are the accepted standards. However, there are generic shortcomings in this approach. For example, cigarette smoke, w^hich is a strong epidemiological risk for the development of human lung cancer and is proximally responsible for approximately 85-90% of lung cancer cases in humans [26], is only w^eakly carcinogenic in mice [27, 28]. In addition, although both mouse and human lung adenocarcinomas may share common molecular defects [27], the histopathological repertoire of spontaneous or induced tumors in mice is very limited [29, 30], and morphologically, nearly all mouse lung tumors bear structural similarities only to BAG or well- differentiated adenocarcinomas. Consequently, whereas humans typically die from lung cancer of "late stage" metastatic disease, mice succumb to respiratory failure following the diffuse involvement of their lungs by "early stage" carcinoma in situ [1]. Spontaneous lung cancer develops in 3% of wild mice [31, 32] with strain-dependent sensitivity. Clones have been isolated from spontaneously arising tumors, and established as cultures in vitro. These cultures now serve as a readily available source for the generation of transplantable allografts. Many investigators, including our group [33-38] have extensively utilized line 1 alveolar carcinoma (L1C2), a murine lung cancer cell line that is syngeneic to BALB/c, and 3LL (Lewis lung cancer), which is syngeneic to C57B1/6. Usually, these cell lines are utilized to generate transplantable heterotopic (referring to a location outside of the organ of origin, typically subcutaneous) tumors in syngeneic mice. Our group has utilized these models to investigate, in general, the interplay between the immune system and the host. Both L1C2 and 3LL tumors are relatively "nonimmunogenic," as is human lung cancer, and immunogenetic strategies that modulate the immune system to generate an anti-tumor immune response can be systematically investigated in these models. However, other lung tumor-allografts, especially when cells are selected to express "marker antigens" to enable their easy detection in culture systems, may indeed become immunogenic. Notably, the transplantable allograft system is artificial, and all recipient hosts have a "stress" response to the implanted tumor that cannot be recapitulated in control animals. In addition, extrapolating anti-tumor responses in mice to humans is not a straightforward proposition, and many therapies that reliably "cure" tumors in inbred strains of mice are not as effective in humans. In part, these differences may be attributable to differences in immune responses in the two hosts. For example, cluster determinants (CD-antigens) in murine strains may not have homologous or functional cellular analogs in the human host. Laboratory animals used for medical experimentation are genetically inbred strains with reliable phenotypic characteristics. Although this feature 5 3 8 Batra et al. imposes a generic limitation on the extrapolation of results in lab animal studies to outbred populations, and thus, human disease, there are signifi­ cant advantages that need to be considered. The inbred nature of laboratory animals enable investigators to reliably establish disease in an animal host, and subsequently to study that disease process in controlled subsets. With respect to tumorigenesis, murine-A/J and SWR strains are the most sensi­ tive, BALB/c is of intermediate sensitivity, and DBA and C57BL/6 are the most resistant. Crosses betw^een susceptible and resistant inbred mouse strains may allows for the mapping of modifier loci for the development of lung cancer [39]. For example, it is reported that the propensity of strains to develop lung tumors correlates w îth a polymorphism in the second intron of K-ras [40]. Practical experience suggests that there are common genetic alterations affecting known tumor suppressor genes and proto-oncogenes occur during mouse lung carcinogenesis. Molecular abnormalities may also be shared w îth human lung cancer, and K-ras activation is a conspicuous example [41]. Human adenocarcinomas commonly carry K-ras mutations; most of these mutations are in codon 12 and are transversions of GGT to either TGT or GTT. It is postulated that these mutations occur early in lung cancer pathogenesis since they can be detected in sputum samples of smokers prior to the clinical diagnosis of lung cancer. Analogously, 80 to 90% of both spontaneous and chemically induced murine lung tumors con­ tain K-ras mutations. Moreover, K-ras mutations also occur early in murine

lung tumorigenesis, and remarkably, codon 12 is the site of genetic change induced by many chemical carcinogens [1]. Furthermore, a consistent loss of mouse chromosome region 4, an area that contains the mouse homolog of the human pl6-ink4a [42, 43], has been described to result in an allelic loss of the pl6-ink4a seen in 50% of mouse adenocarcinomas. Similarly, p53 mutations are found, albeit infrequently [44], although mouse chromosomal regions containing p53 and Rb more commonly exhibit LOH [43]. Reduced expression of Rb and pl6 and increased c-myc expression [39] have also been reported. These commonalties have suggested some to conclude that mouse and human lung carcinomas are sufficiently similar for the murine model to be informative [1], and have formed the rationale for the testing of chemo- preventative strategies [39] in mice. Analogously, these commonalties may be advanced to form the basis for the testing of genetic therapies in murine tumors as w êll. Mice strains also vary with respect to inducible-tumorigenesis. Generally, mice that are sensitive to the development of spontaneous lung tumors are also at the highest risk for chemically induced tumors [31] and form the basis for the quantitative carcinogenecity bioassays. Although a variety of agents, including urethane, metals, and concentrated components of tobacco smoke such as pol- yaromatic hydrocarbons and nitrosoamines [45, 46], can induce lung cancer in mice, tobacco smoke per se is only weakly carcinogenic [28]. Murine lung 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 9 tumors histologically resemble early lesions that originate peripherally (from type 2 alveolar cells or Clara cells) and simulate papillary or bronchioloalveolar cell cancer (BAG). In contrast, the bulk of human tumors are bronchogenic (arise in the airways) and, as described above, display a broad histopathologic variation. In fact, individual human lung cancers may be histologically hetero­ geneous; i.e., they often display mixed morphologies v^ithin the same tumor specimen. So how^ does one reconcile these differences betv^een murine lung cancer and human lung cancer, and moreover, can one generalize observations and results from one species to another, or even from one human being to another? When considered in the context of adenoviral gene delivery, there is a limiting paucity of in vivo data to generate any broad conclusion. On the contrary, our observations in vitro suggest that gene transfer into subtypes of human lung cancer is highly variable, and strategies directed toward achiev­ ing intratumoral gene transfer may require patient or disease-specific vector formulations [47]. The biological heterogeneity of human lung cancer drives our inves­ tigations along specified pathways, utilizing many different models and strategies to come up with viable treatment approaches. For instance, we believe that a systematic assessment of the efficiency and optimal route of adenoviral gene delivery in vivo into murine lung tumors and trans­ planted human xenografts needs to be performed. Researchers are beginning to identify the Ad-cellular attachment receptor (termed the Coxackievirus- adenovirus receptor (CAR) [48]) as a major determinant underlying effi­ cient transduction [49]. Along these lines, the scope and "polarity" of CAR expression in tumors in vivo needs to be defined. Thus, one focus of our program is to systematically evaluate gene transfer into these model sys­ tems using conventional and retargeted adenoviral vectors with the aim of optimizing a vector system and a mode of delivery. This focus evolves from the premise supported by our in vitro data that the histological heterogeneity of lung tumors may be a harbinger of variable responsive­ ness to both adenoviral entry and/or the efficacy of adenoviral gene ther­ apy [47]. Because uniform targeting of tumor in vivo may be unattainable, we have also generated protocols in which the Ad-vector is used in pre­ cisely controlled ex vivo "dosing" approaches to genetically modify antigen- presenting cells (APCs) or tumor cells to vaccinate the host against their tumor [37]. 2. Murine Models That Spontaneously Develop Lung Cancer Murine models of lung cancer include strains susceptible to chemically induced tumors and transgenic strains that express viral and cellular onco­ genes. The simian virus-40 large T-Ag (SV40-TAg) has been commonly used to produce tumors in transgenic mice [50, 51]. SV40-TAg binds and inca­ pacitates the cell cycle checkpoint and DNA-binding capabilities of the p53 5 4 0 Batra ef aL and Rb gene products, resulting in uncontrolled cellular proliferation [52]. To develop a murine model of lung cancer, Wikenheiser and colleagues chose to express the SV40-TAg under the transcriptional control of the lung-specific human surfactant protein C (SP-C) promoter in transgenic mice [53, 54]. They demonstrated that these mice consistently developed multifocal lung adenocarcinomas that had pathological features similar to some human lung adenocarcinomas, and that the mice succumbed to respiratory distress by age 4 - 5 months. As expected, the transgenic animals developed no tumors in any other organ systems, although some nonmalignant tissue also expressed the transgene [53]. Within the lungs, tumors consistently involved the bronchi- olar and alveolar regions of the lung while sparing the large airw^ays. The tumors of these mice also varied w îth respect to the expression of the large TAg, suggesting perhaps that SV-40 TAg may contribute to transformation, but continued expression may not be necessary for tumor progression. Like­ wise, organ-specific expression of SV40-TAg using the regulatory regions of uteroglobin [55] and the Clara cell-specific Mr 10,000 protein (CC-10) also results in the induction of lung tumors [56]. Uteroglobin is a marker protein for the nonciliated epithelial Clara cells, the source of xenobiotic metabolism in the lung, lining the respiratory and terminal bronchioli of the lungs. In animals expressing SV40-TAg under the uteroglobin promoter control, the pulmonary epithelium was morphologically normal at 2 months, dysplastic by 4 months, and transgenic animals were described as developing multifocal pulmonary adenocarcinoma present in various stages of differentiation by 5 months of age. In situ hybridization studies suggested that tumors did not contain the transcripts of the uteroglobin gene, and again, late stage tumors lost expression of the large T-Ag. Tumors also formed in the urogenital tract where uteroglobin is also expressed. Transgenic mice were also generated using the CCIO kDa promoter driving SV-40 large T-Ag [56]^ and it is in this model that we have chosen to test the immunomodulatory capacity of secondary lymphoid chemokine or sic [36]. In the 7736 mouse fine, CC-lOTAg-transgenic mice develop multifocal pulmonary adenocarcinomas and succumb to respiratory failure at 16-20 weeks of age. Pathology is localized to the lungs, and the tumors express the large T-Ag in normal Clara cells and in transformed tumor cells. Pathological progression is similar to that described above, with the lungs appearing morphologically normal at 2 months of age, a number of tumor foci are grossly discernable by 3 months, and the majority of the lung is replaced by coalesced nodules by 4 months of age. As tumor progresses, the expression of endogenous CCIO expression diminishes, and there is increased nuclear p53 expression, suggesting binding and stabilization of the protein by the large T-Ag [56]. From our standpoint, we have found that the reliable progression of lethal tumors in these transgenic mice enable us the test a number of hypotheses, dosing schemes, and dosing routes. Importantly, the effects of immunomodulation by 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 4 1 the gene transfer of specific cytokines and chemokines into tumor cells in vivo can be determined. Moreover, one can compare this direct-delivery strategy W\t\\ alternative approaches, including ex vivo modification of autologous APCs using recombinant Ad-vectors. The subsequent reintroduction of gene- modified APCs back into the tumor environment overcomes the inability of dendritic cells to maturate in the presence of tumor in vivo [57] by providing functional APCs that are capable of processing and presenting tumor antigens to cytolytic T cells in vivo [6]. 3. Murine Models vŝ ith Transplantable Xenografts Xenotransplantation of human tumors into immunocompromised mice began in the late 1960s [58] follov^ing the discovery of the nude mouse in 1962 and its characterization as an athymic mutant in 1968 [59]. The morphologic and karyotypic stability of tumors serially passaged in nude mice v^as described [60], and it v^as established that xenotransplanted tumors in nude mice often retained distinctive phenotypic and functional characteristics found in the human host [61]. However, the "tumor-take" rate for nude mouse xenotransplants is tumor-specific, and generally, carcinomas are more difficult to estabUsh than melanomas or sarcomas [62]. Thus, progressive tumor grow^th from inoculated primary tumors (i.e., cultured directly from the patient) is observed in only 33% for lung cancers [61, 63] and is virtually nil for primary breast or prostate cancers. In addition to properties inherent to the tumor, nude-mouse-related factors also impact on tumor take. For example, mice infected W\t\v the mouse hepatitis virus do not accept xenotransplants, presumably because of enhanced NK-cell activity [64]. In this regard, it is important to recall that although nude mice lack functionally mature T cells, they are capable of mounting normal humoral responses to T-cell-independent antigens [65] and they exhibit high NK-cell activity [GG]^ and these properties probably impact negatively on the tumor-take rate of xenotransplants. The high NK-cell activity also abrogates the metastatic potential of implanted tumors, and the incidence of metastasis is higher in mice Wixh lov^er NK cell activity, e.g., young (3-week-old) syngeneic mice or the beige (bgV bgO mutants derived from the C57BL/6 mice [67, 68]. The discovery of a severe combined immunodeficiency in mice [69] offered yet another option for hosting human tumor xenografts. The scid/scid mice are characterized by the virtual absence of functional T and B lumphocytes due to aberrancies in the rearrangement of antigen receptor genes [70]. The first successful engraftment of human solid organ tumors into scid mice began w îth the subcutaneous inoculation using the A549 lung adenocarcinoma cell line [71]. Since that time, a variety of human solid-organ cancers, both from cell lines and primary tumor specimens, have been successfully engrafted [72]. The higher rates of successful engraftment, presumably because of the lack of residual B-cell function in scid mice, have led many investigators to prefer 5 4 2 Batra ef al. scid/scid mice over nuinu mice as the host recipients of human xenograft tumors. Xenografts are still impacted upon by the scid host's innate immunity, and NK and monocyte/macrophage activities can be upregulated in these hosts. For specific needs, selective breeding of other available mutants (beige mutants with reduced NK-cell activity and osteopetrosis with altered macrophage differentiation) enables the generation of strains that harbor overlapping defects in immune function [73]. Furthermore, genetic engineering and gene- targeting technology has helped create murine-mutants with exquisitely specific immune defects, including mice in which CD4 or CDS T cells are deleted [74] and mice which lack p-2 microglobulin and thus do not express transplantation antigens \1S\. Xenotransplants have many advantages, the primary being that they provide a replenishable source of human tumor. This enables the genetic characterization and gene discovery of tumor-specific phenotypes and, in rare occasions, the progression toward an advanced or metastatic phenotype of the tumor (e.g., from an androgen-dependent prostate tumor to one that is androgen independent, see below). Xenografts incorporating human tumor cells in immune-deficient mice are plentiful. For example, we have devel­ oped a novel animal model mimicking intrapleural malignancy that allows for a controlled, focal dosing of reagents and evaluation of therapeutic ben­ efit [76]. The model is composed of 2.5-cm segments of rat intestine that is denuded, and then everted so that the serosal surface is converted into the lumenal surface of a tube. Lung cancer cells are instilled into the lumen via a polyethylene cannula on day - 1 , allowed to adhere to the serosal sur­ face overnight, and this tubular xenograft is implanted into the interscapular subcutaneous tissue of a nude mouse on day 0 \J(i\ The graft simulates metastatic tumor growth on the pleural surface basal lamina both grossly and histopathologically and enables robust quantitation of tumor kinetics \1G\. The appearance of tumor on this surface is nodular, and these nodules coalesce over time with intervening fibrous stroma. Neovascularization is evident on histological exam of the graft, and tumor growth is continuous with a vari­ ety of NSCLC cell lines. We have found this model to offer certain tangible advantages. For example, with respect to the transduction characteristics of tumor, the value of this model is evidenced

by the following: (1) the cells are representative of human lung cancer; (2) the location of the tumor is precisely known and tumor is directly accessible; (3) the vast majority of cells that repopulate the graft are derived from those instilled (host leukocytes and fibrocytes comprise the remaining minority); (4) the mode of delivery of reagents (fluid inoculation rather than intratumoral injection) is designed so as to be clinically applicable for installation into pleural space; (5) the size of the xenograft enables quantitative assessments of transgene expres­ sion and morphometry simultaneously, containing human tumor into nude mice \7(i\. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 3 C. Gene Therapy of Lung Cancer Using Adenoviral Vectors 1. Gene-Based Therapies Targeting Molecular Transformation Abnormalities at the cell surface (e.g., erbBI), signal transduction (e.g., ras -oncogene), gene regulation and cell cycle control (e.g., /?53, Rfo, c-myc- oncogene), or apoptosis (e.g., p53, BCL-2) are all implicated in the process of transformation and can serve as targets for rational therapeutic intervention. For example, to overcome the deficits due to mutated p53, one strategy for lung cancer gene therapy has opted to replace the mutated p53 gene v^ith a normal copy [77]. Restoring p53 function in these cells has led to decreased tumorigenicity of human cancer cells in vitro and in animal models [78, 79]. Based on these preliminary studies, the first clinical gene therapy trial for human NSCLC also utilized a /?53-gene transfer strategy [77]. In this study, nine patients with advanced NSCLC vv̂ ere treated w îth either bronchoscopic or percutaneous CT-guided injections with a retroviral p53 expression vector (a genetically reengineered retrovirus that is designed to integrate into the cell genome and express the normal /?53-protein). Of the seven patients evaluated, three showed evidence of tumor regression at the treatment site and six showed increased apoptosis of tumor cells on posttreatment biopsies. Importantly, there was no significant toxicity associated with the therapy, and in situ gene transfer was achieved. However, limited therapeutic efficacy was observed and the mechanisms responsible for the anti-tumor effects are still under study. For example, although it was originally believed that mutated p53 function would have to be compensated in each and every cell for restoration of the normal apoptosis-program, the results suggested otherwise. Because there was substantive tumor regression despite poor in situ gene transfer, mechanisms for the observed "bystander effect" were hypothesized [80]. The term "bystander effect" refers to the ability of gene-modified tumor cells to mediate killing of neighboring nontransfected cells. One plausible explanation is that wild-type /?53 induces release of angiostatic factors, thus undermining the blood supply to the tumor [81]. In addition, the expression of p53 may also contribute to an immune-mediated response [82, 83]. These issues have led to more mechanism-based bench and animal studies, as well as other phase 1 clinical trials using Ad vectors encoding the p53 gene for a variety of cancers, including lung tumors [84]. Because of the high frequency of p53 mutations, another strategy that uses replication-competent viruses has been hypothesized to be ideally suited for lung cancer. This approach employs adenoviruses (mutant dll520 or ONYX-015) that are suggested to selectively replicate in p53-mutated (there­ fore, selectively in cancer) cells [85, 86]. Consequently, these mutant viruses are promoted as "magic bullets" that kill tumor cells and leave normal tis­ sues intact. This particular approach has generated considerable controversy 5 4 4 Batra ef aL both in terms of its reputed efficacy as well as its proposed mechanism of action [87-89]. In brief, its effectiveness in both in vitro and in vivo models of lung cancer needs to be confirmed. Nevertheless, the approach represents a prime example of a novel hypothesis-driven strategy that attempts to exploit the biology of a mutant virus to clinical advantage. 2. Immunogene Therapy Effective immunotherapy has the potential for systemic eradication of disease, a payoff that is especially enticing for the treatment of lung cancer. Pre­ vious, largely unsuccessful immunomodulatory campaigns utilized nonspecific immune strategies (e.g., BCG adjuvants). Increasingly, the interest now is in developing specific immune interventions for lung cancer. The major obstacle for effective immunotherapy of lung cancer has been a meager understanding of the immunobiology of this disease. However, a better understanding of the reciprocal interaction between the tumor and the immune system is starting to emerge, lending itself to plausible hypotheses for intervention. We realize that an effective aniti-tumor response may either provoke the immune system to recognize and attack the tumor, or conversely, it may serve to reduce the immunosuppression encumbered upon the host by the tumor. Specific and effective anti-tumor immunity requires both adequate tumor- antigen presentation and the subsequent generation of effector lymphocytes. A variety of cytokines have been investigated to implement such a program in situ [90-97], and many of the studies have utilized the Ad-vector for gene delivery. For several reasons, our efforts have focused on IL-7, IL-12, and more recently on the chemokine sic, for the treatment of lung cancer. The rationale underlying the use of these particular cytokines and chemokines is that they all optimize conditions for tumor antigen processing and presentation by the host's APCs, and they help appropriately localize and sustain the effector lymphocytes response [36, 37, 97, 98]. Although the cellular infiltrates differ depending on the cytokine and model used, many studies indicate that tumor cells that have been transfected with cytokine genes can generate specific and systemic antitumor immunity in vivo. Based on these promising animal studies, what prevents these strategies from being translated into successful and curative human clinical trials? One major problem in human cancer patients may be that although lung cancers express tumor antigens [99], they are ineffective as APCs [100]. Tumor cells cannot function as APCs because (i) they lack costimulatory molecules, (ii) they are unable to adequately process Ag, and (iii) they secrete a variety of inhibitory peptides which promote a state of specific T-cell anergy. Thus, even for highly immunogenic tumors, professional APCs are required for antigen presentation [101]. As described above, local augmentation of IL-7 and IL-12 may help to overcome some of these defects [37]. In addition, one may bring into the tumor environment professional APCs to orchestrate a satisfactory 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 5 immune response against the tumor. In this regard, dendritic cells (DCs) are potent APCs that are ideal for interacting with and activating naive T cells to generate antigen-specific immunity [102, 103]. Recent advances in the isolation and in vitro propagation of DC has stimulated great interest in the use of these cells for clinical cancer therapy [104, 105]. In such approaches, DC may be envisioned to serve as vehicles for genes expressing antigens [106] or expressing cytokines in lung cancer gene therapy [33]. In addition, DC-based immunogenetic therapies may be used in combination v^ith other strategies that have been optimized for Ag presentation [34, 37]. Importantly, of the various approaches tested to gene modify the DCs, our colleagues at UCLA have determined that the Ad-vector is best suited for DC-transduction [107]. 3. Targeting Tumor Invasion and Angiogenesis Overcoming metastatic disease is paramount for effective lung cancer therapy, and the biology underlying metastasis is gaining clarity. Metastasis is a process involving several complimentary yet distinct elements, including the capacity for tumor cells to invade and traverse the basement membrane, and to reestablish viable tumor foci in distant organs. Each step in this process may serve as a point for therapeutic intervention in lung cancer. As the molecular biology becomes better understood, the opportunity to incorporate specific genes into vector systems invariably materializes. The initial step, tumor invasion, requires proteolysis, v^hich has been suggested to be mediated by an overexpression and secretion of matrix metalloproteinases (MMPs) by lung cancer cells [108-111]. Therapeutically, gene transfer strategies have incorporated tissue inhibitors of metalloproteinases (TIMP) to inhibit invasion and metastasis [112], or have utilized antisense abrogation of MMPs to inhibit tumorigenicity [113]. Similarly, angiogenesis (induced grow^th of blood vessels) is suspected to be critical for tumor survival and progression at each stage of metastasis [114]. Angiogenic progression in lung cancer is felt to be due to an imbalance of angiogenic and angiostatic factors, and the risk of metastasis in NSCLC directly correlates v^ith the extent of tumor-derived angiogenesis [114]. Thus, strategies that inhibit of angiogenic mediators or restore angiostatic factors have potential utility for all stages of lung cancer [115-119]. The important mediators implicated in promoting or inhibiting angiogenesis lend themselves favorably for inclusion into gene therapy strategies. For example, recent studies indicate that vascular endothelial growth factor (VEGF) is an important angiogenic factor produced by a variety of tumors, including lung cancer. Lymph nodes with NSCLC metastases express significantly higher levels of VEGF than do normal, uninvolved nodes [120], consistent with the speculation that VEGF plays an important role in the metastasis of lung cancer. In addition to VEGF, recent studies have also implicated CXC chemokines in the abnormal angiogenic/angiostatic balance in NSCLC [121]. Members of 5 4 6 Batra ef at. this family containing the ELR motif (e.g., IL-8) are angiogenic, whereas those that lack this motif (e.g., interferon-inducible protein 10; IP-10) are angiostatic. Accordingly, neutralizing antibodies to IL-8 reduce angiogenesis and consequently the growth of human lung tumors in scid mice [122]. Other molecular strategies to specifically target angiogenic vessels are also being developed. For example, the adhesion protein av^s is relatively specific for angiogenic vessels where it mediates endothelial cells interaction with extracellular matrix components [123] and enables cell motility [124]. Importantly, its blockade can promote tumor regression in vivo in lung cancer models by inducing apoptosis of tumor-associated blood vessels [125]. More recently, phage-display peptide libraries, which are used to screen the specific binding of a massive array of peptides, have isolated small peptides which selectively bind to receptors (including avPa) on angiogenic vessels. Conjugat­ ing these peptides to chemotherapeutic agents have enabled investigators to specifically target tumor vasculature and abrogate tumor growth [126]. 4. Adjuvants to Conventional Therapeutic Approaches for Lung Cancer Conventional multimodality therapy for lung cancer incorporates surgery, radiation, and chemotherapy using a variety of clinical protocols dictated by the subtype and extent of disease. Theoretically, gene therapies may play important synergistic roles in augmenting the effectiveness of conventional approaches. For many such strategies, there already exists a scientific rationale to test them in combination with conventional multimodality therapy. For example, one may enhance the radiation-sensitivity or chemosensitivity of tumor cells (e.g., p53 or iKBa gene therapy) [127, 128] or modify normal tissue susceptibility to cytoablative therapy (e.g., mucosal/tissue protection: by virtue of MDR-1 or bFGF gene transfer). Examples of synergism with the suicide gene therapy approaches have also been studied. The HSV thymidine kinase gene/ganciclovir system induces radiation sensitivity into transduced tumor cells [129], suggest­ ing that these two forms of therapy can be combined to potentiate antitumor responses [130]. Similarly, tumor cells transduced with the cytosine deaminase transgene exhibit enhanced radiation sensitivity following pretreatment with 5-fluorocytosine [131]. Because the loss of p53 function can result in tumor resistance to ionizing radiation [132], restoring p53 function may restore apop- totic pathways and promote effective radiation or chemotherapy. In fact, gene transfer of wild-type p53 has been shown to enhance radiation sensitivity [133] and can act synergistically with as-platinum-based chemotherapy to augment cytotoxicity [134]. Many of the approaches outlined above as being strategies for gene therapy of 'lung cancer" are generic; these approaches can be generalized to a variety of malignancies since transformed cells have in common the same aberrant growth regulatory and signal transduction pathways. The molecular 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 7 and cellular pathogenesis of tumor invasion and immune evasion are also similar betvs^een tumors originating in diverse organ systems. Unfortunately, this commonality may not confer a broad-based advantage w^hen gene therapy strategies are advanced clinically. In this respect, vectors need to provide both efficient gene delivery as w êll as tumor specificity, and as a result, the gene trans­ fer strategies have to become "disease specific." Targeted vectors (as discussed elsew^here in this compilation) have to incorporate features rendering them capable of selective cell surface adherence or entry or, alternatively, express their therapeutic transgenes under tumor-specific regulation. Unfortunately, a lung cancer-specific cell surface target (for transductional targeting)

has not been identified, and one is left trying to use targets that are generally over- expressed in tumor cells or tumor-induced endothelium 1135, 136]. Similarly, lung cancer also does not express a specific tumor marker. Thus, transcriptional targeting approaches largely utilize elements that are "tissue-specific" rather than "cancer-specific." Accordingly, constructs where transgene expression is regulated by tissue-specific promoters (e.g., SLPI, SP-A, CC-10) are being actively developed and tested. III. Animal Models of Human Prostate Cancer A. Human Prostate Cancer After lung cancer, cancer of the prostate (CaP) is the second most com­ mon cause of cancer death in American males. A latent disease, many men have prostate cancer cells long before overt signs of the disease are apparent. The annual incidence of CaP is over 100,000 in the United States, of w^hich over 40,000 w îll die of the disease. Nearly a third of patients present with locally advanced or metastatic disease, and androgen deprivation therapy forms the basis of conventional therapy for the majority of these patients. How^ever, cur­ rently available approaches for advanced CaP are not curative [137], primarily because the cells lose their dependence on androgenic stimulation. The mech­ anisms of progression of CaP cells to hormone independence under androgen ablation therapy remain unclear. To investigate the factors and mechanisms that underlie the development of androgen resistance and metastasis, reliable in vivo models that mimic human CaP progression are essential. Moreover, it is critical that tumor models mirror the pathology and cellular and molecular characteristics of human CaP if it is to serve as a useful tool for basic research, drug screening, or the evaluation of new therapeutic strategies. B. Spontaneous and Transgenic Models of Human Prostate Cancer Currently, a single animal model cannot epitomize the multifaceted aspects of CaP pathogenesis and progression. Rodent models of prostate 5 4 8 Batra ef al. carcinoma have been developed by hormone treatment [138], spontaneous development [139], transgenic prostate-specific oncogene expression [140], and knockout of CaP-tumor suppressor genes [141]. However, these mod­ els are largely inadequate in recapitulating the progression of human disease as bone metastasis, [142] the major cause of chnical morbidity attributable to CaP. Despite pitfalls, the mouse transgenic TRAMP model has been useful for studying the development and progression of prostatic adenocarcinoma. TRAMP mice, generated by expressing SV40-T antigen specifically in prostatic epithehum [140], develop prostatic intraepithelial neoplasia (PIN) by 10-12 weeks of age and eventually progress to adenocarcinoma with metastasis to lymph nodes and lungs [143]. As in human disease, androgen ablation therapy in these mice contributes to the emergence of androgen-independent disease with a poorly differentiated phenotype [144]. C. Xenograft Models of Human Prostate Cancer As for lung cancer, investigators have chosen a number to utilize xenograft models of CaP. Unfortunately, CaP xenografts are far more fas­ tidious than lung cancer xenografts, and the generation of models that are representative of typical human disease has only recently been accomplished. Until recently, the majority of research conducted for CaP relied on the cell lines PC-3, DU145, and LNCaP. Among these, only LNCaP cells exhibit androgen responsiveness and express the prostate-specific antigen (PSA) and androgen receptor (AR). Thus, the relevance of DU-145 and PC-3 cells to clinical CaP has been questioned. To overcome the shortage of represen­ tative models of human CaP, a number of investigators began establishing xenografts in immune-deficient scid/scid mice using samples obtained directly from patients [145-149]. These xenografts offered the following advantages: (1) the expansion of small amounts of starting clinical material, (2) the enrich­ ment of relatively homogeneous cell populations from heterogeneous tumor cell populations, (3) the ability to investigate progression to metastasis and androgen independence [145, 146, 148], and (4) representative diversity that provided a more realistic picture of the heterogeneous nature of this disease. Investigators at UCLA established six distinct CaP xenografts from patients with locally advanced or metastatic diseases into scid/scid mice. Two of these xenografts, LAPC-4 and LAPC-9, have been maintained continuously for more than 2 years by serial passage in scid/scid mice [145, 146], and LAPC-4 has also been successfully established as a cell line in tissue culture to enable correlation with investigations performed in vitro, [145]. LAPC-4 and LAPC-9 offer several advantages over previous models; both express the wild-type androgen receptor (AR), both xenografts have intact AR-signal transduction pathways, and both secrete high levels of the androgen-dependent protein PSA. Accordingly, they grow as androgen-dependent cancers in male scid mice 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 9 and respond to androgen ablation treatment, but interestingly, they eventually progress to a hormone-refractory, androgen-independent state [145, 146]. LAPC-4 and LAPC-9 can be implanted subcutaneously, orthotopically into the mouse prostate, or intratibially. Orthotopic tumors metastasize reproducibly to regional lymph nodes and lung, providing an opportunity to study prostate cancer metastasis. Intratibial injection results in the formation of osteoblastic tumors typical of human CaP where bony metastasis is the major cause of morbidity. From a research standpoint, the generation of these xenografts has provided significant dividends. Given the inability to culture CaP by other means, the xenografts have been used to identify chromosomal abnormalities and to pinpoint the genes important to the pathogenesis of CaP. For example, loss of chromosome lOq w âs a frequently observed genetic defect in prostate cancer. Recently, the PTEN/MMAC tumor suppressor gene v^as identified and mapped to chromosome 10^23.3 [150, 151]. PTEN encodes a protein/lipid phosphatase w^hich has been clearly established to function as a negative regulator of the PI3-kinase/Akt signaling pathw^ay [152-158]. Loss of PTEN leads to constitutive activation of PI3-kinase, and in turn the Akt-signaling pathway [158]. PI3-kinase is also a downstream target of several growth factors implicated in CaP pathogenesis including epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR) and Her2/neu, and it is possible that deregulation of this pathway in PTEN-deficient cells may indeed be responsible for the cancer phenotype. Of note, knockout mice lacking PTEN as a consequence of targeted deletion develop multiple cancers, including prostatic hyperplasia and prostatic intraepithelial neoplasia [141, 159]. Correspondingly, 50-60% of all prostate cancer xenografts established contain deletions, mutations, or absent expression of PTEN [160,161], making the xenografts a relevant and valuable source for biological and therapeutic discovery. Prostate cancer gene therapy approaches that specifically target this pathway are now underway in these models. In addition to modeling the abnormalities of the PTEN/MMAC pathway, xenografts are important in delineating the role of androgens and androgen receptor (AR) signaling in CaP. Prostate epithelial cells utilize androgen as a growth and differentiation factor and are dependent on androgen for survival. Once transformed, androgen deprivation is associated with a transition of CaP cells through a range of diminishing androgen-dependence, and ultimately androgen independence. Although not well understood, this process likely involves perturbations in AR signaling of cellular growth control. Potential AR-related perturbations may involve (1) AR mutation or gene amplification, (2) cross-talk between AR and other signal pathways, and/or (3) alterations in transcriptional coregulators. Greater than 80% of clinical CaP specimens have confirmed AR expression, even in advanced androgen-independent dis­ eases [162, 163]. Among these, AR-gene mutation or amplification has been 5 5 0 Batra ef al. documented in 20 -40% of CaP cases [164-166]. Both LNCaP and the CWR22 xenografts bear AR mutations that enable the receptor to be acti­ vated by nonandrogenic steroid hormones such as progesterone and estrogen. In addition, in a patient who had failed androgen ablation, it was recently demonstrated that his CaP-cells possessed a mutated AR with altered lig- and affinity. Essentially, the mutant AR functioned as a high-affinity Cortisol receptor, enabling the CaP cells to circumvent the androgen requirement for growth [167]. Another emergent theme is that some hormone refractory can­ cers have activated the AR signaling pathway through a ligand-independent mechanism. For example, in LAPC-4 cells expressing wild-type AR, the overex- pression of Her-2/neu has been shown to activate AR [168]. Not surprisingly, the LAPC-4 xenograft progresses to androgen-independence after androgen ablation and differential gene expression studies reveal a consistent increase in Her-2/neu protein expression in androgen-independent tumors. Further­ more, forced overexpression of Her-2/neu in androgen-dependent CaP cells is sufficient to confer androgen-independent growth in vitro and to accelerate androgen-independent growth in castrated animals. Thus, Her-2/neu overex­ pression activates the AR signaling pathway in the absence of ligand and enhances the magnitude of AR response in the presence of low levels of andro­ gen. Last, reconstitution experiments in a heterologous cell type expressing low levels of endogenous AR suggest that these effects of Her-2/neu on the AR pathway require AR-expression [168]. Although the point where Her-2/neu and AR pathway intersects is still undefined, nuclear receptor coactivators might be potential targets since amplification of steroid receptor coactivator, AIBl, is documented in breast and ovarian cancer [169]. Cross-talk between Her-2/neu and AR signaling pathways should provide a novel mechanistic insight into the development of androgen independence. D. Gene Therapy Approaches with Adenovectors in Prostate Cancer Recombinant Ad vectors are most commonly used for CaP because they have demonstrated the capacity to deliver genes intraprostatically in animal models [170]. Hence, several ongoing human CaP clinical gene therapy trials are using Ad [171, 172]. With respect to these applications, several groups are developing transcriptionally targeted prostate-specific Ad [172-175]. These strategies are beneficial in gene therapy applications in that they potentially restrict the expression of cytotoxic therapeutic genes to the malignant cells. Most commonly, the kallikrein-protease prostate specific antigen (PSA) gene regulatory regions have been used to direct prostate-specific expression because prostate epithelia, normal or malignant, specifically express the PSA [176]. Unfortunately, the transcriptional output from the native PSA enhancer and promoter (as from most highly regulated tissue-specific promoters) is much lower than from strong constitutive viral promoters such as CMV. For example. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 1 our studies suggest that the native PSA enhancer and promoter inserted into Ad can direct tissue-specific and androgen-inducible expression in LNCaP cells, but the transcriptional activity is 50-fold lower than the constitutive CMV promoter [Wu et al.^ unpubhshed data]. By exploiting the known properties of the native PSA control regions, we have improved the activity and specificity of the prostate-specific PSA enhancer (Wu et al. unpublished data). Previous studies had established that AR molecules bound cooperatively to AREs in the PSA enhancer core (—4326 to —3935) act synergistically with AR bound to the proximal promoter to regulate transcriptional output [177, 178]. To exploit the synergistic nature of AR action, we generated chimeric enhancer constructs by (1) insertion of a synthetic element containing four tandem copies of the proximal PSA promoter AREI (ARE4) element or (2) duplication of enhancer core and (3) removal of intervening sequences (—3744 to —2875) between the enhancer and the promoter. Each of these three strategies augments activity and androgen inducibility and retained a high degree of tissue discriminatory ability. As a result of these combined approaches, the two most active constructs are termed PSE-BC (duplication of core) and PSE-BAC (insertion of core and ARE4) are approximately 20-fold higher in activity than native PSA enhancer/promoter construct, PSE, composed of the PSA enhancer (-5322 to —2855) fused to the proximal promoter (—541 to +12). Most importantly, the enhanced activity and specificity of the new PSA-enhancer/promoter constructs are retained in an adenoviral vector. The recently developed human CaP xenografts should be excellent models to refine and evaluate this novel prostate-targeted gene therapy because their AR pathways are intact and their growth regulatory pathways bear close resemblance to clinical disease. IV. Summary and Discussion We have presented for discussion a broad-based review of the utility of adenoviral vectors in animal models of lung cancer. Since this entire compi­ lation is devoted to Ad-gene therapy, we have particularly embellished the sections on "animal models" of disease, especially as they pertain to lung and prostate cancer. These examples illustrate that the development of our approaches may need to be disease specific, especially with respect to targeting and mode of delivery. From this review, it is evident that to realize the full potential of cancer gene therapy, advances need to be made on a number of fronts. Not only do we need to construct better Ad-vectors or more rele­ vant animal models, we also need to incorporate emerging technologies to a useful purpose within the experimental design. For example, the pathway to

human clinical trials may be better paved by an improved ability to gather interim surrogate measures of gene transfer and expression in animal models. 5 5 2 Batra et al. The implementation of a quantitative and noninvasive method capable of monitoring transgene expression in living animals repetitively w^ould be useful toward validating the efficacy of any gene therapy strategy. In this respect, a number of investigators, including those at UCLA, are developing sensitive technologies for imaging transgene expression using positron emission tomog­ raphy (PET) and optical measurements. PET is a noninvasive, tomographic imaging modality that already has clinical applications for the diagnosis and management of several diseases including cancer. New^er high-resolution ani­ mal microPET technology developed at UCLA, is allow^ing for the study of smaller animal systems (mice, rats, small primates) previously difficult to image v^ith a resolution approaching 2 mm [179]. With relevance to gene therapy for cancer, the herpes simplex virus 1 thymidine kinase (HSVl-tk) gene has been demonstrated to be an excellent "PET reporter gene" by virtue of trapping positron-emitting 8-[18F] fluoroganciclovir (FGCV) specifically only in cells expressing HSVl-tk[180]. Using FGCV, repetitive PET imaging of adenovirus- directed hepatic expression of the HSVl-tk reporter gene in living mice has been achieved [180-182]. More importantly direct correlation between the retained PET reporter probe and the levels of HSVl-tk gene expression in the targeted organ have also been demonstrated [180-182]. Thus, PET is a sensitive and quantitative modality to image the location and magnitude of adenoviral vector-mediated gene expression in living animals which could be translated to clinical gene therapy apphcation. Similarly, a charge-coupled device (CCD) camera is a highly sensitive camera for measuring photons. Advances in CCD technology can now enable investigators to quantitatively and reliably image low levels of luminescence (from the heterologous expres­ sion of the firefly luciferase gene) arising from within living animals [183]. Although tomographic images are not possible, and the signal is dependent on the depth of tissue from which the light source emanates, it is possible to get reproducible and semiquantitative images. The simplicity and minimal background signal of optical CCD luciferase approach may complement the detailed tomographic imaging of MicroPET and the newer confocal microscopy techniques and, ultimately, be more predictive of gene transfer strategies in the treatment of human disease. AcknovNfledgments We thank Drs. Steven M. Dubinett and Charles L. Sawyers in the Department of Medicine, Dr. Robert E. Reiter in the Department of Urology, and Dr. Sanjiv Gambhir in the Department of Molecular and Medical Pharmacology at the UCLA School of Medicine for thoughtful advice. This project has been supported by the Veterans Administration-Career Development Av^ard and Medical Research Funds (R.K.B.), NIH-R01-CA78654 (R.K.B.), Cahfornia Cancer Research Program (L.W.), Department of Army (L.W.), the UCLA-Jonsson Comprehensive Cancer Center, and the UCLA-Gene Medicine Program. 18. Utilify of Ad Vectors in Animal Models 1: Cancer 5 5 3 References 1. Malkinson, A. M. (1998). Molecular comparison of human and mouse pulmonary adeno­ carcinomas. Exp. Lung Res. 24, 541. 2. Sellers, T. A., Bailey-Wilson, J. E., Elston, R. C , Wilson, A. F., Elston, G. Z., Ooi, W. L., and Rothschild, H. (1990). Evidence for mendelian inheritance in the pathogenesis of lung cancer. / . Natl. Cancer Inst. 82, 1272. 3. Schwartz, A. G., Yang, P., and Swanson, G. M. (1996). Famihal risk of lung cancer among nonsmokers and their relatives. Am. J. Epidemiol. 144, 554. 4. Carbone, D. (1997). The biology of lung cancer. Semin. Oncol. 24, 388. 5. Salgia, R., and Skarin, A. T. (1998). Molecular abnormalities in lung cancer./. Clin. Oncol. 16, 1207. 6. Dubinett, S. M., Miller, P. W., Sharma, S., and Batra., R. K. (1998). Gene therapy for lung cancer. Hematol. Oncol. Clin. North Am. 12, 569. 7. Sethi, T. (1997). Science, medicine, and the future. Lung cancer. Br. Med. J. 314, 652. 8. Shopland, D. R., Eyre, H. J., and Pechacek., T. F. (1991). Smoking-attributable cancer mor­ tality in 1991: Is lung cancer now the leading cause of death among smokers in the United States? / . Natl. Cancer Inst. 83, 1142. 9. Sozzi, G., Miozzo, M., Pastorino, U., Pilotti, S., Donghi, R., Giarola, M., De Gregorio, L., Manenti, G., Radice, P., Minoletti, F., et al. (1995). Genetic evidence for an independent origin of multiple preneoplastic and neoplastic lung lesions. Cancer Res. 55, 135. 10. Mao, L., Lee, J. S., Kurie, J. M., Fan, Y. H., Lippman, S. M., Lee, J. J., Ro, J. Y., Brox- son. A., Yu, R., Morice, R. C., Kemp, B. L., Khuri, F. R., Walsh, G. L., Hittelman, W. N., and Hong., W. K. (1997). Clonal genetic alterations in the lungs of current and former smokers. / . Natl. Cancer Inst. 89, 857. 11. Wistuba, II, Lam, S., Behrens, C., Virmani, A. K., Fong, K. M., LeRiche, J., Samet, J. M., Srivastava, S., Minna, J. D., and Gazdar., A. F. (1997). Molecular damage in the bronchial epithelium of current and former smokers. / . Natl. Cancer Inst. 89, 1366. 12. Batra, R., Sharma, S., and Dubinett., S. (2000). New gene and cell-based therapies for lung cancer. Semin. Resp. Med. 21, 463. 13. Slebos, R., Kibbelaar, R., Dalesio, O., Kooistra, A., Stam, J., Meijer, C., Wagenaar, S., Van- derschueren, R., van Zandwijk, N., Mooi, W., et al. (1990). K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N. Engl. J. Med. 323, 561. 14. Mitsudomi, T., Steinberg, S. M., Nau, M. M., Carbone, D., D'Amico, D., Bodner, S., Oie, H. K., Linnoila, R. I., Mulshine, J. L., Minna, J. D., et al. (1992). p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7, 171. 15. Kamb, A., Shattuck-Eidens, D., Eeles, R., Liu, Q., Gruis, N. A., Ding, W., Hussey, C , Tran, T., Miki, Y.,Weaver-Feldhaus, J., et al. (1994). Analysis of the p l6 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat. Genet. 8, 23. 16. Shapiro, G. I., Edwards, C. D.,Kobzik, L., Godleski, J., Richards, W., Sugarbaker, D. J., and Rollins., B. J. (1995). Reciprocal Rb inactivation and pl6INK4 expression in primary lung cancers and cell lines. Cancer Res. 55, 505. 17. Sozzi, G., Veronese, M. L., Negrini, M., Baffa, R., CotticelU, M. G., Inoue, H., TornieUi, S., Pilotti, S., De Gregorio, L., Pastorino, U., Pierotti, M. A., Ohta, M., Huebner, K., and Croce., C. M. (1996). The FHIT gene 3pl4.2 is abnormal in lung cancer. Cell 85, 17. 18. Pezzella, F., Turley, H., Kuzu, I., Tungekar, M. F., Dunnill, M. S., Pierce, C. B., Harris, A., Gatter, K. C , and Mason., D. Y. (1993). bcl-2 protein in non-small-cell lung carcinoma. N. Engl. J. Med. 329, 690. 19. Kern, J. A., Schwartz, D. A., Nordberg, J. E., Weiner, D. B., Greene, M. I., Torney, L., and Robinson., R. A. (1990). pl85neu expression in human lung adenocarcinomas predicts shortened survival. Cancer Res. 50, 5184. 5 5 4 Batra ef al. 20. Sundaresan, V., Ganly, P., Hasleton, P., Rudd, R., Sinha, G., Bleehen, N. M., and Rab- bitts., P. (1992). p53 and chromosome 3 abnormalities, characteristic of maUgnant lung tumours, are detectable in preinvasive lesions of the bronchus. Oncogene 7, 1989. 21. Marchetti, A., Pellegrini, S., Bertacca, G., Buttitta, F., Gaeta, P., CarniceUi, V., Nardini, V., Griseri, P., Chella, A., Angeletti, C. A., and G. Bevilacqua. (1998). FHIT and p53 gene abnormalities in bronchioloalveolar carcinomas. Correlations with clinicopathological data and K-ras mutations./. Pathol. 184, 240. 22. Kerr, K. M., Carey, F. A., King, G., and Lamb., D. (1994). Atypical alveolar hyperplasia: relationship v^ith pulmonary adenocarcinoma, p53, and c-erbB-2 expression./. Pathol. 174, 249. 23. Westra, W. H., Baas, I. O., Hruban, R. H., Askin, F. B., Wilson, K., Offerhaus, G. J., and Slebos., R. J. (1996). K-ras oncogene activation in atypical alveolar hyperplasias of the human lung. Cancer Res. 56, 2224. 24. Cooper, C. A., Carby, F. A., Bubb, V. J., Lamb, D., Kerr, K. M., and Wyllie, A. H. (1997). The pattern of K-ras mutation in pulmonary adenocarcinoma defines a new pathway of tumour development in the human lung. / . Pathol. 181, 401. 25. Mao, L., Hruban, R. H., Boyle, J. O., Tockman, M., and Sidransky., D. (1994). Detection of oncogene mutations in sputum precedes diagnosis of lung cancer. Cancer Res. 54, 1634. 26. Yesner, R. (1993). Pathogenesis and pathology. Clin. Chest Med. 14, 17. 27. Tuveson, D. A., and Jacks, T. (1999). Modeling human lung cancer in mice: Similarities and shortcomings. Oncogene 18, 5318. 28. Witschi, H. (1998). Tobacco smoke as a mouse lung carcinogen. Exp. Lung Res. 24, 385. 29. Malkinson, A., and Belinsky, S. (1996). The use of animal models in prechnical studies. In "Lung Cancer: Principles and Practice" (Pass, H., Mitchell, J., Johnson, D., and Turrisi, A., Eds.). Lippincott-Raven, Philadelphia. 30. Stoner, G. D. (1998). Introduction to mouse lung tumorigenesis. Exp. Lung Res. 24, 375. 31. Shimkin, M. B., and Stoner., G. D. (1975). Lung tumors in mice: Application to carcinogen­ esis bioassay. Adv. Cancer Res. 21, 1. 32. Malkinson, A. M. (1992). Primary lung tumors in mice: An experimentally manipulable model of human adenocarcinoma. Cancer Res. 52, 2670s. 33. Sharma, S., Miller, P., Stolina, M., Zhu, L., Huang, M., Paul, R., and Dubinett., S. (1997). Multi-component gene therapy vaccines for lung cancer: Effective eradication of estabhshed murine tumors in vivo with Interleukin 7 / Herpes Simplex Thymidine Kinase-transduced autologous tumor and ex t^/Vo-activated dendritic cells. Gene Ther. 4, 1361. 34. Miller, P. W., Sharma, S., Stolina, M., Chen, K., Zhu, L., Paul, R. W., and Dubinett., S. M. (1998). Dendritic cells augment granulocyte-macrophage colony-stimulating factor (GM- CSF)/herpes simplex virus thymidine kinase-mediated gene therapy of lung cancer. Cancer Gene Ther. 5, 380. 35. Sharma, S., Stolina, M., Lin, Y., Gardner, B., Miller, P. W., Kronenberg, M., and Dubi­ nett., S. M. (1999). T cell-derived IL-10 promotes lung cancer growth by suppressing both T cell and APC function. / . Immunol. 163, 5020. 36. Sharma, S., Stolina, M., Luo, J., Strieter, R. M., Burdick, M., Zhu, L. X., Batra, R. K., and Dubinett., S. M. (2000). Secondary lymphoid tissue chemokine mediates T cell-dependent antitumor responses in vivo. / . Immunol. 164, 4558. 37. Miller, P. W., S. Sharma, Stolina, M., Butterfield, L. H., Luo, J., Lin, Y., Dohadwala, M., Batra, R. K., Wu, L., Economou, J. S., and Dubinett., S. M. (2000). Intratumoral adminis­ tration of adenoviral interleukin 7 gene-modified dendritic cells augments specific antitumor immunity and achieves tumor eradication. Hum. Gene Ther. 11, 53. 38. Stolina, M., Sharma, S., Lin, Y., Dohadwala, M., Gardner, B., Luo, J., Zhu, L., Kronen­ berg, M., Miller, P., Lee, J., and Dubinett., S. (2000). Specific inhibition of cyclooxygenase 2 restores antitumor immunity by altering the balance of IL-10 and IL-12 synthesis. / . Immunol. 164, 361. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 5 39. Herzog, C. R., Lubet, R. A., and You., M. (1997). Genetic alterations in mouse lung tumors: Implications for cancer chemoprevention./. Cell Biochem. (Suppl. 28-29), 49. 40. Chen, B.,Johanson, L., Wiest,J. S., Anderson, M. W., and You., M. (1994). The second intron of the K-ras gene contains regulatory elements associated with mouse lung tumor susceptibility. Proc. Natl Acad. Set. USA 91, 1589. 41. You, M., Candrian, U., Maronpot, R. R., Stoner, G. D., and Anderson., M. W. (1989). Activation of the Ki-ras protooncogene in spontaneously occurring and chemically induced lung tumors of the strain A mouse. Proc. Natl. Acad. Set. USA 86, 3070. 42. Herzog, C. R., Wiseman, R. W., and M. You. (1994). Deletion mapping of a putative tumor suppressor gene on chromosome 4 in mouse lung tumors. Cancer Res. 54, 4007. 43. Wiseman, R. W., C. Cochran, Dietrich, W., Lander, E. S., and Soderkvist., P. (1994). Allelo- typing of butadiene-induced lung and mammary adenocarcinomas of B6C3F1 mice: Frequent losses of heterozygosity in regions homologous to human tumor-suppressor genes. Proc. Natl. Acad. Sci. USA 91, 3759. 44. Horio, Y., Chen, A., Rice, P., Roth, J. A., Malkinson, A. M., and Schrump., D. S. (1996). Ki- ras and p53 mutations are early and late events, respectively, in urethane-induced pulmonary carcinogenesis in A/J mice. Mol. Carcinog. 17, 217. 45. Hecht, S. S., Morse, M. A., Amin, S., Stoner, G. D., Jordan, K. G., Choi, C. I., and Chung., F. L. (1989). Rapid

single-dose model for lung tumor induction in A/J mice by 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone and the effect of diet. Carcinogenesis 10, 1901. 46. Kim, S. H., and Lee., C. S. (1996). Induction of benign and malignant pulmonary tumours in mice with benzo(a)pyrene. Anticancer Res. 16, 465. 47. Batra, R., Olsen, J., Pickles, R., Hoganson, S., and Boucher., R. (1998). Transduction of non-small cell lung cancer cells by adenoviral and retroviral vectors. Am. J. Respir. Cell Mol. Biol. 18, 402. 48. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg., R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320. 49. Hutchin, M. E., Pickles, R. J., and Yarbrough., W. G. (2000). Efficiency of adenovirus- mediated gene transfer to oropharyngeal epithelial cells correlates with cellular differentiation and human coxsackie and adenovirus receptor expression. Hum. Gene Ther. 11, 2365. 50. Compere, S. J., Baldacci, P., and Jaenisch., R. (1988). Oncogenes in transgenic mice. Biochim. Biophys. Acta 948, 129. 51. Kao, C , Huang, J., Wu, S. Q., Hauser, P., and Reznikoff., C. A. (1993). Role of SV40 T antigen binding to pRB and p53 in multistep transformation in vitro of human uroepithelial cells. Carcinogenesis 14, 2297. 52. Levine, A. J., and Momand., J. (1990). Tumor suppressor genes: the p53 and retinoblastoma sensitivity genes and gene products. Biochim. Biophys. Acta 1032, 119. 53. Wikenheiser, K., J. Clark, Linnoila, R., Stahlman, M., and Whitsett., J. (1992). Simian virus 40 large T antigen directed by transcriptional elements of the human surfactant protein C gene produces pulmonary adenocarcinomas in transgenic mice. Cancer Res. 52, 5342. 54. Wikenheiser, K., and Whitsett., J. (1997). Tumor progression and cellular differentiation of pulmonary adenocarcinomas in SV40 large T antigen transgenic mice. Am. J. Respir. Cell Mol. Biol. 16, 713. 55. Sandmoller, A., R. Halter, Suske, G., Paul, D., and Beato,, M. (1995). A transgenic mouse model for lung adenocarcinoma. Cell Growth Differ. 6, 97. 56. Magdaleno, S., Wang, G., Mireles, V., Ray, M., Finegold, M., and Demayo., F. (1997). Cyclin-dependent kinase inhibitor expression in pulmonary clara cells transformed with SV40 large t antigen in transgenic mice. Cell Groivth Differ. 8, 145. 57. Gabrilovich, D. I., Chen, H. L., Girgis, K. R., Cunningham, H. T., Meny, G. M., Nadaf, S., Kavanaugh, D., and Carbone., D. P. (1996). Production of vascular endothehal growth 5 5 6 Batra ef aL factor by human tumors inhibits the functional maturation of dendritic cells. Nature Med. 2, 1096. 58. Rygaard, J., and Povlsen., C. O. (1969). Heterotransplantation of a human malignant tumour to "Nude" mice. Acta Pathol. Microbiol. Scand. 77, 758. 59. Pantelouris, E. M. (1968). Absence of thymus in a mouse mutant. Nature 217, 370. 60. Povlsen, C. 0.,Visfeldt, J., Rygaard, J., and Jensen., G. (1975). Growth patterns and chro­ mosome constitutions of human malignant tumours after long-term serial transplantation in nude mice. Acta Pathol. Microbiol. Scand. [A] 83, 709. 61. Shimosato, Y., Kameya, T., and Hirohashi., S. (1979). Growth, morphology, and function of xenotransplanted human tumors. Pathol. Annu. 14(2), 215. 62. Fidler, I. J. (1986). Rationale and methods for the use of nude mice to study the biology and therapy of human cancer metastasis. Cancer Metastasis Rev. 5, 29. 63. Bepler, G., and Neumann., K. (1990). Nude mouse xenografts as in vivo models for lung carcinomas. In Vivo 4, 309. 64. Kyriazis, A. P.,DiPersio, L., Michael, J. G., and Pesce., A. J. (1979). Influence of the mouse hepatitis virus (MHV) infection on the growth of human tumors in the athymic mouse. Int. ]. Cancer 23, 402. 65. Reed, N. D., Manning, J. K., Baker, P. J., and Ulrich., J. T. (1974). Analysis of 'thymus- independent' immune responses using nude mice. In "Proceedings of the First International Workshop on Nude Mice" (J. Rygaard and C O . Povlsen, Eds.), pp. 95-103. Verlag, Stuttgart. 66. Hanna, N. (1982). Role of natural killer cells in control of cancer metastasis. Cancer Metastasis Rev. 1, 45. 67. Hanna, N., and Burton., R. C. (1981). Definitive evidence that natural killer (NK) cells inhibit experimental tumor metastases in vivo. / . Immunol. 127, 1754. 68. Talmadge, J. E., Meyers, K. M., Prieur, D. J., and Starkey., J-. R. (1980). Role of NK cells in tumour growth and metastasis in beige mice. Nature 284, 622. 69. Bosma, G. C., Custer, R. P., and Bosma., M. J. (1983). A severe combined immunodeficiency mutation in the mouse. Nature 301, 527. 70. Bosma, M. J., and Carroll., A. M. (1991). The SCID mouse mutant: definition, characteri­ zation, and potential uses. Annu. Rev. Immunol. 9, 323. 71. Reddy, S., Piccione, D., Takita, H., and Bankert., R. B. (1987). Human lung tumor growth established in the lung and subcutaneous tissue of mice with severe combined immunodefi­ ciency. Cancer Res. 47, 2456. 72. Williams, S. S., Alosco, T. R., Croy, B. A., and Bankert, R. B. (1993). The study of human neoplastic disease in severe combined immunodeficient mice. Lab. Anim. Sci. 43, 139. 73. Croy, B. A., Percy, D. H., and Smith., A. L. (1993). What are scid mice and why is it timely to devote a special topic issue to them? Lab. Anim. Sci. 43, 120. 74. Mak, T. W., Rahemtulla, A., Schilham, M., Koh, D. R., and Fung-Leung., W. P. (1992). Generation of mutant mice lacking surface expression of CD4 or CD8 by gene targeting. / . Autoimmun. 5 (Suppl A), SS. 75. KoUer, B. H., and Smithies., O. (1992). Altering genes in animals by gene targeting. Annu. Rev. Immunol. 10, 705. 76. Hoganson, D., Matsui, H., Batra, R., and Boucher., R. (1998). Toxin gene-mediated growth inhibition of lung adenocarcinoma in an animal model of pleural malignancy. Hum. Gene Ther.9, 1143. 77. Roth, J. A., Nguyen, D., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Person, D. Z., Hong, W. K., Komaki, R., Lee, J. J., Nesbitt, J. C , Pisters, K. M., Putnam, J. B., Schea, R., Shin, D. M., Walsh, G. L., Dolormente, M. M., Han, C. I., Martin, F. D., Yen, N., Xu, K., Stephens, L. C , McDonnell, T. J., Mukhopadhyay, T., and Cai., D. (1996). Retrovirus- mediated wild-type p53 gene transfer to tumors of patients with lung cancer. Nat. Med. 2, 985. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 7 78. Qazilbash, M., Xiao, X., Cowan, K., and Walsh., C. (1997). Cancer gene therapy using a novel adeno-associated virus vector expressing human wild-type p53. Gene Ther. 4, 675. 79. Takahashi, T., Carbone, D., Takahashi, T., Nau, M., Hida, T., Linnoila, I., Ueda, R., and Minna., J. (1992). Wild-type but not mutant p53 suppresses the growth of human lung cancer cells bearing multiple genetic lesions. Cancer Res. 52, 2340. 80. Freeman, S. M., Abboud, C. N., Whartenby, K. A., Packman, C. H., Koeplin, D. S., Moolten, F. L., and Abraham., G. N. (1993). The "bystander effect": Tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res. 53, 5274. 81. Nishizaki, M., Fujiwara, T., Tanida, T., Hizuta, A., Nishimori, H., Tokino, T., Naka- mura, Y., Bouvet, M., Roth, J. A., and Tanaka., N. (1999). Recombinant adenovirus express­ ing wild-type p53 is antiangiogenic: A proposed mechanism for bystander effect. Clin. Cancer Res. 5, 1015. 82. Chen, H., and Carbone., D. (1997). p53 as a target for anti-cancer immunotherapy, Mol. Med. Today 3, 7. 83. Vierboom, M. P., Nijman, H. W., Offringa, R., van der Voort, E. I., van Hall, T., van den Broek, L., Fleuren, G. J., Kenemans, P., Kast, W. M., and Melief., C. J. (1997). Tumor eradication by wild-type p53-specific cytotoxic T lymphocytes./, Exp. Med. 186, 695. 84. Swisher, S. G., Roth, J. A., Nemunaitis, J., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Connors, D. G., El-Naggar, A. K,, Fossella, F., Glisson, B. S., Hong, W. K., Khuri, F. R., Kurie, J. M., Lee, J. J., Lee, J. S., Mack, M., Merritt, J. A., Nguyen, D. M., Nesbitt, J. C , Perez-Soler, R., Pisters, K. M., Putnam, J. B., Jr., Richli, W. R., Savin, M., Waugh, M. K,, and et al. (1999). Adenovirus-mediated p53 gene transfer in advanced non-small-cell lung cancer. / . Natl. Cancer Inst. 91, 763. 85. Bischoff, J. R., Kirn, D. H., Wilhams, A., Heise, C , Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick., F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 7. 86. Heise, C , Sampson-Johannes, A., Williams, A., McCormick, F., Von Hoff, D., and Kirn., D. (1997). ONYX-015, an ElB gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med. 3, 639. 87. Hall, A. R., Dix, B. R., S. J.O'Carroll, and Braithwaite,, A. W. (1998). p53-dependent cell death/apoptosis is required for a productive adenovirus infection. Nat. Med. 4, 1068. 88. Harada, J. N., and Berk., A. J. (1999). p53-Independent and -dependent requirements for ElB-55 K in adenovirus type 5 replication. / . Virol. 73, 5333. 89. Rothmann, T., A. Hengstermann, Whitaker, N. J., Scheffner, M., and zur Hansen., H. (1998). Replication of ONYX-015, a potential anticancer adenovirus, is independent of p53 status in tumor cells. / . Virol. 72, 7. 90. Fearon, E., Pardoll, D., Itaya, T,, Golumbek, P., Levitsky, H., Simons, J., Karasuyama, H., Vogelstein, B., and Frost., P. (1990). Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60, 397. 91. Alhone, A., Consalvo, M., Nanni, P., Lollini, P. L,, Cavallo, F., GiovareUi, M., Forni, M., Guhno, A., Colombo, M. P., Dellabona, P., Hock, H., Blankenstein, T., Rosenthal, F. M., Gansbacher, B., Bosco, M. C , Musso, T., Gusella, L., and Forni., G. (1994), Immunizing and curative potential of replicating and nonreplicating murine mammary adenocarcinoma cells engineered with interleukin (IL)-2, IL-4, IL-6, IL-7, IL-10, tumor necrosis factor alpha, granulocyte-macrophage colony-stimulating factor, and gamma-interferon gene or admixed with conventional adjuvants. Cancer Res. 54, 6022. 92. Bottazzi, B., Walter, S., Govoni, D., Colotta, F., and Mantovani., A. (1992). Monocyte chemotactic cytokine gene transfer modulates macrophage infiltration, growth, and suscep­ tibility to IL-2 therapy of a murine melanoma. / . Immunol. 148, 1280. 5 5 8 Batra et aL 93. Colombo, M. P., Ferrari, G., Stoppacciaro, A., Parenza, M., Rodolfo, M., Mavilio, F., and Parmiani., G. (1991). Granulocyte colony-stimulation factor (G-CSF) gene transfer suppress tumorigenicity of a murine adenocarcinoma in vivo. / . Exp. Med. 173, 889. 94. Heike, Y., Takahashi, M., Kanegae, Y., Sato, Y., Saito, L, and Saijo., N. (1997). Interleukin- 2 gene transduction into freshly isolated lung adenocarcinoma cells with adenoviral vectors. Hum. Gene Ther. 8, 1. 95. Zitvogel, L., Tahara, H., Robbins, P., et al. (1995). Cancer immunotherapy of established tumors v^ith IL-12: effective delivery by genetically engineered fibroblasts. / . Immunol. 155, 1393. 96. Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., PardoU, D., and Mulligan., R. C. (1993). Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimu­ lates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA 90, 3539. 97. Sharma, S., Wang, J., Huang, M., Paul, R., Lee, P., McBride, W., Economou, J., Roth, M., Kiertscher, S., and Dubinett., S. (1996). Interleukin-7 gene transfer in non-small cell lung cancer decreases tumor proliferation, modifies cell surface molecule expression, and enhances antitumor reactivity. Can. Gene Ther. 3, 302. 98. Sica, D., Rayman, P., Stanley, J., Edinger, M., Tubbs, R. R., Klein, E., Bukowski, R., and Finke., J. H. (1993). Interleukin 7 enhances the proliferation and effector function of tumor- infiltrating lymphocytes from renal-cell carcinoma. Int. J. Cancer 53, 941. 99. Yoshino, L, Goedegebuure, P. S., Peoples, G. E., Parikh, A. S., DiMaio, J. M., Lyerly, H. K., Gazdar, A. F., and Eberlein., T.J. (1994). HER2/neu-derived peptides are shared antigens among human non-small cell lung cancer and ovarian cancer. Cancer Res. 54, 3387. 100. Restifo, N. P., Esquivel, F., Kawakami, Y., Yewdell, J. W., Mule, J. J., Rosenberg, S. A., and Bennink, J. R. (1993). Identification of human cancers deficient in antigen processing./. Exp. Med. 177, 265. 101. Huang, A. Y. C , Golumbek, P., Ahmadzadeh, M., Jaffee, E., PardoU, D., and Levitsky., H. (1994). Role of bone marrow-derived cells in

presenting MHC class Lrestricted tumor antigens. Science 264, 961. 102. Caux, C , Liu, Y., and Banchereau., J. (1995). Recent advances in the study of dendritic cells and follicular dendritic cells. Immunol. Today 16, 2. 103. Steinman, R. M. (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271. 104. Hsu, F., Benike, C , Fagnoni, F., Files, T., Czerwinski, D., Taidi, B., Fugleman, E., and Levy., R. (1996). Vaccination of patients with B-cell lymphoma using autologous antigen- pulsed dendritic cells. Nat. Med. 2, 52. 105. Nestle, F., Alijagic, S., Gilliet, M., Sun, Y., Grabbe, S., Dummer, R., Burg, G., and Schaden- dorf., D. (1998). Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4, 328. 106. Ribas, A., Butterfield, L., McBride, W., Jilani, S., Bui, L., VoUmer, C , Lau, R., Dissette, V., Hu, B., A. Chen, Glaspy, J., and Economou., J. (1997). Genetic immunization for the melanoma antigen MART-1/Melan-A using recombinant adenovirus-transduced murine dendritic cells. Cancer Res. 57, 2865. 107. Arthur, J., Butterfield, L., Roth, M., Bui, L., Kiertscher, S., Lau, R., Dubinett, S., Glaspy, J., McBride, W., and Economou., J. (1997). A comparison of gene transfer methods in human dendritic cells. Cancer Gene Ther. 4, 17. 108. Bolon, L, Devouassoux, M., Robert, C , Moro, D., Brambilla, C , and Brambilla., E. (1997). Expression of urokinase-type plasminogen activator, stromelysin 1, stromelysin 3, and matrilysin genes in lung carcinomas. Aw. / . Pathol. 150, 1619. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 9 109. Garbisa, S., Scagliotti, G., Masiero, L., Di Francesco, C., Caenazzo, C., Onisto, M., Micela, M., Stetler-Stevenson, W., and Liotta., L. (1992). Correlation of serum metallo- proteinase levels with lung cancer metastasis and response to therapy. Cancer Res. 52, 4548. 110. Kawano, N., Osawa, H., Ito, T., Nagashima, Y., Hirahara, F., Inayama, Y., Nakatani, Y., Kimura, S., Kitajima, H., Koshikawa, N., Miyazaki, K., and Kitamura., H. (1997). Expres­ sion of gelatinase A, tissue inhibitor of metalloproteinases-2, matrilysin, and trypsin(ogen) in lung neoplasms: An immunohistochemical study. Hum. Pathol. 28, 613. 111. Mari, B., Anderson, I., Mari, S., Ning, Y., Lutz, Y., Kobzik, L., and Shipp., M. (1998). Stromelysin-3 is induced in tumor/stroma cocultures and inactivated via a tumor-specific and basic fibroblast grov^th factor-dependent mechanism./. Biol. Chem. 273, 618. 112. DeClerck, Y., Perez, N., Shimada, H., Boone, T., Langley, K., and Taylor., S. (1992). Inhi­ bition of invasion and metastasis in cells transfected with an inhibitor of metalloproteinases. Cancer Res. 52, 701. 113. Noel, A., Lefebvre, O., Maquoi, E., VanHoorde, L., Chenard, M., Mareel, M., Foidart, J., Basset, P., and Rio., M. (1996). Stromelysin-3 expression promotes tumor take in nude mice. / . Clin. Invest. 97, 1924. 114. Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., and Fusenig., N. (1997). Halting angio- genesis suppresses carcinoma cell invasion. Nat. Med. 3, 1222. 115. Folkman, J. (1995). Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1, 27. 116. Fontanini, G., Vignati, S., Lucchi, M., Mussi, A., Calcinai, A., Boldrini, L., Chine, S., ilvestri, V., Angeletti, C , Basolo, F., and Bevilacqua., G. (1997). Neoangiogenesis and p53 protein in lung cancer: Their prognostic role and their relation with vascular endothelial growth factor (VEGF) expression. Br. J. Cancer 75, 1295. 117. O'Reilly, M. S., Holmgren, L., Shing, Y., Chen, C , Rosenthal, R. A., Moses, M., Lane, W. S., Cao, Y., Sage, E. H., and Folkman., J. (1994). Angiostatin: A novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315. 118. O'Reilly, M. S., Boehm, T., Shing, Y., Fukai, N., Vasios, G., Lane, W. S., Flynn, E., Birk- head, J. R., Olsen, B. R., and Folkman., J. (1997). Endostatin: An endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277. 119. Cyster, J. (1999). Chemokines and cell migration in secondary lymphoid organs. Science 286, 2098. 120. Ohta, Y., Watanabe, Y., Murakami, S., Oda, M., Hayashi, Y., Nonomura, A., Endo, Y., and Sasaki., T. (1997). Vascular endothehal growth factor and lymph node metastasis in primary lung cancer. Br. } . Cancer 76, 1041. 121. Arenberg, D., Polverini, P., Kunkel, S., Shanafelt, A., Hesselgesser, J., Horuk, R., and Stri­ cter., R. (1997). The role of CXC chemokines in the regulation of angiogenesis in non-small cell lung cancer. / . Leukocyte Biol. 62, 554. 122. Arenberg, D., Kunkel, S., Polverini, P., Glass, M., Burdick, M., and Stricter., R. (1996). Inhibition of Interleukin-8 reduces tumorigenesis of human non-small cell lung cancer in SCID mice. / . Clin. Invest. 97, 2792. 123. Hynes, R. (1992). Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69, 11. 124. Leavesley, P., Schwartz, M., Rosenfeld, M., and Cheresh., D. (1993). Integrin bl- and b3- mediated endothelial cell migration is triggered through distinct signaling mechanisms. / . Cell Biol. 121,163. 125. Brooks, P., Montgomery, A., Rosenfeld, M., Reisfeld, R., Hu, T., Klier, G., and Cheresh., D. (1994). Integrin avb3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79, 1157. 126. Arap, W.,Pasqualini, R., and Ruoslahti., E. (1998). Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 279, 377. 5 6 0 Batra ef a/. 127. Wang, C. -Y., Mayo, M. W., and Baldwin., A. S. J. (1996). TNF- and cancer therapy-induced apoptosis: Potentiation by inhibition of NF-kB. Science 274, 784. 128. Batra, R. K., Guttridge, D. C , Brenner, D. A., Dubinett, S. M., Baldwin, A. S., and Boucher., R. C. (1999). IkappaBalpha gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-alpha-mediated cell death. Am. ]. Respir. Cell Mol. Biol. 21, 238. 129. Kim, J. H., Kim, S. H., Brown, S. L., and Freytag., S. O. (1994). Selective enhancement be an antiviral agent of the radiation-induced cell killing of human glioma cells transduced with HSV-tk gene. Cancer Res. 54, 6053. 130. McBride, W., and Dougherty., G. (1995). Radiotherapy for genes that cause cancer. Nat. Med. 1, 1215. 131. Hanna, N., Mauceri, H., Wayne, J., Hallahan, D., Kufe, D., and Weichselbaum., R. (1997). Virally directed cytosine deaminase/5-fluorocytosine gene therapy enhances radiation res­ ponse in human cancer xenografts. Cancer Res. 57, 4205. 132. Mcllwrath, A., Vasey, P., Ross, G., and Brown., R. (1994). Cell cycle arrests and radiosen- sitivity of human tumor cell lines: Dependence on wild-type p53 for radiosensitivity. Cancer Res. 54,3718. 133. Gallardo, D., Drazen, Z. E., and McBride., W. H. (1996). Adenovirus-based Transfer of Wild-Type p53 Gene Increases Ovarian Tumor Radiosensitivity. Cancer Res. 56, 4891. 134. Nguyen, D., Spitz, F., Yen, N., Cristiano, R., and Roth., J. (1996). Gene therapy for lung cancer: enhancement of tumor suppression by a combination of sequential systemic cisplatin and adenovirus-mediated p53 gene transfer./. Thorac. Cardiovasc. Surg. 112, 1372. 135. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel., D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574. 136. Wickham, T., Roelvink, P., Brough, D., and Kovesdi., I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570. 137. Jones, G. W., Mettlin, C., Murphy, G. P., Guinan, P., Herr, H. W., Hussey, D. H., Chmiel, J. S., Fremgen, A. M., Clive, R. E., Zuber-Ocwieja, K. E., et al. (1995). Patterns of care for carcinoma of the prostate gland: Results of a national survey of 1984 and 1990. / . Am. Coll. Surg. 180, 545. 138. Noble, R. L. (1977). The development of prostatic adenocarcinoma in Nb rats following prolonged sex hormone administration. Cancer Res. 37, 1929. 139. Voigt, W., and Dunning, W. F. (1974). In vivo metabohsm of testosterone-3 H in R-3327, an androgen-sensitive rat prostatic adenocarcinoma. Cancer Res. 34, 1447. 140. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen., J. M. (1995). Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. USA 92, 3439. 141. Podsypanina, K., Ellenson, L. H., Nemes, A., Gu, J., Tamura, M., Yamada, K. M., Cordon- Cardo, C., Catoretti, G., Fisher, P. E., and Parsons., R. (1999). Mutation of Pten/Mmacl in mice causes neoplasia in multiple organ systems. Proc. Natl. Acad. Sci. USA 96, 1563. 142. Zhau, H. E., Li, C. L., and Chung., L. W. (2000). Establishment of human prostate carci­ noma skeletal metastasis models. Cancer 88, 2995. 143. Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., and Greenberg., N. M. (1996). Metastatic prostate cancer in a transgenic mouse. Cancer Res. 56, 4096. 144. Gingrich, J. R., Barrios, R. J., Kattan, M. W., Nahm, H. S., Finegold, M. J., and Green­ berg., N. M. (1997). Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res. 57, 4687. 145. Klein, K. A., Reiter, R. E., Redula, J., Moradi, H., Zhu, X. L., Brothman, A. R., Lamb, D. J., Marcelh, M., Belldegrun, A., Witte, O. N., and Sawyers., C. L. (1997). Progression of 18. Utility of Ad Vectors in Animal Models I: Cancer 5 6 1 metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat. Med. 3, 402. 146. Craft, N., Chhor, C , Tran, C , Belldegrun, A., DeKernion, J., Witte, O. N., Said, J., Reiter, R. E., and Sawyers., C. L. (1999). Evidence for clonal outgrowth of androgen- independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res. 59, 5030. 147. Elhs, W. J., Vessella, R. L., Buhler, K. R., Bladou, F., True, L. D., Bigler, S. A., Curtis, D., and Lange., P. H. (1996). Characterization of a novel androgen-sensitive, prostate-specific antigen-producing prostatic carcinoma xenograft: LuCaP 23. Clin. Cancer Res. 2, 1039. 148. Wainstein, M. A., He, F., Robinson, D., Kung, H. J., Schwartz, S., Giaconia, J. M., Edge- house, N. L., Pretlow, T. P., Bodner, D. R., Kursh, E. D., et al. (1994). CWR22: Androgen- dependent xenograft model derived from a primary human prostatic carcinoma. Cancer Res. 54, 6049. 149. van Weerden, W. M., de Ridder, C. M., Verdaasdonk, C. L., Romijn, J. C , van der Kwast, T. H., Schroder, F. H., and van Steenbrugge., G. J. (1996). Development of seven new human prostate tumor xenograft models and their histopathological characterization. Am. J.Pathol. 149, 1055. 150. Li, J., Yen, C , Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J., Miliaresis, C , Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C , Ittmann, M., Tycko, B., Hib- shoosh, H., Wigler, M. H., and Parsons., R. (1997). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943. 151. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., Frye, C , Hu, R., Swedlund, B., Teng, D. H., and Tavtigian., S. V. (1997). Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q233 that is mutated in multiple advanced cancers. Nat. Genet. 15, 356. 152. Davies, M. A., Lu, Y., Sano, T., Fang, X., Tang, P., LaPushin, R., Koul, D., Bookstein, R., Stokoe, D., Yung, W. K., Mills, G. B., and Steck., P. A. (1998). Adenoviral transgene expres­ sion of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. Cancer Res. 58, 5285. 153. Furnari, F. B., Huang, H. J., and Cavenee., W. K. (1998). The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive Gl growth arrest in glioma cells. Cancer Res. 58, 5002. 154. Haas-Kogan, D., Shalev, N., Wong, M., Mills, G., Yount, G., and Stokoe., D. (1998). Protein kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the tumor suppressor PTEN/MMAC. Curr. Biol. 8, 1195. 155. Myers, M. P.,Pass, I., Batty, L H., Van der Kaay, J., Stolarov, J. P., Hemmings, B. A., Wigler, M.H. , Downes, C. P., and Tonks., N. K. (1998). The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc. Natl. Acad. Sci. USA 95, 13,513. 156. Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C , Sasaki, T., Ruland, J., Penninger, J. M., Siderovski, D. P., and Mak., T. W. (1998).

Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29. 157. Sun, H., Lesche, R., Li, D. M., J. Liliental, Zhang, H., Gao, J., Gavrilova, N., Mueller, B., Liu, X., and Wu., H. (1999). PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc. Natl. Acad. Sci. USA 96, 6199. 158. Wu, X., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers., C. L. (1998). The PTEN/MMAC 1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc. Natl. Acad. Sci. USA 95, 15,587. 159. Di Cristofano, A., Pesce, B., Cordon-Cardo, C , and Pandolfi., P. P. (1998). Pten is essential for embryonic development and tumour suppression. Nat. Genet. 19, 348. 5 6 2 Batra ef of. 160. Vlietstra, R. J., van Alewijk, D. C , Hermans, K. G., G. J.van Steenbrugge, and Trapman., J. (1998). Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer Res. 58, 2720. 161. Whang, Y. E., Wu, X., Suzuki, H., Reiter, R. E., Tran, C., Vessella, R. L., Said, J. W., Isaacs, W. B., and Sawyers., C. L. (1998). Inactivation of the tumor suppressor PTEN/MMACl in advanced human prostate cancer through loss of expression. Proc. Natl. Acad. Sci. USA 95, 5246. 162. Trapman, J., and Brinkmann., A. O. (1996). The androgen receptor in prostate cancer. Pathol. Res. Pract. 192, 752. 163. Hobisch, A., Culig, Z., Radmayr, C., Bartsch, G., Klocker, H., and A. Hittmair. (1995). Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res. 55,3068. 164. Gaddipati, J. P., McLeod, D. G., Heidenberg, H. B., Sesterhenn, I. A., Finger, M. J., Moul, J. W., and Srivastava., S. (1994). Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res. 54, 2861. 165. Taplin, M. E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, A. E., Ogata, G. K., Keer, H. N., and Balk., S. P. (1995). Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N. Engl. ]. Med. 332, 1393. 166. Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C., Palotie, A., Tammela, T., Isola, J., and O. P. Kallioniemi. (1995). In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet. 9, 401. 167. Zhao, X. Y., Malloy, P. J., Krishnan, A. V., Swami, S., Navone, N. M., Peehl, D. M., and Feldman., D. (2000). Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat. Med. 6, 703. 168. Craft, N., Shostak, Y., Carey, M., and Sawyers., C. L. (1999). A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaUng by the HER-2/neu tyrosine kinase. Nat. Med. 5, 280. 169. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and P. S. Meltzer. (1997). AIBl, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965. 170. Steiner, M. S., Zhang, Y., Carraher, J., and Lu., Y. (1999). In vivo expression of prostate- specific adenoviral vectors in a canine model. Cancer Gene Ther. 6, 456. 171. Herman, J. R., Adler, H. L., Aguilar-Cordova, E., Rojas-Martinez, A., Woo, S., Timme, T. L., Wheeler, T. M., Thompson, T. C , and Scardino., P. T. (1999). In situ gene therapy for adenocarcinoma of the prostate: a phase I clinical trial. Hum. Gene Ther. 10, 1239. 172. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Hender­ son., D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559. 173. Gotoh, A., Ko, S. C , Shirakawa, T., Cheon, J., Kao, C , Miyamoto, T., Gardner, T. A., Ho, L. J., Cleutjens, C. B., Trapman, J., Graham, F. L., and Chung., L. W. (1998). Devel­ opment of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. / . JJrol. 160, 220. 174. Yu, D. C , Sakamoto, G. T., and Henderson., D. R. (1999). Identification of the transcrip­ tional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res. 59, 1498. 175. Latham, J. P., Searle, P. F., Mautner, V., and James., N. D. (2000). Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer: Construction and testing of a tissue-specific adenovirus vector. Cancer Res. 60, 334. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 6 3 176. AumuUer, G.,Seitz, J., Lilja, H., Abrahamsson, P. A., von der Kammer, H., and Scheit., K. H. (1990). Species- and organ-specificity of secretory proteins derived from human prostate and seminal vesicles. Prostate 17, 31. 177. Huang, W., Shostak, Y., Tarr, P., Sawyers, C , and Carey., M. (1999). Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer./. Biol. Chem. 274, 25756. 178. Reid, K. J., Hendy, S. C , Saito, J. L., Sorensen, P., and Nelson., C. C. (2000). Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. / . Biol. Chem. 60, 24. 179. Shao, Y., Cherry, S. R., Farahani, K., Meadors, K., Siegel, S., Silverman, R. W., and Mars- den., P. K. (1997). Simultaneous PET and MR imaging. Phys. Med. Biol. 42, 1965. 180. Gambhir, S. S.,Barrio, J. R., Wu, L., Iyer, M., Namavari, M., Satyamurthy, N., Bauer, E., Parrish, C , MacLaren, D. C , Borghei, A. R., Green, L. A., Sharfstein, S., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1998). Imaging of adenoviral-directed herpes simplex virus type 1 thymidine kinase reporter gene expression in mice with radiolabeled ganciclovir./. Nucl. Med. 39, 2003. 181. MacLaren, D. C , Gambhir, S. S., Satyamurthy, N., Barrio, J. R., Sharfstein, S., Toyokuni, T., Wu, L., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1999). Repetitive, non-invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Gene Ther. 6, 785. 182. Gambhir, S. S., Barrio, J. R., Phelps, M. E., Iyer, M., Namavari, M., Satyamurthy, N., Wu, L., Green, L. A., Bauer, E., MacLaren, D. C , Nguyen, K., Berk, A. J., Cherry, S. R., and H. R. Herschman. (1999). Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 2333. 183. Contag, P. R.,01omu, I. N., Stevenson, D. K., and Contag., C. H. (1998). Bioluminescent indicators in living mammals. Nat. Med. 4, 245. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease II: Genetic Disease Raymond John Pickles Cystic Fibrosis/Pulmonary Research and Treatment Center University of North Carolina at Chapel Hill Chapel Hill, North Carolina I. Introduction A disease at the forefront of gene therapy research over the past decade is cystic fibrosis (CF). This hereditary, single-gene-defect disease, ahhough affecting epithefial cells of multiple organs of the body, results most often in mortality due to complications associated with the lung. Cystic fibrosis lung disease has been considered as a prototypic disease state for "proof-of-concept" gene-therapy strategies. The lack of an alternative long-term treatment for the pulmonary manifestations of this disease, the accessibility of the lung via the airway lumen, and the fact that viruses known to infect the lung were being developed into nonreplicating gene transfer vectors led investigators to believe that administration of gene transfer vectors to the lung could potentially result in an effective treatment of this disease. Shortly after the cloning of the gene responsible for CF pathophysiology, two groundbreaking observations made gene therapy for CF lung disease appear imminent. First, isolated epithelial cells cultured from the airway epithelium of CF patients could be phenotypically "corrected" by transferring into the cells the cDNA corresponding to the CF gene [1-5]. Second, adenoviral (Ad) vectors engineered to express the CF gene were administered to the airways of experimental animals and transgene expression observed in cells that were considered to require "correction" [6]. These initial observations produced a flurry of scientific activity and excitement in both the gene therapy and CF ADENOVIRAL VECTORS FOR GENE THERAPY 5 6 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 6 6 Raymond John Pickles scientific communities and within 3 years of these observations the first clinical trials describing successful Ad-mediated gene transfer to the airway epithelium of CF patients in vivo were reported [7]. These promising early observations have unfortunately not withstood further investigation. After approximately 20 gene therapy clinical trials for CF lung disease (of which greater than 70% utilized Ad) it has become apparent that gene transfer to airway epithelium in vivo is not a simple procedure. The difficulty lies in the evolution of the respiratory epithelium as an effective barrier to invading pathogens entering the lung (e.g., viruses). The epithelium achieves this "barrier function" by presentation of a host of innate and cell-mediated immune systems, which for gene transfer vectors culminate in reduced uptake and expression of the transgene. In this chapter, I describe the evidence that led investigators to believe that Ad would be useful in CF lung disease, why subsequently this simplistic approach failed, and how increasing knowledge of lung biology and viral bioengineering has and will allow novel strategies to be tested. In light of this emphasis on basic research, new strategies and models will need to be tested and successful demonstration of efficiency and safety will be required before we once again enter the clinic with Ad for CF lung disease gene therapy. II. Pathophysiology of Cystic Fibrosis (CF) Lung Disease Cystic fibrosis is a multifaceted disease with major morbidity and mor­ tality resulting from chronic decline of lung function. This disease is the most common fatal inherited disease in Caucasians with 1 in 2500 live births affected [8]. Although CF is most devastating to the lung (accounting for 90% of mortality), resulting in chronic repetitive infections, chronic obstructive pul­ monary disease, and respiratory failure, other tissues are also affected, including the liver, pancreas, the gastrointestinal tract, and the sweat glands. The abnor­ mal CF gene (250 kb) encodes an mRNA of 6,5 kb which translates into an 180-kDa protein that has been extensively characterized as a cAMP-activated chloride ion channel, named the cystic fibrosis transmembrane conductance regulator (CFTR) [3, 9]. In the lung, CFTR is normally expressed in the respi­ ratory epithelium and although the specific functions of CFTR are complex, is predominately involved in maintenance of ionic homeostasis in this tissue. Over 900 different mutations of CFTR have now been reported, resulting in a range of clinical manifestations and differing severity of the disease. Flowever, 70% of these mutations are due to a three-base-pair deletion leading to the absence of phenylalanine (F) at position 508 (AF508) [10]. This particular mutation leads to misfolded CFTR being retained within the endoplasmic recticulum 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 6 7 of cells, so reducing CFTR function at the plasma membrane [11]. Currently, although the specific localization and functional capacity of AF508 CFTR in the different affected organs is a matter of controversial debate [12] and other mutations can display partial CFTR function, for CF patients, expres­ sion of abnormal CFTR in the airway epithelium generally results in reduced chloride ion secretion, hyperabsorption of sodium ions, increased viscosity of airw^ay secretions, impaired mucociliary clearance, chronic bacterial infection, bronchiectasis, and premature death [8, 13]. Given that all of these effects are likely primary or secondary to loss of CFTR function, the most efficacious w ây to treat the broad range of effects w^ould be to replace the defective CFTR gene w îth a normal copy. Gene therapy for CF lung disease therefore seeks to replace normal CFTR in the airv^ay epithelial cells to hopefully "correct" lung epithelium function. III. Trials and Tribulations with Adenoviral Vectors for CF Lung Disease Clinical gene transfer trials v\Aith CF patients investigating the safety and efficacy of gene transfer vectors (predominately adenoviral and liposomal vectors) have been performed in both the United States and United Kingdom. Details of these trials and the background preclinical studies have been com­ prehensively reviewed

in a recent review^ [14]. Although preclinical data have been largely promising for lung-directed gene transfer, the trials performed to date have show^n, at best, only partial "correction" (<20%) of the CF bioelectrical defect [7, 15-18]. This relatively low^ degree of correction is most likely due to inefficient transfer of the CFTR cDNA to the airway epithelial cells, i.e., a low efficiency of gene transfer, and is most likely not sufficient to be of benefit to CF patients although long-term reversal of disease symptoms were not monitored in this studies. The gene transfer efficiency required for physiological correction of CF lung disease has been a matter of recent debate. While Johnson and colleagues have shown that "correction" of ^^10% of CF cells restores normal chloride secretory function to an epithelium, this degree of "correction" was insufficient to correct the hyperabsorption of sodium [19]. Since "correction" of the sodium defect is likely to be necessary for resolving CF lung disease, then transduction of a higher proportion of epithelial cells will be required [1, 20]. Indeed, it has been suggested that greater than 80% of epithelial cells will have to express CFTR to restore the normal sodium transporting capabilities of the epithelium [20]. With regards to efficiency of gene expression on a per cell basis, it appears that CFTR is normally expressed at levels as low as 10 copies per cell and heterozygotes for the CF gene although expressing only 5 6 8 Raymond John Pickles 50% of normal CFTR show no disease symptoms. This suggests that the level of expression per cell does not need to be high in order to correct function. On the other hand, overexpression of CFTR has been shown to have deleterious effects on cell function although the effects on polarized airway epithelial cells are not documented [21]. Issues of safety have arisen due to elicitation of inflammatory responses after Ad instillation in both animal and human experiments [22-29]. These effects have often been due to the large "loads" of vector that has been administered. A current hypothesis is that improvements in gene transfer efficiency may allow smaller quantities of Ad to be administered, possibly circumventing much of the inflammatory response. IV. The Ainvay Epithelium: Cellular Targets for CF Gene Therapy Airway epithelial cells are present throughout the conducting airways of the lung, including the nasal, tracheal, bronchial, and bronchiolar regions. In the upper airway, the surface epithelium lines these structures and is continuous with the tubulo-acinar submucosal mucus-secreting glands that invaginate from the airway surface. Airway epithelial cell-type composition is dependent both on the regional location and on the particular species studied and the reader is referred to comprehensive reviews that describe species- specific epithelial cell distribution in more detail [30, 31]. The epithefial cell types present in the lung are numerous and include ciliated cells, mucus- secreting cells (goblet), serous cells, clara cells, and basal cells. The cell types of the alveolar structures of the lung (alveolar Types I and II cells) are not thought to participate in the pathophysiology of CF lung disease. In human airways, the upper airway regions (nasal, tracheal, bronchial) are composed of a pseudostratified mucociliary epithelium in which ciliated cells predominate with interspersed mucus-secreting goblet cells. The columnar cells overlie intermediary differentiated cells and basal cell layers which interface with the basement membrane. In addition, the human upper airways contain numerous submucosal glands. In the human lower airways, the bronchioles are lined with a simple cubiodal ciliated epithelium containing few mucus-secreting cells, no basal cells, and an absence of submucosal glands. An important morphological difference between the upper airways of human and mice, the most common animal model for investigating airway administration of gene transfer vectors, is that for the mouse upper airway (excluding the nasal cavity epithelium) the columnar cells are roughly an equal distribution of ciliated and clara cells, compared to the predominance of ciliated cells in the human upper airway [32]. Clara cells are a nonciliated bronchiolar mucus-secreting cell type with distinct 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 6 9 properties from ciliated cells. Clara cells, although present in human airway, are located only in the distal airways and account for only a fraction of the cells present in that region [32]. The airway basal cells, or at least a subpopulation, are considered to be stem cell precursors for all other airway epithelial cells in the upper airway regions. Basal cells can differentiate into mucus or ciliated cell phenotypes [33]. Whereas mucus cells may also be able to differentiate into ciliated cells, the ciliated cell is considered as a terminally redifferentiated cell type. An important observation with regard to experimental models of human airway epithelial cells is that isolation of upper airway epithelial cells for tissue culture purposes results initially in a predominately basal cell-like culture since isolated basal cells proliferate at a greater rate than isolated ciliated and mucus cells. Furthermore, for cells isolated from CF airways, the rate of proliferation of basal cells is even greater than that in normal airway, probably reflecting responses to ongoing inflammatory processes [34]. Therefore, morphological differences need to be considered when designing models to study the interactions of gene transfer vectors with airway cells that are presumed to represent the cells in the lung that are exposed to lumenally delivered vectors. Although CF is a disease of the respiratory epithelium, the exact airway region where CF lung disease initiates is still a matter of debate. It does appear that the first signs of pathology occur in the distal airways with findings of bronchiolitis and mucus plugging in the small airways and although the exact nature of how the CFTR defect initiates the disease is not totally resolved, it does appear that hydration of the periciliary fluid layer in these regions may be a major cause [35, 36]. Currently, both the airway surface columnar cells lining the lumen of the small bronchiolar airways and the serous cells of the submucosal glands are candidates for the location for the onset of the disease. The cell type that is believed to be predominately involved in the onset of disease and therefore the specific target for gene transfer is the ciliated cell since these cells exhibit all of the ion and fluid transporting functions of CFTR and display abnormal function in patients with CF [37]. However, the submucosal gland serous cell is the highest CFTR-expressing cell type in the lung, suggesting that these cells may also be an important target for gene replacement [38]. Ultimately, it will be important to determine the location of disease initiation since it is likely that for a lumenal gene therapy to be successful, administration of vector will have to occur early in the life of a CF patient. Later in life, when the airways possess overwhelming mucus plugging and associated bacterial colonization and inflammation, delivery of genes to the target cells will likely become restricted. The current thrust for CF gene therapy strategies is to deliver transgenes to target cell types before such other barriers to treatment are present. 5 7 0 Raymond John Pickles V. Adenoviral Vectors as Gene Transfer Vectors in the Lung A. Animal Models for CF Airway Gene Transfer Studies The generation of CF mouse models was an important step for under­ standing the physiology of CF disease. There have now been over 10 different mouse models produced displaying a range of CF-associated genetic muta­ tions [39]. Although most of the models reflect the most common human mutation, either a complete gene knockout or a AF508 mutation of the mouse CFTR, other models with less common human mutations (e.g., G551D) have also been reported. The multiorgan pathophysiology associated with the different models has been recently reviewed [39]. Interestingly, although the gastrointestinal phenotype of CF mice is similar to that observed in CF patients, there is no CF-like pathology associated with the CF mouse lung. A comparison of bioelectrical measurements between CF human and CF murine airways has revealed that both species exhibit, relative to normals, hyperabsorption of sodium and an absent or reduced cAMP-induced chlo­ ride secretory response. However, it has been deduced that the ion transport defects in the CF mouse airway do not lead to CF-like lung pathology because CF murine airways compensate for the loss of CFTR activity by upregulat- ing an alternative chloride secretory channel that is regulated by changes in intracellular calcium [40]. However, from a practical standpoint, the ability to measure the "bioelectrical defect" in CF mouse airways makes the model useful in terms of monitoring "bioelectrical correction" with gene transfer strategies, but the ability to monitor inhibition or reversal of CF-like pathology induced by transfer of normal CFTR is not possible in these current mod­ els. Therefore, the current gold standard for success in CF gene transfer to mouse lung in vivo is correction of the chloride (and sodium) ion transport defects. Most gene delivery strategies to murine airways have focused on the epithelium of the nasal mucosa and trachea mainly because of accessibility to these regions but also because these regions are similar to those targeted for human CF gene-therapy trials. Unfortunately, baseline bioelectric mea­ surements of murine trachea indicate that these tissues not display sodium hyperabsorption [41], a key indicator for the human disease, and one that will likely need to be corrected for a treatment to be successful. In contrast, the epithelium of the CF mouse nasal cavity and freshly isolated CF murine nasal mucosa both display sodium hyperabsorption and reduced cAMP-induced chloride secretory activity providing an ideal model for study [42]. A fur­ ther difficulty with murine airways (excluding nasal epithelium) is the large proportion of clara cells that are present throughout the upper airway. The 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 1 distribution of this cell-type in the mouse may be misleading when compar­ ing gene transfer efficiency between mouse and human upper airways (see below). The murine nasal mucosa, however, has few clara cells and exists as a pseudostratified mucociliary epithelium with a cell-type distribution similar to human nasal mucosa, again demonstrating the usefulness of this tissue for gene transfer studies. Therefore, in conclusion, the CF murine models do not display sponta­ neous or induced pathological signs of human CF lung disease. However, CF murine airways do display bioelectric abnormalities associated with human CF and correction of these parameters by gene transfer can be measured both in vitro and in vivo. Given these considerations, since most clinical trials have focused on studying gene transfer to the nasal mucosa, the CF mouse nose is considered a good model for studying these strategies. In addition, since the epithelial cell-type distribution in human nose is similar to that of the human trachea and bronchus the nasal epithelium would appear to be a good model for a large proportion of the human airway epithelium. B. Success and Limitations of Ad 1. Efficiency of Gene Transfer a. Cell Types The major cell types that support wild-type Ad infection in the lung are the epithelial cells of the respiratory mucosa lining the airway passages. The tropism of Ad to the respiratory epithelium established this vector as an obvious candidate for delivering transgenes to the lung. Indeed, Ad-mediated gene transfer to airway epithelial cells grown under standard culture conditions in vitro is highly efficient [43, 44], with cellular transduction efficiencies of 90-100% and when the transgene is CFTR, full correction of the spectrum of CF bioelectrical defects is obtained [1]. In contrast, observations from in vivo epithelial cell models derived from cartilaginous (upper airway) regions of the airways of rodents and nonhuman and human primates show that transgenes are expressed after in vivo dosing in less than 20% of the surface epithelial cells, an efficiency unlikely to benefit to the defective physiology of a CF airway [43, 45]. Although the efficiency of gene transfer can be enhanced by prolonging the contact time of Ad with the epithelium for 12-24 h, it is difficult to envision this strategy as being practical in a cfinical scenario [46, 47]. In the case of intralumenal delivery of Ad to the lower airways of rodents, gene transfer to 10-80% of the airway epithelial cells has been reported with apparently no cell-type-specific selectivity [48, 49], although, in a

detailed study of Ad administration to murine airways, only the nonciliated bronchiolar epithelial cells (i.e., Clara cells) were observed to express transgenes [50]. Clara cells are not thought to require correction in the CF lung and this observation casts a shadow on the use of murine airway epithelium as a model for Ad-mediated gene transfer to the human airway epithelium where Clara cells 572 R a y m o n d John Pickles are less common. Therefore, it appears that lumenal-facing well-differentiated airway epithelial cells in vivo^ at least in the upper airway regions, are resistant to efficient Ad-mediated gene transfer. How can we envision that the airway epithelial cells facing the lumen of the airway are not transduced by Ad given the large body of clinical data that shows that these cells are targeted in wild-type infections? In a series of studies using human tracheal epithelium ex vivo and murine trachea in vivo it was discovered that injury to the epithelium by physical abrasion of the columnar cells revealed epithelial cell types that are susceptible to efficient Ad-transduction, as depicted in Fig. 1 [43, 51, 52]. This cell-type-specific variable efficiency led to the finding that underlying basal cell-like cells were efficiently transduced by Ad. These cells, as precursors to columnar cells could, once transduced, over time proliferate and differentiate into transgene-expressing columnar epithelial cells. Since the epithelial basal cells are probably stimulated to proliferate and differentiate upon injury these susceptible cells were described as ''basal cell-like cells" or the poorly differentiated (PD) airway epithelial cells, i.e., injured or regenerating cells, and this cellular phenotype is similar to that displayed by airway epithelial cells grown on plastic that are also highly transducible by Ad [43, 44]. One consideration when comparing wild-type Ad infection to Ad vectors is that the latter rely on delivering many virus particles to a target tissue Figure 1 Increased susceptibility of injured epithelium to Ad-mediated gene transfer. Exposure of Ad vectors to intact pseudostratified columnar cells (CC) results in low gene transfer efficiency. Physical abrasion of columnar cells before Ad exposure results in efficient gene transfer to the underlying basal cells (BC). Upper figures show schematic of intact and injured pseudostratified columnar respiratory epithelium and lower figures are intact and abraded human tracheal epithelium exposed to AdLacZ ex vivo. Reprinted with permission from [20]. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 3 whereas wild-type Ad needs only access to a small number of cells from which Ad replication and spread can then occur. Therefore, wild-type Ad may be able to take advantage of regions of the airway in which epithelium integrity is compromised or injured. Initiation of wild-type infection in injured regions would then be able to spread as a "basal cellitus" effectively beneath the resistant superficial columnar cells. b. Receptors The differences in the gene transfer efficiencies for the two cellular phenotypes of airway epithelial cells, the PD and well-differentiated (WD) columnar cells, suggests that an early step in the virus-cell interaction is deficient for the WD cells. Adenovirus enters epithelial cells by a two-step process: (1) initial attachment of the viral fiber-knob protein to a high-affinity receptor, the human Coxsackie B and adenovirus 2 and 5 receptor (hCAR)) [53, 54]; and (2) translocation of the virus into the cell cytoplasm via clathrin-coated pit internalization processes, in part mediated by an interaction of the viral penton base with ayPs/s integrins [55]. Since quantitative studies of the interactions of Ad with the airway epithelium in vivo are difficult and prone to considerable variation, specialized cell culture models have been generated to aid characterization of the interac­ tion of Ad with both PD and WD cell types. These models have been shown by a number of groups to reproduce: (1) the well-differentiated (ciliated) and poorly differentiated cellular phenotypes and (2) the relative resistance of WD and permissiveness of PD cells to Ad-mediated gene transfer as observed in vivo [56., 57]. In addition, although these models were originally generated to ask specific questions regarding gene transfer strategies, they have subsequently become valuable in a whole series of studies where quantitative and qualitative measurement of events in the airway epithelium are difficult to perform in vivo [35, 36, 58-63]. Using these models of human airway epithelium, immunofluorescent and functional analyses of the interactions of Ad with human airway epithelial cells have shown that decreased gene transfer efficiency to WD compared to PD cultures is due to limited entry (penetration) of Ad across the apical membrane of WD cultures, which reflects a reduced specific Ad-attachment due to the absence of hCAR and ayPs/s integrins from the apical surface. Interestingly, columnar cells and basal cell-like cells express all the necessary receptors to efficiently allow Ad entry but for columnar cells these processes are segregated and limited to the basolateral membranes as depicted in Fig. 2. In these culture models systems. Ad has been shown to efficiently transduce epithelial cells when applied to the basolateral epithehal surfaces [56, 57, 64, 65]. It appears that the most significant Ad-cell interaction in determin­ ing efficiency is that of the Ad-hCAR interaction. Many cell types usually resistant to Ad infection have been shown to be efficiently transduced after heterologous expression of hCAR, although the status of integrin expression 574 R a y m o n d John Pickles Figure 2 Schematic of polarized epithelial cells displaying resistance of the lumenal surface to adenovirus attachment and entry. The receptors required for Ad entry are located on basolateral membranes and excluded from the apical membrane by the tight junctional complexes. Reprinted with permission from [144]. in these cell-types is not always clear [56, 66]. Earlier observations had sug­ gested that inefficient Ad-mediated gene transfer to a bronchial xenograft model of human in vivo-like ciliated airway epithelial cells reflected the absence of avP3/5 integrins from the lumenal membrane of the epithelium [65]. However, ayPs/i integrins may not alone account for decrements in gene transfer efficiency. In support of this hypothesis, Ad mutants lacking penton base RGD sequences (normally required for Ad-ayPs/j integrin interactions) are able to efficiently transduce human epithelial cells although the rate of internalization is reduced [67]. In addition, in a P5 integrin-knockout mouse model, airway epithelial cells were equally susceptible to Ad-mediated gene transfer as were wild-type airway cells [68], again suggesting that ayPs/s inte­ grins may be facilitative rather than necessary for efficient vector entry into the cell. These observations are important for the design of targeted vectors that attempt to increase gene transfer efficiency to normally unsusceptible cell types [69, 70]. Retargeted vectors attached via nonspecific interactions or to noninternalizing receptors will probably depend on nonspecific uptake pathways to enter cells and while this approach is useful for PD cells in vitro, increasing Ad-attachment to WD cultures that do not exhibit these pathways is unlikely to improve gene transfer efficiency [56]. c. The Innate Immune System of the Lung Despite the progress on the cell biological aspects of vector-cell interactions, surprisingly little atten­ tion has been devoted to another fundamental component of innate airway defense that will almost certainly impact on the efficiency of lumenally 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 5 delivered vectors, the barrier/shielding function of epithelial surfaces by the carbohydrate-rich cell surface glycocalyx. Expression of hCAR, engineered to be expressed at the apical surface of polarized epithelia by incorporation of a glycosylphosphatidylinositol-linker (GPI-CAR), identified glycocalyx com­ ponents as barriers for lumenally applied Ad, accessing these receptors as depicted in Fig. 3 [71]. Electron micrographs demonstrate a "fuzzy coat" on the cell surface [72, 73], termed the glycocalyx, and on epithelial cell apical surfaces it is composed of several families of carbohydrate-rich molecules, including glycoproteins (most notably the mucins), proteoglycans, and glycol- ipids. Glycoconjugates are variably modified by sialic acid and sulfate that impart a strong anionic charge to the cell surface. A major component of the airway glycocalyx w îll likely be the "tethered" mucins and the molecular biologic advances in the mucin field have revealed that the MUCl and MUC4 are highly expressed in airway epithelium and have transmembrane anchoring (tethering) domains [74-82]. With respect to airway gene transfer, sialogly- coconjugates (including MUCl) comprising the glycocalyx on MDCK cells, appear to inhibit Ad gene transfer, presumably due, in part, to their negative charge since neuraminidase treatment to selectively remove sialic acid can circumvent the glycocalyx barrier in these cell types [83, 84]. Although apical surface mucins expressed on WD cells are also restrictive to Ad, neuraminidase alone is not sufficient to allow Ad permeation through the glycocalyx, and Figure 3 Schematic of polarized epithelial cell expressing reengineered Ad receptors at the apical surface. These studies revealed that the apical surface glycocalyx was an effective barrier to Ad accessing receptors located on the apical surface. 5 7 6 Raymond John Pickles more stringent proteolytic treatments are required [116, 117]. Presumably, the mucins, including both tethered and secreted mucins, may also be present in the mucus layer in the airway and may act as false attachment sites for Ad, thus effectively reducing the amount of Ad that ultimately reaches the epithelial surface. The reported rheological properties of CF mucus producing a more viscous, more dehydrated and immobile barrier suggest that this obstacle to gene transfer v îll be even more pronounced in the CF lung. Other components of the innate immune system, not studied in specialized cell culture models, may also have barrier effects on gene transfer efficiency. Ordinarily, such barriers occur in the lung as primary defense mechanisms and may be aggravated in the CF lung w^here airway lumens are inflamed. For example, alveolar macrophages have been reported to sequester up to 70% of Ad genomes within 24 h following tracheal administration to mouse airways [85]. In a mouse nasal model of CF lung bacterial colonization, Pseudomonas infection (PAOl strain) was shown to inhibit Ad gene transfer by 10-fold relative to noninfected control nasal airways [86]. In conclusion, there appear to be numerous potential barriers to Ad gene transfer in the lung especially in the CF lung that exhibits an overactive inflammatory milieu, and strategies to circumvent these barriers will likely need to be designed. However, even if all of these barriers are circumvented the major cause of low efficiency gene transfer is the lack of entry of Ad into the target cells. Strategies to improve the transduction efficiency will therefore be crucial to proving that the concept of gene transfer into the airway may actually be a feasible one. In summary, human WD cultures are resistant to Ad-mediated gene transfer because of decreased specific attachment sites and reduced nonspecific entry paths that can internalize a fraction of a large vector load typical of CF gene therapy protocols using Ad. To circumvent the inefficiency of Ad-mediated gene transfer to the respiratory epithelium, either alterations of the host will be required, i.e., ability to access Ad receptors expressed on basolateral cell surfaces, or Ad will require retargeting to receptor types that are present in sufficient number on the airway epithelial lumenal surface which allow for efficient uptake of Ad into the cell. 2. Safety Initial attempts to improve efficiency of Ad gene transfer to the airway epithelium in vivo have mostly involved delivery of greater doses of Ad to the lung. These doses can represent a relatively large protein load and the subsequent gene expression (even in nonepithelial cells) can produce an unusually high level of transgene in an organ that is designed for monitoring invading pathogen assaults. It is therefore not surprising that inflammatory and immune responses are observed when Ad is delivered to the lung and numerous studies have reported Ad-induced lung inflammation. In general. Ad induces 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 7 an acute nonspecific mixed cellular inflammatory response and a late specific, dose-related, lymphocyte-predominant, cell-mediated immune response in all species so far studied [22, 23, 25-27, 29, 87-90]. The acute response is nonspecific and likely induced by cytokine production in response to the protein load. It has also been suggested that neurogenic inflammation results after administration of Ad in rat airways, an effect shown to be partially due to vector gene expression but also to the viral proteins of the capsid coat [91]. The

later, specific immune response to Ad is mediated by major histocompatibility complex (MHC) class I-restricted cytotoxic (CDS) T lymphocytes directed against viral gene products and transgene proteins in expressing cells. The subsequent destruction of these cells leads to loss of persistence of transgene expression and so reduces efficiency of gene transfer [28, 92, 93]. The use of second-generation and high-capacity "gutless" vectors aims to limit the amount of viral gene expression to decrease the effects of this late immune response and these approaches are the topics of other chapters [94, 95]. In addition to cellular immune responses. Ad also elicits humoral immune responses with the production of mucosal and neutralizing antibodies [25, 87, 90, 96-98]. These responses have been shown to be against the viral capsid proteins and are secondary to a helper (CD4~ )̂ T lymphocyte response. The production of such an antibody response results in neutralization of subsequent readministration of Ad, resulting in loss of gene transfer, assuming that the same Ad serotype is used (see below). Therefore, in addition to the innate immunity of the lung (receptor localization, glycocalyx, macrophages, mucus) reducing the efficiency of gene transfer, the cellular and humoral immune systems also respond to Ad delivery into the airway and as a result reduce the efficiency of gene transfer and the persistence of expression in the target epithelial cells. C. Overcoming the Limitations of Ad 1. Efficiency The localization of entry pathways for Ad to the basolateral surfaces of airway epithelial cells suggests that a delivery strategy to access these regions would be beneficial to improving gene transfer efficiency. This approach may also allow targeting of the epithelial stem cells (basal cells), resulting in transgene expression in the lung for the lifetime of the individual. This is an important consideration for gene transfer to the airway epithelium since fully differentiated lumenal facing cells (e.g., ciliated cells) have a relatively short lifetime, on the order of 40-100 days, and targeting these cell types specifically will require regular readministration of vectors. Access to basal cells/basolateral surfaces may possibly be achieved by intravenous administration of vectors if penetration of the blood vessel wall, the connective tissue, and the basal lamina of the basement membrane were 5 7 8 Raymond John Pickles achievable. Unfortunately, studies that have attempted intravenous delivery strategies have not been successful since vectors do not appear to gain access to sufficient lung epitheHal cells to make this approach feasible [99-102]. Barriers functions provided by the blood vessel endothelial cells and connective tissue surrounding the airv^ay passages seems unpenetratable by Ad. Indeed, the particle permeability of the basal lamina alone is thought to exclude inert particles of greater than 10 nm, which would certainly be restrictive to particles the size of Ad (100 nm). In an in vivo experimental mouse model where Ad was externally administered directly to the tracheal basement membrane, efficient gene transfer to the connective tissue fibroblasts adjacent to the basement membrane was observed without gene transfer to the epithelial cells of the juxtaposed epitheHum [51]. To date, two main strategies to improve intralumenal delivery of Ad vectors have been focused on. One approach is to access the basolateral surfaces of the epithelial cells by disruption of the epithelial "tight" junctions, and the other is to retarget Ad vectors to nonviral receptors that are present on the apical surface of lumenal epithelial cells that allow for entry of Ad into these cell types. Retargeting has so far been achieved by chemically, immunologically, or genetically modifying the Ad capsid coat by incorporating new receptor ligands that can target candidate receptors. a. Modification of the Host by Opening Tight Junctions Epithelial cell "tight" junctions (zonulae occludens) are collar-like structures composed of a diverse number of proteins that separate the apical and basolateral domains of the lumenal columnar epithelial cells. As well as functioning as a restrictive barrier to mixing of apical and basolateral membrane components, these intercellular junctions limit the transepithelial transport of solutes across the epithelium. A number of disease states have been shown to alter tight junction permeability (e.g., asthma) and reagents to increase the permeability of the junction are available. The key to successful disruption of tight junctions to allow Ad access to basolateral epithelial cell surfaces will be to use a reagent that opens tight junctions sufficiently for Ad to pass through but that is rapidly reversible to limit the passage of other lumenal contents (e.g., bacteria) or serosal fluid into the airway lumen. A property exploited for this purpose is the calcium ion dependency of the structural integrity of the junction. Walters et al.^ have successfully shown that treatment of the apical surface of human WD airway cells with the calcium chelator EGTA or hypotonic solutions (e.g., water) allow for improvements in Ad-mediated gene transfer presumably by allowing Ad access to basolateral receptors [64,103]. The slow reversibility of this effect, however, is problematic; tight junction reformation takes a least a couple of hours, a time period that would be unacceptable in a clinical setting. In vivo studies in mouse airways have confirmed that these treatments improve gene transfer efficiency although parameters of safety were not assessed fully [104, 105]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 9 More specific reagents are available for studying tight junction perme­ ability and the effect on Ad-gene transfer. Parsons et al. used a detergent, polidocanol, in murine airways in vivo to enhance Ad-mediated gene transfer, an effect shown to be due to the ability of this reagent to transiently open tight junctions 186]. The short-chain fatty acid sodium caprate, has also been used to increase Ad-mediated gene transfer to human WD cultures and results in full correction of CF cultures when AdCFTR is subsequently applied to the apical surface. This result is exciting since the effect is rapidly reversible effect and has previously been used clinically for enhancing pharmaceutics absorp­ tion across the GI tract, again presumably by an effect on tight junctional permeability. These studies although fraught with inherent safety issues are beginning to establish that this strategy for delivering transgenes to the lung may be a viable option. The possibility of targeting the basal stem cells by this procedure is reason enough to continue pursuing the usefulness of these strategies. b. Targeted Ad to Increase Gene Transfer Efficiency Targeted Ad directed against specific receptors have been used to successfully transduce cell types that are usually refractory to Ad infection. The epidermal growth factor receptor, stem cell factor receptor, fibroblast growth factor receptor, ay integrins, and T-cell receptors (CD 3), have all been used as surrogate recep­ tors for Ad entry in a variety of cell types [106-109]. Given the lack of Ad receptors at the apical surface of lumenal airway epithelial cells, a retargeting strategy to receptors known to present on the airway lumen may allow for gene transfer efficiency to be improved. However, a successful targeting strategy to the lung epithelium will require the identification of target molecules that allow for attachment and internalization of AdV across the apical membrane of columnar airway epithelial cells. The identification of target receptors to which to redirect Ad tropism on the lumen of airway epithelium is difficult because most receptors and entry mechanisms occur on the basolateral surfaces of the cells. Certain members of a specific seven-transmembrane-spanning G-protein-coupled receptor family (i.e., P2Y2-purinoceptors, B2-kinin receptors, and adenosine type 2b receptors) have been identified as putative utile target receptors for redirecting Ad tropism to the surface epithelium of the lung. These receptors have been shown to be present on the lumenal surface of human airway epithelium and internalized into clathrin-coated pits when activated by their respective agonists [110]. The utilization of clathrin-coated pit internalization pathways for native Ad receptors, suggests that the G-protein coupled receptors may provide an ideal surrogate entry pathway for Ad. The high potency of P2Y2 agonists (e.g., ATP, UTP) combined with the low affinity of these agonists for the receptor suggests that the P2Y2 purinoceptors are abundant in number on the lumenal surface of the human respiratory epithelium [111]. Since pharmacological 5 8 0 Raymond John Pickles activation of airway epithelial P2Y2 receptors do not result in untoward effects in human airways, this receptor is an ideal target receptor to redirect Ad tropism. However, since the only available ligands for this receptor are low affinity, small organic molecules, certain technical difficulties are associated with conjugating these molecules to Ad. Other receptor types suitable for Ad retargeting exist on the airway, although specific retargeting data for Ad is lacking. The urokinase plasminogen activator receptor, uPA-R and the SEC- 2 receptor have also been proposed as target receptors for Ad and AAV, respectively [112, 113]. /. Immunologically modified targeted vectors One immunological app­ roach for targeting gene transfer vectors is using bispecific antibodies linking Ad directly to non-Ad-receptor-types present on the cell surface [108,114]. For example, chemically conjugated antibodies, one of which is directed against an epitope-tagged Ad coat protein and the other against oty integrin membrane proteins have been reported to increase gene transfer efficiency by seven- to ninefold compared to that of nonmodified Ad, indicating that increased Ad-attachment results in increased gene transfer efficiency [114]. In a similar approach. Ad was retargeted to nonviral receptor types in conjunction with ablation of the natural Ad tropism using an anti-fiber-knob protein antibody conjugated to folate [115]. Folate-conjugated antibody was the ligand of choice since the folate receptor is reported to be upregulated on the surface of malignant cells, thus providing a targeted vector for a variety of cancers. Retargeting Ad to cells expressing folate-receptors was shown to be specific and successful with significant increases in gene transfer efficiency. As "proof of concept" studies, a hemaggluttin (HA)-epitope-tagged P2Y2 receptor expressed at the apical surface of human WD cultures and tar­ geted with bispecific antibodies consisting of antibodies to Ad fiber-knob protein/HA-tag has been shown to facilitate Ad entry into these cell types, shown schematically in Fig. 4 [116, 117]. This effect is enhanced by coad­ ministration of exogenous ATP to activate the receptor, an effect that can be reduced by desensitization of the P2Y2 receptors prior to addition of tar­ geted Ad. Importantly, the apical surfaces of the HA tagged-P2Y2 expressing cultures required a brief exposure to specific proteases before targeting was effective suggesting that the apical surface glycocalyx hindered access of the targeted vector to the target receptors [116]. This approach also relied on the expression of a HA-tagged receptor that may be overexpressed relative to the endogenously expressed P2Y2 receptors in the culture system. The number of target receptors and the affinity of the targeting ligand are both likely to be critical parameters for the success of such a targeting strategy. //. Chemically modified targeted vectors Since antibodies to the external domains of P2Y2 receptors are not currently available, a strategy to target Ad to the endogenous P2Y2 receptor was to chemically conjugate small molecule agonists (DTP) to the proteins of the Ad capsid coat. Using chemically reactive 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 581 Figure 4 Schematic of targeting strategy used to redirect Ad tropism to P2Y2 receptors on the apical surface of human airway epithelial ceils. Bispecific antibodies against the virus and the receptor were used as a targeting link and activation of the receptor results in receptor internalization and entry of Ad with subsequent gene transfer. biotin derivatives, biotin v^as coupled to the Ad capsid coat predominately via hexon protein. This strategy is reported to couple 2-300 biotins to a single Ad particle and does not significantly alter the fiber-knob-hCAR interac­ tion. By using commercially available biotin-linked UTP in combination v^ith streptavidin as a "bridge" linking biotin-Ad to biotin-UTP, these molecular conjugates v^ere shown to mediate gene transfer by an interaction specifically v^ith endogenous P2Y2 receptors on the apical surface of WD cultures [110]. Again, the effectiveness of this approach w âs reduced by the presence of apical surface glycocalyx since gene transfer was only observed in cultures pretreated with agents that degrade this barrier. Regardless, gene transfer efficiency using these conjugates was still inefficient, probably due to the clumsiness of the "streptavidin bridge" and the low affinity of UTP for this receptor. Future experiments using this targeting strategy will require the identification of receptor agonists with

higher affinity in addition to improved methods to directly couple the agonist ligands to the Ad capsid coat. 5 8 2 Raymond John Pickles Another method for chemically conjugating receptor ligands to Ad is by the use of polyethylene glycol (PEG) that can be covalently linked directly to the Ad capsid coat. A number of groups have now shown that PEG conjugated viruses can be used to target Ad [112, 118]. For example, Ad conjugated to a 12-amino-acid peptide, identified from phage display assays on the apical surfaces of human WD cultures, resulted in a 10-fold increase in gene transfer efficiency to these cell types [118]. Similarly, Ad conjugated via PEG to a peptide that binds to uPA-R has been shown to target Ad to this receptor type and enhance gene transfer to polarized airway epithelia [112]. An additional bonus of using PEG-conjugated Ad is that these vectors appear to be less immunogenic that non-PEG-conjugated Ad. This effect is due to the masking of antigenic Ad capsid proteins (mainly hexon) from neutralizing antibodies ([119], see below). ///. Genetically modified targeted vectors The ideal targeted vector would be one in which the target ligand could be incorporated into the capsid coat with minimal disruption of the physical and biological properties of Ad. For targeting strategies in which a peptide ligand is used, the most desirable method would be to generate an Ad vector genetically modified to express a functional peptide ligand on the viral surface. Such an approach for targeting vectors has been reported, where the Ad viral coat has been genetically modified to express multiple polylysine groups on the C-terminus of the Ad fiber-knob protein [70]. This redirects Ad tropism to heparan sulfate moieties that are present on the surfaces of most mammalian cells. With certain nonepithelial cell types, which lack hCAR, this modified vector has been shown to increase gene transfer efficiency 10- to 300-fold in comparison to nonmodified Ad. However, the modified vector will likely not be useful for gene transfer to the airway epithelium since heparan sulfate is not expressed at the apical surface of airway epithelial cells [120]. Targeted Ad in which the fiber-knob protein (responsible for Ad attachment to the hCAR) has been modified to express novel ligands that can interact with other receptor-types are being developed and the feasibility of this approach has now been reported by a number of groups [107, 121, 122]. A recent development in this type of approach was reported by Krasnykh et al. [123], who hypothesized that the HI loop region of the fiber-knob structure can withstand the insertion of heterologous peptide sequences without significantly compromising the tertiary structure of the fiber-knob protein or the production and infectivity of the modified Ad. These authors incorporated the FLAG octapeptide marker sequence into the HI loop region and were able to produce functional Ad. Importantly, they also showed that the sequence contained within intact virions was accessible to a FLAG-specific antibody, suggesting that sequences inserted into this region are capable of interacting with other target substrates such as cell-surface receptors. A significant technical advance in Ad targeting strategies evolved from studies that deduced the viral sequences in fiber-knob protein that interact 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 3 with hCAR. Genetic ablation of these sequences from Ad vectors led to the generation of Ad that no longer binds to hCAR and no longer transduces cells that are permissive for normal Ad transduction [124]. The broad cellular tropism of Ad vectors can nov^ be reduced, and by the addition of targeting moieties to these Ad vectors specific cell-type targeting is possible. Reduced Ad interactions with nontarget cells will lessen the potential for adverse effects with these vectors. In the lung however, the significance of natural tropism ablation is unclear since most of the epithelial cells targeted with delivery strategies do not express Ad receptors at the lumenal surface. However, the loss of transduction to other cell-types that may interact with Ad delivered to the lung (e.g., macrophages, dendritic cells) may benefit from the hCAR-binding ablation mutant. Recent developments in immunologically, chemically, and genetically modified targeted Ad suggests that "designer" gene transfer vectors will one day be available. Although Ad vectors, in their present form, may not be ideal for a number of gene transfer target tissues, notably the lung epithelium, this vector clearly remains at the forefront of gene therapy research since it is still one of the most efficacious gene transfer vectors available, and will continue to be useful at least in proof-of-concept studies. iv. Screening with other adenoviral subtypes Although over 51 different serotypes of wild-type Ad exist, the predominant serotypes used for gene transfer experiments are serotypes 2 and 5. The reason for this is largely historical since these two serotypes have been extensively studied over the past 30 years and understanding of the viral genome has allowed the manipulations necessary to evolve these viruses into gene transfer vectors. With regard to the airway epithelium, other serotypes have been suggested to be efficacious at delivering transgenes to human WD cultures. Serotypes 17 and 12 have been shown to bind/deliver transgenes 10-fold over Ad2 vectors [125]. However, as of yet no conclusive results have been presented that suggest that the improvements warrant future investigations with these vectors. One approach to determining if any of the other serotypes may be more efficacious in the lung epithelium could be envisioned using a recently reported system of generating an Ad5 capsid-expressing fiber proteins from the other serotypes [126]. This system was used to screen vascular endothelial and smooth muscle cells and the efficiency of gene transfer compared against the efficiency of gene transfer with Ad5. This screening procedure identified Ad5 with Adl6 fibers as being significantly more efficient at gene transfer than Ad5 in these particular cell types. It will be of interest to screen these serotypes on human WD cultures relative to Ad5 to determine whether other Ad serotypes may be of benefit to airway epithelial cell gene transfer. A serotype which may be of particular interest is Ad37, since it has been reported that Ad37 utilizes sialic acid residues that are present on the extracellular surfaces of most cells [127]. An abundance of sialic acid residues on the lumenal surface of airway epithelial 5 8 4 Raymond John Pickles cells as components of glycoconjugates may allow for improved gene transfer. Whether attachment of Ad37 to sialic acid residues located on the airway lumen leads to efficient entry and gene transfer awaits further study. V. Other methods to increase gene transfer efficiency Nonspecific meth­ ods to enhance Ad-mediated gene transfer to airway epithelial cells have been reported [128, 129]. Calcium phosphate coprecipitation has been used to pre­ cipitate aggregates of Ad and other vectors to increase gene transfer to airway epithelia both in vitro and in vivo. It has been suggested that in vivo these aggregates increase the rate of nonspecific endocytosis of Ad across the apical membrane of polarized epithelial cells. The possible effects of this technique on cellular and paracellular permeability have not been investigated. Another method to both improve both the delivery and efficiency of Ad to the lung epithelium in vivo is using the inert perfluorochemicals (PFCs). These compounds are liquid in nature but due to high oxygen saturation capacities can be instilled into the lung for periods of time with maintenance of passive oxygen diffusion. Several studies have now shown that administration of gene transfer vectors (including Ad) with PFC results in increased gene transfer to rodent and nonhuman primate lungs [130-132]. The improvements in gene transfer are predominately localized to the alveolar regions with only modest improvements in the efficiency of gene transfer to the respiratory epithelium. The exact mechanism by which PFCs produce these effects remains to be determined, but may be due to prolonged contact time for the vector on the cells and reduced ingestion of Ad by macrophages and/or due to some nonspecific effect on the paracellular permeability. Nonetheless, this method provides an example of a new strategy to deliver transgenes to the lung without the need for direct instillation or aerosolization, which are both inefficient methods for airway epithelium delivery. 2. Safety Strategies that improve gene transfer efficiency, as described above, will allow for lower doses of Ad to be administered to the lung. This achievement alone will be beneficial in reducing the inflammatory responses seen with Ad administration. However, attempts have also been made to reduce the inflammation produced by expression of viral genes that produce the cell- mediated immune responses described above. The identification of specific viral genes that initiate or amplify the immune response has led to the reengineering of Ad vectors to ablate the specific gene expression. For example, vectors deleted of E2a and E4 have been reported to display reduced immune responses and improve persistence of transgene expression [92, 93]. The ultimate vector is one that contains no viral genes and the high-capacity "gutless" vectors have been generated and appear to blunt the immune response considerably [133-135]. In contrast, several viral genes have been identified that have evolved to subvert the immune response and the inclusion of these genes into new vectors may be desirable (e.g., E3) [136]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 8 5 Strategies to circumvent the humoral immune response have also been considered. Since this arm of the immune system results in the inability of readministration of specific Ad serotypes, serotype switching has been proposed as a method to allow repeat administration. Indeed, Ad5 administration but not Ad4 or Ad30 has been reported to prevent the gene transfer obtained with subsequent Ad5 administration the lung [97]. However, in addition to this being a somewhat limited procedure, it is not yet clear whether these different serotypes are as inefficient for gene transfer to the airway epithelium as Ad5. Transient immunosuppression has also been suggested to reduced the inhibitory effects of neutralizing antibodies. Intratracheal administration of immunosuppressive factors (IL-12, gamma interferon, antibodies to CD40, corticosteroids and cyclophosphamide) at the time of vector administration have all shown a reduction in generation of neutralizing antibodies [137-141]. The longer-term effects of administering these factors to lung have not been reported. Finally, covalent conjugation of PEG to the Ad capsid coat that permits addition of targeting moieties is also a strategy for the virus to elude neutralizing antibodies by masking capsid coat proteins, especially hexon protein. Although PEGylation of Ad leads to some loss of viral titer and aggregation the ability of this procedure to develop targeted vectors combined with reduction in immune response makes this a promising method for future study [119]. VI . Other Vectors The focus of this review has been on Ad vectors for use in CF lung disease. Flowever, a number of other vectors have been suggested as candidates for CF lung gene transfer vectors. Adeno-associated virus (AAV), retrovirus, lentivirus, and liposomal vectors have all shown promise in preclinical studies in the lung and some have been tested in clinical trials. The general observation is that all of these vectors, like Ad, do not appear to display the efficiency of gene transfer in WD airway epithelial cells as they do in nonpolarized cells, suggesting that these vectors confront similar barriers in the airways as do Ad vectors. Strategies to improve gene transfer efficiency for these other vectors have followed the progression of experiments with Ad, i.e., tight junction modulation, targeting, serotype switching, and immune response reduction, and all have been shown as for Ad to improve efficiency to some to degree. Whether efficiency can ever be improved to a point that shows efficacy in the lungs of CF patients remains to be determined. Meanwhile, other viruses (sendai virus [142] and lentiviruses pseudotyped with filovirus coat proteins [143]) may show promise for gene delivery to the airway and preliminary reports suggest that these viruses or components thereof may one day provide us with a method to deliver transgenes to the lung in an efficient and safe manner. 5 8 6 Raymond John Pickles VII. Conclusion It is clear that the evolution of gene therapy has been aided by many different aspects of basic biological and medical research efforts and the possibility of a gene therapy for CF lung disease will

only take time and a continuation of these efforts. These findings will not only be beneficial to the treatment of CF lung disease but also other disease states, which are continually being brought closer to a treatment and perhaps a cure by this new and exciting biomedical technology. Ackno>vledgments The author especially thanks Dr. Ashley Henderson of the UNC Pulmonary Division for useful discussions and critical review of the manuscript and Jennifer Nank for help w îth both manuscript and figure production. References 1. Johnson, L. G., Boyles, S. E., Wilson, J., and Boucher, R. C. (1995). Normalization of raised sodium absorption and raised calcium-mediated chloride secretion by adenovirus-mediated expression of cystic fibrosis transmembrane conductance regulator in primary human cystic fibrosis airway epithelial cells./. Clin. Invest. 95, 1377-1382. 2. Drumm, M. L., Pope, H. A., Cliff, W. H., Rommens, J. M., Marvin, S. A., Tsui, L. C , Collins, F. S., Frizzell, R. A., and Wilson, J. M. (1990). Correction of the cystic fibrosis defect in vitro by retrovirus- mediated gene transfer. Cell 62, 1227-1233. 3. Rommens, J. M., lannuzzi, M. C , Kerem, B., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., et al. (1989). Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245, 1059-1065. 4. Stutts, M. J., Canessa, C. M., Olsen, J. C , Hamrick, M., Cohn, J. A., Rossier, B. C , and Boucher, R. C. (1995). CFTR as a cAMP-dependent regulator of sodium channels. Science 269, 847-850. 5. Boucher, R. C , Stutts, M. J., Knowles, M. R., Cantley, L., and Gatzy, J. T. (1986). Na-f transport in cystic fibrosis respiratory epitheha. Abnormal basal rate and response to adenylate cyclase activation./. Clin, Invest. 78, 1245-1252. 6. Rosenfeld, M. A., Yoshimura, K., Trapnell, B. C , Yoneyama, K., Rosenthal, E. R., Dale- mans, W., Fukayama, M., Bargon, J., Stier, L. E., Stratford-Perricaudet, L., et al. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithefium. Cell 68, 143-155. 7. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75, 207-216. 8. Boat, T., Welsh, MJ, and Beaudet, AL. (1989). Cystic fibrosis. In "The Metabolic Basis of Inherited Disease" (E. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, eds.), pp. 2649-2680. McGraw-Hill, New York. 9. Riordan, J. R., Rommens, J. M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielen- ski, J., Lok, S., Plavsic, N., Chou, J. L., et al. (1989). Identification of the cystic fibrosis gene: Cloning and characterization of complementary DNA. Science 14S, 1066-1073. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 7 10. Welsh, M. J., and Smith, A. E. (1993). Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell 73, 1251-1254. 11. Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G. A., O'Riordan, C. R., and Smith, A. E. (1990). Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63, 827-834. 12. Kalin, N., Claass, A., Sommer, M., Puchelle, E., and Tummler, B. (1999). DeltaF508 CFTR protein expression in tissues from patients with cystic fibrosis. / . Clin. Invest. 103, 1379-1389. 13. Quinton, P. M. (1990). Cystic fibrosis: A disease in electrolyte transport. FASEB J. 4, 2709-2717. 14. Johnson, L., and B. RC. (1997). Towards correction of the genetic defect in cystic fibrosis. In "Gene Therapy for Diseases of the Lung" (B. KL, Ed.) Vol. 104, pp. 239-265. Dekker, New York. 15. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangefi, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994). Administration of an aden­ ovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8, 4 2 - 5 1 . 16. Knowles, M. R., Hohneker, K. W., Zhou, Z., Olsen, J. C , Noah, T. L., Hu, P. C , Leigh, M. W., Engelhardt, J. F., Edwards, L. J., Jones, K. R., et al. (1995). A controlled study of adenoviral-vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis. N. Engl. J. Med. 333, 823-831. 17. Caplen, N. J., Kinrade, E., Sorgi, F., Gao, X., Gruenert, D., Geddes, D., Coutelle, C , Huang, L., Alton, E. W., and Williamson, R. (1995). In vitro liposome-mediated DNA transfection of epithelial cell lines using the cationic liposome DC-Chol/DOPE. Gene Ther. 2, 603-613. 18. Gill, D. R., Southern, K. W., Mofford, K. A., Seddon, T., Huang, L., Sorgi, F., Thomson, A., MacVinish, L. J., Ratcliff, R., Bilton, D., Lane, D. J., Littlewood, J. M., Webb, A. K., Mid- dleton, P. G., Colledge, W. H., Cuthbert, A. W., Evans, M. J., Higgins, C. F., and Hyde, S. C. (1997). A placebo-controlled study of liposome-mediated gene transfer to the nasal epithelium of patients with cystic fibrosis. Gene Ther. 4, 199-209. 19. Johnson, L. G., Olsen, J. C , Sarkadi, B., Moore, K. L., Swanstrom, R., and Boucher, R. C. (1992). Efficiency of gene transfer for restoration of normal airway epithelial function in cystic fibrosis. Nat. Genet. 2, 21-25 . 20. Boucher, R. C. (1996). Current status of CF gene therapy. Trends Genet. 12, 81-84. 21. Teramoto, S., Johnson, L. G., Huang, W., Leigh, M. W., and Boucher, R. C. (1995). Effect of adenoviral vector infection on cell proliferation in cultured primary human airway epithelial cells. Hum. Gene Ther. 6, 1045-1053. 22. Dong, J. Y., Wang, D., Van Ginkel, F. W., Pascual, D. W., and Frizzell, R. A. (1996). Sys­ tematic analysis of repeated gene delivery into animal lungs with a recombinant adenovirus vector. Hum. Gene Ther. 7, 319-331. 23. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., Pernis, B., Wold, W. S., Chanock, R. M., and Prince, G. A. (1989). Role of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. Sci. USA 86, 3823-3827. 24. Ginsberg, H. S., and Prince, G. A. (1994). The molecular basis of adenovirus pathogenesis. Infect. Agents Dis. 3, 1-8. 25. Kaplan, J. M., St George, J. A., Pennington, S. E., Keyes, L. D., Johnson, R. P., Wadsworth, S. C , and Smith, A. E. (1996). Humoral and cellular immune responses of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 117-127. 26. Look, D. C , and Brody, S. L. (1999). Engineering viral vectors to subvert the airway defense response. Am.]. Respir. CellMol. Biol. 20, 1103-1106. 27. St. George, J. A., Pennington, S. E., Kaplan, J. M., Peterson, P. A., Kleine, L. J., Smith, A. E., and Wadsworth, S. C. (1996). Biological response of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 103-116. 5 8 8 Raymond John Pickles 28. Yang, Y., Nunes, F. A,, Berencsi, K., Gonczol, E., Engelhardt, J. F., and Wilson, J. M. (1994). Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nat. Genet. 7, 362-369. 29. Yei, S., Mittereder, N., Wert, S., Whitsett, J. A., Wilmott, R. W., and Trapneli, B. C. (1994). In vivo evaluation of the safety of adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA to the lung. Hum. Gene Ther. 5, 731-744. 30. Jeffery, P. (1990). Form and function of airv^ay epithelium. In "Epithelia: Advances in Cell Physiology and Cell Culture" (C. J. Jones, Ed.), pp. 195-220. Kluw^er Academic, London. 31. Harkema, J., Mariassy, A., St. George, J., Hyde, D. M., and Plopper, C. G. (1994). Epithelial cells of the conducting airways: A species comparison. In "The Airv^ay Epithelium" (S. G. Farmer and D. W. P. Hay, Eds.), Vol. 55, pp. 3-39. Dekker, New York. 32. Mercer, R. R., Russell, M. L., Roggli, V. L., and Crapo,J. D. (1994). Cell number and distribution in human and rat airways. Am. ]. Respir. Cell Mol. Biol. 10, 613-624. 33. Randell, S. H. (1992). Progenitor-progeny relationships in airway epithelium. Chest 101, 11S-16S. 34. Leigh, M. W., Kylander, J. E., Yankaskas, J. R., and Boucher, R. C. (1995). Cell prolifera­ tion in bronchial epithelium and submucosal glands of cystic fibrosis patients. Am. ]. Respir. Cell Mol. Biol. 12,605-612. 35. Matsui, H., Randell, S. H., Peretti, S. W., Davis, C. W., and Boucher, R. C. (1998). Coordi­ nated clearance of pericifiary liquid and mucus from airway surfaces. / . Clin. Invest. 102, 1125-1131. 36. Matsui, H., Grubb, B. R., Tarran, R., Randell, S. H., Gatzy, J. T., Davis, C. W., and Boucher, R. C. (1998). Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease. Cell 95, 1005-1015. 37. Cotton, C. U., Stutts, M. J., Knowles, M. R., Gatzy, J. T., and Boucher, R. C. (1987). Abnor­ mal apical cell membrane in cystic fibrosis respiratory epithelium. An in vitro electrophysio­ logic analysis./. Clin. Invest. 79, 80-85. 38. Engelhardt, J. F., Yankaskas, J. R., Ernst, S. A., Yang, Y., Marino, C. R., Boucher, R. C , Cohn, J. A., and Wilson, J. M. (1992). Submucosal glands are the predominant site of CFTR expression in the human bronchus. Nat. Genet. 2, 240-248. 39. Grubb, B., and Boucher, R. C. (1999). Pathophysiology of Gene-targeted mouse models for cystic fibrosis. Physiol. Rev. 79, S193-S214. 40. Clarke, L. L., Grubb, B. R., Yankaskas, J. R., Cotton, C. U., McKenzie, A., and Boucher, R. C. (1994). Relationship of a non-cystic fibrosis transmembrane conductance regulator- mediated chloride conductance to organ-level disease in Cftr(-/-) mice. Proc. Natl. Acad. Sci. USA 91, 479-483. 41. Grubb, B. R., Paradiso, A. M., and Boucher, R. C. (1994). Anomalies in ion transport in CF mouse tracheal epithelium. Am. J. Physiol. 267, C293-C300. 42. Grubb, B. R., Vick, R. N., and Boucher, R. C. (1994). Hyperabsorption of Na+ and raised Ca(2+)-mediated CI- secretion in nasal epithelia of CF mice. Am. } . Physiol. 266, C1478-C1483. 43. Grubb, B. R., Pickles, R. J., Ye, H., Yankaskas, J. R., Vick, R. N., Engelhardt, J. F., Wil­ son, J. M., Johnson, L. G., and Boucher, R. C. (1994). Inefficient gene transfer by adenovirus vector to cystic fibrosis airway epithelia of mice and humans. Nature 371, 802-806. 44. Mittereder, N., Yei, S., Bachurski, C , Cuppoletti, J., Whitsett, J. A., Tolstoshev, P., and Trapneli, B. C. (1994). Evaluation of the efficacy and safety of in vitro, adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA. Hum. Gene Ther. 5, 717-729. 45. Engelhardt, J. F., Yang, Y., Stratford-Perricaudet, L. D., Allen, E. D., Kozarsky, K., Perri- caudet, M., Yankaskas, J. R., and Wilson, J. M. (1993). Direct gene transfer of human CFTR into human bronchial epithelia of xenografts with El-deleted adenoviruses. Nat. Genet. 4, 27-34. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 9 46. Jiang, C , Akita, G. Y., Colledge, W. H., Ratcliff, R. A., Evans, M. J., Hehir, K. M., St George, J. A., Wadsworth, S. C., and Cheng, S. H. (1997). Increased contact time improves adenovirus-mediated CFTR gene transfer to nasal epithelium of CF mice. Hum. GeneTher.S,671-6S0. 47. Zabner, J., Zeiher, B. G., Friedman, E., and Welsh, M. J. (1996). Adenovirus-mediated gene transfer to ciliated airway epithelia requires prolonged incubation time. / . Virol. 70, 6994-7003. 48. Mastrangeli, A., Danel, C., Rosenfeld, M. A., Stratford-Perricaudet, L., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1993). Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. / . Clin. Invest. 91, 225-234. 49. Hansen, S. H., Sandvig, K., and van Deurs, B. (1992). Internalization efficiency of the transferrin receptor. Exp. Cell Res. 199, 19-28. 50. St. George, J., Sacks, C. R., Lukason, M. J., Nichols, M., Peterson, P. A., Vaccaro, C , Bai­ ley, S., Johnson, J., Pratt, P., and Wadsworth, S. C. (1995). Efficacy of adenoviral vectors in airway epithelium. Pediatr. Pulmonol. (Suppl.) 12, 151. 51. Pickles, R. J., Barker, P. M., Ye, H., and Boucher, R. C. (1996). Efficient adenovirus- mediated gene transfer to basal but not columnar cells of cartilaginous airway epithelia. Hum. Gene Ther. 7, 921-931. 52. Dupuit, F., Zahm, J. M., Pierrot, D., Brezillon, S.,

Bonnet, N., Imler, J. L., Pavirani, A., and Puchelle, E. (1995). Regenerating cells in human airway surface epithelium represent preferential targets for recombinant adenovirus. Hum. Gene Ther. 6, 1185-1193. 53. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S,, Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 54. Tomko, R. P., Xu, R., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA 94, 3352-3356. 55. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 56. Pickles, R. J., McCarty, D., Matsui, H., Hart, P. J., Randell, S. H., and Boucher, R. C. (1998). Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer. / . Virol. 72, 6014-6023. 57. Zabner, J., Freimuth, P., Puga, A., Fabrega, A., and Welsh, M. J. (1997). Lack of high affinity fiber receptor activity explains the resistance of ciliated airway epithelia to adenovirus infection./. Clin. Invest. 100, 1144-1149. 58. Matsui, H., Davis, C. W., Tarran, R., and Boucher, R. C. (2000). Osmotic water perme­ abilities of cultured, well-differentiated normal and cystic fibrosis airway epithelia. / . Clin. Invest. 105, 1419-1427. 59. Walters, R. W., Yi, S., Keshavjee, S., Brown, K. E., Welsh, M. J., Chiorini, J. A., and Zab­ ner, J. (2001). Binding of Adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. / . Biol. Chem. 21 , 21. 60. Jepsen, M., Graham, S., Karp, P. H., and Zabner, J. (2000). Effect of topical nasal pharma­ ceuticals on sodium and chloride transport by human airway epithelia. Am. J. Rhinol. 14, 405-409. 61. Zabner, J., Seller, M. P., Launspach, J. L., Karp, P. H., Kearney, W. R., Look, D. C , Smith, J. J., and Welsh, M. J. (2000). The osmolyte xylitol reduces the salt concentration of airway surface liquid and may enhance bacterial killing. Proc. Natl. Acad. Sci. USA 97, 11,614-11,619. 5 9 0 Raymond John Pickles 62. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David­ son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia in vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 63. Wang, G., Davidson, B. L., Melchert, P., Slepushkin, V. A., van Es, H. H., Bodner, M., Jolly, D. J., and McCray, P. B., Jr. (1998). Influence of cell polarity on retrovirus-mediated gene transfer to differentiated human airw^ay epithelia. / . Virol. 72, 9818-9826. 64. Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J., and Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia./. Biol. Chem. 274, 10,219-10,226. 65. Goldman, M. J., and Wilson, J. M. (1995). Expression of alpha v beta 5 integrin is necessary for efficient adenovirus-mediated gene transfer in the human airway./. Virol. 69,5951-595S. 66. Hidaka, C., Milano, E., Leopold, P. L., Bergelson, J. M., Hackett, N. R., Finberg, R. W., Wickham, T. J., Kovesdi, I., Roelvink, P., and Crystal, R. G. (1999). CAR-dependent and CAR-independent pathways of adenovirus vector-mediated gene transfer and expression in human fibroblasts./. Clin. Invest. 103, 579-587. 67. Freimuth, P. (1996). A human cell line selected for resistance to adenovirus infection has reduced levels of the virus receptor. / . Virol. 70, 4081-4085. 68. Griffiths, M., Huang, X. Z., Wu, J. F., Driscoll, R., and Sheppard, D. (1997). Inactivation of the beta5 integrin subunit gene does not prevent expression of adenovirus genes in mouse airway epithelium. Respir. Crit. Care Med. 155, A549. 69. Fasbender, A., Zabner, J., Chillon, M., Moninger, T. O., Puga, A. P., Davidson, B. L., and Welsh, M. J. (1997). Complexes of adenovirus with polycationic polymers and cationic lipids increase the efficiency of gene transfer in vitro and in vivo. / . Biol. Chem. 272, 6479-6489. 70. Wickham, T. J., Roelvink, P. W., Brough, D. E., and Kovesdi, I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570-1573. 71. Pickles, R., Fahrner, J. Petrella, J., Boucher, R., and Bergelson, J. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarised epithelial cells reveals the glycocalyx as a barrier to adenovirus mediated gene transfer. / . Virol. 74, 6050-6057. 72. Rambourg, A., Neutra, M., and Leblond, C. P. (1966). Presence of a "cell coat" rich in carbohydrate at the surface of cells in the rat. Anat. Rec. 154, 4 1 - 7 1 . 73. Bennett, H. S. (1963). Morphological aspects of extracellular polysaccharides./. Histochem. Cytochem. 11, 23. 74. Bernacki, S. H., Nelson, A. L., Abdullah, L., Sheehan, J. K., Harris, A., Davis, C. W., and Randell, S. H. (1999). Mucin gene expression during differentiation of human airway epithelia in vitro. Am. J. Respir. Cell Mol. Biol. 20, 595-604. 75. Buisine, M. P., Devisme, L., Copin, M. C , Durand-Reville, M., Gosselin, B., Aubert, J. P., and Porchet, N. (1999). Developmental mucin gene expression in the human respiratory tract. Am. J. Respir. Cell Mol. Biol. 20, 209-218. 76. Chambers, J. A., Hollingsworth, M. A., Trezise, A. E., and Harris, A. (1994). Developmental expression of mucin genes MUCl and MUC2. / . Cell Sci. 107(2), 413-424. 77. Braga, V. M., Pemberton, L. F., Duhig, T., and Gendler, S. J. (1992). Spatial and temporal expression of an epithelial mucin, Muc-1, during mouse development. Development 115, 427-437. 78. Pemberton, L., Taylor-Papadimitriou, J., and Gendler, S. J. (1992). Antibodies to the cyto­ plasmic domain of the MUCl mucin show conservation throughout mammals. Biochem. Biophys. Res. Commun. 185, 167-175. 79. Porchet, N., Nguyen, V. C , Dufosse, J., Audie, J. P., Guyonnet-Duperat, V., Gross, M. S., Denis, C , Degand, P., Bernheim, A., and Aubert, J. P. (1991). Molecular cloning and chro­ mosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem. Biophys. Res. Commun. 175, 414-422. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 9 1 80. McNeer, R. R., Huang, D., Fregien, N. L., and Carraway, K. L. (1998). Sialomucin complex in the rat respiratory tract: A model for its role in epithelial protection. Biochem. J. 330(2), 737-744. 81. Sheng, Z., Wu, K., Carraway, K. L., and Fregien, N. (1992). Molecular cloning of the transmembrane component of the 13762 mammary adenocarcinoma sialomucin complex. A new member of the epidermal growth factor superfamily./. Biol. Chem. 267,16,341-16,346. 82. Wu, K., Fregien, N., and Carraway, K. L. (1994). Molecular cloning and sequencing of the mucin subunit of a heterodimeric, bifunctional cell surface glycoprotein complex of ascites rat mammary adenocarcinoma cells./. Biol. Chem. 269, 11,950-11,955. 83. Arcasoy, S. M., Latoche, J., Gondor, M., Watkins, S. C , Henderson, R. A., Hughey, R., Finn, O. J., and Pilewski, J. M. (1997). MUCl and other sialoglycoconjugates inhibit adenovirus-mediated gene transfer to epithelial cells. Am. J. Respir. Cell Mol. Biol. 17y 422-435. 84. Arcasoy, S. M., Latoche, J. D., Gondor, M., Pitt, B. R., and Pilewski, J. M. (1997). Polyca- tions increase the efficiency of adenovirus-mediated gene transfer to epithelial and endothelial cells in vitro. Gene Ther. 4, 32-38. 85. Worgall, S., Leopold, P. L., Wolff, G., Ferris, B., Van Roijen, N., and Crystal, R. G. (1997). Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithelial surface of the respiratory tract. Hum. Gene Ther. 8, 1675-1684. 86. Parsons, D. W., Grubb, B. R., Johnson, L. G., and Boucher, R. C. (1998). Enhanced in vivo airway gene transfer via transient modification of host barrier properties with a surface-active agent. Hum. Gene Ther. 9, 2661-2672. 87. Otake, K., Ennist, D. L., Harrod, K., and Trapnell, B. C. (1998). Nonspecific inflammation inhibits adenovirus-mediated pulmonary gene transfer and expression independent of specific acquired immune responses. Hum. Gene Ther. 9, 2207-2222. 88. Van Ginkel, F. W., Liu, C , Simecka, J. W., Dong, J. Y., Greenway, T., Frizzell, R. A., Kiyono, H., McGhee, J. R., and Pascual, D. W. (1995). Intratracheal gene delivery with adenoviral vector induces elevated systemic IgG and mucosal IgA antibodies to adenovirus and beta-galactosidase. Hum. Gene Ther. 6, 895-903. 89. Simon, R. H., Engelhardt, J. F., Yang, Y., Zepeda, M., Weber-Pendleton, S., Grossman, M., and Wilson, J. M. (1993). Adenovirus-mediated transfer of the CFTR gene to lung of nonhuman primates: Toxicity study. Hum. Gene Ther. 4, 771-780. 90. Yei, S., Mittereder, N., Tang, K., O'Sullivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1, 192-200. 91. Piedimonte, G., Pickles, R. J., Lehmann, J. R., McCarty, D., Costa, D. L., and Boucher, R. C. (1997). Replication-deficient adenoviral vector for gene transfer potentiates airway neurogenic inflammation. Am. J. Respir. Cell Mol. Biol. 16, 250-258. 92. Goldman, M. J., Litzky, L. A., Engelhardt, J. F., and Wilson, J. M. (1995). Transfer of the CFTR gene to the lung of nonhuman primates with El-deleted, E2a-defective recombinant adenoviruses: a preclinical toxicology study. Hum. Gene Ther. 6, 839-851. 93. Engelhardt, J. F., Litzky, L., and Wilson, J. M. (1994). Prolonged transgene expression in cotton rat lung with recombinant adenoviruses defective in E2a. Hum. Gene Ther. 5, 1217-1229. 94. Lieber, A., He, C. Y., Kirillova, I., and Kay, M. A. (1996). Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first- generation vectors in vitro and in vivo. / . Virol. 70, 8944-8960. 95. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F.L., Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 5 9 2 Raymond John Pickles 96. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, I., Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangeli, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 97. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck- Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: Circum­ vention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 98. Scaria, A., St. George, J. A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C , Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40 ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airway. Gene Ther. 4, 611-617. 99. Griesenbach, U., Chonn, A., Cassady, R., Hannam, V., Ackerley, C , Post, M., Tansv^ell, A. K., Olek, K., O'Brodovich, H., and Tsui, L. C. (1998). Comparison between intratracheal and intravenous administration of liposome-DNA complexes for cystic fibrosis lung gene therapy. Gene Ther. 5, 181-188. 100. Liu, P., Qi, H., Huang, L., and Liu, D. (1997). Factors controlling the efficiency of cationic lipid-mediated transfection in vivo via intravenous administration. Gene Ther. 4, 517-523. 101. Lemarchand, P., Jaffe, H. A., Danel, C , Cid, M. C , Kleinman, H. K., Stratford-Perricaudet, L. D., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1992). Adenovirus- mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells. Proc. Natl. Acad. Sci. USA 89, 6482-6486. 102. Lemarchand, P., Jones, M., Danel, C , Yamada, L, Mastrangeli, A., and Crystal, R. G. (1994). In vivo adenovirus-mediated gene transfer to lungs via pulmonary artery. / . Appl. Physiol. 76, 2840-2845. 103. Coyne, C. B., Kelly, M. M., Boucher, R. C , and Johnson, L. G. (2000). Enhanced epithehal gene transfer by modulation of tight junctions with sodium caprate. Am. J. Respir. Cell Mol. Biol. 23, 602-609. 104. Chu, Q.,

St. George, J. A., Lukason, M., Cheng, S. H., Scheule, R. K., and Eastman, S. J. (2001). Egta enhancement of adenovirus-mediated gene transfer to mouse tracheal epithelium in vivo. Hum. Gene Ther. 12, 455-467. 105. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David­ son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia In vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 106. Watkins, S. J., Mesyanzhinov, V. V., Kurochkina, L. P., and Hawkins, R. E. (1997). The "adenobody" approach to viral targeting: Specific and enhanced adenoviral gene delivery. Gene Ther. 4, 1004-1012. 107. Wickham, T. J., Carrion, M. E., and Kovesdi, I. (1995). Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 2, 750-756. 108. Wickham, T. J., Lee, G. M., Titus, J. A., Sconocchia, G., Bakacs, T., Kovesdi, I., and Segal, D. M. (1997). Targeted adenovirus-mediated gene delivery to T cells via CD3. / . Virol. 71, 7663-7669. 109. Hoganson, D. K., Sosnowski, B. A., Pierce, G. F., and Doukas, J. (2001). Uptake of adenovi­ ral vectors via fibroblast growth factor receptors involves intracellular pathways that differ from the targeting ligand. Mol. Ther. 3, 105-112. 110. Kreda, S. M., Pickles, R. J., Lazarowski, E. R., and Boucher, R. C. (2000). G-protein- coupled receptors as targets for gene transfer vectors using natural small-molecule ligands. Nat. Biotechnol. 18, 635-640. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 9 3 111. Mason, S. J., Paradiso, A. M., and Boucher, R. C. (1991), Regulation of transepithelial ion transport and intracellular calcium by extracellular ATP in human normal and cystic fibrosis airway epithehum. Br. J. Pharmacol. 103, 1649-1656. 112. Drapkin, P. T., O'Riordan, C. R., Yi, S. M., Chiorini, J. A., Cardella, J., Zabner, J., and Welsh, M. J. (2000). Targeting the urokinase plasminogen activator receptor enhances gene transfer to human airway epithelia. / . Clin. Invest. 105, 589-596. 113. Ziady, A., K. R., F. T., and Davies, P. (1999). Serpin enzyme complex receptor targeted DNA complexes deliver genes to airway epithelia. Fediatr. Pulmonol. 19, 233. 114. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. / . Virol. 70, 6831-6838. 115. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel, D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574-1578. 116. Pickles, R., Johnson, L. G., Olsen, J. C., Gerard, R., Segal, D., and Boucher, R. C. (1999). Correction of the CF bioelectric defect in human CF well-differentiated airway epithelial cells by retargeting adenoviral vectors to luminal P2Y2 purinoceptors. Fediatr. Fulmonol. 19, 222. 117. Pickles, R., Kreda, S., Olsen, J., Johnson, L., Gerard, R., Segal, D., and Boucher, R. (1998). High efficiency gene transfer to polarised epithelial cells by retargeting adenoviral vectors to P2Y2 purinoceptors with bispecific antibodies. Fediatr. Fulmonol. 17, 261. 118. Romanczuk, H., Galer, C , Zabner, J., Barsomian, G., Wadsworth, S., and O'Riordan, C. (1999). Modification of an adenoviral vector with biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hum. Gene Ther. 10, 2615-2626. 119. O'Riordan, C , Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S., Smith, A., and Fran­ cis, G. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum. Gene Ther. 10, 1349-1358. 120. Summerford, C , and Samulski, R. J. (1998). Membrane-associated heparan sulfate proteo­ glycan is a receptor for adeno-associated virus type 2 virions. / . Virol. 72, 1438-1445. 121. Krasnykh, V. N., Mikheeva, G. V., Douglas, J. T., and Curiel, D. T. (1996). Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. / . Virol. 70, 6839-6846. 122. Michael, S., Hong, J., Curiel, D., and Engler, J. (1995). Addition of a short peptide ligand to the adenovirus fibre protein. Gene Ther. 2, 660-668. 123. Krasnykh, V., Dmitriev, I., Mikheeva, G., Miller, C. R., Belousova, N., and Curiel, D. T. (1998). Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. / . Virol. 72, 1844-1852. 124. Roelvink, P. W., Mi Lee, G., Einfeld, D. A., Kovesdi, L, and Wickham, T. J. (1999). Iden­ tification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571. 125. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector with a type 17 fiber enhances gene transfer to human airway epithelia. / . Virol. 73, 8689-8695. 126. Havenga, M. J., Lemckert, A. A., Grimbergen, J. M., Vogels, R., Huisman, L. G., Vale- rio, D., Bout, A., and Quax, P. H. (2001). Improved adenovirus vectors for infection of cardiovascular tissues./. Virol. 75, 3335-3342. 127. Arnberg, N., Edlund, K., Kidd, A. H., and Wadell, G. (2000). Adenovirus type 37 uses sialic acid as a cellular receptor. / . Virol. 74, 42-48 . 128. Fasbender, A., Lee, J. H., Walters, R. W., Moninger, T. O., Zabner, J., and Welsh, M. J. (1998). Incorporation of adenovirus in calcium phosphate precipitates enhances gene transfer to airway epitheUa in vitro and in vivo. / . Clin. Invest. 102, 184-193. 5 9 4 Raymond John Pickles 129. Lee, J. H., Zabner, J., and Welsh, M. J. (1999). Delivery of an adenovirus vector in a calcium phosphate coprecipitate enhances the therapeutic index of gene transfer to airway epithelia. Hum. Gene Ther. 10, 603-613. 130. Weiss, D.J., Strandjord, T. P., Liggitt, D., and Clark,]. G. (1999). Perflubron enhances adenovirus-mediated gene expression in lungs of transgenic mice with chronic alveolar filling. Hum. Gene Ther. 10, 2287-2293. 131. Weiss, D.J., Strandjord, T. P., Jackson, J. C , Clark, J. G., and Liggitt, D. (1999). Perflu­ orochemical liquid-enhanced adenoviral vector distribution and expression in lungs of spontaneously breathing rodents. Exp. Lung Res. 25, 317-333. 132. Weiss, D. J., Bonneau, L., Allen,]. M., Miller, A. D., and Halbert, C. L. (2000). Perfluo­ rochemical liquid enhances adeno-associated virus-mediated transgene expression in lungs. Mol. Ther. 2, 624-630. 133. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proc. Natl. Acad. Sci. VSA 93, 5731-5736. 134. Mitani, K., Graham, F. L., Caskey, C. T., and Kochanek, S. (1995). Rescue, propagation, and partial purification of a helper virus- dependent adenovirus vector. Troc. Natl. Acad. Sci. USA 92, 3854-3858. 135. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. H., Campbell, K. P., and Caskey, C. T. (1996). In vivo muscle gene transfer of full-length dystrophin with an aden­ oviral vector that lacks all viral genes. Gene Ther. 3, 965-972. 136. Bruder, J. T., Jie, T., McVey, D. L., and Kovesdi, L (1997). Expression of gpl9 K increases the persistence of transgene expression from an adenovirus vector in the mouse lung and liver./. Virol. 71, 7623-7628. 137. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., HoUenbaugh, D., Lins- ley. P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and faciUtates expression after secondary vector administration./. Virol. 72, 7542-7550. 138. Yang, Y., Su, Q., Grewal, L S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues./. Virol. 70, 6370-6377. 139. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, 1555-1566. 140. Yang, Y., Greenough, K., and Wilson, J. M. (1996). Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Ther. 3, 412-420. 141. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 142. Yonemitsu, Y., Kitson, C , Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P. K., Kato, A., Hasan, M. K., Nagai, Y., Masaki, L, Fukumura, M., Hasegawa, M., Geddes, D. M., and Alton, E. W. (2000). Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18, 970-973. 143. Kobinger, G. P., Weiner, D. J., Yu, Q. C , and Wilson, J. M. (2001). Filovirus-pseudotyped lentiviral vector can efficiently and stably transduce airway epithelia in vivo. Nat. Biotechnol. 19,225-230. 144. Boucher, R. C. (1999). Status of gene therapy for cystic fibrosis lung disease./. Clin. Invest. 103,441-445. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease III: Acquired Diseases Erik Lubberts University Medical Center St. Radboud Niimegen Center for Molecular Life Science Nijmegen, The Netherlands Jay K. Kolls^ Department of Medicine and Pediatrics Louisiana State University Health Sciences Center New Orleans, Louisiana I. Adenoviral Vectors for Infectious Disease Recombinant adenoviral vectors for infectious diseases can generally be categorized into three general approaches. The first is the use of a vector-based vaccine where the vector encodes for proteins to achieve an immune response. In fact, adenoviruses have been used in the U.S. military for vaccines [1]. The second approach is to use adenoviral vectors, which encode immunostimula- tory genes to achieve in vivo immunotherapy. Last, these vectors can be used to provide critical accessory molecules for T- or B-cell activation for patients that are deficient in these molecules or theoretically direct anti-infectious genes such as anti-bacterial peptides. These general paradigms hold true for most gene-therapy approaches with adenoviral-based vector systems regardless if the targets are infectious disease, an inherited immune deficiency sate, or cancer. In this chapter we focus on these paradigms in the context of specific disease enti­ ties that may be candidates for treatment with adenovirus-based vector systems. ^ Corresponding author. ADENOVIRAL VECTORS FOR GENE THERAPY 5 9 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 9 6 Lubberts and Kolls A. Tuberculosis Mycobacterium tuberculosis the etiologic agent of tuberculosis (TB), is a facultative intracellular pathogen which remains the foremost cause of death from a single infectious agent among adults [2]. It has been estimated that approximately one-third of the world's population in 1990 (1.7 billion individuals) were infected with M. tuberculosis^ affecting mostly people living in developing countries, and that with the global control measures in place at that time, 30 million people were expected to die due to tuberculosis by the year 2000 [2]. The most effective vaccine against tuberculosis in man is the BCG vaccine, an attenuated substrain of Mycobacterium bovis^ which has been used for more than 50 years worldwide. However, this vaccine is very erratic in conferring protection, varying as much as 0 -80% in separate clinical trials [3]. In countries with a lower incidence of tuberculosis, such as the United States, the emergence of multidrug-resistant strains threatens control measures with anti-mycobacterial drugs. It is apparent that current immunotherapeutic and chemotherapeutic approaches for the control of tuberculosis need to be improved. After inhalation, the organism replicates within the lung macrophage. The protective response to infection with intracellular bacteria is cell-mediated [4]. Protective immunity in the mouse model of tuberculosis is mediated by T lymphocytes that secrete gamma interferon (IFNy), which activates infected macrophages to control intracellular bacilli in a manner believed to be similar to the protective response in man. Several subpopulations of T lymphocytes contribute to the protective response in the lungs of infected mice [5]. Most of this protection is conferred by a short-lived population of rapidly dividing, IFNy-secreting CD4+ T lymphocytes [6] which peak within 3 weeks of infec­ tion, a time which correlates with the control of further mycobacterial growth in the host [7]. The pivotal role of IFNy in protective immunity to M. tuberculosis was unequivocally demonstrated using IFNy knockout (KO) mice. The

single gene encoding IFNy was disrupted, and these mice were originally shown to: (a) be incapable of IFNy production, (b) poorly express class II MHC, (c) be deficient in the production of reactive oxygen and reactive nitrogen radicals, and (d) be very susceptible to M. bovis BCG [8]. IFNy KO mice succumbed to infection with M. tuberculosis fairly rapidly whether the virulent bacilli were delivered intravenously at moderate [9] to high doses [10] or via a low-dose aerosol [9]. There is also an absolute requirement for interleukin (IL)-12 in the protective response against TB. This has been demonstrated using IL-12p40 KO mice. These mice do not produce the heavy chain of the IL-12 heterodimer and therefore do not make the bioactive p70 form of IL-12, which results in a poor cell-mediated response to antigen [11]. Recently, it was shown that IL- 12p40 KO succumbed to an intravenous infection with M. tuberculosis within 50 days [12]. Whereas wild-type controls contained the infection and strongly 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 597 expressed genes encoding IFNy, tumor necrosis factor (TNF), and inducible nitric oxide synthase (iNOS) in infected tissues, these KO mice produced no IFNy message and delayed TNF and iNOS message. As protective cytokines, which play a pivotal role in protection against tuberculosis, IFNy and IL-12 represent attractive targets for cytokine-based therapy approaches designed to enhance protective cell-mediated immu­ nity [13]. Recently, a replication-deficient adenoviral vector designed to deliver IFNy (AdIFN) vv̂ as delivered intratracheally into the lungs of BALB/c mice, v^hich w êre subsequently challenged, v^ith a sublethal aerosol of M. tubercu­ losis. Prior pharmacokinetic analyses of adenoviral-mediated expression of IFNy in BALB/c mice had indicated that transfected mice expressed increased IFNy in the lungs for as long as 21 days follov^ing delivery of the vector. Other mice w êre transfected with a control virus expressing lacZ (AdLacZ) shortly before the low-dose aerosol exposure to M. tuberculosis. AdIFN-treated mice initially contained the infection in the lungs much better than the control nontransfected mice or AdLacZ-treated mice (Fig. 1). The protective effect in the lungs paralleled the local production of IFNy by the vector and, thus, was relatively short-lived, such that the load of viable bacilli in AdIFNy-treated lungs reached levels similar to the controls by 30 days of infection. There was no protective effect on the control of mycobacterial dissemination or growth in other primary target organs. Similar AdIFNy-mediated control of bacterial growth in the lungs was not seen in mice, which already had established chronic M. tuberculosis infection. Based on these preclinical data, several clinical trial have been initiated for both multidrug-resistant M. tuberculosis and persistent mycobacteria avium CSU46 AdIFN AdLacZ p < 0.05 Figure 1 AdIFN reduces growth of Mycobacterium tuberculosis in the lung. Mice were pretreated with AdIFN, AdLacZ, or vehicle and then challenged with CSU 46, a clinical isolate of M. tuberculosis, and lung organism burden was quantified by quantitative organ culture serially after aerosol challenge (data provided by Dr. Elizabeth Rhoades and Dr. Ian Orme, Colorado State University). 5 9 8 Lubberts and Kolls complex (MAC) infection in non-HIV-infected hosts. Williams and colleagues, from our group, recently reported on a Phase I trial of aerosolized IFNy to patients with persistent MAC infection [14]. All patients tolerated the aerosol well and three of eight had sputum acid-fast bacilli (AFB) smears convert to negative. Condos and colleagues have recently reported on five patients in New York City with multidrug-resistant tuberculosis who received 500 |JLg of IFNy aerosolized three times a week for 1 month [15]. Again the aerosol form of the drug was well-tolerated and all patients had sputum smears for AFB convert to negative and the time to positive culture increased (from 17 to 24 days, not significant), suggesting a reduction in organism burden. Moreover, patient weight increased or stabilized, and there were objective decreases in the size of cavitary lesions in all patients 2 months after treatment had ended. It is important to note that data to date suggest that IFN, whether in protein or vector form needs to be provided for a relatively long time to control M. tuberculosis growth. Thus it is possible that newer generations of adenoviral-based or other vector systems may achieve longer-term control of infection. B. Pneumonia Pneumonia and influenza infection remain the sixth leading cause of death in the United States [16]. Drug-resistant organisms are increasingly isolated from infected patients, presumably due to the broad use of antibiotics. As mentioned above, several biological response modifiers such as granulocyte colony stimulating factor (G-CSF) and IFNy have been investigated in patients as protein-based therapies. However, due to pharmacological advantages of adenovirus and other gene-based vector systems, gene therapy may provide an alternative approach for in vivo immunomodulation. Adenoviral-mediated gene transfer of the murine IFN gene (AdIFN) results in dose-dependent increases in IFN in bronchoalveolar lavage fluid (HALF) in both mice and rats [17]. Recombinant protein expression occurs up to 28 days in Sprague-Dawley rats and up to 21 days in Balb/c mice [17]. Expression of IFN has a biological effect for at least 14 days in the lung as class II MHC is significantly upregulated in lavaged alveolar macrophages over this time [17]. Moreover, although AdIFN does not result in spontaneous release of TNF in the lung, a subsequent challenge with intratracheal endotoxin results in a greater than fivefold increase in peak TNF levels in BALF in AdlFN- transduced animals compared to control animals (Fig. 2). This enhanced TNF response is associated with increased neutrophil recruitment [17] and increased clearance of Pseudomonas aeruginosa up to 14 days after gene transfer [17]. Although the high levels of both IFN and TNF in the BALF were quite high, these cytokines were confined to the lung and remained essentially undetectable in the plasma (data not shown). Thus, these compartmentalized 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 599 n PBS B 10(7)AdlFN • 10(8)AdlFN • 10(9)AdlFN n 10(9)AdCMVLuc p < 0.05 Figure 2 Dose-dependent increase of LPS-induced lung TNF production by AdIFN. Six- to 8-week-old BALB/c mice were pretreated with AdIFN, AdCMVLuc, or PBS 3 days prior to admin­ istration of intratracheal LPS. TNF was measure in bronchoalveolar lavage (BAL) fluid 3 h after LPS administration by ELISA and corrected for macrophage cell number in the BAL fluid. ND, none detected. effects may offer cytokine gene transfer and advantage over systemically delivered protein-based therapies. Alcohol abuse is a risk factor for bacterial pneumonia [18] as well as acute lung injury [19]. Alcohol intoxication increases the risk of aspiration and suppresses macrophage free-radical protection and bacterial killing [20, 21]. Moreover, alcohol can suppress the elaboration of alarm cytokines such as TNF [22, 23]. Alcohol-induced suppression of TNF production by macrophages can be reversed by IFN in vitro. To investigate whether IFN gene therapy could augment TNF and bacterial host defense in vivo., we administered AdIFN intratracheally to rats, followed 3 days later with an acutely intoxicating dose of ethanol {S.5 g/kg intraperitoneal). Thirty minutes later animals were chal­ lenged intratracheally with endotoxin (LPS) or live Klebsiella pneumoniae to measure LPS-induced TNF responses and lung neutrophil recruitment or bacterial clearance of K. pneumoniae., respectively. This dose of alcohol has previously been shown by our group to suppress LPS-induced lung macrophage production of TNF. AdIFN pretreatment prevented alcohol-induced TNF sup­ pression as well as lung neutrophil recruitment (Figs. 3A and 3B). Moreover, we observed a significant increase in lung bacterial clearance of K. pneumoniae (Fig. 3C) [24]. Standiford and colleagues have shown that adenoviral gene transfer of functional IL-12 [25] produces the p70 heterodimer of IL-12 in the lung lavage fluid in a dose-dependent fashion for up to 7 days [26]. Mice pretreated with this vector, then challenged with 3 x 10^ K. pneumoniae., had signif­ icantly improved survival, compared to AdCMVLacZ-treated or untreated 600 Lubberts and Kolls 45-1 "* 40- • • L P S 1 S 35- 1 J ETOH-LPS1 ^ on 2 30- 1 25- * p < 0.05 a 20- 1 15- 1—1 1 10- 0- AdIFN AdLUC AdIFN AdLUC * p < 0.001 I 1 600 E PBS c 500 o ETOH E 3 400 0c) a. 300 J) 200 X3 (0 100 * p < 0.05 '> AdIFN AdLUC Figure 3 Enhancement of pulmonary host defense in an acute model of ethanol (ETOH) intox­ ication. Male Sprague-Dawley rats were treated with 10^ pfu of AdIFN or AdLUC as a control. Three days later, rats were treated with intratracheal LPS or live K. pneumoniae. Animals receiving LPS were sacrificed 3 hours later to determine cell migration into or TNF concentration in the BAL fluid. Rats receiving K. pneumoniae were sacrificed immediately or 4 h after bacterial inoculation to determine bacterial clearance. (A) AdIFN reverses ETOH-induced suppression of lung neutrophil migration after LPS. (B) AdIFN enhances lung TNF release into BAL fluid after LPS in control and ETOH-treated animals. (C) AdIFN improves lung clearance of K. pneumoniae in a ETOH-treated rat model. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 1 controls [26]. The beneficial effect of IL-12 overexpression was mediated by both tumor necrosis factor alpha (TNFa) and IFNy, as survival in Ad5IL- 12-treated mice w âs attenuated by concomitant neutralization of endogenous TNFa or IFNy [26]. This same group demonstrated the feasibility of using TNFa, a critical proinflammatory cytokine in lung host defenses (27, 28), for in vivo immunomodulation of pulmonary host defense. To overexpress TNF compartmentally in the lung a recombinant adenovirus expressing TNF (AdmTNF) has been reported [29]. Concomitant bacterial challenge with X. pneumoniae and low-dose AdmTNF (10^ pfu) resulted in improved host defenses against the organism. However, a higher dose of vector (5 x 10^ pfu) was not beneficial in terms of bacterial clearance. Thus, understanding dose-response relationships in gene-based immunotherapies will be critical for this form of treatment to have an impact in clinical infections. Crystal and colleagues have used an adenoviral vector encoding CD40 ligand (AdCD40L) in a vaccine approach to protect against P. aeruginosa (PA) lung infection [30]. CD40L is expressed on activated T cells and allows dendritic cells (DCs) which are specialized antigen-presenting cells, to interact directly with either CD8+ cytotoxic T cells [31, 32] and B cells [33]. By transfecting DC, with AdCD40L, Kikuchi and colleagues demonstrated that gene-modified DCs pulsed with PA could stimulate naive B cells to produce anti- PA antibodies. Moreover, if these pulsed, gene-modified DCs were administered in vivo^ an in vivo anti-PA responses was achieved which protected the vaccinated mice against a subsequent challenge with PA [30]. To support the fact that B cells were critical to this response, passive transfer of either serum or B cells from vaccinated mice conferred protection to naive mice subsequently challenged with PA. C. Opportunistic Infections In addition to its known effects on upregulating macrophage function and innate host defenses, IFNy is also the prototypic THl cytokine that facilitates THO CD4+ T-cell differentiation into THl-expressing CD4+ T cells [34]. Moreover, IFN can also modulate the cytokine expression of CD 8+ T cells to a Tel phenotype [35, 36]. As IFN is produced by activated CD4+ T cells, a lack of IFN secretion could partly explain the pulmonary host defense defect associated with HIV infection. Among HIV-associated opportunistic infections, Pneumocystis carinii pneumonia remains a persistent complication of HIV infection. There is an inverse relationship between CD4+ T-cell count and acquisition of this infection. Furthermore, IFNy, in the form of recombinant protein given as an aerosol, has been shown to reduce the intensity of P. carinii infection in a mouse model [37]. Based on these data, our laboratory investigated whether adenoviral-mediated gene transfer of IFNy to the lung would have a therapeutic effect in a mouse model of P. carinii pneumonia. To 602 Lubberts a n d Kolls p < 0.05 * p < 0.05 A d L U C AdIFN Figure 4 IFN-mediated clearance of Pneumocystis carinii in CD4 T-cell depleted mice. (A) Pretreat- ment with AdIFN resulted in significant clearance of P. carinii by 28 weeks. (B) Specific modulation of CDS phenotype by AdIFN. Lung CDS cells from AdIFN-treated mice show a significant higher precursor frequency of IFN-producing clones, as measure by Elispot, than AdLUC controls. test this concept with gene deHvery, we used the AdIFN model,

which results in prolonged expression of IFN in the lungs of mice depleted of CD4+ T cells [38]. AdIFN-transduced or control (AdLuc) animals were challenged with 2 X 10^ P. carinii cysts and sacrificed at serial time points. There was similar growth of P. carinii in both AdIFN and control animals for the first 2 weeks of the infection. However, after this time point AdIFN-treated mice showed resolution of the infection over 4 - 6 weeks in spite of continued depletion of CD4+ T cells (Fig. 4A). AdIFN-treated mice recruited greater numbers of T cells, which were largely CD8^ [38]. There was also a significant increase in recruited natural killer (NK) cells in the AdIFN-treated mice [38]. AdIFN was ineffective in improving P. carinii infection in both scid mice (which have intact macrophages and NK cells) or in mice depleted of both CD4+ and CD8+ T cells, suggesting that CD8"^ T cells are required for the clearance effect imparted by AdIFN treatment. In further support of CD 8+ T cells having effector function is the fact that there is a greater precursor frequency of IFN- producing CD8+ T cell clones in AdIFN-treated mice as measured by Elispot (Fig. 4B). Understanding effector function of CD8+ T cells in the context of 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 0 3 P. carinii infection may have a significant impact in future therapies designed to support HIV-infected individuals against opportunistic infections. D. Viral Hepatitis Both hepatitis B and hepatitis C are important causes of chronic hepatitis and hepatitis B has been linked to hepatocellular cancer. Hepatitis C virus (HCV) is a positive-strand RNA virus and is the major infectious agent responsible for causing chronic hepatitis. Presently, there is no vaccine for HCV infection. There have been recent advances in drug therapy for this disease using a combination of Ribavirin v^ith IFNa [39]; hov\^ever, there is still need for improved sustained therapy. Lieber and colleagues have demonstrated that adenoviral-mediated gene transfer of hammerhead ribozymes directed against a conserved region of the plus strand and minus strand of the HCV genome v^ere efficient at reducing or eliminating the respective plus- or minus-strand HCV RNAs expressed in cultured cells and from primary human hepatocytes obtained from chronic HCV-infected patients. Another therapeutic approach has been to locally upregulate innate anti­ viral immunity. Tov^ard this end Aurisicchio and colleagues demonstrated that adenoviral-mediated gene transfer of the IFNa2 under the control of a liver- specific promoter protected mice from a challenge w îth mouse hepatitis virus type 3 [40]. Lastly, another approach has been to construct dominant negative core mutants of hepatitis B and when these are expressed in hepatocytes cell lines in the context of a recombinant adenoviral vector, these molecules w êre capable of significantly suppressing viral replication [41]. II. Chronic Inflammatory Diseases A. Inflammatory Bowel Disease The gut has been proposed as a target for gene delivery for a variety of diseases including both metabolic diseases and primary diseases affect­ ing the intestine, including the inflammatory bowel diseases, Chron's disease and ulcerative colitis [42, 43]. Toward this end Hogaboam and colleagues have shown that intraperitoneal delivery of adenovirus encoding interleukin-4 (AdIL-4), a prototypic TH2 cytokine, attenuates colitis induced by trinitroben- zene sulfonic acid (TNB) [44]. TNB-induced colitis is associated with an acute phase followed by an immunologically mediated phase, which is thought to be hapten-induced [45]. The attenuation as a result of AdIL-4 in colitis was associated with a reduction in colonic IFN levels and less induction of inducible nitric oxide synthase [44]. The same group has shown similar data for another TH2 cytokine, interleukin-10 in a similar model of colitis [46]. 6 0 4 Lubberts and Kolls Adenovirus IL-10 treatment was again done by the intraperitoneal route and associated with a significant reduction in colonic myeloperoxidase activity and leukotriene levels, both markers of acute inflammation. What remains unclear from these studies is whether T-cell activation is modified and whether there is protection against a second bout of colitis. Last, the intraperitoneal approach is essentially a systemic form of therapy since IL-4 and IL-10 can be detected in the serum of these mice. Since the gut can be transduced directly with adenovirus vectors, this raises the possibility that local administration of vectors to inflamed intestine could be used to compartmentally upregulate an immunomodulatory gene that would prevent or attenuate existing colitis. Toward this end, Wirtz and colleagues have investigated adenovirus- mediated gene transfer to the inflamed colon using intrarectal administration of Ad5-based vectors. These investigators observed significant gene transfer to colonic epithelium, whereas no colonic gene transfer was observed when the vector was given systemically (intravenous or intraperitoneally). Moreover, gene transfer was enhanced in the setting of TNB-induced inflammation. Last, the investigators investigated an Ad5-based vector with a lysine repeat engineered in the fiber gene, the protein responsible for initial interactions with the Coxsackie-adenovirus receptor. With this genetically modified vector, the investigators observed enhanced gene transfer to cells in the lamina propria and spleen, suggesting that antigen-specific T cells could be modified with this vector approach. B. Arthritis Like inflammatory bowel disease, rheumatoid arthritis (RA) is thought to be dominated by THl-like inflammation (Fig. 5) [47, 48]. Among chronic inflammatory diseases, more has been published on gene therapy for arthritis than any other disease. This is likely due to the fact that (1) it is a common disease entity, (2) current treatment, although effective in many cases, can be improved upon, (3) there is a readily accessible site for gene transfer, (4) there are relevant clinical models of the disease, particularly RA, and (5) gene transfer can be accomplished locally to the synovial lining cells using adenovirus-based vectors [49]. The pathogenesis of RA is complex but data to date suggest that there exist alloreactive T cells that secrete TH-1-like cytokines such as TNFa, TNFp, IL-2, and IFN, which drives inflammation. Accessory cells can also secrete TNF, IL-ip, and IL-18, which are also proinflammatory and can drive THl inflammation. This leads to an inflammatory synovial pannus, which mediates destruction of cartilage and joint erosion, which results in loss of joint function over time. A novel T-cell-derived cytokine, IL-17, has also been implicated in the pathogenesis of RA [50]. Since TH-1 inflammation can be downregulated by TH-2 cytokines, such as IL-4 or IL-10, these cytokines have been investigated as candidate genes 20 . Utility of Ad Vectors in Animal Models III: Acquired Diseases 605 Rheumatoid factors Immune Complexes, Bacterial products, IL-l,TNFa, etc. synoviocytes chondrocytes Collagenase and other proteases Figure 5 Schematic diagram of the pathogenesis of RA. to modify RA inflammation. Woods and colleagues investigated adenoviral- mediated gene transfer of the human IL-4 gene into synovial explants from RA patients and demonstrated a significant reduction in IL-ip, TNFa, and IL-8 elaboration in the explant cultures treated w îth AdIL-4 [51]. In follov^-up to this work, the same group demonstrated in vivo efficacy of intraarticular AdIL-4 treatment in adjuvant-induced arthritis in a rat model [52]. Of note v^as that AdIL-4 w âs effective in both a pretreatment and a posttreatment paradigm [52]. Similar to the in vitro findings in human explants, the in vivo treatment with AdIL-4 in the rat model was associated with lower TNFa and IL-ip levels [52]. Lubberts and colleagues have also shown efficacy of AdIL-4 in a murine model of collagen-induced arthritis (CIA) [53, 54]. Interestingly, in these studies IL-4 had less effect on the joint inflammation than it appeared to have on preservation of cartilage and in preventing bone erosion [53]. These later effects were associated with a reduction of mRNAs for IL-17, TNF, and IL-ip, as well as a decrease in metalloproteinase activity [53, 54]. These investigators also demonstrated that IL-4 can increase type I procollagen 606 Lubberts a n d Kolls synthesis and thus this may explain the joint-sparing/repair effect of IL-4 [53]. Last, Kim and colleagues demonstrated that both periarticular and systemic AdIL-4 were effective in a model of CIA [55]. Whalen and colleagues have investigated another TH2 cytokine, viral IL-10, encoded by an adenoviral vector (AdvIL-10) given by periarticular injection in the same model of CIA and found significant benefit in terms of development of arthritis and arthritis score. Moreover, the investigators show^ed that the injection of AdvIL-10 into one joint prevented arthritis in a second joint [56]. This may be due to in vivo T-cell immunomodulation by viral IL-10. In further support of a role for TH2 cytokine gene therapy in RA, Woods and colleagues have recently demonstrated that adenovirus-mediated gene transfer of interleukin-13, another TH2 cytokine, also suppresses TNF and IL-ip production in RA explant cultures [57]. In addition to the TH2 cytokine approach, the other approach of aden­ oviral gene transfer for arthritis has largely focused on the proinflammatory cytokines TNFa and IL-ip. Tow^ard this end, our laboratory has created sol­ uble type-1 receptors for both IL-1 [58] and TNFa [59] (Fig. 6). Both these molecules are dimerized by the addition of murine IgG Fc fragment and in the case of the TNF inhibitor, this molecule has been found to be more potent in TNF inhibition than monoclonal antibodies that only bind to one epitope [60]. Moreover, the proteins have longer half-lives in vivo than the monomeric soluble receptors [59]. Adenoviral-mediated gene transfer of either one of these constructs into the joint space in a rabbit model of arthritis show^ed less v^hite blood cell infiltration as w êll as less joint sv^elling. How^ever, the IL-1 inhibitor show^ed a better effect in preventing a reduction in cartilage matrix hu TNFR- EDor murine type IIL- 1RED Thrombin cleavage site mu IgG Hinge + Fc Figure 6 Schematic diagram of TNF and IL-1 receptor fusion proteins utilized in arthritis gene therapy. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 7 degradation. Moreover, the two vectors together appeared to have an additive effect on white blood cell infiltration into the joint space. There was also an effect observed on contralateral joints in this study 158]. Le and colleagues also demonstrated efficacy of the TNF inhibitor gene in a rat model of CIA [61]. Interestingly, Quattrocchi have reported in a mouse model of CIA that there is an acute beneficial effect of the TNF inhibitor fusion protein; however, there is a subsequent rebound with enhanced inflammation despite continued circulat­ ing levels of the TNF inhibitor. The investigators speculated that this may be due to antibody formation against the extracellular domain of the receptor that the cross-linked endogenous TNF receptors in the joint [62]. It is important to note that these studies were performed with a chimeric fusion protein (mouse Fc/human p55 TNF receptor) and thus whether the exacerbation of arthritis would be seen with the mouse p55 TNF receptor remains to be seen. Last, Zhang and colleagues have shown that adenoviral-mediated gene transfer of a dominant negative form of inhibitory kappa-B, which facilitates nuclear translocation of nuclear factor-kappa-B, enhanced TNF-mediated apoptosis in synovial tissue [63]. C. Fibrotic Lung Disease Idiopathic pulmonary fibrosis (IFF) is an insidious disorder that results in the deposition of collagen and fibrous tissue in the lung. The etiology of this disorder is unknown but several groups have reported decreased fibrinolytic activity [64, 65] and elevated tissue growth factor-beta-1 expression [66^ 67] in the lungs of patients with IFF. Moreover, IFNy has been shown in a pilot study to improve lung function in patients with IFF and this impairment was associated with decreased levels of messenger RNA for transforming growth factor-beta-1 and connective-tissue growth factor, the main growth factor product of transforming growth factor-beta stimulation [67]. To date this is the first compound to show improvement in lung function. Many trials have been performed with corticosteroids (prednisone) alone or in combination with cyclophosphamide [68]. However, these agents have not been shown to be effective in preserving lung function in randomized clinical trials, and moreover, their use is associated with significant side effects. Since IFF is associated with dysregulated growth factor gene expression, and a lack of definitive therapy, there is a rationale for gene therapy. Simon and colleagues recently reported on enhancing fibrinolytic activ­ ity in the lung in an effort to ameliorate lung fibrotic injury in response to bleomycin, a chemotherapeutic agent that can cause lung fibrosis [69]. These investigators constructed a recombinant adenovirus encoding urokinase-

type plasminogen activator (AduPA), a fibrinolytic activator protein. When expressed in the lung, AduPA resulted in a significant attenuation of bleomycin- 6 0 8 Lubberts and Kolls induced increases in hydroxyproline content, a measure of collagen deposi­ tion [69], Furthermore, Nakao and colleagues have shown that adenovirus- mediated gene transfer of smad7, a downstream inhibitor of TGFp signaling could also block bleomycin-induced fibrosis [70]. This finding was specific to smad7 and not to smad6, which does not inhibit TGPp signaling and thus the data suggest that the effect is through the downregulation of TGFp signaling. Thus, other molecules such as dominant-negatives or soluble receptors for TGFp may also be good candidate constructs for pulmonary fibrosis. In addition to TGFp other proinflammatory cytokines such as interleukin- 1 and TNF have been implicated in pulmonary fibrosis [71]. Our lab reported several years ago on a soluble inhibitor of TNF that consists of the extracellular domain of the human p55 TNF receptor coupled to the murine CH2 and CH3 domains of mouse IgGl (Fig. 6) [59]. This molecule forms as a dimer and is a potent inhibitor of TNF [60]. When expressed in the context of a recombinant adenovirus, after intravenous administration, the construct results in high circulating levels of TNF inhibitory activity [59]. In fact these mice provide a phenocopy of p55 TNF-receptor knockout mice in that they are resistant to mortality induced by endotoxin and d-galactosamine administration; however, they are susceptible to the intracellular pathogen Listeria monocytogenes [59]. However, this molecule also readily crosses into the lung [72] and inhibits TNF activity in this compartment. Moreover, this construct, by virtue of its ability to inhibit TNF in the lung (after systemic vector administration) attenuates the fibrotic response to intratracheal silica [73]. III. Conclusions There are numerous acquired diseases in which adenoviral-mediated gene transfer has shown in proof-of-principle experiments a therapeutic benefit. The challenges for researchers in the field are to take these data and try to develop safe and effective therapies for these diseases. Toward this end, there will need to be advances in targeted vector therapy and regulated gene expression. One area, which may yield promising results in the near future, is in adenovirus- based vaccines either into somatic cells or professional antigen presenting cells such as dendritic cells or in compartmentalized chronic inflammation such as arthritis. In this case, precise gene expression is less likely and, thus, there are fewer technological hurdles to overcome. References 1. Gurwith, M. J., Horwith, G. S., Impellizzeri, C. A., Davis, A. R., Lubeck, M. D., and Hung, P. P. (1989). Current use and future directions of adenovirus vaccine. Semin.Respir. Infect. 4, 299-303. 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 0 9 2. Dolin, P. J., Raviglione, M. C , and Kochi, A. (1994). Global tuberculosis incidence and mortality during 1990-2000. Bull. WHO. 72, 213-220. 3. Sudre, P., Ten, D. G., and Kochi, A. (1992). Tuberculosis: A global overview of the situation today. Bull. WHO. 70, 149-159. 4. Mackaness, G. B. (1971). Resistance to intracellular infection. / . Infect. Dis. 123, 439-445. [Review] 5. Orme, I. M., Andersen, P., and Boom, W. H. (1993). T cell response to Mycobacterium tuberculosis./. Infect. Dis. 167, 1481-1497. [Review] 6. Orme, I. M. (1988). Characteristics and specificity of acquired immunologic memory to Mycobacterium tuberculosis infection./. Immunol. 140, 3589-3593. 7. Orme, I. M., Miller, E. S., Roberts, A. D., Furney, S. K., Griffin, J. P., Dobos, K. M., Chi, D., Rivoire, B., and Brennan, P. J. (1992). T lymphocytes mediating protection and cellular cytolysis during the course of Mycobacterium tuberculosis infection. Evidence for different Icinetics and recognition of a wide spectrum of protein antigens. / . Immunol. 148, 189-196. 8. Dalton, D. K., Pitts Meel^, S., Keshav, S., Figari, I. S., Bradley, A., and Stewart, T. A. (1993). Multiple defects of immune cell function in mice with disrupted interferon-gamma genes. Science 1S9,17?>9-17A1. 9. Cooper, A. M., Dalton, D. K., Stewart, T. A., Griffin, J. P., Russell, D. G., and Orme, I. M. (1993). Disseminated tuberculosis in interferon gamma gene-disrupted mice. / . Exp. Med. 178,2243-2247. 10. Flynn, J. L., Chan, J., Triebold, K, J., Dalton, D. K., Stewart, T. A., and Bloom, B. R. (1993). An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. / . Exp. Med. 178, 2249-2254. 11. Magram, J., Connaughton, S. E., Warrier, R. R., Carvajal, D. M., Wu, C. Y., Ferrante, J., Stewart, C , Sarmiento, U., Faherty, D. A., and Gately, M. K. (1996). IL-12-deficient mice are defective in IFN gamma production and type 1 cyto]<:ine responses. Immunity 4, 471-481. 12. Cooper, A.M., Magram, J., Ferrante, J., and Orme, I. M. (1997). Interleukin 12 (IL-12) is crucial to the development of protective immunity in mice intravenously infected with mycobacterium tuberculosis./. Exp. Med. 186, 39-45 . 13. Nathan, C. F., Kaplan, G., Levis, W. R., Nusrat, A., Witmer, M. D., Sherwin, S. A., Job, C. K., Horowitz, C. R., Steinman, R. M., and Cohn, Z. A. (1986). Local and systemic effects of intradermal recombinant interferon-gamma in patients with lepromatous leprosy. N.Engl.]. Med. 3\S,6-1S. 14. Wilhams, L. M., Snyder, D. C , Deblieux, P., Ah, J., Kuebel, D., deBoisblanc, B. P., and Sum­ mer, W. R. (1994). Safety and feasibility of combined aersolized and subcutaneous interferon- gamma as adjuvant treatment of Mycobacterium avium complex pulmonary infection in non-HIV infected hosts. Am. J. Respir. Crit. Care Med. AllO. 15. Condos, R., Rom, W. N., and Schluger, N. W. (1997). Treatment of multidrug-resistant pulmonary tuberculosis with interferon-gamma via aerosol. Lancet 349, 1513-1515. [see comments] 16. Ewig, S. (1999). Community-acquired pneumonia: Definition, epidemiology, and outcome. Semin. Respir. Infect. 14, 94-102. 17. Lei, D., Lancaster, J. R., Jr., Joshi, M. S., Nelson, S., Stoltz, D., Bagby, G. J., Odom, G., Shel- lito, J. E., and Kolls, J. K. (1997). Activation of alveolar macrophages and lung host defenses using transfer of the interferon-gamma gene. Am. J. Physiol. 272, L852-L859. 18. MacGregor, R. R. (1986). Alcohol and immune defense./. Am. Med. Assoc. 256,1474-1479. 19. Moss, M., Bucher, B., Moore, F. A., Moore, E. E., and Parsons, P. E. (1996). The role of chronic alcohol abuse in the development of acute respiratory distress syndrome in adults. / . Am. Med. Assoc. 275, 50-54. 20. Tamura, D. Y., Moore, E. E., Partrick, D. A., Johnson, J. L., Offner, P. J., Harbeck, R. J., and Silliman, C. C. (1998). Clinically relevant concentrations of ethanol attenuate primed neutrophil bactericidal activity. ].Trauma 44, 320-324. 6 1 0 Lubberts and Kolls 21. Dorio, R. J., Forman, H. J. (1988). Ethanol inhibition of signal transduction in superox­ ide production by rat alveolar macrophages. A proposed mechanism for ethanol related pneumonia. Ann. Clin. Lab Sci. 18, 190-194. 22. Nelson, S., Bagby, G., and Summer, W. R. (1989). Alcohol suppresses lipopolysaccharide- induced tumor necrosis factor activity in serum and lung. Life Sci. 44, 673-676. 23. D'Souza, N. B., Bagby, G. J., Nelson, S., Lang, C. H., and Spitzer, J. J. (1989). Acute alcohol infusion suppresses endotoxin-induced tumor necrosis factor production. Alcohol Clin. Exp. Res. 13, 295-298. 24. Kolls, J. K., Lei, D., Stoltz, D., Zhang, P., Schwarzenberger, P. O., Ye, P., Bagby, G., Sum­ mer, W. R., Shellito, J. E., and Nelson, S. (1998). Adenoviral-mediated interferon-gamma gene therapy augments pulmonary host defense of ethanol-treated rats. Alcohol Clin. Exp. Res. 22, 157-162. 25. Bramson, J., Hitt, M., Gallichan, W. S., Rosenthal, K. L., Gauldie, J., and Graham, F. L. (1996). Construction of a double recombinant adenovirus vector expressing a heterodimeric cytokine: In vitro and in vivo production of biologically active interleukin-12. Hum. Gene Ther. 7, 333-342. 26. Greenberger, M. J., Kunkel, S. L., Stricter, R. M., Lukacs, N. W., Bramson, J., Gauldie, J., Graham, F. L., Hitt, M., Danforth, J. M., and Standiford, T.J. (1996). IL-12 gene therapy protects mice in lethal Klebsiella pneumonia. ]. Immunol. 157, 3006-3012. 27. Standiford, T. J., Huffnagle, G. B. (1997). Cytokines in host defense against pneumonia. / . Invest. Med. 45, 335-345. 28. Nelson, S., Bagby, G., Andresen, J., Nakamura, C , Shellito, J., and Summer, W. (1991). The effects of ethanol, tumor necrosis factor, and granulocyte colony-stimulating factor on lung antibacterial defenses. Adv. Exp. Med. Biol. 288, 245-253. 29. Standiford, T. J., Wilkowski, J. M., Sisson, T. H., Hattori, N., Mehrad, B., Bucknell, K. A., and Moore, T. A. (1999). Intrapulmonary tumor necrosis factor gene therapy increases bacterial clearance and survival in murine gram-negative pneumonia. Hum. Gene Ther. 10, 899-909. 30. Kikuchi, T., Worgall, S., Singh, R., Moore, M. A., and Crystal, R. G. (2000). Dendritic cells genetically modified to express CD40 ligand and pulsed with antigen can initiate antigen- specific humoral immunity independent of CD4+ T cells. Nat. Med. 6, 1154-1159. 31. Banchereau, J., and Steinman, R. M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252. 32. Grewal, I. S., and Flavell, R. A. (1998). CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol. 16, 111-135. 33. Clark, E. A., and Ledbetter, J. A. (1994). How B and T cells talk to each other. Nature 367, 425-428. 34. Mosmann, T. R., and Sad, S. (1996). The expanding universe of T-cell subsets: Thl , Th2 and more. Immunol. Today 17, 138-146. [Review] 35. Li, L., Sad, S., Kagi, D., and Mosmann, T. R. (1997). CDSTcl and Tc2 cells secrete distinct cytokine patterns in vitro and in vivo but induce similar inflammatory reactions. / . Immunol. 158,4152-4161. 2>6. Mosmann, T. R., Li, L., and Sad, S. (1997). Functions of CD8 T-cell subsets secreting different cytokine patterns. Semin. Immunol. 9, 87-92. [Review] 37. Beck, J. M., Liggit, H. D., Brunette, E. N., Fuchs, H. J., Shellito, J. E., and Debs, R. J. (1991). Reduction in intensity of Pneumocystis carinii pneumonia in mice by aerosol administration of interferon-gamma. Infect. Immun. 59, 3859-3862. 38. Kolls, J. K., Habetz, S., Shean, M. K., Vazquez, C , Brown, J. A., Lei, D., Schwarzenberger, P., Ye, P., Nelson, S., Summer, W. R., and Shellito, J. E. (1999). IFN-gamma and CD8+ T Cells Restore Host Defenses Against Pneumocystis carinii in Mice Depleted of CD4''~ T Cells. / . Immunol. 162, 2890-2894. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 1 1 39. Cummings, K. J., Lee, S. M., West, E. S., Cid-Ruzafa, J., Fein, S. G., Aoki, Y., Sulkowski, M. S., and Goodman, S. N. (2001). Interferon and Ribavirin vs Interferon Alone in the Re-treatment of Chronic Hepatitis C Previously Nonresponsive to Interferon: A Meta- analysis of Random­ ized Trials. / . Am. Med. Assoc. 285, 193-199. 40. Aurisicchio, L., Delmastro, P., Salucci, V., Paz, O. G., Rovere, P., Ciliberto, G., La Mon­ ica, N., and Palombo, F. (2000). Liver-specific alpha 2 interferon gene expression results in protection from induced hepatitis. / . Virol. 74, 4816-4823. 41. Scaglioni, P., Melegari, M., Takahashi, M., Chov^dhury, J. R., and Wands, J. (1996). Use of dominant negative mutants of the hepadnaviral core protein as antiviral agents. Hepatology 24, 1010-1017. 42. Noel, R. A., Shukla, P., and Henning, S. J. (1994). Optimization of gene transfer into intestinal cells using a retroviral vector./. Pediatr. Gastroenterol. Nutr. 19, 43-49. 43. Cheng, D. Y., Kolls, J. K., Lei, D., and Noel, R. A. (1997). In vivo and in vitro gene transfer and expression in rat intestinal epithelial cells by El-deleted adenoviral vector. Hum. Gene Ther. 8, 755-764. 44. Hogaboam, C. M., Vallance, B. A., Kumar, A., Addison, C. L., Graham, F. L., Gauldie, J., and Collins, S. M. (1997). Therapeutic effects of interleukin-4 gene transfer in experimental inflammatory bowel disease. / . Clin. Invest. 100, 2766-2776. 45. Macdonald, T. T. (1998). Viral vectors expressing immunoregulatory cytokines to treat inflammatory bov^el disease. Gut 42, 460-461. 46. Barbara, G., Xing, Z., Hogaboam, C. M., Gauldie, J., and Collins, S. M. (2000). Interleukin 10 gene transfer prevents experimental colitis in rats. Gut 46, 344-349. 47. Miossec, P. (2000). Are T ceUs in rheumatoid synovium aggressors or bystanders? Curr. Opin. Rheumatol. 12, 181-185. 48. Muller, B., Gimsa, U., Mitchison, N. A., Radbruch, A., Sieper, J., and Yin, Z. (1998). Mod­ ulating the Thl/Th2 balance in inflammatory arthritis. Springer Semin. Immunopathol. 20, 181-196. 49. Roessler, B. J., Allen, E. D., Wilson, J. M., Hartman, J. W., and Davidson, B. L. (1993). Adenoviral-mediated gene transfer to rabbit synovium in vivo. / . Clin. Invest 92, 1085-1092. 50. Chabaud,

M., Fossiez, F., Taupin, J. L., and Miossec, P. (1998). Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines./. Immunol. 161, 409-414. 51. Woods, J. M., Tokuhira, M., Berry, J. C , Katschke, K. J., Kurata, H., Damergis, J. A., Arai, K., and Koch, A. E. (1999). Interleukin-4 adenoviral gene therapy reduces production of inflammatory cytokines and prostaglandin E2 by rheumatoid arthritis synovium ex vivo. / . Invest. Med. 47, 285-292. 52. Woods, J. M., Katschke, K. J., Volin, M. V., Ruth, J. H., Woodruff, D. C , Amin, M. A., Connors, M. A., Kurata, H., Arai, K. I., Haines, G. K., Kumar, P., and Koch, A. E. (2001). IL- 4 adenoviral gene therapy reduces inflammation, proinflammatory cytokines, vascularization, and bony destruction in rat adjuvant-induced arthritis./. Immunol. 166, 1214-1222. 53. Lubberts, E., Joosten, L. A., Chabaud, M., Van Den, B. L., Oppers, B., Coenen-De Roo, C. J., Richards, C. D., Miossec, P., and Van den Berg, W. B. (2000). IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin ligand and prevents bone erosion. / . Clin. Invest. 105, 1697-1710. 54. Lubberts, E., Joosten, L. A., Van Den, B. L,, Helsen, M. M., Bakker, A. C , van Meurs, J. B., Graham, F. L., Richards, C. D., and Van den Berg, W. B. (1999). Adenoviral vector-mediated overexpression of IL-4 in the knee joint of mice with collagen-induced arthritis prevents cartilage destruction. / . Immunol. 163, 4546-4556. 55. Kim, S. H., Evans, C. H., Kim, S., Oligino, T., Ghivizzani, S. C , and Robbins, P. D. (2000). Gene therapy for established murine collagen-induced arthritis by local and systemic adenovirus-mediated delivery of interleukin-4. Arthritis Res. 2, 293-302. 6 1 2 Lubberts and Kolls 56. Whalen, J. D., Lechman, E. L., Carlos, C. A., Weiss, K., Kovesdi, I., Glorioso, J. C , Rob- bins, P. D., and Evans, C. H. (1999). Adenoviral transfer of the viral IL-10 gene periarticularly to mouse paws suppresses development of collagen-induced arthritis in both injected and uninjected pav^s./. Immunol. 162, 3625-3632. 57. Woods, J. M., Katschke, K. J., Tokuhira, M., Kurata, H., Arai, K. I., Campbell, P. L., and Koch, A. E. (2000). Reduction of inflammatory cytokines and prostaglandin E2 by IL-13 gene therapy in rheumatoid arthritis synovium./. Immunol. 165, 2755-2763. 58. Ghivizzani, S. C , Lechman, E. R., Kang, R., Tio, C , Kolls, J., Evans, C. H., and Robbins, P. D. (1998). Direct adenovirus-mediated gene transfer of interleukin 1 and tumor necrosis factor alpha soluble receptors to rabbit knees with experimental arthritis has local and distal anti-arthritic effects. Proc. Natl. Acad. Sci. USA 95, 4613-4618. 59. Kolls, J., Peppel, K., Silva, M., and Beutler, B. (1994). Prolonged and effective blockade of tumor necrosis factor activity through adenovirus-mediated gene transfer. Proc. Natl. Acad. Sci. USA 91, 215-219. 60. Peppel, K., Crawford, D., and Beutler, B. (1991). A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity. / . Exp. Med. 171, 1483-1489. 61. Le, C. H., Nicolson, A. G., Morales, A., and Sewell, K. L. (1997). Suppression of collagen- induced arthritis through adenovirus-mediated transfer of a modified tumor necrosis factor alpha receptor gene. Arthritis Rheumatism 40, 1662-1669. 62. Quattrocchi, E., Walmsley, M., Browne, K., Williams, R. O., Marinova-Mutafchieva, L., Buurman, W., Butler, D. M., and Feldmann, M. (1999). Paradoxical effects of adenovirus- mediated blockade of TNF activity in murine collagen-induced arthritis. / . Immunol. 163, 1000-1009. 63. Zhang, H. G., Huang, N., Liu, D., Bilbao, L., Zhang, X., Yang, P., Zhou, T., Curiel, D. T., and Mountz, J. D. (2000). Gene therapy that inhibits nuclear translocation of nuclear factor kappaB results in tumor necrosis factor alpha-induced apoptosis of human synovial fibroblasts. Arthritis Rheumatism 43, 1094-1105. 64. Hattori, N., Degen, J. L., Sisson, T. H., Liu, H., Moore, B. B., Pandrangi, R. G., Simon, R. H., and Drew, A. F. (2000). Bleomycin-induced pulmonary fibrosis in fibrinogen-null mice. / . Clin. Invest. 106, 1341-1350. 65. Olman, M. A., Mackman, N., Gladson, C. L., Moser, K. M., and Loskutoff, D. J. (1995). Changes in procoagulant and fibrinolytic gene expression during bleomycin-induced lung injury in the mouse./. Clin. Invest. 96, 1621-1630. 66. Gauldie, J., Jordana, M., and Cox, G. (1993). Cytokines and pulmonary fibrosis. Thorax 48, 931-935. 67. Ziesche, R., Hofbauer, E., Wittmann, K., Petkov, V., and Block, L. H. (1999). A preliminary study of long-term treatment with interferon gamma-lb and low-dose prednisolone in patients with idiopathic pulmonary fibrosis. N. Engl. ]. Med. 341, 1264-1269. 68. Selman, M., King, T. E., and Pardo, A. (2001). Idiopathic pulmonary fibrosis: PrevaiHng and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134,136-151. 69. Sisson, T. H., Hattori, N., Xu, Y., and Simon, R. H. (1999). Treatment of bleomycin-induced pulmonary fibrosis by transfer of urokinase-type plasminogen activator genes. Hum. Gene Ther. 10,2315-2323. 70. Nakao, A., Fujii, M., Matsumura, R., Kumano, K., Saito, Y., Miyazono, K., and Iwamoto, L (1999). Transient gene transfer and expression of Smad7 prevents bleomycin-induced lung fibrosis in mice./. Clin. Invest. 104, 5 - 1 1 . 71. Piguet, P. F. (1993). Cytokines involved in pulmonary fibrosis. Int. Rev. Exp. Pathol. 34B, 173-181. 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 1 3 72. Kolls, J. K., Lei, D., Greenberg, S., Nelson, S., and Beutler, B. (1995). Adenovirus-mediated blockade of tumor necrosis factor in mice protects against endotoxic shock yet impairs pulmonary host defense./. Infect, Dis. 171, 570-575. 73. Curiel, D. T., Pilewski, J. M., and Albelda, S. M. (1996). Gene therapy approaches for inher­ ited and acquired lung diseases. Am. J. Respir. Cell MoL Biol. 14, 1-18. C H A P T E R Testing of Adenoviral Vector Gene Transfer Products: FDA Expectations Steven R. Bauer% Anne M. Pilaro^, and Karen D. Weiss^ *Divlsion of Cellular and Gene Therapies and ^Division of Clinical Trial Design and Analysis CBER Food and Drug Administration Rockville, Maryland I. Introduction Adenovirus vectors that contain gene transfer products are biological products subject to Food and Drug Administration (FDA) regulation through the Center for Biologies Evaluation and Research (CBER) [1]. Sponsors of biologicals subject to FDA regulation that are not yet approved for marketing must file a "Notice of Claimed Investigational Exemption for a Nev^ Drug," w^hich is abbreviated as "IND" for Investigational New Drug Application. Adenoviral vector products have been studied in clinical trials under IND since 1993. As of December 2000, approximately 75 INDs involving administration of an adenoviral vector product have been filed with the FDA, with slightly more than 50% currently active. Each IND contains one or more clinical protocols. The vast majority (>90%) of the adenoviral gene therapy INDs target patients with cancer. The clinical studies contained in the remainder of the INDs target patients with vascular disease (coronary artery or peripheral) or genetic/metabolic diseases. The sponsor is the entity or individual that holds and maintains the IND. The clinical investigator is the individual responsible for the care and welfare of the study participants at his or her site. Sponsors and investigators involved in FDA regulated research must be in compliance with federal regulations, described in the following sections of this chapter. In addition, investigators who receive federal funding for gene transfer clinical research or who conduct clinical studies at an institution that receives federal funds for recombinant DNA research must register the cHnical protocol with the National Institute of ADENOVIRAL VECTORS FOR GENE THERAPY 6 1 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 6 1 6 Bauer ef aL Health (NIH) Office of Biotechnology Activities (OBA) and be in compliance with the NIH Guidelines [2]. The FDA's assessment of safety and ultimately effectiveness of adenovirus- containing products involves thorough evaluation of the information contained in the IND, and any supporting information cross-referenced to another IND or drug master file [3]. The type of information contained in an IND is set forth in 21 CFR 312.20, subpart B. The follow^ing sections describe many of the agency requirements and guidances regarding drug development of adenoviral-containing products. II. Manufacturing Control and Product Characterization A. Purity, Safety, and Potency When an adenovirus-based vector is used for the first time in humans, a major goal of FDA oversight is to ensure the safety of patients who receive the investigational product. A crucial component of safety and effectiveness is careful attention to the details of manufacturing and product characterization. The extent and quality of this information allow^s an assessment of the purity of the final vector preparation that w îll be administered to patients. Assessment of purity involves biological and biochemical characterization of the vector preparation and assessment of hov\̂ completely the formulated product con­ forms to expected characteristics. For adenovirus vectors assessment of purity includes structural and biochemical information about the vector itself as w êll as demonstration of freedom from unexpected and potentially harmful agents such as viruses, fungi, and bacteria or bacterial toxins. Another important goal of product characterization is assessment of the potency of adenovirus vector preparations. Potency measurements are intended to determine the extent to v^hich a particular vector preparation has a desired biological activity. A vector preparation v^ith insufficient potency has little chance of behaving as desired in a clinical trial. Although infectious titer has been proposed as a measurement of potency, this is currently not considered sufficient since the correlation betw^een in vitro infectious assays and biologic effects has not been established. While potency is related to safety and efficacy, it is also an indicator of product manufacturing consistency. Direct measurement of potency for a new adenovirus vector product is often challenging due to lack of an appropriate in vitro or in vivo system to measure potency. Therefore, in initial phases of product development, demonstration of transgene activity by enzymatic means is often adequate for initiation of clinical trials. Development of a bona fide potency assay for vector lot release will be required before FDA can license an adenovirus product. It is generally expected that a potency assay will be in place before Phase 3. Thus, 2 1 . Testing of Ad Vector Gene Transfer Products 6 1 7 as with all biological therapeutic products, assessment of the purity, safety, and potency of adenovirus vectors is a crucial part of product development. B. Regulation of Process as Well as Product The complexity of adenovirus vector manufacturing as v^ell as inher­ ent biological properties of the production system v^arrants oversight of the production process as well as the final product. Indeed, as with all complex bio­ logical products, in order to assure the purity, potency, and safety of adenovirus vectors, regulation of the manufacturing process is as important as character­ ization and testing of the final product. Therefore, there should be thorough characterization of starting materials and product intermediates in order to assure that the final vector product is acceptable for administration to humans. Initial development of a new adenovirus vector involves manipulation and cloning of a transgene cassette with the desired gene and appropriate transcriptional regulatory elements. In a commonly used approach to vector production, an appropriate cell line is then cotransfected with the transgene cassette and a backbone shuttle vector that supplies the remaining components of the adenovirus genome. An appropriate cell line allows homologous recom­ bination between the transgene and backbone plasmids and then supports synthesis of replication-defective adenovirus particles. It is the ability to medi­ ate homologous recombination that allows assembly of the desired vector, but this ability also can lead to unintended structural changes. Thus it is crucial to select a vector clone that is fully characterized and has the intended structure. Since the same cell line is then also used to propagate vector for production of virus banks and for large-scale production, it is important to monitor the structure of the vector through several stages of manufacturing. The cell lines used for production of adenovirus vectors add another complex, biological component to the manufacturing process. The characteri­ zation of the cell lines, including master cell banks and working cell banks is described in detail in section VI. C. Current Good Manufacturing Practices The principles of current Good Manufacturing Practice (cGMP) as per 21 CFR 210 and 211 apply to adenovirus gene transfer products. However, implementation of cGMPs may be staged according to

the phase of prod­ uct development, but there should always be appropriate documentation of manufacturing and of quality oversight. For Phase 1, this includes appropriate written protocols for each stage of product manufacturing and characteriza­ tion. At later stages of product development, appropriate documentation of manufacturing should employ standard operating procedures (SOPs) and cap­ ture all important information relating to vector production. Quality oversight always involves quality control (QC) and quality assurance (QA) mechanisms. 6 1 8 Bauer ef al. regardless of where manufacturing is taking place. In essence, this means that the person(s) responsible for assurance that the production and characterization testing have all been performed properly and have met specified criteria (qual­ ity assurance) are separate from and not direct subordinates of the person(s) responsible for conducting these tests and filing these reports (quality control). As product development moves from Phase 1 into later phases, cGMPs also stipulate development of validated assays that must be in place by prod­ uct Hcensure. Data regarding assay performance (specificity, sensitivity, and reliability) should be submitted to the agency as part of the validation process. III. Development of Recommendations for the Manufacture and Characterization of Adenoviral Vectors Many factors contribute to development of FDA recommendations and requirements for characterization of adenovirus vectors. First are the regula­ tions found in the various applicable parts of the Code of Federal Regulations (CFR). These include the regulatory requirements that biological products administered to humans must be sterile (21 CFR 610.12 or another vaHd alter­ native testing of equal sensitivity), be free of mycoplasma (21 CFR 610.30), and meet endotoxin limits (limulus amebocyte lysate [LAL] per 21 CFR 610.9 or pyrogenicity test 21 CFR 610.13(b)). These estabfish minimum criteria to assure that products administered to humans are not contaminated w îth microbial organisms or their toxic byproducts. Next are FDA review^ staff w ĥo have accumulated experience from review^ of many adenovirus vector and other gene therapy products. Some reviev^ers maintain active research programs in areas related to adenovirus biology or have participated in such research in the past. CBER reviewers have regular internal meetings to discuss relevant issues and develop consistency in oversight of adenovirus vector products. A major effort in this regard v^as launched March 6, 2000, with the issuance of a letter to Gene Therapy Sponsors requesting comprehensive information on product, preclinical, clinical, and QA/QC areas (see section XVI). These data have been tremendously useful and will be used to refine CBER's recommendations regarding adenovirus and other vector products. The cumulative experience of FDA reviewers is also utilized to develop guidance documents, several of which are relevant to the manufacture of adenovirus gene transfer products [4-6] The experience of the gene therapy community has also played a key role in development of FDA recommendations in regulation of adenovirus vector products. The experience of adenovirus vector manufacturers is communi­ cated in meetings between the manufacturer and FDA staff, at presentations 2 1 . Testing of Ad Vector Gene Transfer Products 6 1 9 at scientific meetings, and at presentations to the NIH Recombinant DNA Advisory Committee (RAC). The NIH RAC has played an important role in the development of recommendations and it provides a public forum for discussion. Follov^ing the death of a patient in a gene therapy trial in late 1999, the RAC empanelled an ad hoc advisory group, the RAC Working Group on Adenoviral Vector Safety and Toxicity (Ad-SAT), to examine data from adenovirus gene transfer trials v^ith the intent of formulating recommendations to improve the safety of these clinical trials. One important discussion centered on the accuracy of adenovirus vector titers in terms of both total particle and infectious particle titers [25]. Since toxic vector doses are just above doses w îth potential therapeutic effect, there v^as particular concern over lack of accuracy and comparability between titers determined for different product lots and between different clinical trials. This discussion highlighted the need for a reference standard that could be used to help standardize adenovirus vector titer measurements. This public discussion helped stimulate a gene therapy community initia­ tive to develop such standards. Several public meetings to develop consensus on the need for a standard, to discuss the nature of the reference material, and to discuss mechanisms for its development were held in late 2000 and early 2001 [7]. An Adenovirus Reference Materials Working Group (ARMWG) was formed under the auspices of the Williamsburg Bioprocessing Foundation (WBF), and an WBP/FDA partnership agreement was formulated that allowed participation of FDA staff in development of a reference stock of wild-type adenovirus type 5 which can be used to calibrate assays for particle number and infectivity. The role of FDA is to lend scientific and regulatory expertise in the form of recommendations to the ARMWG, which oversees the develop­ ment of the reference material. Information on this initiative is available at the WBF website (www.wilbio.com) and the CBER website (www.cber.fda.gov). The information includes meeting minutes, transcripts from FDA cosponsored meetings, and explanations of the bid mechanisms by which participants volunteered donations of goods and services toward production and character­ ization of the reference material. This reference material will provide another mechanism for FDA to formulate recommendations for characterization of adenovirus-based gene transfer products. FDA also seeks input from advisory committees such as the Biologi­ cal Response Modifiers Advisory Committee (BRMAC) for recommendations regarding characterization of adenovirus vectors. BRMAC meetings allow FDA to obtain advice on scientific issues that impact gene transfer experiments in a public forum in which all interested parties are allowed to partici­ pate. Transcripts of these meeting are also available on the CBER website (www.cber.fda.gov). The BRMAC's advice on issues such as the amount and type of structural characterization of gene transfer vectors, discussed at two 6 2 0 Bauer et aL recent committee meetings, has been valuable as CBER staff develop and update policy [8, 9] In summary, the FDA receives input and feedback from a variety of sources in formulating recommendations regarding adenovirus manufacturing and characterization. The recommendations may change v^ith advances in technology and through accumulating experience. FDA considers the potential risks and benefits of each vector product and each proposed clinical trial when making its recommendations. This case-by-case approach, v^hich takes into account the severity of the disease and the proposed patient population, permits some flexibility in product manufacture and characterization. IV. Considerations in Manufacturing Adenoviral Vectors A. Components and Characterization While the goal of adenovirus vector manufacturing is to produce a safe, pure, and efficacious vector, the complexity of the process necessitates careful control of the entire manufacturing procedure and of the components used. Raw materials can be a source of adventitious agents or toxic impurities that negatively impact safety of the final product. At early stages of product devel­ opment, certificates of analysis (CoA) for many raw materials such as buffers, and basic tissue culture components should be part of the documentation demonstrating that these reagents are pure and free of adventitious agents. These CoAs should be kept in the manufacturer's records and sample CoAs should be submitted to the agency. At later stages of product development, development of testing and acceptance criteria for some of these materials may be required of the sponsor. As an example, current techniques for adenovirus vector production require mammalian cell substrates. Raw materials include a source of serum, usually fetal bovine serum (FBS), and enzymes such as porcine trypsin for cell culture. These reagents can be contaminated with adventitious virus. Trypsin has been identified as a potential source of porcine parvovirus while FBS can harbor several adventitious viruses. Therefore, FBS and porcine trypsin should come only from sources where appropriate testing is conducted and documented in a CoA. A manufacturer of adenovirus vectors should retain all such CoAs and submit sample copies to FDA. Also, bovine serum from geographic areas known to harbor endemic bovine spongiform encephalopathy agent (BSE) is considered inappropriate for use in manufacturing a biological for use in humans. Since adenovirus vector production relies on cells that support replication of the vector, cell banking is an important aspect of production. Cell banks are cryopreserved stockpiles consisting of very well characterized cell populations that have been shown to be free of adventitious virus, are sterile, and have the 21. Testing of Ad Vector Gene Transfer Products 6 2 1 capacity to support production of the adenovirus vector. Ideally, cell banks are derived from early cell passages and assure that a reliable and consistent source of qualified cells is available for the foreseeable future production needs. Details of the necessary characterizations for cell banks are discussed belov\̂ . In similar fashion, virus banks are an important aspect of adenovirus pro­ duction. Virus banks consist of frozen stocks of very v^ell characterized molec­ ular vector clones. Characterization includes structural, physical/biochemical, and functional assessments in addition to assessments of microbial sterility and freedom from adventitious viruses. Virus banks are derived as an early step in vector manufacturing and assure that a reliable source of infectious vector is available for foreseeable future production needs. Details of the necessary characterizations for virus banks are discussed below. B. Protocols The protocols used for each step of manufacture are important records which can demonstrate that the production process and the starting materials for vector production are of a quality sufficient to assure that the final product is pure and safe. Detailed descriptions of each step should be maintained and submitted to the FDA as part of an IND. Many protocols are an integral part of manufacturing and should be part of standard operating procedures (see below). Even though many protocols such as the molecular biology techniques used to assemble a vector are not repeated steps, detailed protocols for these stages are essential. V. Process Contrcis Control of the manufacturing process is obtained through testing and characterization of intermediates and final product in the production scheme. For adenovirus vectors this includes characterization of the cell substrate (master and working cell banks), the virus seed stock (master virus bank), the bulk vector preparation, and the final formulated product. Details of the testing are outlined below. The goal of process control is twofold; to ensure safe, pure, and efficacious vector products and to demonstrate that the production process is highly reproducible. A. Standard Operating Procedures Standard operating procedures are a mechanism to ensure that pro­ cess controls and protocols for product manufacture and characterization are carried out in a reproducible and documented fashion for each stage of manufacturing and product testing. SOPs consist of detailed written docu­ ments describing each step of a process conducted in manufacturing. SOPs 6 2 2 Bauer ef aL can also refer to many different types of processes that impact adenovirus production, such as required training of personnel, acquisition and acceptance of raw materials, procedures for shipping and handling final product, and conduct of quality oversight. For early product development, SOPs should be developed for the manufacturing and testing steps discussed belov^. For later stages in product development, consultation with the FDA is advisable to assure comprehensive coverage of the manufacturing process by appropri­ ate SOPs. B. Quality Assurance and Quality Control Programs Quality assurance and quality control programs are considered essential steps in assuring safe and high-quality adenovirus vector products. A key concept in a QA/QC program is that there should be separation of authority between the personnel responsible for conduct of testing and manufacturing and the personnel who examine and approve the test data and final product characterization. This can be accomplished in a variety of ways. For instance, separate QA and QC departments in the same institution can be used pro­ vided that the responsible personnel not be under direct supervision of one another. An important topic that is often misunderstood is the division of respon­ sibilities between an IND sponsor and a multiuse facility contracted to do some part of product manufacturing. When these facilities are used to produce more than one gene transfer vector, they are termed multiuse facilities. Many gene-therapy vectors are produced in multiuse facilities. IND sponsors often assume that the contract lab will provide all necessary QA/QC, manufacturing, and product testing information to the FDA and do not involve themselves sufficiently in designing the testing, examining the data, and/or answering FDA questions. Although the contract lab plays an important role, the responsibility for

oversight of QA/QC and reporting lies with the sponsor. The sponsor must recognize that the FDA holds them accountable for oversight of production and testing conducted by a contract organization. An additional concern with multiuse facilities is the potential for cross-contamination of one product with a product made previously or concurrently. The multiuse facility should test for cross-contamination or validate the production and purification process to rule out cross-contamination. The entire production process, from raw materials to oversight of testing and product release, is important in assuring that adenovirus and other gene transfer vectors are as safe and consistent as possible. The next sections describe in greater detail the characterization that should be done for each of the major components or intermediates as well as the final product in adenovirus vector production. These include the cell banks, the virus bank, the bulk virus preparation, and the final vector product. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 3 VI . Characterization of Adenoviral Vector Production Intermediates The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a resuh of feedback from the numerous sources discussed above. Therefore, the follow^ing material is intended to give the reader an overviev^ of FDA expectations. Consultation w îth CBER at the pre-IND stage is strongly recommended. A. Master Cell Bank Testing of the cell banks used in adenovirus vector production is of tw ô general types; safety testing and characterization. Table I is an overview^ of the recommended characterizations. The safety testing is intended to demonstrate that the cell bank is free of any detectable microbial contamination including bacterial, fungal, and viral. Sterility testing is a universal requirement for biologies and is set forth in 21 CFR 610.12. Alternative sterility assays validated to be of equal sensitivity may also be used. The basic premise is to apply the product, in this case cells from the master cell bank, to several grov^th media and to look for outgrow^th of microbial contaminants over the course of 14 days. The specification for this test is no contaminants. Mycoplasma testing is conducted by inoculation of both cells and cell supernatants into appropriate cultures and examining for grow^th of Table I Characterization of the Cell Banks" Safety Identity Sterility Morphology Mycoplasma Isoenzyme tests Adventitious virus Cell-specific identity test • In vitro and in vivo virus • Bovine, porcine, canine viruses (ancillary product dependent 9CFR113.47) • Human viruses: EBV, HBV, HCV, CMV, HIV 1&2, HTLV 1&2, AAV, B19 (other cell substrate specific) Tumorigenicity ^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this list is intended to give the reader an overview^ of FDA oversight. Hov^ever, consultation with CBER is strongly recommended before submission of an IND. 6 2 4 Bauer ef al. mycoplasma. This testing is described in FDA guidelines [5]. Alternative tests such as PCR could be utilized following proper demonstration of the sensitivity and comparability to the culture-based assay. Adventitious virus tests are also intended to show that the test material is free of a variety of viruses. The in vitro adventitious virus test is conducted by inoculating cell cultures with the test material, in this case supernatants from the master cell bank (MCB). Following 14 days in culture, cells are tested for their ability to mediate hemadsorption or hemagglutination with red blood cells from three different species. The cell lines are chosen for their ability to support replication and detection of many different viruses. A list of viruses that can be detected is given in Table II. The in vitro adventitious virus assay provides a nonspecific screen for many different viruses and can sometimes be used to identify certain viruses. The in vivo adventitious virus test is conducted by inoculating animals from several species with supernatant from the cell bank material. The species are chosen to optimize detection of possible contaminating adventitious viruses. The in vivo virus test is capable of detecting an array of viruses complimentary to those detected by the in vitro assay. A list of viruses that can be detected is given in Table II. For both types of adventitious virus tests, the acceptable specification is no detection of virus. In addition to these nonspecific tests, a variety of specific tests for many different viruses may be required. As the current cell fines used to support adenovirus replication are of human origin, a variety of human virus tests are included. FDA-approved test kits should be used when available. Although the cell lines used to produce adenovirus are not generally thought to support replication of several of these viruses, experimental data to preclude this possibility do not exist. In addition, if sensitive cell-fine-specific identity tests are not part of the MCB characterization, it is possible that other human cell lines could be present and may serve as a reservoir for some of these Table II'' In Vitro and In Vivo Adventitious Virus Testing In vitro adventitious virus testing In vivo adventitious virus testing Picornaviruses: e.g., poliovirus, Coxsackie B, Picornaviruses: e.g., influenza, Coxsackie A echovirus, rhinovirus and B, poliovirus Togavirus: e.g., rubella Bunyavirus: e.g., LCMV, hantavirus Paramyxovirus: e.g., parainfluenza, mumps Herpesvirus: e.g., HSV-1 measles, RSV Orthomyxovirus: e.g., influenza Paramyxovirus: e.g., mumps Adenovirus Coronavirus Herpesvirus Flavivirus^ ^"Fields Virology," Chap. 17 [33]. ^"Fields Virology," Chap. 31 [34]. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 5 viruses. In addition, it is surprising that some viruses not thought to repHcate in cell lines such as HEK 293 (human embryonic kidney fibroblasts) have been detected in adenovirus product lots. For the above reasons, these tests are currently recommended at various steps for all adenovirus vector production. Currently, the specific virus tests include Epstein-Barr virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), cytomegalovirus (CMV), human immunodeficiency viruses I and II (HIV 1 and 2), human parvovirus B19, human T-lymphotrophic viruses 1 and 2 (HTLV 1 and 2), and adeno-associated virus (AAV). The test methods, specifications and sensitivities for these tests should be submitted as part of the proposed acceptance criteria for cell banks. Nonhuman cell lines could also be used to produce adenovirus vectors. In such cases additional testing may be necessary. For example, if rodent cells were used, the MCB should also be tested by the appropriate antibody production test: murine antibody production (MAP), rat antibody production (RAP), or hamster antibody production (FlAP) [6]. Current adenovirus production methods commonly use fetal bovine serum (FBS) and porcine trypsin for propagation of producer cell lines. The use of FBS carries two types of risks; the potential for patient exposure to BSE and to adventitious bovine viruses. The use of porcine trypsin carries risk of patient exposure to porcine parvovirus. Producer cell lines with sufficient documentation may be usable without tests for bovine or porcine viruses or BSE. When FBS is used, sufficient documentation includes the following: certificates of analysis (CoA) showing that the FBS is not from one of the countries on the USDA list of countries where BSE is found and that the FBS has been tested for bovine viruses. For porcine trypsin, sufficient documentation includes CoAs showing that the trypsin is negative for porcine parvovirus. If documentation of viral testing is unavailable, the testing will be requested as per 9 CFR 113.47. Once an MCB is tested or shown to have an accepted history of nonexposure to these agents, these tests may be omitted in subsequent stages of production if CoAs of FBS and porcine trypsin contain the proper testing and come from approved geographic locations. Although tumorigenicity testing has often been requested, it is acknowl­ edged that the cell line used in adenovirus production may be tumorigenic in immunodeficient mouse strains. In later stages of product development, this test may be required. For products that are in Phase 1 of clinical testing, it may be possible to omit this test if there is sufficient testing of the product for cell substrate DNA (see below). In addition to safety testing, characterization of MCBs should include tests for identity of the cell lines. Isoenzyme analysis can show the cell line is of the correct species. For most current adenovirus producer cells, this involves testing for human isoenzymes. Morphology is also assessed to show that the cell line retains the expected shape and size. Development of a cell-specific 6 2 6 Bauer ef o/. identity test is currently recommended so that accidental contamination of the adenovirus vector producer cell line can be detected. B. Working Cell Bank Working cell banks are expanded cell populations derived from the MCB and are tested after a defined number of cell generations. The testing of WCBs is similar to that requested for MCBs and consists of the follovs îng safety tests: sterility, mycoplasma, and in vitro adventitious virus. Characterization includes morphology and isoenzyme analysis. C. Master Virus Bank A master virus bank (MVB) consists of a w^ell-characterized stock of virus-based vector that serves as the inoculum for all subsequent large-scale vector production. It is sometimes referred to as a vector seed stock. Table III gives a summary of the types of characterization recommended by the FDA. Safety testing for a master virus bank is very similar to that done for a master cell bank. Thus a master virus bank is tested for sterility and mycoplasma, in vitro and in vivo adventitious virus, and specific viruses (EBV, HBV, HCV, CMV, HIV 1 and 2, AAV, B19, HTLV 1 and 2) if the cells used to produce the MVB were not fully characterized as described for the MCB. Depending on the degree of characterization of the FBS and porcine trypsin, a MVB may require testing for bovine viruses and porcine parvovirus. Table III Characterization of the Master Virus Bank° Safety Characterization Sterility Identity Mycoplasma • Sequence insert and flanking regions Adventitious Virus restriction map^ • In vitro and in vivo virus Activity • Bovine, porcine, canine viruses (ancillary • Transgene specific protein expression product-dependent 9CFR113.47) • Other • Human viruses: EBV, HBV, HCV, CMV, Titer HIV 1&2, HTLV 1 & 2, AAV, B19 • Infectious titer • Replication-competent adenovirus • Particle count '^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this hst is intended to give the reader an overview of FDA oversight. However, consultation with CBER is strongly recommended before submission of an IND. BRMAC Advisory Committee Meeting, November 16, 2000: recommended entire sequence for vectors <40 kb 18]. 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 7 In addition to the above testing for cell banks, an adenovirus MVB should be tested for replication-competent adenovirus (RCA). RCAs are a common byproduct of adenovirus vector production and are currently con­ sidered a safety risk. RCAs most often arise due to molecular recombination between the vector and endogenous elements of the producer cell line genome. Some of these recombinations restore the replication competence of a normally replication-defective vector and give rise to RCA. For example, in the HEK 293 cell-line, endogenous El sequences are required to allov^ replication of the El defective adenovirus vectors. The vectors can undergo homologous recom­ bination with the endogenous El , thus restoring their replication competence. This is a stochastic and unavoidable consequence of the biology of the certain producer cells. Development of producer cells with smaller or no regions of homology between vector and endogenous sequences may reduce homologous recombination but may still support nonhomologous recombination. For most replication defective adenovirus vectors, RCA testing is performed by inocu­ lation of the test material onto a cell line that will support replication of a RCA but not of defective vector. Supernatant from this treatment is passaged to a second cell monolayer. Development of cytopathic effects (CPEs) or lysis indicates the presence of RCA. The current recommended specification for RCA is <1 RCA in a total of 3 x 10^^ virus particles. Characterization of the adenovirus vector MVB

encompasses a variety of approaches to establish the physical, biochemical, and biological properties of the vector preparation. Identity is an important parameter and demon­ strates that the intended product is the actual starting material for large-scale production. Current FDA recommendations for structural characterization of adenovirus vectors include determination of the nucleotide sequence of the transgene insert and flanking regions. The remainder of the structure can be demonstrated by techniques such as restriction mapping and PCR. In cases where extensive characterization of the transgene protein is available, no sequencing is necessary and restriction mapping of the vector would be suffi­ cient. However, at a recent meeting of the BRMAC which addressed the issue of structural characterization, it was recommended that vectors <40 kb in length should be characterized by sequencing of the entire vector genome [8]. It is likely that the FDA will adopt this recommendation in the near future. For adenovirus vectors, the MVB would be the most appropriate material for this sequence analysis. Another important characteristic of an adenovirus vector MVB is the activity of the transgene. Although this is not a potency assay per se, this parameter suggests that the therapeutic transgene will be functional in clinical trials and thereby justifies the risks of exposure to patients. Activity assays can include demonstration that the transgene-encoded protein is expressed and demonstration that the protein is functional in some biochemical assay. Assays that determine the expression and activity of the adenovirus vector should 6 2 8 Bauer ef a/. be part of the acceptance criteria for each MVB. Methods and acceptable specifications for these assays should be part of IND submissions. The number of adenovirus vector particles in a MVB is measured in two ways. One method is to determine the particle count. Most often this is determined by a measurement of the amount of DNA in a vector preparation which is then related to particle number by an agreed-upon conversion factor. Although this is a physical/chemical assay, the precision is affected by several factors including formulation of the vector preparation and nonviral nucleic acid content of the preparation. Cellular nucleic acids as well as differences in DNA sequence between vectors can affect the precision of this measurement, which can vary on the order of 10%. A second measure of adenovirus vector quantity in a MVB is the infectious titer. This is an assessment of how many of the particles retain the capacity to interact with cell surface receptors and subsequently undergo internalization. This measure is an indication that the manufacturing process is gentle enough to preserve viral coat protein structure and will largely determine the ability of adenovirus preparations to infect patient cells and thereby introduce the desired genetic material. This assay is subject to much more variability than the particle number determination. In recent years, some sources of variability have been identified. The concentration and diffusion rate of adenovirus particles are two important parameters to consider [10]. Infectious titer assays utilize adherent cells sitting at the bottom of tissue culture dishes. Since adenovirus particles do not settle out of solution but instead randomly diffuse, the volume of material tested can have a profound impact on the apparent infectious titer. A recent initiative to develop an adenovirus reference material should lead to increased accuracy in both particle and infectious particle determina­ tions [11]. A reference material consisting of wild-type adenovirus 5 with a known particle and infectious titer will be produced and distributed. Com­ parisons between different adenovirus vector preparations within and between lots can be made using this reference material as an index to calibrate assays done in different places and at different times. VII. Characterization of Adenoviral Vector Final Products Testing of the final adenovirus vector product consists of safety test­ ing and product characterization. Such testing involves physical/chemical and biological assessments. Table IV provides a summary of the currently recom­ mended testing. Whereas production intermediates such as the MCB and MVB are subject to acceptance criteria, the final product characterization is subject to lot release and is recorded on a CoA with specified tests, methods, sensi­ tivities, and results. Some of the safety testing is similar to that done for the 2 1 . Testing of Ad Vector Gene Transfer Products 6 2 9 Table IV Characterization of the Final Product" Safety Product characterization Sterility Identity Mycoplasma • Restriction map, structural characterization Endotoxin Activity Adventitious virus^ • Transgene specific • In vitro virus Potency • AAV • Required by phase II/III • Replication-competent adenovirus Titer General safety • Particle count/infective particle ratio <30:1 • Required by time of licensure Purity • Cell substrate DNA <10 ng/dose, <100-200bpins ize • Cell substrate protein • Ancillary products • Process residuals ^The necessity for and specifications for each of these characterizations is assessed on a case-by-case basis and can change depending on the phase of product development and as a result of feedback from the numerous sources discussed above. Therefore, this list is intended to give the reader an overview of FDA oversight. However, consultation with CBER is strongly recommended before submission of an IND. ^These tests should be done on the unpurified bulk in order to maximize sensitivity and not deplete final product. MCB and MVB. Thus sterility and mycoplasma testing should be performed, as should testing for endotoxin levels in the final formulated product (LAL per 21 CFR 610.9 or pyrogenicity test 21 CFR 610.13(b)). Adventitious virus testing consists of the in vitro virus test, and tests for AAV and RCA. In general, an in vivo adventitious virus test is not recommended for final product. These adventitious virus tests should be performed on the unpurified bulk in order to maximize sensitivity and not deplete the final product. One other test that is required for licensed products is that of General Safety 21 CFR 610.11. The current recommendation for RCA is <1 RCA per 3 x 10^^ virus particles. Current recommendations for final product characterization are similar to those for MVB. However, identity (structural characterization) need not be done by DNA sequence analysis. Rather, other methods such as sensitive restriction mapping combined w îth Southern blot analysis or PCR mapping may be used to show that the final vector preparation is homogenous within the limits of the assays. The same activity assay used on the MVB can be used on the final vector preparation. Development of a potency assay that reflects the intended biological function of the vector preparation should commence as soon as possible during product development and should be in place by the end of Phase 2 or the beginning of Phase 3. Test methods, sensitivities. 6 3 0 Bauer ef a/. and specifications for lot release should be submitted as part of an IND submission. The number of particles and the infectious titer per unit volume should be measured and reported. Currently the recommendation is that the ratio of total particles to infectious particles in the final product should be no greater than 30:1. The previous recommendation of 100:1 was developed shortly after the first adenovirus vector trials v^ere initiated and has remained constant until recently. How^ever, review of data received in response to the March 6, 2000, letter to gene-therapy sponsors suggests that almost all adenovirus vector lots have a ratio of less than 30:1 particles to infectious particles. Advances in understanding of infectious titer assays and the development of an adenovirus reference material will be helpful in reassessing this recommendation in the near future. Product characterization should also include assessments of potential impurities such as production cell DNA and protein. If the cell line used for production is tumorigenic, current FDA recommendations for adenovirus vector products are that no more than 10 ng/dose of cell substrate DNA be present. In addition, the DNA that is present should be degraded to a size less than 100-200 bp in length. If these criteria are met, the need for tumorigenicity assays of the cell substrate is less pressing. The current recommendation for cell substrate protein is that the sponsor should measure and report amounts present in order to set lot release acceptance criteria by Phase III. If cell substrate proteins are present, their potential for immunogenicity should be considered. Other potential impurities should also be assessed in analysis of the final product. These include fetal bovine serum, other tissue culture reagents, antibi­ otics, process residuals such as CsCl, or column chromatography materials. Other tests that may be necessary include pH of the formulated final product, assessment of particulates, volume, and appearance. The necessity and extent of these tests should be discussed with FDA. All lot-release testing of the product should be summarized in a certificate of analysis that accompanies the vector product. A final consideration for product characterization is vector stability. Stability testing should be conducted on the final formulated, vialed product. In early phases of product development, stability testing should also assess procedures for shipping and handling of the final product. Stability testing should be initiated during Phase 1 and should be conducted according to a plan that has been discussed with the FDA. VIII. Preclinical Testing of AdenoviraE Vectors In the development of a new adenoviral vector for gene transfer, the preclinical pharmacology and toxicology programs are typically conducted 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 1 in conjunction with the development of the product manufacturing. The overall purpose of preclinical animal and in vitro studies is to support the safety and rationale for use of the product in human subjects. Although not unique to gene therapy vectors in general, or more specifically, to ade­ noviral vector development, there are several basic goals to be achieved by preclinical testing v^hich contribute to the design and conduct of the ini­ tial clinical trials. These include, but are not limited to, (i) identification of dose(s) which confer the desired biologic effect; (ii) definition of a safe starting dose and escalation scheme; (iii) identification of pharmacodynamic mea­ sures of biologic activity; (iv) identification of safety and toxicity parameters to monitor in the clinical trial; (v) definition of inclusion and/or exclu­ sion criteria based on observed toxicities, and, finally, (vi) designated stop­ ping rules for the clinical trial based on the toxicity profile observed in animals. A. Pharmacologic Activity Initially, the pharmacologic activity of a proposed vector system is evaluated either in vitro or in vivo, as demonstration of "proof of concept." These studies are designed to determine the feasibility and efficiency of the gene transfer, and whether the biologic activity in correcting the genetic defect or conferring that the desired response is observed (e.g., multidrug resistance in hematopoietic stem cells). When available, animal models which mimic the human disease, either through genetic or pharmacologic mechanisms may be used as "proof of principle," to demonstrate that transfer of the gene is actually able to correct the genetic defect, ameliorate or slow progression of the disease, or alleviate some of its clinical signs or symptoms. Based on the responses observed in the preclinical pharmacology program, a decision is made by the investigators to either further evaluate the candidate vector for safety with the intention of entering it into the clinic or to terminate the development of potentially unsuccessful products. Preclinical pharmacology data are provided both to CBER in support of an IND application and to the NIH RAC in support of use of aden­ oviral vectors for gene transfer in several different clinical indications. Of the data which have been publicly reviewed and discussed, biologic activ­ ity of adenoviral vectors have been evaluated in murine tumor models and murineihuman tumor xenografts, transgenic mouse models of human dis­ ease (e.g., ornithine transcarbamylase deficiency), human cell xenografts in immunodeficient rats and/or mice, and in pharmacologically induced dis­ ease states in rodents, monkeys, and dogs. Advantages of using adenoviral vectors are their ability to transduce a variety of different, nondividing cell types, high levels of gene expression for relatively short durations of time, and a large enough capacity to carry relatively large, transgene sequences. 6 3 2 Bauer ef al. IX. Toxicology Testing A. Scope of Toxicity Testing The next step in the precUnical program for a candidate gene transfer vector is the toxicology testing. Prior to initial entry of a new drug or biologic agent into humans, the basis for the determination of in

vivo safety is the preclinical testing performed in animals. Toxicology studies to demonstrate safety of gene transfer vectors, including adenovirus, are intended to answer specific questions regarding the acceptable riskibenefit ratio to the patient, and provide an indication of what expected toxicities may occur on introduction of the product into humans. Traditional drug development programs, evaluating the safety of small molecule or protein therapeutics typically conduct toxicology testing in normal animals, using a well-defined paradigm to establish the acute, subchronic, and cumulative toxicities of an agent prior to its first use in man. At least two animal species are used for the initial demonstration of safety; typically, testing is done both in rodents (i.e., mice, rats, or hamsters) and one nonrodent species (i.e., dog, pig, or nonhuman primate). The advantages of this approach are that a wide range of doses may be investigated to give high multiples of the expected human exposure, the metabolism and disposition profiles in the different species may be established as a basis for comparison for the clinical dosing, and the background incidence of any specific, adverse findings may be well-documented in that particular strain of animal being tested. The use of more than one species in traditional drug evaluation programs is encouraged to increase the chance of detecting any toxicity expected for the clinical trial. Traditional toxicology programs, however, frequently are of little value in the determination of safety of gene transfer agents. For many of the vectors in development, the issues of species-specificity of the transgene product under study, as well as limitations in the doses that are feasible to administer and the interaction of the agent with its specific receptor must be taken into account in designing the safety program. In gene transfer research, demonstration of safety must also take into account toxicities due to both expression of the transgene, or the ultimate therapeutic agent, as well as any adverse effects associated with the vector, or delivery system used to introduce the foreign gene. Additionally, any underlying pathology associated with the disease being investigated may either exacerbate or confound any toxicity related to the gene transfer system. These points must be considered in designing a preclinical program to evaluate the safety and efficacy of a gene transfer agent. The FDA recognizes that novel issues exist in designing and interpreting preclinical studies for gene transfer vectors, and has provided several guidance documents to assist investigators in developing their preclinical programs. CBER's recently published guidance document provides a framework for the 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 3 design of preclinical safety programs in gene therapy, based on the available data from both in vitro and in vivo efficacy models, as well any specific concerns for the clinical population planned for study [4]. The CBER document follows the guidance set forth by the International Conference on Harmonization S6 document, "Preclinical Safety Evaluation of Biotechnology-Derived Pharma­ ceuticals" (ICH S6). Although the ICH guidance does not directly address toxicology study design for gene transfer agents, many of the principles of this document apply [12]. In general, toxicity study design for gene transfer agents follows many of the principles set forth by ICH S6 regarding dose and species selection, route of administration, and study timing. Each of these points is addressed separately in the context of gene transfer, below. To understand the safety of gene transfer vectors, the design of preclinical studies should take into consideration the following points: (i) the class of vector to be administered, (ii) the animal species, gender, age, and physiologic state most relevant for the clinical indication and product class, and (iii) the intended doses, route of administration, and treatment regimens planned for the clinical trial. With many of the gene transfer vectors, these considerations will be dependent, as the route of administration or the maximal feasible dose for the preclinical study may be influenced by the species selected for testing, and vice versa. B. Species Selection The recent death of a patient while participating in a clinical trial of adenovirus-mediated gene transfer, as well as the finding that data in Rhesus monkeys using the same class of vectors and route of administration predicted many of the toxicities observed in this subject have highlighted the importance of preclinical data, and the relevance of the animal model in determining a safety profile for these agents. CBER's recommendations for selection of species for safety evaluation of adenoviral vectors have generally followed the guidance set forth by the ICH S6 document, taking into account the limitations of the animal model being tested. Preclinical pharmacologic and safety testing of vectors for gene transfer should employ the most appropriate, pharmacologically relevant animal model available. In contrast to traditional drug development programs, for many biologic products including gene transfer vectors, safety evaluation and toxicology testing in a single, relevant species is permissible prior to Phase 1 studies in the clinic. A relevant animal species would be one in which the biological response to the therapy would be expected to mimic the human response. Relevant animal species for safety evaluation may also be selected based on the clinical population intended for study and/or intended route of administration, or by the species-specificity of the transgene product. In some cases, the interaction of the transgene product with its specific receptor occurs only in humans 6 3 4 Bauer ef o/. and nonhuman primates, necessitating toxicology testing in monkeys. In many cases, however, the toxicities observed are independent of the transgene product (e.g., inflammatory reactions in response to adenovirus capsid proteins) and may be tested in rodent species or other small, nonrodent laboratory species. In other cases, specific information regarding the safety of a gene transfer approach may be obtained only in an animal model of the disease, in w^hich the underlying disease pathology can influence significantly the safety of the intervention. When evaluating the pharmacologic activity of a vector in an animal model of the clinical indication, it is recommended that safety data be gathered at the same time, in order to assess the contribution of disease-related changes in physiology or underlying pathology to the response to the vector. C. Route of Administration Most gene transfer studies, both in humans and in animals, are expected to involve either single administrations or a small number of repeat admin­ istrations over a short duration of time. CBER recommends that both the route of administration and the dosing schedule in animal studies mimic those intended for the clinical trial as closely as possible. However, there are issues specific to the gene transfer that need to be incorporated into the study design, for example, the persistence of gene expression following transduction of the target organ, which will impact upon the duration of the toxicity study. Another example would be the physical characteristics of the agent being stud­ ied (i.e., vector aggregation at high concentrations). The dose and the route of administration for the preclinical safety studies of cellular and gene therapies should mimic those intended for the clinical trial as closely as possible. It is understood, however, that some dosing techniques and/or regimens intended for the clinical trial may be difficult to achieve in a small animal species, such as a rodent. In these cases, a method of administration similar to that planned for use in the clinic is advised. For example, intrapulmonary instillation of adenoviral vectors by intranasal administration in Cotton rats or mice is an acceptable approach in lieu of direct intrapulmonary administration through a bronchoscope. D. Selection of Dose Current recommendations for dose selection for safety testing are based on those demonstrated in efficacy models to provide gene transfer sufficient for pharmacologic effect, as well as inclusion of doses with a likelihood of demonstrating toxicity. Dose selection should be based on preliminary activity data from studies both in vitro and in vivo. For the determination of safety, a no-observable adverse effect level dose (NOAEL), an overtly toxic dose, and several intermediate doses should be evaluated, to determine not only 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 5 the dose relationship of the toxicities to the amount of vector administered and/or transgene expression, but also to evaluate the shape and steepness of the dose-response curve. Preclinical safety studies should include one dose equivalent to, and at least one dose escalation level exceeding, those proposed for the clinical trial. The multiples of the human dose required to determine adequate safety margins may vary w îth each class of vector employed and the relevance of the animal model to humans. Allometric scaling of doses based on either body weight or total body surface area as appropriate facilitates comparisons across species and allov\̂ s determination (retrospectively) of v^hether an animal model was predictive of toxicities observed in the clinic. For example, adenoviral vectors used in cystic fibrosis demonstrated very similar toxicities after direct instillation into the lungs of Cotton rats, mice, hamsters. Rhesus monkeys, and baboons (Table V). These toxicities included dose-related, perivascular, and peribron­ chiolar inflammation, mononuclear inflammatory cell infiltrates, pulmonary edema, and interstitial pneumonia. When the NOAEL doses were calculated for each species after scaling by total body surface area, with the exception of Rhesus monkeys, it was discovered that these values were remarkably similar between the different species. Additionally, when scaled by total body surface area, the NOAEL doses in mice. Cotton rats, hamsters, and baboons for direct instillation of adenovirus into the lungs were approximately equivalent to the human dose of 2 x 10^ lU, or 1.2 x 10^ lU/m^, which was the first dose in humans at which toxicity was observed, when scaled by body surface areas. Table V Allometric Scaling of Adenovirus Dose in Animals and Man Species Apparent NOAEL NOAEL (pfu/m^ surface area) C57B1/6 mouse 2.6 x 10^ pfu/mouse 2.4 x 10^ pfu/m^ Hamster 3.6 x 10^ pfu/hamster 1.7 x 10^ pfu/m^ Cotton rat 5 x 10^ pfu/rat 1.9 x 10^ pfu/m^ Rhesus monkey 2 x 1 0 ^ pfu/monkey^ 8.2 x 10^ pfu/m^ Baboon 7 x 10^ pfu/monkey 1.8 x 10^ p f u W Human 2 x 10^ pfu/patient 1.2 x 10^ pfuW^ Note. Cotton rats, mice, and hamsters were administered increasing doses of adenoviral vectors encoding the human CFTR gene by intranasal instillation. Baboons, Rhesus monkeys, and humans w êre treated w îth adenoviral vectors encoding CFTR via bronchoscopic instillation into an isolated lobe of the lung. Animals v^ere sacrificed 3 to 5 days after vector administration, and histologic sections of the lung were examined microscopically for evidence of inflammation [15]. The human data were obtained via chest radiograms and CT scans of a patient in a phase 1 clinical trial [13]. ^NOAEL not available; lowest dose tested with minimum pathology ^Toxic dose in humans, 2 x 10^ lU, or 1.2 x 10^ lU/m^. 6 3 6 Bauer ef o/. This finding allowed for a redesign of the clinical approach to gene therapy for cystic fibrosis, using smaller volumes for instillation of vector and a more targeted approach to deliver the adenovirus to the larger airway epithelial surfaces. To date, cystic fibrosis patients have been treated using two to three logs higher doses of adenovirus with this newer approach without the toxicities observed in the initial clinical trial [13]. In cases where gene transfer vectors may be in limited supply, or for vectors with inherently low toxicity, a maximum feasible dose may be admin­ istered as the highest level tested in the preclinical studies. In all studies, and especially when using animal models of the clinical indication, appropriate controls, such as naive or vehicle-treated animals should be included. This should allow determination of an adequate margin of safety for use of the vector in the clinical trial, as well as an acceptable dose-escalation scheme. X. Biodistribution One issue with direct administration of genetically modified cells or viral or other vectors is that the injected material may not stay where it is initially introduced. Therefore, localization studies designed to determine the distribution of the vector, or the trafficking of genetically modified cells after administration to the proposed site are incorporated into the toxicology test­ ing. These studies have two purposes: (i) first, to identify potential distribution of the vector to sites other than the intended target site, where presence of the vector and/or aberrant expression

of the transgene may lead to toxicity; and (ii) to evaluate potential distribution of vector to gonadal tissues and/or transfection of germ cells. In a discussion by the NIH RAC about the risk of potential, inadvertent gene transfer to germ cells, it was concluded that the risk of vertical transmission of the foreign gene was very small. A discussion by the RAC and several expert panelists in gene transfer or reproductive biology recommended that unless there were significant safety issues associated with either the vector or the transgene product, preclinical biodistribution studies in animals were not always required prior to initial Phase 1 trials. In addition, the panel concluded that in cases such as adenoviral vectors, where a large body of literature exists regarding their distribution and potential for toxicity, minor changes in the vector (e.g., substitution of a different transgene with no poten­ tial toxicity associated with it) did not require further preclinical distribution studies prior to initiating clinical trials [14]. Biodistribution studies, in which the disposition of the vector is detected after administration by the intended clinical route not only provide data regarding the potential for gonadal uptake and inadvertent germ-line gene transfer, but can also identify any target organs in which aberrant vector distribution or gene expression may be detrimental. CBER's current recommendation is that biodistribution studies of gene transfer agents are not always required prior to Phase 1 clinical trials; however, these 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 7 studies should be incorporated into the drug development plan so that data are available prior to commencing large-scale, pivotal studies in the clinic [14]. Dose levels selected for biodistribution studies should foUovvr those used in the toxicity studies and include either vehicle or untreated control animals, and the route of administration should be relevant to that employed in the clinical trial. Transfer of the gene to normal, surrounding, and distal tissues as v^ell as to the target site should be evaluated using the most sensitive detection methods possible and should include evaluation of gene persistence. When aberrant or unexpected localization is observed, studies should be conducted to determine w^hether the gene is expressed and v^hether its presence is associated with adverse effects. Additional groups of animals may be treated intravenously, as a 'Vorst-case" scenario in cases v^here w^idespread vector dissemination may be expected to cause toxicities in organs other than the target site [15]. A. Good Laboratory Practices Preclinical studies in support of use of gene transfer vectors including adenovirus, in clinical studies should be conducted in compliance v^ith the regulations for Good Laboratory Practices (GLPs) as set forth in 21 CFR, part 58. Compliance v^ith these regulations is intended to assure the quality and integrity of the animal safety data used in support of human research studies, as v^ell as marketing approval. There is often some confusion as to w^hat types of studies need to be conducted under the GLP regulations. Preclinical pharmacology, "proof-of- concept," and efficacy studies in animals, as well as in vitro pharmacology studies are not expected to be conducted in full compliance with GLP. However, in vitro and animal toxicology studies, including single- and repeat-dose toxicity testing, reproductive toxicity and carcinogenicity studies, and, for gene transfer research, biodistribution studies are expected to follow the guidelines set forth by the regulation. Although studies for gene transfer vectors in early stages of clinical development need not be in full compliance with the GLP regulations (i.e., quality assurance audits, validation of test and other methodology may be omitted in early studies), CBER expects that any pivotal toxicology studies submitted to an IND or licensing application will be conducted under the auspices of GLP. XI . Introduction to Clinical Testing The goal of clinical testing is to provide information about the product's safety and effectiveness and, ultimately, allow new products to come to the marketplace. As discussed in the introduction to the precUnical section, the principles described below are neither unique to gene transfer vectors in general, nor to adenoviral vectors in particular. 6 3 8 Bauer ef aL A. Phases of Clinical Development Premarket clinical testing proceeds in a stepwise fashion, often referred to as Phases 1, 2, and 3 of clinical development, although the phases are not always discrete. Phase 4 studies are those performed after marketing. Each phase of product clinical testing has its series of goals or objectives. The primary goals of Phase 1 testing are to learn about the product's safety and pharmacokinetic profile and to identify a safe dose or doses for further study. Phase 1 studies involve small numbers of study participants who are closely monitored for the development of drug effects. A common Phase 1 design is a single dose, rising dose, cohort study. Escalation to the next dose cohort occurs after sufficient safety assessment of the proceeding cohort. The starting dose and dose escalation scheme employed depend on the data gleaned from product and preclinical testing, and other clinical data, if available (e.g., closely related products or same product studied in different populations). Dose escalation usually proceeds until a defined endpoint, such as a maximal tolerated dose, or an optimal biologic dose, is reached. Phase 1 studies for some drugs may be conducted in healthy volunteers. This approach is common when anticipated side-effects of the product are expected to be minimal and transient and the target population (those with the disease or condition of interest) have high background rates of adverse events, making it difficult to tease out the safety profile of the product. However, for many classes of drugs and biologicals, including adenovirus gene transfer products, the potential short- and long-term adverse effects (see section XIII) generally makes their risks unacceptable for testing in healthy volunteers. The next phases of clinical testing, Phases 2 and 3, build upon the information generated from the prior studies. The goal of Phase 2 testing is to gain preliminary evidence of the product's activity in the disease or condition of interest and to begin to characterize that activity. Phase 2 is the ideal time to optimize the dose and/or dosing regimen, the patient population, the response parameters that are most likely to reflect clinical benefit, as well to build upon the safety database. Phase 2 trials often are randomized, controlled, and conducted in multicenters. Phase 3 of clinical testing includes clinical studies to establish the prod­ uct's effectiveness. The number of efficacy trials, trial design(s), and size of the safety database necessary to determine net clinical benefit depend on a number of factors, including but not limited to the class of product under development, the condition or disease being studied, and the availability of other therapies. Phase 4 of clinical testing are studies conducted after market approval. Their purpose is to address questions that arose during the premarketing investigations, or to evaluate the product in other related setttings, such as the elderly, or people with more advanced stages of the disease. The design of a postmarketing study (such as a randomized controlled clinical trial or a registry) depends on the questions to be addressed. 2 1 . Testing of Ad Vector Gene Transfer Products 6 3 9 XII . Good Clinical Practices Good Clinical Practices (GCPs) are a set of principles and procedures intended to preserve and protect the rights and confidentiality of human research subjects and to assure, to the extent possible, that the clinical research generates valid scientific data. The origins of a code of conduct to protect human subjects in clinical research date back to the Nuremberg war trials and the Declaration of Helsinki. In 1996, the FDA, under the auspices of the Interna­ tional Conference on Harmonization (ICH), published the guidance document entitled: "E6 Good Clinical Practice (GCP) Consohdated Guideline." Basic principles of GCP will be discussed below; the reader is referred to the CBER website http://www.fda.gov/cber/guidelines.htm for the full document [16]. A. Responsibilities of a Sponsor and Investigators The sponsor oversees the IND and communicates with the FDA. As set forth in regulations at 21 CFR 312, subpart D, and in the ICH GCP guidelines, the oversight function includes selecting study investigators, reporting safety information to the FDA, and providing accurate and timely information to all investigators. In some cases, a sponsor may transfer all or some of its obligations to a contract research organization (CRO), although the sponsor retains ultimate responsibility for the IND. Clinical investigators also have specific obligations, delineated in 21 CFR 312, subpart D, and in the ICH GCP guidelines. Investigators are responsible for selecting study participants based on eligibility requirements of the protocol and for obtaining the protocol-specified evaluations. The investigator is responsible for the welfare of the study subjects at his/her clinical site. This includes collecting safety data and reporting safety information to the IND sponsor. The investigator also must account for all investigational medical product, maintain accurate records, provide annual updates to the Institutional Review Board (IRB), and obtain consent from all study participants. Where the sponsor and investigator are distinct, their separate roles, with the former overseeing the latter, incorporate the checks and balances that minimize bias and maximize patient safety and trial validity. These checks and balances may be lacking when the investigator is also the sponsor, and additional external oversight is advisable. Individual physicians who assume the role of sponsor, investigator, or sponsor/investigator should be familiar with guidances and federal regulations that set out the respective duties of the sponsor and the investigator. B. Adverse Event Reporting Adverse event collection and reporting is a fundamental aspect of drug development and of human subjects protection. The clinical investigator is the 6 4 0 Bauer et aL individual who identifies, evaluates, and documents adverse events experienced by study participants at his or her site and v^ho is responsible for updating the IND sponsor and the IRB as appropriate, as set forth in federal regulations (at 21 CFR 312.64). The sponsor is responsible for submitting safety information to FDA. The timing and reporting format will depend on the nature of the adverse event. The sponsor must report to FDA in writing all serious and unexpected adverse event information associated with the use of the investigational product within 15 calendar days of receipt of the information. Any unexpected life- threatening or fatal event associated with the use of the investigational product must be reported by telephone (or facsimile) within 7 calendar days of receipt of the information (as per 21 CFR 312.32). The telephone and written reports constitute expedited reports. Although causality assessment is integral to expedited reporting, a determination that a given investigational product caused or was associated with an adverse event in the course of a clinical study is not always possible. The most reliable way to assess the contribution of a test article to an adverse event is by comparing adverse event rates and severity in treatment and control groups. Randomized controlled trials, however, are infrequent in early phases of clinical testing. Although one cannot always be certain that there is a relationship between the administration of the study product and the adverse event, the level of suspicion required for reporting is quite low. Except if there is no reasonable possibility that the product caused or contributed to an unexpected serious adverse event, that event must be reported to the FDA according to specified time frames. The sponsor is also required to submit to the IND an annual report that includes a summary of the most frequent and the most serious adverse events (21 CFR 312). The ICFl guideline entitled "E3: Structure and Content of Clinical Study Reports" describes the manner in which safety data for individual studies should be organized and presented to regulatory authorities in marketing applications [17]. A marketing application includes an integrated summary of the entire safety experience for the product. FDA, as part of the ICH process, is developing a guideline entitled "The Common Technical Document for the Registration of Pharmaceuticals for Human Use" that addresses, among other items, formatting of integrated safety data [18]. Once marketed, a passive surveillance system allows for the continued collection and reporting of safety information [19]. For some products, such as ones that pose unique long-term risks, a more active type of postmarketing follow-up will be required. C. Consent and Vulnerable Populations In general, prospective participants cannot

be enrolled into a trial without their consent. Elements of the consent form and the consent process are set forth 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 1 in 21 CFR part 50. Before consenting, study participants must be informed of known and potential toxicities that may occur from participation in a trial of an investigational product, even if the likelihood of toxicity is remote. The IRB at each institution participating in a study must reviev^ and approve the consent form and the clinical research protocol before the study can be initiated at that institution. The composition and duties of the IRB are described in the ICH GCP guidelines and in 21 CFR part 56. For some of the disorders that are targets of gene therapy, such as inborn errors of metabolism, the affected population v îll be pediatric subjects. Mechanisms exist to strengthen the human subject protections for study participants w ĥo may be particularly vulnerable, such as children, w ĥo cannot give valid consent [20]. When a child is to be enrolled in a research study, the parent or legal guardian consents (gives permission) for the child to be in the study. The FDA, as part of the ICH process, has published a guidance document that addresses clinical trials in children, including ethical issues [20]. In rare circumstances v^here it is not possible to obtain a participant's consent because of the nature of his or her illness or injury, and in which obtaining consent from a legally acceptable representative (e.g., next of kin) is not feasible, the FDA may permit the clinical trial to proceed with a waiver of consent, as set forth in 21 CFR 50.24. D. Moni tor ing and Audi t ing Monitoring and auditing are fundamental aspects of GCP. Although their purposes are similar (to assure appropriate trial conduct and data validity), the approaches differ. As stated in the ICH GCP document, monitoring is "the act of overseeing the progress of the cUnical trial and ensuring that it is conducted, recorded, and reported in accordance with the protocol, standard operating procedures, GCP, and applicable regulatory requirements." Medical monitors, usually employees of the sponsor, perform on-site (and, if indicated, off-site) evaluations of trial-related activities. The extent and frequency of monitoring should be appropriate for the length, complexity, and other particulars of the trial. Among the functions of the monitor is identification of deviations in protocol conduct so that the sponsor may take appropriate corrective steps, e.g., retraining investigators, closing out certain sites, etc. Auditing is defined in the ICH CGP document as "the systematic and independent examination of trial-related activities and documents." The audit is usually conducted at the conclusion of the trial. The sponsor may hire auditors who document findings in a written report to the sponsor. FDA field inspectors also conduct independent study audits. Traditionally, the purpose of the FDA audits has been to verify the data submitted to the FDA in support of a marketing application. However, the FDA and the sponsor may conduct "for cause" or directed audits at any stage of clinical investigation if there is reason to suspect a problem with trial conduct or data integrity. 6 4 2 Bauer et al. The FDA has performed directed inspections at a few gene therapy chnical sites since 1999. The agency also audited approximately 70 gene transfer clinical sites selected at random to assess whether systemic problems with the conduct of such clinical studies existed. Inspectional findings will be discussed in more detail in section XVI. An additional measure of human subject protection is use of a Data Monitoring Committee (DMC) to evaluate accumulating data from a clinical trial [22]. Generally, the sponsor establishes the DMC, including selecting the members and devising the charter. The DMC members should be independent of the sponsor and clinical investigators. The role of the DMC varies according to the charter and the nature of the study. The DMC is usually empowered to recommend study modifications to enhance safety of participants; in some cases, a DMC may recommend that a study be stopped if data indicate a major safety concern. Of note, DMCs review data submitted to them but do not visit sites to directly ensure that the data are accurate, the protocol is followed, consent is documented, etc. Thus, a DMC does not perform the functions of or obviate the need for study monitors. The FDA is in the process of developing guidance on DMCs. XIII. Clinical Safety of Adenoviral Vector Products Most of the completed and ongoing adenoviral vector clinical trials are early, uncontrolled trials. The absence of an internal control group limits the ability to draw definitive conclusions about the contribution of the adenovirus vector product to an adverse event. Despite this caveat regarding causality assessments, administration of replication defective adenovirus is associated with an acute cellular and cytokine mediated inflammatory response. Individ­ uals have experienced systemic reactions such as fever, chills, hypotension, and laboratory findings consistent with disseminated intravascular coagula­ tion, including thrombocytopenia. An overwhelming systemic inflammatory response, to which has been attributed, at least in part, the death of a volunteer in a trial of ornithine transcarbamylase (OTC) deficiency who received intra­ hepatic artery injection of a high dose of adenovirus-containing product, has not been observed in other clinical trials, including those that employ systemic administration of similar doses of adenovirus vector. See also discussion in section XVI. The route of administration appears to play a key role in determining the type of and occurrence of adverse events. Toxicities have been particularly prominent in organs that are the sites of adenovirus injection, including the lung, brain, and liver [13, 23, 24]. In addition to route of administration, other variables associated with the cHnical trial may influence the nature, frequency, and severity of an adverse event. Such factors include the adenovirus construct. 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 3 transgene, dose, and frequency of product administration, and host factors such as the underlying disease, other comorbidities, and use of concomitant medications. A committee of experts convened to discuss adenovirus safety in December 1999 questioned the role of the transgene in the toxicity profile and suggested employing null adenovirus vectors as controls v^hen possible to tease out the relative toxicities of the transgene from the vector [25]. Preexisting antibody to adenovirus and/or the development of an anti­ body response foUow îng administration of an adenovirus-containing product may play a role in product safety, although a clear relationship has not been established [24]. The limited data available have not suggested a correlation between high baseline levels of neutralizing antibody and adenovirus toxicity (or activity). Moreover, in a study that involved repeat administration of an adenovirus-containing product, participants developed large spikes in serum levels of neutralizing antibody after the initial dose. How^ever, the toxicity pro­ files of the first and subsequent doses were similar, again suggesting a lack of correlation. It is important that clinical investigators continue to characterize the immune status of study participants at baseline and following adenovirus vector administration, and attempt to correlate adverse events with levels of or changes in antibody titer. Ultimately, such information could be utilized in patient selection criteria or in clinical monitoring to enhance safety and effectiveness. The long-term safety of gene transfer is under active discussion. Con­ cerns about late adverse sequelae such as new malignancies occurring years or decades following administration of replication-competent, integrating viruses resulted in FDA guidance regarding testing for replication-competent retrovirus (RCR) in product and patient's serum and for lifelong clinical monitor­ ing [26]. These recommendations are currently limited to retroviral vector INDs. Although adenovirus can become replication competent, the FDA had not previously recommended that patients exposed to this class of product be followed long term. Long-term follow-up of gene therapy products was discussed at recent meetings of the Biologies Response Modifier's Advisory Committee [8, 9, 9a]. FDA will revise the recommendations for long term fol­ low up of recipients of gene transfer products including adenovirus-containing products, pending additional public discussions. XIV. Bioactivity of Adenoviral Vector Products A goal of Phase 2 testing is to determine if the adenovirus containing product is bioactive and, if so, to determine whether the observed activity findings, together with the safety profile, warrant further clinical testing. Bioactivity measures may be laboratory findings, clinical outcomes, or a combination of the two. One measure of bioactivity for gene therapy products is detection of gene transfer and gene expression. This may not be possible 6 4 4 Bauer ef a/. where assays for the transgene are not yet developed or are insensitive to low levels of expression. Documentation of clinical or surrogate outcomes and/or alternative assessments (e.g., pharmacodynamic measurements), and correlations, if any, to levels of gene expression, are highly desirable in early product development. The extent to which the generation of such data will be feasible depends on, among other factors, the nature of the product, the clinical population in the study, and the state of the science regarding assays to detect the transgene. The majority of the clinical investigations with adenoviral vectors to date target patients with cancer. In the oncology setting, studies that are in Phase 2 of development are usually designed to capture data on tumor responses (complete and partial response rates). The demonstration that the adenovirus gene therapy product results in a certain level of tumor response, and the characterization of those responses (rates of complete and partial responses, duration of response, etc.), along with an acceptable safety profile, will usually be sufficient evidence of activity to warrant efficacy trials. Early studies of cystic fibrosis (CF) involved topical administration of the adenovirus product containing the cystic fibrosis transmembrane regulator (CFTR) protein gene to the nasal epithelium. Measures of product activity included gene transfer/gene expression and assessment of the potential differ­ ence across the nasal epithelium. Topical administration resulted in only low levels of gene transfer and limited pharmacodynamic affects. Gene transfer via aerosolized delivery systems appeared to be marginally improved over topical administration. Given the limited product bioactivity that has been seen, clin­ ical development of adenovirus containing products for CF has largely been abandoned. An evolving area of clinical research is use of adenoviral vector products that contain genes intended to promote vascular growth. Patients enrolled gen­ erally have vascular disease. Studies are ongoing in both cardiac and peripheral vascular disease settings. The activity measures can include laboratory measures such as myocardial perfusion, and measures of gene expression. XV. Clinical Efficacy of Adenoviral Vector Products FDA grants market approval for products that are shown to be safe and effective. The efficacy standard, applicable to all FDA-regulated products, as stated in section 505(d) of the Food, Drug, and Cosmetic Act, is substantial evidence^ defined as "evidence consisting of adequate and well-controlled investigations, including clinical investigations, by experts qualified by scientific training and experience to evaluate the effectiveness of the drug involved, on the basis of which it could be fairly and responsibly concluded by such experts 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 5 that the drug will have the effect it purports or is represented to have under the conditions of use prescribed, recommended, or suggested in the labeling or proposed labeling thereof." The follov^ing paragraphs address the issues of the quality and quantity of clinical investigations that can provide "substantial evidence." A. Choice of Control An "adequate and w êll controlled" investigation is one w^hose design and execution produces valid scientific data. Clinical investigations intended to show^ efficacy must be controlled so that the effect(s) of the intervention can be distinguished from other influences, such as spontaneous change, placebo effect, or biased observation. In Phase 2 testing, controlled trials are helpful in teasing out adverse events and in assessing the magnitude of the effect relative to the control group. Such information will be useful for sample size calculations for the efficacy trial(s). The choice of control (e.g., historical, active, placebo, etc.) depends on the clinical setting. The agency has approved products for market based on studies with various types of control groups. Each type of control has its advantages and limitations. The reader is referred to the ICH guidance entitled "ElO Choice of Control in Clinical Trials" for an extensive discussion on this

topic [27]. A control for an adenoviral-containing gene transfer product could be the adenovirus vector without the transgene (i.e., containing a null vector) as discussed previously. Such a null vector control could help delineate safety and efficacy of the vector separately from the insert, as well as show that both vector and insert contribute to product effectiveness. A null vector control, if deemed appropriate, could be incorporated earlier in product development (rather than during Phase 3) as it might be beneficial to determine early on the contribution of and need for the transgene. Adenovirus products are currently in Phase 3 testing in patients with malignancies. Most are designed as "add-on" trials, i.e., chemotherapy 4- gene product vs chemotherapy + placebo (or no additional treatment if a placebo is not feasible). If a trial is not blinded, such as would be the case if the control arm could not receive a placebo, it will be important to utilize objective outcome measures and to control use of concomitant therapies. If measures are not objective, blinded third party assessors may be useful. B. Endpoint Selection Trials intended to provide substantial evidence of efficacy must be "ade­ quate" in addition to "well-controlled." They must be conducted according to GCPs (as discussed in section XII) to maximize human subject protection and data validity. They must also be designed with appropriate, relevant endpoints that either reflect clinical outcomes or are acceptable surrogate endpoints. 6 4 6 Bauer ef o/. Surrogate endpoints are laboratory or other measurements not directly indicating clinical benefit but that are expected to correlate with or predict clinical benefit. Surrogate endpoints are usually easier to measure than clinical endpoints and occur earlier in the course of the disease, allowing for shorter, smaller, and, thus, less expensive studies. Their major disadvantage is the uncertainty surrounding whether and to what extent the surrogate reflects the true clinical benefit. Thus, if FDA bases important regulatory decisions regarding product licensure on a surrogate and the medical community bases practice decisions on data generated from trials using surrogates, it is critical that the surrogate be valid for the particular treatment and disease. Once a surrogate is validated for one treatment and disease using a particular product, the extent to which that validation applies to other products in the same class and across product classes could become important, particularly as one might define a product class in the context of adenoviral-containing products. In earlier phases of clinical testing, use of surrogate endpoints may serve useful and potentially less problematic roles. For instance, during product development, a surrogate may be used to assess dose-response and thus provide the rationale for dose selection for later trials, or they may be used as initial proof-of-concept to base decisions about further clinical development. Several excellent papers provide more in-depth discussions about surrogates and validation of surrogates [28, 29]. Where the disease is serious or life threatening and without acceptable alternatives treatments, it may be possible to establish efficacy and receive FDA approval based on trials employing a surrogate endpoint that is not yet validated but reasonably likely to predict clinical benefit. If a product is marketed based on an effect on such a surrogate endpoint. Phase 4 studies are required to verify the clinical benefit. These provisions are set forth in 21 CFR 601.40, subpart E. Oncology and AIDS are two areas where this provision has been used with some frequency. The number of adequate and well-controlled trials that will be necessary to make a determination of substantial evidence of effectiveness has been discussed in FDA guidance [30]. Sponsors should meet with the agency at the end of Phase 2 and discuss and reach agreements about critical product development issues, such as the number and types of clinical trials and the size of a safety database considered necessary to file a marketing application. XVI. How the Role of FDA Regulators Has Changed Since September 1999 In mid-September 1999, a participant in a clinical study of an adenovi­ ral vector product for Ornithine transcarbamylase (OTC) deficiency became profoundly compromised and ultimately died 4 days after receiving the 2 1 . Testing of Ad Vector Gene Transfer Products 6 4 7 experimental product by intrahepatic artery infusion. This event was the first death in a chnical gene transfer trial that was clearly directly attributable to the administration of a vector and resulted in a number of regulatory actions, as well as a commitment by the FDA to increase sponsor outreach programs to address issues related to the safety of all gene transfer vectors, including adenovirus. These efforts have included (i) safety symposia held in conjunction with the Office of Biotechnology Activities (OBA) at the National Institutes of Health (NIH); (ii) the FDA's issuance of a letter on March 6, 2000, to all gene therapy sponsors, requesting that they provide information regarding the oversight of their programs, including the manufacturing, animal data, and any ongoing or future clinical trials; (iii) targeted inspections of clinical sites for compliance with gene transfer protocols conducted at their site; and (iv) increased sponsor education and training in issues specific to gene transfer, as well as the conduct of clinical trials, in general. A. Safety Symposia in Conjunction with OBA Following the death of the study participant discussed above, the OTC trial was immediately placed on clinical hold, and the FDA initiated a search of its database to identify all protocols involving adenoviral vectors used for therapeutic intent. A total of 12 protocols were identified which used adenovirus administered by either systemic or intrahepatic artery infusion, or by direct injection into the liver. The sponsors of these protocols were informed of the death of the patient in the OTC trial and were asked to provide an assessment of the safety and toxicity of their adenovirus clinical studies, including the maximal dose of vector administered to date. After review of the information provided by these sponsors, one other clinical trial, using adenovirus encoding a tumor suppressor gene and administered by the same route of injection but at a higher dose than the OTC vector, was placed on clinical hold pending receipt and review of the safety data for that specific trial. The NIH OBA issued a call for investigators to submit safety information from all adenoviral vector clinical and preclinical studies. On December 8 and 9, 1999, OBA held an open, public symposium whose purpose was to exam­ ine the available scientific, technical, and clinical data regarding adenoviral vectors in gene transfer, to identify specific safety issues that were unique to adenovirus, and to make recommendations to the gene transfer community where additional clinical or preclinical data should be required. Investigators from both industry and academic settings presented information regarding the biology, pathophysiology, and toxicities associated with adenovirus infection, both by the natural route of infection as well as by the different approaches used in the gene transfer research studies. Both preclinical study results and data from human subjects in adenovirus-vectored trials for cystic fibrosis, oncology, and metabolic disorders were discussed, with the majority of the clinical data coming from studies in the oncologic setting [25]. 6 4 8 Bauer ef a/. In general, comparison of the data across the different settings revealed that the toxicities associated with adenovirus, whether in animals or in human subjects were very similar, and consisted mainly of local, dose-related, and dose-limiting inflammatory responses and immune cell activation. These find­ ings were consistent, whether the virus was administered by bronchoscopic instillation to the lungs, by direct injection into a localized tumor, or by systemic administration. Patients treated with adenovirus vectors at very high doses were found to exhibit some signs of clinical toxicity similar to those observed in the patient at University of Pennsylvania; however, there was no other incident of death attributable to the vector, even in the study where doses higher than that used in the OTC trial were administered by intrahepatic arterial infusion. Based on the results presented and the discussion at this symposium, a working group on adenovirus safety and toxicity (Ad-SAT) was con­ vened by OBA, composed of clinicians and scientists from FDA, industry and academia. The recommendations from this group were presented at the close of the safety symposium, and included the need for additional information regarding adenovirus vector standardization, biodistribution in human subjects as well as in preclinical studies, and the construction of a database which would include both preclinical data which could predict expected toxicities for the clinic, as well as data from human subjects which would allow comparison of the safety across a number of different settings. The findings and recommendations of the Ad-SAT and RAC were recently pubHshed [30a]. OBA and FDA have also cosponsored three additional safety symposia on clinical trials for gene transfer since the December 1999 meeting. These have included discussions of safety issues involved in development of helper- dependent adenoviral vectors and in clinical programs of gene transfer for cardiovascular disease, as well a recent discussion of the potential tumorigenic- ity of adeno-associated viral vectors in mouse models of human ^-glucuronidase deficiency. B. Results of FDA's Directed Inspections In the weeks following the death of the patient in the OTC study, the FDA conducted a directed inspection of the clinical site and the Institutional Review Board at the University of Pennsylvania, as well as an inspection of the animal experiments conducted in support of the clinical program. All three inspections found deviations and deficiencies, including inadequate clinical monitoring and oversight of the clinical trial, inadequate reporting of adverse events, and failure to follow clinical and preclinical study protocols. As a result of these directed inspections, the FDA placed the remainder of the clinical studies under the same sponsorship on clinical hold and issued warning letters 21 • Testing of Ad Vector Gene Transfer Products 6 4 9 to the sponsor, to all of the clinical investigators involved in the OTC trial, and to the director of the preclinical laboratory facility. The FDA also issued a Notice of Initiation of Disqualification Proceedings and Opportunity to Explain (NIDPOE) Letter to the principal investigator. Redacted versions of these letters are available at the CBER w^ebsites [31, 32]. A second clinical inspection of a different site, using a different class of vector for gene transfer in cardiac and peripheral vascular disease also found numerous discrepancies in the conduct of the clinical trials and compliance with the regulations governing investigational new agents [31]. As a result of these two inspections, the FDA determined that a more systematic review of procedures to ensure compliance with regulations was warranted. This was accomplished by two specific activities. In March of 2000, the FDA issued a letter to all Gene Therapy IND or Master File sponsors requesting information on the gene transfer product characterization, a review of the preclinical safety studies to ensure any findings that met the criteria requiring an expedited report as per 21 CFR 312.32-33 were submitted, and a summary of the procedures to ensure adequate monitoring and adequate oversight. A copy of the March 6, 2000, letter is available at http://www.fda.gov/cber/genetherapy/gtpubs.htm. In April 2000, the FDA initiated a series of inspections of clinical sites conducting trials in gene transfer research. At the time, CBER had 211 active gene transfer IND submissions; a random sample of 30 INDs was taken and the principal investigators and clinical sites were identified. From these 30 INDs, 70 sites were identified for inspection to determine their level of compliance with the current regulations. A summary of the results of the March 6 letter and the additional site inspections is provided below. C. Description of the March 6, 2000, Letter and Summary of Responses The March 6, 2000, letter was sent to approximately 150 sponsors holding slightly less than 300 total active INDs or master files. Items 1-5 of the letter were questions regarding product testing and characterization data, test methods, specifications, information regarding other products produced in the facility, and quality control procedures. The goals were to: (i) ensure that all gene therapy products currently in clinical trials are adequately tested by contemporary standards, (ii) determine where testing requirements need to be made more stringent or relaxed, (iii) gather information to aid in development of additional guidance, (iv) gain information concerning product characteri­ zation and manufacturing processes and arrangements in order

to move these products forward toward licensure, and (v) develop a mechanism to ensure that IND annual reports routinely contain updates of this information. In gen­ eral, sponsors of adenovirus gene transfer trials have been in compliance with FDA recommendations and expectations regarding adenovirus vector product 6 5 0 Bauer ef a/. characterization. In addition, review of the adenovirus vector lot information led to recent changes in recommendations regarding vector infectious particle and total particle measurements as v^ell as a change in the recommendation regarding RCA. In addition to requests for information on manufacturing practices, the March 6 letter also asked sponsors to provide a summary of the monitoring program for each clinical study conducted under their IND and documentation of their oversight function. The intent w âs to confirm or bring sponsors into compliance v̂ îth GCP as required under 21 CFR 312, subpart D, and as described in the ICH GCP guidance. FDA review^ of the descriptions of the clinical monitoring programs found that the monitoring programs in general incorporated many of the activities and procedures in accordance v^ith the ICH GCP guidance and the requirements listed 21 CFR 312, subpart D. How^ever, some areas of deficiencies were noted, including but not limited to lack of procedures to correct or remove noncompliant investigators, ensuring reporting of protocol modifications to FDA, and ensuring safety reports are filed to the IND in a timely fashion. The last question in the March 6 letter was intended to remind sponsors that certain findings from animal experiments, i.e., severe toxicities and/or deaths on study, also rise to the level of an expedited report. It asked the sponsors to verify that such data, if relevant, either had already been submitted as required under regulation, or, if not previously submitted, that the data be promptly submitted to the IND or master file. In general, most sponsors indicated they were already in compliance with reporting requirements for such data. D. Results of Additional Inspections The sites inspected were chosen at random. Specific questions regarding the background information on the product and the clinical study were developed by the inspection team, and focused on the conduct of the protocol, the reporting of adverse events, blinding of study medication where applicable, and whether the clinical end points were met. CBER field inspectors conducted the inspections between April and August 2000. In general, these inspections found that most sponsors, both commercial and academic, as well as clinical investigators, were in compliance with the regulations. Of the 70 sites inspected, 11 had no current, active clinical trials or had never initiated their proposed studies, and 23 (33%) required no further action from FDA. Approximately half of the sites had objectionable conditions or practices identified by the inspection team; however, in 33 cases (47% of total sites), only voluntary action to correct the deficiencies was called for. Only three sites were identified where official regulatory action (i.e., warning letters) was required. The most common deficiencies in all of these 2 1 . Testing of Ad Vector Gene Transfer Products 6 5 1 cases were: (i) failure to follow the protocol; (ii) an inadequate consent form; (iii) lack of supporting data for case report form entries and/or discrepancies between the source documents and the case report forms; (iv) inadequate drug accountability records; and (v) the failure to notify the Institutional Review Board(s) of protocol changes, adverse events, or deaths. In summary, the targeted inspections in gene transfer research clinical trials demonstrated, with a few exceptions, that studies were being conducted according to appropriate regulation and guidance. Where deviations were noted, they appeared to be similar to those found in routine inspections of Phase 3 studies of more traditional, biologic agents. The FDA will continue to conduct inspections of clinical, preclinical, and/or manufacturing sites involved in gene transfer research on "for cause" as well as routine bases as part of our role in protecting the safety of patients enrolled in these trials. E. Sponsor Outreach and Education CBER had routinely been involved in educational and training activities aimed at sponsors and investigators who are involved in gene transfer research. However, following the death of the patient in the OTC deficiency study, the agency recognized the need to inform potential sponsors of not only the issues specific to the conduct of gene transfer studies, but also on the issues involved in the design of a clinical program and the elements of GCP. Education sessions have taken place at various venues, including the Drug Information Association (DIA) annual meetings and a special satellite broadcast cosponsored by DIA and the FDA; the annual meetings of the Society of Toxicology, the American College of Toxicology, the International Society for Genetic Anticancer Agents, meetings of the Pharmaceutical Research and Manufacturer's Association, meetings of the RAC, and the annual American Society of Gene Therapy (ASGT) meetings. FDA will continue to participate in training courses held by ASGT, as well as other professional and scientific societies. XVI. Summary Adenovirus vectors are complex biologies. The FDA's recommendations and expectations for product manufacture and characterization, preclinical, and clinical testing incorporate the tremendous experience gained in the nearly 10 years since the first adenovirus gene transfer experiment, as well as from the experience with the entire field of gene transfer research. The FDA is cognizant of the need for flexibility in its recommendations and will consider many factors, including the intended target population, the seriousness of the disease under study, the potential benefits and risks from the investigational product, when advising sponsors about their adenovirus development program. 6 5 2 Bauer ef aL The agency will update and reassess recommendations for adenovirus vector production and testing based on the growing experience and on feedback from a variety of sources. The information in the above sections is intended to educate the reader about FDA processes and expectations and should be utilized in conjunction with consultation from FDA staff. The FDA encourages new investigators to consult with FDA staff prior to submission of an IND. The formal process for FDA consultation is a pre-IND meeting. Sponsors may request information about the IND process in gen­ eral through CBER's Office of Communication, Training, and Manufacturers Assistance (OCTMA) at 301-827-2000. A sponsor for a gene transfer product who is interested in meeting with the Agency should submit a written request (i.e., letter or fax) to the Director, Division of Application Review and Policy, Office of Therapeutics Research and Review, Center for Biologies Evaluation and Research. Requests for meetings should be submitted in triplicate to the following address: Center for Biologies Evaluation and Research, Attn: Office of Therapeutics Research and Review, HFM-99, Room 200N, 1401 Rockville Pike, Rockville, MD 20852-1448. Prior to submitting a written request for a meeting by fax, the sponsor should contact the Division of Application Review and Policy to determine to whom the fax should be directed and to arrange for confirmation of receipt of the fax. Acknovsfledgments The authors express their gratitude for comments and suggestions from Dr. Stephanie Simek, Dr. Andrew Byrnes, Dr. David Green, Ms. Mercedes Serabian, Dr. Susan Ellenberg, and Dr. Jay Siegel. References 1. Kessler, D. A., Siegel, J. P., Noguchi, P. D, et al. (1993). Regulation of somatic-cell therapy and gene therapy by the Food and Drug Administration. N. Engl. J. Med. 329, 1169-1173. 2. Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) (January 2001). Available at http://www4.od.nih.gov/oba/rac/guidelines/guideUnes.html. 3. Center for Drug Evaluation and Research. (September 1989). "Guideline for Drug Master Files." 4. Food and Drug Administration, Center for Biologies Evaluation and Research (March 1998). "Guidance for Industry: Guidance for Human Somatic Cell Therapy and Gene Therapy." Available at http://www.fda.gov/cber/guidelines. 5. (1993). "Points to Consider in the Characterization of Cell lines Used to Produce Biologicals." Available at http://www.fda.gov/cber/guidelines. 6. Federal Register Notice of Availability (September 9, 1998). "International Conference on Harmonisation: Guidance on Viral Safety Evaluation of Biotechnology Products Derived from Cell Lines of Human or Animal Origin; Availability." 63 FR 51074. 2 1 . Testing of Ad Vector Gene Transfer Products 6 5 3 7. WBF and CBER websites for Adenovirus Reference Material Working Group, Bid proposals and meeting minutes/transcripts www.wilbio.com and www.cber.fda.gov. 8. "Biologies Response Modifiers Advisory Committee Meeting, Nov. 16-17, 2000." Tran­ scripts available at www.cber.fda.gov. 9. "Biologies Response Modifiers Advisory Committee Meeting April 5-6, 2001." Transcripts available at www.cber.fda.gov. 9a. "Biologies Response Modifiers Advisory Committee Meeting Oct. 24-26 ,2001 ." Transcripts available at www.cber.fda.gov. 10. Shabram, P., and Aguilar-Cordova, E. (2000). Multiplicity of infection/multiplicity of con­ fusion. MoL Ther. 2, 420-421. 11. Hutchins, B., Sajjadi, N., Seaver, S., Shepherd, A., Bauer, S. R,, Simek, S., Carson, K., and Aguilar-Cordova, E. (2000). Working toward an adenoviral vector testing standard. MoL Ther. 2, 532-534. 12. International Conference on Harmonisation (July 1997). "Guidance for Industry. S6: Preclin­ ical Safety Evaluation of Biotechnology-Derived Pharmaceuticals." Available at http://www. fda.gov/cber/guidelines. 13. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangeli, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994). Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8 , 4 2 - 5 1 . 14. Recombinant DNA Advisory Committee Meeting http://www4.od.nih.gov/oba/3-99RAC. htm 15. Pilaro, A. M., and Serabian, M. A. (1999). Preclinical development strategies for novel gene therapeutic products. Toxicol. Pathol. 27, 4 - 7 . 16. International Conference on Harmonisation. "Guidance for Industry. E6: Good Clinical Practice: Consolidated Guidance." Available at http://www.fda.gov/cber/guidelines. 17. International Congress on Harmonisation. "Guidance for Industry. E3: Structure and Con­ tent of the Final Study Report," Available at http://www.fda.gov/cber/guidelines. 18. International Congress on Harmonisation. "The Common Technical Document." Available at http://www.fda.gov/cber/guidelines. 19. Kessler, D. A. (1993). MedWatch: The new FDA medical products reporting program Am. } . Hosp. Pharm. 50, 1151-1152. 20. "Additional Safeguards for Children in Clinical Investigations of FDA-Regulated Indus­ try Products. Interim Rule." Available at http://www.fda.gov/OHRMS/DOCKETS/98fr/ cd0030.pdf. 21. International Conference on Harmonisation. " E l l : Clinical Investigation of Medicinal Products in the Pediatric Population." Available at http://www.fda.gov/cber/guidelines. 22. Wittes, J. (1993). Behind closed doors: The data monitoring board in randomized clinical trials. Stat. Med. 12, 419-424. 23. Trask, T. W., Trask, R. P., Aguilar-Cordova, E., Shine, D., Wyde, P. R., Goodman, J. C , Hamilton, W. J., Rojas-Martinez, A., Chen, S. H., Woo, S. L., and Grossman, R. G. (2000). Phase I study of adenoviral delivery of the HSV-tk gene and ganciclovir administration in patients with current malignant brain tumors. Mol. Ther. 1, 195-203. 24. Kafri, T., Morgan, D., Krahl, T., Sarvetnick, N., Sherman, L., and Verma, I. (1998). Cellular immune response to adenoviral vector infected cells does not require de novo viral gene expression: Implications for gene therapy. Proc. Natl. Acad. Sci. USA 95, 1377-1382. 25. Recombinant DNA Advisory Committee. "Minutes of Symposium and Meeting, December 8-10, 1999." Available at: http://www4.od.nih.gov/oba/rac/meeting.html. 26. "Testing for Replication Competent Retrovirus in Retroviral Based Gene Therapy Products and During Follow up of Patients in Clinical Trials using Retroviral Vectors, October 18, 2000." Available at http://www.fda.gov/cber/guidelines. 6 5 4 Bauer ef aL 27. International Conference on Harmonisation, "Guidance for Industry. ElO: Choice of Con­ trol." Available at http://www.fda.gov/cber/guidelines. 28. Fleming, T. R. (1994). Surrogate markers in AIDS and cancer trials Stat. Med. 13, 1423-1435. 29. Fleming, T. R., and DeMets, D. L. (1996). Surrogate Endpoints in Clinical Trials: Are We Being Misled? Ann. Intern. Med. 125, 605-613. 30. "Guidance for Industry: Providing Clinical Evidence of Effectiveness, May 1998." Available at http://www.fda.gov/cber/guidelines. 30a. NIH Report. Assessment of adenoviral vector safety and toxicity: Report of the National Institutes of Health Recombinant DNA Advisory Committee (2002). Hum. Gene Ther. 13, 3 -13 . 31. Warning Letters http://www.fda.gov/cber/efoi/warning01.htm and http://www.fda.gov/foi/ warning-letters. 32. Notice of Intent at http://www.fda.gov/foi/nidpoe/default.html. 33. Mcintosh, K. (1990). Diagnositc virology. In "Fields Virology" (B.N. Fields and D. M. Knipe, Eds.), 2nd ed. Raven Press, Chap. 17, pp. 383-410. New York. 34. Wagner, R. (1990). Rhabdoviridae and their replication. In "Fields Virology" (B. N. Fields and D. M. Knipe, Eds.), 2nd ed. Raven Press, Chap. 31, pp. 867-883. New York. C H A P T E R Imaging Adenovirus-Mediated Gene Transfer Kurt R. Zinn^ and Tandra R. Chaudhuri University of Alabama at Birmingham Birmingham, Alabama I. Introduction Gene therapy represents a new paradigm in the treatment of human

disease. The future widespread apphcation of gene therapy requires gene expression in the targeted cells or tissue. Gene expression means the successful accomplishment of gene delivery, which is most efficaciously accomplished with a gene-therapy vector. In their December 1995 report, Orkin and Motulsky identified shortcomings in all gene-therapy vectors, including a lack of quan­ titative assessment of gene transfer and expression [1]. Noninvasive imaging specifically addresses the latter issue and can advance the testing of enhanced gene-therapy vectors by providing information on the in vivo location of vector delivery, as well as the extent and magnitude of gene transfer and expression. In addition, the consequences of the gene expression can be eval­ uated, such as the production of specific enzymes or metabolites, induction of apoptosis, or measurement of tumor shrinkage. While imaging of gene transfer has not yet been approved for routine human applications, several groups have reported systems for detection of gene transfer in animal models. The purpose of this chapter is to provide an overview of current imaging technologies and their scientific bases, with emphasis on those technologies that are applicable to gene therapy. Finally, the current imaging literature will be reviewed with respect to imaging gene therapy vectors, especially adenoviral (Ad) vectors. ^ Corresponding author. Supported by NIH Grant CA80104. ADENOVIRAL VECTORS FOR GENE THERAPY ^ C C Copyright 2002, Elsevier Science (USA). All rights reserved. 6 5 6 Zinn and Chaudhuri II. What Information Is Provided by Imaging? Noninvasive imaging technologies have become increasingly important over the past 20 years in the management of human diseases. Diagnostic radiology is the medical specialty that is responsible for imaging, providing critical information in three general areas, namely (i) anatomy/blood flov ,̂ (ii) metaboUsm, and (iii) receptor expression. The first area is the most v^idely applied in terms of the number of studies. This type of imaging affords an opportunity to detect the abnormality, since many conditions result in the disruption of normal anatomy, function, or blood flow. One example is the detection of a mass in an abnormal location on a chest radio­ graph, which, with further tests leads to a diagnosis of cancer. Another example is the identification of fractures following traumatic injury, or decreased bone density resulting from osteoporosis. These basic radiol­ ogy techniques remain an important component of disease management. They are routinely accomplished by radiography and angiography, computed tomography (CT), magnetic resonance imaging (MRI), and ultrasonography (US). Less frequently, gamma-ray imaging (especially PET) studies assess blood flow. Metabolism is the second general area that can be assessed by noninvasive imaging. This category includes the evaluation of organ function. Examples include noninvasive imaging to assess heart perfusion under stress, gastric emptying, ventilation/perfusion of the lung, renal and liver function, and blood flow to the brain. Metabolite imaging is a further example, since magnetic resonance spectroscopy (MRS) techniques now detect altered metabolites in disease processes. Another aspect of metabolism that can be assessed is energy utilization. The increased metabolic rate of cancerous tissue relative to normal tissue can be imaged using radioactive probes that accumulate in areas of higher metabolic activity. These studies are accomplished by administration of a radioactive drug; the increased uptake of the radioactive drug in the cancerous lesion is imaged with gamma-ray detection instruments. In a similar manner, the glucose or fatty acid metabolism in myocardium can be evaluated following ischemic injury. The third area that can be assessed by noninvasive imaging is that of receptor expression. While receptors may potentially be assessed with MRI, the most success to date has been demonstrated using radioactive, gamma- emitting drugs followed by imaging with gamma-ray detection instruments as described above. This area represents the latest evolution in imaging; it is often described as "molecular imaging" since disease-specific receptors are detected. One example is the application of somatostatin receptor imaging for detection of neuroendocrine tumors. This recent capability is possible due to in vivo accumulation of a radiolabeled peptide with high affinity for somatostatin receptor expressed on the surface of the tumor cells. Another 22 . Imaging Adenovirus-Mediated Gene Transfer 6 5 7 example is detection and measurement of dopamine receptors, which become ahered in Parkinson's disease. Molecular imaging represents a growth area for radiology, and promises to allow early detection and monitoring of disease response during therapeutic intervention. III. Scientific Basis for Imaging A. Electromagnetic Energy In general, all imaging technologies require the use of electromagnetic energy. Each imaging modality exploits a different part of the electromagnetic energy spectrum. The spectrum includes gamma rays. X-rays, visible light, ultrasonic waves, and radiowaves. All of these waves are photons of energy, but they differ in their wavelength and, therefore, energy. Each imaging instrument is designed to detect a particular range of electromagnetic energy. Most often, the instrument also generates the requisite energy for the imaging application, and the detection occurs after interaction with the imaging subject. The exception is with gamma-ray imaging, where the requisite energy is provided by decay of an administered radioactive probe that is not part of the instrument. B. Contrast All imaging technologies require contrast in order for images to be produced. In the case of gamma-ray imaging, the contrast is provided by the localized accumulation of the radioactivity. In the case of radiography, the bone and soft tissues attenuate the X-rays to a different degree, which leads to contrast. Contrast is achieved in magnetic resonance imaging because the local environment of the proton is different in fat, water, and the soft tissues. With US, contrast is achieved because the reflectance of the ultrasonic wave is dependent on the tissue architecture or blood flow. Contrast for light-based imaging is provided by localized light emission or fluorescence. Contrast for radiography, CT, MRI, and US can be increased by administration of an exogenous contrast-enhancing agent. Angiography is always better with a contrast agent, whether done by fluoroscopy, CT, or MRI. C. Gamma Rays and Detection In the electromagnetic energy spectrum, the highest energy photons (shortest wavelength, highest frequency) are gamma rays. Gamma rays arise out of nuclear events during radioactive decay. For in vivo imaging purposes, the best gamma rays are of low energy, in the range of 100-511 keV. Gamma rays in this energy range can be efficiently stopped and therefore measured 658 Zinn and Chaudhuri by external detectors. Approximately 80-90% of nuclear medicine imaging is accomplished using radioactive ^^"'Tc, which emits a 140-keV gamma ray during its radioactive decay. ^̂ ^̂ Tc has a 6-h half-life and is continuously available from regional nuclear pharmacies. It is the decay product of ^^Mo (half-life = 66 h) and is eluted daily from the ^^Mo/^^"^Tc generator system and therefore available at very high specific activity and low cost. ^^"^Tc is chelated (complexed) with various compounds that have different biological characteristics. A typical mobile Anger gamma camera for planar imaging is shown in Fig. lA. Gamma camera imaging requires the use of a collimator, a solidly constructed gamma-ray attenuator (usually made from lead) that is placed between the subject and the gamma-ray detector. There are various types of collimators, some more specific for low-energy gamma rays, while other are specific for higher ranges of gamma-ray energies. A pinhole coUimator and parallel-hole collimator is shown in Figs. IB and ID, respectively. The pinhole collimator has a small round hole at the end (inset, Fig. IC) that allows projection of the gamma rays onto the detector crystal, thus forming an image like a pinhole camera. In contrast, the parallel-hole collimator allows passage Figure 1 Gamma camera and collimators. (A) Anger 4 2 0 / 5 5 0 mobile radioisotope gamma camera (Technicare, Solon, OH); (B) gamma camera detector head with the pinhole collimator; (C) close-up of the pinhole; (D) gamma camera detector head with the high resolution parallel-hole collimator. The gamma camera has one detector head; the collimators are changed for the particular application. 22. Imaging Adenovirus-Mediated Gene Transfer 659 "^^^^xm Detector Crystal Figure 2 Diagram showing cross-section of the detector head with a mouse in position for imaging. (A) Imaging with a parallel hole collimator; (B) imaging with a pinhole collimator; (C) data acquisition computer (NumaStation, Amherst, NH) showing collected images. A gamma ray is depicted in A and B passing through the collimators and interacting with the detector crystal (1), leading to production of light that is detected by the photomultiplier tubes. of gamma rays that are perpendicular to the plane of the collimator. Figure 2 presents a diagram illustrating a cross section of the gamma camera equipped with either a high-resolution parallel-hole collimator or a pinhole collimator. The mice are in position for imaging and were previously injected with a compound called methylene diphosphonate labeled with ^^mj^ (^^"^Tc-MDP). This compound localized in areas of bone with high osteoblastic activity by 4 h after intravenous injection; The gamma rays emitted from the animal are stopped by the detector crystal (Fig. 2, "1") and visible light photons are emitted. These photons are captured by the photomultiplier tubes adjacent to the crystal and converted to a voltage pulse. The X, Y location of the interaction event is recorded, as well as the magnitude of the voltage pulse (Z, pulse height), which is proportional to the energy of the gamma ray that was stopped. The gamma camera in this example has an intrinsic spatial resolution of 3 mm; therefore, individual vertebra of the mouse were not detected separately. However, uptake in the spine and knee joints is clearly visualized. Additional examples of ^ "̂̂ Tc complexes for human imaging include 99mYc-JV[AG3 (mercaptoacetyltriglycine) for imaging renal function and 660 Zinn and Chaudhuri ^^"^Tc-HMPAO (hexamethylpropyleneamineoxime) for imaging blood flow in the brain. Peptides and antibodies radiolabeled with ^ "̂̂ Tc are also approved for human imaging applications. Most often, the 99mj^ |g attached to protein with a bifunctional chelater. With this system one part of the chelator binds 99mj^ in stable conformation, while a second part is used for attachment of the complex to the protein. Besides ^^"^Tc, other radionuclides that are used for imaging include ^^Ga, ^^^In, ^^^I, and -̂̂ Î (see Table I). These radionuclides have different gamma-ray emissions; simultaneous imaging with 99mj^ is possible. Multi-gamma-ray imaging is one feature that differentiates gamma camera imaging from PET. The latter is limited to detection of positron annihilation events, and therefore radionuclides lacking positron emission are not detected. The image presented in Fig. 2 is a planar image that represents a two-dimensional distribution of the ^^"^Tc-MDP at 4 h after intravenous injection. Single photon emission computed tomography (SPECT) is also possible with specialized gamma cameras that are routinely available in nuclear medicine departments. SPECT is accomplished by collecting multiple images (or projections) at various angles around the subject; the gamma camera usually moves. A tomographic image of the distribution of the radioactivity is produced following reconstruction of these projections. The typical spatial Table I Radionuclides Commonly Used in imaging Gamma-ray (keV) Imaging Radionuclide Decay mode" Half-life (Abundance) application "c H 20.38 min 511 PET 1 3 N P + 9.96 min 511 PET " O 18p n 122 s 511 PET H 109.8 min 511 PET -̂̂ Cu EC 4 1 % ,, H 12.7 h 511 PET 19%, p - 40% 1345 (0.48%) ^^Ga EC 3.26 days 93 (37%), 184.6 Gamma (20.4%), 393.5 camera (4.6%) 99m-[-^ IT 6 h 140 (89%) Gamma camera i"ln EC 2.83 days 171.3 (90.2%), Gamma 245.3 (94%) camera 1231 EC 13.2 h 159.1 (83%) Gamma camera 124j H 2 5 % , , EC 40% 4.15 days 511,602.7(61%) PET 131j P- 8.04 days 364.5 (81.2%) Gamma camera ^P—, beta minus (electron emission); p+, beta plus (positron emission); EC, electron capture; IT, isomeric transition. 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 1 resolution provided by clinical SPECT imaging is on the order of 1 cm^ [2, 3]. New methods for animal imaging are able to accomplish both planar and SPECT imaging at a spatial resolution of 1 mm^ and better [4-6]. Many new generation gamma cameras also include solid-state detectors, which eliminates the need for the photomultiplier tubes. PET is an alternate three-dimensional imaging technique for the indirect detection of positrons. Positrons are positively charged electrons that are emitted from a proton-rich nucleus during radioactive decay. The lifetime of positrons is relatively short since they undergo annihilation by combining with an electron, giving

rise to two 511-keV gamma rays at opposite (180°) orientations. The 511-keV gamma rays are actually detected in PET, not the positrons. PET scanners have a circular array of detectors that are designed to operate in a coincidence mode. This means that a signal is generated only when two detectors at opposite orientations simultaneously detect the 511-keV gamma rays, arising from the positron annihilation event. Since various 511- keV pairs of photons strike different pairs of detectors, the location of the actual decay events can be determined when the image is reconstructed. PET scanners do not require collimators, since the coincidence circuitry accomplishes the same objective. In recent years, dual-head gamma cameras have been designed with coincidence circuitry, thereby enabling gamma cameras to conduct PET imaging studies. The volumetric resolution of clinical PET scanners is approximately 0.4 cm^ [7, 8]. A new small animal PET scanner (MicroPET, Concorde Microsystems, Knoxville, TN) is reported to have a spatial resolution of 1.8 mm and volume resolution of 8 mm^ for in vivo imaging [9]. This latter system represents a significant advancement in small animal imaging, since improved spatial was needed for detection of individual organs in mice. Radionuclides that are used in PET imaging are proton rich and produced at cyclotrons using charged-particle reactions. A list of common PET radionuclides is included in Table I. Most PET radionuclides have short half-lives; therefore, production must be in close proximity to where imaging will be done. In addition, PET radionuchdes such as ^^C, -̂̂ N, and ^^O are suitable as intrinsic labels for many molecules, thereby enabling imaging studies of the actual molecule of interest. For example, fatty acid metabolism could be imaged with the ^^C-labeled fatty acid, where the ^^C replaced the normal ^^C in the molecular structure. Intrinsic labeling of this type cannot be accomplished with ^^"^Tc, since the radionuclide is not part of the molecule. A bifunctional chelate would be required for the ^ "̂̂ Tc to attach it to the fatty acid, and a ^^"^Tc-labeled fatty acid might have different in vivo uptake and elimination characteristics than the natural fatty acid. D. Light-Based Imaging and Detection Visible light has a wavelength between 400 and 700 nm, while the near- infrared region is from 700 to 1000 nm. Light in the near infrared is better 6 6 2 Zinn and Chaudhuri for in vivo imaging, since it penetrates the tissue more readily. For light-based imaging, contrast is achieved by at least three mechanisms. A specific color can be produced due to transfer of an enzyme (e.g., p-galactosidase) that reacts with a substrate to produce a colored product. A second mechanism is provided by fluorescence, excitation at one wavelength, with simultaneous detection at another wavelength. Special filters are employed to block detection of the excitation wavelength, thereby reducing the background for better contrast. Spectral imaging [10] and hyperspectral imaging [11] are technologies recently developed, while data processing for optical imaging is also improving [12, 13]. New fluorescence techniques use quenched substrates, which become fluorescent (unquenched) after activation by a specific process. Finally, light emission by enzymatic reaction can be achieved following expression of the gene encoding for luciferase. In vitro light detection instruments include microscopes, fluorescence-activated cell sorters, and fluorescence-based plate readers. In vivo light-based imaging can be accomplished with fluorescent stereomicroscopes and light-tight boxes with CCD cameras. A commercial instrument for luciferase imaging is also available from Xenogen, Inc. (Alameda, CA). E. Magnetic Resonance Imaging and Spectroscopy The proton is the element responsible for the signal generation in proton MRI, and can be viewed as a minimagnet due to the spinning single electron. MRI utilizes two energies, a strong magnetic field and pulses of radio frequency (RF) electromagnetic energy. RF energy is not ionizing, and a trillion times less in magnitude than X-rays. The sensitivity of the technology is related to the large number of protons that are present in water and fat, the primary constituents of a human or animal. When protons are placed in a magnetic field, they become aligned with, or opposed to, the external field. Excitation with a precise resonance frequency (MHz) results in excited-state protons, all of which are in phase, but tilted away from the direction of the external magnetic field. The "in-phase" aspect is unique to the excited state, since ground-state protons are not in phase. Therefore, to summarize, absorption of a resonance RF energy by the proton results in an excited state, where all the excited-state protons are in phase. When the RF excitation is stopped, the excited protons "relax" and emit resonance RF energy in proportion to proton density. This is the MRI signal and is analogous to phosphorescence for light. The relaxation of the excited protons is also referred to as the spin-lattice relaxation, which is the time for the protons to realign with external magnetic field. The time course is described by an exponential equation that includes a constant (Tl). The protons also "dephase" at an exponential rate, which is referred to as spin-spin relaxation. This decay of signal is also described by an equation that includes another constant (T2 or T2''' time constant). The important fact 22 . Imaging Adenovirus-Mediated! Gene Transfer 6 6 3 is that the magnitude of both Tl and T2 depend on the tissue (local proton environment) and therefore contrast is achieved in MRI due to this difference. MRI contrast agents exert their effects by modulating Tl and T2 in the local environment of the contrast agent. In other w^ords, the enhanced contrast provided by an MRI contrast agent is not related to signal generated by the contrast agent, rather the effect of the contrast agent on the local protons. In this respect, the mechanism of the MRI contrast agent is different from an X-ray contrast agent. The latter causes contrast due to higher absorption of the X-rays. Overall, the in vivo spatial resolution of MRI is superb, reaching a voxel resolution of about 50 [xm^. Typical clinical MRI instruments have a magnetic field strength of 0.5-2 Tesla. MRS represents a specialized capability of magnetic resonance technology. MRS is not concerned W\t\\ T l and T2 times constants, rather with accurate measurement of the chemical shifts associated with molecules that incorporate ^H, ^^C, ^^F, and ^^P. Each particular molecule has a different signature, allowing for assignment of individual metabolites. This can be very important to the understanding of disease processes, or response during therapy. For example, brain phospholipid metabolites (such as free phosphate, phosphocholine, etc.) can be studied. MRS often requires magnets of high field strength in order to separate the overlapping signals of individual metabolites. An additional disadvantage of the MRS is the relatively low sensitivity for detecting the metabolites, which requires either very long imaging times or large voxel sizes (volume area). MRS methods have been reviewed recently [14-16]. IV. Imaging and Gene-Therapy Vectors A. Gamma-Ray Imaging Gamma-ray imaging has been applied in two different ways to evaluate gene-therapy vectors in animal models. First, the in vivo location of the administered vector can be imaged following dosing. Second, the vector- dependent location of transgene expression can be imaged. This is accomplished by detection of expressed genetic reporters encoded in the vector. Both methods yield different information and may, or may not be correlated. For example, following intravenous injection an Ad vector might immediately localize in the liver. However, the extent of liver gene expression would depend on the cell type infected, the type of promoter, and the time after dosing. The two methods are reviewed in the following sections. 1. Radiolabeling the Vector Gamma camera imaging has been applied to evaluate directly labeled vectors. The in vivo distribution of ^^^In-labeled herpes simplex virions 6 6 4 Zinn and Chaudhuri was imaged following intravenous dosing [17]. This method of nonspecific labeling with ^^^In oxine showed no effect on viral infectivity; a maximum specific activity of 250 |jiCi/10^ plague forming units (pfu) was achieved. ^^"^Tc-labeled Ad was evaluated following aerosol administration to the lung [18] or following intravenous injection [19]. The former approach [18] used nonspecific labeling with SnFi as the reductant for the ^^"^Tc ([TCO4]-). The latter approach represented a new method for radiolabeling a recombinant Ad vector with ^^"^Tc. A recombinant 6-His tag on the C-terminal knob was specifically targeting for labeling using Tc(I) carbonyl chemistry. This radiolabeling chemistry was originally described by Waibel [20]. Advantages of this system are related to the ease of radiolabeling and high stability over nonspecific methods, plus the specific attachment at the 6-His tag did not change the infectious characteristics of the Ad vector. It is anticipated that the technology will be used to image Ad vectors with modified tropism. 2. Imaging the Expression of Reporter Genes One method to evaluate gene transfer is to construct a vector encoding a suitable gene that when expressed can be targeted with a radiolabeled probe. An Ad vector encoding the human type 2 somatostatin receptor (hSSTr2) was used to infect cells growing in cell culture plates, and the expressed hSSTr2 was detected by imaging accumulation of the ^^"^Tc-labeled somatostatin analog P2045 [21]. An example of this approach is presented in Fig. 3. The in vitro method was further extended for detection of both hSSTr2 and herpes simplex virus thymidine kinase (TK) expression by simultaneously imaging "trapped" radiolabeled molecules specific for each expressed gene [22]. Imaging can also detect the location of gamma-ray emitting radiotracers that accumulate in target sites in vivo, due to localized expression of a reporter gene product. In this regard, the administered radiotracer must be cleared from the normal tissue so specific accumulation can be detected over background radioactivity. To date, this approach has been applied to image the in vivo expression of four different reporter genes, namely hSSTr2 [23-26], TK [27-39], the type 2 dopamine receptor (D2R) [35, 37, 40-42] , and the thyroid sodium/iodide symporter gene [43]. The expression of hSSTr2 has been imaged with radiolabeled peptide ligands including ^^"^Tc-P829 [23], ^̂ ^ Re- P829 [23], ^^"^Tc-P2045 [24-26], and ^i^In-octreotide [25]. Figure 4 presents images that compare two different ^^"^Tc-labeled somatostatin analogs for imaging Ad-mediated expression of hSSTr2. Several radiolabeled substrates have been applied for imaging TK expression, including ^^^I-FIAU [27, 32, 37], ^^^I-FIAU [23, 25, 30], 8- [i^F]fluoroganciclovir [29, 34, 35, 37], 8-[^^F]fluoropenciclovir [35, 37, 38, 40, 41], 9-[(3-[i^F]fluoro-l-hydroxy-2-propoxy)methyl]guanine [39], and others [37]. D2R expression has been imaged with 3-(2^-[^^F]- fluoroethyl)spiperone [35, 37, 40, 41] and [^^C]raclopride [42]. The expressed 2 2 . I m a g i n g A d e n o v i r u s - M e d i a t e d G e n e Transfer 665 Block Block A A l 1 2 3 4 5 6 7 8 9 101112 1 2 3 4 5 6 7 8 9 101112 A427 ? J t ^ 0 % ' w ^ 1 %: > W Pfl K^ X J M I SKOVSJpi 10 1^ ^ * i 100 ^ ' * ^ ^ H 100 f ^ - ^ BxPC3 ? : i . f l | 1 € #- ^ 10 ^ ^ ^ H 10 * * * 100 '/ ^ . ^ H too *i • • B A427 SKOVSJp i BxPC3 0 MDA- 1 ' . - : • • 10 --?r-- >?y^-^;',,4v MB-468 100 j » > - ^ ^ : g # ^ f k ' . Figure 3 Imaging hSSTr2 gene transfer to tumor cell monolayers growing in 96-well plates by detection of internally bound ^^'^Tc-labeled P2045 (a somatostatin analog). Two levels of ^^"'lc-?2045 (7 nM: wells 1 - 3 , 7 - 9 ; 36 nM: wells 4-6, 10-12) were added to the two plates as shown in (A). Image (B) shows the quantity of internally bound ^^'^Tc-P2045 was dependent on the cell line and amount of Ad-hSSTr2. Cells were incubated with ^^"^Tc-P2045 for 3 h at 37°C and imaged following an acid wash to remove surface-bound activity. The cells were either uninfected (0) or infected with 1, 10, or 100 pfu/cell of Ad-hSSTr2 48 h earlier. Excess unlabeled P2045 (15 |JLM final concentration) was added to lanes 7 - 1 2 immediately prior to addition of ^^"^Tc-P2045 in order to show that the internal binding was specific. Reprinted with permission from Zinn etol. [22].

reporters were imaged in xenograft tumors [23-28, 32, 34, 36-45], liver [29, 34-37, 39], and striatum [42]. In the majority of xenograft tumor studies, the reporter gene was transferred to the tumor cells prior to implantation in the animal [27, 28, 31, 36-38, 40, 41], or vector-producer cells were injected in an established tumor [27, 28, 31]. Transfer of the reporter gene by intratumor injection was accomplished with Ad-hSSTr2 for subcutaneous tumors [23-25,45], Ad-TK for intrahepatic tumors [32], Ad-TK for subcutaneous tumors [39], and the Ad encoding the thyroid sodium/iodide symporter gene [43]. Transfer of the TK gene to rat striatum was accomplished by direct injection of Ad-TK [42]. Most recently, ^ "̂̂ I-FIAU and PET were applied to monitor TK expression resulting from replication and spread of a replication-conditional HSV-1 vector (encoding TK) in a subcutaneous tumor [44]. A biscistronic Ad vector encoding both TK and hSSTr2 was evaluated in a tumor model where the expressions of both TK and hSSTr2 were simultaneously imaged [24, 45]. The hSSTr2 system was more sensitive than TK and showed a dose-response relative to Ad dose, while the same was not observed for TK imaging. Additional advantages of the hSSTr2 system over other genetic reporters for imaging gene transfer in cancer, include the lower 666 Zinn and Chaudhuri Figure 4 Imaging Ad-mediated gene transfer to subcutaneous tumors. (A) Picture of a mouse with two subcutaneous A-427 tumors (human lung cancer). The left tumor was injected 48 h earlier with a control Ad vector (1 x 10^ pfu intratumor) while the right tumor was injected 48 h earlier with Ad-hSSTr2 (1 x 10^ pfu intratumor). (B) Gamma camera image (pinhole collimator) at 5 h after intravenous dosing with ^^"^Tc-P829 (NeoTect™, Diatide Research Laboratories, Londonderry, NH). (C) Gamma camera image (pinhole collimator) at 5 h after intravenous dosing with ^^"^Tc-P2045, a new somatostatin analog (Diatide Research Laboratories, Londonderry, NH). The right tumors show uptake of the 99mTc-labeled somatostatin analog due to gene transfer and expression of hSSTr2. cost of ^^^Tc relative to PET radionuclides, the wider availability of SPECT relative to PET, and the negative growth effect of hSSTr2 expression on cancer proUferation and metastasis [46-48]. B. Light-Based Imaging Light-based genetic reporters are commonly used to detect in vitro gene transfer. Examples include P-galactosidase [49], green fluorescent protein (GFP) [50, 51], red-shifted GFP derivatives [52], blue- or yellow-shifted GFP derivatives [53], and luciferase [54]. Advantages include high spatial resolution and sensitivity. Light-based approaches for in vivo imaging can be applied to assess the broad physiology involving tumor growth, which includes biochemical processes, receptors, and enzymes [55-81]. Currently, two general approaches are applied for light-based imaging. The first approach uses fluorescent-based probes that specifically accumulate, or become activated, due to a tumor-specific process. This approach uses fluorescent probes 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 7 that target tumor-specific receptors or enzymes. One example reported by Jackson and group used light-based imaging to demonstrate accumulation of a tumor receptor-specific, single-chain Fv fragment labeled with Cy5 fluorescent dye in mice bearing melanoma xenografts [55]. Tumor uptake of antibodies conjugated with near infrared dyes was previously visualized by light-based technology [56, 57]. Optical imaging also detected tumor accumulation of a somatostatin-avid peptide conjugated with a near infrared fluorescent dye [58-60]. An alternate application was described by Weissleder et al. using Cy5.5 probes that were inactive (autoquenched) when injected in the mice, but became specifically activated by proteases expressed in breast xenograft tumors [61, 62]. A recent report described a quantitative light-based method for noninvasive imaging of human breast cancer [63]. In this study, the images were obtained using near-infrared diffuse optical tomography (DOT), with contrast enhancement provided by indocyanine green (ICG) that was administered to the patient. MRI was performed concurrently on the same patient and showed that ICG-enhanced optical images coregistered accurately with gadolinium-enhanced MRI, thereby validating the ability of DOT to image breast tumors. Others also used ICG and modified photodynamic agents in combination with frequency-domain photon migration techniques to detect spontaneous cancer in the canine mammary chain [64, 65]. The second general approach for light-based imaging uses reporter genes yielding protein products that achieve light emission. Luciferase is one example of a reporter gene, the expression of which can be imaged by detecting light emission following injection of luciferin [66-69]. Luciferase is normally absent in mammalian cells, but stable integration of a luciferase-containing plasmid was achieved in cancer cells [67, 68] which were implanted and detected by imaging. In a separate report, an adeno-associated viral vector was used to induce luciferase expression in utero, with detection by whole-body imaging [69]. One disadvantage to luciferase imaging is the requirement of luciferin substrate injection. However, the sensitivity is high and requires only short-term photon acquisition and integration to produce images of intact animals. Therefore, real-time studies and high-throughput in vivo screening of gene expression is possible, especially during therapeutic intervention. Several investigators have applied GFP as a light-based reporter after stable integration of the GFP gene in cancer cells prior to implantation in mice [70-81]. Light emission was achieved following excitation of the GFP protein with blue light. Chishima et al. demonstrated that GFP-expressing tumor cells were visualized after tumor-bearing mice were dissected, and the metastasis of cancer was detected in many different organs [73-77]. This work was later extended by Yang et al. to include noninvasive imaging of GFP- positive melanoma metastasis in mice [78]. In a very recent article, Hoffman and his group reported imaging results from a study where an Ad vector encoding enhanced GFP was injected into different organs of nude mice. 6 6 8 Zinn and Chaudhuri Light-based in vivo imaging showed GFP expression in different organs [79]. Enhanced GFP is not cytotoxic and has stable fluorescence signal that can be readily detected. Therefore, it is a suitable reporter molecule for imaging gene expression in animal models [80, 81]. As an example, Fig. 5 presents a light-based image of GFP expression in a subcutaneous tumor following Ad- mediated gene transfer of GFP. Advantages of GFP imaging include the high sensitivity and tremendous spatial resolution that can be achieved. A further advantage is the fact that the protein is genetically encoded, without the need for exogenous substrates. C. Magnetic Resonance Technologies For cancer applications, MRI can indirectly assess the effect of gene therapy by measuring changes in tumor size, blood flow, or extracellular fluid volume [82-85]. Direct measurement of gene expression by MRI requires contrast-enhancement. This was achieved in vitro by stable induction of melanin, a protein with high affinity for metal ions [86, 87]. For in vivo imaging, cells expressing high levels of transferrin receptor were detected on T2-weighted images after injection of transferrin conjugated with paramagnetic iron particles [88, 89]. These monocrystalline iron oxide nanoparticles (also called MIONs) were improved with a cross-linked dextran coat and better conjugation chemistry for the transferrin attachment, leading to a 10-fold improvement in in vitro cellular uptake [90, 91]. These improved nanoparticles may be better suited for imaging the transferrin receptor following gene transfer in vivo. So far this remains a potential application. An alternate strategy for imaging gene transfer was reported by Louie and Meade [92]. The basis of this approach was the construction of a MRL contrast agent that was sensitive to ^-galactosidase. Gadolinium was chelated in a manner that water was inaccessible, and therefore "inactive" as a contrast agent. Flowever, ^-galactosidase was capable of cleaving part of the molecular structure, rendering the gadolinium accessible to water, and "active" as a contrast agent on Tl-weighted MRI images. For the approach to be applicable for in vivo imaging, the contrast agent must be delivered to the site of P- galactosidase expression. Therefore, the suitability of this strategy for imaging vector-mediated gene transfer remains to be proven. There are three literature reports demonstrating the capability of MRS for noninvasive detection of enzyme-specific metabolites that are applicable to gene therapy [93-95]. The first report detected the metabolite [^^F]5-FU in cytosine deaminase-positive tumors following administration of 5-FC [93]. The subcutaneous tumor was established following implantation of HT28/yCD cells that stably expressed Saccharomyces cerevisiae cytosine deaminase. Imaging required a surface coil surrounding the tumor, and spatial information about cytosine deaminase expression in the tumor was not obtained. The second 22 . Imaging Adenovirus-Mediated Gene Transfer 6 6 9 report involved noninvasive monitoring of arginine kinase (AK) expression follov^ing Ad-mediated delivery to skeletal muscle [94]. MRS detected the metabolite [^^P]phosphoarginine in the muscle, the product of the AD enzyme. Imaging also required a surface coil surrounding the limb, and no spatial information about AK expression was obtained. The third report involved detection of [^^Pjphosphocreatine in liver of mice foUov^ing intravenous dosing of an Ad vector encoding creatine kinase [95]. The liver v^as surgically exposed for placement of a surface coil for MRS, in order for specific detection of this metabolite. V. Gene-Therapy Vectors May Advance Molecular Imaging While this chapter has focused on how imaging may advance gene therapy, the converse may also occur. Gene-therapy vectors may lead to better imaging approaches. One example relates to the need for a reliable method for early detection and monitoring of ovarian cancer. Ovarian cancer is the leading cause of death among gynecologic malignancies in United States [96, 97]. More than 23,000 new cases of ovarian cancer are diagnosed yearly, with 15,000 deaths annually [97, 98]. For gynecologists, ovarian cancer is extremely difficult to detect in early stage since no reliable screening method exists for this disease. This results in a poor prognosis. In the past decade, there was a 30% increase in the incidence of ovarian cancer and 20% increase in deaths from this disease [99]. Currently, surgical staging by histological examination and vigorous surgical debulking are routine practice for early detection and partial treatment of this disease [96]. Early detection of this disease would be the best way to improve survival. In that regard, the development of an accurate, noninvasive in vivo imaging modality with high sensitivity for the detection of small lesions is needed. Detection of small tumors using conventional techniques is difficult, thereby hindering both early diagnosis and effective therapeutic intervention. Existing technologies do not meet the need for the early detection and monitoring of ovarian cancer. Imaging technologies have improved in their sensitivity to image ovarian, breast, and other cancers noninvasively by PET, CT, MRI, SPECT, and US [98-113]. However, these methods fall short in fulfilling the need for early and accurate diagnosis of neoplastic disease. According to Wahl, PET imaging with [^^F]FDG was able to detect primary breast lesions over 1 cm in diameter [108]. Similar findings were reported by Richter et al. [109]. Grab et al. concluded that a negative finding on PET or MRI would not exclude early ovarian neoplasia [110]. Kubik- Huch et al. reported in a comparative study that, PET, CT, and MRI were not a replacement for surgery in the detection of microscopic peritoneal 6 7 0 Zinn and Chaudhuri disease [111]. While PET imaging offered less accurate spatial assignment of small lesions compared with CT and MRI, the latter two modalities were less specific than [^^F]FDG PET [111]. In a separate report, Tempany et al. reported that CT and MR were equivocal for imaging advanced ovarian cancer [112]. Kurjak et al. reported that transvaginal color Doppler and three-dimensional power Doppler ultrasound imaging improved the ability to differentiate benign from malignant ovarian masses [113]. Taken together, all currently available imaging techniques are not satisfactory for the early and accurate detection of ovarian and breast tumors smaller than 1 cm in diameter. Clinicians are searching for an effective screening method for the early detection of ovarian cancer. Our group has suggested that Ad vectors can be developed for this purpose [114]. The idea is to achieve GFP contrast in ovarian tumors and apply light-based imaging for detection (Fig. 6). For this to be realized, it will be necessary to induce GFP expression specifically in the tumors. This could be accomplished in two ways. First, it is likely that ovarian tumors express unique genes that are not found in normal tissues. The human genome project and DNA array research are likely to uncover these genes. Once a gene is discovered, the promoter element controlling the gene could be used to drive GFP expression. Intraperitoneal injection of an Ad vector encoding

the GFP gene under control of the ovarian-specific promoter would enable visualization of GFP-expressing ovarian tumors. A second general method to cause GFP reporter gene expression specifically in the tumors would be to develop Ad vectors that specifically target tumor. Ad vectors have now been produced that lack native tropism [115]. Vector targeting continues to improve, and a clear demonstration of targeting to an artificial receptor has been realized [116]. While vectors are currently not available to target tumor-specific receptors and lead to specific tumor transduction, their future development is likely. Thus, whether due to tumor-specific targeting or tumor-specific promoters, one can envision inducing GFP expression in tumors that could subsequently be detected by light-based technology. Fluorescent stereomicroscopy is adequate for noninvasive imaging in animal models, especially mice. However, this approach may not be possible in humans due to thickness of the abdominal wall. Detection of GFP expression could be accomplished with endoscopy or laparoscopy and enable physicians to detect the presence of tumor cells at an earliest stage without major surgery. This would be of great diagnostic value to gynecologists, especially in detecting intraperitoneal tumors at an early stage. In the clinical setting of second-look laparoscopy the patient could be injected 2 days earlier with an Ad vector that induced GFP expression in recurrent tumor. A fluorescent endoscope would detect GFP-positive tumors much smaller in size than what is currently detected through standard laparoscopy. 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 1 VI . Conclusion Noninvasive imaging in its various forms represents an expanding endeavor that v îll positively impact gene therapy. Gamma-ray imaging modalities have an established track record for imaging gene transfer in animal models. Human studies w îth the same systems are likely to be the next evolution. At our institution two clinical trials are planned; both include the hSSTrl reporter gene for imaging gene transfer. References 1. Orkin, S. H., and Motulsky, A. G. (1995). "Report and Recommendations of the Panel to Assess the NIH Investment in Research on Gene Therapy." Available at http://vv^v^w.nih.gov/ nev^s/panelrep.html. 2. Groch, M. W., and Erwin, W. D. (2001). Single-photon emission computed tomography in the year 2001: Instrumentation and quality control. / . NucL Med. Technol. 29, 12-18. 3. Groch, M. W., and Erwin, W. D. (2000). SPECT in the year 2000: Basic principles./. NucL Med. Technol. 28, 233-344. 4. Kastis, K., Barrett, H. H., Barber, H. B., et aL (2000). A small-animal gamma-ray imager using a CdZnTe pixel array and a high-resolution collimator. High resolution imaging in small animals with PET, MR and other modalities. In "Abstract Book," p. 17. 5. Weber, D. A., and Ivanovic, M. (1999). Ultra-high-resolution imaging of small animals: Implications for preclinical and research studies./. NucL CardioL 6, 332-344. 6. Ishizu, K., Mukai, T., Yonekura, Y., Pagani, M., Fujita, T., Magata, Y., Nishizawa, S., Tamaki, N., Shibasaki, H., and Konishi, J. (1995). Ultra-high resolution SPECT system using four pinhole collimators for small animal studies. / . NucL Med. 36, 2282-2287. 7. Turkington, T. G. (2001). Introduction to PET instrumentation./. NucL Med. TechnoL 29, 4 - 1 1 . 8. Fleming, J. S., Goatman, K. A., Julyan, P. J., Boivin, C. M., Wilson, M. J., Barber, R. W., Bird, N. J., and Fryer, T. D. (2000). A comparison of performance of three gamma camera systems for positron emission tomography. NucL Med. Commun. 21 , 1095-1102. 9. Chatziioannou, A. F., Cherry, S. R., Shao, Y., Silverman, R. W., Meadors, K., Far- quhar, T. H., Pedarsani, M., and Phelps, M. E. (1999). Performance evaluation of microPET: A high-resolution lutetium oxyorthosilicate PET scanner for animal imaging. / . NucL Med. 40,1164-1175. 10. Farkas, D. L., and Becker, D. (2001). Applications of spectral imaging: Detection and analysis of human melanoma and its precursors. Pigment Cell Res. 14, 2 - 8 . 11. Schultz, R. A., Nielsen, T., Zavaleta, J. R., Ruch, R., Wyatt, R., and Garner, H. R. (2001). Hyperspectral imaging: A novel approach for microscopic analysis. Cytometry 43, 239-247. 12. Kam, Z., Hanser, B., Gustafsson, M. G., Agard, D. A., and Sedat, J. W. (2001). Computa­ tional adaptive optics for live three-dimensional biological imaging. Proc. Natl. Acad. Set. USA 98, 3790-3795. 13. Farkas, D. L.,Du, C , Fisher, G. W.,Lau, C.,Niu, W., Wachman, E. S., and Levenson, R. M. (1998). Non-invasive image acquisition and advanced processing in optical bioimaging. Comput. Med. Imaging Graph. 22, 89-102. 14. Evelhoch, J. L., GiUies, R. J., Karczmar, G. S., Koutcher, J. A., Maxwell, R. J., Nal- cioglu, O., Raghunand, N., Ronen, S. M., Ross, B. D., and Swartz, H. M. (2000). Appli­ cations of magnetic resonance in model systems: cancer therapeutics. Neoplasia 2, 152-165. 6 7 2 Zinn and Chaudhuri 15. Gillies, R. J., Bhujwalla, Z. M., Evelhoch, J., Garwood, M., Neeman, M., Robinson, S. P., Sotak, C. H., and Van Der Sanden, B. (2000). Applications of magnetic resonance in model systems: Tumor biology and physiology. Neoplasia 2, 139-151. 16. Kurhanewicz, J., Vigneron, D. B., and Nelson, S. J. (2000). Three-dimensional magnetic resonance spectroscopic imaging of brain and prostate cancer. Neoplasia 2, 166-189. 17. Schellingerhout, D., Bogdanov, Jr., A., Marecos, E., Spear, M., Breakefield, X., and Weissleder, R. (1998). Mapping the in vivo distribution of herpes simplex virions. Hum. Gene Ther. 9, 1543-1549. 18. Lerondel, S., Le Pape, A., Sene, C., Faure, L., Bernard, S., Diot, P., Nicolis, E., Mehtah, M., Lusky, M., Cabrini, G., and Pavirani, A. (2001). Radioisotopic imaging allov^s optimization of adenovirus lung deposition for cystic fibrosis gene therapy. Hum. Gene Ther. 12, 1-11. 19. Zinn, K. R., Chaudhuri, T. R., Belousova, N., Davis, A. J., Mountz, Jr., J. D., Mountz, J. M., Curiel, D. T., and Krasnykh, V. N. (2001). In vitro and in vivo imaging of ^^"^Tc-labeled recombinant adenovirus. Mol. Ther. 3, S136. 20. Waibel, R., Alberto, R., Willuda, J., Finnern, R., Schibli, R., Stichelberger, A., Egli, A., Abram, U., Mach, J. P., Pluckthun, A., and Schubiger, P. A. (1999). Stable one-step technetium-99m labeling of His-tagged recombinant proteins with a novel Tc(I)-carbonyl complex. Nat. Biotechnol. 17, 897-901. 21. Zinn, K. R., Chaudhuri, T. R., Buchsbaum, D. J., Mountz, J. M., and Rogers, B. E. (2001). Simultaneous Evaluation of Dual Gene Transfer to Adherent Cells by Gamma-ray Imaging. Nucl. Med. Biol. 28, 135-144. 22. Zinn, K. R., Chaudhuri, T. R., Buchsbaum, D. J., Mountz, J. M., and Rogers, B. E. (2001). Detection and measurement of in vitro gene transfer by gamma camera imaging. Gene Ther. 8,291-299. 23. Zinn, K. R., Buchsbaum, D. J., Chaudhuri, T. R., Mountz, J. M., Grizzle, W. E., and Rogers, B. E. (2000). Noninvasive monitoring of gene transfer using a reporter receptor imaged with a high affinity peptide radiolabeled with ^^"^Tc or ^̂ ^ Re. / . Nucl. Med. 41 , 887-895. 24. Zinn, K. R., Buchsbaum, D. J., Chaudhuri, T. R., Mountz, J. M., Krasnykh, V. N., Curiel, D. T., and Rogers, B. E. (2000). Simultaneous in vivo imaging of thymidine kinase and somatostatin receptor expression after gene transfer with an adenoviral vector encoding both genes. Mol. Ther. 1, S44. 25. Rogers, B. E., Zinn, K. R., and Buchsbaum, D. J. (2000). Gene transfer strategies for improv­ ing radiolabeled peptide imaging and therapy. Q. J. Nucl. Med. 44, 208-223. 26. Chaudhuri, T. R., Rogers, B. E., Buchsbaum, D. J., Mountz, J. M., and Zinn, K. R. (2001). A non-invasive reporter system to image adenoviral-mediated gene transfer to ovarian cancer xenografts. Gyn. Oncol. 83, 432-438. 27. Tjuvajev, J. G., Finn, R., Watanabe, K., Joshi, R., Oku, T., Kennedy, J., Beattie, B., Koutcher, J., Larson, S., and Blasberg, R. G. (1996). Noninvasive imaging of herpes virus thymidine kinase gene transfer and expression: A potential method for monitoring clinical gene therapy. Cancer Res. 56, 4087-4095. 28. Tjuvajev, J. G., Avril, N., Oku, T., Sasajima, T., Miyagawa, T., Joshi, R., Safer, M., Beat- tie, B., DiResta, G., Daghighian, F., Augensen, F., Koutcher, J., Zweit, J., Humm, J., Lar­ son, S. M., Finn, R., and Blasberg, R. (1998). Imaging herpes virus thymidine kinase gene transfer and expression by positron emission tomography. Cancer Res. 58, 4333-4341. 29. Gambhir, S. S., Barrio, J. R., Wu, L., Iyer, M., Namavari, M., Satyamurthy, N., Bauer, E., Parrish, C , MacLare, D. C , Borghei, A. R., Green, L. A., Sharfstein, S., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman, H. R. (1998). Imaging of adenoviral-directed herpes simplex virus type 1 thymidine kinase reporter gene expression in mice with radiolabeled ganciclovir. / . Nucl. Med. 39, 2003-2011. 30. Tjuvajev, J. G., Joshi, A., Callegari, J., Lindsley, L., Joshi, R., Balatoni, J., Finn, R., Lar­ son, S. M., Sadelain, M., and Blasberg, R. G. (1999). A general approach to the non-invasive 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 3 imaging of transgenes using cis-linked herpes simplex virus thymidine kinase. Neoplasia 1, 315-20. 31. Blasberg, R. G., and Tjuvajev, J. G. (1999). Herpes simplex virus thymidine kinase as a marker/reporter gene for PET imaging of gene therapy. Q. J. Nucl. Med. 43, 163-169. 32. Tjuvajev, J. G., Chen, S. H., Joshi, A., Joshi, R., Guo, Z. S., Balatoni, J., Ballon, D., Koutcher, J., Finn, R., Woo, S. L., and Blasberg, R. G. (1999). Imaging adenoviral-mediated herpes virus thymidine kinase gene transfer and expression in vivo. Cancer Res. 59, 5186-5193. 33. Hospers, G. A., Calogero, A., van Waarde, A., Doze, P., Vaalburg, W., Mulder, N. H., de Vries, E. F. (2000). Monitoring of herpes simplex virus thymidine kinase enzyme activity using positron emission tomography. Cancer Res. 60, 1488-1491. 34. Gambhir, S. S., Barrio, J. R., Phelps, M. E., Iyer, M,, Namavari, M., Satyamurthy, N., Wu, L., Green, L. A., Bauer, E., MacLaren, D. C., Nguyen, K., Berk, A. J., Cherry, S. R., and Herschman, H. R. (1999). Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 2333-2338. 35. Gambhir, S. S., Barrio, J. R., Herschman, H. R., and Phelps, M. E. (1999). Assays for noninvasive imaging of reporter gene expression. Nucl. Med. Biol. 26, 481-490. 36. Gambhir, S. S., Bauer, E., Black, M. E., Liang, Q., Kokoris, M. S., Barrio, J. R., Iyer, M., Namavari, M., Phelps, M. E., and Herschman, H. R. (2000). A mutant herpes simplex virus type 1 thymidine kinase reporter gene shows improved sensitivity for imaging reporter gene expression with positron emission tomography. Proc. Natl. Acad. Sci. USA 97, 2785-2790. 37. Gambhir, S. S., Herschman, H. R., Cherry, S. R., Barrio, J. R., Satyamurthy, N., Toyokuni, T., Phelps, M. E., Larson, S. M., Balatoni, J., Finn, R., Sadelain, M., Tjuvajev, J., and Blasberg, R. (2000). Imaging transgene expression with radionuclide imaging technologies. Neoplasia 2, 118-138. 38. Iyer, M., Barrio, J. R., Namavari, M., Bauer, E., Satyamurthy, N., Nguyen, K., Toyokuni, T., Phelps, M. E., Herschman, H. R., and Gambhir, S. S. (2001). 8-[18F] Fluoropenciclovir: an improved reporter probe for imaging HSVl-tk reporter gene expression in vivo using PET. / . Nucl. Med. 42, 96-105. 39. Hustinx, R., Shiue, C. Y., Alavi, A., McDonald, D., Shiue, G. G., Zhuang, H., Lanuti, M., Lambright, E., Karp, J. S., and Eck, S. L. (2001). Imaging in vivo herpes simplex virus thymi­ dine kinase gene transfer to tumour-bearing rodents using positron emission tomography and [18F]FHPG. Eur. J. Nucl. Med. 28, 5-12. 40. Yu, Y., Annala, A. J., Barrio, J. R., Toyokuni, T., Satyamurthy, N., Namavari, M., Cherry, S. R., Phelps, M. E., Herschman, H. R., and Gambhir, S. S. (2000). Repetitive, non­ invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Nat. Med. 6, 933-937. 41. MacLaren, D. C , Gambhir, S. S., Satyamurthy, N., Barrio, J. R., Sharfstein, S., Toyo­ kuni, T., Wu, L., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman, H. R. (1999). Repetitive, non-invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Gene Ther. 6, 785-791. 42. Ogawa, O., Umegaki, H., Ishiwata, K., Asai, Y., Ikari, H., Oda, K., Toyama, H., Ingram, D. K., Roth, G. S., Iguchi, A., and Senda, M. (2000). In vivo imaging of adenovirus- mediated over-expression of dopamine D2 receptors in rat striatum by positron emission tomography. Neuroreport 11, 743-748. 43. Boland, A., Ricard, M., Opolon, P., Bidart, J. M., Yeh, P., Filetti, S., Schlumberger, M., and Perricaudet, M. (2000). Adenovirus-mediated transfer of the thyroid sodium/iodide symporter gene into tumors

for a targeted radiotherapy. Cancer Res. 60, 3484-3492. 44. Jacobs, A., Tjuvajev, J. G., Dubrovin, M., Akhurst, T., Balatoni, J., Beattie, B., Joshi, R., Finn, R., Larson, S. M., Herrlinger, U., Pechan, P. A., Chiocca, E. A., Breakefield, X. O., and Blasberg, R. G. (2001). Positron emission tomography-based imaging of transgene 6 7 4 Zinn and Chaudhuri expression mediated by replication-conditional, oncolytic herpes simplex virus type 1 mutant vectors in vivo. Cancer Res. 61 , 2983-2995. 45. Zinn, K. R., Chaudhuri, T. R., Krasnykh, V. N., Buchsbaum, D. J., Belousova, N., Griz­ zle, W. E., Curiel, D. T., and Rogers, B. E. (in press). Dual imaging of somatostatin receptor and thymidine kinase after gene transfer v^ith a bicistronic adenovirus. Radiology. 46. Bousquet, C , Puente, E., Buscail, L., Vaysse, N., and Susini, C. (2001) Antiproliferative effect of somatostatin and analogs. Chemotherapy 47, 30-39. 47. Ferjoux, G., Bousquet, C., Cordelier, P., Benali, N., Lopez, F., Rochaix, P., Buscail, L., and Susini, C. (2000). Signal transduction of somatostatin receptors negatively controlling cell proliferation./. Physiol. Paris 94, 205-210. 48. Rochaix, P., Delesque, N., Esteve, J. P., Saint-Laurent, N., Voight, J. J., Vaysse, N., Susini, C , and Buscail, L. (1999). Gene therapy for pancreatic carcinoma: Local and distant antitumor effects after somatostatin receptor sst2 gene transfer. Hum. Gene Ther. 10, 995-1008. 49. Aran, J. M., Gottesman, M. M., and Pastan, L (1997). Construction and characterization of bicistronic retroviral vectors encoding the multidrug transporter and beta-galactosidase or green fluorescent protein. Cancer Gene Ther. 5, 195-206. 50. de Martin, R., Raidl, M., Hofer, E., and Binder, B. R. (1997). Adenovirus-mediated expres­ sion of green fluorescent protein. Gene Ther. 4, 493-495. 51. Meyer, K., Irminger, J. C , Moss, L. G., et al. (1977). Sorting human beta-cells consequent to targeted expression of green fluorescent protein. Diabetes 47, 1974-1977. 52. Cote, J., Bourget, L., Gamier, A., and Kamen, A. (1997). Study of adenovirus production in serum-free 293SF suspension culture by GFP-expression monitoring. Biotechnol. Prog. 13, 709-714. 53. Haseloff, J. (1999). GFP variants for multispectral imaging of living cells. Methods Cell Biol. 58 ,139-151 . 54. Stables, J., Scott, S., Brown, S., Roelant, C , Burns, D., Lee, M. G., and Rees, S. (1999). Development of a dual glow-signal firefly and renilla luciferase assay reagent for the analysis of G-protein coupled receptor signalling. / . Recept. Signal Transduct. Res. 19, 395-410. 55. Ramjiawan, B., Maiti, P., Aftanas, A., Kaplan, H., Fast, D., Mantsch, H. H., and Jack­ son, M. (2000). Non-invasive localization of tumors by immunofluorescence imaging using a single chain FV fragment of a human monoclonal antibody with broad cancer specificity. C^wc^r 89, 1134-1144. 56. Ballou, B., Fisher, G. W., Deng, J. S., Hakala, T. R., Srivastava, M., and Farkas, D. L. (1998). Cyanine fluorochrome-labeled antibodies in vivo: Assessment of tumor imaging using Cy3, Cy5, Cy5.5, and Cy7. Cancer Detect. Prev. 22, 251-257. 57. Ballou, B., Fisher, G. W., Hakala, T. R., and Farkas, D. L. (1997). Tumor detection and visualization using cyanine fluorochrome-labeled antibodies. Biotechnol. Prog. 13, 649-58. 58. Becker, A., Hessenius, C , Licha, K., Ebert, B., Sukowski, U., Semmler, W., Wiedenmann, B., and Grotzinger, C. (2001). Receptor-targeted optical imaging of tumors with near-infrared fluorescent ligands. Nat. Biotechnol. 19, 327-331. 59. Becker, A., Hessenius, C , Bhargava, S., Grotzinger, C , Licha, K., Schneider-Mergener, J., Wiedenmann, B., and Semmler, W. (2000). Cyanine dye labeled vasoactive intestinal peptide and somatostatin analog for optical detection of gastroenteropancreatic tumors. Ann. NY Acad. Sci. 921, 275-278. 60. Licha, K., Hessenius, C , Becker, A., Henklein, P., Bauer, M., Wisniewski, S., Wiedenmann, B., and Semmler, W. (2001). Synthesis, characterization, and biological properties of cyanine-labeled somatostatin analogues as receptor-targeted fluorescent probes. Bioconjug. Chem. 12, 44-50. 61. Weissleder, R., Tung, C. H., Mahmood, U., and Bogdanov, A. (1999). In vivo imaging of tumors with protease-activated near-infrared fluorescent probes. Nat. Biotechnol. 17, 375-378. 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 5 62. Mahmood, U., Tung, C.-H., Bogdanov, Jr., A., and Weissleder, R. (1999). Near-infrared optical imaging of protease activity for tumor detection. Radiology 213, 866-870. 63. Ntziachristos, V., Yodh, A. G., Schnail, M., and Chance, B. (2000). Concurrent MRI and diffuse optical tomography of breast after indocyanine green enhancement. Proc. Natl. Acad. Set. USA 97, 2767-2772. 64. Reynolds, J. S., Troy, T. L., Mayer, R. H., Thompson, A. B., Waters, D. J., Cornell, K. K., Snyder, P. W., and Seveck-Muraca, E. M. (1999). Imaging of spontaneous canine mammary tumors using fluorescence contrast agents. Photochem. Photohiol. 70, 87-94. 65. Gurfinkel, M., Thompson, A. B., Ralston, W., Troy, T. L., Moore, A. L., Moore, T. A., Gust, D. J., Tatman, D., Reynolds, J. S., Muggenburg, B., Nikula, K., Pandey, R., Mayer, R. H., Hawrysz, D. J., and Sevick-Muraca, E. M. (2000). Pharmacokinetics of ICG and HPPH for detection of normal and tumor tissue using fluorescence, near-infrared reflectance imaging. Photochem. Photohiol. 72, 94-102. 66. Rehemtulla, A., Stegman, L. D., Cardozo, S. J., Gupta, S., Hall, D. E. Contag, C. H., and Ross, B. D, (2000). Rapid and quantitative assessment of cancer treatment response using in vivo bioluminescence imaging. Neoplasia 2, 491-495. 67. Contag, P. R., Olomu, I. N., Stevenson, D. K., and Contag, C. H. (1998). Bioluminescent indicators in living mammals. Nat. Med. 4, 245-247. 68. Contag, C. H., Jenkins, D., Contag, P. R., and Negrin, R. S. (2000). Use of reporter genes for optical measurements of neoplastic disease in vivo. Neoplasia 2, 41-52 . 69. Lipshutz, G. S., Gruber, C. A., Cao, Y. A., Hardy, J., Contag, C. H., and Gaensler, K. M. L. (2001). In Utero delivery of adeno-associated viral vectors: Intraperitoneal gene transfer produces long-term expression. Mol. Ther. 3, 284-292. 70. Li, C. Y., Shan, S., Huang, Q., Braun, R. D., Lanzen, J., Hu, K., Lin, P., and Dew^hirst, M. W. (2000). Initial stages of tumor cell-induced angiogenesis: Evaluation via skin window chambers in rodent models. / . Natl. Cancer Inst. 92, 143-147. 71. Bennett, J., Duan, D., Engelhardt, J. F., and Maguire, A. M. (1997). Real-time, noninva­ sive in vivo assessment of adeno-associated virus-mediated retinal transduction. Invest. Ophthalmol. Vis. Sci. 38, 2857-2863. 72. Yang, M., Baranov, E., Jiang, P., Sun, F. X., Li, X. M., Li, L., Hasegawa, S., Bouvert, M., Al- Tuwaijri, M., Chishima, T., Shimada, H., Moossa, A. R., Penman, S., and Hoffman, R. M. (2000). Whole-body optical imaging of green fluorescent protein-expressing tumors and metastases. Proc. Natl. Acad. Sci. USA 97, 1206-1211. 73. Chishima, T., Miyagi, Y., Wang, X., Tan, Y., Shimada, H., Moosa, A. R., and Hoffman, R. M. (1997). Cancer invasion and micrometastasis visualized in live tissue by green fluorescent protein expression. Cancer Res. 57, 2042-2047. 74. Chishima, T., Miyagi, Y, Wang, X., Tan, Y., Shimada, H., Moosa, A. R., and Hoffman, R. M. (1997). Visualization of metastatic process by green fluorescent protein expression. Anticancer Res. 17, 2377-2384. 75. Chishima, T., Miyagi, Y., Wang, X., Li, L., Tan, Y., Baranov, E., Yang, M., Shimada, H., Moosa, A. R., and Hoffman, R. M. (1997). Use of histoculture and green fluorescent protein to visualize tumor cell host interaction. In Vitro Cell Dev. Biol. Anim. 33, 745-747. 76. Chishima, T., Miyagi, Y., Wang, X., Li, L., Tan, Y., Baranov, E., Yang, M., Shimada, H., Moosa, A. R., Penman, S., and Hoffman, R. M. (1997). Governing step of metastasis visu­ alized in vitro. Proc. Natl. Acad. Sci. USA 94, 11,573-11,576. 77. Yang, M., Hasewaga, S., Jiang, P., Wang, X., Tan, Y., Chishima, T., Shimada, H., Moosa, A. R., and Hoffman, R. M. (1998). Widespread skeletal metastatic potential of human lung cancer revealed by green fluorescent protein expression. Cancer Res. 58, 4217-4221. 78. Yang, M., Jiang, P., An, Z., Baranov, E., Li, L., Hasewaga, S., Al-Tuwaijri. M., Chishima, T., Shimada, H., Moosa, A. R., and Hoffman, R. M, (1999). Genetically fluorescent melanoma bone and organ metastasis models. Clin. Cancer Res. 5, 3549-3559. 6 7 6 Zinn and Chaudhuri 79. Yang, M., Baranov, E., Moosa, A. R., Penman, S., and Hoffman, R. M. (2000). Visualizing gene expression by whole-body fluorescence imaging. Proc. Natl. Acad. Set. USA 97, 12,278-12,282. 80. Pfeifer, A., Kessler, T., Yang, M., Baranov, E., Kootstra, N., Cheresh, D. A., Hoff­ man, R. M., and Verma, I. M. (2001). Transduction of liver cells by lentiviral vectors: analysis in living animals by fluorescence imaging. Mol. Ther. 3, 319-322. 81. Dardalhon, V., Noraz, N., Pollok, K., Rebouissou, C , Boyer, M., Bakker, A. Q., Spits, H., and Taylor, N. (1999). Green fluorescent protein as a stable marker of fibronectin-facilitated retroviral gene transfer in primary human T lymphocytes. Hum. Gene Ther. 10, 5-14. 82. Su, M. Y., Taylor,]. A., Villarreal, L. P., and Nalcioglu, O. (2000). Prediction of gene therapy-induced tumor size changes by the vascularity changes measured using dynamic contrast-enhanced MRI. Magn. Resort. Imaging 18, 311-7 . 83. Maron, A., Gustin, T., Le Roux, A., Mottet, I., Dedieu, J. P., Brion, J. P., Demeure, R., Perricaudet, M., and Octave, J. N. (1996). Gene therapy of rat C6 glioma using adenovirus- mediated transfer of the herpes simplex virus thymidine kinase gene: Long-term follow-up by magnetic resonance imaging. Gene Ther. 3, 315-322. 84. Maron, A., Gustin, T., Mottet, I., Demeure, R., and Octave, J. N. (1995). Ganciclovir medi­ ated regression of rat brain tumors expressing the herpes simplex virus thymidine kinase imaged by magnetic resonance. / . Neurooncol. 24, 259-65. 85. Chenevert, T. L., Stegman, L. D., Taylor, J. M., Robertson, P. L., Greenberg, H. S., Rehem- tulla. A., and Ross, B. D. (2000). Diffusion magnetic resonance imaging: an early surrogate marker of therapeutic efficacy in brain tumors. / . Natl. Cancer Inst. 92, 2029-2036. 86. Enochs, W. S., Petherick, P., Bogdanova, A., Mohr, U., and Weissleder, R. (1997). Param­ agnetic metal scavenging by melanin: MR imaging. Radiology 204, 417-423. 87. Weissleder, R., Simonova, M., Bogdanova, A., Bredow, S., Enochs, W. S., Bogdanov, A. (1997). MR imaging and scintigraphy of gene expression through melanin induction. Radiology 204, 425-429. 88. Weissleder, R., Moore, A., Mahmood, U., Bhorade, R., Benveniste, H., Chiocca, E. A., and Basilion, J. P. (2000). In vivo magnetic resonance imaging of transgene expression. Nat. Med. 6,351-355. 89. Moore, A., BasiUon, J. P., Chiocca, E. A., and Weissleder, R. (1998). Measuring transferrin receptor gene expression by NMR imaging. Biochim. Biophys. Acta 1402, 239-249. 90. Hogemann, D., Josephson, L., Weissleder, R., and Basilion, J. P. (2000). Improvement of MRI probes to allow efficient detection of gene expression. Bioconjug. Chem. 1, 941-946. 91. Bremer, C., and Weissleder, R. (2001). In vivo imaging of gene expression. Acad Radiol. 8, 15-23. 92. Louie, A. Y., Huber, M. M., Ahrens, E. T., Rothbacher, U., Moats, R., Jacobs, R. E., Eraser, S. E., and Meade, T. J. (2000). In vivo visualization of gene expression using magnetic resonance imaging. Nat. Biotechnol. 18, 321-325. 93. Stegman, L. D., Rehemtulla, A., Beattie, B., Kievit, E., Lawrence, T. S., Blasberg, R. G., Tjuvajev, J. G., and Ross, B. D. (1999). Noninvasive quantitation of cytosine deaminase transgene expression in human tumor xenografts with in vivo magnetic resonance spec­ troscopy. Froc. Natl. Acad. Sci. USA 96, 9821-9826. 94. Walter, G., Barton, E. R., and Sweeney, H. L. (2000). Noninvasive measurement of gene expression in skeletal muscle. Proc. Natl. Acad. Sci. USA 97, 5151-5155. 95. Auricchio, A., Zhou, R., Wilson, J. M., and Glickson, J. D. (2001). In vivo detection of gene expression in liver by ^^P nuclear magnetic resonance spectroscopy employing creatine kinase as a marker gene. Proc. Natl. Acad. Sci. USA 98, 5205-5210. 96. Partridge, E. E., and Barnes, M. N. (1999). Epithelial ovarian cancer: prevention, diagnosis, and treatment. CA Cancer]. Clin. 49, 297-320. 97. Greenlee, R. T., Murray, T., Bolden, S., and Wingo, P. A. (2000). Cancer statistics, 2000. CA Cancer]. Clin. 50, 7 -33 . 22 . Imaging Adenovirus-Mediated Gene Transfer 6 7 7 98. Landis, S. H., Murray, T., Bolden, S., and Wingo, P. A. (1999). Cancer statistics, 1999. CA Cancer J. C/m. 49, 8 -31 . 99. Wingo, P. A., Tong, T., and Bolden, S. (1995). Cancer statistics, 1995. CA Cancer J. Clin. 45, 8-30. 100. Kakuda, J. T., Stuntz, M. E., Vargas, H. I., and Khalkhali, I. (1999). Status of scintimam- mography and its relationship to other detection methods for breast cancer. Cancer Biother, Radiopharm. 14, 435-442. 101. Fiorca, P. A., and Roberts, W. S. (1996). Screening for ovarian cancer. Cancer Control 3, 120-129. 102. Ozalp, S.,

Yalcin, O. T., Polay, S., Asian, N., VardareH, E., and Adapinar, B. (1999). Diag­ nostic efficacy of the preoperative lymphoscintigraphy, Ga-67 scintigraphy and computed tomography for detection of lymph node metastasis in cases w îth ovarian or endometrial carcinoma. Acta Obstet. Gynecol. Scand. 78, 155-159. 103. Pisano, E. D., and Parham, C. A. (2000). Digital mammography, sestamibi breast scintig­ raphy, and positron emission tomography breast imaging. Radiol. Clin. North Am. 38, 861-869. 104. Varagnolo, L., Stokkel, M. P., Mazzi, U., and Pauwels, E. K. (2000). ^^F-labeled radiophar­ maceuticals for PET in oncology, excluding FDG. Nucl. Med. Biol. 27, 103-112. 105. Yasuda, D., Kubuta, M., Tajima, T., Umemura, S., Fujii, H., Takahashi, W., Ide, M., and Shohtsu, A. (1999). A small breast cancer detected by PET./pn. / . Clin. Oncol. 29, 387-389. 106. Sakorafas, G. H., and Tsiotou, A. G. (1999). Occult breast cancer: a challenge from a surgical perspective. Surg. Oncol. 8, 27 -33 . 107. Noh, D. Y., Yun, I.J., Kang, H. S., Kim, H. S., Chung, J. K., Lee, D. S., Lee, M. C , Moon,W. K., Youn, Y. K., Oh, S. K., and Choe, K. J. (1999). Detection of cancer in augmented breasts by positron emission tomography. Eur. J. Surg. 165, 847-851. 108. Wahl, R. L. (1998). Overview of the current status of PET in breast cancer imaging. Q. J. Nucl. Med. 42, 1-7. 109. Richter, M., Dschietzig, C , Romann, D., and Riedel, H. H. (1998). Initial experiences with radionuclide mammography at the Cottbus Carl-Thiem clinic. Zentralbl. Chir. 123, 49-52 . 110. Grab, D., Flock, F., Stohr, L, Nussle, K., Richer, A., Fenchel, S., Brambs, H. J., Reske, S. N., and Kreienberg, R. (2000). Classification of asymptomatic adnexal masses by ultrasound, magnetic resonance imaging, and positron emission tomography. Gynecol. Oncol. 77, 454-459. 111. Kubik-Huch, R. A., Dorffler,W., von Schulthess, G. K., Marincek, B., Kochli, O. R., Seifert, B., Haller, U., and Steinert, H. C. (2000). Value of (i^F)-FDG positron emission tomography, computed tomography, and magnetic resonance imaging in diagnosing primary and recurrent ovarian cancer. Eur. Radiol. 10, 761-767. 112. Tempany, C. M., Zou, K. H., Silverman, S. G., Brown, D. L., Kurtz, A. B., and McNeil, B. J. (2000). Staging of advanced ovarian cancer: Comparison of imaging modalities — Report from the Radiological Diagnostic Oncology Group. Radiology 215, 761-767. 113. Kurjak, A., Kupesic, S, Anic, T., and Kosuta, D. (2000). Three-dimensional ultrasound and power Doppler improve diagnosis of ovarian lesions. Gynecol. Oncol. 76, 28-32 . 114. Chaudhuri, T. R., Rogers, B. E., Mount, J. M., Partridge, E. E., and Zinn, K. R. (2001). Light-based imaging of GFP-positive ovarian cancer xenografts during therapy. Gynecol. Oncol. 82 ,581-589. 115. Roelvick, P. W., Lee, G. M., Einfeld, D. A., Kovesdi, L, Wickham, T. J. (1999). Identifi­ cation of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 86, 1568-1571. 116. Douglas, J. T., Miller, C. R., Kim, M., Dmitriev, I., Mikheeva, G., Krasnykh, V., Curiel, J. T. (1999). A system for the propagation of adenoviral vectors with genetically modified receptor specificities. Nat. Biotechnol. 17, 470-475. Chapter 1 , Figure 1 A cryo-EM reconstruction of Ad2 (17 A resolution) viewed along on icosahedral fivefold axis [32] and displayed with modeled full-length fibers. The penton base is shown in yellow, the fiber in green, and the rest of the capsid in blue. The fiber shafts are bent (5-15°) in random directions at a point ~90 A beyond the penton base. The fiber knobs shown are filtered representations of the crystal structure [7]. The scale bar is 100 A. 60 A Chapter 1 , Figure 3 The penton base (yellow) and reconstructed portion of the fiber (green) from a cryo-EM reconstruction of Ad2 (17 A resolution) [32]. The boundaries chosen for the two proteins are arbitrary. Note the five protrusions of the penton base, which are spaced by 60 A and surround the central fiber. Ad2 Ad12 B ^3 & Ad2 Ad12 d Z»RGD-«BI IB- 289 305 Chapter 1 , Figure 4 Cryo-EM reconstructions of Ad2 (left) and A d l 2 (right) at ~21 A resolution. (A) Ad capsids viewed along an icosahedral threefold axis. The penton base proteins at the icosahedral vertices are shown in yellow, the reconstructed portion of the flexible fibers are in green, and the remaining capsid density is in blue. (B) Side views of the external portion of the penton base contoured at a level corresponding to the strong capsid density. (C) Enlargements of a single penton base protrusion at hvo isosurface levels, one just above the noise (transparent red) and the other showing well-defined density (yellow). (D) The lengths of the variable regions flanking the RGD sequence (red) in Ad2 and A d l 2 are obtained from sequence alignment of five different Ad serotypes. The scale bars are 100 (A) and 25 (B and C) A. Reproduced with permission from Chiu efa/. [3]. 490 A Chapter 1 , Figure 6 A cryo-EM reconstruction of Ad2 (17 A resolution) [32] shown color coded by radial height with respect to the center of the particle. (A) The full reconstruction viewed along an icosahedral twofold axis. The scale bar is 100 A. (B) An enlarged rectangular section around the icosahedral twofold axis. The white ovals surround elongated density that has been assigned to polypeptide Ilia by cryo-EM difference mapping [61 ]. Note that the polypeptide Ilia density spans the full thickness of the capsid from the outer to the inner surface, but only the external portion is visible here. (C) The color scheme for the capsid density from blue at an inner radius of 326 A to red at an outer radius of 490 A. ^ p j , " . . . . ^ - . . .y >5: Chapter 1 , Figure 7 An enlarged circular section of a cryo-EM reconstruction of Ad2 (17 A resolution) [32] around an icosahedral fivefold axis. The white outlines indicate on the outer capsid surface the positions of trimeric density regions observed by cryo-EM difference mapping on the inner capsid surface [61 ]. This internal capsid density was assigned to polypeptide VI and is observed to bridge the bottoms of the five peripentonal hexons, the ring of hexons closest to the penton base. The color scheme is the same as in Fig. 6. Chapter 1 , Figure 8 An enlarged triangular section of a cryo-EM reconstruction of Ad2 (17 A resolution) [32] around an icosahedral threefold axis. (A) The triangular section includes roughly one-fifth of three pentons at the corners, roughly half of four hexons along each edge, and six complete hexons in the center of the facet. (B) The same section shown in (A) with white outlines around the density assigned by cryo-EM difference mapping to polypeptide IX on the outer capsid surface [61 ]. The color scheme is the same as in Fig. 6. Ad12 +avP5 proximal domain B Chapter 2, Figure 2 Cryo-electron microscopic visualization of the ay^5 integrin in association with adenovirus type 12 capsid. (A) Side- and top-surface views. (B) Slice planes through the integrin density perpendicular to an icosahedral fivefold symmetry axis. The heights of the slice planes are indicated by numbered lines in A. The color scheme for the individual proteins is as follows: blue (hexon), yellow (penton base), green (fiber), and red (integrin). Stronger density values are represented by darker shades, and weaker density values are represented by lighter shades. The black lines in slice 3 designate the boundary for the extracted model of one integrin proximal domain displayed in Fig. 3. The scale bars are 100 A. Reprinted with permission from Chiu et ol. [82]. Chapter 2 , Figure 3 Model for the interaction between the integrin proximal domain and the A d l 2 penton base protein. One-fifth of the integrin ring density is shown extracted along estimated boundaries to model the proximal domain of a single avp5 heterodimer, (A) The modeled proximal domain shown in association with the penton base protein. (B) The modeled proximal domain rotated ~90° with respect to the view in A to show the interaction with a single penton base protrusion. (C) The same view as in B but with the protrusion removed to reveal the RGD-binding cleft on the inner surface. The scale bars are 25 A. Reprinted with permission from Chiu etal. [82]. Chapter 6, Figure 9 Chromosomal localization of pIG.ElA.ElB in PER.C6 cells. Twenty-five- color COBRA-FISH with 24 human chromosome-specific painting probes combined with integrated plasmid probe DNA on PER.C6 metaphase chromosomes. One of three chromosomes 14 contains the integrated El construct; this chromosome is shown as an enlargement. HI Chapter 8 , Figure 2 Ad5 fiber knob trimer viewed along the threefold symmetry axis. Flexible loops localized on the surface of the molecule are indicated with two-letter codes, which specify the p-strands connected by a particular loop. The image was generated using X-ray crystallography data published by Xia etol. [89]. Reproduced with permission from [141]. NH2 Chapter 1 3 , Figure 1 (A) Schematic diagram of the three-dimensional structure of the Ad2 hexon monomer. Reprinted with permission from Roberts etol. [13]. PI and P2 represent the two basal p-barrel domains. The surface tower domain consists of loops L I , L2, and L4. The yellow regions in loops LI and L2 represent the variable regions exposed on the surface of the Ad2 hexon that encode type-specific neutralizing antigenic determinants [19]. FG2 NT Chapter 1 3 , Figure 1 (B) Schematic diagram of the three-dimensional structure of Ad5 hexon monomer. Reprinted with permission from Rux etai [11] ; DEI , F G l , and FG2 represent loop domains with type determinants located in DEI and F G l . The hexon base contains a small loop domain DE2 in addition to two other domains V I and V2, which are held apart by the VC or connector domain. NT represents the N terminus loop. Reprinted with permission from Academic Press. B D a y 3 p l . N . D a y 3 0 p l . N . Day 3 p I.N. Day 30 p I.N. CT ^^Vi-^. TNF-bp. ^^^:: ~'^:^ ^*%. Chapter 1 4 , Figure 3 Decreased inflammatory response and prolonged p-galactosidase expres­ sion in the lung after administration of soluble sTNFRl. Lung tissue from vehicle-treated control (CT) C57BL /6 -+ /+ mice and from mice treated with TNF-bp was examined 3 days and 30 days after intranasal (in) administration of AdCMVLacZ (1 x 10^° pfu). (A) Tissue fixed and stained with hema­ toxylin and eosin. (original magnification, x320) . (B) Frozen section prepared for analysis of p-Gal staining. Chapter 2 2 , Figure 5 Light-based imaging of GFP expression following gene transfer with an Ad vector. (A) Bright-field image of a mouse with a subcutaneous tumor on the flank; (B) fluorescent image of the same field for detecting GFP expression; (C) fused image combining A and B. The tumor was injected with an Ad encoding GFP 48 h earlier. The mouse was imaged with a fluorescent stereomicroscope. Chapter 2 2 , Figure 6 In vivo imaging of GFP-positive xenografts. (A) In vivo fluorescent image from outside abdominal wall of nude mouse implanted with 1 x 1 0 ^ GFP-positive SKOV3 cells 4 days earlier. Three tumors were visible, as labeled on the figures. (B) Fluorescence image after removal of abdominal wall and positioning to place all three ovarian tumors in the field; (C) bright field image of the same field shown in 6B; (D) fused fluorescence and bright field images of B and C; (E) higher magnification (x 100) of tumor 3; (F) fused fluorescence and bright field image of tumor 3. New blood vessels are visible as indicated by the arrows. Reprinted with permission from Chaudhuri efo/. [114].

  
    
         
  
    
         

 
    
         
     !" # !!"   $ % &'!( )'"*('+*)"(', -     &. /  % &'!) 01')'"*('+*)"('+ -     &. /   2 3   3   &45 +((" )1"")  .   46   -  7      8 .  .   - 2      8 -2    2  8 - 8 4 2 4 8  8    8 - 4    2     . 8       7 94-  2  -4   -  2  -  4   -   2  $ 3 -   . 2 - 8 ! #"8   4  8  -  2  4 4 .    2  - ': 7 :     2  - 4  4   $ 3 -   .7 -    - 2 -  ; 4   - 7  < -     +((#
  $  4 2  - 8   8  8 7   -4     - 8     2  -2 8  4   - 2    -  .   4   2  2 2   47 =  5 $ 7 > 8   8 $ 9 =  5 % 8   8 $
 4 5 =', ? 8   @ :> $A8 -B 8 $ 3 5 C '  8 4  38 -  - 5 D;: C  B $8 2 8 $
   '2 -- +*E)!((/EF " * ) + ! (   G-  -  2   4    4-     4  2         4  6    2    - 4      2   4  7  44    4 .        -4 7    2       -      .  2      .   4  6  .     2       .  2  2  7 32          2      2   4  -  7  -   - ' 4    - 7   2     4  -44 -  4  4 7   .  '  ' 8 2      4  - 4    -    H4 2 4   . 7 F       8 .  2  .        4       4 .  8 -   4 7  4  2  H4 .  7  ' 2    - -   7 F - 8 .    2  4      8 77   2 2    7   2  4     - 4 . -4  2 - '   - 4     7 F   4  2    -   -4  ' 2        -  4  -   7 F --  4  8       2  4 '   2     .  2   4    4    2   7 F - 4   -   -  7 $ >   7 %  2   4--  2 4 - 6    4 2  4-7

  F  -   - 4 .  2  4    24 4 7   8 - +((#  2 2    5
 27 97  7 7
  
        
          
                  !   "                                                #              $   
                      %                &   '(   

            ) 
                       *  
 
       
      +       
     +     
  ,            # 

    
             

                     

     ,         - .         "    ,              /     0  !   / 0!1          1                                       !      2          
  "
   - .         "   '     #               32     $                 
               !    +               !   4   
                 -    '    5678 
              9                          9          ,
- /    :      1          ,
            ,
!!               -            ;     
   !                       "       2             <   #                  <   $     =>                          !
      !         .   ?      !                        /          1   
  ! 9            '.    ! ,                      !             ).  ! '           ).    !!            #  3   !"                !#            '   
!$               
!                     !                ? .)+  !               ! ,      -          !       -     .      !            -   2              '+     !!      & @   /      1      )     ?     $     !" ,       -       )                "   % &   
"    , -&     -&     
 
"     , -&         "     , -& & 

  ,   "     , -& &    .)    #  % &  
 #      -& &    , 
 $
        %
 $              , 
 $              #
$              $(   
    $               


$                  

 $                 #

 $!            2         .)  < 

 
    '     

      2          #

  ,0-     2       

     2           
             2            
                 <  
 
      
              "   A
                 2   
               4 .   
                     !   
                 '
       .      '
 !     @              2   '


           
  '        0  
               -           <   
  ,          2    <   
              
           )           3    
                  
!                

"                )             2  
 #                    
 
 
         
             
                    #
       2                 
 
       

  9           

      )          *  3 
           )          *  3 
                *  3 
                :  : ".
    
     
      &     '(    +  
  
                 
 !
   
 !             .      ".  
 "
        

"                     

"                   
 "                    *  
 "                 3 .  
 "                    <  
 "                           2
 "!                  ,   
 ""           )           ?&  -,  
 #  
 #   -  
 # #  -  2-      '      # #  -  -       ? .     
   # 9             # B         -      -              # % ,     
 # , /     , :    1 B    
 #  , B     #  B . , B     #   ,  #  ," /,      " )  1   #       #!   CD /3-CD1  #" 9,  ##         2 /
,!1  #$ -                         E!     # =02>                  # 02           # )    #   )    $     #  <  0       2 /<0!1   #  < -             #!  <  0      2 /<0 1  #"       --    / -B01  ##  <  0           2 /<001  (    %               IF :     -  4 FF :    -    - 4       GG           5G: 7: GG8F  4   2   4   0!   J"+K 8 *1K 2' L . 4     - 2       '  -  24'       4227      2    . 0*7*  J 8 "! 0 L7     2 24'    422    '  - -4  . )*K7 %   +*K 2    422  24'     422 7    - . -2      4         - 2      4  4 7    - 2    .  2 JC 7 ! L5

 5 2 J!07!KL   2    -5 !)7!
C4'    422 5 )7(K

 5 4 J*+7 KL   2    -5 + 7
C4'    422 5 +*7+K

 5   J) 7)KL   2    -5 +#7
C4'    422 5 # 71K %   8     -4 2   .    !*7+K 2   8 4 0(K . -  - .    422 7 %  -    4 . -48 .  -  H4 8       4 2    7  G , @     3 G ,             
  GH                  !   "  5CD8 F    - . 2  JC 7 +L5

 5 2

 5   4

 5     H4 +'.   2 -'   .    (
       2  4--4     .    B  7     . 2      --      64      4 6 7            4    2   '  8  .   64    - 2     7   8  . 224  22 .  - +   - )   7 %2  - 2  4    . .    ' 2    8  .      - +   7 %2  - 2  4      

       !"  #$ %   


3 H        #$             & '(      & '(    & %' ) !"  #$     & '   ) !"  #$         &'   ) !"  #$      &%'  *   &+ ,%-.' / G , @        .     ' 2    8  . 2    - )   7 GC           5II: 7J8 F   M00N .      2 !1((  4   8     8  2 4 +!  -  *  -  2   ' 8 2     2    2 !7*K7       #+K 2 -7 92  2   5 .    24 2 4  2   2  2       48  4 -       7 C 4 22  - 2 424   .  JC 7 )L5
       4   .   '     '   J -   L
& 4  .  -'     '   J -L
& 4  . -'     '    .   '    '   J -L
& 4  . -'     '  8  -' '     '    .  '    ' '   J -L 3 C        0!  ,11* 23.  /         $    4 G6                5GGJ8 F A   7 M!!(N     - 2 4--4    +!!    4 -4 JC 7 *L5

     4-     2  -4  .  .  -  2     4-    2  -4    2     - 7 A 2H4 1K7

 5   -  .  . 8      4- '     2  4-     2  -47  .  -      .    4-     2  -47 A 2H4 )!K7

     .     .  -   7 A 2H4 *1K7 3 6      - G , @    

  5    .     7 CH4   .   -    -    4--4'   .   6    7 A 2H4 )K7

 5   - .     - %%% JL8      !  !     !   "  4     .       4-     2  -47 A 2H4 #K7

 5   "      ! 8 4     !   2  B   64 2      2     - 7 A 2H4 *K7  4   6  2  -4 .  2     - 2  8      -  47 %  '  8  . 
  .    -7      4   2H4 .  - %%8 %%%  %:7     HG           # 57I8 F )      
3 4  4 .       B 
 -  5 O+" 
922   5 44 8 3'
3  45 
5   )  !    
 -  5 +" *( 
922   5 2 B  4 8 2   
3  45 4 - . 
5    4  P 3     )  !        
 -  5 Q *( 
922   5   4P  -
3  45 -  
5     - 8    422 - 5 H       HH            $  5DK8
# " 
  $ 44 2  4--4      2  -
# "  %         
# "  &  !!    
# " ' &  !!      
           CG          %  5GCJ8F  4   .   2   2 '    7    2 2   .     2   2 8 .  - 4  22     2 2   7  8     '   -  2  2' 7 C4 8      4' 44 24 2   2   2      H4 227  4  - -     4  2     '        JC 7 "L5  6     2 -   2  2  4   2   4 2  7  - 2           '  -   8   2     2 -  '  7      2    4    ) 
   94  2  -8 4    -  -   8 .    2    2  2 2 7 %2  - 4   4  4   8  -  -' -   4   - 47  2   4 -'  .  2  2 2      2 4 7       -  2   - %%  '  8 .   .     -  2 2  7  2   4 -   4      - 7 3 C              3 K          
      7 A    8  -   8 . 2 8     47 )     94   -8 2    4 4     2  2 2 7  - 2  4    -   2 4      7 )     94   - -8 2   - 2  2   - 8 -  4  -  2 4      -- 2 '. 4    -- 2  - 7   28  -   4 4    ' -   44    -        47 %2  -   -2  4   8  ' 2 -     8    -    2 4  -47 3B  4 -7 A    8  -   2422 8  4 8 ' 2 8   4'    7  % $              7 A4-4 2  2 -    4  4  4   - -8 4 2   -'     7 A  -  .         - 7 % 6    4 4 .   -  2 48 4  4  '  4 2   . 4        - 4-  47    -  2   - %%%   7    48 2      4        4   2   7 94    - ' 8  - %%%     -   - %   7 %  -         2  2 2     -'      - 2  4 7 % 8  .8  - - 7   -   - 2    4 -    2  2   4 4  2    ' 4  4 ' 47 CH             &   '(    56C8 F /3 D1   )  2 -    4     --'  ) C  -   !  ) 3 4  48  4   )  2    -   -2     ,' '   2 #  !+ .   ) 3 4  4 -- . 4  4-  ) A - -  C              3 D $                  CC            )  5GD8 F ) ( " -  !7"         - 2   ) )     -5 )
    --  24   -   C6                      *   5LK8 )
 * 2 5 8    48    4 )
 + 2 5 8 - J-L8    4 )
 , 2 5    48    4 )
 - 2 5 

- 2  2    J 8  B 8   4 . 4  L 
        6G     +        5LG8 8' 6 9   
 2 B  4  . 2  2  .5 L         4  6    !)"
 7 L    2     B   4 '-4 6 7 L & 2                 '   .  4 -   2    2   P       . - '4    8 4'   8  8 -       4  8 . 4  7 :' )  9       2    .   4 2  .  4 '  7    64 .  2 4 64    4    8 '  644 24   24 2  4-- 7 6H    +      5GJ78   4  5
# "   94 5 !(  )# . & 22 .   .  & 22 . 22       4  &    .   %        24   2   4   '  / 6     +  
# "   !!  94 5 *  !+   F 4 -  2  
# "     94 5 "    +  +   -  4   2   C   4   2    P    4 4 2  4            - .   .    - 4 -24 - 8       - . 2   .  -  '   2  -24 - 7  22   . 44    4  2     5      22   8          7 6C ,            #  5GJC8   -4   -2    2 2 4  2      - 7
%  " $ - 44 - .     -  2  -     7     44     2  8     2   -       2      -  4      422   J -   L7  44  2   -      28 2   -    -  2       - 7 %2   -    48  -  -'   4 .   . 48 .  -4 4' 4 4       2   -4 4--  4-   -  -  4 2      - 7 '   - -    -  4  . 4  .   '  4 2 4 -4     4      4  -  2  7
%  " 8    4   8   8   8    4 4B     .    -  2    /% 8              ;   4  4  7    -   2     ' .  4      .   - .  4   -  7    - 2   -         2      - . -     2   7
%  " 8     -         4      +8 4  -  2    .       2    B7  4      -       -  8  .  7
%  " '8        -P  .8  -  2             . 7  4    -        -       +  )7
     KG            
 5GJI8 !L = 2   J 7 "7#L +L  - - 2       - )L  - - 2     2  - *L  - H4 2  4 2      "L  2     2  -             6 , 31. &+ 1'
#"   4-4 
#"     4   
#"     4--4 
#"  '  2  4--4  '2 2 2-4
#"  .  2 4--4  2-4
#"  /  2 4-48 4--48  2-4     2   '     2   - -   2 4  --   H47   4'  2    -248 . -     2   . 24 7 %      . 2   4-4   2-48       4 7 #"  0 %  4-4     4 '      7      4  4 4  2   .       2   7 #"  0 %    4     4  ' 4     4   -  2  4227 5 K         3 I          0                   & 
'*    &    '*      &    '*      &  ' #"  0 %  4--4  4    4--' 48 4        4 4 7 F  '  .   2   +8    )   4  4-  27 %2   !     8        4-  27 #"   '   .7   * J4--4   4-- '2 2  2-4L    " J4--4    2' -4L   -  8    224 2 -7 #"  /0  '422  4   4-48 4--' 48  2-47     .         -7  4            2 KH                     5KG: KC8 /3 L1
# *    B         4-4  8          2  -  
# +    B  4-    4    -     .  4--4  
# ,    B -     3  B  -       2  2-4          2   2 - -4 -   2  '   37 3 L     9       &+ ,4 * 4%.' 3 K         KC ,         - .         "  5CH8  4     8 . -   -8  4  2    %%% J-      & M 0NL7  2  .'  42  2   %%%  - -   4    -'  24'    422  J !L7 

     
    JC 7 M)*NL   . 42         2       -7    422       !( !+' 7
 1   -  J  )' -L    8 4 2 4-  2    4 2    2 7 4-' 2 2  2  4 -4     4  422 7
1     J) #' -L  .   4 2  422 4    '2 2   2   7
1         #   -   2 4-'   2    '2  4 2  422P  4 -' - 4 47     - -  .  )'     4   2  .    4  4  7 %     -8   2  2   .   4  4 7  ' 2    2   2  7   G ) !          '  ,       8 8     <%   :   
  = : :      %>-      % ?-       8 )    )* <  :   
  = :     0* >/     % #  * ?4  @ ) !   /        & '  4% 8              3 7 A            C4'         2  . '    7 9     

44 2    6
     !   "      4  422  - 7  2  &8  4     4  4 .  - 2  4  8       -4  7 ='  2     2 2 4  H4       4-     2   2      2 4  7 G 2  2  ' 2       2    422    2  ' -  2 2      4 4 7  K         K6 ,              /     0  !   / 0!1          1 5GHG8   4 32   -  %4    422 2      -8 -   4   4     -       2   7  -  '     2  422 .      5 * 2  4'  - 8 + 2  4'  - 648  , 2   -''   '   7    2      2 4  4    2 (  *7 0    4 42 4 42 3 3 - 8       )    &8  :   ' ( &  4228 .      2   4  4 % 8 4-2 4         -4 2    8  B P 44 O!  %% 4   24 2      422 2        8 48  -4 64 P 44 O+  %%%      422 64 8 4  2   
 2   28 2    .  42 2  422   J  2  4--4LP 44 O)  %: :  -    422   44  8   '    2   2   2   48  B    2  -         J - 4 4--4   4  J L   '%%%  '%: 7L  4-            : %      &'    3%  8  - 8 4   -44 . 4 3%%     J44 O+ L    -   2     422   .    2      3%%%   8  -        .  '   2     P 44 )  *  3%:      422    .       422 ' 8 2H4 .       2  '       2 '- 7  3%: 2'       2 .     8       -  2  - KK                 5HG8
  - 24     4  2  4--4
 4  .   )       
   . )  "   
  .   "    KD                  5I8
1   422  2 !    4       2   2  4  
1  5 422  2 !  )    2   2  4  
1   422  2 "   
1  '   422  .    422 2 / K         KI      2          
 5GJI8   2     4      2     7         4-5
  
 8   7  2 4  4-8 B      '  JL     4  J.  44 44 L8   -   2 47
1   -   24'4  4   !          7 9-8 -  7 4-2  7 8 24'4 
1   24'4  2  4--4
1   24'4         
1      .     1     4- 4  -   24'4  ' 4   ! 7  422  .    - 2 '  - 7  .8 24'4        '  .  2      2  --   ' H47    -   -8 .  4   2 24'  7   2 $ 4- %    -   7
 '  -    4  -  44 4  2  - 27 4  -8 .   8      44      7    4 4   2  -7  2  .   - 2     B 5 !L          4 4           8 B      2 '   4 B 7 4 -  #+K 2   7 F -'     4   4     2       J   B L8        '  - 7     H4 2         H4 4 4-- 7  -  4  2  .   8    -    .7  41               6 4 +L       8 .       ' - 8       4  -     2 4  7   4  2H4    4      7 4 2   H4  4-- 8  -    7 )L    -        2  4--4  4   !           4        .  2   7 1     4- 4  24'4 8 .  44    4--47    8 4      8  --  + 7  2 2    4'        4   4    7  2-4  8  4   4    '       -   -   -  44 -7 1  5    4-8 2           4--4 4    4-4  44  2-' 47     2   J*    L8   .  2   2  -8 -      2  4228 - .    - 2  -  4-     - 2  27   48  4      2  8  4 -         7  2   4    4  7 1         4-  B       4       2  4  7    4'     -8    4   -  '  . 2  6    4-    -    -  -  2   2  7    2   -  2 -8    - 4    7 - K         KL
   - .         "   '    5CC8  -  24 2 422 2   - 4   - 2     4 27     - 2   '  8          4 --  -4 2    4     47  4   2  - 2  2  4 7
,        4--4   JC 7 !(L7     -  '- 2        2  -        -   2  +  ) 7

 " !    5 4--4       4     422    .    2 -   JC 7 !(L   'B  4 2       - 4 .  4--4                 .     2  -  7   2       4     2 -4  .  4-4  4--4  7     2  ' -     .  8 .    4 '  6    2       4  .  '  7    42 4   7  422       -   2    - 4 2   4 ' 27     5 4--4     4  64  . 2-48  - 4     - JC 7 !(L7             2  4--' 4 .   2     .  64  2  4-'   2-4 27 %  '- 8   

 2  2-4       . '   7  - 2   4  --   2      4     7   '-      -   2  2-4     7  45 6        1    3 GJ 6                    0  '      0    9    #   '   &+ ,%%.' 5 K        

2      4 .   4--4  ' 2-4   7    2  2-4   28  -B    JC 7 !( L7  -B      - .    4--4   2-4                   -      .  ' 2-4    7      2  4-'  2' -4         2    7 %   8 -   2      44   4 64      4 . .  4 42 2       4      4-  4'     2  7  -   4 --'  2  4  4     - 2  422 27     8    8   4 '     . '4              -7
)    F  4    8    44 7 . '4   4     "    '    JC 7 !(L7     2  -  2 -   4' 7 K7               32    5C78

 5 -  

 5  -  2 4-- +"K 2  

 5  -  2 4-- "(K 2  

  5  - 4-4 2    4            #$ 2 KGJ                 
 5GJI8 /3 GG1
# " 5 -  4-        
# " 5 -  4-   2 4 
# " 5 -  4-   2   3 GG         *           9          *   *             *    %             KGG             !    + 5GHL8 F  A%   .  .  !  47  H4   .  -2    -' !'.  H4' '    JA5 *1( 8 =5 !+ 8 C:5 +"(
+"(8 5 )1(
"!+L7  4   - 2  4--4 48  4-   JAL 2  4--4 2    4   4 7    .     .  42 2  4 !   42     2  2  + JC 7 !+L7   H4'    .  B     4  4'   - 7   2  42 . .   8    8 AR!E+ . 4  4 7  2 4 .   2  4 - 2  ( J- 2 L  ! J24 2 L7  4 .    8 .  -4  4  4        2  -8 64    -    7  8   -     4-  - 2  2 7 %3 K         3 GH         $    !"   
)          (             3 GC          #$  4  - -   2  2  4--4   ' -    4-     4--4 2  JC 7 !)L7 %   2   . !7((  (7#( J " L8  4       
      7 :4 . (7#(  (7*( J " L 4 
   7 :4  . (7*( J " L  '        J +L7  4             #$ %   H B                       0      ;      33>3-3  #    3-3>3/3  )      <3/3 KGH             !   4   5G6H8 F       . -2    !7(' 7  H4 2 -  !'.  4 -' A%   J' -   MANE  M=N5 0((E!+ L -    4'  6  - .  7 C  H4 8   % 2     422 4    2  2  4-- . 4         .  -4 -     .   2  -4 JC 7 !*L7
 " # "  S4  2  - 2  4--4 45 C  H4 H4 4  2  - 2  4--4 4   -     .  4 7   J L . .  4   4-     2  -4 -   4-    2     JC 7 !* L7      . 2  '   J  L JC 7 !*8 2L .  4--4 4        7        H4   2 4  ' - .    -  47  4 8  4     4' --4 48 .     H4 2    - 2 7 % K         3 G6,M3 ,                                   8        !       !          &
'*    &'(   &'*  !     &/' #           &
'            7   &'  :    !  !             ! !   *        !                             "             &
'(     &'( !               &'(  !     &' ;  &  '            !            !           4 %              %% 3 G6 " 8 !  ! &  '   3 6     KGC                 -    '    5678 /3 GK1F   2 44  -      -   2 ' 48 .          44  - 8  3  -     . 4 -2    47 3 GK                  %/ K         4 2  4  422 4    4    '    -2  8 -4 .  3 8 4  '  2 2 44 2        -' 7
# " 3  -      -   48 . 4  2 
# "   4     2 
# "   2 2   - 8 4      4  2
# "     4 2  4
# " '   2  4  -
            DG 9                          9    5GCG8F  4  2'2 B  4  . 4  7 = - .   -     4  -47  4   -  ' -       4-   48     -  2 2  2   48    48   -   47 C 4  - 2   4   4 5

 5  2   - 2   .   -   48 .       4 JC 7 !#L

 5  .   -   48 4 .    ' 4      4 JC 7 !#L

 5 =H4  4      -   4 JC 7 !#L

  5       48 .    ' 4    -   4 JC 7 !# L   3 GD M   

!      *   !      !    #     ! !     %- D                 3 GD      "  !   !              !    
 #     ! !   *    !       !  DH     ,
- /    :      1    5GHH: GHC8F  
   2   64 2  4-  4 2  '    -        -    7

 5 2   2   2  2   2  4-  ' 47 ) +!K 2 
 7 )   2     -        4'  4  4   -   '     -'  JC 7 !0L7

 5  -     2  2   4-    47 ) G4   . 2  2    2  47 )     4       4 .       2  4-  4  4  ' 4 2  4 7 ) ""K 2 
  JC 7 !0L7  -     )0860  %1     3 GI   ! *     &)086' 0   )086 0   % )086 0   / )086 0 

 5 4'   2    4-  4 .  .   -   7 )  2  2 4  44     4'   2  4   8 4    -  . 8   4 2  4    7 ) A 8     4      24 .  2 2  2 4   H4   47 ) K 2 
  JC 7 !0L7

 '5  - )   .       -  7 )    -     H4  27 ) !(K 2 
  JC 7 !0 L7 %5 D               !   )086     28    - )  *     .   2  -  8   - +  7 F    4 8     2    - 
 - +  )   - +  *  7 DC     ,
       5LH8 F  4  -2        -  #) -7 2 8 #+K     2 .  2    2  '  M!++8 !+)N7  '  -   4   2 -  '4-  4 64     2   2    - -     M!++8 !+)N7  4  2   '    - 2 
 5

 4 5  H4   T 2 

 5   '2      4 4-   4  -  2  -   JC 7 !1L

 5  4 2-  2  4  -      -   -  JC 7 !1L

 5  4-  4'-   -           4   JC 7 !1L    3 GL 
)086   &# ' 
   &# '  
   &# '  -/ ) !  )086       # %2 D6    ,
!!      5LL8F   - %% 
         M!++8 !+)N '     2  -      6 4 2    .   4-    7  4      - 2  - %% 
       5
*  
 5  4-   - %% 
  JC 7 ! L
5   
 5 -  4-   - %% 
  JC 7 ! L
,   
 5      -    - %% 
  JC 7 ! L   3 G7 ) !   )086   !   8 6   !      /3 D               DK        - 5KL8 /  C1
6    
6   4  4
6   -  
6  '    .  -     C       0C:    4
 0         0C:  )086   >
8    )  !          D  &6'   0C: &6'   0C:  $    )  !   ! &E ' )       ) ! D        !   &E '            !    !         !     &  ' 0  !   !   
6    0C: &*   >    9'  --     !      / DD          ;     5G6J8   4    2     2  -   . ' 2  2  8 48  48    2   '   7 % 4          .  P     2      -   4  8   8 - 4  4          4 2    2 2 7 &8  2'    - .   B  2  -  2   '   2 4  2 -    2  -- -  7    !7 -    4 .    422  +7
 -     ! !7 44 
 - %5 4-  44 
 - %%5 4  -  -   2  
 - %%%5 44  2  .    4  2  4'  +7 9  
 - %5 48   . -  2 4-4
 - %%5 48   . 24'  2 4-4'     !7 4 4-4
 - %5 -
 - %%5  - +7 4-    J
 L
 - %5  2 2 
 - %%5  -  2 -    4-  4 2   
 - %%%5 U4' V  2 4-  4
 - %:5  4-  4  .     - / D               DI                      57H8 F
& 
3  2 
C 
4 4   
:4    
9  - 2 
4 2  DL       2             <  5K68F    F 2 44  2    -     -  E    -   2   .         7  22  - 2 -   44  .  B 5
# 7    4  2  4-   4    4  '  J778      L  -   -  8 4'     2  2     2  -          7  4-4  8 .     4 64  .  4-   4  8    P .  4     -7       '             -  -   2  4--4     4  8       8 .  2    2 2   -  7  -   4 2   - % 44    4    '  4      4 4     -   J778   2    4  4-   4 '    - 4-4 2  4--4  E  4-4          L7  -2               !   /%
#7   "       -  2   44      .        7 F   - 2  8    -      2       U V      2   4  7  4      2  4  2 2  4-4  7  2  4-2 J 4L -      2  2     -      -   '  .     -     44 -  7  -' -   2    - %% -   44    - 4-' 4 2  48 4-2   4 -   2  4-4 48  .  -          2   4  7   - %%  

   2   4-  2 2           7
)    !         24'    2   4   -    ' 4    4    -        2    -  8  .     447  -  ' - 2 -24     2  447 D7                  <  5K68F    F M"*N  - -   2   4-   -  -   24 2  -     7

  ) 87             !       %   -    -     -     -     4  7  - -   2  4-4'         4  8 -  ' -   2   6  -7 %    4-4 2      2  4-   4     '  4  7  -  8 8  -     . 2     -          2 2  4-4  7  -  2    // D                  8       -    4-' -4       24'7 %    .8  .8   4  2  4--4    ' .   7   - 2     -      4     - %% 44  4 -       7    4-2   2  4-4  8   2H4     2     4227    ' -   2     422   4      2    -     7 ) 87              9   2    -      -  4' -4     7 %   2 0( - . 4' 4      2    -  8  + - J)KL . 2 4  2     7

  )       !   "            !        -    .   2   4 2    .   4  7 %   .    2 4 '  8   2      -4-47  4-4      2       4  8     ' -    -    6  -  - 2 '   7   4  8  -    --      47 =- 2        6  - 4 .        2  447 G4  -  . '  2  4-4    4-' 4 P    8 -4 44   2  4-4'       .7 F   $ M!**N . . '     -  2    4-4 2  4-4 '     H47  4     2   .   2     4227 --  2 2       4   7  - 3     F  G         : /4 DGJ     =>          5L8 F : 4   2       4  C 7 +(7  ' 4  4-4   4 4-4 J%L . 4   2  $E 3  -8 C 7 +(P  2  $E 3  - . 4 4-4 J%L  8 C 7 +(P  4-4 J%L  .   2  $E 3  '     3 HJ 8       F  G                          !  !    !   &! '   #        &#C0'  #C0D8))    0      &+ : ,5.' /- D               -8 C 7 +(7 F   . 2  -     4          2  3   4 8 C 7 +( 7 DGG              5KH8F
1  5     2  4-   4   JC 7 +!L
1  5   2  4-   4    - 4'    2  4--4   JC 7 +!L     3 HG     6     &+ C!   ,4.' H   &)HC0'    H   )HC0              & "'  H  % )HC0         !      & #"'  H  / )HC0           & "'  !      & #"'  -            C!   /1
1  5    2    2  4-   4  '    - 42  2  4-4   JC 7 +!L
1  '5    2    2  4-   4  '    - 42  2  4--4   4-4'    JC 7 +! L !
     IG         .   ?     5DL8 -4   2       -   2  -4   - 2 -4            7  2       -  -  7 '       2 -  -4  '    .   -4    4   2    4'  4 7
 2       -4      2   -   2  -4 .  -' T       8     -4           .   -4 -7  '  - 2    8 .  -     - 2      -   7     -  2   - 2   -4     4    ' H4  4       2 2 7

   B  -  2  2    -4   7      -       4  '   JC 7 ++L7

   B  -  2     -4     -       4    JC 7 ++L7

   B  4-    2   -4  -  2  4-    -4    JC 7 ++L7 43 I           3 HH               *      !   &   '     *         !  &   '      & '         !  &   ' )          &$' &+ ,-5.' IH                        /          1   
 5H78F    2    4 2 !(1  4 8    - ' -  - 2   4        '  JC 7 +)L            - %  :%7  1   !     4    -  - 2   . -   2  4 7  .8 4 2 -   2'4    2' 2  -      4 247  B 2    4-   2  4-4 8 '   2   -  .   2 4 8     7         7 F          2            '      2  -4 47

 5 ) B             4'    JC 7 +)L ) .   )(7+K 2  -

 5 )       .     4   JC 7 +)L ) .   +7(*K 2  -

 5 ) .    7  4-  4-4        4  8   2  4-4   .     4   JC 7 +) L ) .   *(7#K 2  -

  5 )           2   4  ' P     4     JC 7 +)L ) .   7()K 2  -

 5 )        .     2   JC 7 +) 2L ) .   "7!K 2

 -

 5 )   -  2      JC 7 +) L ) .   !!7*K 2  - 4 I             3 HC            8                
  
  
  1%
        H     4% IC 9            '.   56D8 F $   7 M*#N 4     -     4 2    2 4    6  -4 2 *)    4 7   2 2   2     4   J $L     2  2   4   J%$L7        $ .    -4  4  .  22 -    .    2 -7  22     --         J  45 1#K      5 !*KL8 4      2     2 4 7  2 4  .      .    2 2  244 H44     2   '  4 - 2  7 4-4 2     - '  B  7  .  2  $  . *  +"  J   !*70 L7
         % #07*K  $   .  -4   .   8 .  )+7#K  .    J*  0  . L     '  - 2  4  .    2 -  ' .  4  7   2     44 2     2 +(           2  7 4' -48 .        .  -47   . -   2 4        2  7 4' -4 2       JC 7 +*L5
$   .  -4 )   )   4 ) 34
$ - 2   -4 ) -E   ) -E4 4/ I         3 H6 : 
     
   ! !          #HC0 A ! 9           9         9                !       !                      &*      ! !         *     !    9  *          ! ( !  !( %%  ( %%%   !*   
   ! !   &     '        ! ! 9   &+ ,/-.' !       %$       - 2  2   '    4   2     44 .   -    2 4 7  1%
        H     44 3 H6
       % ")7"K        - 2  48 .          $7 %    2 2  4   4       4 .   4  7 %  *#7"K  .  .  -- 8   4 2   .      7 %   J0KL   2 4  2  %$  -       4   . 4       2    447 %  4   %$      - 2  47 6  !    HC0    4 2  . 46     7   #+71K  4 . 2   P        . 4 4  2 4 447 % ) 7#K  .   . J;L8  +)7+K   4 J;;L7  .   2  J;;;L ' 2 -    JC 7 +*L7
&   J      -L
. -5   4 8        - .   
 -5 -   2 4      4    2      -   -4 4- I        I6 ,                     5LI8 F  4   2 4         4 ' 48  2  .5

 5 )   5     . -      -   4 JC 7 +"L ) .   ##K

 5 )  .  24 .     2    .    -   -     JC 7 +"L ) . -  0K

 5 )  '-- 4-    .  U  V    4      2    .  .' 2 4-   JC 7 +"L         .     -' -   2   4    .    4--   .  7  --    -   4-4      .      ) . 2 4  ! K

  5 )  - 2        -4   JC 7 +" L ) . 2 4  1K  14      !    )  C  41     3 HK                           *  *       *       !   ;                                           !   ;                                               !     * !             
*                    *   *     &+ ,51.' IK             ). 5GG78  4 2         -- 7  2 8 4   8  8    8 48 2H4 8     -       JC 7 +#L7 45 I        3 HD 8        ! &+ , 2.' ID '           ).   5KI: GG78F $ 4      .  - 4-7     -   -   2 --  +(
 4   2 . 2    4   8  4        -        -- 7 %    B -8   -          4   .     2  4      2 7   4     -   4-  2  .  2    2  J778    2  4'     4-     28 4       L7        --  8 4  8    4         2  7 %   -' 8 - 2    8      2 '   .  4  7 4     -24  4    -   4  7   . M!! N  - - + B -  2   4     2  .    5  11        !    ;  +  42
1  5 ( +"K   J  L
1  5 +" "(K J2  4    4-     L
1  5   "(K J2  4    4-       2    L II            #  3  577: GJJ8F % 4 - . 4    .     2        - -  5 J!L      2   4 -48 J+L 4 J 6  64 L8  J)L   -    6  -4 4  . 8 .  2 8  7 2 8  2  2 4      2  . J *L5 %7 45  64 %%7 45  6  64 %%%7 H4 5 -   64   6         " 
   8   H9 7  ; 7 (    0!  (  !  ! F  7 G( & 7 '             & ; !   !      '   )   B      B 7 7  ; 7  ;     &  * 0!

      '     @  7  &*    *  '(         7 (     !   7      $"         I  -3 I          6 &  ' " 
   8"  $  6 !   #      7        &*  & * 7    !*       * &  7  '    * '   * 0!    * 0      '   !   I     #              !     * !    IL            5GHI8     5L68 F  4  2    - --     B .  '    - 2  4  7    2   -  4  4       - .  4  4    ' 2   2 .    4-7  2  4-  B     2 2 48 '   -  2 4    4   7   4  2  - 44  2 4    4-4 2   4       8 . 2  2      7 C 8   4  2H4  4     7  -    4- 8  4    
+# J2  48 4  8 8  4  L8 
4           .  + '  8  #4   44 H4     7 %  -'    4   U   V7   4 6      B 22 2    2   4    - .      4 8  8     7 %      2 ' - 22 2      48 .   - -   6    7 9         2  4  .     4 8   '  8   8  .      2   -'  12         !    H!   - -     .    -    2  4 8 '  8      J.       4  '    L7 A- -   2  4  2  4   2   4    -   - 2    2    . 4  -4   7  '    -4   4     .   2 ' ' - 22 2  47      4   -4  2  -    7  -        4-     2 4 48   4  7  -  4   -    4      7 A 8 -   2     4228   2  2 7 %2  -   -2  8  2  2  - 2  -4 4    .  -4 27       4  4 2    4-   A% J2  48 4  8 8  8  2 L7 .  8     M1*N      4-  2  .  .7  U   V G  4        U   V  *)+&      .    *4  2 )4 '       -  +  7 &  -    4   4      ' -   - 7 %2 -       -4 -  -2  8 .    2  -4      7  -   4   '    6   4 7 I7            '    566: 6K: GGL8F  -     .  8  .      -'  8 4      4  4 7 2  4     4   4 2  4 '    -   4       2  2  4   7  22  2       2  . 2 5 !L 3       +L G    . 4  - - I        )L G    .  - *L 4    . 4  - "L 4    . 4    - #L G'  4    4   - 2  2  2    -24    '    -4        2  4'   .   - 7 9-  2     '   2  4     2         7   2   2     - J B  2   4 L     4     -  7  .8  -'     2  2  2    4  -   -7
, *          2   2   -  2 '  8  4   -  2 4- 8 '  8  -        -       2 7         8   7    '   -  2     - 7 %2    '  8   H4   22 2    -       2   7 %   8    4  224   424 7     '  .   J4       422  . 4-  4   L   H4      .   -   7 G4             7 ) , *    7  4-     2  4   - 2     .  4 42 2          - 2  4     -   J
L   - .   4   4     '  7    4  4 4  2  4-  44 7  4 2     2  4     422 2  2-4   - 2  4--4 7 %  4--48   2-48      2  4--4  4' -4     4  4-   7   2    4     0       12         !    H!   -% .   2   2  4   2    7 %  '  8 4  4-  44    -  -   2  - 2     422            -'   2  - 7 %  4 4 T -8 4-   44       '   - H47 ) , *     7    44    2   -   2  4'       2   2  2        4  -8 - 4  -  4               2    7 % 44     -4   - J3L   A%   .    4    4 '            -7    44  44      . 4 '    4   7  4 2    44     .' 7   -     44  . 4  - 4 -'  8        2  4-4 8  4' --4 8  2    2  2-4 4'    7     2  4-4    -  4-   44        4' 4 7 34  - 4  - 2  4--4   -4 -  6  2 .  2     4    6      6 - '  4  -       7 %  4 4 T -   J+((+L8    44    '  .  2 4 -  47 ) , *      7  -   44    2 -   -   2  4'       2   3  A%  .    4   7         2H4 4   ' .    .    - 2     .    4 6  7  -   44'       .   2   4  ' 2  F   '. 7   44    -/ I        - . 4     422 27  8   4   2 4  -   44    7 ) , *'   ! 7 %2  44  2   4   B    2

   2  44      2 7   4 2  48 4   64 8 - 8   H4    2 4   2  - 7 %2'  44  2 4  4  8 2     . -  64 8 44   . # . 4 ' .    . + 7 3  8 2  44  4  2     4  6  42 4    424  2 2  4   4  2  2  44 7 %2  44  4  4   ' 64   2  44    -  4  - -      7 44  4   4 2  4 2  '   8 .     4  4 7    - 2          4   47
, +       9    B  46   2    4 6      4 4     2 6    4 7 9   .     4' 7    -  4    4 7    - -  4  4  '   2  4 -         4   H4  2  - 7 4         2  2    2 22 2    -    2 2     .  -  2 --'  7  - -      .  2   ' 7      . 6    2 2  '   2  4  2  224    B     2 4  7 %2  4- 2    2           2 2    
 2  '   8    42  .    8 2      8    42  . 4    7  12         !    H!   -4 ) , +  $  9    !    3 8    4     4  6  4   2H4 4        8  2 8  4  -- B47    -    '       .  24 2  4       4   B 2     7         -    J3 !7!L 2    4   '      -  24 2  4      2    .  4 42 2    8 .  6  2    2  4      .    2 7  -       '  -  24  2 4      8 .   '  J 4 L  -  24  2 4  -     7 3-4    44P  '   422   7 %2  4   4     2 8  4  - 2  4   -7  4        2 .   -8      3     3 7 3          4   47         4  27  --   4   -  24   . 4   8  4  2   .  8    '   2       4 - - 2   '      - .   -     7      2      2 4 7 ) , +            7  G    . 4  -      2' H4 2  2 4  8  4 2  #(K 2  -'     4 4 T 4 7 =     64 .  2    H4  4   '  - 8   -24 44  2  .  4 -'   2  7  -   8   2    -  --  8     -  7    44     4 2      -   .    7 C     8  .8   ' - 4      $   $   - ' -- I            - 2  2   4  '   -7       4   J3 +7!L    2   4    -  4    . 4  -'  7       4   8  48       8    4  E   '          4       7 %   8  -  2  4    '      4  -   4  2      2    7   2  .   2       '   2   .    2   2  -4 48 .   -4    2    .  '   7
   . 4  -  - '   -4    J-   L   2H4  - 4  B 7   8    '   -4   8     -    '   4   -  24 J 4   L7   44    . 4  - 2  -4   7 %2  -     8  4 2   - -  4    - .   2 - -7 C 8 2        -  2  B 2  8     4  4          -  4       '  7 ) , +           7  G    .  -  4 2  -- '  )(K 2  - .     4 T 4 7  64  2   7 % 4   '   H4  4 8     4   -8  -24 44  2  .  2H4    -'2 -'   2 48  2' 7  -   2  ' 2  4 .   4         ' 4 8      7  -     .   -      -  -   --  8 4    7     44          12         !    H!   -1 -   .   - 7  .    '   2       . -- 7 %      - 4    - 8   - '        2  (
 4  44     --   -   7 %2  -        4    -8    2     -   .  - 7       4   J3 )7!L 2   2  -4 4   4    .  - 7          . 4  - 7 F 2   -'  8  -        -    '   4 4  7 %2       '     8  - 2     4    7 %   224    '   44 4 4  7  - 8   4 '   2   2  4     4  24      -7  -4  4      4     -  2  -4 4  4  7  '   2  -8 4   7
  '  .  -      7  2H4 8       B7  -   44   4      2         8 4     4  44   4    22  7  -   - 4'  2  -    -  7  44        8 4 -     7  -   -  2  -4  24   -        4  7   2   .  '    2   7 ) , +'            7  4    . 4  -     4    .  - 7  - 8  - -    .  2 64   - 7  64    . 2 422   .    4 7  -  4 . -       4 2 7        2  .  -5 I         4         4 8 .   4           7  -   8    -     

-  -   --  8   4   --       - 8        7    44P     2   4       0(
7  .   .  -  2         '  . -- 7 %2     - 8 4 46      -    2  -   2    2  8 4    . 4  - 4  4 47      4    . 4  -   -   2    -    . 4  - J3 *7!L7      -4     -7  ' 4   4    -    - 4  2247 -  2        -   H4   -  4 2    -   -7 4   4 -          -4 '  44      4        - 7 ) , +.           7  4    .  -     '      4    7   8  6  2    4      4    .  - 8 .  4       4 46 4    7  4  4    .  -  4 2  --  )(K 2   2  8 4 4    .  -  4 2    "K7   2  -      .   2 48 4     64  - 4 4    .  - 7
 2  2 .   - '  4       J 8 .L7  -    2 B  - 8 .  '         4 7   -     -     4  2   64'  12         !    H!   -2 8     8   6  7   -'    -   8 -  8  2 2 7  -      2  -   2  4        --     4  - 2  8 .  -     -   2 44     .7 44   4     7  '       44 8  4   -8  2H4     -247  -  '  8 -   8 -  8  2  .   . --     .           44      7      4    .  -  -   '   2    -       2  - J3 "7!L7       8 4  -4    - 4  .  2   '   8  -4 4 -48    7 3 '   2  4247    4    44    .  - 2   '   2   4  47 ) , +/                             2  2  8 . .  4    4'   .  4  4 8 - 4     4  48 4     4  24'     B  2  2  7       4 .   4         E  -    E  2  2 . 4  -   7  .8     4 2    -   .   4   4   . -   -  .   4 2 ' 4    4    -    4 2 '   7 F 8  -   .  -     4        .24  4   4 7   -8   4   4 2    ' 4  -  44  .     7  - 2 4' 4   4     . 4       .  -    47   4    2 13 I           44  -'27   4   4     . -   2 7 3  .     4  4      4     -   2 4 2  2 2 -8    2 24   -     -7  4 2         4  4   7  4   4   -  .   8  4 4      4 2 '  4 7  -     .  -   7 3  8    .  - .  2  2  4     424 - 7
, ,             - 2   4 .      4   .7  2  4-   - 2   4 .   422 4  4-  B       '     4   .7       4     '  4    4         2   2     4 7 % 28    4          4   448 4  -   2   4     .  4       2   4'  7     2   2  -7 %2 2 4'  8  -   -     2  6 P 2 8      - 7     4-   - 2 - . 422  4    4H4    4 44 J  4L  6 7          '    4  #7     4 -    2  4- 2 -     6   4          6  -  - 7  - 8   4 27 F24 '   4   4-  2  8 .     -  2  4   8 4 2 -  7   '   8  -  4        -  4  8 4   - 7  1 3         !    :   1 IGJ               5K: D8 F    2  4     2  .  4    -   A  &   -   -  4             " 5 
       *        :          "    .  . 2  -           2  44 8   -   7 %   -   2 '  .5 
                  *           :                   2   -       2  24       2  .    -  8 .  8 24'    ' - 7 %   . - 2   -7  '     4 2    2 4 H4  4  2     .  - .  -  H4 2   4    -  -  4  4 7  '      2    2   4   -2 2    2   4 - 47  -   2 4 42    2    -  24'     - 4    2    2   4 - 4  -  .         4 4-  2   44    7  '  2  2   -   4-      2  .5 1 I        
      )  2 4 ) 2  T 2 ) G4 4 ) &   4 -  *   ) & 4 ) 44     4 42 ) 3-4 24  ) &   4 - ) &  4     :          " ) & 4 ) & 44     4 42 ) 3-4 24  )   4 - ) 2   . -   4- %%  %%% .  2' 7 C4'  8  24  8 .  -    '      - 8 .         4 - .  4-7 C  -8   -  -   4- %%%     2 64 2     2  7  - .    4 4 - -   .   '  

4 4 42      - 7 --        2          -'  2 4    -   4-8             4 -  7   4 --   4   .  ' -- 7  .        -    - 2       - 4     24 7  4   -2  4    2            44 2 -  .  4  .   -   4-7 %  -   2 -    -   4-   .     . 6  7 F 4  ++)  4  .   2  . 4  4-   2    JC 7 +0L7  1             ! 1% 3 HI         ! &+ ,4.' IGG                 5IL8 /3 HL1
+ 9   )   !  " 24   4     B  .    4 . 4  2 -  '   7 ) #   5  -  2  4 2     8    2  2   4     4  7    4  2  ' 4 2       .   2   4 ' 7 )  !  5   4  24 2       .  2  4   2   ' 4  7
5    )      "  -  2  4   .  2   4   2     8  .  2   4     4- '  2   -4  J-  - 4L7 )     M!(*N5 -   2  4   2   4   2     -4  .   - 2   2      2  -  - 47 1/ I        3 HL             ! , ; :   6       " H08@    1             ! 14 )    5     . 4  2  4 2     8 4  2  4 2   2   4    -   2  2   4'    2   -4 7 ) $% 
  5 4  2  2   4   2     8  .  4  .  7
,   ) & !  5     -      -'  2   G 228  .  2   4        -4       47    -4 - 4   - 7  4  2  - ' -8  4   2 7 % .  2 4  - . 4  7 )           
 
5  '  4 28      2  2  2   4    -   -4 - 48  -'  .  8 2  - .   7 4 2 2  2   4       .   7 ) '    5 4   . 2   - 4    - .  .    2    447 ) ()   M!)0N5 4 4  2  2   4  8  4 2   . 4-4   7
1(*-  M!("N5          B    ' 4 . 4  7     4    4  4   - 4      7 1- I        IGH                ? .)+ 5GJL8  4       2  2 4 -   44 8  --           '   2 2 8 2   2  -   -   - 4   7   24 2  '  ' 2     4B 5
  
 ) *         ) ,  9      

      )  
   U V ) - $     4     ) * ;   2 4 2  2 -4   24  ,      4 -       8  4 2  --  "K 2    7 9 4   2  2   4 8  - '   2     4 8    4 2  J' B4    8   4 -     7       2 
     !  : 4 4 -   44     4- 2 - .  4     4  4  4   44   4   4   - 2 44  7 %   4- 2 -       -     4 6 7  8  2   4    4  1            ! 11 4    4  -      -7   2  -  4   -       4 2  .24   4 -   44 7 A .   - ' 4   7 4      4 2   -'  . -   44 8 .     .  - ' 4   8   .24   44   4 7 9-     2   - 8 4    . 24   22  J -    -L 4 2    -      44   4 7  . -     4- 2 -  -       4       -     7 4 '       4-     7     4- 2 -   4 - 4   8 4    4   -       7        4      -   4  - ' 7 %    4  -         -  2  4    - 7 =  - 4  2 - .   4 44   4       2  4  4-  4   4 2   4-8    -   44'  7   2      -  6  . 4 --   2   -       8 4   4   -4 -   8 .  2   -7 3  8
    4 --    2  -         -       22 -4  4  -   7          2  9 -   4 2   4 6     4'    4 2 4 -   44 7  B -      - -8      8   4'        -  4 2 4 -   4' 4 7 ,        2      4- 2 - . 4 -   44  ' H4 -      4 2 -  4    4 2    4 7 4       ' 15 I        4   2'4    4  4H4 -   '  7 4    2       4  '    4   -      4  4 - '   44 8 . 2 H4 4 -   44   4-      7   2  -48 48    422 4448      4  4 -   44'  7      2    4  2  -   -47    8 24  2   -4     -   4 6    2  4  7 G    -4  -   -4  7  - '  -4   4 -     -     4   -  B  4   -    7 9  -      2      422 4447      2   - . 4 -   4' 4    -4 4 -   -47  -   -4         4 2    4        -  8   -4  47
       . 4 -   44 P  .8      8     -' 4  4 4  J778    L7 H4 -   44       4       
  7  4    4  8      4    . 

 4  2 4- 7    .    2 -         4 -   44       7 %     4     -     2 .  -   4 22 2     -    7 #      
  -    2   4 6 7  4   4 -       -4    7
  2  4 4  -4 .     2 - .     -   24  4  7 % - . -4 .  2  -  2  4 '  8  4   4 2   -4   7 % - .  4      2 -4   24 8   4 .    4 2  -4      4 2 7  1 / 8       C)   12 IGC              5GJ8 /3 H71 F
  4 2    - 4
  4 2   2  4
 *     2 O +"K
 +     2 Q +"K 3 H7          &+ , 3.' IG6 ,      -         5G78 F 3   7 M! N 4    - - 4 4   -    4   4      4      )+ -7     '     - 5
1     2   4 42 .  8 4   4 '  8  4    7
1   4   4    7
1    2    2   4    7 53 I        IGK       -     .     5GL8 9    -   2   4    .  ' 4             2   - 5  .  4' 2   4   .     '   JC 7 )(L7  8 .     4'   2 (
8 2   4  .       )(
8  '   . 4         2    8   - . 4        - --   '  7  4  2   "" " : #      -'      2  2 -       .   4    24  -   2  4      8    '         2    JC 7 )(L7   "" " : #      -     2  2    8  -         .   4    24  -   2  4       JC 7 )(L8    .  U   - V 4 .      24  -   2  4     2  .  4  ' 4  JO0(
 4 L7 4  2  - 2     '    -          .    8    4   2  4 42   '   2  '         7 4  4        2    -  - ' 4      24  4' 27  3 CJ       C)     C)                     *       :   *   C>)             *      !                1 4       C)   5 3 CJ A C)         !    *        C)                     !     & ' B  C>)   &$' A  C)        !      &#' 3 CJ ; C)   & '  C )                                     *         B  C)   &$'       !     *   C)                  &#' &+ , 5.' 5 I         4 8 2   '  8    -   2   4   .  4   2 .       '   7   -    2     4 .   4    24  -  8 .  -     '   2 2 8  4 8     7  .8  4   2 4   '       .   4        2  8 .    24  -   2    -  .  8    4  2   0(
8 .     24  -  7 2 8 . 2     4- 2 '        7    2  '         -   2  4       .    '      7   4 .   4      2  4   .             '  2  4   .   4    7 C  -8   4     .    (
2  4 8   ' 4  -   2 (
 4  2    7 8  '         .       .     2   4  .        4-         .   4   4     7  2    J '      .      L         7 IGD            -   2              '+    5KJ8 F =    2   - 2  .   JC 7 )!L7
# " 5  2         -      8  8      .  -'  -    J   L7  2        44   -   2  7
# " 5          -- 2  4     %$ P        %$ '   7  %$   2     4 4  1 - )           !   5% 3 CG                4 -    J
  L7    -  4-  2       7
# " 5         -    -      2   44  .   2    7     .  . - 4       8  2   2 2 4  47
# " '5  2 4       H4 4-  7  '  -         2     - '  -- 2  4'   -  7 5/ I        IGI      & @   /      1      )     ?    5IC8  $    5DD8    2     4      8 -   8  -      - 8    .  . 2     4  -   2   2 2 4  4-7
1   )
4 -  ) & 
1   )
  4 2     -4  4 )    -  7 % 7 4 
1   )
  4 2 B   4  - )    -  7 % 7 4 
1   )
4  J4L ) & -  H       .   44      4  -   . -4 - - 8 4     4 6   7 %-    -  ' B  4     4  6 7 %   44  ' P  .8   8  .  -   - - .  --   47 4   4   8  .8  -     .      1 1

      7 D   54  47 =  4      6 7 '   - 2         2    4   4   4     7  4'   - 2  4 4 2 2 8 2 8    2  4  47 %   8 44      )"  2  8     -     2   -  8   .       8    -  4-   4-  42 2     4227       2 4  -  .     2        4    .    '   -           8 .   - 7 F  2      .  4  4 6 8  .8  -       4  '     - -   -       -   J$ 4- %% 8 %%% L7 H     4 2 -  .     4   -' 4    48     - - '  J44 L .     4  -  J$ 4- %% L 8    8     -  J$ 4- %%L 2  -   4-        4 42 2     4227  - 8    . 4  -   -  B    4-  . -   7     8   - .  -  - - -    4-  . -   7 4 2  4   -  8       2 - 2  2  J4   -- L .  --  '  47 F      4     8  .8    2 -     4    4 8 4 '       2 - 7 G2 4 8    4     - 2'      -248   -    4   2  4  7   - 2     -248    2         8 ' 4  2     2  2   4    -8      J44 L 2  4  7 5- I               .  4      4  4 42    422 2   -  4-        - .  -  J$ 4- %%L7 %   - .    4  -  J$ 4- %% L8   - 2   . 4  4    8 2 8 '   -- .           7 H      B   4  -  8   ' 48   - -  4 6   .   '  - 7 4 2  B   4  8  -     -  2   .8 8  ' -'-  6 8  .     -   4 4   2 7  .   -  $ 4- %%8   .  - . -   8  - J4   --'  L .  --   47 F      4'   -2  8  -   .  --   4     4       4 -  7  '   4   2     4  '  JH4 28  -  4    8 .  E2          2  L7  '  - 2    4  4    -- 2     2  2   4    -8  4  2    6  -48 4 . 4      2      7  4    44   .  -4 8   - 42    - '  ' 4   7     4 42 422  4' -   2  J$ 4- %%%L8     2  4        2 4 J$ 4- %%% L       .   4    7 H  
   4- 2    - -4 -  4 6   8 4     2 - 7  - 44     2    4    - 4     4 6  44     7 G   8      4   - 2  4  64 .  . P  .'  1 5 8       !   51 8 4 4   4 .     2 24   8    4 4     .   - 7   44    -  2  7   -8 -- 8    .  --   4   - 2 2   -  .      47 G'  8   .    4    4'  6   J  2  L7 3   - 2   4        4228 4 .        J   L8   44    4  7 2      -4 -   - 8       -    4 7 IGL ,       -       )               5G68 F   2  - -   - 4 2 !(( - .    2  -4   4     . 4        5    8  4    4 2  %$7         JC 7 )+L       -  2   2  4  4    8  4  ' 4 5 +    !  
 

     . -  2 2  J"+KL5  '  2  4  4     B  3 J KL  39 J!)KL  39 J)(KL JC 7 )+L7
      
           '   2     2  - J
 L  2  * . -  +#K 2  J 7   L7      2   .  39 J!#KL   3 J!(KL JC 7 )+L7
      
         J   7   L  2  8 .   1K 2 7      2   . 39= J+KL  39= J#KL JC 7 )+ L7 55 I       


     
 8 . 4-   -   '     B  8 8 38 98 =  C8 . -  #K 2  7      2   .  39= J!KL8  39=C J)KL8  3=C J+KL JC 7 )+L7

      5 % 1K 2  8  -4 ' '         . 2 4 7 %  8  .    -48    2 -4  JC 7 )+ 2L7 +       F  4      -    2 -4 ' '  4   JC 7 )+ L5   <= 3=    3 CH     & '  F: G    )    &  )086  '  6          &    '  ; :    &!   !  '  1 5 8       !   52    3 CH 0     )   &HC0       '  @ !   &HC0       J     ' &    &HC0           J      ' .    &             ' 23 I       
 
        8 . 4   '  4    8 .    2H4  7 %  8    .  .   U1V J1 L7  -4    .           JC 7 )+L7
!
           
            " %  8    .  .   U1>(V J1  > ( "  L7       '  4   .           JC 7 )+ L7
!
                  # 
            " %  8     .   1>(>: J"  >  "  >   L7        4   7         .           JC 7 )+ 6L7
!        $     
   
 " %  8    .  .   U(V

J "   L7  -4    .       U '  4  V JC 7 )+L7       4  2 5      39E$8 2  -8  -      2  4    ' 2  -8 .            '     8 7 "   % &   LG    , -&     -&     
 5CG: HL8 F 2  2 .         2  '       2     7       2     .   4     ' 4 6    2  4  -    -   JC 7 ))L7  ' 4 -  2    . 4 ' P   2   2   -8  2 .  -2 24 JC 7 ))L5

 5    4-    .    4 2 '      2    7      2    -    4 427  - 2    ' 4 6    ..  . P      2  !(  ++
8 .       !#
7     2    - 2   4 6     2 2   '     ..  4. 7      2  (  !(
8 .       07"
7

        2     2   2            - !7  8       4       4  7  - 2    ' 4 6  2      .         - !P       +#7!
7 2     2 4  2   4 2  8 .    2       2   2   4   - !7    2  - 2   4 6     8 .      4 !(7
7

 5    4-  4  2       4 2     7 %      4   4  8 -     - 4 4 427   2 2 L ,     &  3 CC @                                                             *    7  !             5     87          2%   4  2         2       - !  +7  - 2    4 6     2  2    B 8       )#7!
P     8  - 2   4 6  2       2 !)7
.  7 %    2   - !   - )    2  - 2      4    4 6   - '  8 .  B 2   2   2   4 ' 7 2  ## - 4  +0 J*!KL .  - !8 )+ J*1KL .  - +8  0 J!!KL .  - )7       ' 2  --  .  .    4 2  '  - . -24   4 6  4         2    - 2 P  . 2 4    6  2  - -   2   - !7 %2 --    - !  - 2  6   4  4       2     4 42 2   .  - 2 7  8  4 42 2  6    - !      2   .  -8 .     2   - -   4       7 LH     , -&        5GH78F   2  4  .  22  - 2  2 4 '   4 64       -   4     4  7  64  -         2   4- 7  2      -'  . *  . !( 7  64  2          2 ' 64    7       4 2 - 2    447
1  5  4     4  2    4'  6   .   -8 . 8     B   6  27      2        4   2 -        7 2/ L ,     &
1  5    B -8 .   8      4    2    7  4  2     H4 - 7 A          H4 JB'.L  .    4 6    -'  --   2P  8    - -  4  2    4- '2  - 2  6    - .     7 %   8   .  2    2     4-  - 2     -    J 8  - .     L7  -'   -  2       -B   7 F 4      -8 4     2 2  '     2 64     4 7
1  5  64  .   2  2  4  2   . - 4    -    4-. 7   44    -7 A     . ' 2 -  2    4 6 8    2    -P 4   - 8   .  -  2    4  -7           -B       -  7 LC     , -& &    ,  5G8 32      2    4 -      2   2  64  7
1   - 2    4 6    4 2   2  .   2. 2 2    4    -4   7     2    4 6 7
  48  4  -    44        4 6 7         '  8 4     . 4-  2   4  '   2  7
1   - JC 7 )*L  44  4 2    2  . 4 4-4 2  -4    4  7  64 2H4  2    44 7    4-4 2    4  7
      '  5%     87 7     8 24   3 C6 8            7 &    ' 8            7 &  ' B     4 6 8    -   6 8 2H4 4 2  7 A               8 4      44    .  2  8  . ..   --   7 F    4'6  64  4- 8      2    4  .  !('  !"'- 4 .  4-  2   .  4  4    . '4-7 2- L ,     &
1   - 2    4 6  JC 7 )*L  44  4 2   2  . 4-4 2      4    4  7  64 2H4  2      7
           ' 4 6   44     2     '   - 7 92    48     2     --   7      8    2       4-  42 2    8    .       -    7 -    4    2 -   - 2    2  7   2 64  44    .     2  P  .8  64  4 2   2   -  4-  - 2   4 7      2H4   48       8       .  4-. -7 L6     , -& &    .)   5GGK8 A .  2  2       7 M!+ N     - %:8 :  :%    2  - ) 64       7  - ! 4- 

 - )       T 2 7   2 U -V   4       ' 7  .8    2   6  2  - %:8 :8  :% 64  -8      -     2  '4  - %%%       -  8   4 2   7   2 2   '   2  .7

  - 2   4     4 6   3  4    9   -B4 4   5/     87 7     $    21

    4 6  4-   4 6  . 5       -  .  - .     4  - 2    4   3  4 -       9   -B4 4 

    4   4-   4 6       4   - ' - 2  3  4   4- 3  4 - +"  !((K       4  9   -B4 4 44  2         *** + " U
4   V  4   -  
  64 3   -  24

     4   4-   4 6        - -      4   -B4 4 3  4    - 4- 3  4 -   - 8 4          4  9   -B4 4  2    

    4   4- 3  4   4-   4 6       - .     -4 J778 !((  )((K       4 L 9   -B4 4  2    2 2   25 L ,     &

    4   4- 3  4   4-  4    -    4   -   4 6      - 2           -  3  4 -    4    - J778  2       L8     4   - J778  2      L 9   -B4 4  2         2    -  2   4  - 4       2 2    4  7     8     4 6    JC 7 )"L7      2    -  2   4     4   4-' 4    2    4 6  JC 7 )"L7    2    4    B  - J778  - '  L8 4  J778 4- 2 L   -  4 2   3 CK       7        7   7     & '                                 8       & '                      * !           5/     87 7     $    22    3 CK E      & '             !                      
7           * !                          9    8   & '                           * !               7  !                                              !  !                         4  7  -4      8 - 4  .  2    4 6 7      8  4-. - 2    2   '        2    4  7 33 L ,     &   F   2   --   -  2   4 8 U -V   4    47 %  UV  - %%% 64 8    4    4    4- JC 7 )"L7    --   - 4-    -4'    4   -  - 2   7     -' B4 4   2    7  
  28  - -  2  4 42 2          -   - 4-  2  '   4    4  7 3    '    4   2  -   4  '  7 A  -  - 2   4 ' -  4-  .         4 ' -7  64    2 '  - %  %% 64  .  --      4 6          .   4 -   - 4-   4      4     -  7  -  2  B  64       ' 4       -  7 &  -     2 4   2  4 24  4  2    2    4  7   4  .   4  -    ' -B  -  2 -      -  7      2   - %%% 64    - -  2    4 4 42   .  24 2     - 7     4   64 7  '  2 64 2   U-  V   4 4  .   '     2   . 2    7 %   2  -  8  - 4 . - -7  -    -   2    '  2      4        - '  24 .    4  7 A4         4-7 2 8   4      -'  7  28     -  24  4'  5/     87 7     $    3 7  .8 .   4   .     2 '      2 -   2    2 7   6          -     2    4   2 -7   H4 -  4    2 7  

     2    2  8   - %:  '  4   8   7    -   -    4   -B4 4   2  --        -4    2  JC 7 )" L7
  4 -          -   - 2   4     7  4  '  -     4        2  '    - 7 -  4    J778     4   4   L    64    - ' -    47 F  64  4     2  -     - %:   4      .     4   7  4   -  2    4  4  2  - .   4 6  64 . -4 2 -    4 6 7 
 - :   4             2   - %%% 64 7      -- 2    2'4  J778   4  8   4'   8    -B4 4 L   44'  4    2   JC 7 )"L7 F   . 4' -  - 2   .  4 --  -4 2  '     48   ..  - 2   - 4   H4 2 4  2   4 7 
 %2     2      - :%   4   8       64 7  64  2  4 2  4   2H4  -  4- 647 3 L ,     &   2      4      - 4       2  8   .   2  ' -47    4-   4    4      JC 7 )" 2L7 %  -   2

4     8            6   7  '   4    4-    4   4'      7    4  8  .8     4       - 4-   4     7 .8    2     -B4 4  -      2 4 -7 #  % *   7G      -& &    ,  5G8    64   -4     4      4  8   7
 1   - 2   4 6  4 2       2  --    - 2     4  2 2    4   4  2  2 . 7     2  6 8  -  47
 1   - 2   4 6   B  4-4 2   4   . 4 4-4 2   ' 4  7
  . 44   B   6 8   2    -7
1   - 2  6    - 4-4 2   ' 4    4   JC 7 )#L7  -       7 G4 -  .    -  4   $  %% -   2     - 7 3 CD 8          7 3/ 7      $ A     2   4   -   4 2   4  -  2 4  8 -  ' 8    2      47 $
        % GJG              ,  5G8 C4 2          4-5
1  5 24 2     8    2H4 
1  5 24      4  8 .  4   2H4
1  5 24 2  -   2  8 . ' -   4    1  5   
        2 64    2   4    2   -  2   4 7 F   -8  -  2  2   44      4  .   2   - ..  . 7   -8 . 8  -  -   24 7 A  '  44  2    P  .8    2 ' -8  24   224  4B7 %2 -  -  24  4  -4   4   -          - 7 1  5          
 C4 2        4      -4  2  2  47  4    ' 4   -               2   24 2  8  .  2 4' 2'          7 & M "N  2 24 2    2    .  -7 3- GJ            1  5    %
     C4 2    2    2H48  2    4         4 2 ' 8      -7   2 64 44'      --     2     7 GJH              # 57K:GJG:GJD8F & 2  4 24    4-5 !7  4 245    J1(KL JC 7 )0 2L +7 C4 2   5    4 24 J!"KL )7 C4 2   5   J"KL -   !     - !(K 2 4 64    ' 2  .  -8 -  4-   4 2    JC 7 )0L7
    -   H4    7 % 4   2H4   2 ) 5 !7  24  2  -'  
        .   4    - 4 ' 8 - .  -   4-7 = H4 .  2  47   2 4 - 2      4 7 !7  ,
  7   4-    4  2    .      2     -     7 %-   2  4    7      -  -      2  2 JC 7 )0L7 +7 .     
7   -4    8  4 2 ' 8      -B      '  8  -4 ..  2 . JC 7 )0L7 )7 !
     
  7  -  4 2     .  - 2   7 *7   
7  -4       4 2   4  *(
.   2  7 &   '   2    2  4 4    7  3               ; 31      4 64      -  24 2  4--    +"K 2  7   8     -   4  .7 A 24 4 2   ' - 2  44  -4     .7    3 CI M $                    &'(          )*(                                        7       !                 *        !    !   9              !                                 7             !          35 GJ              3 CIM                     (                 (              !             9                  8            7        #      & ' +                !            !    7             !                  &$'  3%            32 4 2  22    4 & M "8 !(!8 !(#N 4    24 2     ! #1   22  - JC 7 )0 L5

 5  - .   

 5 - .  2    2   - '  2 

 5 24 2  4 42          - % 24 .  -    8 ' H4    8       - 4 7          - %%8 - 8 24  48 4    4     2   -  2 7  -  2 '    4-.  . .  4 2  ' -B4 48 .   2   - ..  2 .         2  -47          - %%% 248   2  4 42 %2  8 2' H4    -    8  -- 4 2  4   4-- 8    2  .   '  -  2   2   7 A -  2  4 42     U. 2T V     -8 .  -  48 . &   - 4  2' 4 2  4 42 2   - JC 7 )0L7 GJC              $(    5DH8 %     2  8 ?W    -  &T 2  2  4 24 JC 7 )1L7  - % -   24 . 4   4 64 .  . 4   2  3'6  JL7 3 GJ               4 24 .  4  5  - %%5 . 4  2  -     2   -  2 '  J4L  - %%5 .   4  2  - -B   2    2  J  4L  - %%%5 24        4  8 4     2    - %:5 -4   5 -  -  4  64 4 2  -  7 3 CL

             &+ ,-.'            *               7 & !'               *  !   !           9 *     &   !'                    
    7                 &    '  3/              GJ6                5H68    2 T 2  3  4  ! (     2  2 4 24  .    '  24 -  .      4- 2 T  24 2 5
1  5 24 2    
1  5 24 2    )  *5  - J  4L )  **5 -      24       ' 4    3    -B    3    8 -B   )  **" 24 2  4 42 )  *+5      - 4 J L8 . ' - 2  -  2  )  +5  4 8 .     -     8 4   2 8  4 2 7
1  5 24 2  -   )  *5  - )  **5 - J  4-4 L )  ***5 4 )  *+5 --  -  J   4  4L )  +5  4 1   248  24 2     8      '   24    4   7  4   -   .       2     2   -    7  2  2  4 - 2  .  4 2    -     47 %   8  -      2     4    4 44  44 8 .  '      27  24  4 2  1(K 2 4'  247  GJ            1   24  4 2  !+  !"K8 2  4 24   42         2    4  '     24 2 7 & M 1N 2 -  4  -  2  24 . 4       -7  * 24           2 * 5 !7 %  248  '        2     -  '  8  8   2 -7  24    '  4 24  4 .       -B   .    4    4   JC 7 ) L7 %  **  4 248    4     2      7       -B       2  J**L JC 7 ) L8          4-4 .  -B           J** L JC 7 ) L7     24  22 .  . 247     2  4    2' 4             24 7  24  H4    4   4 -   .             2  -4       7 C 4 2    -      4 2    -      2  4     245 J!L .  -  8  4 2 8 .    2  -B      -4  4      4    -4 ..  2 .   .  2  P J+L  -  6 8 -   8  4  .     ..    8  4   P J)L  -4     '          P  J*L  -B4 4  4-    4 .   2   .   '   4       8   4   .  4   4-   -   8 2   4 2  -B4 47  ***  4 24    4 42 2    4 6    JC 7 ) L7  4   - %% 24   4  8  - %%% 24  B      4 42 . 4    4 64 7   - %%% 64   48    24 .  2'     ' 4 - 8   H4 - .  4B7 %  8   3/              %      3 C7                          &  '                     8 !     9        *      *        *      :                     *     9                                          7  ;                              7  8 
           !   F    G       7             !      *                        !    !     &+ ,/.' / GJ            28  2     6    2    ' 4 6 7 %   8    4   U. 2T V   -  2    2  8  4 2   4       4   24    4  - 7 % --      2 4  22  - 2  4 24 4     2 248   - ' 4   4 2 2  4 2  4    4 '        - 47  *+ 24 4        24 .  ' -   4 -  JC 7 ) L7 3    2    4 6 8   - 4    4   !# 7    2    24 8    '  4 6   7 %    4  48  '  .     - 4    7  -  2  4-4  4    - 4    - 4-.  44 2 7    4   '     - 4    4 .   - 2  7 3      8    -   ' 4 .   %%%   4 - 8  - %% 24 2    2  8   - %: 24   4-4 2  - 47 GJK                   5GG68F  . 2  .  -       . 2        2 -8  4   ' 4   4 2 !((( -7  . 2   2 '      2    - 4 7 C4 2    22 J - !L8 4 - -  24 J - +L  24   4 2 J - )L 44   '   -  7    2  -  2 4  .    - -  J - + L  - 4'22 J - ) L 2' 47 %     -8   2  4    -' + 24 .   2  2      4 7  34               4  22  2 24 .  2 5  -          JC 7 *(L7
  .  22 2     '        . 4-.  2    2  2 7
  .  22 2         . 4-' .  2    2   2     - 8  -   '        4  7
  .    '22 2  - 7 C4 .     "  *  + -   - J     !((K  L 2  6  2 ' 7   2 224 4 2     - 2  ' 8 -4     2   8 4 . ' 8 H48 )(
4 '   2  . . 4    . 4  7  *   * 24 . 24 4    '

 4P  / 24 . 4        -'  2  4 8 4    64  .  4    ' 7 %   / 4  4-  .   4   .  6  2      2   . . 44 --         7 . 24 4  4- 2  -'+ . -  .   4 24 J - + !L          4 24 J - + +L7  0   0 24 .  4       4'   7 9-   -') 64  .  '  - 2    -   - 2  2 2 ' 8 .   - H4  2 4   . 4  2  2    2 7  -' 24 . 4  8  +71K 2  24 - -4 P   . 4 -  4 J - % !L7  -'+ 64 .       J# 7+KL    . - J - + LP       .  - + !7 2   -'+ ! 248 +17 K  .   4      . -7  -'+ + 24     2 +"7"K7 2   - + + 64 +!7!K .   '     -     .  4  7  -') 247 +1K 2  . -  4 - J - )L7  -'%   -'+ 24 .    4  - -4   .   5C    -') 247  -'++ 24 ' 4   4  - -4     24P  4 . - GJ            3 6J  * *  %       31          1 .  -   !)  +" 7  -'+ 24 .  4  -   A . - 2 .     4 2  -'%   -') 247 GJD                 # 57L8 F

  . B   2 6 8 .  '   --      8  -  6  24 7

      2  -  2     6   248 4  -    8   2   4'  8   - . . 2 . 2 4 47 GJI            2         .)  <  5GGK 8F  --  24 2  -   2      22 2  $ %%%  4 6     JC 7 *!8L7   3 6G               (   
    '      GGG     2          # 57C8  2   -   8     2  24      2 64 8 4   -   2 ' - 2     2  2 4 6   7   '  - 24 -   4 -     -  8         4-  8    2  4 2 24 7 9- 24 H4   4  2      -    22 2 4   2 2   .   4  4   4 2  4 427  2  4 . 2    2   - 2 -  . 4  4 JC 7 *+L7 '  !:       4- 4   248    2    4 2 24 8  .     -    !7(     4    *"
7   4-  4  1"K 2 -  4 247    -  -    ' 7  2   44      2 4   ' - 8 -  24  P  .8  2 - 2  B    H4 2     2    7 '  !!:    -    
4 -      . 4 -  2  4'       H4 7     -   4   -       2  4--  2  44        4 2 4   4  7 3 GG     2        3 6H      H          *       !     *                   /4
H  *     *         *        !     H  *     *                 H  
*     !   *       *      *       H 
*      ! *       *       *       H  

!            !  !      H 
*    D  *          7 *    *     !                    *            *                             ;  '  !!!:       24 4 64    4     2  4'     -    !7(     4    *"
7  4  24 24   - -  8    ' 422          4   7        4 4      27 =-' -  24  2    7   -     4 -' 7     !   - 7 A 4  4  2    *"
4 -   2  4   '  7  -    44  -    22    '    .    4    -       2   2 .    -  -  7     !     .  2  ' -      8 -4   -  6 7  2' 4  2 4 2    4 8   B    -      -   -247  -    .   -     4        7 %  -   2  2 4     4 7   4 ' 4      4  7  

   !  8  . 2   '    2   8 2 4   . -'  .          8 4  4       4          4227 %  2    -   - 7  24    H4     4'-   -' -  4       - 7 '  !9:  -        4    2  2 2      '     !7(  2    4  7  -   -    2    4        4227   44'  4      8 48 .   -   - 2   4    8   4 -     7 %  . '- -8  4        '  - .  28  4    - 24 2  4     -7 %  '- -8       GG     2           2  4  8 -   4     - .  .  4          4-47       '422 2  4  4    2 -   7    4    4 -7   4   -    4 7 &8   4 2  4--     ' 4  2 -     4     7 %2   4 2  4--  - 4  -  4 8  - '   2  4 2  4  . 4 --   4    2  2 4'- 24  .     7 '  9: -       . '-   4     4       .  4 - 24 2  4  7 9- 2   4  -     2        - ' 4    - 7 &  2 --   2  - 7 %  '- -8  .8  -   4    .  4          4   4--4     7   '     '422 2  2 .    4

7  ' 4 42     2   7  -  4 8 4    2 4 -   -       4228  ' 4  . 4        8  2 24'  '  7  .8      4   2'- '  -     H4  4-- 7 -  4       -       --   4'    4227 %  2 4'- 248   4   '   8    2 4'- 248   4     8    2 4'-  8   4--   4     7  4    44 -  ' .   4 7 F    -   4 2   .    8         -7  .8  -    .  '    2    - 24    24'   7              ; % '  9!:   -   24 4 .  4    . -   4    64 4   6 8  4 -     2 --4   2  7  - 2  4     2 8 -  8  4- P 4   2 4-'  -8   .  24 2  -   2  448 .  4   4 7 % . '-  '- 24'   8   4--   4   44  H4 4  2  4 8 .  2 4 8    4 .  4  7   4  .      4     '- 2' 4'    .   4    -   4'       -   '- 24'   7 % 2 4' - 24'        7 &4 4  -'   4      .   2 4'- -7 9- 24 2  4 42  2 . 2' 4'    48 . - 2  4     4  -         .  6  -8  2  2    4  2  7  -  2' 4      4 .  -      4  4    2  .      7 F  -  2         B  8   ' 4   227 F  -       +(K 2  4 428        4 4   ' 4 2   B 8   -  2  4-4     2    7 F  4 2      "(K 2   '  428  6   4       4 - -  2  4-4' 7  -    4         7   '- 24 4 2    - .  4  2  2        -  7  4 4' 2  2      -7    *'    . -2  ! 0" M *N   .  C 7 *)7  A  4 4      4  4- .  8   2  2    . ' 7 % . -B   *'  2         4'  2    -2  - 2      / GG     2        3 6C                            &  '         3        /4
      !                   &*  *   '             *           *         &  '  *      &   '       & *  * $*  *  #+   '*      !   *       !   *      D          *   !                        !  !    ! *       *         !   *        !   *       D    B       *                  ; 4 2 8 4    U -V   -4 2  4 -   -   2 - -  4 2' 4       2    7   2  4'    -    .   2     8    C 7 *)8  7    & 4-    2      4  H4 2    4 M *N7  -   2 - -  4 24 .    P  .8 '  .    -    7 
    2   *'  2   4  C 7 *)7 %2  6    J  4- 2 2 L  -    !   *"
8  24  !'-8   -8    2  4 2 24 7    2  - 24  24      - 2 - J778 +'-8 )' -8  *'-L       - 7 % +'- 248        - 7 %  )'- 24  24'   8    4- 8 - 4    -    .    - 2   4   4 2    4       4      & '          !*         *       $*       &  D   '               !  !     !    D  *             *           7         7      !                    &*  *   '         &*  *  * '     D   *         !  @          *           *       D   ! *                    *          0            *      *           !     - GG     2         7  - 4        2   - 2 )'- -7 2  *'- 248   4'' - *'- 24    - 8    -4    4 *'- 24 J 24'   L7 %  24'  '  8  4    - 4 2   .        2   J 8 -  8 8  2 8    8    48 4- 8 2 8   L     2   - 2 24'   7    4 42 28  U '- V  U- V 248  ' 2  - 24'   8 4 - 2  4 4' 2  - 4  2  6 7 B    &  ' =  4 2  -  4 24  2   -8    -       2 7    4   2' 4 2  -  448    2    4 2 24 8  .     -    !   ' 4    *"
7  2   44       2 4   - 8 -   P  .8 2     8    2  2    ' .     2  -      4 7   44  4 2  -  4    4   '   7  4  2   2   4   .  2 2  *'          8 -   8   -      . 2  2   H4 24     4 4  4 . 2 7  *'    .      -    4 2 -  4 2  47    '  8   4  8    -B  4  - 24  24  . .'  '  2   4-    - 2 8  4   -' -  7 = 8  4    - '4    47  . 2  -     *' 

' 8   .  C 7 *)8   .   .  H4 2  -  4 24 -  44 J-  L              ; 1 2 8 .      7    2     B  4  2   7 4 -'      .        4   2  4  2  .  -  8   4   2  -    -  4 2 4   2  4  8   4      2    ' 42 4        7       &  ' %  - 2  4        ' 8 . 4 - 2  4 8  7  4 - 4'   -  4 42 2   -   4 J L7  - 2        .' 4 4--    4 7 & 4        2 - .  248 4  --        2 4   2   7 4  4    -  8        . 64   -  4    2    -  -  8  - 2    2  4 8  2  28 4  - 7  4   4 - 2  -  - 2   7      &   ' . '- 2 - 24 4  - 2    J2  2   4 2  --      L7  -  6    2  47    8 4 - 24 2' 4 -    4 8 4    4      4         422 47      -8  . -     7   C   -  -8      *"
 4    -  44  7  - 4       -- '   -7 4--    .    4  44   -24     4 2  4 7 3  ' -  . 24   -        2   -7 I  C   4-  -8  -  6    ' -  2            4 5 GG     2          7  -          -47 3   4   2  .  2   45 J!L  H4    4 8 J+L  H4 4 4  4  H4  -4 4 -8  J)L 4424 48 H4  -  4'   4 2 -  7    C    4  -8 2   2  4-- 2  -   -  6       2 P  .8 4    4     4         4228  H4    44   .    - - -- .  -  .    4'    8   2 . 2 8    7 %2   4248    -2  -  2 P  .8 . ' 4 -8 - 4    -2 -  4    2  8     4 8 -4 4 - 7    !    . '-  4  -  44  .  '         4 2    2   7   '   44 2      2   2 2    '   422     -   2  4 427 %  224  4   -    4 2 - -7 4-  -  4    -   .  -   -    .7  2       4 2    2  4 42  4 8   -  2   4  2      7 3 8 -   48   -247 %2   4     - 2  4 42 2   8 -  4   422 ' -  4     '- --   -2 7    4'   24 2         -  --       '- -- 7     !    . '-  4  - 24  44 - 4  4      B47  .  3   -24  4    4 2 -7   8 .              ; 2   4  . 4      8 - .  - 2  4 42    8 -  4 8  2 8  - 2  4-4    4 7    %  )'- -8  4             .     4-- 7  4- 8 - 4    -   .  -   .      ' 47  4   - 7 F   4   ' - 8       7 F   4   ' - 8       7     44     - 27  :-4  .  3    -24   .  4 42  7 -  4   '  2   4    -  --   44 -2 7 % )' -  4  -8  -    -2 .   2'4      2 4  4    2   -    7 +      .  C 7 *)8   4 *'- 24 J 24'  '  L8  4    - 4 2   .    J778   L8  2   2    4 8  '  2    4-- 7  -     4'-  - *'- 248 .8  .  4 8   ' - 8   '   7 F      2  2'4 8 -  -  -2 . 24  2  4'       422  4 4 27
  /     4'- *'- 248 -  C 7 *)8        44 2  -'  2    -  2    -  '          *'- 24 J 24'  '  L   7 C  2 8    -   - *' '    JC 7 *)L   4 - *'-   .   .  '     -4    *'- 24 J 24'  '  L 4 . 4  - 2   7  4   24  -  4      2   4   %3 GG     2          -   2        *"
 47 %   4'- *'- 24     - 2  4  8     - 4      .    4--    7  -   2  4 2       4 *'- 24 J 24'  '  L7    8  -2     - 2    -    -  - 2  4 *' - 24 J 24'   L7      2   - .  .   .  4   4  2    642 4  8  -            ' 8 .      64    4-- 8  2  4   2 4      8 -    2      7 F  *'     2  -   '  - 2   2      4 8     2 ' -  4 *'- 24  -    2H47 %  224 2  4            2     -8 4    4'- *'- 247 4 4 2  4   - 2  224 4 2   2  4  4        4  ' 4 2   4 - 2   7 %  *'   8  4'   2   *"
    -   7   44 8  4   .  -8   '        2    2   4     7 %   4'- *'- 248  4    4   4 . 4  -8 4  4-- 4' 4       7 4 *'- 24 J 2' 4'   L     4  - 2 -  '  -8 .  2   . -2  ' -   4  -  -    H4 2   2'4    4     - 7 +      .  C 7 *!8   +'-  )'- -   *' - -  24'   8 4    4 2   .    7 F     8   4 '   - -   4  -8  . - '     8   4   - -    4'   8B        %   -8    

 C 7 *)7 % *'- 24' '   8   4   24 8   4   4          2'4    8        7  4  -2      -  4  2  +'- 24'   P -  4   '  2  2  )'- 24'   8 4  4  8   2'4      2   -    P   -  2  *'- 24'   7 8             -  248  4  C 7 *!8  44   . -       -      -27  .        8  3   -24  4 7  -  4-   B 2   2  4  2    7 C       H4  2    -  2  *'   2 8  '- 24 44 4 2   '  - .  4  2  2        -   7  4 42  2     '  -7  -   44 H4 7   -4 '     - 2   24 .   4      *'  2 7 GGH ,0-     2        5DC: 7G8F    2   2  . -       -   2 )( 4   24 2  -  44  2   4  7 +((  . 4  4 2 -    - H4 8  -   8  - -- 8   2   2 0)( 247     - 4  '     -   --  2  .    2 24    4 4 2  4  7  2   B   - J& L  4 ' % GG     2        - 24  -    H4 -2 2  4   - 2   4    2   247 %   8  -    2.  2     -4  -   4 7 '                     !  24  -- 2  2      2  24 2         -   24 4 '      4-   4  4-8     2        2        -    - 2  248  224    8   -  7 F  -X 7 7 7 F  4-X7 7 7 F 4  4-X7 7 7   H4     -  .        ' 2 7      8 8  37 =  -       5 !8 +8 )P !8 +8 )P 3!8 3+8 3)7 4     4-7    4-  24 4      8 '     4 7!8 7+8 7)8   +0 4  4- 2    7  4  4- -      .   4-7    4 8  8   8  .   !  - 8        5 !    - 24 .   -    3)    224 24 .  .  -  7 4 .   2  24         4     -   JC 7 **L7   8B        %%         . 48  2       2    7   G   48    24         7 2  .  2 4     JC 7 **L5 !R44 +R 4E4 )R24 *RE24  
 =        5  - 8  - 8      JC 7 *+L7        -    2   2 4   2  E24 J**' L7        4 JC 7 **L5 !R  -    +R     )R     -      2       2   H4 .           .  - 2  -' -  J- 5 )!'  **'L7 2   24        8  4 2 '   7 %  - 24       2     - 2  . 7 %   - 24       2  4 7  24   .  - 4  -   ' 2   4 247 %2  24     .  4 - 24 .   6 8   2  - '   -  -       2  7 %/ GG     2           3 66  8B           !                !   !  !        !                !           !  "  &   '   8B        %4   3 66           & * $  * # '             &  * $   * #    '   !   8          &=  J     '     #   
  24 2  -      U-V J - L  U42  V7 42  24   U. V 2' 4 J - L  U -V 24 J - 3L7 %- GG     2        3 66  8B         %
    
 %  -       24   U' 4V J - L  U4V7  4 24   U- 4V J - L  U - 4V J - 3L7   %  5  %
 
 JR4 42 8 R4 2 8  3R4L8  %
    8B        %1
 JR  8 R8 3R L8  
  
 JR2   8 R   8  3R4-  '  L JC 7 ** L7             2  24          '   .   -   7  .  H4  UFXV 7 7 7  UFXV 7 7 7        7  -'4     .    -         2  -4     7 . 4  4  -     2  247   2  .   '   . 4 . -   -    2  24 JC 7 **L7 =- 2    2  24 2  -   5 )+' +7! ) +' + 7! C4 -  .  24   .  4  =- 2    2  24 2    5 ))'3)7+ ) )' 3 ) 7+ C4   - 42  -  42  C   &+ // ' R=4 42  24 ) ! =4 42  248 4  7!  4  8   - 7+  4  8 - 7) .   4    ) + =4 42  248 - -  7! . 4 2    7+ . 4   7) .  4   ) ) =4 42  248  - -  7! -8 .  4  7+ -8 .   7) 42  %5 GG     2        R=4 2  24 ) ! =4 2  248 . -  -  7! ;  4  7+  ; 4  7) -  ;  4  ) + =4 2  248 . 4 -  -  7! . 4    - 2  --  -  7+ .    - 2  --  2  7) 42  - ;  2  4  ) ) =4 2  248 .  4    7! UV  ;  4  ;        7+ UV  ;  4  24 ;'         7)  4  24 ;-      3R4 24 ) 3! 4 248 .   - 7! - 448 .  4   7+ - 448 . 4   7)    ) 3+ 4 248 - .  - 7! - 448 .  4   7+ - 448 . 4   7) -  448 . 4   ) 3) 4 248   7!    7+     4  7) - 44 2   GGC     2            5GI8 %     2  2 4'   - 2 &  .   -   -   4  2    2  248  2 '  . 2  .  - JC 7 *"L5  % #           %2 3 6K            C! &+ , 1.' /3 GG     2       

3!   5

     - 24

*!   5 4  +'- 24 . 4  2  '  J
 * L    4  J
 * L

+!   5 4   4      + - J4   248
 + L8 ) - J4   24 ;  48
 + L8  * - J4   24;    4 8
 + L7

,!   5 4       -     2  4   P   4   +' J
 , L8 )' J
 , L8  *'-'24 J
 , L      - 247

?!   5 -    -   24  '  7          - 8 8  37 GG6            2             5GK8 F    4 -  .  4 2  4  -    24 H4 . - 4     4          4  -  .   '  4  4- 2 H47  2   8  4  '    2   - .     B  H4 2 24 2  -  447  4 2  4   2  22 24   .   -   H4  .   4       - 7 4      -       8   .  -'   8  4  .    4 *  -    - 2   8 . -8    -4  '  .  24 H4    4-  2  . JC 7 *#L5
   @   !    ; )
 5 -  -    )
 5       24'   
87   @    !    ; )
 5 4    4  )
 '5  4  4   / )      "       / 3 6D )      "           " 
 5 
       -

   
 7   24    4- .   )'  *' - 24 -    4   48      4  2  4 7
 5 !        7
 5      !7 & 4  2  4   2  .    - )'- 248 .    2  4'   2    2 - 2   4'  8  +'  *'- 24   4   - 4  7 / GG     2       
 '5  
         24 .  -    *'- 24 . -  2   7 GGK                <   5IH: GC78F     . 2   -    - 2   2  -7
 * !    .    -    -     ' 2    2  7
 + !    .     - 2   4   -   7
 , !       4 2   - 2  -        4 - 7      .   
A 
) 5    (  !"
 4 
)   5 !#  )(
2  4 
# 5    )(
2  4    
    .   
A 
)  - 2   ' 2  2  2
)    - 2   . '  2   2  2
#  - 2    . '  2   2  2 
       GHG             "   A 5CI8  -4 24   2  -4  ' -4 247  2         44  -      2  64  7       -     -   2 24  JC 7 *0L7
 C4 2   -4  8     4
C4 2  -  ! - + 3   -  )   
3 C4 2  -4  3!    3+ 4   3) 4   . L C4 2        L  2    4       
9 4 24 9! $   24 9+ C4 2    2  L F 2  2  2    L F  B  - 2  -4 L F        2   L 3 4 24 9) C4    . -4  24  24 2   -
= C4    . 4  24 // GH               3 6I          )    *   8*      !  &'(    :*         : *  &,'* :*    &-'( :%*  &' +       *     & '  +       *       & !'  +       &%' E                  +           &%!'           H   &  @' H    &.
'  H                 &.'  H    9       &.,'  H      !  &@' &+ ,%1.'              A   $K  /4    /- GH            GHH                2    5CJ8 93 4   M)(N    -4 24      - JC 7 *1L5

 5 24 2  

 5 24 2  - - 

 5 24  4   4-     3 6L          &+ ,%3.' GHC              4 .    5G6C8 Y    9  -2   - %%% -4 24 '     93 4     2 24     2 - 4     ,' 27      N
  
4  
4  ;         / 1N
O"
"
!( !
Q+(  /           /1 GH6                    !    5DG8 F %4 24 . 2  2   -      
    - JC 7 * L7 3- 2  2' 48 2    4    8  4    2'    24  - !8 . 4    .  -8 -   .  B 2  2     H4 J - ! L    J - ! L  "  . 4    27

 5      247  - ! .  24 2 '  2 "   8   - ! .  24 2     " 7

 5 2    24   - 2  7

 5 4-    24    4    2     - 7

 '5  B  24     -4    7 C4  .  4 2    - 2  -47

 .5  B  24 J   - *L8 .      ' -   -  247 3 67            &+ ,- .' /5 GH            GHK                ' 56L8 C4 2      4- !(K 2 -4 248     !(K 2 .   2 - 7  2   4   4  2 64  24 -   47 C   -4-  2  4 8       .         2   24 7 C4 2     4 .   --    2    4        7 C4 2    2  4 .   --  ''  2    4        7  24       4- 8 .  - -'    2  -    -      2  4 2 7    2 4   4 2  4 42  2 -  7  4   4  22  - 2   24 JC 7 "(L5
 - %5    24  - %5    24  - %5 -    24
 - %%5 24   4     2 

       2  -4
 - %%%5 24   4     2     4-'      2  -4
 - %:5 24   4     2          2  -4
 - :5    2  - %%  %:
 - :5    2  - %%%  %:
 - :5    2  - %%8 %%%8  %:
 - :%5  4 24  4                H /2 3 KJ             &+ ,/5.' 43 GH            GHD      .      ' 56L8 C4 2      4- +"K 2 -4 24P 2  48 !(K  2. J+7"K 2   L   2 - 7  2      .  64     2 - 7 %2  2 - 8              -7 C4 2       4     .      -   - 2   4 8  2   4 8   2   4-  - 2   4 7 9-  4 2  24   -8 .  24    4       4-  -4  7 %2  4-  4--  44 J '3'6 '   4      - '   4    L  4- 8 -  -'   7 . 22  - 2    24    ' 4 JC 7 "!L5

  4    - 247

  4    2 - 24 J '   2  4  -L7 3 KG               &+ ,/5.'  1     D      4 GHI     @              2   ' 56I: 6L8  4-   4  4-   - J3L    ' 2'4     2  4-    2    4 JC 7 "+L7     -  2    - 8     - 8   '  4  8   8  3 6 8     - 7  4-  4      2  7  2'   4    -4   -7 =   4 4' 4   . -4 24 7   -   .        - .  -4  4--      8  .      4  4   3 6      4  8  -    2 -  2  2    2'4 447 4 4-  2  2   -  2  3 JC 7 "+L    7       648  .8  4   4-  44    2  -      2   -7 %2  4 2   422      8    2  .    - J  U 4 4- VL8  4   .  2 -       4   2  3   .  2H4 47  8  4-  2  - '   2     .  24 2  2  4  2' 4 2   4    -  4   4'  7 8  48 2        ' 24   ' H48 4    4 8  4 8  4 P 4  - P     4'2 4  2  4    4  P 4 4  -  4    -'   4 P   4   6  7 3 ' H4 8 64 2  3    24 4 2   -'  2  4 4- 7 3 -4   - .  4'    2     2   7 %2 4- -  -8 4   4   B  2     2  64    7 CH4 8 -   2  2  64  . 2   4  B  '  4-    7 C4 2    8    8   ' 4 GH              3 KH )        86     !D           !    $ 0     !D          D       )       !D       !  ! & '       &$' @ !       !D       !   !    &#'*   ! ! &.'*   !   ! !       &/' B   !      !  !  !   & '   !            &0'  1     D      4%  -     - 2  4 4-   H4 4 '   7  2   4        8      7
%     
 *5   4-    
 +5   4-      4- 
!    
 ,5 4'  4- 
 -5 4 
 85    2        4- 
 %5  2   4
 15  2  4    4-  
   +         GCG '        0   5GJD8 4    ! #!    - - 2   2  4   2   4 42 2  -7 .  2    4 2   -  2 4    7    -   2       2  2 4  5
% "      2  . 2   7
% "     2    24    2      7
1         + 4      2        7
% "  '      2   .   7 GCH                    <    5GC68F  4  2     -     -    3  2   4 2 !!) - JC 7 ")L7 %  - ' 4     . .  --      2  (7#"  (70(7
&$   J" KL5  4  .  8   4   . H4 4    42 2    7 $       !!7"
J    M9N8 171
L7          * J*)KL  6   * 4- GC     0         3 KC @                 J!#KL               4' -47 %   8  4  - 4       7
&$   J)+KL5  4  . 44 -   8   4    .  7  3   4 4    8   -  4   -     2    7       !1
J98 07+
L7 . 4  4- .  2 5 + J!0KL  .  . 2  -   6  -8 4    8   - 8  + J!"KL  '   -   4-4    444   - 2    7 %  - +8  .      2        C   7 M*!N8 4  4 2   '      -    2    7
&$  ' J KL5   - 2    -  . 2   '      2    +"
8    2    7     . 2 -  8   4  . .     44 -   7       . )"70
J98 "7
L7  %/         41 GCC ,          2    <    5GC68  -   2  4  . -     . 4'  4    2 44 8 .    - 2  4'   -       2    JC 7 "*L7    . *"  ""K -   4  8 (K       8  !((K   -     7  7B-@8 3 K6 #           !  0                 $ 0 !      # 0                 . $           $ / @        # .+ /*    !  8   ! /4

 44L         8       44L     !   ! /4L    !  GC6              5KG 8 F %  4  '-   .  4   2 2 4 22  - 2   2  2    4     -' - 4   2     2  ,' 2      45 GC     0         2     J   L     4-   2     J   L7 %           - 4 4  -'.       B   -   2  -8    2     2  ,' 2  -          2          .    2  ' -47  - ( JC 7 ""L -     P           4 -7     .  2       - ! JC 7 ""L   7 %  - + JC 7 ""L   8     3 KK         3    !   &-'      &, '    &  ,          !      '       !          !              !         !                    %    !          !     !   %4               42            .  2        2    7 %  - ) JC 7 "" L             7 GCK          )           3     5CL8 F
1  5    4-.    2  4  8 4-   '4 6  -  . 8        - 4   - 2  4   4  '  JC 7 "#L7
1  5   4-      '4 6  -  .  .      - 2   '   .      4  - JC 7 "#L7
1  5   4-      2   4    2  2   2        7    '    22       4    2    -8 2  -8   4                 4  -7 $ '4 6  -  .       JC 7 "#L7    3 KD H   )             8          H           7 0                 H  % 0             -3 GC     0          .    22 .    4-7    '4'  6  -  . .  2    4- !    4- )  +7 GCD                  5GCH8   2 422   -  2       '  2  2 422   - 7 C 4   4-   2     2      4'   2  - 7  2 4  -   4     2 4-     2    2       4 2 '  2   2   7  2  J "L  - -  2  4   ' 2  - -  -8  2  4 8  4 7   K          &+ , %.'  8  # @ 8! 9     7   !    !9  9 &+ 41'     :  #   #           7  * !   9   (  !9 9   &+ 41!'     *  9 D       8   )    #  !9      7 !   *    (  !9     !        &+ 41'   ! 9     9     :  8 8!  ; !9 !     7   (  !      !9    &+ 41 '     %1             C    -     3 KI :            8  * !  :  *  9    8  *  !9   :   ! &+ , %.' GCI                 5KK8 /3 KL M1 A   -   2  422  . - -  7  .  2     4  J%L8 .        4        2   24'  422 7 C   . 2 5
1  5  % .    # 
1  5  % . "   
1  5 4B  .     $  +  J  4B   2     2  2     4 427 %  . 4 -5 )   2  2     )  2  2     -4         L - GC     0         3 KL $           , H  (   (   %(    /( "   4 &+ ,44.'
1  '5  . 2   4 6  .     $  ) 24
1  .5  -  2 4'  -8 .   2 422'  - GCL                )             2   5GHJ8 A     4  2 2 4  - 2     7 %  - 838   2  44   4-.  . 4    2    7  - 8 . 2        2    7 %  - 8  .     2  4-  - 2       - 8         2  - 2    JC 7 " L7  %2 $                  -% 3 K7 $                         &+ , 3.' GC7                    
  5GGI8  4    '2 4  4  .    2    4-    2   4      - '  2  4  - 7 A  -   2   .     8  8   4    -     -7
)      .         -     - 2   2  4      8   8 4   )     JC 7 #(L7
)        .         -     - 2   2  4      8   8 . )  0    8 .    4'6   4 JC 7 #(L7 -/ GC     0        
#      .         -     - 2   2  4 2     8   8  .    0    8 .  . 2   4 6     JC 7 #(L7    3 DJ $           #                        *  ! *   <%  #                         *  ! *   ! %  1 *     7    )                         *  ! *   ?5 *         &+ , 1.' 
          G6G 

           5HK8      2               4 8  4  -B   4        -     -  4  4     7     4 -      - 2       4    -    -- -- - - 7    .   B   2     2 4  7 M1)N8 4     2  2     -     7 C    8   2  2      2 - ' -     C M*N --      . .7   2   - -  4   -4 -     "8  -  . 4     JC 7 #!L7 3 DG          !            ; MN   :  , 34. !     ,4. -- G6            
# " 5    -        B      2     247   - .  - 2  228 -24 -         2   7 '    .   2 4-   2  2    J   4    L  4-   2 '     . 7 4        2  '     -    - - 7
# " 5     B        2 -   - 2  2   .  .'- -7   2        -  7 C     2  J*L 224  -  8 J+L    2 8  J,L    -  E  2 7  2 4 2     B    B 4       7 %     ' 4       -        -' '   2       -   4 .      . --   .    - 2  ' - - 7  .8 .  - 2   -8  2        +7
# " 5     B      - 2' 4 2   8    U  V7    -'   - 2  4     .   2  - '        2  2   8      .     7 3   2    2    -7    2H4 '     -  -7   - 2       8  -   8   -  . 4  2 4   - 2  4   247
# " '5     - 2 4       2  2   4  2 4-  7     '  .  - 2   2  - 8   28 '    4 2-    - 4    7 '  4 8          *7
# " .5  22 .   *  "    -- 2  447        *8 4  . -        "7    2          '   2  - 7     4      8  -     -4  7  /                -1 G6H                   # 5GJH8  -      4   4       4   2      C   M!*0N  - 2  = M!*1N 4 .   227  22   -    -  2 4 6    2        4 2     -   2  447     28   -  2 ' 4 -4      4 .       4 (
7   -   -4    )(
8     2     - 4  4 -4    '     .  44    #(
7   2      .  4     -  4    . 4 .    4  '  7 4   .  - 2  4 42   '  . 2 . --  -8     8  2  ' -  2 -4       2 4  2 4   2  4  7 %  4  2    2 4  8   34 M!* N  - 2  = M!*1N -  4       2         '   2 4  2      2      '   2 2     4 2  2 . 4  U4 '  V7      2         -     -    -  2 4 6    2    4  8 & M!(+N        2  . '-  2 2     4  -47           2    '  8 &   -   2  2 C  ='     4 7  4  C 7 #+7
# " 7   %   .  4       .  2   7 A  - .       J A%L  -247       -7        2  4 -    2 4'    2 7     -8 4   -  -7
 . 2   J$4T   -5 G6             3 DH                   ; , 3.   L      -7 G2 4 8       2 .  4    7
# " 7   %%    4 42      4 . -  4  8   4   4        -4    .      4--  2  4    8  4     -7     .  U4  V   7     A%  - -24  4   2   7
  44 -    7   - -   ' -    4 24   4     - 2 4'     7
# " 7   %%%   B    2 .    4  7   -     . '-  2 24   - 2 4    7 =4    2         8 2   2-7 F  -  2  - 2  4    8  -  2 7 =4  ,' 2  .  U-' 22V - '  8       H4  47  4 42 2     7
# "  7   %:   .   2  4 42 2    4     4 2  4  7  '      48   2    '  -  4   8 -4 2  8   4 4' 2 2      . 4 8    7 ' 4 2  .    4    8    ' 4 4  -      -   - 2  '  /%                 -2   8    4 .  4   -   44'  7 F  -   44 8  -        4  22   8       -    4 2      -     2    7  8             2  6   -7 G6C      2                  5KD8  4     2    2  4  '    7   2   . 2 2   ' 4    .     .7 C 4  4- . 2 5   .    ;  2  4    8   .      ;     ! 2   2  4  8   .      !     ;   2  4  8    .     ;   2   2  4    7 
        GKG 9    !        5GJH8 F 0 *  *            

4 4     -  4  7 F    .  4    -2    7 % 4 -  2   ' 8   -24       2     .'  8  8  7
' -    4     .  ' 7     -  4    . 8     - '   -         7 %     2  2 4  8    - 4  2  6  42 .   2  44    2     4227 %2  4   -  - -  4 8          422    4  '  7 %  6  4   -   G 8 - 4 .    2 2 4  6   - J-8    .L -    2  4   - 7     -2 '   4   - 4 4   4      '   2    422 2        7 @* *    7 %          2    4  8      - 2    '  7  4  C 7 #)  37 %    !    8 4    8    2 6  -7        8     -   2       2  7  6     22      - 2  7 4 .     - . 64 4   .   - 2 P  .8 4  44         47 F   2. 6   ' 1 GK         
  3 DC
            , @     *   *                 E      !             !         A   !                     8     4 8 . -  --     '  5 U2   V8 U .'   4  8V  U V7 %   !   4 4  .    '  8 . 4    2       -  7  ' 4  2     4    4 2 4   '    4  - 4  4  -   2  4' 4 4 -4    2    7          ! 2 4     .           2  44  &   UB V7 95    2      .   2    4 2   4 7  -  2   4    2  '   4 4 .   . 4   4  2   4  8  2   2   2    7  2    2          -  2 224  ' -     - 7  4% )           1% 3 D6 8              86   * !  !      (  *           (   %*  !        GKH     )          *  3  5ID8 F $  . .     "  .  4     . '    2  8   "  .  .   2  2        "  .  .    2  2   '   JC 7 #*L7 GKC         )          *  3  5ID8 F F 2  4  .     "  .  4     .     '  8   "  .     . 2        !(     "  .       - 2  JC 7 #"L7 1/ GK          3 DK 8               86   *   (  *       ! (  %*       GK6              *  3  5ID8 F   22 - -   - --  -4       -   2   - 2  .  4      8  4  .    4     
 2  . 5  - 2  4   4-.    2    '       JC 7 ##L7
    " ! 7  .    2H4 4  *!K   7 %    4-.    2  4'   . -    .7     -  4  4   4 7 & . 2  6  - 4   4-  -  2    2  .    .   8 . -     4        '    4   --   
  -7  4    - 4   4-. 8 .   ' .  4   - 2  -47 %     7         4   2  44     '  .  2     2    .   -           42 2  4   JC 7 ##L7  4/ $           14    3 DD $                                                &+ ,1-.'
    ! 7  .    2H48 4  )#K   7 %      2 4-.    2  4    - 8 42  . 2     4  4   7  4    - 4 -4       U    '4-V7  2    2  --        '  -     -    4-   2  -  2    7  -     2  4   2  .      4      '4 '  JC 7 ##L7
    ! 7    2H4 4  ! K7 %    4  2  4  .    - 7 F 4    2     - 4     . -  . .   4' 1- GK          2 2       U-   V --7     2  2 4        ' 4 4 7   2      -    2 6  - 4   4   4 JC 7 ##L7 GKK              :  : ". 5IK8 F    22  -   - 4   - 4  2     6  2  7  - 4     8 .   4  22 '  42    (K 2 2 2 4  7  '   2    -      6  -  7       -2 2  4  7 F .   2 '      -    -   4  6      2     8 4     -    -   - 8 .   .  -     24  6  -  7  .8       4 2  4'  64 4     -    .   --   -7    4  '   - .   %8       8 -4   -  6  2  2  J 8  L8   -    7     44 22    . 4          8  .   ' 4 2   - 2  -    6 7  -     -4   - 4   2  7 %  4          4 2  '  2  5
1  37 &
  7       8 4      -  8   -7
1  7   
7     2  2  .    -5 -4  2 4 . 8 -4  -      6  -  . 7 F - 8 4 2   -  

      - 4 2 2  6     -' 7  2 4 .   -     7    -   4 - 2     -  44 $           11 . 4 4 7 3 - --  4 . 4 '     8 4    8 4 T  - 7
1  7 #   
7 =    6  -  .'   -       7 =       -   . ' 6 7
1  7 1 
  
7 =    6  -  .  -       7 =         6 7
1   7      
7 =    6  -  .  -       7  2    -'    . ' 6 7
1  7 1 
7    4 42  -- 7 $    2    -   . ' 6 7 9        8       8  4           P 2 -8     4              4   2  7    8 -     - 2 8    - .    2       . 2  6  -8 4   2 6      - 2  6  24  4 .  2  6  -7 %2  8    2     4    2  . 4  -'     7        2   2  . -4- 5 !7 %       2  4 4  2   2     2 -  4   2  7 +7 % -4   8 2  4  -  7     --     2 4        7 )7 % -   2  2      2      ' 4 6 7 
      GDG    &     '(  56H8   +   5GHK8 -            - 5
# " 5 - 2 24 8   2     8 -  -   8       7
# " 5  2 8 2 4 -  8 -48     '   7
# " 5  2     8  - 2 '   JU-  V   - .8 -   4-- - 4L8       7
# "  5   -4 . 2  2   8 -  4    8       2 4     ' 8 -   4      7 GDH
                  5GHD8
 2  224  -  4   2  4  -    2  42  2    2  - 6 7  4 2          2   4    6 8 4    4 - 7      .  . 2  2  2  8 -     8  2 4'   -    4 2   24  - 7  4  . 8   - 2    2  -  2   4 8  48       7 2 8 . - -   . 2    2  - 6    JL     2 4  P JL   T ' 48      P 4 JL  4  2  -   53 GD          4 2   7 3 8   2  2  4     .   4  22 2  7 %   8  2 4 -     4 2 4    -8    -    8  .   7
2 
J  48  .8 -8 8 7L

  " %5
4  2'4 2  . 4 -   %%5 %  -  %%%5 -  .  2'4  8 4     %:5 -  .   4 4   
(   " 5 &  4   5 3 -    5   4  -  5   4  -  35 A   .    4.
  !5   "   2  -    4   +5  -  2  "     8   4  
     3    -;  ;  R      4  2      -4  2 ' 4  8   6   8   2  6    2 48  '   2  6    7    - %  -4  2'' 4 2  . 4 -  7 4    4   -  4  - . 4 2 7 %   4 - J - %%L 4 .  -44    2 .  -47    - %%% '  .     2  6   4 4   2 48 4  - . 4 2   - 48   .  6  -' 7          - %7 F        4 4 .  6  2 8   2   - %:7 %   4   8  44    -  44 4     -     8  8    7     2    8 8  3 -     4-8 '        2 3    M+(N7     -  - .      4 47      '  - 6           5 -     J L    J L7   4 4  '     44    8     8 '  2  4- -  48  % - 7    -  4    8   8       4 4--'   2  4  7  3   4   2    -'   .      .    . 4 4.     - 2  2 7     "    4  4  2  -     2   7 F   4- - .   "     -   2  .   4     4- !7   - .  2 .  4    .  -  2  "     2   4- +7  4' 22 .    "   4  4    .  '  6    4 2 -  -    7  4     .  -   -  '   4  4  ' 7 448 '  8   '    -8    7 !
    GIG             .      ".   5CK: GCL8  4      2     4 5 !7 % -      2 -   2      .  -    2   .  -  467 +7 9 -    2    -2 -  2  4   7 )7
   4    4 2  64 -7           - 2    J$L8   JL8   -   2  J L7 = 2   2 24     22 -    7 H  &H'    2  4 4 -    2      -4     8       8      -  8     .  7 %     -4B     UV  U4 V8 -   2      '  2   7          $(8  .'      -  $!8   '      -  $+7 %    8          .       7          4    2 4  2 2 P    8 -         .7 C     -8  8  4    2 '  .      7     - .          --8  .8             '    - --    47 5/ GI        ) & '     2   -       4 7  (     2 .  -4   .   ' - 2  7  !        4  -48 4   -  4 4  4   -4 -47 C'  - 6      4

2 4 4       2 4    B 7        B  4    .   - 2       !7    4     2     -8  ' 2    - J+L7 9 -   4   4   2  4 4  8   4 8   4'  4T  B    4    - 2  7   '   2   24          2  24     2'4  -       8 2  ' -8     +7 .8     2'4         - 2    .         6 24     -   A       +7 4 2  -  H4   2  22   4 4 - 8       8  2   +7  # ' 2  -   -   .    2  -  7 #   &#'  2        44   -   - J !L   J (L 2 7    4 4 .     2 -     !7 %    ' 8    .     -     4    !   4    -  -      .    -7 $ 8 44    B   4 8 .  4         8 2  .    7   2.  - 2  8 4     ' 8 -   8       8    2 '   2     -   7    . U-V '    4    !  8     -  - '  7    J$L8  JL8  - 2  J L '       4     7  0  .  --  2        18  --  2     1               54   D )   & ' !       /G1 "2       /H1   )        )      )       @     6            A      $     #    6   6  8  H   8     #    #  6    8 !   :  8
  6   @   6  8  C   6   6     I )  !       '       0 H3 3 #3  8  H3 3 #3 % 8   H3 > #3>  7    - --    4 2 '       J  !L8  J  +L8    J  )L7       4    $(7       '    .'   J  %L8  '   J  %%L8   J  %%%L7           %    %%       - JL   - J L7 A       8   4 4 .     %%%7 5- GI          L )         '       8 0 *  H #3 : 0 *  H  #3 8 C  *  H #3 : C  *  H  #3  8  *   H > > # ) *  ! &H3* 3* #3' 3 8      -    2   '  7       .  -   24   8 2 8 4  24 7 F      2 48 '    44 8   8  2  7 F   8       2  7          .  -          2  .7 %  8   !   44   .   - -7   .    2    2  '    4 4   J . %L7 3     . 4      2  7    8   -- 4  . 22 8 .   . ' '  7         8 4   - 8 -8 -  -8   8  7     . -4  4 2 4 4     8 .     - 2 8 2  - 8    7 ) *   ! &H3* 3* #3'  6  2      - 2       '   7       .       - ' 7          4      7             .   2 4 48       !  8    7 A  - 2           4 .    4   7 F   8   +   44  4 4     2    .     4 -'  1               51 -7   - 2      -   '       2  J . % L7    -  .  .  4-     2     2     -'        -7 3  A%  .         4 .   4 4       . 2   2   7 3  A          -7    8         ' '  7    . 22   4 7    '   --   7     4 4   . B  2  2 4 27 A -  2          4 4 7 ) %*    ! &H3* >* #3> '          - 7    4       2   44  H4  7       .  -   24 .     46    47   .   -  --        .' 2 7       '     2   -- . 4 4   '    4 7 3     -  .      H4           .'    7  2 .     6       -7 A'     3 T     -7 3  4    7 %  -   .  4- .    ' -  2      -   -7 3  A              47 =  ' -      7    8        B   .' 22    4   2 4 7  ' '           -  48 4      24 2   8 4  -  - '  -8  7     -7   -   '  - 2  2       4   -4 -4 JU' VL       7 55 GI        ) 8*   *  &H * * #3'  .'    - 44   .'  . 8 -8   - ' 7 4 2     48    -  2'      B 7  .'      -    '  - - 2   '     48 4       . 8       -  4   .     -  7 %  2 48   %   2  4-28   8   2. 4 4  2   7  4 4T   B       4 4  4    4   47       -8      '    4'  2   8 24 2    8 4     -  3 T  8  7 %  -   .   2 4-    - 4 .   ' - 2  7 3  A   2   -   7   44  4  . 22 7  '  '   --  ' ' 7     . 2       2   8 4  -  -  - J  T   !  8   8 +L7    4 4  -4 ' -4  -  2  -  4     '  - 2  2 4 4 JUV  L7 ) :*  

*  &H * * #3'   2   2  -  .'     4'  4      2  -  .'     4 47  .'         -   - 8   -         2 4 4  .7                       - 2   .  8 2  -8 . 4       % 7 4 2    2 22   4 4 - 8        2     '  - 778  - - 2 7
 4 4    4-  -8   - 4  -  .'      -  -7 A  -   4   2   - -       2  -  7  1               52 ) 8*    *  &H* * #3'  '      -   - 7    .   -24       4 2  2 7  '   '    . -   --           .7   '              4   -7  '   4 4    H4   4    T 4   4 4 - 7      -   2   2  4 4 '  47  '      -          ' - J . %%%L7   2     2  224  ' 4B7   8  2      -  4      2   7 %  -   -  .  4-    4   -   - 27   B  4  .   - 2   2   4 4   2   -7    8       2  '   '   J  T   +8 )8  *L7    -  4 . 2H4  7    -  -  -7  ' '    7 :4  8  8   '   2  -7    4  2   4   4 4 7      -4 7 ) :*    *  &H* * #3'   '       -    %% 7  '         H4      - 2  7   8  - - .  -   247 A    8      B    4     2'4  7  -    2  '    -  .  4  2  4 47 %  -   .  B        - 2  7 A    3  2   - - 2  '    -7 ?4    .'    8  '    -    -  4 2        - 4 4   7    8   %%      %%  8 .  2   2  '    7 23 GI        ) *      -  - .     %%%7   %%%           .  8  -  '  -7    4     -- 2  -       -     . 4 ' 7   4  44    2 7 3 2     -4  7 %  -    .   - 7 A       4  -   '  -       -   7 "
         GLG                      5GH68 3 -  .      - B  2  4 2 --  4 P  44  1 B  JC 7 #0L7   . 4      -  8   8  7  4  2   . 4  . (7" 7       4 8    8     2   -  -  8  4     2     -  4   . 4 8   - 8   . .   2   -      4    . ' 3 DI 8              C  !             9  &+ , /.' 2 GL            - 7  4         -'   -    - U V 2    -   -    7  4  -  . 2   U V 2   . 2    2   4  2   ' -   2  4  +     .  . -      B 7 GLH                    5GH68 3 -  .      - B  2  4 2 --  4 P     " B  JC 7 #1L7   . 4      -  8   8  7  4  2   . 4  . (7" 7       4 8    8     2   -  -  8  4     2     -  4   . 4 8   - 8   . .   2   -      4    . '  - 7  4         -'   -    - U V 2    -   -    7     -  . 2   U V 2   . 2   -    2      2   -   2   - 4  . -    - 2  . !7"     . 7 3 DL 8              H !             9  &+ , /.'  5% $           2% GLC                    *   5LD8  -   2    4  .  4   B  JC 7 # L  -    4 !8 "  # 2   4--8  .    - 2     B  +8 )  *  4  -- 2  7   . 4    P $  !R  !  $  +R. !  +  $  )R   + 7  4   4         &((   4   B      2   -7    4 2  B    4-       4 2 !1 JC 7 # L7   -           2       !+7    4  .      -  .  A    . 8 .  . 4    4 2 B    22       2      7 3 D7 8             6      9                     &)&&'  & =2D 5     ' &+ ,5-.' 2/ GL           GL6                 3 .   56J8
, 35  4
, 5 4   4-   E  2  2  
, 5  - 4   
, 5  - 4 2 4-  +   4   - 
, '5  - 4   +   4   - 
, .5  -   J7 78 --  2 L
, .5  -    2     GLK                    <   5GCD8  4  .   2   2    4 B     ' 2  4     - 7   ' 2 2     - 8 2  -4-  2 4 8 . '     B  JC 7 0(L Y  !  -  2 .  4     2        2  - 7   2  -  .    . H4 -   -'  Y  +  )7 Y  ! 4    .   4  2     - '      27 % . 4    4-     4 B  . 4 --       4   42    -     .  7 3 IJ 8      

      &+ , %-.'  51      !   24 GLD                           2 5GHJ8  -4  8 .   2 2      2  - 2     - 8 .    . 2      B 2  2       - JC 7 0!L7  2 . .  2   -  -    "  7 % .      "   .  .    .   . .8 "   .  .    . .  "  ' .    4   -7 3 IG     !                     &+ , 3.' GLI                  ,    5C8 $      .  B  -    2  '     JC 7 0+L7      8    . ' B   8    J   -  L8    J'   --L 27     8    . 2   2        2      428    2    .    .  8    2       .  7 2- GL           3 IH      !         #         !         !      )    !           GLL           )           ?&  -,   5IG8 F   -   .        2 2 - .      2           2  4 2  E   2     2    5
"  38  2 P
"  8 2  4-    "(K 2  - JC 7 0)L
"  8 2  4-     "(K 2  - 4     -   JC 7 0)LP 
"  8 2     -    - JC 7 0)L7 C 8     2    -   2   .     -       2  4  - 7  55      !  21    3 IC      !           &+ ,1 .' H   !        & ' H   !        & '     !!     7    H   !   !       & ' #   G7G   -   5HC8 F %  3   4  2 24  8  4  ' -         2  4 2   4 46'   6 -      J L7  4      4  '-     8   .       4 - . 4 48      2 24   2   4 7  -'     2   24  7  2 46 -'         2 - - 4 '  2     J !(L7  2 -   !"8 .  - 2  -   B 7   46 -     2    4'    4       . 8  8    - J !!L7   2  -  -2    '    2  -   2        4   4 7 . -      2   2   8   .   !!7  -      -T 46 ' .      -2    .       - .7 C 4 2  -      . 8 2 4      7 )      
    6 4 8      3 $   /3 6 4  33 33 G7    GJ )        
 2  ; 4 # 3 #  4 )  3   GG )        ,    8    +   / +  D  / I    6  I     I    / I   - I     5 8!   3  3   B                    ! !             ! 3  4  .   .  422 -7  -     . -  2 .            4 2   4  - 7 G22 -   . -     4   B 7  4  4  - 4  4    4       - 8 2   4    - 7   !( -      2     2     -2      2 8   2   . .     7       2 -4   P     2   2    .     '  7 48    2 .   .     8   2  #   3        4   -4 -   .    -2  7    4    .  .  .'.    4  . 4 4  4  24 8 4 '    + - 7 % -  2            .   !!7  6    -  -       - 2 -4 2 .     J !+L8  .   -  24        J !)  !*L7 C   4  - .  4    8   ' 4   4  - .  (
J   2  -  4  ' 4    L7
.   4      M1 N7  4     4   - . 2   4   (
2   7  4 T    4  -    - . 2  4   4   (
8  - 4 7 % - .     2  4     (
8  - .  . 4   4    -2    4   GH 6         "  /
1
  3>%3 3 % >-3  - >23 / 2 > 3 -  > 43 5 4 > 53 3   GC A  
 
  C !    !    C !    !  !  C      !    C      !  !  +           3 3 G7    G6   
 
  @        3 @     !   @      !  7  / @       &   ! !' - @        ! 5 @         &@
1' 3  -    .   7  4    2   4  - .         .  3  %%8      2  2  4  - .8  - .     -    7 % --  - -  2   - .  (
 4 8  -   F'   7 M!)"N . 4 - 4 2   - . 4      7     4    +"' '    +" - 4  . 4 224 7     2    - .  +" - 8 . - - '    2   - .7  -      '     -  4  2   -8 - 2    . 4  2  2   7  - . 2     4 8  4    8  .    7   -  4  24   2   4   4    .   !"7 G7GG #  -  2-      '    5G6G8 /  7 M!*!N -     '  '-2 3       48  4 2  %  8     - -4  JR!#+(L - J !#L7 G 3 T     4 2   4  2  '  3       4  24   .     *(       #( 7  2  #   3%   GK )       
    8    

 4 4 E / / $ / / )   6  3 3 $ 8!  3 3 + 3 3   3 3 A  3 3 6 4 4  33 33   GD ;         &+ , / .' , / 1      3   >%3 2/ 5- % >/3 2/ 5- / >43 2% 54 4 >-3 2 5% - >13 23 5 1 >53 5- 5 922 - -4           4 3     4  -  3      . 24' 4  -  .  - -4 7 3/ G7  G7GH #  -  -       ? .   5DI8  4B  2    J !0L 2     JR**!L  ' -  - -4  . 4  4   -     64  '   ' 3     4      2   -    -  2 4  8  2  ' 4  .      -   4  4'  4 7   GI ;         &+ ,-1.' , / 1      3  5>2 24 55 %3>%2 24 51 /3>/2 2- 5- 43>42 2/ 5/ -3>-2 2 5% 13 55 5 G7GC 9           5GH8  4  2  3       2   '  ' ' 3      .   !17   GL
            9      /O1 A 2 > 33 H 5 >23 )  1 >53 8 "  - >13 6 < -3  2 O   !      #  ) 34 G7H B         -      -            5GC8F   .   -  $ H4  2  2' 2  4  24  H4   3    J3L J C 7 0*L7  4    8  3 H4  .  - . . ! .  *0 - -    4  4  7 C   '    3 .    -  2    2'7   4  2  3 H4    -    . (7*08   4  224 (7*(8  '  (7#0" J-R(7(((L8     2  H4  (71(8  2  - T 3 4  (71"7 3 48  8     2  H4   4    7       2  -' H4  .  - ' 3 . 2 4 J-R(71+L7         3 H4'        4  4  3   2   4 2  2  .'4- 4 7  46 - - .  4 4  4     2  B  !"8 .  2 -   !"  - 2  -   B 7    2  2      2    . 4 H4   3 ' 4  7  4  -' 2     2 -T - . 2   4  2     2  2  2'      7 %  H4   -    2  --' . '
8    2 --'   .     2  "     (
 4 7 . '2 -   4   2     8      .  4 - . 4  -  2  - . 4   2' 4  '
 ' . 2  -2    '    2 - .7  4'     2   +7+(7     2 -  2   4'  2 - .   .   ! 7 3- G7     N  N
  . )  N 8     &     '
 
  8    
   
P !
 6               !               ) 6 > I  Q EK9!  > B Q    R RS0 C 3 I6 O   !      #  )               :  , %.  2 O   !      #  ) 31 !!
N 6      *  !    *          !           &      *            '           

         

      

         

     

!!!   6      *  !    *         !      &C!!* ) * H  '           

         

      

         

     

!9 <.  6              !           8  &     '  !                 

  

 . 

       

   

9 
      *        ! !               

 ) .    

 ) .     

6               *    !          35 G7  9!
  )       3 I6 &  '  2 O   !      #  ) 32 9!!
           3 G7  9!!
          3 I6 &  '  2 O   !      #  )  !P
  2       G7  P      ) 6    !  0 6        !    4   6          !     ) 6 > I  Q EK9!  > B Q    R RS0 C       E6@+  !  DD        E6@+          3 I6 &  '   G7 8           6 #    -
.
  #    -
.
  3 3 1 4  5 5  / 2 3 % 1 3  / 2 / 4  4 - % ?  4  2% I08      % G7C % ,     5H8   8   2 -8 24     2       2   4    8    4 -   2 2  U'.V   7 % 8  4      Q1 4 2  -8 24    2      8 Q# 8 Q* 28  O) -  J +(L7   HJ I08    
    3 6  * !!(    "    * !  !!(      / ;     (        (  "  4 E        (    5 B     3 ;  +  I!    
      / 0            4 #    *   *    ! * *   5 )    ( !   !       3 ;   #   8         8        / #     (   <-3
*   </4
4 #         23
*   23
5 #     (   /3
*   3
3 ;   (     / G7  G76 , /     , :    1 B    5DJ8Q F   .  - 4  28 2'  4 2  -   24  48 .  2 4  -  24 8   4     -      7    6  '  2     2  -  4   JL8  3 4 2 44  -   J3 L8   %' 4 2  F    J   8  L7  --     . - 4    2    -7 %   !8 % $ 8   4- 2   '    - . !) 4  4  4'   4     2 1+! 7 %   +8 % % A 4 8  1+!  .  4  01  4 

4 '   4    2  . . 8 -8   ' 2 2  8       4--     2     - 2  -   24  47 %         4 2   - .   7   +8 C4 % A 4 8 .    4 2 2 '   . -  -  01' H4 7  2  8 .  4 4 .  +(    G 8 3 8  48 .   2 2     2  9 2  8  4 8   J9L H4 7  9 4  4 JC 7 0"L   )('8 2'-  H4'      4 -  24    -   - ' - .  2  44     2  4-- 7            2    8  4    4      6    4--  7  2/ @8)C &@ !    8* )     C ' O    4 3 IK  @8)C "    - G7  3 IK &  '  2/ @8)C &@ !    8* )     C ' O    1  5 G7  3 ID  "  @8)C "    2/ @8)C &@ !    8* )     C ' O    2 3 G7         '!9 JC 7 0#L   7      8   -     4 2    E   -4- 7  .8 4  24 9 4  4 -    - 8        2   . .      -  24     4 -7 G76G  , B        H4    4 4  -   .  4   -2   7
 .   4 8   4        .8    -- - 47 %2 4      -- 4  -2      - .8 -  4   
  . -  . 4     47 % T  .    4 4  -2    P - .   4     2  . 4 -' 2   7 G76H  B . , B        H4    4 4  -   .  4   -2   7
 .   4 8   4        .8    -- - 47 %2 4      -- 4  -2      - .8 -  4   
 2 . -  . 4     ' 47 % T  .    4 4  -2   '  P - .   4     2  . 4 -' 2   7 G76C   , %  - 2 +((+8  4   4      2   9 4  47  .   "   ;      4   -8   22    ' -  4 .  .  7 C    8  4     -    P  .8      .  4 4  4 .  4- .    7  9     .  - 5   E -  H4'  2/ @8)C &@ !    8* )     C ' O      J)( 8   ! "L   -    -2  - E 4  .    J* 8   ! "L7 @ !D     +0 2  )(  4   - 2       4'  7    4 2    - -   - 4    8 - 4    4 2 27  4   2      4 2 !((  4   4-   +"7  2             -   4    ( !(( 7          7
   
   
4 2  -   !  +"   .   H4   4 2  - - 7 B   & D    ' = -   4   2 2 4 8 .       4    4 4 2  4 2  H4 7   2  -   4    2  -2 224  - 2'   E-2      4- 2 .    ' - 4 .    22   2     H4  U4  V   )(' -   2  97   -  4     2  .  4  -'   2 4'  4  7  2 4 H4  4  .     4   7 -  4-    4 2   -      2 4 J4 2 LP 4   4' -  +"      4 2 !((7 #   %2    !(K 2   J 8     L  2    -  8 4 .      4  9 '  E -   7   4 J 8     !(K 2     2 L8   4        '-2  - E-2    .   4 4   4   2  2 4 7    U4V --            7  G7  G7K  ," /,      " )  1  5GGG8    4   = . 4     -    ' B 2  2    2   4 7  2    - 2'4      -    7  =   B  4   2   22    4 2  4  24  --   -    2   7 @     -T 8  8  8 8   8  -  4    JC 7 00L7 -        2  '     2 -  48 2  - -  4   -' 2  7       -    .  -    2   2   8 2  8 .    2 2  .'4- 7 %  -    . .  U4 BV  - '   2  2           2  2 - '  - 2     - 4 7 6      - 2'4  2        7 6  2     - JC 7 00L7  -     2 .    -    4            2  -   -  7
   .   -     .   -  '  7   H4   2  4 2      7   H4   2  4 2     7  -       4 2 - H4   7   2 -      !(  4      2  ( J -  L  !( J-      L7  !  -     2 .    -'   -  2  JC 7 00L7    2  ' -   -   H4      4  7       8 2   4  2  47  24  8)A) &8 )     A! )  ' ) %   3 II 8)A)  @    6      "    / G7  3 II 6      ! "   3 II 6           "   8        2       2 4'-     JC 7 00 L7  -     (8 2   4    8 !8 2  2   224    8 +8 2  2   . 224    8  )8 2  2  224  -2    7 =  4   '  - 7 4 !( H4     4    )(7  !( H4  4      -      2  4       2 2  -7  -      2    .   -  7  44'   2              .  2   2    4 7  24  8)A) &8 )     A! )  ' ) 4 3 II 6         3 II 6       - G7  3 II  6         6       !  24  8)A) &8 )     A! )  ' ) 1 6       -   -   2  2    2  2  .  7 $     J   4  -4  L  4      4 8 4    22  ' 4 2  -4      

    JC 7 00L7    -    2     4      7  4 2     -2 7 C .    4   ' 4 '4   . 2    7 =     4 .    2        .    (
2  4 7 %     4         2 -    .  47 3 '  4'    4  4   2  4 2  2   --    7 )       ( 2   -8 ! 2  8 + 2  8  ) 2  JC 7 00 2L7      4  4--4   4   8   4 6   8  - '     -   4-47 %2      -     8           7 %- '      . 5 J!L - 2 .   2   4        P J+L -      (
2 2 P  J)L  (
2   4  J  -24 L7  -   2 4  -4       -'    2 8  - 8  2  7             2 8  - 8  2  8 2  7 )              A 3 4   JC 7 00 L7        . -   24  7    4  2 .  8  4 8     .    2     8      .    2     7  ! %    (8 2 8 !8 2  J('  !' '  L8 +8 2   J!'  +'       '   L8 )8 2  J   +'      2 ' 5 G7    L JC 7 00L7  - 2  2    8 - '    8 2   8    --         7        .  - 4    4 - 4  -T  -   .  -   4  8  -     8  ' B   4  7 -  - 2      -  2  7         2 7 )        2    2   - 2'4  2    4    4   7 =H4 .       2 - -   -   44 9  7   4        2  . 2 47 J!( 4   -  L
"R;J"E)L
344 9  7 C  -8 2  4   -    #8   44 9    ++8   4  24    5 JM!( #N
"R+(L;J"E)
++R)0LR"0 J 4 2  -  !((L7 G7D      5I78  -  4   JL .     24 ' 4'        2 !+ H4   2  &T 4 8  = 4 8     2H4  - 2 -     4  -   G 2 F '  7 4   2     4  24   4   ' 4  8 4   .   .      -8  '    2  7  H4  H4   U V  U V -  4       .  - 2     4 -2   24 7  4    8  -       .    4  ' 47   - 2 H4-   !'8 1'8  +('- 4 . 7 .   H4         - ' 8    -   4 2     '    2 2   4 - 7  - T        -T     -     - 7 C  .'4- 4   -2    -     2- )      2  -     - 7    U   2  .'4-V   2 -8 4 -    H4  4   22 2  4 7 &     8  4    2  28 8 8     7 % 8 -2 24  2 2     4        ' -    24  2 -2    -   -  - 8  -  2   7 C  -8  -    (K 2 -  -  4
8 2     98 -2   97 38      -       )(K  2  1' .      7         %4  2   4 2       -   7 G 2   -   .  .   2  24  4  2 4 . -       4H4 - .' 4  2   -47  4   2         4-  4 .  4  4  2 -      7 C 4 01    H4      -   -- - 7   - -   4  -   - 2    2 2  .'4- 7  -T 4-       H4  !+8   .  24'    4 6 7 %2  8        . H4   !(8 .    . 7 &   !+ 24  H4 P -  4     .    U V  U V  7         2  J2  22 4  L7  - T      -        -4 '  2  -7        4      4  2   8 4     4 2       4-  7    4      -T 8 - -' 8  -4 2  .'4- 7  2  .'4-   4  2      2  4   . -  2   4   2  -  4 . -2  7 C 4 01    4  2 7  -    !+ H4'   2  -   -2 4 J2  -8 R   2  .'4-8   R9?98  R   4   - L  4        7 22 . %3 G7   3 IL  ) )      ) )      "     2- )      % 3 IL  ) )       !       % G7  3 IL ) )               H4        U!V    .  U(V      4      7    4 2  ' . 2    H4       4 2 - -    - 2 -    4- .  -2   24 7  -  4    4   2       2  .'4- -      24     -   2     4-7 C 4 01    $- -8 .  . -  ' -  2 24  4 7
  4 2  . -  4  8 2  -8   9?9 4    2  - 8    -   2  2  -7  -    4  .  24  4  -7  21 )   %- &)+%-' %% G7I   CD /3-CD1F  C')# JC 7 0 8L   4'-4- 8  '2   4 .  )# H4 7 %    1' - 2 2 24    .'    .  -   ' -     4 4   -2'  4  7 %    48  --        -2  8 8    4-7     8  C')#  -  4' 24  4  2   -2 - -4 8  -  '  4  2 8   22   2 - ' 4   .    2 22 7    - 4' B  -    4  2  C')#P  .     '  - 2     J!'- 8 +'4L 4 2   C' !+P  -  2  :  +7( 2  C')# JC 7 0 8 LP -   4  2 4-  4     4     P  .         "(  4  - 2  %  S4 2 2  J%SL
 6P  4  2     7 )+%- 0   -   .  C')#   4   *8((( -4 P   2    -4  ! 11  4  +(((  4    -    C')#   4'    UCV 2 2   J4' .  7 +((+L7     - 2    4      - 2  C')#8  -

  4 8 4  2     8   '       2 2  C')# 4T 4 JF  7 ! )L7  2   .  4B   2 . -'.   4  C')# JF   4 ! +P    7 ! )L7    4 4   -     2  C')# -     -  4 4  -   2    4 JF  7 ! *P F  7 +(((L7  4T 4   4-   4    4-' '      2     4  4 -  :  +7( JC')#+L8 .  4  . JF  7 +(((P F  D  +((!L7  2 4 48 2 -4  ! " JF  7 ! "L   4-  JF  7 +((+L - %/ G7  3-CDG    3 I7  )+%- )   21 )   %- &)+%-' %4 3 I7 &  ' %- G7  3 I7 &  '  21 )   %- &)+%-' %13-CDG ,  3 I7  )+%- 8  %5 G7  3 I7 &  '  21 )   %- &)+%-' %2 3 I7 &  ' /3 G7  3-CDH    3 I7 )+%-  )   21 )   %- &)+%-' / 3 I7 &  ' / G7  3 I7 &  '  21 )   %- &)+%-' /%3-CDH ,  3 I7 )+%-  8  // G7  3 I7 &  '  21 )   %- &)+%-' /4 3 I7 &  ' /- G7   2   2   C'!+  4 8        4 2   4 2 !+ C')# 7  2     -  -   4 2   - 2  C')#   .      22  9 .  &. J! #L7   8  C')# . 64       .  4  -   4  4    - 4 2   . 2 UH4 2 2V 4 -4    1  2 J$  7 +((+L7    2 '    4  C')# 4    4 2 4 2  4   . -4    -  2 4     C')# . -  5 "66--- 07
7  424 2  C')#    4    -'  '-2  .  - -4     4'        +((      7      2H4 4       8 . "(    C')# -4  8 5 8  -8 8   ' 4 8   4 -4  8 - 8 8  ' 8    8 %:E 8  -'  8   .    8   8  .  -8 4' -  8 44     8 4 44    8 '  8 -    8 4  8 -   8 - 648  8 4 48 4  -  48 -'  8  4 J4' .  7 +((+L7   2  C')#    46 2    "(( -4'         ++  47     4    -4 2  !)  47       )+%-  C')# .  4  2 4 -       2   4-  - 7      - . '  2  *( 4      4  4 J L J.  F ! +L7     -    2H4 4  -  .  '4  4       22  '    JF  7 ! )P F ! "L7  H4     - 4- -     2 8  21 )   %- &)+%-' /1 4  5  4 24   24 8   .'  8 6 -   46  8    2 4  42 4 2'4  2   4 JF  7 ! )L7  C')#       4     4   ! 0(  ! 1( J. @ F ! +L8 4   2 5  $
    F'  %  J$
F %L J94-4 ! 1*LP  4 -     24  4 J
  7 ! 0)P 4 @ 3 ! 0)P A     7 ! 0*P .  7 ! 1!LP  
-  S4  J
SL JF ! 0#LP   4  -    424 4   %4 =-'  J%=L J    7 ! 0 L7      - H4   2      48   - . 4 2   !* ' C4   F' 
 2 JCF
L J.  F ! +L7  CF
.   4 2  H4    4   - 2  4   C')#7  C')# . 2      U  -V 2   ! 11   U  V 2   ! ( JF ! 11P F   4 ! +L7  4 . JF  7 ! )L8    2      '2 4 2  .         2  )#     -  -    .   8 2     7 )+%-  # C )   &
  3' % ! #8 :  +7( 2  C')# JC')#+L JC 7 0 8 L .  4 8    2  2      7   - ' 8 .  4   C')#+ 4T 4 JF  7 +(((L8 . - 2 24 4 4   H4  H4  7 2 8  C')#+ -  4 5
%-   4   H4       -2  .        2    ' 4 4P
 -   4 2  H4   .   2' '  2          -8   ' 4  - P
$  - .    44  -  .  '4   G     4P
C' -     - 2    4 -    2      .   24  P  8 /5 G7 
C' J - 2 'L -     -2      J L  : J:L 7 )+%-T C )   #  U  H    C')#Z  4 5 4 @ %-  $4    )+('-  4T 4  4   -8   8    @ ' -  2  C')#Z  4 7  4 4   - -4  @  -2   2   1 C')#Z 8     4 48 .   46 2   4 J C')#
     4 5  4 2  G 2 :'   !8   =  L7 JC')#Z       2  1   8
 7L G7L 9, 5HH: GGH8   -       .'   -   -   -7  H48  .     8    4 2  !(     - 2 . --8  -'    44 2  -T -  2    2 -7 %  -   46     2   - U 4 -    -   V8 .   - U -  V7  46     2 -       7  4     4   2  B   7 A  7 M!!+N     2       2 7  : - 8 2 8 4-  4      '   8  8   2  -  -   .     -4 7    8    -4-     '  .   2      2 -      '  7   - 422         4    447 C 8  4 2 4  4  -   4 22    2 7  -  .  4    -  -  -   4  -   .  .  7    2   - . !('8 !"'8  +('    2     "'  J"       8      - .  22 )       !   &)68@' /2 4 ( " L7
     2 22   4  - 4 2    7 :4    2 4   2   4  44 - 4      -  2    7  4           '   . 4      8 4 .  4      4   4 . -     -      -  7 G77         2 /
,!1 5GGC8 F   4  -     J
9%L .  -  - '    2'  4  . 4 2    -   .       2 -24  4 7  
' 9% .    4 4 4     7 @        
9% .  - 2  4   4-  7 % . '    4  - 2  4  -    2 -   8 2    4 4     4  7     2  
9%   2 +(   4-  -   48  .   -    -   4   -  4   4 '    -  -7  2   2 

4 .        - 2 2 -  '    .  4  - 7 %  22   -           H4   -   8    .  2   47 % . 4  2   2 2  2  
9% 2 '  .  .  2    .  4    2          .  .7  - 4 .  4 2    2     4 .  4 2  !!  1  J +!L7  
9% . 2'   8   2 2 8 H4 " !( 4   -7 43 G7    HG )       !     C      P )  8      VVVVVVVVVVVVVVVVVVVVV E   ! VVVVV  E          P ;  VVVVVVVVVVVVVVVVVVVVV E   ! VVVVV % $         P ;  VVVVVVVVVVVVVVVVVVVVV E   ! VVVVV /      !     P ;  VVVVVVVVVVVVVVVVVVVVV E   ! VVVVV 4 6        P ;  VVVVVVVVVVVVVVVVVVVVV E   ! VVVVV .,1  C         P )  E    P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV  E    ! P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV % 6           P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV / 6       !     P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV 4 6      P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV - 6  !7     P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV  22 )       !   &)68@' 4   HG &  ' ) 1     !7  3   P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV 5 $       !  P ;    VVVVVVVVVVVVVVVVVVVVV )    $"   VVVVV )     .  4  4  7 :4     2     .  46 4 ' -      .  -   - 2    ' 4 2  -   . 4   7  4   4   
9%   2  B    . .   4    7 :  8 -'  --   2     4 8 . -    2  7  - . 4  -        -     -  - 4  - . 4    4  - 7  
9%T     .    4-    '  2 -   4 2   4  -  .  24  2  4 2 4   . -   . ' -  .    2  -   4 7  4   . 4 2          B    !+   2 H4  7  4   2  (  !! .       - 4    2   7  4   . 4        2   4     4   4   -  2     .  --   467  4 .  4-  !((7      -    -' - .   4    4 -   7 %2  46     .    --8    . 4 7 2 8    4     2  (  !(( .        -7    
9%   . 4' 4 G7       -   4  7 48   '  
9%    4    2  (  !((7  
9% --   24  .   - - -4     - 2   7     .  4   B  .   4    4 .  4  -     24   7  
9%    2'   % 7 G  '  8           7
 4  4   - - 4 2  
9%7 2     8  .8   -   -  
9% . 4 24 7 2 8  
9%  4       4      -T -    7  
9%      8 ' '  8      4   7 %  --         - 4  7  
9%  4 2  -     424 %4     -    7 G7GJ -                         E!    5I68 F S4    2   2   4     -2  4   -    48  - -'   2  -   24  2    4 6 7  -4-  2  --   -  2'  H4       -   24  2   4    -   4 2  - - 4  2    8  8  -     7         - H4  .  -  .  -   - . .    2         4 7  4 2  - . . 8   H4  . '  2   8  - 8   2  -   2 3 )    "             4%    7   .  2       - 4  '  H4   . - -  7 2  ' 8 H4    -   8 4  4     4    8   4     '  2  ' 4 .   - 4  4 H4 7   4  A S4  4   -   ' 5   8 -8  8     8 . 8  2  J ++L7  28       .  -   .   .     ' -     -  J ++L7      JS4  !L   2  !('   4  7  4       8    2 .  2     2  -       4 7 %  8    2  ( J -  L  !( J .L8 .    4   . (        -7 = 2        2   2 4-'   H4  . 2     2  ! J- L  " JL7 =     -       2   ' - H4   4-   . 7 48  -    2      2  + J- L  !( JL7  -    2 2 4 H4      2 -   JS4  +L  4  JS4  )L8  2' H4 2 -  2 . - JS4  *L8   2' H4 2  - JS4  "L7       2  H4 8 4    H4    2    2   JS4  #L    2 H4    224 .  -  8 4  -4      -4  8  '  8       8   .   . 8      JS4  0  !!L7          2  H4'  7   2     2   4 '      JS4  !+L8   H4  '  2    2 224   .        JS4  !)L8     .  -    ' 4/ G7    HH )    "   E      P 0  $  +     & '    !      P 0  $  : 6       "                !         "        *     "   !        !      !      *       "                 &    '                          *      !      
  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
    "      23  @       *      !            P 8'
   :' )  ' #  @' # A' ; % @       *      !           - *

4P 8'
   :' )  ' #  @' # A' ; / @       *                 -''  '  1  2   P 8' A   :' )     ' B    @' 0      A' ;  4 @       *        4 2      P 8' A   :' )     ' B    @' 0      A' ;   2 3 )    "             44   HH &  '   "      -1 4 -                -1 2  -   - 4 &*  *  *  *      * '*      !   !       P 8'
   ( ! :' )   ' #   @' #  A' ;  O   1>  @       *                   -   1   -P 1 6             8' I! :' )     ' #     @' #    A' ;    5 !  !  8' I! :' )     ' #     @' #    A' ;    2 $       !     8' I! :' )     ' #     @' #    A' ;    3 )        !     8' I! :' )     ' #     @' #    A' ;     0      !   ,5> 3 ! &%->/4 '. 8' I! :' )     ' #     @' #    A' ;    4- G7    HH &  '   "          4                - *     4 &* ! !*  * !   * '*       !         P 8'
   ( ! :' )   ' #   @' #  A' ;  % @       *            *  , 4-  4*         P 8' I! :' )     ' #     @' #    A' ;    / 0     &   '      7            *  * -   1   - 8  VVVVVVVVVVVVVVVVV 8' I! :' )   ' #   @' #  A' ;    "       4 @       *    !       P 8' 6  &  ' VVVVVVVVVVVVVVV :' C  ' )  @' I A' @ !        +' @ !        H' $     @* A* +*  H    !  "  *    "   -> 2     "   3  2 3 )    "             41   HH &  ' - @       *      ,   1      !       P 8' 8  :' )     ' B    @' 0      A' ;  1 @       *          *      !       ' 1   ''1       !       P 8' 8  :' )     ' B    @' 0      A' ;  5 @       *          *             -1 !       P 8' 8  :' )     ' B    @' 0      A' ;  2 @       *          *                       !       P 8' 8  :' )     ' B    @' 0      A' ;    "      '    '  52 453 3 @       *                    P 8' 6 :' + ' H @'
  A' A 45 G7    HH &  '   6                   52 45 &       *         ' 6 VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV @         VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV $      VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV E VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV            "              -4 6        '      JS4  !*L7  .   4       H4    B  2  2 .  JS4  !"L  2 4   H4     2H4 2    .  JS4  !#L8   .  22 JS4  !0L8     .      JS4  !1L        . 44 .   -2  JS4'   ! L7  2   JS4  +(L   2    H4     -       ' 2  2  -   7      4        4      - - 7 C 8  -   JS4  +!L  .  -    .   .       - 7    !8 2    - 8  +8 2      - 7      4       4   4 .    2    4    2 4 -   ' 4      -    -     4B  .   4    '  7  4  .    2   4  2      .  - 2  4  .   4  4    -      -  2  2  7  ' 4   . !" -  2     J    4' -  !7"P    8 (  !" - L8 *( -  2  - J    4-  2 4P    8 1  *( - L8 +( -  2    J    4-  . P    8 *  +( - L8  2 FB  G "         42 !" -  2       J    4' -  9:;    8 )  !" - L8  !( -  2  .  J '    4-  P    8 +  !( - L7 2 8    -      2  !0  !(( - 7 G7GG =02>                 5HI8 F @     "   % 8  4  . +( -    4-  4     2  .  ' -  -  -  .   4 7 C   ' 4  2   H4 8  4  2  ++' H4      +( . -7  .       - 2  H4 8     -       2  .   4    --  -7  .          -   4   24  4  -  . .      7 %     .    4- 2 - .  '   .  4     44  2   4 7  .    -  2 -    '     -2 7  4  4    4- 2   4        - - .  -24  4        2     7    H4  .  2 2  -  4      .   . 24  4- 2 - 4  2 2  .  7    !+ 8  2 .  2 -    JC 7 1(L7 =     2  !  "8 2      224   8     - 4      .    2  !+ J 224L  #( J  224L7  4    -      !+' H4  . - 2    -  . -   8

  -       --  2  4  - 7 %    2  4   4  4 4 -   -    4    -7 C. -   22' 4   - 7 -3 G7  3 LJ B  )    )  2 FB  G "         - - G7   2    H4   44 2  - .  4      4-    -   -  .  3   4    J 9  ! )L7   4  H4  -    4 2 4  2   4  -  .   8 -8 8   '    -   7 G7GH 02         5HD8 F % 2   4  -  -4 -  2     -   2 8        - 2 -    -  2 -       -2 7 @     "   % 8  4  . +( -    4-   .    2 .  2   4 8      2 .   .   -  -   - 7  4   2  !1' H4      +( . -7  .       - 2  H4      -       2  .  8   4 7  .          -   4   24  4  - '  . .      7    H4  .   2        . 24  4- 2 +( - 4  2 2  . '  7    !+ 8  2 .  2 -  '   JC 7 1!L7 =  .   2  !  "8 2      224       - 4      .    2  !+ J 224L  #( J  224L7  4    -      !+' H4  . -  2 4    -  . -   8   -  2      --  2  4  '  7 %    2  4   4  48  -  2. 224 2   -7        ' - 48  2   H4                 4   4 7  2  B      ! "   -% 3 LG B  )     ! ) -/ G7  3 LG &  '  2 % $  -4 G7GC )  5GGD8    J +)L .   2   4  4 2  -7   HC $   :    %  "2 ' /L7MIK1 3  /I6MKG1
   /GJJM7J1 /KJ  1 ,1 ;  * 43 ; ; ; $   ! *              8   %3 ; # #  #                                                       ) !  3 ; ; ; & "  !  !  !   ' $  3   # 33L  3 33L 14L  43L  ;        ( 43L *        ( ( ( &   *   14L    '         43L               14L   4  *        -- G7    HC &  '  %  "2 ' /L7MIK1 3  /I6MKG1
   /GJJM7J1 /KJ  1 43L   4    14L        43L   3     (      ;   %3 6   # #  #     (      (     *    !        (      #  4                  ( (    (           !   (        *    *  #  3  *    *    *  *  (       * (    #  3  (          !     33  ! G7G6   )    $    5D68        A .  7 M!!#N .  2 2   4     -   4      .  4    2  -   .  46  2 -8  8     J +*L7  2 4  E  B     !   &EB)' -1   H6 6       ,     ;           (     43     ;       (    7   /3 !    7    ;          (     %4  7   #           ( 3       7   #     ( !      3  ; 3 #  4 )  3 ,1 ;       !  %3 ;        !     4 6             !  3 6   +  3 A"       4L     4 H   4L     3 A 23> 33  (   13>52  (  /3>-2  (  %2  G7GK  <  0       2 /<0!1 5IJ8 F  -4-  2  4 .   -   8 8  - '  4   2  - .  4   7     -T 46 -  2    24      -    4 2  8  .     ' -2 H4 2 2 4   .   -- -7  ' -5 G7  3 LH  E  B )     !   &EB)' 48  F   4     JF%L8 .     4   - 4  4    4  2  - .  4   7 9 - 4  J!L  2  2  -2 - - -4'  P J+L   2 4 -2   U V JUVL 2  ' .  48 .   8  . - -   -8   -   8  P J)L   4  4 -'  2H4 '- '  2 4  E  B     !   &EB)' -2 3 LH &  '  - 4     P  J*L -  -  '  - 4  .  4- 2 !( -7  F%  +! 7  2 8 .  -   -'  8   !( 7     - 8  8  .  J* LP 2  J* LP     J) L J C 7 1+L7     -   (8 .  2   -      4 ' H4 2 27  .    -   +!((7   2   -       4 ' H4 2 27  4   -    4    4 ' 4   2  - .  4   7   -T . --  2     4     -   '   2  4 2  8  4  4    ' 4    4  4   - 4     13 G7  4    - - -4 8  4   24  H4  2  4      -  2 -   -7 G7GD  < -            5GCC8 % ! 10 F -4  4   2    2 '    2   4  .   .  C 7 1)7 G7GI  <  0      2 /<0 1 5D78 F  -4-  2  4 .   -     ' -2 H4 ' 2'2 4   2  - .    422 7   2    -  4  2    4   2  . 5 J!L  2  2  -2 - - -4 7 J+L $  2 -  8 J)L   4 8 J*L -   - '   - 48 J"L   2  8  J#L   7  FA3   2 +!  - 2  -  ' H4 2 2 JASL7    H4    -   -  8 2 4   -     8 2 4   .  8 2 4   2  8         JC 7 1*L7 %  2 48     -    2  (  !(( J!((  :L8               2  (  +!((7

       -     +!((8      -     (7  -       '  24 2 8      -    -  2    4    2  +!((8    +!((8  4-   !((7 C  -8  - .      2 !1(( . 4   -'     2 J+!(( !1((LE+!((
!((R!*7)K7  4     4   - 4   '   4    - - -4 8  4    2 1  E  B     &EB$' 1 3 LC E @  ) 1 G7  24  H4  2     -T -   '  -7 3 L6  E  B $    &EB$'  2 1  E  B     &EB$' 1% 3 L6 &  ' 1/ G7  G7GL       --    / -B01 5K78 F      - -B0  A3'S .  -  4   -  2   8   4 8 - 8  E   7 % . '  2     4  . 2  48 4  . '  -    2    422 8   2  2  '-2 H4 ' 2'2 4  48  .   4   -4 2    2 - .  24 -4 2  '   422 7  -  4    422 -    2  - -    -      422 27  -4 4     2  4 2   -   4     422 -    H4'  ' 2'2 47   . 2 4   - H4 '   .    !(('-  4   J:L -  2  . 4 7  - H4  .     -   -  4- 2 +( - . 4    422 7 = - 4 .  44 .  .   4   2    7  .   2 2 H4  -'   .   .  -- -8 .  -      -      H4 2 28 .  -  4  -  H4 8  .  - . 4 4    2    H4 7   ""' H4  .   - P  . - 4       H4   - H48      4 2  : -  2 7    2 H4  H4 8  4  2  ""' 4   8     H4  .    7  H4  4   -  2       H4 ' 2'2 48  -  2    -8     2 ' 4    4   2  2 7  H4 '  .  4 2  2  H4 7   2  4  .      H4     4- 2 )(  4 - . 4    422 7  H4  .     2 .  2 5    "      &$OB0' 14 -  8 + . -8   E   4   7       4 J!L    2' 2 .    2  H4  2     ' 4 H4   J+L    8  4  !((7 % .   -    H4  .      2 !"K   . 4     2    2   2 H4 7  4 H4  .  4     - 2           4   7 .  -  2    .  7 % .  - B   A3'S  4     4 .     422 P   . 8  4 2    . 4   7  4 2    A3'S H4  .  4 2  ""  )*P +! 2    H4  .  4 2 -  E  8  4  8   2 - 7  +!  .     2   H4  H4 ' 7  2 )*' H4         22' 3 LK  $  O  0  #  &$OB0' 1- G7  3 LK &  '  2 "7("KP  -  "'-         J 4 2 !(( - L7     2   .    2  H4  .     J"171* 7 " 7#)L8     2 -       4 7  2 )* H4  . 4  2 -  ' - 22 - 2 H4 2 2   -     422  2 5    "      &$OB0' 11 3 LK &  '  2   4 7  . H4     2 J!L  -   -   -8 J+L -    8 J)L . '   8 J*L 2  48  J"L       4 J C 7 1"L7  H4  .      2      2  - -4     2   - 2  %' 47 15 G7  G7G7  <  0           2 /<001 5LJ8 F  -4-  .   -     '-2 H4 2 2 4   2    JL 2   4 7  %4 .  4  4   - 4  4      - .  2   4  . ' - 4  -2    -   5 J!L  2  2  -2 - - -4 P J+L   P J)L   4 P J*L - 2  -   - H4   J"L    '    -  2  2 H4 7  2 4  ! 8 -  2 4  J H4  2  -  -   - 8 2 H4  2  - 8    .  24 8 2 H4  2  2  24    H4  2     24  JC 7 1#L7  -    --  !( 7 %  2 48  H4    -    2  ( !(( J!((  :L     4-   2  4 2  H4 .  7              2 ! ((7        -     ! ((      -     (7 %    -        24 2 8      -    -  2    4    2  ! ((8    ! ((  4-   !((7   -8  - .      2 *"( . 4   -    2 ! (( *"(  !((
0#)
! ((  4   -2 4       46 -       4--   4   2  2 -  44 2   2  H4 7  4   -2 4       .   4    7  24  . 2       -    46  4       .  7 48 ' 4 4  4      - . 7  2 2  E  B            &EBB)' 12  F     4   4   2  - .  2   4     8     - 7   -T . --  2     4     -     2  4 2 8 . 4    4     4   - 4     2    - - -4 7 % - -   .    4     7 53 G7  " !0# ,N
      " !0# N !# % !0# 0
,!"#  @  @<. !# % !0# 0
,!"#   "                             !     *    !                                        &6       &6          FDG'    FDG'  C       1 C                P       !      P              C    *            P 5 C            !7 &  ! * !  '     !     P % C             P         2 C                   !         * / C                  P !       P               4 C       3 C