questionFrontendId
int64 1
3.51k
| questionTitle
stringlengths 3
79
| TitleSlug
stringlengths 3
79
| content
stringlengths 431
25.4k
⌀ | difficulty
stringclasses 3
values | totalAccepted
stringlengths 2
6
| totalSubmission
stringlengths 2
6
| totalAcceptedRaw
int64 124
16.8M
| totalSubmissionRaw
int64 285
30.3M
| acRate
stringlengths 4
5
| similarQuestions
stringlengths 2
714
| mysqlSchemas
stringclasses 295
values | category
stringclasses 6
values | codeDefinition
stringlengths 122
24.9k
⌀ | sampleTestCase
stringlengths 1
4.33k
| metaData
stringlengths 37
3.13k
| envInfo
stringclasses 26
values | topicTags
stringlengths 2
153
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
101 | Symmetric Tree | symmetric-tree | <p>Given the <code>root</code> of a binary tree, <em>check whether it is a mirror of itself</em> (i.e., symmetric around its center).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/symtree1.jpg" style="width: 354px; height: 291px;" />
<pre>
<strong>Input:</strong> root = [1,2,2,3,4,4,3]
<strong>Output:</strong> true
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/symtree2.jpg" style="width: 308px; height: 258px;" />
<pre>
<strong>Input:</strong> root = [1,2,2,null,3,null,3]
<strong>Output:</strong> false
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[1, 1000]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
<p> </p>
<strong>Follow up:</strong> Could you solve it both recursively and iteratively? | Easy | 2.4M | 4.1M | 2,392,757 | 4,064,961 | 58.9% | [] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n bool isSymmetric(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public boolean isSymmetric(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def isSymmetric(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def isSymmetric(self, root: Optional[TreeNode]) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nbool isSymmetric(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public bool IsSymmetric(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {boolean}\n */\nvar isSymmetric = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction isSymmetric(root: TreeNode | null): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Boolean\n */\n function isSymmetric($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func isSymmetric(_ root: TreeNode?) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun isSymmetric(root: TreeNode?): Boolean {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n bool isSymmetric(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc isSymmetric(root *TreeNode) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Boolean}\ndef is_symmetric(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def isSymmetric(root: TreeNode): Boolean = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn is_symmetric(root: Option<Rc<RefCell<TreeNode>>>) -> bool {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (is-symmetric root)\n (-> (or/c tree-node? #f) boolean?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec is_symmetric(Root :: #tree_node{} | null) -> boolean().\nis_symmetric(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec is_symmetric(root :: TreeNode.t | nil) :: boolean\n def is_symmetric(root) do\n \n end\nend"}] | [1,2,2,3,4,4,3] | {
"name": "isSymmetric",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
102 | Binary Tree Level Order Traversal | binary-tree-level-order-traversal | <p>Given the <code>root</code> of a binary tree, return <em>the level order traversal of its nodes' values</em>. (i.e., from left to right, level by level).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/tree1.jpg" style="width: 277px; height: 302px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> [[3],[9,20],[15,7]]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = [1]
<strong>Output:</strong> [[1]]
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 2000]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
</ul>
| Medium | 2.7M | 3.9M | 2,749,829 | 3,922,746 | 70.1% | ['binary-tree-zigzag-level-order-traversal', 'binary-tree-level-order-traversal-ii', 'minimum-depth-of-binary-tree', 'binary-tree-vertical-order-traversal', 'average-of-levels-in-binary-tree', 'n-ary-tree-level-order-traversal', 'cousins-in-binary-tree', 'minimum-number-of-operations-to-sort-a-binary-tree-by-level', 'divide-nodes-into-the-maximum-number-of-groups'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<vector<int>> levelOrder(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<List<Integer>> levelOrder(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def levelOrder(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[List[int]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def levelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nint** levelOrder(struct TreeNode* root, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<IList<int>> LevelOrder(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[][]}\n */\nvar levelOrder = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction levelOrder(root: TreeNode | null): number[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[][]\n */\n function levelOrder($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func levelOrder(_ root: TreeNode?) -> [[Int]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun levelOrder(root: TreeNode?): List<List<Int>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<List<int>> levelOrder(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc levelOrder(root *TreeNode) [][]int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[][]}\ndef level_order(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def levelOrder(root: TreeNode): List[List[Int]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn level_order(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<Vec<i32>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (level-order root)\n (-> (or/c tree-node? #f) (listof (listof exact-integer?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec level_order(Root :: #tree_node{} | null) -> [[integer()]].\nlevel_order(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec level_order(root :: TreeNode.t | nil) :: [[integer]]\n def level_order(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "levelOrder",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<list<integer>>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Breadth-First Search', 'Binary Tree'] |
103 | Binary Tree Zigzag Level Order Traversal | binary-tree-zigzag-level-order-traversal | <p>Given the <code>root</code> of a binary tree, return <em>the zigzag level order traversal of its nodes' values</em>. (i.e., from left to right, then right to left for the next level and alternate between).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/tree1.jpg" style="width: 277px; height: 302px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> [[3],[20,9],[15,7]]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = [1]
<strong>Output:</strong> [[1]]
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 2000]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
| Medium | 1.4M | 2.4M | 1,440,082 | 2,351,198 | 61.2% | ['binary-tree-level-order-traversal', 'zigzag-grid-traversal-with-skip'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<vector<int>> zigzagLevelOrder(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<List<Integer>> zigzagLevelOrder(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def zigzagLevelOrder(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[List[int]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def zigzagLevelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nint** zigzagLevelOrder(struct TreeNode* root, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<IList<int>> ZigzagLevelOrder(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[][]}\n */\nvar zigzagLevelOrder = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction zigzagLevelOrder(root: TreeNode | null): number[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[][]\n */\n function zigzagLevelOrder($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func zigzagLevelOrder(_ root: TreeNode?) -> [[Int]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun zigzagLevelOrder(root: TreeNode?): List<List<Int>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<List<int>> zigzagLevelOrder(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc zigzagLevelOrder(root *TreeNode) [][]int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[][]}\ndef zigzag_level_order(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def zigzagLevelOrder(root: TreeNode): List[List[Int]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn zigzag_level_order(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<Vec<i32>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (zigzag-level-order root)\n (-> (or/c tree-node? #f) (listof (listof exact-integer?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec zigzag_level_order(Root :: #tree_node{} | null) -> [[integer()]].\nzigzag_level_order(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec zigzag_level_order(root :: TreeNode.t | nil) :: [[integer]]\n def zigzag_level_order(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "zigzagLevelOrder",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<list<integer>>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Breadth-First Search', 'Binary Tree'] |
104 | Maximum Depth of Binary Tree | maximum-depth-of-binary-tree | <p>Given the <code>root</code> of a binary tree, return <em>its maximum depth</em>.</p>
<p>A binary tree's <strong>maximum depth</strong> is the number of nodes along the longest path from the root node down to the farthest leaf node.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/11/26/tmp-tree.jpg" style="width: 400px; height: 277px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> 3
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = [1,null,2]
<strong>Output:</strong> 2
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 10<sup>4</sup>]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
| Easy | 3.9M | 5M | 3,873,471 | 5,037,169 | 76.9% | ['balanced-binary-tree', 'minimum-depth-of-binary-tree', 'maximum-depth-of-n-ary-tree', 'time-needed-to-inform-all-employees', 'amount-of-time-for-binary-tree-to-be-infected', 'height-of-binary-tree-after-subtree-removal-queries'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n int maxDepth(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public int maxDepth(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def maxDepth(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def maxDepth(self, root: Optional[TreeNode]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nint maxDepth(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public int MaxDepth(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number}\n */\nvar maxDepth = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction maxDepth(root: TreeNode | null): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer\n */\n function maxDepth($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func maxDepth(_ root: TreeNode?) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun maxDepth(root: TreeNode?): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n int maxDepth(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc maxDepth(root *TreeNode) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer}\ndef max_depth(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def maxDepth(root: TreeNode): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn max_depth(root: Option<Rc<RefCell<TreeNode>>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (max-depth root)\n (-> (or/c tree-node? #f) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec max_depth(Root :: #tree_node{} | null) -> integer().\nmax_depth(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec max_depth(root :: TreeNode.t | nil) :: integer\n def max_depth(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "maxDepth",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
105 | Construct Binary Tree from Preorder and Inorder Traversal | construct-binary-tree-from-preorder-and-inorder-traversal | <p>Given two integer arrays <code>preorder</code> and <code>inorder</code> where <code>preorder</code> is the preorder traversal of a binary tree and <code>inorder</code> is the inorder traversal of the same tree, construct and return <em>the binary tree</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/tree.jpg" style="width: 277px; height: 302px;" />
<pre>
<strong>Input:</strong> preorder = [3,9,20,15,7], inorder = [9,3,15,20,7]
<strong>Output:</strong> [3,9,20,null,null,15,7]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> preorder = [-1], inorder = [-1]
<strong>Output:</strong> [-1]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= preorder.length <= 3000</code></li>
<li><code>inorder.length == preorder.length</code></li>
<li><code>-3000 <= preorder[i], inorder[i] <= 3000</code></li>
<li><code>preorder</code> and <code>inorder</code> consist of <strong>unique</strong> values.</li>
<li>Each value of <code>inorder</code> also appears in <code>preorder</code>.</li>
<li><code>preorder</code> is <strong>guaranteed</strong> to be the preorder traversal of the tree.</li>
<li><code>inorder</code> is <strong>guaranteed</strong> to be the inorder traversal of the tree.</li>
</ul>
| Medium | 1.5M | 2.3M | 1,518,910 | 2,288,403 | 66.4% | ['construct-binary-tree-from-inorder-and-postorder-traversal'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n TreeNode* buildTree(vector<int>& preorder, vector<int>& inorder) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public TreeNode buildTree(int[] preorder, int[] inorder) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def buildTree(self, preorder, inorder):\n \"\"\"\n :type preorder: List[int]\n :type inorder: List[int]\n :rtype: Optional[TreeNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def buildTree(self, preorder: List[int], inorder: List[int]) -> Optional[TreeNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nstruct TreeNode* buildTree(int* preorder, int preorderSize, int* inorder, int inorderSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public TreeNode BuildTree(int[] preorder, int[] inorder) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {number[]} preorder\n * @param {number[]} inorder\n * @return {TreeNode}\n */\nvar buildTree = function(preorder, inorder) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction buildTree(preorder: number[], inorder: number[]): TreeNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param Integer[] $preorder\n * @param Integer[] $inorder\n * @return TreeNode\n */\n function buildTree($preorder, $inorder) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func buildTree(_ preorder: [Int], _ inorder: [Int]) -> TreeNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun buildTree(preorder: IntArray, inorder: IntArray): TreeNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n TreeNode? buildTree(List<int> preorder, List<int> inorder) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc buildTree(preorder []int, inorder []int) *TreeNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {Integer[]} preorder\n# @param {Integer[]} inorder\n# @return {TreeNode}\ndef build_tree(preorder, inorder)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def buildTree(preorder: Array[Int], inorder: Array[Int]): TreeNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn build_tree(preorder: Vec<i32>, inorder: Vec<i32>) -> Option<Rc<RefCell<TreeNode>>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (build-tree preorder inorder)\n (-> (listof exact-integer?) (listof exact-integer?) (or/c tree-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec build_tree(Preorder :: [integer()], Inorder :: [integer()]) -> #tree_node{} | null.\nbuild_tree(Preorder, Inorder) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec build_tree(preorder :: [integer], inorder :: [integer]) :: TreeNode.t | nil\n def build_tree(preorder, inorder) do\n \n end\nend"}] | [3,9,20,15,7]
[9,3,15,20,7] | {
"name": "buildTree",
"params": [
{
"name": "preorder",
"type": "integer[]"
},
{
"name": "inorder",
"type": "integer[]"
}
],
"return": {
"type": "TreeNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Divide and Conquer', 'Tree', 'Binary Tree'] |
106 | Construct Binary Tree from Inorder and Postorder Traversal | construct-binary-tree-from-inorder-and-postorder-traversal | <p>Given two integer arrays <code>inorder</code> and <code>postorder</code> where <code>inorder</code> is the inorder traversal of a binary tree and <code>postorder</code> is the postorder traversal of the same tree, construct and return <em>the binary tree</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/tree.jpg" style="width: 277px; height: 302px;" />
<pre>
<strong>Input:</strong> inorder = [9,3,15,20,7], postorder = [9,15,7,20,3]
<strong>Output:</strong> [3,9,20,null,null,15,7]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> inorder = [-1], postorder = [-1]
<strong>Output:</strong> [-1]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= inorder.length <= 3000</code></li>
<li><code>postorder.length == inorder.length</code></li>
<li><code>-3000 <= inorder[i], postorder[i] <= 3000</code></li>
<li><code>inorder</code> and <code>postorder</code> consist of <strong>unique</strong> values.</li>
<li>Each value of <code>postorder</code> also appears in <code>inorder</code>.</li>
<li><code>inorder</code> is <strong>guaranteed</strong> to be the inorder traversal of the tree.</li>
<li><code>postorder</code> is <strong>guaranteed</strong> to be the postorder traversal of the tree.</li>
</ul>
| Medium | 780.6K | 1.2M | 780,596 | 1,184,497 | 65.9% | ['construct-binary-tree-from-preorder-and-inorder-traversal'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n TreeNode* buildTree(vector<int>& inorder, vector<int>& postorder) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public TreeNode buildTree(int[] inorder, int[] postorder) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def buildTree(self, inorder, postorder):\n \"\"\"\n :type inorder: List[int]\n :type postorder: List[int]\n :rtype: Optional[TreeNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def buildTree(self, inorder: List[int], postorder: List[int]) -> Optional[TreeNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nstruct TreeNode* buildTree(int* inorder, int inorderSize, int* postorder, int postorderSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public TreeNode BuildTree(int[] inorder, int[] postorder) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {number[]} inorder\n * @param {number[]} postorder\n * @return {TreeNode}\n */\nvar buildTree = function(inorder, postorder) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction buildTree(inorder: number[], postorder: number[]): TreeNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param Integer[] $inorder\n * @param Integer[] $postorder\n * @return TreeNode\n */\n function buildTree($inorder, $postorder) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func buildTree(_ inorder: [Int], _ postorder: [Int]) -> TreeNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun buildTree(inorder: IntArray, postorder: IntArray): TreeNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n TreeNode? buildTree(List<int> inorder, List<int> postorder) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc buildTree(inorder []int, postorder []int) *TreeNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {Integer[]} inorder\n# @param {Integer[]} postorder\n# @return {TreeNode}\ndef build_tree(inorder, postorder)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def buildTree(inorder: Array[Int], postorder: Array[Int]): TreeNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn build_tree(inorder: Vec<i32>, postorder: Vec<i32>) -> Option<Rc<RefCell<TreeNode>>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (build-tree inorder postorder)\n (-> (listof exact-integer?) (listof exact-integer?) (or/c tree-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec build_tree(Inorder :: [integer()], Postorder :: [integer()]) -> #tree_node{} | null.\nbuild_tree(Inorder, Postorder) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec build_tree(inorder :: [integer], postorder :: [integer]) :: TreeNode.t | nil\n def build_tree(inorder, postorder) do\n \n end\nend"}] | [9,3,15,20,7]
[9,15,7,20,3] | {
"name": "buildTree",
"params": [
{
"name": "inorder",
"type": "integer[]"
},
{
"name": "postorder",
"type": "integer[]"
}
],
"return": {
"type": "TreeNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Divide and Conquer', 'Tree', 'Binary Tree'] |
107 | Binary Tree Level Order Traversal II | binary-tree-level-order-traversal-ii | <p>Given the <code>root</code> of a binary tree, return <em>the bottom-up level order traversal of its nodes' values</em>. (i.e., from left to right, level by level from leaf to root).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/tree1.jpg" style="width: 277px; height: 302px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> [[15,7],[9,20],[3]]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = [1]
<strong>Output:</strong> [[1]]
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 2000]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
</ul>
| Medium | 722.8K | 1.1M | 722,780 | 1,102,090 | 65.6% | ['binary-tree-level-order-traversal', 'average-of-levels-in-binary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<vector<int>> levelOrderBottom(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<List<Integer>> levelOrderBottom(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def levelOrderBottom(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[List[int]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def levelOrderBottom(self, root: Optional[TreeNode]) -> List[List[int]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nint** levelOrderBottom(struct TreeNode* root, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<IList<int>> LevelOrderBottom(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[][]}\n */\nvar levelOrderBottom = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction levelOrderBottom(root: TreeNode | null): number[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[][]\n */\n function levelOrderBottom($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func levelOrderBottom(_ root: TreeNode?) -> [[Int]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun levelOrderBottom(root: TreeNode?): List<List<Int>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<List<int>> levelOrderBottom(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc levelOrderBottom(root *TreeNode) [][]int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[][]}\ndef level_order_bottom(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def levelOrderBottom(root: TreeNode): List[List[Int]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn level_order_bottom(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<Vec<i32>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (level-order-bottom root)\n (-> (or/c tree-node? #f) (listof (listof exact-integer?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec level_order_bottom(Root :: #tree_node{} | null) -> [[integer()]].\nlevel_order_bottom(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec level_order_bottom(root :: TreeNode.t | nil) :: [[integer]]\n def level_order_bottom(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "levelOrderBottom",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<list<integer>>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Breadth-First Search', 'Binary Tree'] |
108 | Convert Sorted Array to Binary Search Tree | convert-sorted-array-to-binary-search-tree | <p>Given an integer array <code>nums</code> where the elements are sorted in <strong>ascending order</strong>, convert <em>it to a </em><span data-keyword="height-balanced"><strong><em>height-balanced</em></strong></span> <em>binary search tree</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/18/btree1.jpg" style="width: 302px; height: 222px;" />
<pre>
<strong>Input:</strong> nums = [-10,-3,0,5,9]
<strong>Output:</strong> [0,-3,9,-10,null,5]
<strong>Explanation:</strong> [0,-10,5,null,-3,null,9] is also accepted:
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/18/btree2.jpg" style="width: 302px; height: 222px;" />
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/18/btree.jpg" style="width: 342px; height: 142px;" />
<pre>
<strong>Input:</strong> nums = [1,3]
<strong>Output:</strong> [3,1]
<strong>Explanation:</strong> [1,null,3] and [3,1] are both height-balanced BSTs.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 10<sup>4</sup></code></li>
<li><code>-10<sup>4</sup> <= nums[i] <= 10<sup>4</sup></code></li>
<li><code>nums</code> is sorted in a <strong>strictly increasing</strong> order.</li>
</ul>
| Easy | 1.4M | 2M | 1,441,221 | 1,954,057 | 73.8% | ['convert-sorted-list-to-binary-search-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n TreeNode* sortedArrayToBST(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public TreeNode sortedArrayToBST(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def sortedArrayToBST(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: Optional[TreeNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def sortedArrayToBST(self, nums: List[int]) -> Optional[TreeNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nstruct TreeNode* sortedArrayToBST(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public TreeNode SortedArrayToBST(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {number[]} nums\n * @return {TreeNode}\n */\nvar sortedArrayToBST = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction sortedArrayToBST(nums: number[]): TreeNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param Integer[] $nums\n * @return TreeNode\n */\n function sortedArrayToBST($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func sortedArrayToBST(_ nums: [Int]) -> TreeNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun sortedArrayToBST(nums: IntArray): TreeNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n TreeNode? sortedArrayToBST(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc sortedArrayToBST(nums []int) *TreeNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {Integer[]} nums\n# @return {TreeNode}\ndef sorted_array_to_bst(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def sortedArrayToBST(nums: Array[Int]): TreeNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn sorted_array_to_bst(nums: Vec<i32>) -> Option<Rc<RefCell<TreeNode>>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (sorted-array-to-bst nums)\n (-> (listof exact-integer?) (or/c tree-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec sorted_array_to_bst(Nums :: [integer()]) -> #tree_node{} | null.\nsorted_array_to_bst(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec sorted_array_to_bst(nums :: [integer]) :: TreeNode.t | nil\n def sorted_array_to_bst(nums) do\n \n end\nend"}] | [-10,-3,0,5,9] | {
"name": "sortedArrayToBST",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "TreeNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Divide and Conquer', 'Tree', 'Binary Search Tree', 'Binary Tree'] |
109 | Convert Sorted List to Binary Search Tree | convert-sorted-list-to-binary-search-tree | <p>Given the <code>head</code> of a singly linked list where elements are sorted in <strong>ascending order</strong>, convert <em>it to a </em><span data-keyword="height-balanced"><strong><em>height-balanced</em></strong></span> <em>binary search tree</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/08/17/linked.jpg" style="width: 500px; height: 388px;" />
<pre>
<strong>Input:</strong> head = [-10,-3,0,5,9]
<strong>Output:</strong> [0,-3,9,-10,null,5]
<strong>Explanation:</strong> One possible answer is [0,-3,9,-10,null,5], which represents the shown height balanced BST.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> head = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in <code>head</code> is in the range <code>[0, 2 * 10<sup>4</sup>]</code>.</li>
<li><code>-10<sup>5</sup> <= Node.val <= 10<sup>5</sup></code></li>
</ul>
| Medium | 594.8K | 928.5K | 594,828 | 928,471 | 64.1% | ['convert-sorted-array-to-binary-search-tree', 'create-binary-tree-from-descriptions'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode() : val(0), next(nullptr) {}\n * ListNode(int x) : val(x), next(nullptr) {}\n * ListNode(int x, ListNode *next) : val(x), next(next) {}\n * };\n */\n/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n TreeNode* sortedListToBST(ListNode* head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * int val;\n * ListNode next;\n * ListNode() {}\n * ListNode(int val) { this.val = val; }\n * ListNode(int val, ListNode next) { this.val = val; this.next = next; }\n * }\n */\n/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public TreeNode sortedListToBST(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def sortedListToBST(self, head):\n \"\"\"\n :type head: Optional[ListNode]\n :rtype: Optional[TreeNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def sortedListToBST(self, head: Optional[ListNode]) -> Optional[TreeNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\n/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nstruct TreeNode* sortedListToBST(struct ListNode* head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int val=0, ListNode next=null) {\n * this.val = val;\n * this.next = next;\n * }\n * }\n */\n/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public TreeNode SortedListToBST(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val, next) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n */\n/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {ListNode} head\n * @return {TreeNode}\n */\nvar sortedListToBST = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\n/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction sortedListToBST(head: ListNode | null): TreeNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val = 0, $next = null) {\n * $this->val = $val;\n * $this->next = $next;\n * }\n * }\n */\n/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param ListNode $head\n * @return TreeNode\n */\n function sortedListToBST($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init() { self.val = 0; self.next = nil; }\n * public init(_ val: Int) { self.val = val; self.next = nil; }\n * public init(_ val: Int, _ next: ListNode?) { self.val = val; self.next = next; }\n * }\n */\n/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func sortedListToBST(_ head: ListNode?) -> TreeNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\n/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun sortedListToBST(head: ListNode?): TreeNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode? next;\n * ListNode([this.val = 0, this.next]);\n * }\n */\n/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n TreeNode? sortedListToBST(ListNode? head) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\n/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc sortedListToBST(head *ListNode) *TreeNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val = 0, _next = nil)\n# @val = val\n# @next = _next\n# end\n# end\n# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {ListNode} head\n# @return {TreeNode}\ndef sorted_list_to_bst(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(_x: Int = 0, _next: ListNode = null) {\n * var next: ListNode = _next\n * var x: Int = _x\n * }\n */\n/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def sortedListToBST(head: ListNode): TreeNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for singly-linked list.\n// #[derive(PartialEq, Eq, Clone, Debug)]\n// pub struct ListNode {\n// pub val: i32,\n// pub next: Option<Box<ListNode>>\n// }\n// \n// impl ListNode {\n// #[inline]\n// fn new(val: i32) -> Self {\n// ListNode {\n// next: None,\n// val\n// }\n// }\n// }\n// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn sorted_list_to_bst(head: Option<Box<ListNode>>) -> Option<Rc<RefCell<TreeNode>>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for singly-linked list:\n#|\n\n; val : integer?\n; next : (or/c list-node? #f)\n(struct list-node\n (val next) #:mutable #:transparent)\n\n; constructor\n(define (make-list-node [val 0])\n (list-node val #f))\n\n|#\n\n; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (sorted-list-to-bst head)\n (-> (or/c list-node? #f) (or/c tree-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for singly-linked list.\n%%\n%% -record(list_node, {val = 0 :: integer(),\n%% next = null :: 'null' | #list_node{}}).\n\n%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec sorted_list_to_bst(Head :: #list_node{} | null) -> #tree_node{} | null.\nsorted_list_to_bst(Head) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for singly-linked list.\n#\n# defmodule ListNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# next: ListNode.t() | nil\n# }\n# defstruct val: 0, next: nil\n# end\n\n# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec sorted_list_to_bst(head :: ListNode.t | nil) :: TreeNode.t | nil\n def sorted_list_to_bst(head) do\n \n end\nend"}] | [-10,-3,0,5,9] | {
"name": "sortedListToBST",
"params": [
{
"name": "head",
"type": "ListNode"
}
],
"return": {
"type": "TreeNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Linked List', 'Divide and Conquer', 'Tree', 'Binary Search Tree', 'Binary Tree'] |
110 | Balanced Binary Tree | balanced-binary-tree | <p>Given a binary tree, determine if it is <span data-keyword="height-balanced"><strong>height-balanced</strong></span>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/10/06/balance_1.jpg" style="width: 342px; height: 221px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> true
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/10/06/balance_2.jpg" style="width: 452px; height: 301px;" />
<pre>
<strong>Input:</strong> root = [1,2,2,3,3,null,null,4,4]
<strong>Output:</strong> false
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> true
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 5000]</code>.</li>
<li><code>-10<sup>4</sup> <= Node.val <= 10<sup>4</sup></code></li>
</ul>
| Easy | 1.9M | 3.4M | 1,882,623 | 3,431,760 | 54.9% | ['maximum-depth-of-binary-tree', 'k-th-largest-perfect-subtree-size-in-binary-tree', 'check-balanced-string'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n bool isBalanced(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public boolean isBalanced(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def isBalanced(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def isBalanced(self, root: Optional[TreeNode]) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nbool isBalanced(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public bool IsBalanced(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {boolean}\n */\nvar isBalanced = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction isBalanced(root: TreeNode | null): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Boolean\n */\n function isBalanced($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func isBalanced(_ root: TreeNode?) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun isBalanced(root: TreeNode?): Boolean {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n bool isBalanced(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc isBalanced(root *TreeNode) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Boolean}\ndef is_balanced(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def isBalanced(root: TreeNode): Boolean = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn is_balanced(root: Option<Rc<RefCell<TreeNode>>>) -> bool {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (is-balanced root)\n (-> (or/c tree-node? #f) boolean?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec is_balanced(Root :: #tree_node{} | null) -> boolean().\nis_balanced(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec is_balanced(root :: TreeNode.t | nil) :: boolean\n def is_balanced(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "isBalanced",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Binary Tree'] |
111 | Minimum Depth of Binary Tree | minimum-depth-of-binary-tree | <p>Given a binary tree, find its minimum depth.</p>
<p>The minimum depth is the number of nodes along the shortest path from the root node down to the nearest leaf node.</p>
<p><strong>Note:</strong> A leaf is a node with no children.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/10/12/ex_depth.jpg" style="width: 432px; height: 302px;" />
<pre>
<strong>Input:</strong> root = [3,9,20,null,null,15,7]
<strong>Output:</strong> 2
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = [2,null,3,null,4,null,5,null,6]
<strong>Output:</strong> 5
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 10<sup>5</sup>]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
</ul>
| Easy | 1.4M | 2.8M | 1,400,818 | 2,788,358 | 50.2% | ['binary-tree-level-order-traversal', 'maximum-depth-of-binary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n int minDepth(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public int minDepth(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def minDepth(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def minDepth(self, root: Optional[TreeNode]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nint minDepth(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public int MinDepth(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number}\n */\nvar minDepth = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction minDepth(root: TreeNode | null): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer\n */\n function minDepth($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func minDepth(_ root: TreeNode?) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun minDepth(root: TreeNode?): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n int minDepth(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc minDepth(root *TreeNode) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer}\ndef min_depth(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def minDepth(root: TreeNode): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn min_depth(root: Option<Rc<RefCell<TreeNode>>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (min-depth root)\n (-> (or/c tree-node? #f) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec min_depth(Root :: #tree_node{} | null) -> integer().\nmin_depth(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec min_depth(root :: TreeNode.t | nil) :: integer\n def min_depth(root) do\n \n end\nend"}] | [3,9,20,null,null,15,7] | {
"name": "minDepth",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
112 | Path Sum | path-sum | <p>Given the <code>root</code> of a binary tree and an integer <code>targetSum</code>, return <code>true</code> if the tree has a <strong>root-to-leaf</strong> path such that adding up all the values along the path equals <code>targetSum</code>.</p>
<p>A <strong>leaf</strong> is a node with no children.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/01/18/pathsum1.jpg" style="width: 500px; height: 356px;" />
<pre>
<strong>Input:</strong> root = [5,4,8,11,null,13,4,7,2,null,null,null,1], targetSum = 22
<strong>Output:</strong> true
<strong>Explanation:</strong> The root-to-leaf path with the target sum is shown.
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/01/18/pathsum2.jpg" />
<pre>
<strong>Input:</strong> root = [1,2,3], targetSum = 5
<strong>Output:</strong> false
<strong>Explanation:</strong> There are two root-to-leaf paths in the tree:
(1 --> 2): The sum is 3.
(1 --> 3): The sum is 4.
There is no root-to-leaf path with sum = 5.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = [], targetSum = 0
<strong>Output:</strong> false
<strong>Explanation:</strong> Since the tree is empty, there are no root-to-leaf paths.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 5000]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
<li><code>-1000 <= targetSum <= 1000</code></li>
</ul>
| Easy | 1.8M | 3.4M | 1,767,966 | 3,360,901 | 52.6% | ['path-sum-ii', 'binary-tree-maximum-path-sum', 'sum-root-to-leaf-numbers', 'path-sum-iii', 'path-sum-iv'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n bool hasPathSum(TreeNode* root, int targetSum) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public boolean hasPathSum(TreeNode root, int targetSum) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def hasPathSum(self, root, targetSum):\n \"\"\"\n :type root: Optional[TreeNode]\n :type targetSum: int\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def hasPathSum(self, root: Optional[TreeNode], targetSum: int) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nbool hasPathSum(struct TreeNode* root, int targetSum) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public bool HasPathSum(TreeNode root, int targetSum) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @param {number} targetSum\n * @return {boolean}\n */\nvar hasPathSum = function(root, targetSum) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction hasPathSum(root: TreeNode | null, targetSum: number): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @param Integer $targetSum\n * @return Boolean\n */\n function hasPathSum($root, $targetSum) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func hasPathSum(_ root: TreeNode?, _ targetSum: Int) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun hasPathSum(root: TreeNode?, targetSum: Int): Boolean {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n bool hasPathSum(TreeNode? root, int targetSum) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc hasPathSum(root *TreeNode, targetSum int) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @param {Integer} target_sum\n# @return {Boolean}\ndef has_path_sum(root, target_sum)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def hasPathSum(root: TreeNode, targetSum: Int): Boolean = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn has_path_sum(root: Option<Rc<RefCell<TreeNode>>>, target_sum: i32) -> bool {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (has-path-sum root targetSum)\n (-> (or/c tree-node? #f) exact-integer? boolean?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec has_path_sum(Root :: #tree_node{} | null, TargetSum :: integer()) -> boolean().\nhas_path_sum(Root, TargetSum) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec has_path_sum(root :: TreeNode.t | nil, target_sum :: integer) :: boolean\n def has_path_sum(root, target_sum) do\n \n end\nend"}] | [5,4,8,11,null,13,4,7,2,null,null,null,1]
22 | {
"name": "hasPathSum",
"params": [
{
"name": "root",
"type": "TreeNode"
},
{
"name": "targetSum",
"type": "integer"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
113 | Path Sum II | path-sum-ii | <p>Given the <code>root</code> of a binary tree and an integer <code>targetSum</code>, return <em>all <strong>root-to-leaf</strong> paths where the sum of the node values in the path equals </em><code>targetSum</code><em>. Each path should be returned as a list of the node <strong>values</strong>, not node references</em>.</p>
<p>A <strong>root-to-leaf</strong> path is a path starting from the root and ending at any leaf node. A <strong>leaf</strong> is a node with no children.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/01/18/pathsumii1.jpg" style="width: 500px; height: 356px;" />
<pre>
<strong>Input:</strong> root = [5,4,8,11,null,13,4,7,2,null,null,5,1], targetSum = 22
<strong>Output:</strong> [[5,4,11,2],[5,8,4,5]]
<strong>Explanation:</strong> There are two paths whose sum equals targetSum:
5 + 4 + 11 + 2 = 22
5 + 8 + 4 + 5 = 22
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/01/18/pathsum2.jpg" style="width: 212px; height: 181px;" />
<pre>
<strong>Input:</strong> root = [1,2,3], targetSum = 5
<strong>Output:</strong> []
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = [1,2], targetSum = 0
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 5000]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
<li><code>-1000 <= targetSum <= 1000</code></li>
</ul>
| Medium | 995.2K | 1.7M | 995,250 | 1,654,035 | 60.2% | ['path-sum', 'binary-tree-paths', 'path-sum-iii', 'path-sum-iv', 'step-by-step-directions-from-a-binary-tree-node-to-another'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<vector<int>> pathSum(TreeNode* root, int targetSum) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<List<Integer>> pathSum(TreeNode root, int targetSum) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def pathSum(self, root, targetSum):\n \"\"\"\n :type root: Optional[TreeNode]\n :type targetSum: int\n :rtype: List[List[int]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def pathSum(self, root: Optional[TreeNode], targetSum: int) -> List[List[int]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nint** pathSum(struct TreeNode* root, int targetSum, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<IList<int>> PathSum(TreeNode root, int targetSum) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @param {number} targetSum\n * @return {number[][]}\n */\nvar pathSum = function(root, targetSum) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction pathSum(root: TreeNode | null, targetSum: number): number[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @param Integer $targetSum\n * @return Integer[][]\n */\n function pathSum($root, $targetSum) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func pathSum(_ root: TreeNode?, _ targetSum: Int) -> [[Int]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun pathSum(root: TreeNode?, targetSum: Int): List<List<Int>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<List<int>> pathSum(TreeNode? root, int targetSum) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc pathSum(root *TreeNode, targetSum int) [][]int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @param {Integer} target_sum\n# @return {Integer[][]}\ndef path_sum(root, target_sum)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def pathSum(root: TreeNode, targetSum: Int): List[List[Int]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn path_sum(root: Option<Rc<RefCell<TreeNode>>>, target_sum: i32) -> Vec<Vec<i32>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (path-sum root targetSum)\n (-> (or/c tree-node? #f) exact-integer? (listof (listof exact-integer?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec path_sum(Root :: #tree_node{} | null, TargetSum :: integer()) -> [[integer()]].\npath_sum(Root, TargetSum) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec path_sum(root :: TreeNode.t | nil, target_sum :: integer) :: [[integer]]\n def path_sum(root, target_sum) do\n \n end\nend"}] | [5,4,8,11,null,13,4,7,2,null,null,5,1]
22 | {
"name": "pathSum",
"params": [
{
"name": "root",
"type": "TreeNode"
},
{
"name": "targetSum",
"type": "integer"
}
],
"return": {
"type": "list<list<integer>>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Backtracking', 'Tree', 'Depth-First Search', 'Binary Tree'] |
114 | Flatten Binary Tree to Linked List | flatten-binary-tree-to-linked-list | <p>Given the <code>root</code> of a binary tree, flatten the tree into a "linked list":</p>
<ul>
<li>The "linked list" should use the same <code>TreeNode</code> class where the <code>right</code> child pointer points to the next node in the list and the <code>left</code> child pointer is always <code>null</code>.</li>
<li>The "linked list" should be in the same order as a <a href="https://en.wikipedia.org/wiki/Tree_traversal#Pre-order,_NLR" target="_blank"><strong>pre-order</strong><strong> traversal</strong></a> of the binary tree.</li>
</ul>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/01/14/flaten.jpg" style="width: 500px; height: 226px;" />
<pre>
<strong>Input:</strong> root = [1,2,5,3,4,null,6]
<strong>Output:</strong> [1,null,2,null,3,null,4,null,5,null,6]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> root = [0]
<strong>Output:</strong> [0]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 2000]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
<p> </p>
<strong>Follow up:</strong> Can you flatten the tree in-place (with <code>O(1)</code> extra space)? | Medium | 1.2M | 1.7M | 1,154,374 | 1,698,333 | 68.0% | ['flatten-a-multilevel-doubly-linked-list', 'correct-a-binary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n void flatten(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public void flatten(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def flatten(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: None Do not return anything, modify root in-place instead.\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def flatten(self, root: Optional[TreeNode]) -> None:\n \"\"\"\n Do not return anything, modify root in-place instead.\n \"\"\"\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nvoid flatten(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public void Flatten(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {void} Do not return anything, modify root in-place instead.\n */\nvar flatten = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\n/**\n Do not return anything, modify root in-place instead.\n */\nfunction flatten(root: TreeNode | null): void {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return NULL\n */\n function flatten($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func flatten(_ root: TreeNode?) {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun flatten(root: TreeNode?): Unit {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n void flatten(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc flatten(root *TreeNode) {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Void} Do not return anything, modify root in-place instead.\ndef flatten(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def flatten(root: TreeNode): Unit = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn flatten(root: &mut Option<Rc<RefCell<TreeNode>>>) {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (flatten root)\n (-> (or/c tree-node? #f) void?)\n )"}] | [1,2,5,3,4,null,6] | {
"name": "flatten",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "void"
},
"output": {
"paramindex": 0
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Linked List', 'Stack', 'Tree', 'Depth-First Search', 'Binary Tree'] |
115 | Distinct Subsequences | distinct-subsequences | <p>Given two strings s and t, return <i>the number of distinct</i> <b><i>subsequences</i></b><i> of </i>s<i> which equals </i>t.</p>
<p>The test cases are generated so that the answer fits on a 32-bit signed integer.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "rabbbit", t = "rabbit"
<strong>Output:</strong> 3
<strong>Explanation:</strong>
As shown below, there are 3 ways you can generate "rabbit" from s.
<code><strong><u>rabb</u></strong>b<strong><u>it</u></strong></code>
<code><strong><u>ra</u></strong>b<strong><u>bbit</u></strong></code>
<code><strong><u>rab</u></strong>b<strong><u>bit</u></strong></code>
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = "babgbag", t = "bag"
<strong>Output:</strong> 5
<strong>Explanation:</strong>
As shown below, there are 5 ways you can generate "bag" from s.
<code><strong><u>ba</u></strong>b<u><strong>g</strong></u>bag</code>
<code><strong><u>ba</u></strong>bgba<strong><u>g</u></strong></code>
<code><u><strong>b</strong></u>abgb<strong><u>ag</u></strong></code>
<code>ba<u><strong>b</strong></u>gb<u><strong>ag</strong></u></code>
<code>babg<strong><u>bag</u></strong></code></pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length, t.length <= 1000</code></li>
<li><code>s</code> and <code>t</code> consist of English letters.</li>
</ul>
| Hard | 521.5K | 1.1M | 521,513 | 1,050,114 | 49.7% | ['number-of-unique-good-subsequences'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int numDistinct(string s, string t) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int numDistinct(String s, String t) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def numDistinct(self, s, t):\n \"\"\"\n :type s: str\n :type t: str\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def numDistinct(self, s: str, t: str) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int numDistinct(char* s, char* t) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int NumDistinct(string s, string t) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @param {string} t\n * @return {number}\n */\nvar numDistinct = function(s, t) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function numDistinct(s: string, t: string): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @param String $t\n * @return Integer\n */\n function numDistinct($s, $t) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func numDistinct(_ s: String, _ t: String) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun numDistinct(s: String, t: String): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int numDistinct(String s, String t) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func numDistinct(s string, t string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @param {String} t\n# @return {Integer}\ndef num_distinct(s, t)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def numDistinct(s: String, t: String): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn num_distinct(s: String, t: String) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (num-distinct s t)\n (-> string? string? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec num_distinct(S :: unicode:unicode_binary(), T :: unicode:unicode_binary()) -> integer().\nnum_distinct(S, T) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec num_distinct(s :: String.t, t :: String.t) :: integer\n def num_distinct(s, t) do\n \n end\nend"}] | "rabbbit"
"rabbit" | {
"name": "numDistinct",
"params": [
{
"name": "s",
"type": "string"
},
{
"name": "t",
"type": "string"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['String', 'Dynamic Programming'] |
116 | Populating Next Right Pointers in Each Node | populating-next-right-pointers-in-each-node | <p>You are given a <strong>perfect binary tree</strong> where all leaves are on the same level, and every parent has two children. The binary tree has the following definition:</p>
<pre>
struct Node {
int val;
Node *left;
Node *right;
Node *next;
}
</pre>
<p>Populate each next pointer to point to its next right node. If there is no next right node, the next pointer should be set to <code>NULL</code>.</p>
<p>Initially, all next pointers are set to <code>NULL</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2019/02/14/116_sample.png" style="width: 500px; height: 171px;" />
<pre>
<strong>Input:</strong> root = [1,2,3,4,5,6,7]
<strong>Output:</strong> [1,#,2,3,#,4,5,6,7,#]
<strong>Explanation: </strong>Given the above perfect binary tree (Figure A), your function should populate each next pointer to point to its next right node, just like in Figure B. The serialized output is in level order as connected by the next pointers, with '#' signifying the end of each level.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 2<sup>12</sup> - 1]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
</ul>
<p> </p>
<p><strong>Follow-up:</strong></p>
<ul>
<li>You may only use constant extra space.</li>
<li>The recursive approach is fine. You may assume implicit stack space does not count as extra space for this problem.</li>
</ul>
| Medium | 1.2M | 1.8M | 1,183,685 | 1,819,130 | 65.1% | ['populating-next-right-pointers-in-each-node-ii', 'binary-tree-right-side-view', 'cycle-length-queries-in-a-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\npublic:\n int val;\n Node* left;\n Node* right;\n Node* next;\n\n Node() : val(0), left(NULL), right(NULL), next(NULL) {}\n\n Node(int _val) : val(_val), left(NULL), right(NULL), next(NULL) {}\n\n Node(int _val, Node* _left, Node* _right, Node* _next)\n : val(_val), left(_left), right(_right), next(_next) {}\n};\n*/\n\nclass Solution {\npublic:\n Node* connect(Node* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\n public int val;\n public Node left;\n public Node right;\n public Node next;\n\n public Node() {}\n \n public Node(int _val) {\n val = _val;\n }\n\n public Node(int _val, Node _left, Node _right, Node _next) {\n val = _val;\n left = _left;\n right = _right;\n next = _next;\n }\n};\n*/\n\nclass Solution {\n public Node connect(Node root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node(object):\n def __init__(self, val=0, left=None, right=None, next=None):\n self.val = val\n self.left = left\n self.right = right\n self.next = next\n\"\"\"\n\nclass Solution(object):\n def connect(self, root):\n \"\"\"\n :type root: Node\n :rtype: Node\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node:\n def __init__(self, val: int = 0, left: 'Node' = None, right: 'Node' = None, next: 'Node' = None):\n self.val = val\n self.left = left\n self.right = right\n self.next = next\n\"\"\"\n\nclass Solution:\n def connect(self, root: 'Optional[Node]') -> 'Optional[Node]':\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a Node.\n * struct Node {\n * int val;\n * struct Node *left;\n * struct Node *right;\n * struct Node *next;\n * };\n */\n\nstruct Node* connect(struct Node* root) {\n\t\n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/*\n// Definition for a Node.\npublic class Node {\n public int val;\n public Node left;\n public Node right;\n public Node next;\n\n public Node() {}\n\n public Node(int _val) {\n val = _val;\n }\n\n public Node(int _val, Node _left, Node _right, Node _next) {\n val = _val;\n left = _left;\n right = _right;\n next = _next;\n }\n}\n*/\n\npublic class Solution {\n public Node Connect(Node root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * // Definition for a _Node.\n * function _Node(val, left, right, next) {\n * this.val = val === undefined ? null : val;\n * this.left = left === undefined ? null : left;\n * this.right = right === undefined ? null : right;\n * this.next = next === undefined ? null : next;\n * };\n */\n\n/**\n * @param {_Node} root\n * @return {_Node}\n */\nvar connect = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for _Node.\n * class _Node {\n * val: number\n * left: _Node | null\n * right: _Node | null\n * next: _Node | null\n * constructor(val?: number, left?: _Node, right?: _Node, next?: _Node) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction connect(root: _Node | null): _Node | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a Node.\n * class Node {\n * function __construct($val = 0) {\n * $this->val = $val;\n * $this->left = null;\n * $this->right = null;\n * $this->next = null;\n * }\n * }\n */\n\nclass Solution {\n /**\n * @param Node $root\n * @return Node\n */\n public function connect($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a Node.\n * public class Node {\n * public var val: Int\n * public var left: Node?\n * public var right: Node?\n *\t public var next: Node?\n * public init(_ val: Int) {\n * self.val = val\n * self.left = nil\n * self.right = nil\n * self.next = nil\n * }\n * }\n */\n\nclass Solution {\n func connect(_ root: Node?) -> Node? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var `val`: Int) {\n * var left: Node? = null\n * var right: Node? = null\n * var next: Node? = null\n * }\n */\n\nclass Solution {\n fun connect(root: Node?): Node? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a Node.\n * type Node struct {\n * Val int\n * Left *Node\n * Right *Node\n * Next *Node\n * }\n */\n\nfunc connect(root *Node) *Node {\n\t\n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for Node.\n# class Node\n# attr_accessor :val, :left, :right, :next\n# def initialize(val)\n# @val = val\n# @left, @right, @next = nil, nil, nil\n# end\n# end\n\n# @param {Node} root\n# @return {Node}\ndef connect(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var _value: Int) {\n * var value: Int = _value\n * var left: Node = null\n * var right: Node = null\n * var next: Node = null\n * }\n */\n\nobject Solution {\n def connect(root: Node): Node = {\n \n }\n}"}] | [1,2,3,4,5,6,7] | {
"name": "connect",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "TreeNode"
},
"structures": [
{
"name": "TreeNode",
"comment": "Definition for a Node.",
"members": [
{
"name": "val",
"type": "integer"
},
{
"name": "left",
"type": "TreeNode"
},
{
"name": "right",
"type": "TreeNode"
},
{
"name": "next",
"type": "TreeNode"
}
]
}
],
"languages": [
"cpp",
"java",
"python",
"csharp",
"javascript",
"python3",
"swift",
"golang",
"kotlin",
"ruby",
"c",
"scala",
"php",
"typescript"
],
"manual": true,
"typescriptCustomType" : "class _Node {\n val: number\n left: _Node | null\n right: _Node | null\n next: _Node | null\n\n constructor(val?: number, left?: _Node, right?: _Node, next?: _Node) {\n this.val = (val===undefined ? 0 : val)\n this.left = (left===undefined ? null : left)\n this.right = (right===undefined ? null : right)\n this.next = (next===undefined ? null : next)\n }\n}"
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Linked List', 'Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
117 | Populating Next Right Pointers in Each Node II | populating-next-right-pointers-in-each-node-ii | <p>Given a binary tree</p>
<pre>
struct Node {
int val;
Node *left;
Node *right;
Node *next;
}
</pre>
<p>Populate each next pointer to point to its next right node. If there is no next right node, the next pointer should be set to <code>NULL</code>.</p>
<p>Initially, all next pointers are set to <code>NULL</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2019/02/15/117_sample.png" style="width: 500px; height: 171px;" />
<pre>
<strong>Input:</strong> root = [1,2,3,4,5,null,7]
<strong>Output:</strong> [1,#,2,3,#,4,5,7,#]
<strong>Explanation: </strong>Given the above binary tree (Figure A), your function should populate each next pointer to point to its next right node, just like in Figure B. The serialized output is in level order as connected by the next pointers, with '#' signifying the end of each level.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> root = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 6000]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
<p> </p>
<p><strong>Follow-up:</strong></p>
<ul>
<li>You may only use constant extra space.</li>
<li>The recursive approach is fine. You may assume implicit stack space does not count as extra space for this problem.</li>
</ul>
| Medium | 735.2K | 1.3M | 735,156 | 1,333,388 | 55.1% | ['populating-next-right-pointers-in-each-node'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\npublic:\n int val;\n Node* left;\n Node* right;\n Node* next;\n\n Node() : val(0), left(NULL), right(NULL), next(NULL) {}\n\n Node(int _val) : val(_val), left(NULL), right(NULL), next(NULL) {}\n\n Node(int _val, Node* _left, Node* _right, Node* _next)\n : val(_val), left(_left), right(_right), next(_next) {}\n};\n*/\n\nclass Solution {\npublic:\n Node* connect(Node* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\n public int val;\n public Node left;\n public Node right;\n public Node next;\n\n public Node() {}\n \n public Node(int _val) {\n val = _val;\n }\n\n public Node(int _val, Node _left, Node _right, Node _next) {\n val = _val;\n left = _left;\n right = _right;\n next = _next;\n }\n};\n*/\n\nclass Solution {\n public Node connect(Node root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node(object):\n def __init__(self, val=0, left=None, right=None, next=None):\n self.val = val\n self.left = left\n self.right = right\n self.next = next\n\"\"\"\n\nclass Solution(object):\n def connect(self, root):\n \"\"\"\n :type root: Node\n :rtype: Node\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node:\n def __init__(self, val: int = 0, left: 'Node' = None, right: 'Node' = None, next: 'Node' = None):\n self.val = val\n self.left = left\n self.right = right\n self.next = next\n\"\"\"\n\nclass Solution:\n def connect(self, root: 'Node') -> 'Node':\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a Node.\n * struct Node {\n * int val;\n * struct Node *left;\n * struct Node *right;\n * struct Node *next;\n * };\n */\n\nstruct Node* connect(struct Node* root) {\n\t\n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/*\n// Definition for a Node.\npublic class Node {\n public int val;\n public Node left;\n public Node right;\n public Node next;\n\n public Node() {}\n\n public Node(int _val) {\n val = _val;\n }\n\n public Node(int _val, Node _left, Node _right, Node _next) {\n val = _val;\n left = _left;\n right = _right;\n next = _next;\n }\n}\n*/\n\npublic class Solution {\n public Node Connect(Node root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * // Definition for a _Node.\n * function _Node(val, left, right, next) {\n * this.val = val === undefined ? null : val;\n * this.left = left === undefined ? null : left;\n * this.right = right === undefined ? null : right;\n * this.next = next === undefined ? null : next;\n * };\n */\n\n/**\n * @param {_Node} root\n * @return {_Node}\n */\nvar connect = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for _Node.\n * class _Node {\n * val: number\n * left: _Node | null\n * right: _Node | null\n * next: _Node | null\n * \n * constructor(val?: number, left?: _Node, right?: _Node, next?: _Node) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\n\nfunction connect(root: _Node | null): _Node | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a Node.\n * class Node {\n * function __construct($val = 0) {\n * $this->val = $val;\n * $this->left = null;\n * $this->right = null;\n * $this->next = null;\n * }\n * }\n */\n\nclass Solution {\n /**\n * @param Node $root\n * @return Node\n */\n public function connect($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a Node.\n * public class Node {\n * public var val: Int\n * public var left: Node?\n * public var right: Node?\n *\t public var next: Node?\n * public init(_ val: Int) {\n * self.val = val\n * self.left = nil\n * self.right = nil\n * self.next = nil\n * }\n * }\n */\n\nclass Solution {\n func connect(_ root: Node?) -> Node? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var `val`: Int) {\n * var left: Node? = null\n * var right: Node? = null\n * var next: Node? = null\n * }\n */\n\nclass Solution {\n fun connect(root: Node?): Node? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a Node.\n * type Node struct {\n * Val int\n * Left *Node\n * Right *Node\n * Next *Node\n * }\n */\n\nfunc connect(root *Node) *Node {\n\t\n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a Node.\n# class Node\n# attr_accessor :val, :left, :right, :next\n# def initialize(val)\n# @val = val\n# @left, @right, @next = nil, nil, nil\n# end\n# end\n\n# @param {Node} root\n# @return {Node}\ndef connect(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var _value: Int) {\n * var value: Int = _value\n * var left: Node = null\n * var right: Node = null\n * var next: Node = null\n * }\n */\n\nobject Solution {\n def connect(root: Node): Node = {\n \n }\n}"}] | [1,2,3,4,5,null,7] | {
"name": "connect",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "TreeNode"
},
"languages": [
"cpp",
"java",
"python",
"csharp",
"javascript",
"python3",
"golang",
"swift",
"kotlin",
"ruby",
"c",
"scala",
"php",
"typescript"
],
"manual": true,
"typescriptCustomType" : "class _Node {\n val: number\n left: _Node | null\n right: _Node | null\n next: _Node | null\n\n constructor(val?: number, left?: _Node, right?: _Node, next?: _Node) {\n this.val = (val===undefined ? 0 : val)\n this.left = (left===undefined ? null : left)\n this.right = (right===undefined ? null : right)\n this.next = (next===undefined ? null : next)\n }\n}\n"
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Linked List', 'Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
118 | Pascal's Triangle | pascals-triangle | <p>Given an integer <code>numRows</code>, return the first numRows of <strong>Pascal's triangle</strong>.</p>
<p>In <strong>Pascal's triangle</strong>, each number is the sum of the two numbers directly above it as shown:</p>
<img alt="" src="https://upload.wikimedia.org/wikipedia/commons/0/0d/PascalTriangleAnimated2.gif" style="height:240px; width:260px" />
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> numRows = 5
<strong>Output:</strong> [[1],[1,1],[1,2,1],[1,3,3,1],[1,4,6,4,1]]
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> numRows = 1
<strong>Output:</strong> [[1]]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= numRows <= 30</code></li>
</ul>
| Easy | 2.1M | 2.7M | 2,061,764 | 2,690,378 | 76.6% | ['pascals-triangle-ii', 'check-if-digits-are-equal-in-string-after-operations-ii'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<vector<int>> generate(int numRows) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<List<Integer>> generate(int numRows) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def generate(self, numRows):\n \"\"\"\n :type numRows: int\n :rtype: List[List[int]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def generate(self, numRows: int) -> List[List[int]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nint** generate(int numRows, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<IList<int>> Generate(int numRows) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} numRows\n * @return {number[][]}\n */\nvar generate = function(numRows) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function generate(numRows: number): number[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $numRows\n * @return Integer[][]\n */\n function generate($numRows) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func generate(_ numRows: Int) -> [[Int]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun generate(numRows: Int): List<List<Int>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<List<int>> generate(int numRows) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func generate(numRows int) [][]int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} num_rows\n# @return {Integer[][]}\ndef generate(num_rows)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def generate(numRows: Int): List[List[Int]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn generate(num_rows: i32) -> Vec<Vec<i32>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (generate numRows)\n (-> exact-integer? (listof (listof exact-integer?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec generate(NumRows :: integer()) -> [[integer()]].\ngenerate(NumRows) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec generate(num_rows :: integer) :: [[integer]]\n def generate(num_rows) do\n \n end\nend"}] | 5 | {
"name": "generate",
"params": [
{
"name": "numRows",
"type": "integer"
}
],
"return": {
"type": "list<list<integer>>",
"dealloc": true,
"rowsize": "param_1"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
119 | Pascal's Triangle II | pascals-triangle-ii | <p>Given an integer <code>rowIndex</code>, return the <code>rowIndex<sup>th</sup></code> (<strong>0-indexed</strong>) row of the <strong>Pascal's triangle</strong>.</p>
<p>In <strong>Pascal's triangle</strong>, each number is the sum of the two numbers directly above it as shown:</p>
<img alt="" src="https://upload.wikimedia.org/wikipedia/commons/0/0d/PascalTriangleAnimated2.gif" style="height:240px; width:260px" />
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> rowIndex = 3
<strong>Output:</strong> [1,3,3,1]
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> rowIndex = 0
<strong>Output:</strong> [1]
</pre><p><strong class="example">Example 3:</strong></p>
<pre><strong>Input:</strong> rowIndex = 1
<strong>Output:</strong> [1,1]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>0 <= rowIndex <= 33</code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Could you optimize your algorithm to use only <code>O(rowIndex)</code> extra space?</p>
| Easy | 1M | 1.6M | 1,027,393 | 1,564,826 | 65.7% | ['pascals-triangle', 'find-triangular-sum-of-an-array'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<int> getRow(int rowIndex) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<Integer> getRow(int rowIndex) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def getRow(self, rowIndex):\n \"\"\"\n :type rowIndex: int\n :rtype: List[int]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def getRow(self, rowIndex: int) -> List[int]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nint* getRow(int rowIndex, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<int> GetRow(int rowIndex) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} rowIndex\n * @return {number[]}\n */\nvar getRow = function(rowIndex) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function getRow(rowIndex: number): number[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $rowIndex\n * @return Integer[]\n */\n function getRow($rowIndex) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func getRow(_ rowIndex: Int) -> [Int] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun getRow(rowIndex: Int): List<Int> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<int> getRow(int rowIndex) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func getRow(rowIndex int) []int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} row_index\n# @return {Integer[]}\ndef get_row(row_index)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def getRow(rowIndex: Int): List[Int] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn get_row(row_index: i32) -> Vec<i32> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (get-row rowIndex)\n (-> exact-integer? (listof exact-integer?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec get_row(RowIndex :: integer()) -> [integer()].\nget_row(RowIndex) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec get_row(row_index :: integer) :: [integer]\n def get_row(row_index) do\n \n end\nend"}] | 3 | {
"name": "getRow",
"params": [
{
"name": "rowIndex",
"type": "integer"
}
],
"return": {
"type": "list<integer>"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
120 | Triangle | triangle | <p>Given a <code>triangle</code> array, return <em>the minimum path sum from top to bottom</em>.</p>
<p>For each step, you may move to an adjacent number of the row below. More formally, if you are on index <code>i</code> on the current row, you may move to either index <code>i</code> or index <code>i + 1</code> on the next row.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> triangle = [[2],[3,4],[6,5,7],[4,1,8,3]]
<strong>Output:</strong> 11
<strong>Explanation:</strong> The triangle looks like:
<u>2</u>
<u>3</u> 4
6 <u>5</u> 7
4 <u>1</u> 8 3
The minimum path sum from top to bottom is 2 + 3 + 5 + 1 = 11 (underlined above).
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> triangle = [[-10]]
<strong>Output:</strong> -10
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= triangle.length <= 200</code></li>
<li><code>triangle[0].length == 1</code></li>
<li><code>triangle[i].length == triangle[i - 1].length + 1</code></li>
<li><code>-10<sup>4</sup> <= triangle[i][j] <= 10<sup>4</sup></code></li>
</ul>
<p> </p>
<strong>Follow up:</strong> Could you do this using only <code>O(n)</code> extra space, where <code>n</code> is the total number of rows in the triangle? | Medium | 954.4K | 1.6M | 954,413 | 1,622,286 | 58.8% | [] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int minimumTotal(vector<vector<int>>& triangle) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int minimumTotal(List<List<Integer>> triangle) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def minimumTotal(self, triangle):\n \"\"\"\n :type triangle: List[List[int]]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def minimumTotal(self, triangle: List[List[int]]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int minimumTotal(int** triangle, int triangleSize, int* triangleColSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MinimumTotal(IList<IList<int>> triangle) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[][]} triangle\n * @return {number}\n */\nvar minimumTotal = function(triangle) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function minimumTotal(triangle: number[][]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[][] $triangle\n * @return Integer\n */\n function minimumTotal($triangle) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func minimumTotal(_ triangle: [[Int]]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun minimumTotal(triangle: List<List<Int>>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int minimumTotal(List<List<int>> triangle) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func minimumTotal(triangle [][]int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[][]} triangle\n# @return {Integer}\ndef minimum_total(triangle)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def minimumTotal(triangle: List[List[Int]]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn minimum_total(triangle: Vec<Vec<i32>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (minimum-total triangle)\n (-> (listof (listof exact-integer?)) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec minimum_total(Triangle :: [[integer()]]) -> integer().\nminimum_total(Triangle) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec minimum_total(triangle :: [[integer]]) :: integer\n def minimum_total(triangle) do\n \n end\nend"}] | [[2],[3,4],[6,5,7],[4,1,8,3]] | {
"name": "minimumTotal",
"params": [
{
"name": "triangle",
"type": "list<list<integer>>"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
121 | Best Time to Buy and Sell Stock | best-time-to-buy-and-sell-stock | <p>You are given an array <code>prices</code> where <code>prices[i]</code> is the price of a given stock on the <code>i<sup>th</sup></code> day.</p>
<p>You want to maximize your profit by choosing a <strong>single day</strong> to buy one stock and choosing a <strong>different day in the future</strong> to sell that stock.</p>
<p>Return <em>the maximum profit you can achieve from this transaction</em>. If you cannot achieve any profit, return <code>0</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> prices = [7,1,5,3,6,4]
<strong>Output:</strong> 5
<strong>Explanation:</strong> Buy on day 2 (price = 1) and sell on day 5 (price = 6), profit = 6-1 = 5.
Note that buying on day 2 and selling on day 1 is not allowed because you must buy before you sell.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> prices = [7,6,4,3,1]
<strong>Output:</strong> 0
<strong>Explanation:</strong> In this case, no transactions are done and the max profit = 0.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= prices.length <= 10<sup>5</sup></code></li>
<li><code>0 <= prices[i] <= 10<sup>4</sup></code></li>
</ul>
| Easy | 6.2M | 11.2M | 6,166,143 | 11,225,960 | 54.9% | ['maximum-subarray', 'best-time-to-buy-and-sell-stock-ii', 'best-time-to-buy-and-sell-stock-iii', 'best-time-to-buy-and-sell-stock-iv', 'best-time-to-buy-and-sell-stock-with-cooldown', 'sum-of-beauty-in-the-array', 'maximum-difference-between-increasing-elements', 'maximum-profit-from-trading-stocks'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxProfit(vector<int>& prices) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxProfit(int[] prices) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxProfit(self, prices):\n \"\"\"\n :type prices: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxProfit(self, prices: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxProfit(int* prices, int pricesSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxProfit(int[] prices) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} prices\n * @return {number}\n */\nvar maxProfit = function(prices) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxProfit(prices: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $prices\n * @return Integer\n */\n function maxProfit($prices) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxProfit(_ prices: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxProfit(prices: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxProfit(List<int> prices) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxProfit(prices []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} prices\n# @return {Integer}\ndef max_profit(prices)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxProfit(prices: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_profit(prices: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-profit prices)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_profit(Prices :: [integer()]) -> integer().\nmax_profit(Prices) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_profit(prices :: [integer]) :: integer\n def max_profit(prices) do\n \n end\nend"}] | [7,1,5,3,6,4] | {
"name": "maxProfit",
"params": [
{
"name": "prices",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
122 | Best Time to Buy and Sell Stock II | best-time-to-buy-and-sell-stock-ii | <p>You are given an integer array <code>prices</code> where <code>prices[i]</code> is the price of a given stock on the <code>i<sup>th</sup></code> day.</p>
<p>On each day, you may decide to buy and/or sell the stock. You can only hold <strong>at most one</strong> share of the stock at any time. However, you can buy it then immediately sell it on the <strong>same day</strong>.</p>
<p>Find and return <em>the <strong>maximum</strong> profit you can achieve</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> prices = [7,1,5,3,6,4]
<strong>Output:</strong> 7
<strong>Explanation:</strong> Buy on day 2 (price = 1) and sell on day 3 (price = 5), profit = 5-1 = 4.
Then buy on day 4 (price = 3) and sell on day 5 (price = 6), profit = 6-3 = 3.
Total profit is 4 + 3 = 7.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> prices = [1,2,3,4,5]
<strong>Output:</strong> 4
<strong>Explanation:</strong> Buy on day 1 (price = 1) and sell on day 5 (price = 5), profit = 5-1 = 4.
Total profit is 4.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> prices = [7,6,4,3,1]
<strong>Output:</strong> 0
<strong>Explanation:</strong> There is no way to make a positive profit, so we never buy the stock to achieve the maximum profit of 0.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= prices.length <= 3 * 10<sup>4</sup></code></li>
<li><code>0 <= prices[i] <= 10<sup>4</sup></code></li>
</ul>
| Medium | 2.4M | 3.5M | 2,444,167 | 3,537,471 | 69.1% | ['best-time-to-buy-and-sell-stock', 'best-time-to-buy-and-sell-stock-iii', 'best-time-to-buy-and-sell-stock-iv', 'best-time-to-buy-and-sell-stock-with-cooldown', 'best-time-to-buy-and-sell-stock-with-transaction-fee', 'maximum-profit-from-trading-stocks'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxProfit(vector<int>& prices) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxProfit(int[] prices) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxProfit(self, prices):\n \"\"\"\n :type prices: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxProfit(self, prices: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxProfit(int* prices, int pricesSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxProfit(int[] prices) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} prices\n * @return {number}\n */\nvar maxProfit = function(prices) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxProfit(prices: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $prices\n * @return Integer\n */\n function maxProfit($prices) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxProfit(_ prices: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxProfit(prices: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxProfit(List<int> prices) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxProfit(prices []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} prices\n# @return {Integer}\ndef max_profit(prices)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxProfit(prices: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_profit(prices: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-profit prices)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_profit(Prices :: [integer()]) -> integer().\nmax_profit(Prices) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_profit(prices :: [integer]) :: integer\n def max_profit(prices) do\n \n end\nend"}] | [7,1,5,3,6,4] | {
"name": "maxProfit",
"params": [
{
"name": "prices",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming', 'Greedy'] |
123 | Best Time to Buy and Sell Stock III | best-time-to-buy-and-sell-stock-iii | <p>You are given an array <code>prices</code> where <code>prices[i]</code> is the price of a given stock on the <code>i<sup>th</sup></code> day.</p>
<p>Find the maximum profit you can achieve. You may complete <strong>at most two transactions</strong>.</p>
<p><strong>Note:</strong> You may not engage in multiple transactions simultaneously (i.e., you must sell the stock before you buy again).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> prices = [3,3,5,0,0,3,1,4]
<strong>Output:</strong> 6
<strong>Explanation:</strong> Buy on day 4 (price = 0) and sell on day 6 (price = 3), profit = 3-0 = 3.
Then buy on day 7 (price = 1) and sell on day 8 (price = 4), profit = 4-1 = 3.</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> prices = [1,2,3,4,5]
<strong>Output:</strong> 4
<strong>Explanation:</strong> Buy on day 1 (price = 1) and sell on day 5 (price = 5), profit = 5-1 = 4.
Note that you cannot buy on day 1, buy on day 2 and sell them later, as you are engaging multiple transactions at the same time. You must sell before buying again.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> prices = [7,6,4,3,1]
<strong>Output:</strong> 0
<strong>Explanation:</strong> In this case, no transaction is done, i.e. max profit = 0.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= prices.length <= 10<sup>5</sup></code></li>
<li><code>0 <= prices[i] <= 10<sup>5</sup></code></li>
</ul>
| Hard | 754.9K | 1.5M | 754,944 | 1,494,550 | 50.5% | ['best-time-to-buy-and-sell-stock', 'best-time-to-buy-and-sell-stock-ii', 'best-time-to-buy-and-sell-stock-iv', 'maximum-sum-of-3-non-overlapping-subarrays', 'maximum-profit-from-trading-stocks', 'maximize-win-from-two-segments'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxProfit(vector<int>& prices) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxProfit(int[] prices) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxProfit(self, prices):\n \"\"\"\n :type prices: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxProfit(self, prices: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxProfit(int* prices, int pricesSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxProfit(int[] prices) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} prices\n * @return {number}\n */\nvar maxProfit = function(prices) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxProfit(prices: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $prices\n * @return Integer\n */\n function maxProfit($prices) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxProfit(_ prices: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxProfit(prices: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxProfit(List<int> prices) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxProfit(prices []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} prices\n# @return {Integer}\ndef max_profit(prices)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxProfit(prices: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_profit(prices: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-profit prices)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_profit(Prices :: [integer()]) -> integer().\nmax_profit(Prices) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_profit(prices :: [integer]) :: integer\n def max_profit(prices) do\n \n end\nend"}] | [3,3,5,0,0,3,1,4] | {
"name": "maxProfit",
"params": [
{
"name": "prices",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
124 | Binary Tree Maximum Path Sum | binary-tree-maximum-path-sum | <p>A <strong>path</strong> in a binary tree is a sequence of nodes where each pair of adjacent nodes in the sequence has an edge connecting them. A node can only appear in the sequence <strong>at most once</strong>. Note that the path does not need to pass through the root.</p>
<p>The <strong>path sum</strong> of a path is the sum of the node's values in the path.</p>
<p>Given the <code>root</code> of a binary tree, return <em>the maximum <strong>path sum</strong> of any <strong>non-empty</strong> path</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/10/13/exx1.jpg" style="width: 322px; height: 182px;" />
<pre>
<strong>Input:</strong> root = [1,2,3]
<strong>Output:</strong> 6
<strong>Explanation:</strong> The optimal path is 2 -> 1 -> 3 with a path sum of 2 + 1 + 3 = 6.
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/10/13/exx2.jpg" />
<pre>
<strong>Input:</strong> root = [-10,9,20,null,null,15,7]
<strong>Output:</strong> 42
<strong>Explanation:</strong> The optimal path is 15 -> 20 -> 7 with a path sum of 15 + 20 + 7 = 42.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[1, 3 * 10<sup>4</sup>]</code>.</li>
<li><code>-1000 <= Node.val <= 1000</code></li>
</ul>
| Hard | 1.5M | 3.7M | 1,531,666 | 3,733,397 | 41.0% | ['path-sum', 'sum-root-to-leaf-numbers', 'path-sum-iv', 'longest-univalue-path', 'time-needed-to-inform-all-employees', 'difference-between-maximum-and-minimum-price-sum'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n int maxPathSum(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public int maxPathSum(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def maxPathSum(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def maxPathSum(self, root: Optional[TreeNode]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nint maxPathSum(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public int MaxPathSum(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number}\n */\nvar maxPathSum = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction maxPathSum(root: TreeNode | null): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer\n */\n function maxPathSum($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func maxPathSum(_ root: TreeNode?) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun maxPathSum(root: TreeNode?): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n int maxPathSum(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc maxPathSum(root *TreeNode) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer}\ndef max_path_sum(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def maxPathSum(root: TreeNode): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn max_path_sum(root: Option<Rc<RefCell<TreeNode>>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (max-path-sum root)\n (-> (or/c tree-node? #f) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec max_path_sum(Root :: #tree_node{} | null) -> integer().\nmax_path_sum(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec max_path_sum(root :: TreeNode.t | nil) :: integer\n def max_path_sum(root) do\n \n end\nend"}] | [1,2,3] | {
"name": "maxPathSum",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Dynamic Programming', 'Tree', 'Depth-First Search', 'Binary Tree'] |
125 | Valid Palindrome | valid-palindrome | <p>A phrase is a <strong>palindrome</strong> if, after converting all uppercase letters into lowercase letters and removing all non-alphanumeric characters, it reads the same forward and backward. Alphanumeric characters include letters and numbers.</p>
<p>Given a string <code>s</code>, return <code>true</code><em> if it is a <strong>palindrome</strong>, or </em><code>false</code><em> otherwise</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "A man, a plan, a canal: Panama"
<strong>Output:</strong> true
<strong>Explanation:</strong> "amanaplanacanalpanama" is a palindrome.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = "race a car"
<strong>Output:</strong> false
<strong>Explanation:</strong> "raceacar" is not a palindrome.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> s = " "
<strong>Output:</strong> true
<strong>Explanation:</strong> s is an empty string "" after removing non-alphanumeric characters.
Since an empty string reads the same forward and backward, it is a palindrome.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 2 * 10<sup>5</sup></code></li>
<li><code>s</code> consists only of printable ASCII characters.</li>
</ul>
| Easy | 4.1M | 8.1M | 4,072,539 | 8,071,065 | 50.5% | ['palindrome-linked-list', 'valid-palindrome-ii', 'maximum-product-of-the-length-of-two-palindromic-subsequences', 'find-first-palindromic-string-in-the-array', 'valid-palindrome-iv', 'maximum-palindromes-after-operations'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n bool isPalindrome(string s) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public boolean isPalindrome(String s) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def isPalindrome(self, s):\n \"\"\"\n :type s: str\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def isPalindrome(self, s: str) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "bool isPalindrome(char* s) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public bool IsPalindrome(string s) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @return {boolean}\n */\nvar isPalindrome = function(s) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function isPalindrome(s: string): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @return Boolean\n */\n function isPalindrome($s) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func isPalindrome(_ s: String) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun isPalindrome(s: String): Boolean {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n bool isPalindrome(String s) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func isPalindrome(s string) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @return {Boolean}\ndef is_palindrome(s)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def isPalindrome(s: String): Boolean = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn is_palindrome(s: String) -> bool {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (is-palindrome s)\n (-> string? boolean?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec is_palindrome(S :: unicode:unicode_binary()) -> boolean().\nis_palindrome(S) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec is_palindrome(s :: String.t) :: boolean\n def is_palindrome(s) do\n \n end\nend"}] | "A man, a plan, a canal: Panama" | {
"name": "isPalindrome",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Two Pointers', 'String'] |
126 | Word Ladder II | word-ladder-ii | <p>A <strong>transformation sequence</strong> from word <code>beginWord</code> to word <code>endWord</code> using a dictionary <code>wordList</code> is a sequence of words <code>beginWord -> s<sub>1</sub> -> s<sub>2</sub> -> ... -> s<sub>k</sub></code> such that:</p>
<ul>
<li>Every adjacent pair of words differs by a single letter.</li>
<li>Every <code>s<sub>i</sub></code> for <code>1 <= i <= k</code> is in <code>wordList</code>. Note that <code>beginWord</code> does not need to be in <code>wordList</code>.</li>
<li><code>s<sub>k</sub> == endWord</code></li>
</ul>
<p>Given two words, <code>beginWord</code> and <code>endWord</code>, and a dictionary <code>wordList</code>, return <em>all the <strong>shortest transformation sequences</strong> from</em> <code>beginWord</code> <em>to</em> <code>endWord</code><em>, or an empty list if no such sequence exists. Each sequence should be returned as a list of the words </em><code>[beginWord, s<sub>1</sub>, s<sub>2</sub>, ..., s<sub>k</sub>]</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> beginWord = "hit", endWord = "cog", wordList = ["hot","dot","dog","lot","log","cog"]
<strong>Output:</strong> [["hit","hot","dot","dog","cog"],["hit","hot","lot","log","cog"]]
<strong>Explanation:</strong> There are 2 shortest transformation sequences:
"hit" -> "hot" -> "dot" -> "dog" -> "cog"
"hit" -> "hot" -> "lot" -> "log" -> "cog"
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> beginWord = "hit", endWord = "cog", wordList = ["hot","dot","dog","lot","log"]
<strong>Output:</strong> []
<strong>Explanation:</strong> The endWord "cog" is not in wordList, therefore there is no valid transformation sequence.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= beginWord.length <= 5</code></li>
<li><code>endWord.length == beginWord.length</code></li>
<li><code>1 <= wordList.length <= 500</code></li>
<li><code>wordList[i].length == beginWord.length</code></li>
<li><code>beginWord</code>, <code>endWord</code>, and <code>wordList[i]</code> consist of lowercase English letters.</li>
<li><code>beginWord != endWord</code></li>
<li>All the words in <code>wordList</code> are <strong>unique</strong>.</li>
<li>The <strong>sum</strong> of all shortest transformation sequences does not exceed <code>10<sup>5</sup></code>.</li>
</ul>
| Hard | 403.5K | 1.5M | 403,483 | 1,487,089 | 27.1% | ['word-ladder', 'groups-of-strings'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<vector<string>> findLadders(string beginWord, string endWord, vector<string>& wordList) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<List<String>> findLadders(String beginWord, String endWord, List<String> wordList) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def findLadders(self, beginWord, endWord, wordList):\n \"\"\"\n :type beginWord: str\n :type endWord: str\n :type wordList: List[str]\n :rtype: List[List[str]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def findLadders(self, beginWord: str, endWord: str, wordList: List[str]) -> List[List[str]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nchar*** findLadders(char* beginWord, char* endWord, char** wordList, int wordListSize, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<IList<string>> FindLadders(string beginWord, string endWord, IList<string> wordList) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} beginWord\n * @param {string} endWord\n * @param {string[]} wordList\n * @return {string[][]}\n */\nvar findLadders = function(beginWord, endWord, wordList) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function findLadders(beginWord: string, endWord: string, wordList: string[]): string[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $beginWord\n * @param String $endWord\n * @param String[] $wordList\n * @return String[][]\n */\n function findLadders($beginWord, $endWord, $wordList) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func findLadders(_ beginWord: String, _ endWord: String, _ wordList: [String]) -> [[String]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun findLadders(beginWord: String, endWord: String, wordList: List<String>): List<List<String>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<List<String>> findLadders(String beginWord, String endWord, List<String> wordList) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func findLadders(beginWord string, endWord string, wordList []string) [][]string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} begin_word\n# @param {String} end_word\n# @param {String[]} word_list\n# @return {String[][]}\ndef find_ladders(begin_word, end_word, word_list)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def findLadders(beginWord: String, endWord: String, wordList: List[String]): List[List[String]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn find_ladders(begin_word: String, end_word: String, word_list: Vec<String>) -> Vec<Vec<String>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (find-ladders beginWord endWord wordList)\n (-> string? string? (listof string?) (listof (listof string?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec find_ladders(BeginWord :: unicode:unicode_binary(), EndWord :: unicode:unicode_binary(), WordList :: [unicode:unicode_binary()]) -> [[unicode:unicode_binary()]].\nfind_ladders(BeginWord, EndWord, WordList) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec find_ladders(begin_word :: String.t, end_word :: String.t, word_list :: [String.t]) :: [[String.t]]\n def find_ladders(begin_word, end_word, word_list) do\n \n end\nend"}] | "hit"
"cog"
["hot","dot","dog","lot","log","cog"] | {
"name": "findLadders",
"params": [
{
"name": "beginWord",
"type": "string"
},
{
"name": "endWord",
"type": "string"
},
{
"name": "wordList",
"type": "list<string>"
}
],
"return": {
"type": "list<list<string>>"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'String', 'Backtracking', 'Breadth-First Search'] |
127 | Word Ladder | word-ladder | <p>A <strong>transformation sequence</strong> from word <code>beginWord</code> to word <code>endWord</code> using a dictionary <code>wordList</code> is a sequence of words <code>beginWord -> s<sub>1</sub> -> s<sub>2</sub> -> ... -> s<sub>k</sub></code> such that:</p>
<ul>
<li>Every adjacent pair of words differs by a single letter.</li>
<li>Every <code>s<sub>i</sub></code> for <code>1 <= i <= k</code> is in <code>wordList</code>. Note that <code>beginWord</code> does not need to be in <code>wordList</code>.</li>
<li><code>s<sub>k</sub> == endWord</code></li>
</ul>
<p>Given two words, <code>beginWord</code> and <code>endWord</code>, and a dictionary <code>wordList</code>, return <em>the <strong>number of words</strong> in the <strong>shortest transformation sequence</strong> from</em> <code>beginWord</code> <em>to</em> <code>endWord</code><em>, or </em><code>0</code><em> if no such sequence exists.</em></p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> beginWord = "hit", endWord = "cog", wordList = ["hot","dot","dog","lot","log","cog"]
<strong>Output:</strong> 5
<strong>Explanation:</strong> One shortest transformation sequence is "hit" -> "hot" -> "dot" -> "dog" -> cog", which is 5 words long.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> beginWord = "hit", endWord = "cog", wordList = ["hot","dot","dog","lot","log"]
<strong>Output:</strong> 0
<strong>Explanation:</strong> The endWord "cog" is not in wordList, therefore there is no valid transformation sequence.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= beginWord.length <= 10</code></li>
<li><code>endWord.length == beginWord.length</code></li>
<li><code>1 <= wordList.length <= 5000</code></li>
<li><code>wordList[i].length == beginWord.length</code></li>
<li><code>beginWord</code>, <code>endWord</code>, and <code>wordList[i]</code> consist of lowercase English letters.</li>
<li><code>beginWord != endWord</code></li>
<li>All the words in <code>wordList</code> are <strong>unique</strong>.</li>
</ul>
| Hard | 1.3M | 3.1M | 1,310,978 | 3,107,096 | 42.2% | ['word-ladder-ii', 'minimum-genetic-mutation', 'words-within-two-edits-of-dictionary'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int ladderLength(string beginWord, string endWord, vector<string>& wordList) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int ladderLength(String beginWord, String endWord, List<String> wordList) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def ladderLength(self, beginWord, endWord, wordList):\n \"\"\"\n :type beginWord: str\n :type endWord: str\n :type wordList: List[str]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def ladderLength(self, beginWord: str, endWord: str, wordList: List[str]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int ladderLength(char* beginWord, char* endWord, char** wordList, int wordListSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int LadderLength(string beginWord, string endWord, IList<string> wordList) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} beginWord\n * @param {string} endWord\n * @param {string[]} wordList\n * @return {number}\n */\nvar ladderLength = function(beginWord, endWord, wordList) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function ladderLength(beginWord: string, endWord: string, wordList: string[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $beginWord\n * @param String $endWord\n * @param String[] $wordList\n * @return Integer\n */\n function ladderLength($beginWord, $endWord, $wordList) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func ladderLength(_ beginWord: String, _ endWord: String, _ wordList: [String]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun ladderLength(beginWord: String, endWord: String, wordList: List<String>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int ladderLength(String beginWord, String endWord, List<String> wordList) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func ladderLength(beginWord string, endWord string, wordList []string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} begin_word\n# @param {String} end_word\n# @param {String[]} word_list\n# @return {Integer}\ndef ladder_length(begin_word, end_word, word_list)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def ladderLength(beginWord: String, endWord: String, wordList: List[String]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn ladder_length(begin_word: String, end_word: String, word_list: Vec<String>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (ladder-length beginWord endWord wordList)\n (-> string? string? (listof string?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec ladder_length(BeginWord :: unicode:unicode_binary(), EndWord :: unicode:unicode_binary(), WordList :: [unicode:unicode_binary()]) -> integer().\nladder_length(BeginWord, EndWord, WordList) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec ladder_length(begin_word :: String.t, end_word :: String.t, word_list :: [String.t]) :: integer\n def ladder_length(begin_word, end_word, word_list) do\n \n end\nend"}] | "hit"
"cog"
["hot","dot","dog","lot","log","cog"] | {
"name": "ladderLength",
"params": [
{
"name": "beginWord",
"type": "string"
},
{
"name": "endWord",
"type": "string"
},
{
"name": "wordList",
"type": "list<string>"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'String', 'Breadth-First Search'] |
128 | Longest Consecutive Sequence | longest-consecutive-sequence | <p>Given an unsorted array of integers <code>nums</code>, return <em>the length of the longest consecutive elements sequence.</em></p>
<p>You must write an algorithm that runs in <code>O(n)</code> time.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [100,4,200,1,3,2]
<strong>Output:</strong> 4
<strong>Explanation:</strong> The longest consecutive elements sequence is <code>[1, 2, 3, 4]</code>. Therefore its length is 4.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [0,3,7,2,5,8,4,6,0,1]
<strong>Output:</strong> 9
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> nums = [1,0,1,2]
<strong>Output:</strong> 3
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>0 <= nums.length <= 10<sup>5</sup></code></li>
<li><code>-10<sup>9</sup> <= nums[i] <= 10<sup>9</sup></code></li>
</ul>
| Medium | 2.4M | 5.2M | 2,444,676 | 5,187,522 | 47.1% | ['binary-tree-longest-consecutive-sequence', 'find-three-consecutive-integers-that-sum-to-a-given-number', 'maximum-consecutive-floors-without-special-floors', 'length-of-the-longest-alphabetical-continuous-substring', 'find-the-maximum-number-of-elements-in-subset'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int longestConsecutive(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int longestConsecutive(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def longestConsecutive(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def longestConsecutive(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int longestConsecutive(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int LongestConsecutive(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar longestConsecutive = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function longestConsecutive(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function longestConsecutive($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func longestConsecutive(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun longestConsecutive(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int longestConsecutive(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func longestConsecutive(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef longest_consecutive(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def longestConsecutive(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn longest_consecutive(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (longest-consecutive nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec longest_consecutive(Nums :: [integer()]) -> integer().\nlongest_consecutive(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec longest_consecutive(nums :: [integer]) :: integer\n def longest_consecutive(nums) do\n \n end\nend"}] | [100,4,200,1,3,2] | {
"name": "longestConsecutive",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Union Find'] |
129 | Sum Root to Leaf Numbers | sum-root-to-leaf-numbers | <p>You are given the <code>root</code> of a binary tree containing digits from <code>0</code> to <code>9</code> only.</p>
<p>Each root-to-leaf path in the tree represents a number.</p>
<ul>
<li>For example, the root-to-leaf path <code>1 -> 2 -> 3</code> represents the number <code>123</code>.</li>
</ul>
<p>Return <em>the total sum of all root-to-leaf numbers</em>. Test cases are generated so that the answer will fit in a <strong>32-bit</strong> integer.</p>
<p>A <strong>leaf</strong> node is a node with no children.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/num1tree.jpg" style="width: 212px; height: 182px;" />
<pre>
<strong>Input:</strong> root = [1,2,3]
<strong>Output:</strong> 25
<strong>Explanation:</strong>
The root-to-leaf path <code>1->2</code> represents the number <code>12</code>.
The root-to-leaf path <code>1->3</code> represents the number <code>13</code>.
Therefore, sum = 12 + 13 = <code>25</code>.
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/num2tree.jpg" style="width: 292px; height: 302px;" />
<pre>
<strong>Input:</strong> root = [4,9,0,5,1]
<strong>Output:</strong> 1026
<strong>Explanation:</strong>
The root-to-leaf path <code>4->9->5</code> represents the number 495.
The root-to-leaf path <code>4->9->1</code> represents the number 491.
The root-to-leaf path <code>4->0</code> represents the number 40.
Therefore, sum = 495 + 491 + 40 = <code>1026</code>.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[1, 1000]</code>.</li>
<li><code>0 <= Node.val <= 9</code></li>
<li>The depth of the tree will not exceed <code>10</code>.</li>
</ul>
| Medium | 1.1M | 1.6M | 1,077,988 | 1,581,841 | 68.1% | ['path-sum', 'binary-tree-maximum-path-sum', 'smallest-string-starting-from-leaf'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n int sumNumbers(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public int sumNumbers(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def sumNumbers(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def sumNumbers(self, root: Optional[TreeNode]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\nint sumNumbers(struct TreeNode* root) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public int SumNumbers(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number}\n */\nvar sumNumbers = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction sumNumbers(root: TreeNode | null): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer\n */\n function sumNumbers($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func sumNumbers(_ root: TreeNode?) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun sumNumbers(root: TreeNode?): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n int sumNumbers(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc sumNumbers(root *TreeNode) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer}\ndef sum_numbers(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def sumNumbers(root: TreeNode): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn sum_numbers(root: Option<Rc<RefCell<TreeNode>>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (sum-numbers root)\n (-> (or/c tree-node? #f) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec sum_numbers(Root :: #tree_node{} | null) -> integer().\nsum_numbers(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec sum_numbers(root :: TreeNode.t | nil) :: integer\n def sum_numbers(root) do\n \n end\nend"}] | [1,2,3] | {
"name": "sumNumbers",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Binary Tree'] |
130 | Surrounded Regions | surrounded-regions | <p>You are given an <code>m x n</code> matrix <code>board</code> containing <strong>letters</strong> <code>'X'</code> and <code>'O'</code>, <strong>capture regions</strong> that are <strong>surrounded</strong>:</p>
<ul>
<li><strong>Connect</strong>: A cell is connected to adjacent cells horizontally or vertically.</li>
<li><strong>Region</strong>: To form a region <strong>connect every</strong> <code>'O'</code> cell.</li>
<li><strong>Surround</strong>: The region is surrounded with <code>'X'</code> cells if you can <strong>connect the region </strong>with <code>'X'</code> cells and none of the region cells are on the edge of the <code>board</code>.</li>
</ul>
<p>To capture a <strong>surrounded region</strong>, replace all <code>'O'</code>s with <code>'X'</code>s <strong>in-place</strong> within the original board. You do not need to return anything.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">board = [["X","X","X","X"],["X","O","O","X"],["X","X","O","X"],["X","O","X","X"]]</span></p>
<p><strong>Output:</strong> <span class="example-io">[["X","X","X","X"],["X","X","X","X"],["X","X","X","X"],["X","O","X","X"]]</span></p>
<p><strong>Explanation:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/19/xogrid.jpg" style="width: 367px; height: 158px;" />
<p>In the above diagram, the bottom region is not captured because it is on the edge of the board and cannot be surrounded.</p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">board = [["X"]]</span></p>
<p><strong>Output:</strong> <span class="example-io">[["X"]]</span></p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>m == board.length</code></li>
<li><code>n == board[i].length</code></li>
<li><code>1 <= m, n <= 200</code></li>
<li><code>board[i][j]</code> is <code>'X'</code> or <code>'O'</code>.</li>
</ul>
| Medium | 916.8K | 2.2M | 916,818 | 2,165,030 | 42.3% | ['number-of-islands', 'walls-and-gates'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n void solve(vector<vector<char>>& board) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public void solve(char[][] board) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def solve(self, board):\n \"\"\"\n :type board: List[List[str]]\n :rtype: None Do not return anything, modify board in-place instead.\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def solve(self, board: List[List[str]]) -> None:\n \"\"\"\n Do not return anything, modify board in-place instead.\n \"\"\"\n "}, {"value": "c", "text": "C", "defaultCode": "void solve(char** board, int boardSize, int* boardColSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public void Solve(char[][] board) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {character[][]} board\n * @return {void} Do not return anything, modify board in-place instead.\n */\nvar solve = function(board) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n Do not return anything, modify board in-place instead.\n */\nfunction solve(board: string[][]): void {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String[][] $board\n * @return NULL\n */\n function solve(&$board) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func solve(_ board: inout [[Character]]) {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun solve(board: Array<CharArray>): Unit {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n void solve(List<List<String>> board) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func solve(board [][]byte) {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Character[][]} board\n# @return {Void} Do not return anything, modify board in-place instead.\ndef solve(board)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def solve(board: Array[Array[Char]]): Unit = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn solve(board: &mut Vec<Vec<char>>) {\n \n }\n}"}] | [["X","X","X","X"],["X","O","O","X"],["X","X","O","X"],["X","O","X","X"]] | {
"name": "solve",
"params": [
{
"name": "board",
"type": "character[][]"
}
],
"return": {
"type": "void"
},
"output": {
"paramindex": 0
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Depth-First Search', 'Breadth-First Search', 'Union Find', 'Matrix'] |
131 | Palindrome Partitioning | palindrome-partitioning | <p>Given a string <code>s</code>, partition <code>s</code> such that every <span data-keyword="substring-nonempty">substring</span> of the partition is a <span data-keyword="palindrome-string"><strong>palindrome</strong></span>. Return <em>all possible palindrome partitioning of </em><code>s</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> s = "aab"
<strong>Output:</strong> [["a","a","b"],["aa","b"]]
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> s = "a"
<strong>Output:</strong> [["a"]]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 16</code></li>
<li><code>s</code> contains only lowercase English letters.</li>
</ul>
| Medium | 1.1M | 1.5M | 1,082,287 | 1,510,973 | 71.6% | ['palindrome-partitioning-ii', 'palindrome-partitioning-iv', 'maximum-number-of-non-overlapping-palindrome-substrings'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<vector<string>> partition(string s) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<List<String>> partition(String s) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def partition(self, s):\n \"\"\"\n :type s: str\n :rtype: List[List[str]]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def partition(self, s: str) -> List[List[str]]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Return an array of arrays of size *returnSize.\n * The sizes of the arrays are returned as *returnColumnSizes array.\n * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free().\n */\nchar*** partition(char* s, int* returnSize, int** returnColumnSizes) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<IList<string>> Partition(string s) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @return {string[][]}\n */\nvar partition = function(s) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function partition(s: string): string[][] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @return String[][]\n */\n function partition($s) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func partition(_ s: String) -> [[String]] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun partition(s: String): List<List<String>> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<List<String>> partition(String s) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func partition(s string) [][]string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @return {String[][]}\ndef partition(s)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def partition(s: String): List[List[String]] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn partition(s: String) -> Vec<Vec<String>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (partition s)\n (-> string? (listof (listof string?)))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec partition(S :: unicode:unicode_binary()) -> [[unicode:unicode_binary()]].\npartition(S) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec partition(s :: String.t) :: [[String.t]]\n def partition(s) do\n \n end\nend"}] | "aab" | {
"name": "partition",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "list<list<string>>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['String', 'Dynamic Programming', 'Backtracking'] |
132 | Palindrome Partitioning II | palindrome-partitioning-ii | <p>Given a string <code>s</code>, partition <code>s</code> such that every <span data-keyword="substring-nonempty">substring</span> of the partition is a <span data-keyword="palindrome-string">palindrome</span>.</p>
<p>Return <em>the <strong>minimum</strong> cuts needed for a palindrome partitioning of</em> <code>s</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "aab"
<strong>Output:</strong> 1
<strong>Explanation:</strong> The palindrome partitioning ["aa","b"] could be produced using 1 cut.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = "a"
<strong>Output:</strong> 0
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> s = "ab"
<strong>Output:</strong> 1
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 2000</code></li>
<li><code>s</code> consists of lowercase English letters only.</li>
</ul>
| Hard | 329.9K | 942.7K | 329,856 | 942,660 | 35.0% | ['palindrome-partitioning', 'palindrome-partitioning-iv', 'maximum-number-of-non-overlapping-palindrome-substrings', 'number-of-great-partitions'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int minCut(string s) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int minCut(String s) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def minCut(self, s):\n \"\"\"\n :type s: str\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def minCut(self, s: str) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int minCut(char* s) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MinCut(string s) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @return {number}\n */\nvar minCut = function(s) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function minCut(s: string): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @return Integer\n */\n function minCut($s) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func minCut(_ s: String) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun minCut(s: String): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int minCut(String s) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func minCut(s string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @return {Integer}\ndef min_cut(s)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def minCut(s: String): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn min_cut(s: String) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (min-cut s)\n (-> string? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec min_cut(S :: unicode:unicode_binary()) -> integer().\nmin_cut(S) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec min_cut(s :: String.t) :: integer\n def min_cut(s) do\n \n end\nend"}] | "aab" | {
"name": "minCut",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['String', 'Dynamic Programming'] |
133 | Clone Graph | clone-graph | <p>Given a reference of a node in a <strong><a href="https://en.wikipedia.org/wiki/Connectivity_(graph_theory)#Connected_graph" target="_blank">connected</a></strong> undirected graph.</p>
<p>Return a <a href="https://en.wikipedia.org/wiki/Object_copying#Deep_copy" target="_blank"><strong>deep copy</strong></a> (clone) of the graph.</p>
<p>Each node in the graph contains a value (<code>int</code>) and a list (<code>List[Node]</code>) of its neighbors.</p>
<pre>
class Node {
public int val;
public List<Node> neighbors;
}
</pre>
<p> </p>
<p><strong>Test case format:</strong></p>
<p>For simplicity, each node's value is the same as the node's index (1-indexed). For example, the first node with <code>val == 1</code>, the second node with <code>val == 2</code>, and so on. The graph is represented in the test case using an adjacency list.</p>
<p><b>An adjacency list</b> is a collection of unordered <b>lists</b> used to represent a finite graph. Each list describes the set of neighbors of a node in the graph.</p>
<p>The given node will always be the first node with <code>val = 1</code>. You must return the <strong>copy of the given node</strong> as a reference to the cloned graph.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2019/11/04/133_clone_graph_question.png" style="width: 454px; height: 500px;" />
<pre>
<strong>Input:</strong> adjList = [[2,4],[1,3],[2,4],[1,3]]
<strong>Output:</strong> [[2,4],[1,3],[2,4],[1,3]]
<strong>Explanation:</strong> There are 4 nodes in the graph.
1st node (val = 1)'s neighbors are 2nd node (val = 2) and 4th node (val = 4).
2nd node (val = 2)'s neighbors are 1st node (val = 1) and 3rd node (val = 3).
3rd node (val = 3)'s neighbors are 2nd node (val = 2) and 4th node (val = 4).
4th node (val = 4)'s neighbors are 1st node (val = 1) and 3rd node (val = 3).
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/01/07/graph.png" style="width: 163px; height: 148px;" />
<pre>
<strong>Input:</strong> adjList = [[]]
<strong>Output:</strong> [[]]
<strong>Explanation:</strong> Note that the input contains one empty list. The graph consists of only one node with val = 1 and it does not have any neighbors.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> adjList = []
<strong>Output:</strong> []
<strong>Explanation:</strong> This an empty graph, it does not have any nodes.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the graph is in the range <code>[0, 100]</code>.</li>
<li><code>1 <= Node.val <= 100</code></li>
<li><code>Node.val</code> is unique for each node.</li>
<li>There are no repeated edges and no self-loops in the graph.</li>
<li>The Graph is connected and all nodes can be visited starting from the given node.</li>
</ul>
| Medium | 1.5M | 2.5M | 1,541,557 | 2,501,938 | 61.6% | ['copy-list-with-random-pointer', 'clone-binary-tree-with-random-pointer', 'clone-n-ary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\npublic:\n int val;\n vector<Node*> neighbors;\n Node() {\n val = 0;\n neighbors = vector<Node*>();\n }\n Node(int _val) {\n val = _val;\n neighbors = vector<Node*>();\n }\n Node(int _val, vector<Node*> _neighbors) {\n val = _val;\n neighbors = _neighbors;\n }\n};\n*/\n\nclass Solution {\npublic:\n Node* cloneGraph(Node* node) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\n public int val;\n public List<Node> neighbors;\n public Node() {\n val = 0;\n neighbors = new ArrayList<Node>();\n }\n public Node(int _val) {\n val = _val;\n neighbors = new ArrayList<Node>();\n }\n public Node(int _val, ArrayList<Node> _neighbors) {\n val = _val;\n neighbors = _neighbors;\n }\n}\n*/\n\nclass Solution {\n public Node cloneGraph(Node node) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node(object):\n def __init__(self, val = 0, neighbors = None):\n self.val = val\n self.neighbors = neighbors if neighbors is not None else []\n\"\"\"\n\nclass Solution(object):\n def cloneGraph(self, node):\n \"\"\"\n :type node: Node\n :rtype: Node\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node:\n def __init__(self, val = 0, neighbors = None):\n self.val = val\n self.neighbors = neighbors if neighbors is not None else []\n\"\"\"\n\nfrom typing import Optional\nclass Solution:\n def cloneGraph(self, node: Optional['Node']) -> Optional['Node']:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a Node.\n * struct Node {\n * int val;\n * int numNeighbors;\n * struct Node** neighbors;\n * };\n */\n\nstruct Node *cloneGraph(struct Node *s) {\n\t\n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/*\n// Definition for a Node.\npublic class Node {\n public int val;\n public IList<Node> neighbors;\n\n public Node() {\n val = 0;\n neighbors = new List<Node>();\n }\n\n public Node(int _val) {\n val = _val;\n neighbors = new List<Node>();\n }\n\n public Node(int _val, List<Node> _neighbors) {\n val = _val;\n neighbors = _neighbors;\n }\n}\n*/\n\npublic class Solution {\n public Node CloneGraph(Node node) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * // Definition for a _Node.\n * function _Node(val, neighbors) {\n * this.val = val === undefined ? 0 : val;\n * this.neighbors = neighbors === undefined ? [] : neighbors;\n * };\n */\n\n/**\n * @param {_Node} node\n * @return {_Node}\n */\nvar cloneGraph = function(node) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for _Node.\n * class _Node {\n * val: number\n * neighbors: _Node[]\n * \n * constructor(val?: number, neighbors?: _Node[]) {\n * this.val = (val===undefined ? 0 : val)\n * this.neighbors = (neighbors===undefined ? [] : neighbors)\n * }\n * }\n * \n */\n\n\nfunction cloneGraph(node: _Node | null): _Node | null {\n\t\n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a Node.\n * class Node {\n * public $val = null;\n * public $neighbors = null;\n * function __construct($val = 0) {\n * $this->val = $val;\n * $this->neighbors = array();\n * }\n * }\n */\n\nclass Solution {\n /**\n * @param Node $node\n * @return Node\n */\n function cloneGraph($node) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a Node.\n * public class Node {\n * public var val: Int\n * public var neighbors: [Node?]\n * public init(_ val: Int) {\n * self.val = val\n * self.neighbors = []\n * }\n * }\n */\n\nclass Solution {\n func cloneGraph(_ node: Node?) -> Node? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var `val`: Int) {\n * var neighbors: ArrayList<Node?> = ArrayList<Node?>()\n * }\n */\n\nclass Solution {\n fun cloneGraph(node: Node?): Node? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a Node.\n * type Node struct {\n * Val int\n * Neighbors []*Node\n * }\n */\n\nfunc cloneGraph(node *Node) *Node {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a Node.\n# class Node\n# attr_accessor :val, :neighbors\n# def initialize(val = 0, neighbors = nil)\n#\t\t @val = val\n#\t\t neighbors = [] if neighbors.nil?\n# @neighbors = neighbors\n# end\n# end\n\n# @param {Node} node\n# @return {Node}\ndef cloneGraph(node)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var _value: Int) {\n * var value: Int = _value\n * var neighbors: List[Node] = List()\n * }\n */\n\nobject Solution {\n def cloneGraph(graph: Node): Node = {\n \n }\n}"}] | [[2,4],[1,3],[2,4],[1,3]] | {
"name": "cloneGraph",
"params": [
{
"name": "edges",
"type": "integer[][]"
}
],
"return": {
"type": "boolean"
},
"languages": [
"cpp",
"java",
"python",
"csharp",
"javascript",
"python3",
"golang",
"swift",
"kotlin",
"ruby",
"c",
"scala",
"php",
"typescript"
],
"manual": true,
"typescriptCustomType" : "class _Node {\n val: number\n neighbors: _Node[]\n\n constructor(val?: number, neighbors?: _Node[]) {\n this.val = (val===undefined ? 0 : val)\n this.neighbors = (neighbors===undefined ? [] : neighbors)\n }\n}\n"
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Hash Table', 'Depth-First Search', 'Breadth-First Search', 'Graph'] |
134 | Gas Station | gas-station | <p>There are <code>n</code> gas stations along a circular route, where the amount of gas at the <code>i<sup>th</sup></code> station is <code>gas[i]</code>.</p>
<p>You have a car with an unlimited gas tank and it costs <code>cost[i]</code> of gas to travel from the <code>i<sup>th</sup></code> station to its next <code>(i + 1)<sup>th</sup></code> station. You begin the journey with an empty tank at one of the gas stations.</p>
<p>Given two integer arrays <code>gas</code> and <code>cost</code>, return <em>the starting gas station's index if you can travel around the circuit once in the clockwise direction, otherwise return</em> <code>-1</code>. If there exists a solution, it is <strong>guaranteed</strong> to be <strong>unique</strong>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> gas = [1,2,3,4,5], cost = [3,4,5,1,2]
<strong>Output:</strong> 3
<strong>Explanation:</strong>
Start at station 3 (index 3) and fill up with 4 unit of gas. Your tank = 0 + 4 = 4
Travel to station 4. Your tank = 4 - 1 + 5 = 8
Travel to station 0. Your tank = 8 - 2 + 1 = 7
Travel to station 1. Your tank = 7 - 3 + 2 = 6
Travel to station 2. Your tank = 6 - 4 + 3 = 5
Travel to station 3. The cost is 5. Your gas is just enough to travel back to station 3.
Therefore, return 3 as the starting index.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> gas = [2,3,4], cost = [3,4,3]
<strong>Output:</strong> -1
<strong>Explanation:</strong>
You can't start at station 0 or 1, as there is not enough gas to travel to the next station.
Let's start at station 2 and fill up with 4 unit of gas. Your tank = 0 + 4 = 4
Travel to station 0. Your tank = 4 - 3 + 2 = 3
Travel to station 1. Your tank = 3 - 3 + 3 = 3
You cannot travel back to station 2, as it requires 4 unit of gas but you only have 3.
Therefore, you can't travel around the circuit once no matter where you start.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>n == gas.length == cost.length</code></li>
<li><code>1 <= n <= 10<sup>5</sup></code></li>
<li><code>0 <= gas[i], cost[i] <= 10<sup>4</sup></code></li>
</ul>
| Medium | 1.1M | 2.3M | 1,061,734 | 2,303,048 | 46.1% | ['maximize-the-topmost-element-after-k-moves'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int canCompleteCircuit(vector<int>& gas, vector<int>& cost) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int canCompleteCircuit(int[] gas, int[] cost) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def canCompleteCircuit(self, gas, cost):\n \"\"\"\n :type gas: List[int]\n :type cost: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def canCompleteCircuit(self, gas: List[int], cost: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int canCompleteCircuit(int* gas, int gasSize, int* cost, int costSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int CanCompleteCircuit(int[] gas, int[] cost) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} gas\n * @param {number[]} cost\n * @return {number}\n */\nvar canCompleteCircuit = function(gas, cost) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function canCompleteCircuit(gas: number[], cost: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $gas\n * @param Integer[] $cost\n * @return Integer\n */\n function canCompleteCircuit($gas, $cost) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func canCompleteCircuit(_ gas: [Int], _ cost: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun canCompleteCircuit(gas: IntArray, cost: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int canCompleteCircuit(List<int> gas, List<int> cost) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func canCompleteCircuit(gas []int, cost []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} gas\n# @param {Integer[]} cost\n# @return {Integer}\ndef can_complete_circuit(gas, cost)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def canCompleteCircuit(gas: Array[Int], cost: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn can_complete_circuit(gas: Vec<i32>, cost: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (can-complete-circuit gas cost)\n (-> (listof exact-integer?) (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec can_complete_circuit(Gas :: [integer()], Cost :: [integer()]) -> integer().\ncan_complete_circuit(Gas, Cost) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec can_complete_circuit(gas :: [integer], cost :: [integer]) :: integer\n def can_complete_circuit(gas, cost) do\n \n end\nend"}] | [1,2,3,4,5]
[3,4,5,1,2] | {
"name": "canCompleteCircuit",
"params": [
{
"name": "gas",
"type": "integer[]"
},
{
"name": "cost",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Greedy'] |
135 | Candy | candy | <p>There are <code>n</code> children standing in a line. Each child is assigned a rating value given in the integer array <code>ratings</code>.</p>
<p>You are giving candies to these children subjected to the following requirements:</p>
<ul>
<li>Each child must have at least one candy.</li>
<li>Children with a higher rating get more candies than their neighbors.</li>
</ul>
<p>Return <em>the minimum number of candies you need to have to distribute the candies to the children</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> ratings = [1,0,2]
<strong>Output:</strong> 5
<strong>Explanation:</strong> You can allocate to the first, second and third child with 2, 1, 2 candies respectively.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> ratings = [1,2,2]
<strong>Output:</strong> 4
<strong>Explanation:</strong> You can allocate to the first, second and third child with 1, 2, 1 candies respectively.
The third child gets 1 candy because it satisfies the above two conditions.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>n == ratings.length</code></li>
<li><code>1 <= n <= 2 * 10<sup>4</sup></code></li>
<li><code>0 <= ratings[i] <= 2 * 10<sup>4</sup></code></li>
</ul>
| Hard | 726.3K | 1.6M | 726,275 | 1,631,640 | 44.5% | ['minimize-maximum-value-in-a-grid', 'minimum-number-of-operations-to-satisfy-conditions', 'check-if-grid-satisfies-conditions'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int candy(vector<int>& ratings) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int candy(int[] ratings) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def candy(self, ratings):\n \"\"\"\n :type ratings: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def candy(self, ratings: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int candy(int* ratings, int ratingsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int Candy(int[] ratings) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} ratings\n * @return {number}\n */\nvar candy = function(ratings) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function candy(ratings: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $ratings\n * @return Integer\n */\n function candy($ratings) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func candy(_ ratings: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun candy(ratings: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int candy(List<int> ratings) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func candy(ratings []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} ratings\n# @return {Integer}\ndef candy(ratings)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def candy(ratings: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn candy(ratings: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (candy ratings)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec candy(Ratings :: [integer()]) -> integer().\ncandy(Ratings) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec candy(ratings :: [integer]) :: integer\n def candy(ratings) do\n \n end\nend"}] | [1,0,2] | {
"name": "candy",
"params": [
{
"name": "ratings",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Greedy'] |
136 | Single Number | single-number | <p>Given a <strong>non-empty</strong> array of integers <code>nums</code>, every element appears <em>twice</em> except for one. Find that single one.</p>
<p>You must implement a solution with a linear runtime complexity and use only constant extra space.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">nums = [2,2,1]</span></p>
<p><strong>Output:</strong> <span class="example-io">1</span></p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">nums = [4,1,2,1,2]</span></p>
<p><strong>Output:</strong> <span class="example-io">4</span></p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">nums = [1]</span></p>
<p><strong>Output:</strong> <span class="example-io">1</span></p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 3 * 10<sup>4</sup></code></li>
<li><code>-3 * 10<sup>4</sup> <= nums[i] <= 3 * 10<sup>4</sup></code></li>
<li>Each element in the array appears twice except for one element which appears only once.</li>
</ul>
| Easy | 3.6M | 4.7M | 3,571,883 | 4,726,735 | 75.6% | ['single-number-ii', 'single-number-iii', 'missing-number', 'find-the-duplicate-number', 'find-the-difference', 'find-the-xor-of-numbers-which-appear-twice'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int singleNumber(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int singleNumber(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def singleNumber(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def singleNumber(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int singleNumber(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int SingleNumber(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar singleNumber = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function singleNumber(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function singleNumber($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func singleNumber(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun singleNumber(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int singleNumber(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func singleNumber(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef single_number(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def singleNumber(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn single_number(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (single-number nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec single_number(Nums :: [integer()]) -> integer().\nsingle_number(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec single_number(nums :: [integer]) :: integer\n def single_number(nums) do\n \n end\nend"}] | [2,2,1] | {
"name": "singleNumber",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Bit Manipulation'] |
137 | Single Number II | single-number-ii | <p>Given an integer array <code>nums</code> where every element appears <strong>three times</strong> except for one, which appears <strong>exactly once</strong>. <em>Find the single element and return it</em>.</p>
<p>You must implement a solution with a linear runtime complexity and use only constant extra space.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> nums = [2,2,3,2]
<strong>Output:</strong> 3
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> nums = [0,1,0,1,0,1,99]
<strong>Output:</strong> 99
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 3 * 10<sup>4</sup></code></li>
<li><code>-2<sup>31</sup> <= nums[i] <= 2<sup>31</sup> - 1</code></li>
<li>Each element in <code>nums</code> appears exactly <strong>three times</strong> except for one element which appears <strong>once</strong>.</li>
</ul>
| Medium | 717.6K | 1.1M | 717,553 | 1,106,074 | 64.9% | ['single-number', 'single-number-iii', 'find-the-xor-of-numbers-which-appear-twice'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int singleNumber(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int singleNumber(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def singleNumber(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def singleNumber(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int singleNumber(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int SingleNumber(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar singleNumber = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function singleNumber(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function singleNumber($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func singleNumber(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun singleNumber(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int singleNumber(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func singleNumber(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef single_number(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def singleNumber(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn single_number(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (single-number nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec single_number(Nums :: [integer()]) -> integer().\nsingle_number(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec single_number(nums :: [integer]) :: integer\n def single_number(nums) do\n \n end\nend"}] | [2,2,3,2] | {
"name": "singleNumber",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Bit Manipulation'] |
138 | Copy List with Random Pointer | copy-list-with-random-pointer | <p>A linked list of length <code>n</code> is given such that each node contains an additional random pointer, which could point to any node in the list, or <code>null</code>.</p>
<p>Construct a <a href="https://en.wikipedia.org/wiki/Object_copying#Deep_copy" target="_blank"><strong>deep copy</strong></a> of the list. The deep copy should consist of exactly <code>n</code> <strong>brand new</strong> nodes, where each new node has its value set to the value of its corresponding original node. Both the <code>next</code> and <code>random</code> pointer of the new nodes should point to new nodes in the copied list such that the pointers in the original list and copied list represent the same list state. <strong>None of the pointers in the new list should point to nodes in the original list</strong>.</p>
<p>For example, if there are two nodes <code>X</code> and <code>Y</code> in the original list, where <code>X.random --> Y</code>, then for the corresponding two nodes <code>x</code> and <code>y</code> in the copied list, <code>x.random --> y</code>.</p>
<p>Return <em>the head of the copied linked list</em>.</p>
<p>The linked list is represented in the input/output as a list of <code>n</code> nodes. Each node is represented as a pair of <code>[val, random_index]</code> where:</p>
<ul>
<li><code>val</code>: an integer representing <code>Node.val</code></li>
<li><code>random_index</code>: the index of the node (range from <code>0</code> to <code>n-1</code>) that the <code>random</code> pointer points to, or <code>null</code> if it does not point to any node.</li>
</ul>
<p>Your code will <strong>only</strong> be given the <code>head</code> of the original linked list.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2019/12/18/e1.png" style="width: 700px; height: 142px;" />
<pre>
<strong>Input:</strong> head = [[7,null],[13,0],[11,4],[10,2],[1,0]]
<strong>Output:</strong> [[7,null],[13,0],[11,4],[10,2],[1,0]]
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2019/12/18/e2.png" style="width: 700px; height: 114px;" />
<pre>
<strong>Input:</strong> head = [[1,1],[2,1]]
<strong>Output:</strong> [[1,1],[2,1]]
</pre>
<p><strong class="example">Example 3:</strong></p>
<p><strong><img alt="" src="https://assets.leetcode.com/uploads/2019/12/18/e3.png" style="width: 700px; height: 122px;" /></strong></p>
<pre>
<strong>Input:</strong> head = [[3,null],[3,0],[3,null]]
<strong>Output:</strong> [[3,null],[3,0],[3,null]]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>0 <= n <= 1000</code></li>
<li><code>-10<sup>4</sup> <= Node.val <= 10<sup>4</sup></code></li>
<li><code>Node.random</code> is <code>null</code> or is pointing to some node in the linked list.</li>
</ul>
| Medium | 1.6M | 2.6M | 1,561,342 | 2,607,400 | 59.9% | ['clone-graph', 'clone-binary-tree-with-random-pointer', 'clone-n-ary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\npublic:\n int val;\n Node* next;\n Node* random;\n \n Node(int _val) {\n val = _val;\n next = NULL;\n random = NULL;\n }\n};\n*/\n\nclass Solution {\npublic:\n Node* copyRandomList(Node* head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/*\n// Definition for a Node.\nclass Node {\n int val;\n Node next;\n Node random;\n\n public Node(int val) {\n this.val = val;\n this.next = null;\n this.random = null;\n }\n}\n*/\n\nclass Solution {\n public Node copyRandomList(Node head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node:\n def __init__(self, x, next=None, random=None):\n self.val = int(x)\n self.next = next\n self.random = random\n\"\"\"\n\nclass Solution(object):\n def copyRandomList(self, head):\n \"\"\"\n :type head: Node\n :rtype: Node\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "\"\"\"\n# Definition for a Node.\nclass Node:\n def __init__(self, x: int, next: 'Node' = None, random: 'Node' = None):\n self.val = int(x)\n self.next = next\n self.random = random\n\"\"\"\n\nclass Solution:\n def copyRandomList(self, head: 'Optional[Node]') -> 'Optional[Node]':\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a Node.\n * struct Node {\n * int val;\n * struct Node *next;\n * struct Node *random;\n * };\n */\n\nstruct Node* copyRandomList(struct Node* head) {\n\t\n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/*\n// Definition for a Node.\npublic class Node {\n public int val;\n public Node next;\n public Node random;\n \n public Node(int _val) {\n val = _val;\n next = null;\n random = null;\n }\n}\n*/\n\npublic class Solution {\n public Node CopyRandomList(Node head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * // Definition for a _Node.\n * function _Node(val, next, random) {\n * this.val = val;\n * this.next = next;\n * this.random = random;\n * };\n */\n\n/**\n * @param {_Node} head\n * @return {_Node}\n */\nvar copyRandomList = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for _Node.\n * class _Node {\n * val: number\n * next: _Node | null\n * random: _Node | null\n * \n * constructor(val?: number, next?: _Node, random?: _Node) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * this.random = (random===undefined ? null : random)\n * }\n * }\n */\n\n\nfunction copyRandomList(head: _Node | null): _Node | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a Node.\n * class Node {\n * public $val = null;\n * public $next = null;\n * public $random = null;\n * function __construct($val = 0) {\n * $this->val = $val;\n * $this->next = null;\n * $this->random = null;\n * }\n * }\n */\n\nclass Solution {\n /**\n * @param Node $head\n * @return Node\n */\n function copyRandomList($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a Node.\n * public class Node {\n * public var val: Int\n * public var next: Node?\n * public var random: Node?\n * public init(_ val: Int) {\n * self.val = val\n * self.next = nil\n * \t self.random = nil\n * }\n * }\n */\n\nclass Solution {\n func copyRandomList(_ head: Node?) -> Node? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = Node(5)\n * var v = ti.`val`\n * Definition for a Node.\n * class Node(var `val`: Int) {\n * var next: Node? = null\n * var random: Node? = null\n * }\n */\n\nclass Solution {\n fun copyRandomList(node: Node?): Node? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a Node.\n * type Node struct {\n * Val int\n * Next *Node\n * Random *Node\n * }\n */\n\nfunc copyRandomList(head *Node) *Node {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for Node.\n# class Node\n# attr_accessor :val, :next, :random\n# def initialize(val = 0)\n# @val = val\n#\t\t @next = nil\n#\t\t @random = nil\n# end\n# end\n\n# @param {Node} node\n# @return {Node}\ndef copyRandomList(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a Node.\n * class Node(var _value: Int) {\n * var value: Int = _value\n * var next: Node = null\n * var random: Node = null\n * }\n */\n\nobject Solution {\n def copyRandomList(head: Node): Node = {\n \n }\n}"}] | [[7,null],[13,0],[11,4],[10,2],[1,0]] | {
"name": "copyRandomList",
"params": [
{
"name": "head",
"type": "ListNode"
}
],
"return": {
"type": "ListNode"
},
"languages": [
"cpp",
"java",
"python",
"csharp",
"javascript",
"python3",
"golang",
"swift",
"kotlin",
"ruby",
"c",
"scala",
"php",
"typescript"
],
"manual": true,
"typescriptCustomType" : "class _Node {\n val: number\n next: _Node | null\n random: _Node | null\n\n constructor(val?: number, next?: _Node, random?: _Node) {\n this.val = (val===undefined ? 0 : val)\n this.next = (next===undefined ? null : next)\n this.random = (random===undefined ? null : random)\n }\n}\n"
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Hash Table', 'Linked List'] |
139 | Word Break | word-break | <p>Given a string <code>s</code> and a dictionary of strings <code>wordDict</code>, return <code>true</code> if <code>s</code> can be segmented into a space-separated sequence of one or more dictionary words.</p>
<p><strong>Note</strong> that the same word in the dictionary may be reused multiple times in the segmentation.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "leetcode", wordDict = ["leet","code"]
<strong>Output:</strong> true
<strong>Explanation:</strong> Return true because "leetcode" can be segmented as "leet code".
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = "applepenapple", wordDict = ["apple","pen"]
<strong>Output:</strong> true
<strong>Explanation:</strong> Return true because "applepenapple" can be segmented as "apple pen apple".
Note that you are allowed to reuse a dictionary word.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> s = "catsandog", wordDict = ["cats","dog","sand","and","cat"]
<strong>Output:</strong> false
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 300</code></li>
<li><code>1 <= wordDict.length <= 1000</code></li>
<li><code>1 <= wordDict[i].length <= 20</code></li>
<li><code>s</code> and <code>wordDict[i]</code> consist of only lowercase English letters.</li>
<li>All the strings of <code>wordDict</code> are <strong>unique</strong>.</li>
</ul>
| Medium | 2M | 4.2M | 2,007,166 | 4,179,628 | 48.0% | ['word-break-ii', 'extra-characters-in-a-string'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n bool wordBreak(string s, vector<string>& wordDict) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public boolean wordBreak(String s, List<String> wordDict) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def wordBreak(self, s, wordDict):\n \"\"\"\n :type s: str\n :type wordDict: List[str]\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def wordBreak(self, s: str, wordDict: List[str]) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "bool wordBreak(char* s, char** wordDict, int wordDictSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public bool WordBreak(string s, IList<string> wordDict) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @param {string[]} wordDict\n * @return {boolean}\n */\nvar wordBreak = function(s, wordDict) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function wordBreak(s: string, wordDict: string[]): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @param String[] $wordDict\n * @return Boolean\n */\n function wordBreak($s, $wordDict) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func wordBreak(_ s: String, _ wordDict: [String]) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun wordBreak(s: String, wordDict: List<String>): Boolean {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n bool wordBreak(String s, List<String> wordDict) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func wordBreak(s string, wordDict []string) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @param {String[]} word_dict\n# @return {Boolean}\ndef word_break(s, word_dict)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def wordBreak(s: String, wordDict: List[String]): Boolean = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn word_break(s: String, word_dict: Vec<String>) -> bool {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (word-break s wordDict)\n (-> string? (listof string?) boolean?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec word_break(S :: unicode:unicode_binary(), WordDict :: [unicode:unicode_binary()]) -> boolean().\nword_break(S, WordDict) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec word_break(s :: String.t, word_dict :: [String.t]) :: boolean\n def word_break(s, word_dict) do\n \n end\nend"}] | "leetcode"
["leet","code"] | {
"name": "wordBreak",
"params": [
{
"name": "s",
"type": "string"
},
{
"name": "wordDict",
"type": "list<string>"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'String', 'Dynamic Programming', 'Trie', 'Memoization'] |
140 | Word Break II | word-break-ii | <p>Given a string <code>s</code> and a dictionary of strings <code>wordDict</code>, add spaces in <code>s</code> to construct a sentence where each word is a valid dictionary word. Return all such possible sentences in <strong>any order</strong>.</p>
<p><strong>Note</strong> that the same word in the dictionary may be reused multiple times in the segmentation.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "catsanddog", wordDict = ["cat","cats","and","sand","dog"]
<strong>Output:</strong> ["cats and dog","cat sand dog"]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = "pineapplepenapple", wordDict = ["apple","pen","applepen","pine","pineapple"]
<strong>Output:</strong> ["pine apple pen apple","pineapple pen apple","pine applepen apple"]
<strong>Explanation:</strong> Note that you are allowed to reuse a dictionary word.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> s = "catsandog", wordDict = ["cats","dog","sand","and","cat"]
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 20</code></li>
<li><code>1 <= wordDict.length <= 1000</code></li>
<li><code>1 <= wordDict[i].length <= 10</code></li>
<li><code>s</code> and <code>wordDict[i]</code> consist of only lowercase English letters.</li>
<li>All the strings of <code>wordDict</code> are <strong>unique</strong>.</li>
<li>Input is generated in a way that the length of the answer doesn't exceed 10<sup>5</sup>.</li>
</ul>
| Hard | 733.9K | 1.4M | 733,883 | 1,379,863 | 53.2% | ['word-break', 'concatenated-words'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<string> wordBreak(string s, vector<string>& wordDict) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<String> wordBreak(String s, List<String> wordDict) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def wordBreak(self, s, wordDict):\n \"\"\"\n :type s: str\n :type wordDict: List[str]\n :rtype: List[str]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def wordBreak(self, s: str, wordDict: List[str]) -> List[str]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nchar** wordBreak(char* s, char** wordDict, int wordDictSize, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<string> WordBreak(string s, IList<string> wordDict) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @param {string[]} wordDict\n * @return {string[]}\n */\nvar wordBreak = function(s, wordDict) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function wordBreak(s: string, wordDict: string[]): string[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @param String[] $wordDict\n * @return String[]\n */\n function wordBreak($s, $wordDict) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func wordBreak(_ s: String, _ wordDict: [String]) -> [String] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun wordBreak(s: String, wordDict: List<String>): List<String> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<String> wordBreak(String s, List<String> wordDict) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func wordBreak(s string, wordDict []string) []string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @param {String[]} word_dict\n# @return {String[]}\ndef word_break(s, word_dict)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def wordBreak(s: String, wordDict: List[String]): List[String] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn word_break(s: String, word_dict: Vec<String>) -> Vec<String> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (word-break s wordDict)\n (-> string? (listof string?) (listof string?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec word_break(S :: unicode:unicode_binary(), WordDict :: [unicode:unicode_binary()]) -> [unicode:unicode_binary()].\nword_break(S, WordDict) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec word_break(s :: String.t, word_dict :: [String.t]) :: [String.t]\n def word_break(s, word_dict) do\n \n end\nend"}] | "catsanddog"
["cat","cats","and","sand","dog"] | {
"name": "wordBreak",
"params": [
{
"name": "s",
"type": "string"
},
{
"name": "wordDict",
"type": "list<string>"
}
],
"return": {
"type": "list<string>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'String', 'Dynamic Programming', 'Backtracking', 'Trie', 'Memoization'] |
141 | Linked List Cycle | linked-list-cycle | <p>Given <code>head</code>, the head of a linked list, determine if the linked list has a cycle in it.</p>
<p>There is a cycle in a linked list if there is some node in the list that can be reached again by continuously following the <code>next</code> pointer. Internally, <code>pos</code> is used to denote the index of the node that tail's <code>next</code> pointer is connected to. <strong>Note that <code>pos</code> is not passed as a parameter</strong>.</p>
<p>Return <code>true</code><em> if there is a cycle in the linked list</em>. Otherwise, return <code>false</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist.png" style="width: 300px; height: 97px; margin-top: 8px; margin-bottom: 8px;" />
<pre>
<strong>Input:</strong> head = [3,2,0,-4], pos = 1
<strong>Output:</strong> true
<strong>Explanation:</strong> There is a cycle in the linked list, where the tail connects to the 1st node (0-indexed).
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist_test2.png" style="width: 141px; height: 74px;" />
<pre>
<strong>Input:</strong> head = [1,2], pos = 0
<strong>Output:</strong> true
<strong>Explanation:</strong> There is a cycle in the linked list, where the tail connects to the 0th node.
</pre>
<p><strong class="example">Example 3:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist_test3.png" style="width: 45px; height: 45px;" />
<pre>
<strong>Input:</strong> head = [1], pos = -1
<strong>Output:</strong> false
<strong>Explanation:</strong> There is no cycle in the linked list.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of the nodes in the list is in the range <code>[0, 10<sup>4</sup>]</code>.</li>
<li><code>-10<sup>5</sup> <= Node.val <= 10<sup>5</sup></code></li>
<li><code>pos</code> is <code>-1</code> or a <strong>valid index</strong> in the linked-list.</li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Can you solve it using <code>O(1)</code> (i.e. constant) memory?</p>
| Easy | 3.8M | 7.3M | 3,802,205 | 7,286,384 | 52.2% | ['linked-list-cycle-ii', 'happy-number'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode(int x) : val(x), next(NULL) {}\n * };\n */\nclass Solution {\npublic:\n bool hasCycle(ListNode *head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode next;\n * ListNode(int x) {\n * val = x;\n * next = null;\n * }\n * }\n */\npublic class Solution {\n public boolean hasCycle(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution(object):\n def hasCycle(self, head):\n \"\"\"\n :type head: ListNode\n :rtype: bool\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution:\n def hasCycle(self, head: Optional[ListNode]) -> bool:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nbool hasCycle(struct ListNode *head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int x) {\n * val = x;\n * next = null;\n * }\n * }\n */\npublic class Solution {\n public bool HasCycle(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val) {\n * this.val = val;\n * this.next = null;\n * }\n */\n\n/**\n * @param {ListNode} head\n * @return {boolean}\n */\nvar hasCycle = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction hasCycle(head: ListNode | null): boolean {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val) { $this->val = $val; }\n * }\n */\n\nclass Solution {\n /**\n * @param ListNode $head\n * @return Boolean\n */\n function hasCycle($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init(_ val: Int) {\n * self.val = val\n * self.next = nil\n * }\n * }\n */\n\nclass Solution {\n func hasCycle(_ head: ListNode?) -> Bool {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\n\nclass Solution {\n fun hasCycle(head: ListNode?): Boolean {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc hasCycle(head *ListNode) bool {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val)\n# @val = val\n# @next = nil\n# end\n# end\n\n# @param {ListNode} head\n# @return {Boolean}\ndef hasCycle(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(var _x: Int = 0) {\n * var next: ListNode = null\n * var x: Int = _x\n * }\n */\n\nobject Solution {\n def hasCycle(head: ListNode): Boolean = {\n \n }\n}"}] | [3,2,0,-4]
1 | {
"name": "hasCycle",
"params": [
{
"name": "head",
"type": "ListNode"
},
{
"name": "pos",
"type": "integer"
}
],
"return": {
"type": "boolean"
},
"manual": true,
"languages": [
"cpp",
"java",
"python",
"c",
"csharp",
"javascript",
"ruby",
"swift",
"golang",
"python3",
"scala",
"kotlin",
"php",
"typescript"
]
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Hash Table', 'Linked List', 'Two Pointers'] |
142 | Linked List Cycle II | linked-list-cycle-ii | <p>Given the <code>head</code> of a linked list, return <em>the node where the cycle begins. If there is no cycle, return </em><code>null</code>.</p>
<p>There is a cycle in a linked list if there is some node in the list that can be reached again by continuously following the <code>next</code> pointer. Internally, <code>pos</code> is used to denote the index of the node that tail's <code>next</code> pointer is connected to (<strong>0-indexed</strong>). It is <code>-1</code> if there is no cycle. <strong>Note that</strong> <code>pos</code> <strong>is not passed as a parameter</strong>.</p>
<p><strong>Do not modify</strong> the linked list.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist.png" style="height: 145px; width: 450px;" />
<pre>
<strong>Input:</strong> head = [3,2,0,-4], pos = 1
<strong>Output:</strong> tail connects to node index 1
<strong>Explanation:</strong> There is a cycle in the linked list, where tail connects to the second node.
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist_test2.png" style="height: 105px; width: 201px;" />
<pre>
<strong>Input:</strong> head = [1,2], pos = 0
<strong>Output:</strong> tail connects to node index 0
<strong>Explanation:</strong> There is a cycle in the linked list, where tail connects to the first node.
</pre>
<p><strong class="example">Example 3:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/07/circularlinkedlist_test3.png" style="height: 65px; width: 65px;" />
<pre>
<strong>Input:</strong> head = [1], pos = -1
<strong>Output:</strong> no cycle
<strong>Explanation:</strong> There is no cycle in the linked list.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of the nodes in the list is in the range <code>[0, 10<sup>4</sup>]</code>.</li>
<li><code>-10<sup>5</sup> <= Node.val <= 10<sup>5</sup></code></li>
<li><code>pos</code> is <code>-1</code> or a <strong>valid index</strong> in the linked-list.</li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Can you solve it using <code>O(1)</code> (i.e. constant) memory?</p>
| Medium | 1.6M | 2.9M | 1,588,130 | 2,923,673 | 54.3% | ['linked-list-cycle', 'find-the-duplicate-number'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode(int x) : val(x), next(NULL) {}\n * };\n */\nclass Solution {\npublic:\n ListNode *detectCycle(ListNode *head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode next;\n * ListNode(int x) {\n * val = x;\n * next = null;\n * }\n * }\n */\npublic class Solution {\n public ListNode detectCycle(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution(object):\n def detectCycle(self, head):\n \"\"\"\n :type head: ListNode\n :rtype: ListNode\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution:\n def detectCycle(self, head: Optional[ListNode]) -> Optional[ListNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nstruct ListNode *detectCycle(struct ListNode *head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int x) {\n * val = x;\n * next = null;\n * }\n * }\n */\npublic class Solution {\n public ListNode DetectCycle(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val) {\n * this.val = val;\n * this.next = null;\n * }\n */\n\n/**\n * @param {ListNode} head\n * @return {ListNode}\n */\nvar detectCycle = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction detectCycle(head: ListNode | null): ListNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val) { $this->val = $val; }\n * }\n */\n\nclass Solution {\n /**\n * @param ListNode $head\n * @return ListNode\n */\n function detectCycle($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init(_ val: Int) {\n * self.val = val\n * self.next = nil\n * }\n * }\n */\n\nclass Solution {\n func detectCycle(_ head: ListNode?) -> ListNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\n\nclass Solution {\n fun detectCycle(head: ListNode?): ListNode? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc detectCycle(head *ListNode) *ListNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val)\n# @val = val\n# @next = nil\n# end\n# end\n\n# @param {ListNode} head\n# @return {ListNode}\ndef detectCycle(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(var _x: Int = 0) {\n * var next: ListNode = null\n * var x: Int = _x\n * }\n */\n\nobject Solution {\n def detectCycle(head: ListNode): ListNode = {\n \n }\n}"}] | [3,2,0,-4]
1 | {
"name": "detectCycle",
"params": [
{
"name": "head",
"type": "ListNode"
},
{
"name": "pos",
"type": "integer"
}
],
"return": {
"type": "ListNode"
},
"languages": [
"cpp",
"java",
"python",
"c",
"csharp",
"javascript",
"golang",
"python3",
"swift",
"kotlin",
"php",
"ruby",
"scala",
"typescript"
],
"manual": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Hash Table', 'Linked List', 'Two Pointers'] |
143 | Reorder List | reorder-list | <p>You are given the head of a singly linked-list. The list can be represented as:</p>
<pre>
L<sub>0</sub> → L<sub>1</sub> → … → L<sub>n - 1</sub> → L<sub>n</sub>
</pre>
<p><em>Reorder the list to be on the following form:</em></p>
<pre>
L<sub>0</sub> → L<sub>n</sub> → L<sub>1</sub> → L<sub>n - 1</sub> → L<sub>2</sub> → L<sub>n - 2</sub> → …
</pre>
<p>You may not modify the values in the list's nodes. Only nodes themselves may be changed.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/04/reorder1linked-list.jpg" style="width: 422px; height: 222px;" />
<pre>
<strong>Input:</strong> head = [1,2,3,4]
<strong>Output:</strong> [1,4,2,3]
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/09/reorder2-linked-list.jpg" style="width: 542px; height: 222px;" />
<pre>
<strong>Input:</strong> head = [1,2,3,4,5]
<strong>Output:</strong> [1,5,2,4,3]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the list is in the range <code>[1, 5 * 10<sup>4</sup>]</code>.</li>
<li><code>1 <= Node.val <= 1000</code></li>
</ul>
| Medium | 1.2M | 2M | 1,210,959 | 1,955,663 | 61.9% | ['delete-the-middle-node-of-a-linked-list', 'take-k-of-each-character-from-left-and-right'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode() : val(0), next(nullptr) {}\n * ListNode(int x) : val(x), next(nullptr) {}\n * ListNode(int x, ListNode *next) : val(x), next(next) {}\n * };\n */\nclass Solution {\npublic:\n void reorderList(ListNode* head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * int val;\n * ListNode next;\n * ListNode() {}\n * ListNode(int val) { this.val = val; }\n * ListNode(int val, ListNode next) { this.val = val; this.next = next; }\n * }\n */\nclass Solution {\n public void reorderList(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution(object):\n def reorderList(self, head):\n \"\"\"\n :type head: Optional[ListNode]\n :rtype: None Do not return anything, modify head in-place instead.\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution:\n def reorderList(self, head: Optional[ListNode]) -> None:\n \"\"\"\n Do not return anything, modify head in-place instead.\n \"\"\"\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nvoid reorderList(struct ListNode* head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int val=0, ListNode next=null) {\n * this.val = val;\n * this.next = next;\n * }\n * }\n */\npublic class Solution {\n public void ReorderList(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val, next) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n */\n/**\n * @param {ListNode} head\n * @return {void} Do not return anything, modify head in-place instead.\n */\nvar reorderList = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\n/**\n Do not return anything, modify head in-place instead.\n */\nfunction reorderList(head: ListNode | null): void {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val = 0, $next = null) {\n * $this->val = $val;\n * $this->next = $next;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param ListNode $head\n * @return NULL\n */\n function reorderList($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init() { self.val = 0; self.next = nil; }\n * public init(_ val: Int) { self.val = val; self.next = nil; }\n * public init(_ val: Int, _ next: ListNode?) { self.val = val; self.next = next; }\n * }\n */\nclass Solution {\n func reorderList(_ head: ListNode?) {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\nclass Solution {\n fun reorderList(head: ListNode?): Unit {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode? next;\n * ListNode([this.val = 0, this.next]);\n * }\n */\nclass Solution {\n void reorderList(ListNode? head) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc reorderList(head *ListNode) {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val = 0, _next = nil)\n# @val = val\n# @next = _next\n# end\n# end\n# @param {ListNode} head\n# @return {Void} Do not return anything, modify head in-place instead.\ndef reorder_list(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(_x: Int = 0, _next: ListNode = null) {\n * var next: ListNode = _next\n * var x: Int = _x\n * }\n */\nobject Solution {\n def reorderList(head: ListNode): Unit = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for singly-linked list.\n// #[derive(PartialEq, Eq, Clone, Debug)]\n// pub struct ListNode {\n// pub val: i32,\n// pub next: Option<Box<ListNode>>\n// }\n// \n// impl ListNode {\n// #[inline]\n// fn new(val: i32) -> Self {\n// ListNode {\n// next: None,\n// val\n// }\n// }\n// }\nimpl Solution {\n pub fn reorder_list(head: &mut Option<Box<ListNode>>) {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for singly-linked list:\n#|\n\n; val : integer?\n; next : (or/c list-node? #f)\n(struct list-node\n (val next) #:mutable #:transparent)\n\n; constructor\n(define (make-list-node [val 0])\n (list-node val #f))\n\n|#\n\n(define/contract (reorder-list head)\n (-> (or/c list-node? #f) void?)\n )"}] | [1,2,3,4] | {
"name": "reorderList",
"params": [
{
"name": "head",
"type": "ListNode"
}
],
"return": {
"type": "void"
},
"output": {
"paramindex": 0
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Linked List', 'Two Pointers', 'Stack', 'Recursion'] |
144 | Binary Tree Preorder Traversal | binary-tree-preorder-traversal | <p>Given the <code>root</code> of a binary tree, return <em>the preorder traversal of its nodes' values</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,null,2,3]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1,2,3]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/08/29/screenshot-2024-08-29-202743.png" style="width: 200px; height: 264px;" /></p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,2,3,4,5,null,8,null,null,6,7,9]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1,2,4,5,6,7,3,8,9]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/08/29/tree_2.png" style="width: 350px; height: 286px;" /></p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = []</span></p>
<p><strong>Output:</strong> <span class="example-io">[]</span></p>
</div>
<p><strong class="example">Example 4:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1]</span></p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 100]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Recursive solution is trivial, could you do it iteratively?</p>
| Easy | 2M | 2.7M | 1,973,399 | 2,716,823 | 72.6% | ['binary-tree-inorder-traversal', 'verify-preorder-sequence-in-binary-search-tree', 'n-ary-tree-preorder-traversal', 'kth-largest-sum-in-a-binary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<int> preorderTraversal(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<Integer> preorderTraversal(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def preorderTraversal(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[int]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def preorderTraversal(self, root: Optional[TreeNode]) -> List[int]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nint* preorderTraversal(struct TreeNode* root, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<int> PreorderTraversal(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[]}\n */\nvar preorderTraversal = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction preorderTraversal(root: TreeNode | null): number[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[]\n */\n function preorderTraversal($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func preorderTraversal(_ root: TreeNode?) -> [Int] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun preorderTraversal(root: TreeNode?): List<Int> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<int> preorderTraversal(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc preorderTraversal(root *TreeNode) []int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[]}\ndef preorder_traversal(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def preorderTraversal(root: TreeNode): List[Int] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn preorder_traversal(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<i32> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (preorder-traversal root)\n (-> (or/c tree-node? #f) (listof exact-integer?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec preorder_traversal(Root :: #tree_node{} | null) -> [integer()].\npreorder_traversal(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec preorder_traversal(root :: TreeNode.t | nil) :: [integer]\n def preorder_traversal(root) do\n \n end\nend"}] | [1,null,2,3] | {
"name": "preorderTraversal",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<integer>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Stack', 'Tree', 'Depth-First Search', 'Binary Tree'] |
145 | Binary Tree Postorder Traversal | binary-tree-postorder-traversal | <p>Given the <code>root</code> of a binary tree, return <em>the postorder traversal of its nodes' values</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,null,2,3]</span></p>
<p><strong>Output:</strong> <span class="example-io">[3,2,1]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/08/29/screenshot-2024-08-29-202743.png" style="width: 200px; height: 264px;" /></p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,2,3,4,5,null,8,null,null,6,7,9]</span></p>
<p><strong>Output:</strong> <span class="example-io">[4,6,7,5,2,9,8,3,1]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/08/29/tree_2.png" style="width: 350px; height: 286px;" /></p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = []</span></p>
<p><strong>Output:</strong> <span class="example-io">[]</span></p>
</div>
<p><strong class="example">Example 4:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1]</span></p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of the nodes in the tree is in the range <code>[0, 100]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
<p> </p>
<strong>Follow up:</strong> Recursive solution is trivial, could you do it iteratively? | Easy | 1.6M | 2.1M | 1,585,459 | 2,108,576 | 75.2% | ['binary-tree-inorder-traversal', 'n-ary-tree-postorder-traversal', 'minimum-fuel-cost-to-report-to-the-capital'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<int> postorderTraversal(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<Integer> postorderTraversal(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def postorderTraversal(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[int]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def postorderTraversal(self, root: Optional[TreeNode]) -> List[int]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nint* postorderTraversal(struct TreeNode* root, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<int> PostorderTraversal(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[]}\n */\nvar postorderTraversal = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction postorderTraversal(root: TreeNode | null): number[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[]\n */\n function postorderTraversal($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func postorderTraversal(_ root: TreeNode?) -> [Int] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun postorderTraversal(root: TreeNode?): List<Int> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<int> postorderTraversal(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc postorderTraversal(root *TreeNode) []int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[]}\ndef postorder_traversal(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def postorderTraversal(root: TreeNode): List[Int] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn postorder_traversal(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<i32> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (postorder-traversal root)\n (-> (or/c tree-node? #f) (listof exact-integer?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec postorder_traversal(Root :: #tree_node{} | null) -> [integer()].\npostorder_traversal(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec postorder_traversal(root :: TreeNode.t | nil) :: [integer]\n def postorder_traversal(root) do\n \n end\nend"}] | [1,null,2,3] | {
"name": "postorderTraversal",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<integer>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Stack', 'Tree', 'Depth-First Search', 'Binary Tree'] |
146 | LRU Cache | lru-cache | <p>Design a data structure that follows the constraints of a <strong><a href="https://en.wikipedia.org/wiki/Cache_replacement_policies#LRU" target="_blank">Least Recently Used (LRU) cache</a></strong>.</p>
<p>Implement the <code>LRUCache</code> class:</p>
<ul>
<li><code>LRUCache(int capacity)</code> Initialize the LRU cache with <strong>positive</strong> size <code>capacity</code>.</li>
<li><code>int get(int key)</code> Return the value of the <code>key</code> if the key exists, otherwise return <code>-1</code>.</li>
<li><code>void put(int key, int value)</code> Update the value of the <code>key</code> if the <code>key</code> exists. Otherwise, add the <code>key-value</code> pair to the cache. If the number of keys exceeds the <code>capacity</code> from this operation, <strong>evict</strong> the least recently used key.</li>
</ul>
<p>The functions <code>get</code> and <code>put</code> must each run in <code>O(1)</code> average time complexity.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input</strong>
["LRUCache", "put", "put", "get", "put", "get", "put", "get", "get", "get"]
[[2], [1, 1], [2, 2], [1], [3, 3], [2], [4, 4], [1], [3], [4]]
<strong>Output</strong>
[null, null, null, 1, null, -1, null, -1, 3, 4]
<strong>Explanation</strong>
LRUCache lRUCache = new LRUCache(2);
lRUCache.put(1, 1); // cache is {1=1}
lRUCache.put(2, 2); // cache is {1=1, 2=2}
lRUCache.get(1); // return 1
lRUCache.put(3, 3); // LRU key was 2, evicts key 2, cache is {1=1, 3=3}
lRUCache.get(2); // returns -1 (not found)
lRUCache.put(4, 4); // LRU key was 1, evicts key 1, cache is {4=4, 3=3}
lRUCache.get(1); // return -1 (not found)
lRUCache.get(3); // return 3
lRUCache.get(4); // return 4
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= capacity <= 3000</code></li>
<li><code>0 <= key <= 10<sup>4</sup></code></li>
<li><code>0 <= value <= 10<sup>5</sup></code></li>
<li>At most <code>2 * 10<sup>5</sup></code> calls will be made to <code>get</code> and <code>put</code>.</li>
</ul>
| Medium | 2M | 4.6M | 2,040,940 | 4,563,711 | 44.7% | ['lfu-cache', 'design-in-memory-file-system', 'design-compressed-string-iterator', 'design-most-recently-used-queue'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class LRUCache {\npublic:\n LRUCache(int capacity) {\n \n }\n \n int get(int key) {\n \n }\n \n void put(int key, int value) {\n \n }\n};\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * LRUCache* obj = new LRUCache(capacity);\n * int param_1 = obj->get(key);\n * obj->put(key,value);\n */"}, {"value": "java", "text": "Java", "defaultCode": "class LRUCache {\n\n public LRUCache(int capacity) {\n \n }\n \n public int get(int key) {\n \n }\n \n public void put(int key, int value) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * LRUCache obj = new LRUCache(capacity);\n * int param_1 = obj.get(key);\n * obj.put(key,value);\n */"}, {"value": "python", "text": "Python", "defaultCode": "class LRUCache(object):\n\n def __init__(self, capacity):\n \"\"\"\n :type capacity: int\n \"\"\"\n \n\n def get(self, key):\n \"\"\"\n :type key: int\n :rtype: int\n \"\"\"\n \n\n def put(self, key, value):\n \"\"\"\n :type key: int\n :type value: int\n :rtype: None\n \"\"\"\n \n\n\n# Your LRUCache object will be instantiated and called as such:\n# obj = LRUCache(capacity)\n# param_1 = obj.get(key)\n# obj.put(key,value)"}, {"value": "python3", "text": "Python3", "defaultCode": "class LRUCache:\n\n def __init__(self, capacity: int):\n \n\n def get(self, key: int) -> int:\n \n\n def put(self, key: int, value: int) -> None:\n \n\n\n# Your LRUCache object will be instantiated and called as such:\n# obj = LRUCache(capacity)\n# param_1 = obj.get(key)\n# obj.put(key,value)"}, {"value": "c", "text": "C", "defaultCode": "\n\n\ntypedef struct {\n \n} LRUCache;\n\n\nLRUCache* lRUCacheCreate(int capacity) {\n \n}\n\nint lRUCacheGet(LRUCache* obj, int key) {\n \n}\n\nvoid lRUCachePut(LRUCache* obj, int key, int value) {\n \n}\n\nvoid lRUCacheFree(LRUCache* obj) {\n \n}\n\n/**\n * Your LRUCache struct will be instantiated and called as such:\n * LRUCache* obj = lRUCacheCreate(capacity);\n * int param_1 = lRUCacheGet(obj, key);\n \n * lRUCachePut(obj, key, value);\n \n * lRUCacheFree(obj);\n*/"}, {"value": "csharp", "text": "C#", "defaultCode": "public class LRUCache {\n\n public LRUCache(int capacity) {\n \n }\n \n public int Get(int key) {\n \n }\n \n public void Put(int key, int value) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * LRUCache obj = new LRUCache(capacity);\n * int param_1 = obj.Get(key);\n * obj.Put(key,value);\n */"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} capacity\n */\nvar LRUCache = function(capacity) {\n \n};\n\n/** \n * @param {number} key\n * @return {number}\n */\nLRUCache.prototype.get = function(key) {\n \n};\n\n/** \n * @param {number} key \n * @param {number} value\n * @return {void}\n */\nLRUCache.prototype.put = function(key, value) {\n \n};\n\n/** \n * Your LRUCache object will be instantiated and called as such:\n * var obj = new LRUCache(capacity)\n * var param_1 = obj.get(key)\n * obj.put(key,value)\n */"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "class LRUCache {\n constructor(capacity: number) {\n \n }\n\n get(key: number): number {\n \n }\n\n put(key: number, value: number): void {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * var obj = new LRUCache(capacity)\n * var param_1 = obj.get(key)\n * obj.put(key,value)\n */"}, {"value": "php", "text": "PHP", "defaultCode": "class LRUCache {\n /**\n * @param Integer $capacity\n */\n function __construct($capacity) {\n \n }\n \n /**\n * @param Integer $key\n * @return Integer\n */\n function get($key) {\n \n }\n \n /**\n * @param Integer $key\n * @param Integer $value\n * @return NULL\n */\n function put($key, $value) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * $obj = LRUCache($capacity);\n * $ret_1 = $obj->get($key);\n * $obj->put($key, $value);\n */"}, {"value": "swift", "text": "Swift", "defaultCode": "\nclass LRUCache {\n\n init(_ capacity: Int) {\n \n }\n \n func get(_ key: Int) -> Int {\n \n }\n \n func put(_ key: Int, _ value: Int) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * let obj = LRUCache(capacity)\n * let ret_1: Int = obj.get(key)\n * obj.put(key, value)\n */"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class LRUCache(capacity: Int) {\n\n fun get(key: Int): Int {\n \n }\n\n fun put(key: Int, value: Int) {\n \n }\n\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * var obj = LRUCache(capacity)\n * var param_1 = obj.get(key)\n * obj.put(key,value)\n */"}, {"value": "dart", "text": "Dart", "defaultCode": "class LRUCache {\n\n LRUCache(int capacity) {\n \n }\n \n int get(int key) {\n \n }\n \n void put(int key, int value) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * LRUCache obj = LRUCache(capacity);\n * int param1 = obj.get(key);\n * obj.put(key,value);\n */"}, {"value": "golang", "text": "Go", "defaultCode": "type LRUCache struct {\n \n}\n\n\nfunc Constructor(capacity int) LRUCache {\n \n}\n\n\nfunc (this *LRUCache) Get(key int) int {\n \n}\n\n\nfunc (this *LRUCache) Put(key int, value int) {\n \n}\n\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * obj := Constructor(capacity);\n * param_1 := obj.Get(key);\n * obj.Put(key,value);\n */"}, {"value": "ruby", "text": "Ruby", "defaultCode": "class LRUCache\n\n=begin\n :type capacity: Integer\n=end\n def initialize(capacity)\n \n end\n\n\n=begin\n :type key: Integer\n :rtype: Integer\n=end\n def get(key)\n \n end\n\n\n=begin\n :type key: Integer\n :type value: Integer\n :rtype: Void\n=end\n def put(key, value)\n \n end\n\n\nend\n\n# Your LRUCache object will be instantiated and called as such:\n# obj = LRUCache.new(capacity)\n# param_1 = obj.get(key)\n# obj.put(key, value)"}, {"value": "scala", "text": "Scala", "defaultCode": "class LRUCache(_capacity: Int) {\n\n def get(key: Int): Int = {\n \n }\n\n def put(key: Int, value: Int): Unit = {\n \n }\n\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * val obj = new LRUCache(capacity)\n * val param_1 = obj.get(key)\n * obj.put(key,value)\n */"}, {"value": "rust", "text": "Rust", "defaultCode": "struct LRUCache {\n\n}\n\n\n/** \n * `&self` means the method takes an immutable reference.\n * If you need a mutable reference, change it to `&mut self` instead.\n */\nimpl LRUCache {\n\n fn new(capacity: i32) -> Self {\n \n }\n \n fn get(&self, key: i32) -> i32 {\n \n }\n \n fn put(&self, key: i32, value: i32) {\n \n }\n}\n\n/**\n * Your LRUCache object will be instantiated and called as such:\n * let obj = LRUCache::new(capacity);\n * let ret_1: i32 = obj.get(key);\n * obj.put(key, value);\n */"}, {"value": "racket", "text": "Racket", "defaultCode": "(define lru-cache%\n (class object%\n (super-new)\n \n ; capacity : exact-integer?\n (init-field\n capacity)\n \n ; get : exact-integer? -> exact-integer?\n (define/public (get key)\n )\n ; put : exact-integer? exact-integer? -> void?\n (define/public (put key value)\n )))\n\n;; Your lru-cache% object will be instantiated and called as such:\n;; (define obj (new lru-cache% [capacity capacity]))\n;; (define param_1 (send obj get key))\n;; (send obj put key value)"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec lru_cache_init_(Capacity :: integer()) -> any().\nlru_cache_init_(Capacity) ->\n .\n\n-spec lru_cache_get(Key :: integer()) -> integer().\nlru_cache_get(Key) ->\n .\n\n-spec lru_cache_put(Key :: integer(), Value :: integer()) -> any().\nlru_cache_put(Key, Value) ->\n .\n\n\n%% Your functions will be called as such:\n%% lru_cache_init_(Capacity),\n%% Param_1 = lru_cache_get(Key),\n%% lru_cache_put(Key, Value),\n\n%% lru_cache_init_ will be called before every test case, in which you can do some necessary initializations."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule LRUCache do\n @spec init_(capacity :: integer) :: any\n def init_(capacity) do\n \n end\n\n @spec get(key :: integer) :: integer\n def get(key) do\n \n end\n\n @spec put(key :: integer, value :: integer) :: any\n def put(key, value) do\n \n end\nend\n\n# Your functions will be called as such:\n# LRUCache.init_(capacity)\n# param_1 = LRUCache.get(key)\n# LRUCache.put(key, value)\n\n# LRUCache.init_ will be called before every test case, in which you can do some necessary initializations."}] | ["LRUCache","put","put","get","put","get","put","get","get","get"]
[[2],[1,1],[2,2],[1],[3,3],[2],[4,4],[1],[3],[4]] | {
"classname": "LRUCache",
"maxbytesperline": 200000,
"constructor": {
"params": [
{
"type": "integer",
"name": "capacity"
}
]
},
"methods": [
{
"name" : "get",
"params": [
{
"type": "integer",
"name": "key"
}
],
"return": {
"type": "integer"
}
},
{
"name" : "put",
"params": [
{
"type": "integer",
"name": "key"
},
{
"type": "integer",
"name": "value"
}
],
"return": {
"type": "void"
}
}
],
"systemdesign": true,
"params": [
{
"name": "inputs",
"type": "integer[]"
},
{
"name": "inputs",
"type": "integer[]"
}
],
"return": {
"type": "list<String>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'Linked List', 'Design', 'Doubly-Linked List'] |
147 | Insertion Sort List | insertion-sort-list | <p>Given the <code>head</code> of a singly linked list, sort the list using <strong>insertion sort</strong>, and return <em>the sorted list's head</em>.</p>
<p>The steps of the <strong>insertion sort</strong> algorithm:</p>
<ol>
<li>Insertion sort iterates, consuming one input element each repetition and growing a sorted output list.</li>
<li>At each iteration, insertion sort removes one element from the input data, finds the location it belongs within the sorted list and inserts it there.</li>
<li>It repeats until no input elements remain.</li>
</ol>
<p>The following is a graphical example of the insertion sort algorithm. The partially sorted list (black) initially contains only the first element in the list. One element (red) is removed from the input data and inserted in-place into the sorted list with each iteration.</p>
<img alt="" src="https://upload.wikimedia.org/wikipedia/commons/0/0f/Insertion-sort-example-300px.gif" style="height:180px; width:300px" />
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/04/sort1linked-list.jpg" style="width: 422px; height: 222px;" />
<pre>
<strong>Input:</strong> head = [4,2,1,3]
<strong>Output:</strong> [1,2,3,4]
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/04/sort2linked-list.jpg" style="width: 542px; height: 222px;" />
<pre>
<strong>Input:</strong> head = [-1,5,3,4,0]
<strong>Output:</strong> [-1,0,3,4,5]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the list is in the range <code>[1, 5000]</code>.</li>
<li><code>-5000 <= Node.val <= 5000</code></li>
</ul>
| Medium | 419.8K | 749.4K | 419,780 | 749,379 | 56.0% | ['sort-list', 'insert-into-a-sorted-circular-linked-list'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode() : val(0), next(nullptr) {}\n * ListNode(int x) : val(x), next(nullptr) {}\n * ListNode(int x, ListNode *next) : val(x), next(next) {}\n * };\n */\nclass Solution {\npublic:\n ListNode* insertionSortList(ListNode* head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * int val;\n * ListNode next;\n * ListNode() {}\n * ListNode(int val) { this.val = val; }\n * ListNode(int val, ListNode next) { this.val = val; this.next = next; }\n * }\n */\nclass Solution {\n public ListNode insertionSortList(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution(object):\n def insertionSortList(self, head):\n \"\"\"\n :type head: Optional[ListNode]\n :rtype: Optional[ListNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution:\n def insertionSortList(self, head: Optional[ListNode]) -> Optional[ListNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nstruct ListNode* insertionSortList(struct ListNode* head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int val=0, ListNode next=null) {\n * this.val = val;\n * this.next = next;\n * }\n * }\n */\npublic class Solution {\n public ListNode InsertionSortList(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val, next) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n */\n/**\n * @param {ListNode} head\n * @return {ListNode}\n */\nvar insertionSortList = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction insertionSortList(head: ListNode | null): ListNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val = 0, $next = null) {\n * $this->val = $val;\n * $this->next = $next;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param ListNode $head\n * @return ListNode\n */\n function insertionSortList($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init() { self.val = 0; self.next = nil; }\n * public init(_ val: Int) { self.val = val; self.next = nil; }\n * public init(_ val: Int, _ next: ListNode?) { self.val = val; self.next = next; }\n * }\n */\nclass Solution {\n func insertionSortList(_ head: ListNode?) -> ListNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\nclass Solution {\n fun insertionSortList(head: ListNode?): ListNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode? next;\n * ListNode([this.val = 0, this.next]);\n * }\n */\nclass Solution {\n ListNode? insertionSortList(ListNode? head) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc insertionSortList(head *ListNode) *ListNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val = 0, _next = nil)\n# @val = val\n# @next = _next\n# end\n# end\n# @param {ListNode} head\n# @return {ListNode}\ndef insertion_sort_list(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(_x: Int = 0, _next: ListNode = null) {\n * var next: ListNode = _next\n * var x: Int = _x\n * }\n */\nobject Solution {\n def insertionSortList(head: ListNode): ListNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for singly-linked list.\n// #[derive(PartialEq, Eq, Clone, Debug)]\n// pub struct ListNode {\n// pub val: i32,\n// pub next: Option<Box<ListNode>>\n// }\n// \n// impl ListNode {\n// #[inline]\n// fn new(val: i32) -> Self {\n// ListNode {\n// next: None,\n// val\n// }\n// }\n// }\nimpl Solution {\n pub fn insertion_sort_list(head: Option<Box<ListNode>>) -> Option<Box<ListNode>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for singly-linked list:\n#|\n\n; val : integer?\n; next : (or/c list-node? #f)\n(struct list-node\n (val next) #:mutable #:transparent)\n\n; constructor\n(define (make-list-node [val 0])\n (list-node val #f))\n\n|#\n\n(define/contract (insertion-sort-list head)\n (-> (or/c list-node? #f) (or/c list-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for singly-linked list.\n%%\n%% -record(list_node, {val = 0 :: integer(),\n%% next = null :: 'null' | #list_node{}}).\n\n-spec insertion_sort_list(Head :: #list_node{} | null) -> #list_node{} | null.\ninsertion_sort_list(Head) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for singly-linked list.\n#\n# defmodule ListNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# next: ListNode.t() | nil\n# }\n# defstruct val: 0, next: nil\n# end\n\ndefmodule Solution do\n @spec insertion_sort_list(head :: ListNode.t | nil) :: ListNode.t | nil\n def insertion_sort_list(head) do\n \n end\nend"}] | [4,2,1,3] | {
"name": "insertionSortList",
"params": [
{
"name": "head",
"type": "ListNode",
"dealloc": false
}
],
"return": {
"type": "ListNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Linked List', 'Sorting'] |
148 | Sort List | sort-list | <p>Given the <code>head</code> of a linked list, return <em>the list after sorting it in <strong>ascending order</strong></em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/09/14/sort_list_1.jpg" style="width: 450px; height: 194px;" />
<pre>
<strong>Input:</strong> head = [4,2,1,3]
<strong>Output:</strong> [1,2,3,4]
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2020/09/14/sort_list_2.jpg" style="width: 550px; height: 184px;" />
<pre>
<strong>Input:</strong> head = [-1,5,3,4,0]
<strong>Output:</strong> [-1,0,3,4,5]
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> head = []
<strong>Output:</strong> []
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the list is in the range <code>[0, 5 * 10<sup>4</sup>]</code>.</li>
<li><code>-10<sup>5</sup> <= Node.val <= 10<sup>5</sup></code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Can you sort the linked list in <code>O(n logn)</code> time and <code>O(1)</code> memory (i.e. constant space)?</p>
| Medium | 1M | 1.6M | 1,000,903 | 1,635,511 | 61.2% | ['merge-two-sorted-lists', 'sort-colors', 'insertion-sort-list', 'sort-linked-list-already-sorted-using-absolute-values'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode() : val(0), next(nullptr) {}\n * ListNode(int x) : val(x), next(nullptr) {}\n * ListNode(int x, ListNode *next) : val(x), next(next) {}\n * };\n */\nclass Solution {\npublic:\n ListNode* sortList(ListNode* head) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * int val;\n * ListNode next;\n * ListNode() {}\n * ListNode(int val) { this.val = val; }\n * ListNode(int val, ListNode next) { this.val = val; this.next = next; }\n * }\n */\nclass Solution {\n public ListNode sortList(ListNode head) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution(object):\n def sortList(self, head):\n \"\"\"\n :type head: Optional[ListNode]\n :rtype: Optional[ListNode]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\nclass Solution:\n def sortList(self, head: Optional[ListNode]) -> Optional[ListNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nstruct ListNode* sortList(struct ListNode* head) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int val=0, ListNode next=null) {\n * this.val = val;\n * this.next = next;\n * }\n * }\n */\npublic class Solution {\n public ListNode SortList(ListNode head) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val, next) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n */\n/**\n * @param {ListNode} head\n * @return {ListNode}\n */\nvar sortList = function(head) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction sortList(head: ListNode | null): ListNode | null {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val = 0, $next = null) {\n * $this->val = $val;\n * $this->next = $next;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param ListNode $head\n * @return ListNode\n */\n function sortList($head) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init() { self.val = 0; self.next = nil; }\n * public init(_ val: Int) { self.val = val; self.next = nil; }\n * public init(_ val: Int, _ next: ListNode?) { self.val = val; self.next = next; }\n * }\n */\nclass Solution {\n func sortList(_ head: ListNode?) -> ListNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\nclass Solution {\n fun sortList(head: ListNode?): ListNode? {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * int val;\n * ListNode? next;\n * ListNode([this.val = 0, this.next]);\n * }\n */\nclass Solution {\n ListNode? sortList(ListNode? head) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc sortList(head *ListNode) *ListNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val = 0, _next = nil)\n# @val = val\n# @next = _next\n# end\n# end\n# @param {ListNode} head\n# @return {ListNode}\ndef sort_list(head)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(_x: Int = 0, _next: ListNode = null) {\n * var next: ListNode = _next\n * var x: Int = _x\n * }\n */\nobject Solution {\n def sortList(head: ListNode): ListNode = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for singly-linked list.\n// #[derive(PartialEq, Eq, Clone, Debug)]\n// pub struct ListNode {\n// pub val: i32,\n// pub next: Option<Box<ListNode>>\n// }\n// \n// impl ListNode {\n// #[inline]\n// fn new(val: i32) -> Self {\n// ListNode {\n// next: None,\n// val\n// }\n// }\n// }\nimpl Solution {\n pub fn sort_list(head: Option<Box<ListNode>>) -> Option<Box<ListNode>> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for singly-linked list:\n#|\n\n; val : integer?\n; next : (or/c list-node? #f)\n(struct list-node\n (val next) #:mutable #:transparent)\n\n; constructor\n(define (make-list-node [val 0])\n (list-node val #f))\n\n|#\n\n(define/contract (sort-list head)\n (-> (or/c list-node? #f) (or/c list-node? #f))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for singly-linked list.\n%%\n%% -record(list_node, {val = 0 :: integer(),\n%% next = null :: 'null' | #list_node{}}).\n\n-spec sort_list(Head :: #list_node{} | null) -> #list_node{} | null.\nsort_list(Head) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for singly-linked list.\n#\n# defmodule ListNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# next: ListNode.t() | nil\n# }\n# defstruct val: 0, next: nil\n# end\n\ndefmodule Solution do\n @spec sort_list(head :: ListNode.t | nil) :: ListNode.t | nil\n def sort_list(head) do\n \n end\nend"}] | [4,2,1,3] | {
"name": "sortList",
"params": [
{
"name": "head",
"type": "ListNode",
"dealloc": false
}
],
"return": {
"type": "ListNode",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Linked List', 'Two Pointers', 'Divide and Conquer', 'Sorting', 'Merge Sort'] |
149 | Max Points on a Line | max-points-on-a-line | <p>Given an array of <code>points</code> where <code>points[i] = [x<sub>i</sub>, y<sub>i</sub>]</code> represents a point on the <strong>X-Y</strong> plane, return <em>the maximum number of points that lie on the same straight line</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/25/plane1.jpg" style="width: 300px; height: 294px;" />
<pre>
<strong>Input:</strong> points = [[1,1],[2,2],[3,3]]
<strong>Output:</strong> 3
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/02/25/plane2.jpg" style="width: 300px; height: 294px;" />
<pre>
<strong>Input:</strong> points = [[1,1],[3,2],[5,3],[4,1],[2,3],[1,4]]
<strong>Output:</strong> 4
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= points.length <= 300</code></li>
<li><code>points[i].length == 2</code></li>
<li><code>-10<sup>4</sup> <= x<sub>i</sub>, y<sub>i</sub> <= 10<sup>4</sup></code></li>
<li>All the <code>points</code> are <strong>unique</strong>.</li>
</ul>
| Hard | 454.1K | 1.6M | 454,101 | 1,586,697 | 28.6% | ['line-reflection', 'minimum-number-of-lines-to-cover-points', 'minimum-lines-to-represent-a-line-chart', 'count-special-subsequences'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxPoints(vector<vector<int>>& points) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxPoints(int[][] points) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxPoints(self, points):\n \"\"\"\n :type points: List[List[int]]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxPoints(self, points: List[List[int]]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxPoints(int** points, int pointsSize, int* pointsColSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxPoints(int[][] points) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[][]} points\n * @return {number}\n */\nvar maxPoints = function(points) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxPoints(points: number[][]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[][] $points\n * @return Integer\n */\n function maxPoints($points) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxPoints(_ points: [[Int]]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxPoints(points: Array<IntArray>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxPoints(List<List<int>> points) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxPoints(points [][]int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[][]} points\n# @return {Integer}\ndef max_points(points)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxPoints(points: Array[Array[Int]]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_points(points: Vec<Vec<i32>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-points points)\n (-> (listof (listof exact-integer?)) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_points(Points :: [[integer()]]) -> integer().\nmax_points(Points) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_points(points :: [[integer]]) :: integer\n def max_points(points) do\n \n end\nend"}] | [[1,1],[2,2],[3,3]] | {
"name": "maxPoints",
"params": [
{
"name": "points",
"type": "integer[][]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Math', 'Geometry'] |
150 | Evaluate Reverse Polish Notation | evaluate-reverse-polish-notation | <p>You are given an array of strings <code>tokens</code> that represents an arithmetic expression in a <a href="http://en.wikipedia.org/wiki/Reverse_Polish_notation" target="_blank">Reverse Polish Notation</a>.</p>
<p>Evaluate the expression. Return <em>an integer that represents the value of the expression</em>.</p>
<p><strong>Note</strong> that:</p>
<ul>
<li>The valid operators are <code>'+'</code>, <code>'-'</code>, <code>'*'</code>, and <code>'/'</code>.</li>
<li>Each operand may be an integer or another expression.</li>
<li>The division between two integers always <strong>truncates toward zero</strong>.</li>
<li>There will not be any division by zero.</li>
<li>The input represents a valid arithmetic expression in a reverse polish notation.</li>
<li>The answer and all the intermediate calculations can be represented in a <strong>32-bit</strong> integer.</li>
</ul>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> tokens = ["2","1","+","3","*"]
<strong>Output:</strong> 9
<strong>Explanation:</strong> ((2 + 1) * 3) = 9
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> tokens = ["4","13","5","/","+"]
<strong>Output:</strong> 6
<strong>Explanation:</strong> (4 + (13 / 5)) = 6
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> tokens = ["10","6","9","3","+","-11","*","/","*","17","+","5","+"]
<strong>Output:</strong> 22
<strong>Explanation:</strong> ((10 * (6 / ((9 + 3) * -11))) + 17) + 5
= ((10 * (6 / (12 * -11))) + 17) + 5
= ((10 * (6 / -132)) + 17) + 5
= ((10 * 0) + 17) + 5
= (0 + 17) + 5
= 17 + 5
= 22
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= tokens.length <= 10<sup>4</sup></code></li>
<li><code>tokens[i]</code> is either an operator: <code>"+"</code>, <code>"-"</code>, <code>"*"</code>, or <code>"/"</code>, or an integer in the range <code>[-200, 200]</code>.</li>
</ul>
| Medium | 1.3M | 2.5M | 1,343,131 | 2,469,704 | 54.4% | ['basic-calculator', 'expression-add-operators'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int evalRPN(vector<string>& tokens) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int evalRPN(String[] tokens) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def evalRPN(self, tokens):\n \"\"\"\n :type tokens: List[str]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def evalRPN(self, tokens: List[str]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int evalRPN(char** tokens, int tokensSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int EvalRPN(string[] tokens) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string[]} tokens\n * @return {number}\n */\nvar evalRPN = function(tokens) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function evalRPN(tokens: string[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String[] $tokens\n * @return Integer\n */\n function evalRPN($tokens) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func evalRPN(_ tokens: [String]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun evalRPN(tokens: Array<String>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int evalRPN(List<String> tokens) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func evalRPN(tokens []string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String[]} tokens\n# @return {Integer}\ndef eval_rpn(tokens)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def evalRPN(tokens: Array[String]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn eval_rpn(tokens: Vec<String>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (eval-rpn tokens)\n (-> (listof string?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec eval_rpn(Tokens :: [unicode:unicode_binary()]) -> integer().\neval_rpn(Tokens) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec eval_rpn(tokens :: [String.t]) :: integer\n def eval_rpn(tokens) do\n \n end\nend"}] | ["2","1","+","3","*"] | {
"name": "evalRPN",
"params": [
{
"name": "tokens",
"type": "string[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Math', 'Stack'] |
151 | Reverse Words in a String | reverse-words-in-a-string | <p>Given an input string <code>s</code>, reverse the order of the <strong>words</strong>.</p>
<p>A <strong>word</strong> is defined as a sequence of non-space characters. The <strong>words</strong> in <code>s</code> will be separated by at least one space.</p>
<p>Return <em>a string of the words in reverse order concatenated by a single space.</em></p>
<p><b>Note</b> that <code>s</code> may contain leading or trailing spaces or multiple spaces between two words. The returned string should only have a single space separating the words. Do not include any extra spaces.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> s = "the sky is blue"
<strong>Output:</strong> "blue is sky the"
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> s = " hello world "
<strong>Output:</strong> "world hello"
<strong>Explanation:</strong> Your reversed string should not contain leading or trailing spaces.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> s = "a good example"
<strong>Output:</strong> "example good a"
<strong>Explanation:</strong> You need to reduce multiple spaces between two words to a single space in the reversed string.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 10<sup>4</sup></code></li>
<li><code>s</code> contains English letters (upper-case and lower-case), digits, and spaces <code>' '</code>.</li>
<li>There is <strong>at least one</strong> word in <code>s</code>.</li>
</ul>
<p> </p>
<p><b data-stringify-type="bold">Follow-up: </b>If the string data type is mutable in your language, can you solve it <b data-stringify-type="bold">in-place</b> with <code data-stringify-type="code">O(1)</code> extra space?</p>
| Medium | 2.3M | 4.4M | 2,255,505 | 4,438,750 | 50.8% | ['reverse-words-in-a-string-ii'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n string reverseWords(string s) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public String reverseWords(String s) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def reverseWords(self, s):\n \"\"\"\n :type s: str\n :rtype: str\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def reverseWords(self, s: str) -> str:\n "}, {"value": "c", "text": "C", "defaultCode": "char* reverseWords(char* s) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public string ReverseWords(string s) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @return {string}\n */\nvar reverseWords = function(s) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function reverseWords(s: string): string {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @return String\n */\n function reverseWords($s) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func reverseWords(_ s: String) -> String {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun reverseWords(s: String): String {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n String reverseWords(String s) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func reverseWords(s string) string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @return {String}\ndef reverse_words(s)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def reverseWords(s: String): String = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn reverse_words(s: String) -> String {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (reverse-words s)\n (-> string? string?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec reverse_words(S :: unicode:unicode_binary()) -> unicode:unicode_binary().\nreverse_words(S) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec reverse_words(s :: String.t) :: String.t\n def reverse_words(s) do\n \n end\nend"}] | "the sky is blue" | {
"name": "reverseWords",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "string"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Two Pointers', 'String'] |
152 | Maximum Product Subarray | maximum-product-subarray | <p>Given an integer array <code>nums</code>, find a <span data-keyword="subarray-nonempty">subarray</span> that has the largest product, and return <em>the product</em>.</p>
<p>The test cases are generated so that the answer will fit in a <strong>32-bit</strong> integer.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [2,3,-2,4]
<strong>Output:</strong> 6
<strong>Explanation:</strong> [2,3] has the largest product 6.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [-2,0,-1]
<strong>Output:</strong> 0
<strong>Explanation:</strong> The result cannot be 2, because [-2,-1] is not a subarray.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 2 * 10<sup>4</sup></code></li>
<li><code>-10 <= nums[i] <= 10</code></li>
<li>The product of any subarray of <code>nums</code> is <strong>guaranteed</strong> to fit in a <strong>32-bit</strong> integer.</li>
</ul>
| Medium | 1.6M | 4.6M | 1,586,220 | 4,574,804 | 34.7% | ['maximum-subarray', 'house-robber', 'product-of-array-except-self', 'maximum-product-of-three-numbers', 'subarray-product-less-than-k'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxProduct(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxProduct(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxProduct(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxProduct(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxProduct(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxProduct(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar maxProduct = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxProduct(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function maxProduct($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxProduct(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxProduct(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxProduct(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxProduct(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef max_product(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxProduct(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_product(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-product nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_product(Nums :: [integer()]) -> integer().\nmax_product(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_product(nums :: [integer]) :: integer\n def max_product(nums) do\n \n end\nend"}] | [2,3,-2,4] | {
"name": "maxProduct",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
153 | Find Minimum in Rotated Sorted Array | find-minimum-in-rotated-sorted-array | <p>Suppose an array of length <code>n</code> sorted in ascending order is <strong>rotated</strong> between <code>1</code> and <code>n</code> times. For example, the array <code>nums = [0,1,2,4,5,6,7]</code> might become:</p>
<ul>
<li><code>[4,5,6,7,0,1,2]</code> if it was rotated <code>4</code> times.</li>
<li><code>[0,1,2,4,5,6,7]</code> if it was rotated <code>7</code> times.</li>
</ul>
<p>Notice that <strong>rotating</strong> an array <code>[a[0], a[1], a[2], ..., a[n-1]]</code> 1 time results in the array <code>[a[n-1], a[0], a[1], a[2], ..., a[n-2]]</code>.</p>
<p>Given the sorted rotated array <code>nums</code> of <strong>unique</strong> elements, return <em>the minimum element of this array</em>.</p>
<p>You must write an algorithm that runs in <code>O(log n) time</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [3,4,5,1,2]
<strong>Output:</strong> 1
<strong>Explanation:</strong> The original array was [1,2,3,4,5] rotated 3 times.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [4,5,6,7,0,1,2]
<strong>Output:</strong> 0
<strong>Explanation:</strong> The original array was [0,1,2,4,5,6,7] and it was rotated 4 times.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> nums = [11,13,15,17]
<strong>Output:</strong> 11
<strong>Explanation:</strong> The original array was [11,13,15,17] and it was rotated 4 times.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>n == nums.length</code></li>
<li><code>1 <= n <= 5000</code></li>
<li><code>-5000 <= nums[i] <= 5000</code></li>
<li>All the integers of <code>nums</code> are <strong>unique</strong>.</li>
<li><code>nums</code> is sorted and rotated between <code>1</code> and <code>n</code> times.</li>
</ul>
| Medium | 2.3M | 4.5M | 2,344,592 | 4,480,301 | 52.3% | ['search-in-rotated-sorted-array', 'find-minimum-in-rotated-sorted-array-ii'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int findMin(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int findMin(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def findMin(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def findMin(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int findMin(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int FindMin(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar findMin = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function findMin(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function findMin($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func findMin(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun findMin(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int findMin(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func findMin(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef find_min(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def findMin(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn find_min(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (find-min nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec find_min(Nums :: [integer()]) -> integer().\nfind_min(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec find_min(nums :: [integer]) :: integer\n def find_min(nums) do\n \n end\nend"}] | [3,4,5,1,2] | {
"name": "findMin",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Binary Search'] |
154 | Find Minimum in Rotated Sorted Array II | find-minimum-in-rotated-sorted-array-ii | <p>Suppose an array of length <code>n</code> sorted in ascending order is <strong>rotated</strong> between <code>1</code> and <code>n</code> times. For example, the array <code>nums = [0,1,4,4,5,6,7]</code> might become:</p>
<ul>
<li><code>[4,5,6,7,0,1,4]</code> if it was rotated <code>4</code> times.</li>
<li><code>[0,1,4,4,5,6,7]</code> if it was rotated <code>7</code> times.</li>
</ul>
<p>Notice that <strong>rotating</strong> an array <code>[a[0], a[1], a[2], ..., a[n-1]]</code> 1 time results in the array <code>[a[n-1], a[0], a[1], a[2], ..., a[n-2]]</code>.</p>
<p>Given the sorted rotated array <code>nums</code> that may contain <strong>duplicates</strong>, return <em>the minimum element of this array</em>.</p>
<p>You must decrease the overall operation steps as much as possible.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> nums = [1,3,5]
<strong>Output:</strong> 1
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> nums = [2,2,2,0,1]
<strong>Output:</strong> 0
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>n == nums.length</code></li>
<li><code>1 <= n <= 5000</code></li>
<li><code>-5000 <= nums[i] <= 5000</code></li>
<li><code>nums</code> is sorted and rotated between <code>1</code> and <code>n</code> times.</li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> This problem is similar to <a href="https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/description/" target="_blank">Find Minimum in Rotated Sorted Array</a>, but <code>nums</code> may contain <strong>duplicates</strong>. Would this affect the runtime complexity? How and why?</p>
<p> </p>
| Hard | 518.9K | 1.2M | 518,867 | 1,178,132 | 44.0% | ['find-minimum-in-rotated-sorted-array'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int findMin(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int findMin(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def findMin(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def findMin(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int findMin(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int FindMin(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar findMin = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function findMin(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function findMin($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func findMin(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun findMin(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int findMin(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func findMin(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef find_min(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def findMin(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn find_min(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (find-min nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec find_min(Nums :: [integer()]) -> integer().\nfind_min(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec find_min(nums :: [integer]) :: integer\n def find_min(nums) do\n \n end\nend"}] | [1,3,5] | {
"name": "findMin",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Binary Search'] |
155 | Min Stack | min-stack | <p>Design a stack that supports push, pop, top, and retrieving the minimum element in constant time.</p>
<p>Implement the <code>MinStack</code> class:</p>
<ul>
<li><code>MinStack()</code> initializes the stack object.</li>
<li><code>void push(int val)</code> pushes the element <code>val</code> onto the stack.</li>
<li><code>void pop()</code> removes the element on the top of the stack.</li>
<li><code>int top()</code> gets the top element of the stack.</li>
<li><code>int getMin()</code> retrieves the minimum element in the stack.</li>
</ul>
<p>You must implement a solution with <code>O(1)</code> time complexity for each function.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input</strong>
["MinStack","push","push","push","getMin","pop","top","getMin"]
[[],[-2],[0],[-3],[],[],[],[]]
<strong>Output</strong>
[null,null,null,null,-3,null,0,-2]
<strong>Explanation</strong>
MinStack minStack = new MinStack();
minStack.push(-2);
minStack.push(0);
minStack.push(-3);
minStack.getMin(); // return -3
minStack.pop();
minStack.top(); // return 0
minStack.getMin(); // return -2
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>-2<sup>31</sup> <= val <= 2<sup>31</sup> - 1</code></li>
<li>Methods <code>pop</code>, <code>top</code> and <code>getMin</code> operations will always be called on <strong>non-empty</strong> stacks.</li>
<li>At most <code>3 * 10<sup>4</sup></code> calls will be made to <code>push</code>, <code>pop</code>, <code>top</code>, and <code>getMin</code>.</li>
</ul>
| Medium | 2.1M | 3.8M | 2,119,793 | 3,777,710 | 56.1% | ['sliding-window-maximum', 'max-stack'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class MinStack {\npublic:\n MinStack() {\n \n }\n \n void push(int val) {\n \n }\n \n void pop() {\n \n }\n \n int top() {\n \n }\n \n int getMin() {\n \n }\n};\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * MinStack* obj = new MinStack();\n * obj->push(val);\n * obj->pop();\n * int param_3 = obj->top();\n * int param_4 = obj->getMin();\n */"}, {"value": "java", "text": "Java", "defaultCode": "class MinStack {\n\n public MinStack() {\n \n }\n \n public void push(int val) {\n \n }\n \n public void pop() {\n \n }\n \n public int top() {\n \n }\n \n public int getMin() {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * MinStack obj = new MinStack();\n * obj.push(val);\n * obj.pop();\n * int param_3 = obj.top();\n * int param_4 = obj.getMin();\n */"}, {"value": "python", "text": "Python", "defaultCode": "class MinStack(object):\n\n def __init__(self):\n \n\n def push(self, val):\n \"\"\"\n :type val: int\n :rtype: None\n \"\"\"\n \n\n def pop(self):\n \"\"\"\n :rtype: None\n \"\"\"\n \n\n def top(self):\n \"\"\"\n :rtype: int\n \"\"\"\n \n\n def getMin(self):\n \"\"\"\n :rtype: int\n \"\"\"\n \n\n\n# Your MinStack object will be instantiated and called as such:\n# obj = MinStack()\n# obj.push(val)\n# obj.pop()\n# param_3 = obj.top()\n# param_4 = obj.getMin()"}, {"value": "python3", "text": "Python3", "defaultCode": "class MinStack:\n\n def __init__(self):\n \n\n def push(self, val: int) -> None:\n \n\n def pop(self) -> None:\n \n\n def top(self) -> int:\n \n\n def getMin(self) -> int:\n \n\n\n# Your MinStack object will be instantiated and called as such:\n# obj = MinStack()\n# obj.push(val)\n# obj.pop()\n# param_3 = obj.top()\n# param_4 = obj.getMin()"}, {"value": "c", "text": "C", "defaultCode": "\n\n\ntypedef struct {\n \n} MinStack;\n\n\nMinStack* minStackCreate() {\n \n}\n\nvoid minStackPush(MinStack* obj, int val) {\n \n}\n\nvoid minStackPop(MinStack* obj) {\n \n}\n\nint minStackTop(MinStack* obj) {\n \n}\n\nint minStackGetMin(MinStack* obj) {\n \n}\n\nvoid minStackFree(MinStack* obj) {\n \n}\n\n/**\n * Your MinStack struct will be instantiated and called as such:\n * MinStack* obj = minStackCreate();\n * minStackPush(obj, val);\n \n * minStackPop(obj);\n \n * int param_3 = minStackTop(obj);\n \n * int param_4 = minStackGetMin(obj);\n \n * minStackFree(obj);\n*/"}, {"value": "csharp", "text": "C#", "defaultCode": "public class MinStack {\n\n public MinStack() {\n \n }\n \n public void Push(int val) {\n \n }\n \n public void Pop() {\n \n }\n \n public int Top() {\n \n }\n \n public int GetMin() {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * MinStack obj = new MinStack();\n * obj.Push(val);\n * obj.Pop();\n * int param_3 = obj.Top();\n * int param_4 = obj.GetMin();\n */"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "\nvar MinStack = function() {\n \n};\n\n/** \n * @param {number} val\n * @return {void}\n */\nMinStack.prototype.push = function(val) {\n \n};\n\n/**\n * @return {void}\n */\nMinStack.prototype.pop = function() {\n \n};\n\n/**\n * @return {number}\n */\nMinStack.prototype.top = function() {\n \n};\n\n/**\n * @return {number}\n */\nMinStack.prototype.getMin = function() {\n \n};\n\n/** \n * Your MinStack object will be instantiated and called as such:\n * var obj = new MinStack()\n * obj.push(val)\n * obj.pop()\n * var param_3 = obj.top()\n * var param_4 = obj.getMin()\n */"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "class MinStack {\n constructor() {\n \n }\n\n push(val: number): void {\n \n }\n\n pop(): void {\n \n }\n\n top(): number {\n \n }\n\n getMin(): number {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * var obj = new MinStack()\n * obj.push(val)\n * obj.pop()\n * var param_3 = obj.top()\n * var param_4 = obj.getMin()\n */"}, {"value": "php", "text": "PHP", "defaultCode": "class MinStack {\n /**\n */\n function __construct() {\n \n }\n \n /**\n * @param Integer $val\n * @return NULL\n */\n function push($val) {\n \n }\n \n /**\n * @return NULL\n */\n function pop() {\n \n }\n \n /**\n * @return Integer\n */\n function top() {\n \n }\n \n /**\n * @return Integer\n */\n function getMin() {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * $obj = MinStack();\n * $obj->push($val);\n * $obj->pop();\n * $ret_3 = $obj->top();\n * $ret_4 = $obj->getMin();\n */"}, {"value": "swift", "text": "Swift", "defaultCode": "\nclass MinStack {\n\n init() {\n \n }\n \n func push(_ val: Int) {\n \n }\n \n func pop() {\n \n }\n \n func top() -> Int {\n \n }\n \n func getMin() -> Int {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * let obj = MinStack()\n * obj.push(val)\n * obj.pop()\n * let ret_3: Int = obj.top()\n * let ret_4: Int = obj.getMin()\n */"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class MinStack() {\n\n fun push(`val`: Int) {\n \n }\n\n fun pop() {\n \n }\n\n fun top(): Int {\n \n }\n\n fun getMin(): Int {\n \n }\n\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * var obj = MinStack()\n * obj.push(`val`)\n * obj.pop()\n * var param_3 = obj.top()\n * var param_4 = obj.getMin()\n */"}, {"value": "dart", "text": "Dart", "defaultCode": "class MinStack {\n\n MinStack() {\n \n }\n \n void push(int val) {\n \n }\n \n void pop() {\n \n }\n \n int top() {\n \n }\n \n int getMin() {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * MinStack obj = MinStack();\n * obj.push(val);\n * obj.pop();\n * int param3 = obj.top();\n * int param4 = obj.getMin();\n */"}, {"value": "golang", "text": "Go", "defaultCode": "type MinStack struct {\n \n}\n\n\nfunc Constructor() MinStack {\n \n}\n\n\nfunc (this *MinStack) Push(val int) {\n \n}\n\n\nfunc (this *MinStack) Pop() {\n \n}\n\n\nfunc (this *MinStack) Top() int {\n \n}\n\n\nfunc (this *MinStack) GetMin() int {\n \n}\n\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * obj := Constructor();\n * obj.Push(val);\n * obj.Pop();\n * param_3 := obj.Top();\n * param_4 := obj.GetMin();\n */"}, {"value": "ruby", "text": "Ruby", "defaultCode": "class MinStack\n def initialize()\n \n end\n\n\n=begin\n :type val: Integer\n :rtype: Void\n=end\n def push(val)\n \n end\n\n\n=begin\n :rtype: Void\n=end\n def pop()\n \n end\n\n\n=begin\n :rtype: Integer\n=end\n def top()\n \n end\n\n\n=begin\n :rtype: Integer\n=end\n def get_min()\n \n end\n\n\nend\n\n# Your MinStack object will be instantiated and called as such:\n# obj = MinStack.new()\n# obj.push(val)\n# obj.pop()\n# param_3 = obj.top()\n# param_4 = obj.get_min()"}, {"value": "scala", "text": "Scala", "defaultCode": "class MinStack() {\n\n def push(`val`: Int): Unit = {\n \n }\n\n def pop(): Unit = {\n \n }\n\n def top(): Int = {\n \n }\n\n def getMin(): Int = {\n \n }\n\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * val obj = new MinStack()\n * obj.push(`val`)\n * obj.pop()\n * val param_3 = obj.top()\n * val param_4 = obj.getMin()\n */"}, {"value": "rust", "text": "Rust", "defaultCode": "struct MinStack {\n\n}\n\n\n/** \n * `&self` means the method takes an immutable reference.\n * If you need a mutable reference, change it to `&mut self` instead.\n */\nimpl MinStack {\n\n fn new() -> Self {\n \n }\n \n fn push(&self, val: i32) {\n \n }\n \n fn pop(&self) {\n \n }\n \n fn top(&self) -> i32 {\n \n }\n \n fn get_min(&self) -> i32 {\n \n }\n}\n\n/**\n * Your MinStack object will be instantiated and called as such:\n * let obj = MinStack::new();\n * obj.push(val);\n * obj.pop();\n * let ret_3: i32 = obj.top();\n * let ret_4: i32 = obj.get_min();\n */"}, {"value": "racket", "text": "Racket", "defaultCode": "(define min-stack%\n (class object%\n (super-new)\n \n (init-field)\n \n ; push : exact-integer? -> void?\n (define/public (push val)\n )\n ; pop : -> void?\n (define/public (pop)\n )\n ; top : -> exact-integer?\n (define/public (top)\n )\n ; get-min : -> exact-integer?\n (define/public (get-min)\n )))\n\n;; Your min-stack% object will be instantiated and called as such:\n;; (define obj (new min-stack%))\n;; (send obj push val)\n;; (send obj pop)\n;; (define param_3 (send obj top))\n;; (define param_4 (send obj get-min))"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec min_stack_init_() -> any().\nmin_stack_init_() ->\n .\n\n-spec min_stack_push(Val :: integer()) -> any().\nmin_stack_push(Val) ->\n .\n\n-spec min_stack_pop() -> any().\nmin_stack_pop() ->\n .\n\n-spec min_stack_top() -> integer().\nmin_stack_top() ->\n .\n\n-spec min_stack_get_min() -> integer().\nmin_stack_get_min() ->\n .\n\n\n%% Your functions will be called as such:\n%% min_stack_init_(),\n%% min_stack_push(Val),\n%% min_stack_pop(),\n%% Param_3 = min_stack_top(),\n%% Param_4 = min_stack_get_min(),\n\n%% min_stack_init_ will be called before every test case, in which you can do some necessary initializations."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule MinStack do\n @spec init_() :: any\n def init_() do\n \n end\n\n @spec push(val :: integer) :: any\n def push(val) do\n \n end\n\n @spec pop() :: any\n def pop() do\n \n end\n\n @spec top() :: integer\n def top() do\n \n end\n\n @spec get_min() :: integer\n def get_min() do\n \n end\nend\n\n# Your functions will be called as such:\n# MinStack.init_()\n# MinStack.push(val)\n# MinStack.pop()\n# param_3 = MinStack.top()\n# param_4 = MinStack.get_min()\n\n# MinStack.init_ will be called before every test case, in which you can do some necessary initializations."}] | ["MinStack","push","push","push","getMin","pop","top","getMin"]
[[],[-2],[0],[-3],[],[],[],[]] | {
"classname": "MinStack",
"constructor": {
"params": []
},
"methods": [
{
"params": [
{
"type": "integer",
"name": "val"
}
],
"return": {
"type": "void"
},
"name": "push"
},
{
"params": [],
"return": {
"type": "void"
},
"name": "pop"
},
{
"params": [],
"return": {
"type": "integer"
},
"name": "top"
},
{
"params": [],
"return": {
"type": "integer"
},
"name": "getMin"
}
],
"return": {
"type": "boolean"
},
"systemdesign": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Stack', 'Design'] |
156 | Binary Tree Upside Down | binary-tree-upside-down | null | Medium | 110.9K | 172.5K | 110,925 | 172,534 | 64.3% | ['reverse-linked-list'] | [] | Algorithms | null | [1,2,3,4,5] | {
"name": "upsideDownBinaryTree",
"params": [
{
"name": "root",
"type": "TreeNode",
"dealloc": false
}
],
"return": {
"type": "TreeNode",
"dealloc": true
},
"manual": false
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Binary Tree'] |
157 | Read N Characters Given Read4 | read-n-characters-given-read4 | null | Easy | 201.3K | 477.6K | 201,264 | 477,619 | 42.1% | ['read-n-characters-given-read4-ii-call-multiple-times'] | [] | Algorithms | null | "abc"
4 | {
"name": "read",
"params": [
{
"name": "file",
"type": "string"
},
{
"name": "n",
"type": "integer"
}
],
"return": {
"type": "string"
},
"manual": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Array', 'Simulation', 'Interactive'] |
158 | Read N Characters Given read4 II - Call Multiple Times | read-n-characters-given-read4-ii-call-multiple-times | null | Hard | 190.6K | 445.5K | 190,648 | 445,495 | 42.8% | ['read-n-characters-given-read4'] | [] | Algorithms | null | "abc"
[1,2,1] | {
"name": "read",
"params": [
{
"name": "file",
"type": "string"
},
{
"name": "queries",
"type": "integer[]"
}
],
"return": {
"type": "list<string>",
"dealloc": true
},
"manual": true,
"languages": [
"cpp",
"java",
"python",
"c",
"csharp",
"javascript",
"ruby",
"swift",
"golang",
"python3",
"scala",
"kotlin",
"php",
"typescript"
]
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Array', 'Simulation', 'Interactive'] |
159 | Longest Substring with At Most Two Distinct Characters | longest-substring-with-at-most-two-distinct-characters | null | Medium | 279.8K | 498.1K | 279,754 | 498,064 | 56.2% | ['longest-substring-without-repeating-characters', 'sliding-window-maximum', 'longest-substring-with-at-most-k-distinct-characters', 'subarrays-with-k-different-integers'] | [] | Algorithms | null | "eceba" | {
"name": "lengthOfLongestSubstringTwoDistinct",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'String', 'Sliding Window'] |
160 | Intersection of Two Linked Lists | intersection-of-two-linked-lists | <p>Given the heads of two singly linked-lists <code>headA</code> and <code>headB</code>, return <em>the node at which the two lists intersect</em>. If the two linked lists have no intersection at all, return <code>null</code>.</p>
<p>For example, the following two linked lists begin to intersect at node <code>c1</code>:</p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/05/160_statement.png" style="width: 500px; height: 162px;" />
<p>The test cases are generated such that there are no cycles anywhere in the entire linked structure.</p>
<p><strong>Note</strong> that the linked lists must <strong>retain their original structure</strong> after the function returns.</p>
<p><strong>Custom Judge:</strong></p>
<p>The inputs to the <strong>judge</strong> are given as follows (your program is <strong>not</strong> given these inputs):</p>
<ul>
<li><code>intersectVal</code> - The value of the node where the intersection occurs. This is <code>0</code> if there is no intersected node.</li>
<li><code>listA</code> - The first linked list.</li>
<li><code>listB</code> - The second linked list.</li>
<li><code>skipA</code> - The number of nodes to skip ahead in <code>listA</code> (starting from the head) to get to the intersected node.</li>
<li><code>skipB</code> - The number of nodes to skip ahead in <code>listB</code> (starting from the head) to get to the intersected node.</li>
</ul>
<p>The judge will then create the linked structure based on these inputs and pass the two heads, <code>headA</code> and <code>headB</code> to your program. If you correctly return the intersected node, then your solution will be <strong>accepted</strong>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/05/160_example_1_1.png" style="width: 500px; height: 162px;" />
<pre>
<strong>Input:</strong> intersectVal = 8, listA = [4,1,8,4,5], listB = [5,6,1,8,4,5], skipA = 2, skipB = 3
<strong>Output:</strong> Intersected at '8'
<strong>Explanation:</strong> The intersected node's value is 8 (note that this must not be 0 if the two lists intersect).
From the head of A, it reads as [4,1,8,4,5]. From the head of B, it reads as [5,6,1,8,4,5]. There are 2 nodes before the intersected node in A; There are 3 nodes before the intersected node in B.
- Note that the intersected node's value is not 1 because the nodes with value 1 in A and B (2<sup>nd</sup> node in A and 3<sup>rd</sup> node in B) are different node references. In other words, they point to two different locations in memory, while the nodes with value 8 in A and B (3<sup>rd</sup> node in A and 4<sup>th</sup> node in B) point to the same location in memory.
</pre>
<p><strong class="example">Example 2:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/05/160_example_2.png" style="width: 500px; height: 194px;" />
<pre>
<strong>Input:</strong> intersectVal = 2, listA = [1,9,1,2,4], listB = [3,2,4], skipA = 3, skipB = 1
<strong>Output:</strong> Intersected at '2'
<strong>Explanation:</strong> The intersected node's value is 2 (note that this must not be 0 if the two lists intersect).
From the head of A, it reads as [1,9,1,2,4]. From the head of B, it reads as [3,2,4]. There are 3 nodes before the intersected node in A; There are 1 node before the intersected node in B.
</pre>
<p><strong class="example">Example 3:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/05/160_example_3.png" style="width: 300px; height: 189px;" />
<pre>
<strong>Input:</strong> intersectVal = 0, listA = [2,6,4], listB = [1,5], skipA = 3, skipB = 2
<strong>Output:</strong> No intersection
<strong>Explanation:</strong> From the head of A, it reads as [2,6,4]. From the head of B, it reads as [1,5]. Since the two lists do not intersect, intersectVal must be 0, while skipA and skipB can be arbitrary values.
Explanation: The two lists do not intersect, so return null.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes of <code>listA</code> is in the <code>m</code>.</li>
<li>The number of nodes of <code>listB</code> is in the <code>n</code>.</li>
<li><code>1 <= m, n <= 3 * 10<sup>4</sup></code></li>
<li><code>1 <= Node.val <= 10<sup>5</sup></code></li>
<li><code>0 <= skipA <= m</code></li>
<li><code>0 <= skipB <= n</code></li>
<li><code>intersectVal</code> is <code>0</code> if <code>listA</code> and <code>listB</code> do not intersect.</li>
<li><code>intersectVal == listA[skipA] == listB[skipB]</code> if <code>listA</code> and <code>listB</code> intersect.</li>
</ul>
<p> </p>
<strong>Follow up:</strong> Could you write a solution that runs in <code>O(m + n)</code> time and use only <code>O(1)</code> memory? | Easy | 1.9M | 3.2M | 1,918,537 | 3,167,941 | 60.6% | ['minimum-index-sum-of-two-lists'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * ListNode *next;\n * ListNode(int x) : val(x), next(NULL) {}\n * };\n */\nclass Solution {\npublic:\n ListNode *getIntersectionNode(ListNode *headA, ListNode *headB) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * int val;\n * ListNode next;\n * ListNode(int x) {\n * val = x;\n * next = null;\n * }\n * }\n */\npublic class Solution {\n public ListNode getIntersectionNode(ListNode headA, ListNode headB) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for singly-linked list.\n# class ListNode(object):\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution(object):\n def getIntersectionNode(self, headA, headB):\n \"\"\"\n :type head1, head1: ListNode\n :rtype: ListNode\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, x):\n# self.val = x\n# self.next = None\n\nclass Solution:\n def getIntersectionNode(self, headA: ListNode, headB: ListNode) -> Optional[ListNode]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for singly-linked list.\n * struct ListNode {\n * int val;\n * struct ListNode *next;\n * };\n */\nstruct ListNode *getIntersectionNode(struct ListNode *headA, struct ListNode *headB) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public int val;\n * public ListNode next;\n * public ListNode(int x) { val = x; }\n * }\n */\npublic class Solution {\n public ListNode GetIntersectionNode(ListNode headA, ListNode headB) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * function ListNode(val) {\n * this.val = val;\n * this.next = null;\n * }\n */\n\n/**\n * @param {ListNode} headA\n * @param {ListNode} headB\n * @return {ListNode}\n */\nvar getIntersectionNode = function(headA, headB) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode {\n * val: number\n * next: ListNode | null\n * constructor(val?: number, next?: ListNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.next = (next===undefined ? null : next)\n * }\n * }\n */\n\nfunction getIntersectionNode(headA: ListNode | null, headB: ListNode | null): ListNode | null {\n\n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a singly-linked list.\n * class ListNode {\n * public $val = 0;\n * public $next = null;\n * function __construct($val) { $this->val = $val; }\n * }\n */\n\nclass Solution {\n /**\n * @param ListNode $headA\n * @param ListNode $headB\n * @return ListNode\n */\n function getIntersectionNode($headA, $headB) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for singly-linked list.\n * public class ListNode {\n * public var val: Int\n * public var next: ListNode?\n * public init(_ val: Int) {\n * self.val = val\n * self.next = nil\n * }\n * }\n */\n\nclass Solution {\n func getIntersectionNode(_ headA: ListNode?, _ headB: ListNode?) -> ListNode? {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var li = ListNode(5)\n * var v = li.`val`\n * Definition for singly-linked list.\n * class ListNode(var `val`: Int) {\n * var next: ListNode? = null\n * }\n */\n\nclass Solution {\n fun getIntersectionNode(headA:ListNode?, headB:ListNode?):ListNode? {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for singly-linked list.\n * type ListNode struct {\n * Val int\n * Next *ListNode\n * }\n */\nfunc getIntersectionNode(headA, headB *ListNode) *ListNode {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for singly-linked list.\n# class ListNode\n# attr_accessor :val, :next\n# def initialize(val)\n# @val = val\n# @next = nil\n# end\n# end\n\n# @param {ListNode} headA\n# @param {ListNode} headB\n# @return {ListNode}\ndef getIntersectionNode(headA, headB)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for singly-linked list.\n * class ListNode(var _x: Int = 0) {\n * var next: ListNode = null\n * var x: Int = _x\n * }\n */\n\nobject Solution {\n def getIntersectionNode(headA: ListNode, headB: ListNode): ListNode = {\n \n }\n}"}] | 8
[4,1,8,4,5]
[5,6,1,8,4,5]
2
3 | {
"name": "getIntersectionNode",
"params": [
{
"name": "intersectVal",
"type": "integer"
},
{
"name": "listA",
"type": "ListNode"
},
{
"name": "listB",
"type": "ListNode"
},
{
"name": "skipA",
"type": "integer"
},
{
"name": "skipB",
"type": "integer"
}
],
"return": {
"type": "ListNode"
},
"languages": [
"cpp",
"java",
"python",
"c",
"csharp",
"javascript",
"golang",
"python3",
"swift",
"ruby",
"kotlin",
"scala",
"php",
"typescript"
],
"manual": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Hash Table', 'Linked List', 'Two Pointers'] |
161 | One Edit Distance | one-edit-distance | null | Medium | 223.4K | 648.1K | 223,365 | 648,149 | 34.5% | ['edit-distance'] | [] | Algorithms | null | "ab"
"acb" | {
"name": "isOneEditDistance",
"params": [
{
"name": "s",
"type": "string"
},
{
"name": "t",
"type": "string"
}
],
"return": {
"type": "boolean"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Two Pointers', 'String'] |
162 | Find Peak Element | find-peak-element | <p>A peak element is an element that is strictly greater than its neighbors.</p>
<p>Given a <strong>0-indexed</strong> integer array <code>nums</code>, find a peak element, and return its index. If the array contains multiple peaks, return the index to <strong>any of the peaks</strong>.</p>
<p>You may imagine that <code>nums[-1] = nums[n] = -∞</code>. In other words, an element is always considered to be strictly greater than a neighbor that is outside the array.</p>
<p>You must write an algorithm that runs in <code>O(log n)</code> time.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [1,2,3,1]
<strong>Output:</strong> 2
<strong>Explanation:</strong> 3 is a peak element and your function should return the index number 2.</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [1,2,1,3,5,6,4]
<strong>Output:</strong> 5
<strong>Explanation:</strong> Your function can return either index number 1 where the peak element is 2, or index number 5 where the peak element is 6.</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 1000</code></li>
<li><code>-2<sup>31</sup> <= nums[i] <= 2<sup>31</sup> - 1</code></li>
<li><code>nums[i] != nums[i + 1]</code> for all valid <code>i</code>.</li>
</ul>
| Medium | 1.9M | 4M | 1,857,558 | 4,003,327 | 46.4% | ['peak-index-in-a-mountain-array', 'find-a-peak-element-ii', 'pour-water-between-buckets-to-make-water-levels-equal', 'count-hills-and-valleys-in-an-array', 'find-the-peaks'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int findPeakElement(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int findPeakElement(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def findPeakElement(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def findPeakElement(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int findPeakElement(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int FindPeakElement(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar findPeakElement = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function findPeakElement(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function findPeakElement($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func findPeakElement(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun findPeakElement(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int findPeakElement(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func findPeakElement(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef find_peak_element(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def findPeakElement(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn find_peak_element(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (find-peak-element nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec find_peak_element(Nums :: [integer()]) -> integer().\nfind_peak_element(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec find_peak_element(nums :: [integer]) :: integer\n def find_peak_element(nums) do\n \n end\nend"}] | [1,2,3,1] | {
"name": "findPeakElement",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Binary Search'] |
163 | Missing Ranges | missing-ranges | null | Easy | 285.5K | 813.7K | 285,486 | 813,718 | 35.1% | ['summary-ranges', 'find-maximal-uncovered-ranges'] | [] | Algorithms | null | [0,1,3,50,75]
0
99 | {
"name": "findMissingRanges",
"params": [
{
"name": "nums",
"type": "integer[]"
},
{
"name": "lower",
"type": "integer"
},
{
"name": "upper",
"type": "integer"
}
],
"return": {
"type": "list<list<integer>>"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array'] |
164 | Maximum Gap | maximum-gap | <p>Given an integer array <code>nums</code>, return <em>the maximum difference between two successive elements in its sorted form</em>. If the array contains less than two elements, return <code>0</code>.</p>
<p>You must write an algorithm that runs in linear time and uses linear extra space.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [3,6,9,1]
<strong>Output:</strong> 3
<strong>Explanation:</strong> The sorted form of the array is [1,3,6,9], either (3,6) or (6,9) has the maximum difference 3.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [10]
<strong>Output:</strong> 0
<strong>Explanation:</strong> The array contains less than 2 elements, therefore return 0.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 10<sup>5</sup></code></li>
<li><code>0 <= nums[i] <= 10<sup>9</sup></code></li>
</ul>
| Medium | 266.2K | 545.1K | 266,175 | 545,076 | 48.8% | ['widest-vertical-area-between-two-points-containing-no-points', 'maximum-consecutive-floors-without-special-floors'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maximumGap(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maximumGap(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maximumGap(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maximumGap(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maximumGap(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaximumGap(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar maximumGap = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maximumGap(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function maximumGap($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maximumGap(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maximumGap(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maximumGap(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maximumGap(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef maximum_gap(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maximumGap(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn maximum_gap(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (maximum-gap nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec maximum_gap(Nums :: [integer()]) -> integer().\nmaximum_gap(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec maximum_gap(nums :: [integer]) :: integer\n def maximum_gap(nums) do\n \n end\nend"}] | [3,6,9,1] | {
"name": "maximumGap",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Sorting', 'Bucket Sort', 'Radix Sort'] |
165 | Compare Version Numbers | compare-version-numbers | <p>Given two <strong>version strings</strong>, <code>version1</code> and <code>version2</code>, compare them. A version string consists of <strong>revisions</strong> separated by dots <code>'.'</code>. The <strong>value of the revision</strong> is its <strong>integer conversion</strong> ignoring leading zeros.</p>
<p>To compare version strings, compare their revision values in <strong>left-to-right order</strong>. If one of the version strings has fewer revisions, treat the missing revision values as <code>0</code>.</p>
<p>Return the following:</p>
<ul>
<li>If <code>version1 < version2</code>, return -1.</li>
<li>If <code>version1 > version2</code>, return 1.</li>
<li>Otherwise, return 0.</li>
</ul>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">version1 = "1.2", version2 = "1.10"</span></p>
<p><strong>Output:</strong> <span class="example-io">-1</span></p>
<p><strong>Explanation:</strong></p>
<p>version1's second revision is "2" and version2's second revision is "10": 2 < 10, so version1 < version2.</p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">version1 = "1.01", version2 = "1.001"</span></p>
<p><strong>Output:</strong> <span class="example-io">0</span></p>
<p><strong>Explanation:</strong></p>
<p>Ignoring leading zeroes, both "01" and "001" represent the same integer "1".</p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">version1 = "1.0", version2 = "1.0.0.0"</span></p>
<p><strong>Output:</strong> <span class="example-io">0</span></p>
<p><strong>Explanation:</strong></p>
<p>version1 has less revisions, which means every missing revision are treated as "0".</p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= version1.length, version2.length <= 500</code></li>
<li><code>version1</code> and <code>version2</code> only contain digits and <code>'.'</code>.</li>
<li><code>version1</code> and <code>version2</code> <strong>are valid version numbers</strong>.</li>
<li>All the given revisions in <code>version1</code> and <code>version2</code> can be stored in a <strong>32-bit integer</strong>.</li>
</ul>
| Medium | 539.7K | 1.3M | 539,673 | 1,282,305 | 42.1% | [] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int compareVersion(string version1, string version2) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int compareVersion(String version1, String version2) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def compareVersion(self, version1, version2):\n \"\"\"\n :type version1: str\n :type version2: str\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def compareVersion(self, version1: str, version2: str) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int compareVersion(char* version1, char* version2) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int CompareVersion(string version1, string version2) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} version1\n * @param {string} version2\n * @return {number}\n */\nvar compareVersion = function(version1, version2) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function compareVersion(version1: string, version2: string): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $version1\n * @param String $version2\n * @return Integer\n */\n function compareVersion($version1, $version2) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func compareVersion(_ version1: String, _ version2: String) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun compareVersion(version1: String, version2: String): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int compareVersion(String version1, String version2) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func compareVersion(version1 string, version2 string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} version1\n# @param {String} version2\n# @return {Integer}\ndef compare_version(version1, version2)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def compareVersion(version1: String, version2: String): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn compare_version(version1: String, version2: String) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (compare-version version1 version2)\n (-> string? string? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec compare_version(Version1 :: unicode:unicode_binary(), Version2 :: unicode:unicode_binary()) -> integer().\ncompare_version(Version1, Version2) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec compare_version(version1 :: String.t, version2 :: String.t) :: integer\n def compare_version(version1, version2) do\n \n end\nend"}] | "1.2"
"1.10" | {
"name": "compareVersion",
"params": [
{
"name": "version1",
"type": "string"
},
{
"name": "version2",
"type": "string"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Two Pointers', 'String'] |
166 | Fraction to Recurring Decimal | fraction-to-recurring-decimal | <p>Given two integers representing the <code>numerator</code> and <code>denominator</code> of a fraction, return <em>the fraction in string format</em>.</p>
<p>If the fractional part is repeating, enclose the repeating part in parentheses.</p>
<p>If multiple answers are possible, return <strong>any of them</strong>.</p>
<p>It is <strong>guaranteed</strong> that the length of the answer string is less than <code>10<sup>4</sup></code> for all the given inputs.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> numerator = 1, denominator = 2
<strong>Output:</strong> "0.5"
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> numerator = 2, denominator = 1
<strong>Output:</strong> "2"
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> numerator = 4, denominator = 333
<strong>Output:</strong> "0.(012)"
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>-2<sup>31</sup> <= numerator, denominator <= 2<sup>31</sup> - 1</code></li>
<li><code>denominator != 0</code></li>
</ul>
| Medium | 251.6K | 967.2K | 251,562 | 967,239 | 26.0% | [] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n string fractionToDecimal(int numerator, int denominator) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public String fractionToDecimal(int numerator, int denominator) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def fractionToDecimal(self, numerator, denominator):\n \"\"\"\n :type numerator: int\n :type denominator: int\n :rtype: str\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def fractionToDecimal(self, numerator: int, denominator: int) -> str:\n "}, {"value": "c", "text": "C", "defaultCode": "char* fractionToDecimal(int numerator, int denominator) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public string FractionToDecimal(int numerator, int denominator) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} numerator\n * @param {number} denominator\n * @return {string}\n */\nvar fractionToDecimal = function(numerator, denominator) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function fractionToDecimal(numerator: number, denominator: number): string {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $numerator\n * @param Integer $denominator\n * @return String\n */\n function fractionToDecimal($numerator, $denominator) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func fractionToDecimal(_ numerator: Int, _ denominator: Int) -> String {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun fractionToDecimal(numerator: Int, denominator: Int): String {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n String fractionToDecimal(int numerator, int denominator) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func fractionToDecimal(numerator int, denominator int) string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} numerator\n# @param {Integer} denominator\n# @return {String}\ndef fraction_to_decimal(numerator, denominator)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def fractionToDecimal(numerator: Int, denominator: Int): String = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn fraction_to_decimal(numerator: i32, denominator: i32) -> String {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (fraction-to-decimal numerator denominator)\n (-> exact-integer? exact-integer? string?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec fraction_to_decimal(Numerator :: integer(), Denominator :: integer()) -> unicode:unicode_binary().\nfraction_to_decimal(Numerator, Denominator) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec fraction_to_decimal(numerator :: integer, denominator :: integer) :: String.t\n def fraction_to_decimal(numerator, denominator) do\n \n end\nend"}] | 1
2 | {
"name": "fractionToDecimal",
"params": [
{
"name": "numerator",
"type": "integer"
},
{
"name": "denominator",
"type": "integer"
}
],
"return": {
"type": "string"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'Math', 'String'] |
167 | Two Sum II - Input Array Is Sorted | two-sum-ii-input-array-is-sorted | <p>Given a <strong>1-indexed</strong> array of integers <code>numbers</code> that is already <strong><em>sorted in non-decreasing order</em></strong>, find two numbers such that they add up to a specific <code>target</code> number. Let these two numbers be <code>numbers[index<sub>1</sub>]</code> and <code>numbers[index<sub>2</sub>]</code> where <code>1 <= index<sub>1</sub> < index<sub>2</sub> <= numbers.length</code>.</p>
<p>Return<em> the indices of the two numbers, </em><code>index<sub>1</sub></code><em> and </em><code>index<sub>2</sub></code><em>, <strong>added by one</strong> as an integer array </em><code>[index<sub>1</sub>, index<sub>2</sub>]</code><em> of length 2.</em></p>
<p>The tests are generated such that there is <strong>exactly one solution</strong>. You <strong>may not</strong> use the same element twice.</p>
<p>Your solution must use only constant extra space.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> numbers = [<u>2</u>,<u>7</u>,11,15], target = 9
<strong>Output:</strong> [1,2]
<strong>Explanation:</strong> The sum of 2 and 7 is 9. Therefore, index<sub>1</sub> = 1, index<sub>2</sub> = 2. We return [1, 2].
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> numbers = [<u>2</u>,3,<u>4</u>], target = 6
<strong>Output:</strong> [1,3]
<strong>Explanation:</strong> The sum of 2 and 4 is 6. Therefore index<sub>1</sub> = 1, index<sub>2</sub> = 3. We return [1, 3].
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> numbers = [<u>-1</u>,<u>0</u>], target = -1
<strong>Output:</strong> [1,2]
<strong>Explanation:</strong> The sum of -1 and 0 is -1. Therefore index<sub>1</sub> = 1, index<sub>2</sub> = 2. We return [1, 2].
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>2 <= numbers.length <= 3 * 10<sup>4</sup></code></li>
<li><code>-1000 <= numbers[i] <= 1000</code></li>
<li><code>numbers</code> is sorted in <strong>non-decreasing order</strong>.</li>
<li><code>-1000 <= target <= 1000</code></li>
<li>The tests are generated such that there is <strong>exactly one solution</strong>.</li>
</ul>
| Medium | 2.6M | 4.1M | 2,616,307 | 4,148,766 | 63.1% | ['two-sum', 'two-sum-iv-input-is-a-bst', 'two-sum-less-than-k'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<int> twoSum(vector<int>& numbers, int target) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int[] twoSum(int[] numbers, int target) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def twoSum(self, numbers, target):\n \"\"\"\n :type numbers: List[int]\n :type target: int\n :rtype: List[int]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def twoSum(self, numbers: List[int], target: int) -> List[int]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nint* twoSum(int* numbers, int numbersSize, int target, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int[] TwoSum(int[] numbers, int target) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} numbers\n * @param {number} target\n * @return {number[]}\n */\nvar twoSum = function(numbers, target) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function twoSum(numbers: number[], target: number): number[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $numbers\n * @param Integer $target\n * @return Integer[]\n */\n function twoSum($numbers, $target) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func twoSum(_ numbers: [Int], _ target: Int) -> [Int] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun twoSum(numbers: IntArray, target: Int): IntArray {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<int> twoSum(List<int> numbers, int target) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func twoSum(numbers []int, target int) []int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} numbers\n# @param {Integer} target\n# @return {Integer[]}\ndef two_sum(numbers, target)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def twoSum(numbers: Array[Int], target: Int): Array[Int] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn two_sum(numbers: Vec<i32>, target: i32) -> Vec<i32> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (two-sum numbers target)\n (-> (listof exact-integer?) exact-integer? (listof exact-integer?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec two_sum(Numbers :: [integer()], Target :: integer()) -> [integer()].\ntwo_sum(Numbers, Target) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec two_sum(numbers :: [integer], target :: integer) :: [integer]\n def two_sum(numbers, target) do\n \n end\nend"}] | [2,7,11,15]
9 | {
"name": "twoSum",
"params": [
{
"name": "numbers",
"type": "integer[]"
},
{
"name": "target",
"type": "integer"
}
],
"return": {
"type": "integer[]"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Two Pointers', 'Binary Search'] |
168 | Excel Sheet Column Title | excel-sheet-column-title | <p>Given an integer <code>columnNumber</code>, return <em>its corresponding column title as it appears in an Excel sheet</em>.</p>
<p>For example:</p>
<pre>
A -> 1
B -> 2
C -> 3
...
Z -> 26
AA -> 27
AB -> 28
...
</pre>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> columnNumber = 1
<strong>Output:</strong> "A"
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> columnNumber = 28
<strong>Output:</strong> "AB"
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> columnNumber = 701
<strong>Output:</strong> "ZY"
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= columnNumber <= 2<sup>31</sup> - 1</code></li>
</ul>
| Easy | 614K | 1.4M | 614,033 | 1,425,322 | 43.1% | ['excel-sheet-column-number', 'cells-in-a-range-on-an-excel-sheet', 'design-spreadsheet'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n string convertToTitle(int columnNumber) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public String convertToTitle(int columnNumber) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def convertToTitle(self, columnNumber):\n \"\"\"\n :type columnNumber: int\n :rtype: str\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def convertToTitle(self, columnNumber: int) -> str:\n "}, {"value": "c", "text": "C", "defaultCode": "char* convertToTitle(int columnNumber) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public string ConvertToTitle(int columnNumber) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} columnNumber\n * @return {string}\n */\nvar convertToTitle = function(columnNumber) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function convertToTitle(columnNumber: number): string {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $columnNumber\n * @return String\n */\n function convertToTitle($columnNumber) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func convertToTitle(_ columnNumber: Int) -> String {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun convertToTitle(columnNumber: Int): String {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n String convertToTitle(int columnNumber) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func convertToTitle(columnNumber int) string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} column_number\n# @return {String}\ndef convert_to_title(column_number)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def convertToTitle(columnNumber: Int): String = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn convert_to_title(column_number: i32) -> String {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (convert-to-title columnNumber)\n (-> exact-integer? string?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec convert_to_title(ColumnNumber :: integer()) -> unicode:unicode_binary().\nconvert_to_title(ColumnNumber) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec convert_to_title(column_number :: integer) :: String.t\n def convert_to_title(column_number) do\n \n end\nend"}] | 1 | {
"name": "convertToTitle",
"params": [
{
"name": "columnNumber",
"type": "integer"
}
],
"return": {
"type": "string"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Math', 'String'] |
169 | Majority Element | majority-element | <p>Given an array <code>nums</code> of size <code>n</code>, return <em>the majority element</em>.</p>
<p>The majority element is the element that appears more than <code>⌊n / 2⌋</code> times. You may assume that the majority element always exists in the array.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> nums = [3,2,3]
<strong>Output:</strong> 3
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> nums = [2,2,1,1,1,2,2]
<strong>Output:</strong> 2
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>n == nums.length</code></li>
<li><code>1 <= n <= 5 * 10<sup>4</sup></code></li>
<li><code>-10<sup>9</sup> <= nums[i] <= 10<sup>9</sup></code></li>
</ul>
<p> </p>
<strong>Follow-up:</strong> Could you solve the problem in linear time and in <code>O(1)</code> space? | Easy | 4.1M | 6.3M | 4,116,357 | 6,277,583 | 65.6% | ['majority-element-ii', 'check-if-a-number-is-majority-element-in-a-sorted-array', 'most-frequent-even-element', 'minimum-index-of-a-valid-split', 'minimum-operations-to-exceed-threshold-value-i', 'find-valid-pair-of-adjacent-digits-in-string'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int majorityElement(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int majorityElement(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def majorityElement(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def majorityElement(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int majorityElement(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MajorityElement(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar majorityElement = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function majorityElement(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function majorityElement($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func majorityElement(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun majorityElement(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int majorityElement(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func majorityElement(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef majority_element(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def majorityElement(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn majority_element(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (majority-element nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec majority_element(Nums :: [integer()]) -> integer().\nmajority_element(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec majority_element(nums :: [integer]) :: integer\n def majority_element(nums) do\n \n end\nend"}] | [3,2,3] | {
"name": "majorityElement",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Divide and Conquer', 'Sorting', 'Counting'] |
170 | Two Sum III - Data structure design | two-sum-iii-data-structure-design | null | Easy | 168K | 435.2K | 167,981 | 435,159 | 38.6% | ['two-sum', 'unique-word-abbreviation', 'two-sum-iv-input-is-a-bst'] | [] | Algorithms | null | ["TwoSum","add","add","add","find","find"]
[[],[1],[3],[5],[4],[7]] | {
"classname": "TwoSum",
"constructor": {
"params": []
},
"methods": [
{
"params": [
{
"type": "integer",
"name": "number"
}
],
"return": {
"type": "void"
},
"name": "add"
},
{
"params": [
{
"type": "integer",
"name": "value"
}
],
"return": {
"type": "boolean"
},
"name": "find"
}
],
"return": {
"type": "boolean"
},
"systemdesign": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Hash Table', 'Two Pointers', 'Design', 'Data Stream'] |
171 | Excel Sheet Column Number | excel-sheet-column-number | <p>Given a string <code>columnTitle</code> that represents the column title as appears in an Excel sheet, return <em>its corresponding column number</em>.</p>
<p>For example:</p>
<pre>
A -> 1
B -> 2
C -> 3
...
Z -> 26
AA -> 27
AB -> 28
...
</pre>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> columnTitle = "A"
<strong>Output:</strong> 1
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> columnTitle = "AB"
<strong>Output:</strong> 28
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> columnTitle = "ZY"
<strong>Output:</strong> 701
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= columnTitle.length <= 7</code></li>
<li><code>columnTitle</code> consists only of uppercase English letters.</li>
<li><code>columnTitle</code> is in the range <code>["A", "FXSHRXW"]</code>.</li>
</ul>
| Easy | 777.2K | 1.2M | 777,235 | 1,187,859 | 65.4% | ['excel-sheet-column-title', 'cells-in-a-range-on-an-excel-sheet'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int titleToNumber(string columnTitle) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int titleToNumber(String columnTitle) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def titleToNumber(self, columnTitle):\n \"\"\"\n :type columnTitle: str\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def titleToNumber(self, columnTitle: str) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int titleToNumber(char* columnTitle) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int TitleToNumber(string columnTitle) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} columnTitle\n * @return {number}\n */\nvar titleToNumber = function(columnTitle) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function titleToNumber(columnTitle: string): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $columnTitle\n * @return Integer\n */\n function titleToNumber($columnTitle) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func titleToNumber(_ columnTitle: String) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun titleToNumber(columnTitle: String): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int titleToNumber(String columnTitle) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func titleToNumber(columnTitle string) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} column_title\n# @return {Integer}\ndef title_to_number(column_title)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def titleToNumber(columnTitle: String): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn title_to_number(column_title: String) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (title-to-number columnTitle)\n (-> string? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec title_to_number(ColumnTitle :: unicode:unicode_binary()) -> integer().\ntitle_to_number(ColumnTitle) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec title_to_number(column_title :: String.t) :: integer\n def title_to_number(column_title) do\n \n end\nend"}] | "A" | {
"name": "titleToNumber",
"params": [
{
"name": "columnTitle",
"type": "string"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Math', 'String'] |
172 | Factorial Trailing Zeroes | factorial-trailing-zeroes | <p>Given an integer <code>n</code>, return <em>the number of trailing zeroes in </em><code>n!</code>.</p>
<p>Note that <code>n! = n * (n - 1) * (n - 2) * ... * 3 * 2 * 1</code>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> n = 3
<strong>Output:</strong> 0
<strong>Explanation:</strong> 3! = 6, no trailing zero.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> n = 5
<strong>Output:</strong> 1
<strong>Explanation:</strong> 5! = 120, one trailing zero.
</pre>
<p><strong class="example">Example 3:</strong></p>
<pre>
<strong>Input:</strong> n = 0
<strong>Output:</strong> 0
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>0 <= n <= 10<sup>4</sup></code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> Could you write a solution that works in logarithmic time complexity?</p>
| Medium | 544.5K | 1.2M | 544,509 | 1,221,371 | 44.6% | ['number-of-digit-one', 'preimage-size-of-factorial-zeroes-function', 'abbreviating-the-product-of-a-range', 'maximum-trailing-zeros-in-a-cornered-path'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int trailingZeroes(int n) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int trailingZeroes(int n) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def trailingZeroes(self, n):\n \"\"\"\n :type n: int\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def trailingZeroes(self, n: int) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int trailingZeroes(int n) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int TrailingZeroes(int n) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} n\n * @return {number}\n */\nvar trailingZeroes = function(n) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function trailingZeroes(n: number): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $n\n * @return Integer\n */\n function trailingZeroes($n) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func trailingZeroes(_ n: Int) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun trailingZeroes(n: Int): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int trailingZeroes(int n) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func trailingZeroes(n int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} n\n# @return {Integer}\ndef trailing_zeroes(n)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def trailingZeroes(n: Int): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn trailing_zeroes(n: i32) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (trailing-zeroes n)\n (-> exact-integer? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec trailing_zeroes(N :: integer()) -> integer().\ntrailing_zeroes(N) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec trailing_zeroes(n :: integer) :: integer\n def trailing_zeroes(n) do\n \n end\nend"}] | 3 | {
"name": "trailingZeroes",
"params": [
{
"name": "n",
"type": "integer"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Math'] |
173 | Binary Search Tree Iterator | binary-search-tree-iterator | <p>Implement the <code>BSTIterator</code> class that represents an iterator over the <strong><a href="https://en.wikipedia.org/wiki/Tree_traversal#In-order_(LNR)" target="_blank">in-order traversal</a></strong> of a binary search tree (BST):</p>
<ul>
<li><code>BSTIterator(TreeNode root)</code> Initializes an object of the <code>BSTIterator</code> class. The <code>root</code> of the BST is given as part of the constructor. The pointer should be initialized to a non-existent number smaller than any element in the BST.</li>
<li><code>boolean hasNext()</code> Returns <code>true</code> if there exists a number in the traversal to the right of the pointer, otherwise returns <code>false</code>.</li>
<li><code>int next()</code> Moves the pointer to the right, then returns the number at the pointer.</li>
</ul>
<p>Notice that by initializing the pointer to a non-existent smallest number, the first call to <code>next()</code> will return the smallest element in the BST.</p>
<p>You may assume that <code>next()</code> calls will always be valid. That is, there will be at least a next number in the in-order traversal when <code>next()</code> is called.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2018/12/25/bst-tree.png" style="width: 189px; height: 178px;" />
<pre>
<strong>Input</strong>
["BSTIterator", "next", "next", "hasNext", "next", "hasNext", "next", "hasNext", "next", "hasNext"]
[[[7, 3, 15, null, null, 9, 20]], [], [], [], [], [], [], [], [], []]
<strong>Output</strong>
[null, 3, 7, true, 9, true, 15, true, 20, false]
<strong>Explanation</strong>
BSTIterator bSTIterator = new BSTIterator([7, 3, 15, null, null, 9, 20]);
bSTIterator.next(); // return 3
bSTIterator.next(); // return 7
bSTIterator.hasNext(); // return True
bSTIterator.next(); // return 9
bSTIterator.hasNext(); // return True
bSTIterator.next(); // return 15
bSTIterator.hasNext(); // return True
bSTIterator.next(); // return 20
bSTIterator.hasNext(); // return False
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[1, 10<sup>5</sup>]</code>.</li>
<li><code>0 <= Node.val <= 10<sup>6</sup></code></li>
<li>At most <code>10<sup>5</sup></code> calls will be made to <code>hasNext</code>, and <code>next</code>.</li>
</ul>
<p> </p>
<p><strong>Follow up:</strong></p>
<ul>
<li>Could you implement <code>next()</code> and <code>hasNext()</code> to run in average <code>O(1)</code> time and use <code>O(h)</code> memory, where <code>h</code> is the height of the tree?</li>
</ul>
| Medium | 935.4K | 1.3M | 935,385 | 1,255,667 | 74.5% | ['binary-tree-inorder-traversal', 'flatten-2d-vector', 'zigzag-iterator', 'peeking-iterator', 'inorder-successor-in-bst', 'binary-search-tree-iterator-ii'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass BSTIterator {\npublic:\n BSTIterator(TreeNode* root) {\n \n }\n \n int next() {\n \n }\n \n bool hasNext() {\n \n }\n};\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * BSTIterator* obj = new BSTIterator(root);\n * int param_1 = obj->next();\n * bool param_2 = obj->hasNext();\n */"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass BSTIterator {\n\n public BSTIterator(TreeNode root) {\n \n }\n \n public int next() {\n \n }\n \n public boolean hasNext() {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * BSTIterator obj = new BSTIterator(root);\n * int param_1 = obj.next();\n * boolean param_2 = obj.hasNext();\n */"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass BSTIterator(object):\n\n def __init__(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n \"\"\"\n \n\n def next(self):\n \"\"\"\n :rtype: int\n \"\"\"\n \n\n def hasNext(self):\n \"\"\"\n :rtype: bool\n \"\"\"\n \n\n\n# Your BSTIterator object will be instantiated and called as such:\n# obj = BSTIterator(root)\n# param_1 = obj.next()\n# param_2 = obj.hasNext()"}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass BSTIterator:\n\n def __init__(self, root: Optional[TreeNode]):\n \n\n def next(self) -> int:\n \n\n def hasNext(self) -> bool:\n \n\n\n# Your BSTIterator object will be instantiated and called as such:\n# obj = BSTIterator(root)\n# param_1 = obj.next()\n# param_2 = obj.hasNext()"}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n\n\n\ntypedef struct {\n \n} BSTIterator;\n\n\nBSTIterator* bSTIteratorCreate(struct TreeNode* root) {\n \n}\n\nint bSTIteratorNext(BSTIterator* obj) {\n \n}\n\nbool bSTIteratorHasNext(BSTIterator* obj) {\n \n}\n\nvoid bSTIteratorFree(BSTIterator* obj) {\n \n}\n\n/**\n * Your BSTIterator struct will be instantiated and called as such:\n * BSTIterator* obj = bSTIteratorCreate(root);\n * int param_1 = bSTIteratorNext(obj);\n \n * bool param_2 = bSTIteratorHasNext(obj);\n \n * bSTIteratorFree(obj);\n*/"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class BSTIterator {\n\n public BSTIterator(TreeNode root) {\n \n }\n \n public int Next() {\n \n }\n \n public bool HasNext() {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * BSTIterator obj = new BSTIterator(root);\n * int param_1 = obj.Next();\n * bool param_2 = obj.HasNext();\n */"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n */\nvar BSTIterator = function(root) {\n \n};\n\n/**\n * @return {number}\n */\nBSTIterator.prototype.next = function() {\n \n};\n\n/**\n * @return {boolean}\n */\nBSTIterator.prototype.hasNext = function() {\n \n};\n\n/** \n * Your BSTIterator object will be instantiated and called as such:\n * var obj = new BSTIterator(root)\n * var param_1 = obj.next()\n * var param_2 = obj.hasNext()\n */"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nclass BSTIterator {\n constructor(root: TreeNode | null) {\n \n }\n\n next(): number {\n \n }\n\n hasNext(): boolean {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * var obj = new BSTIterator(root)\n * var param_1 = obj.next()\n * var param_2 = obj.hasNext()\n */"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass BSTIterator {\n /**\n * @param TreeNode $root\n */\n function __construct($root) {\n \n }\n \n /**\n * @return Integer\n */\n function next() {\n \n }\n \n /**\n * @return Boolean\n */\n function hasNext() {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * $obj = BSTIterator($root);\n * $ret_1 = $obj->next();\n * $ret_2 = $obj->hasNext();\n */"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\n\nclass BSTIterator {\n\n init(_ root: TreeNode?) {\n \n }\n \n func next() -> Int {\n \n }\n \n func hasNext() -> Bool {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * let obj = BSTIterator(root)\n * let ret_1: Int = obj.next()\n * let ret_2: Bool = obj.hasNext()\n */"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass BSTIterator(root: TreeNode?) {\n\n fun next(): Int {\n \n }\n\n fun hasNext(): Boolean {\n \n }\n\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * var obj = BSTIterator(root)\n * var param_1 = obj.next()\n * var param_2 = obj.hasNext()\n */"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass BSTIterator {\n\n BSTIterator(TreeNode? root) {\n \n }\n \n int next() {\n \n }\n \n bool hasNext() {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * BSTIterator obj = BSTIterator(root);\n * int param1 = obj.next();\n * bool param2 = obj.hasNext();\n */"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\ntype BSTIterator struct {\n \n}\n\n\nfunc Constructor(root *TreeNode) BSTIterator {\n \n}\n\n\nfunc (this *BSTIterator) Next() int {\n \n}\n\n\nfunc (this *BSTIterator) HasNext() bool {\n \n}\n\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * obj := Constructor(root);\n * param_1 := obj.Next();\n * param_2 := obj.HasNext();\n */"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\nclass BSTIterator\n\n=begin\n :type root: TreeNode\n=end\n def initialize(root)\n \n end\n\n\n=begin\n :rtype: Integer\n=end\n def next()\n \n end\n\n\n=begin\n :rtype: Boolean\n=end\n def has_next()\n \n end\n\n\nend\n\n# Your BSTIterator object will be instantiated and called as such:\n# obj = BSTIterator.new(root)\n# param_1 = obj.next()\n# param_2 = obj.has_next()"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nclass BSTIterator(_root: TreeNode) {\n\n def next(): Int = {\n \n }\n\n def hasNext(): Boolean = {\n \n }\n\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * val obj = new BSTIterator(root)\n * val param_1 = obj.next()\n * val param_2 = obj.hasNext()\n */"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nstruct BSTIterator {\n\n}\n\n\n/** \n * `&self` means the method takes an immutable reference.\n * If you need a mutable reference, change it to `&mut self` instead.\n */\nimpl BSTIterator {\n\n fn new(root: Option<Rc<RefCell<TreeNode>>>) -> Self {\n \n }\n \n fn next(&self) -> i32 {\n \n }\n \n fn has_next(&self) -> bool {\n \n }\n}\n\n/**\n * Your BSTIterator object will be instantiated and called as such:\n * let obj = BSTIterator::new(root);\n * let ret_1: i32 = obj.next();\n * let ret_2: bool = obj.has_next();\n */"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define bst-iterator%\n (class object%\n (super-new)\n \n ; root : (or/c tree-node? #f)\n (init-field\n root)\n \n ; next : -> exact-integer?\n (define/public (next)\n )\n ; has-next : -> boolean?\n (define/public (has-next)\n )))\n\n;; Your bst-iterator% object will be instantiated and called as such:\n;; (define obj (new bst-iterator% [root root]))\n;; (define param_1 (send obj next))\n;; (define param_2 (send obj has-next))"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec bst_iterator_init_(Root :: #tree_node{} | null) -> any().\nbst_iterator_init_(Root) ->\n .\n\n-spec bst_iterator_next() -> integer().\nbst_iterator_next() ->\n .\n\n-spec bst_iterator_has_next() -> boolean().\nbst_iterator_has_next() ->\n .\n\n\n%% Your functions will be called as such:\n%% bst_iterator_init_(Root),\n%% Param_1 = bst_iterator_next(),\n%% Param_2 = bst_iterator_has_next(),\n\n%% bst_iterator_init_ will be called before every test case, in which you can do some necessary initializations."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule BSTIterator do\n @spec init_(root :: TreeNode.t | nil) :: any\n def init_(root) do\n \n end\n\n @spec next() :: integer\n def next() do\n \n end\n\n @spec has_next() :: boolean\n def has_next() do\n \n end\nend\n\n# Your functions will be called as such:\n# BSTIterator.init_(root)\n# param_1 = BSTIterator.next()\n# param_2 = BSTIterator.has_next()\n\n# BSTIterator.init_ will be called before every test case, in which you can do some necessary initializations."}] | ["BSTIterator","next","next","hasNext","next","hasNext","next","hasNext","next","hasNext"]
[[[7,3,15,null,null,9,20]],[],[],[],[],[],[],[],[],[]] | {
"classname": "BSTIterator",
"maxbytesperline": 200000,
"constructor": {
"params": [
{
"type": "TreeNode",
"name": "root"
}
]
},
"methods": [
{
"params": [],
"name": "next",
"return": {
"type": "integer"
}
},
{
"params": [],
"name": "hasNext",
"return": {
"type": "boolean"
}
}
],
"systemdesign": true,
"params": [
{
"name": "inputs",
"type": "integer[]"
},
{
"name": "inputs",
"type": "integer[]"
}
],
"return": {
"type": "integer[]",
"dealloc": true
},
"manual": false
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Stack', 'Tree', 'Design', 'Binary Search Tree', 'Binary Tree', 'Iterator'] |
174 | Dungeon Game | dungeon-game | <p>The demons had captured the princess and imprisoned her in <strong>the bottom-right corner</strong> of a <code>dungeon</code>. The <code>dungeon</code> consists of <code>m x n</code> rooms laid out in a 2D grid. Our valiant knight was initially positioned in <strong>the top-left room</strong> and must fight his way through <code>dungeon</code> to rescue the princess.</p>
<p>The knight has an initial health point represented by a positive integer. If at any point his health point drops to <code>0</code> or below, he dies immediately.</p>
<p>Some of the rooms are guarded by demons (represented by negative integers), so the knight loses health upon entering these rooms; other rooms are either empty (represented as 0) or contain magic orbs that increase the knight's health (represented by positive integers).</p>
<p>To reach the princess as quickly as possible, the knight decides to move only <strong>rightward</strong> or <strong>downward</strong> in each step.</p>
<p>Return <em>the knight's minimum initial health so that he can rescue the princess</em>.</p>
<p><strong>Note</strong> that any room can contain threats or power-ups, even the first room the knight enters and the bottom-right room where the princess is imprisoned.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<img alt="" src="https://assets.leetcode.com/uploads/2021/03/13/dungeon-grid-1.jpg" style="width: 253px; height: 253px;" />
<pre>
<strong>Input:</strong> dungeon = [[-2,-3,3],[-5,-10,1],[10,30,-5]]
<strong>Output:</strong> 7
<strong>Explanation:</strong> The initial health of the knight must be at least 7 if he follows the optimal path: RIGHT-> RIGHT -> DOWN -> DOWN.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> dungeon = [[0]]
<strong>Output:</strong> 1
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>m == dungeon.length</code></li>
<li><code>n == dungeon[i].length</code></li>
<li><code>1 <= m, n <= 200</code></li>
<li><code>-1000 <= dungeon[i][j] <= 1000</code></li>
</ul>
| Hard | 253.6K | 646.2K | 253,578 | 646,169 | 39.2% | ['unique-paths', 'minimum-path-sum', 'cherry-pickup', 'minimum-path-cost-in-a-grid', 'minimum-health-to-beat-game', 'paths-in-matrix-whose-sum-is-divisible-by-k', 'check-if-there-is-a-path-with-equal-number-of-0s-and-1s'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int calculateMinimumHP(vector<vector<int>>& dungeon) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int calculateMinimumHP(int[][] dungeon) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def calculateMinimumHP(self, dungeon):\n \"\"\"\n :type dungeon: List[List[int]]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def calculateMinimumHP(self, dungeon: List[List[int]]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int calculateMinimumHP(int** dungeon, int dungeonSize, int* dungeonColSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int CalculateMinimumHP(int[][] dungeon) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[][]} dungeon\n * @return {number}\n */\nvar calculateMinimumHP = function(dungeon) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function calculateMinimumHP(dungeon: number[][]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[][] $dungeon\n * @return Integer\n */\n function calculateMinimumHP($dungeon) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func calculateMinimumHP(_ dungeon: [[Int]]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun calculateMinimumHP(dungeon: Array<IntArray>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int calculateMinimumHP(List<List<int>> dungeon) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func calculateMinimumHP(dungeon [][]int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[][]} dungeon\n# @return {Integer}\ndef calculate_minimum_hp(dungeon)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def calculateMinimumHP(dungeon: Array[Array[Int]]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn calculate_minimum_hp(dungeon: Vec<Vec<i32>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (calculate-minimum-hp dungeon)\n (-> (listof (listof exact-integer?)) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec calculate_minimum_hp(Dungeon :: [[integer()]]) -> integer().\ncalculate_minimum_hp(Dungeon) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec calculate_minimum_hp(dungeon :: [[integer]]) :: integer\n def calculate_minimum_hp(dungeon) do\n \n end\nend"}] | [[-2,-3,3],[-5,-10,1],[10,30,-5]] | {
"name": "calculateMinimumHP",
"params": [
{
"name": "dungeon",
"type": "integer[][]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming', 'Matrix'] |
175 | Combine Two Tables | combine-two-tables | <p>Table: <code>Person</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| personId | int |
| lastName | varchar |
| firstName | varchar |
+-------------+---------+
personId is the primary key (column with unique values) for this table.
This table contains information about the ID of some persons and their first and last names.
</pre>
<p> </p>
<p>Table: <code>Address</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| addressId | int |
| personId | int |
| city | varchar |
| state | varchar |
+-------------+---------+
addressId is the primary key (column with unique values) for this table.
Each row of this table contains information about the city and state of one person with ID = PersonId.
</pre>
<p> </p>
<p>Write a solution to report the first name, last name, city, and state of each person in the <code>Person</code> table. If the address of a <code>personId</code> is not present in the <code>Address</code> table, report <code>null</code> instead.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Person table:
+----------+----------+-----------+
| personId | lastName | firstName |
+----------+----------+-----------+
| 1 | Wang | Allen |
| 2 | Alice | Bob |
+----------+----------+-----------+
Address table:
+-----------+----------+---------------+------------+
| addressId | personId | city | state |
+-----------+----------+---------------+------------+
| 1 | 2 | New York City | New York |
| 2 | 3 | Leetcode | California |
+-----------+----------+---------------+------------+
<strong>Output:</strong>
+-----------+----------+---------------+----------+
| firstName | lastName | city | state |
+-----------+----------+---------------+----------+
| Allen | Wang | Null | Null |
| Bob | Alice | New York City | New York |
+-----------+----------+---------------+----------+
<strong>Explanation:</strong>
There is no address in the address table for the personId = 1 so we return null in their city and state.
addressId = 1 contains information about the address of personId = 2.
</pre>
| Easy | 1.2M | 1.6M | 1,237,963 | 1,592,473 | 77.7% | ['employee-bonus'] | ['Create table If Not Exists Person (personId int, firstName varchar(255), lastName varchar(255))', 'Create table If Not Exists Address (addressId int, personId int, city varchar(255), state varchar(255))', 'Truncate table Person', "insert into Person (personId, lastName, firstName) values ('1', 'Wang', 'Allen')", "insert into Person (personId, lastName, firstName) values ('2', 'Alice', 'Bob')", 'Truncate table Address', "insert into Address (addressId, personId, city, state) values ('1', '2', 'New York City', 'New York')", "insert into Address (addressId, personId, city, state) values ('2', '3', 'Leetcode', 'California')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef combine_two_tables(person: pd.DataFrame, address: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers":{"Person":["personId","lastName","firstName"],"Address":["addressId","personId","city","state"]},"rows":{"Person":[[1,"Wang","Allen"],[2,"Alice","Bob"]],"Address":[[1,2,"New York City","New York"],[2,3,"Leetcode","California"]]}} | {"mysql": ["Create table If Not Exists Person (personId int, firstName varchar(255), lastName varchar(255))", "Create table If Not Exists Address (addressId int, personId int, city varchar(255), state varchar(255))"], "mssql": ["Create table Person (personId int, firstName varchar(255), lastName varchar(255))", "Create table Address (addressId int, personId int, city varchar(255), state varchar(255))"], "oraclesql": ["Create table Person (personId int, firstName varchar(255), lastName varchar(255))", "Create table Address (addressId int, personId int, city varchar(255), state varchar(255))"], "database": true, "name": "combine_two_tables", "pythondata": ["Person = pd.DataFrame([], columns=['personId', 'firstName', 'lastName']).astype({'personId':'Int64', 'firstName':'object', 'lastName':'object'})", "Address = pd.DataFrame([], columns=['addressId', 'personId', 'city', 'state']).astype({'addressId':'Int64', 'personId':'Int64', 'city':'object', 'state':'object'})"], "manual": true, "database_schema": {"Person": {"personId": "INT", "firstName": "VARCHAR(255)", "lastName": "VARCHAR(255)"}, "Address": {"addressId": "INT", "personId": "INT", "city": "VARCHAR(255)", "state": "VARCHAR(255)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
176 | Second Highest Salary | second-highest-salary | <p>Table: <code>Employee</code></p>
<pre>
+-------------+------+
| Column Name | Type |
+-------------+------+
| id | int |
| salary | int |
+-------------+------+
id is the primary key (column with unique values) for this table.
Each row of this table contains information about the salary of an employee.
</pre>
<p> </p>
<p>Write a solution to find the second highest <strong>distinct</strong> salary from the <code>Employee</code> table. If there is no second highest salary, return <code>null (return None in Pandas)</code>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+--------+
| id | salary |
+----+--------+
| 1 | 100 |
| 2 | 200 |
| 3 | 300 |
+----+--------+
<strong>Output:</strong>
+---------------------+
| SecondHighestSalary |
+---------------------+
| 200 |
+---------------------+
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+--------+
| id | salary |
+----+--------+
| 1 | 100 |
+----+--------+
<strong>Output:</strong>
+---------------------+
| SecondHighestSalary |
+---------------------+
| null |
+---------------------+
</pre>
| Medium | 1.1M | 2.5M | 1,101,106 | 2,545,903 | 43.3% | [] | ['Create table If Not Exists Employee (id int, salary int)', 'Truncate table Employee', "insert into Employee (id, salary) values ('1', '100')", "insert into Employee (id, salary) values ('2', '200')", "insert into Employee (id, salary) values ('3', '300')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef second_highest_salary(employee: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers":{"Employee":["id","salary"]},"rows":{"Employee":[[1,100],[2,200],[3,300]]}} | {"mysql": ["Create table If Not Exists Employee (id int, salary int)"], "mssql": ["Create table Employee (id int, salary int)"], "oraclesql": ["Create table Employee (id int, salary int)"], "database": true, "name": "second_highest_salary", "pythondata": ["Employee = pd.DataFrame([], columns=['id', 'salary']).astype({'id':'int64', 'salary':'int64'})"], "manual": false, "postgresql": ["Create table If Not Exists Employee (id int, salary int)"], "database_schema": {"Employee": {"id": "INT", "salary": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
177 | Nth Highest Salary | nth-highest-salary | <p>Table: <code>Employee</code></p>
<pre>
+-------------+------+
| Column Name | Type |
+-------------+------+
| id | int |
| salary | int |
+-------------+------+
id is the primary key (column with unique values) for this table.
Each row of this table contains information about the salary of an employee.
</pre>
<p> </p>
<p>Write a solution to find the <code>n<sup>th</sup></code> highest <strong>distinct</strong> salary from the <code>Employee</code> table. If there are less than <code>n</code> distinct salaries, return <code>null</code>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+--------+
| id | salary |
+----+--------+
| 1 | 100 |
| 2 | 200 |
| 3 | 300 |
+----+--------+
n = 2
<strong>Output:</strong>
+------------------------+
| getNthHighestSalary(2) |
+------------------------+
| 200 |
+------------------------+
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+--------+
| id | salary |
+----+--------+
| 1 | 100 |
+----+--------+
n = 2
<strong>Output:</strong>
+------------------------+
| getNthHighestSalary(2) |
+------------------------+
| null |
+------------------------+
</pre>
| Medium | 474K | 1.3M | 474,047 | 1,251,723 | 37.9% | ['the-number-of-users-that-are-eligible-for-discount'] | ['Create table If Not Exists Employee (Id int, Salary int)', 'Truncate table Employee', "insert into Employee (id, salary) values ('1', '100')", "insert into Employee (id, salary) values ('2', '200')", "insert into Employee (id, salary) values ('3', '300')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "CREATE FUNCTION getNthHighestSalary(N INT) RETURNS INT\nBEGIN\n RETURN (\n # Write your MySQL query statement below.\n\n );\nEND"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "CREATE FUNCTION getNthHighestSalary(@N INT) RETURNS INT AS\nBEGIN\n RETURN (\n /* Write your T-SQL query statement below. */\n\n );\nEND"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "CREATE FUNCTION getNthHighestSalary(N IN NUMBER) RETURN NUMBER IS\nresult NUMBER;\nBEGIN\n /* Write your PL/SQL query statement below */\n\n RETURN result;\nEND;"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef nth_highest_salary(employee: pd.DataFrame, N: int) -> pd.DataFrame:"}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "CREATE OR REPLACE FUNCTION NthHighestSalary(N INT) RETURNS TABLE (Salary INT) AS $$\nBEGIN\n RETURN QUERY (\n -- Write your PostgreSQL query statement below.\n \n \n );\nEND;\n$$ LANGUAGE plpgsql;"}] | {"headers": {"Employee": ["id", "salary"]}, "argument": 2, "rows": {"Employee": [[1, 100], [2, 200], [3, 300]]}} | {"mysql": ["Create table If Not Exists Employee (Id int, Salary int)"], "mssql": ["Create table Employee (Id int, Salary int)"], "oraclesql": ["Create table Employee (Id int, Salary int)"], "database": true, "manual": true, "name": "nth_highest_salary", "pythondata": ["Employee = pd.DataFrame([], columns=['Id', 'Salary']).astype({'Id':'Int64', 'Salary':'Int64'})"], "database_schema": {"Employee": {"Id": "INT", "Salary": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
178 | Rank Scores | rank-scores | <p>Table: <code>Scores</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| score | decimal |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table contains the score of a game. Score is a floating point value with two decimal places.
</pre>
<p> </p>
<p>Write a solution to find the rank of the scores. The ranking should be calculated according to the following rules:</p>
<ul>
<li>The scores should be ranked from the highest to the lowest.</li>
<li>If there is a tie between two scores, both should have the same ranking.</li>
<li>After a tie, the next ranking number should be the next consecutive integer value. In other words, there should be no holes between ranks.</li>
</ul>
<p>Return the result table ordered by <code>score</code> in descending order.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Scores table:
+----+-------+
| id | score |
+----+-------+
| 1 | 3.50 |
| 2 | 3.65 |
| 3 | 4.00 |
| 4 | 3.85 |
| 5 | 4.00 |
| 6 | 3.65 |
+----+-------+
<strong>Output:</strong>
+-------+------+
| score | rank |
+-------+------+
| 4.00 | 1 |
| 4.00 | 1 |
| 3.85 | 2 |
| 3.65 | 3 |
| 3.65 | 3 |
| 3.50 | 4 |
+-------+------+
</pre>
| Medium | 476.3K | 735.3K | 476,305 | 735,251 | 64.8% | [] | ['Create table If Not Exists Scores (id int, score DECIMAL(3,2))', 'Truncate table Scores', "insert into Scores (id, score) values ('1', '3.5')", "insert into Scores (id, score) values ('2', '3.65')", "insert into Scores (id, score) values ('3', '4.0')", "insert into Scores (id, score) values ('4', '3.85')", "insert into Scores (id, score) values ('5', '4.0')", "insert into Scores (id, score) values ('6', '3.65')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef order_scores(scores: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Scores": ["id", "score"]}, "rows": {"Scores": [[1, 3.50], [2, 3.65], [3, 4.00], [4, 3.85], [5, 4.00], [6, 3.65]]}} | {"mysql": ["Create table If Not Exists Scores (id int, score DECIMAL(3,2))"], "mssql": ["Create table Scores (id int, score DECIMAL(3,2))"], "oraclesql": ["Create table Scores (id int, score DECIMAL(3,2))"], "database": true, "name": "order_scores", "pythondata": ["Scores = pd.DataFrame([], columns=['id', 'score']).astype({'id':'Int64', 'score':'Float64'})"], "manual": false, "postgresql": ["Create table If Not Exists Scores (id int, score DECIMAL(3,2))"], "database_schema": {"Scores": {"id": "INT", "score": "DECIMAL(3, 2)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
179 | Largest Number | largest-number | <p>Given a list of non-negative integers <code>nums</code>, arrange them such that they form the largest number and return it.</p>
<p>Since the result may be very large, so you need to return a string instead of an integer.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [10,2]
<strong>Output:</strong> "210"
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [3,30,34,5,9]
<strong>Output:</strong> "9534330"
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 100</code></li>
<li><code>0 <= nums[i] <= 10<sup>9</sup></code></li>
</ul>
| Medium | 705K | 1.7M | 705,026 | 1,719,695 | 41.0% | ['smallest-value-of-the-rearranged-number', 'find-the-key-of-the-numbers'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n string largestNumber(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public String largestNumber(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def largestNumber(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: str\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def largestNumber(self, nums: List[int]) -> str:\n "}, {"value": "c", "text": "C", "defaultCode": "char* largestNumber(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public string LargestNumber(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {string}\n */\nvar largestNumber = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function largestNumber(nums: number[]): string {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return String\n */\n function largestNumber($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func largestNumber(_ nums: [Int]) -> String {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun largestNumber(nums: IntArray): String {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n String largestNumber(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func largestNumber(nums []int) string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {String}\ndef largest_number(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def largestNumber(nums: Array[Int]): String = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn largest_number(nums: Vec<i32>) -> String {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (largest-number nums)\n (-> (listof exact-integer?) string?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec largest_number(Nums :: [integer()]) -> unicode:unicode_binary().\nlargest_number(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec largest_number(nums :: [integer]) :: String.t\n def largest_number(nums) do\n \n end\nend"}] | [10,2] | {
"name": "largestNumber",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "string"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'String', 'Greedy', 'Sorting'] |
180 | Consecutive Numbers | consecutive-numbers | <p>Table: <code>Logs</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| num | varchar |
+-------------+---------+
In SQL, id is the primary key for this table.
id is an autoincrement column starting from 1.
</pre>
<p> </p>
<p>Find all numbers that appear at least three times consecutively.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Logs table:
+----+-----+
| id | num |
+----+-----+
| 1 | 1 |
| 2 | 1 |
| 3 | 1 |
| 4 | 2 |
| 5 | 1 |
| 6 | 2 |
| 7 | 2 |
+----+-----+
<strong>Output:</strong>
+-----------------+
| ConsecutiveNums |
+-----------------+
| 1 |
+-----------------+
<strong>Explanation:</strong> 1 is the only number that appears consecutively for at least three times.
</pre>
| Medium | 529K | 1.2M | 528,981 | 1,158,726 | 45.7% | [] | ['Create table If Not Exists Logs (id int, num int)', 'Truncate table Logs', "insert into Logs (id, num) values ('1', '1')", "insert into Logs (id, num) values ('2', '1')", "insert into Logs (id, num) values ('3', '1')", "insert into Logs (id, num) values ('4', '2')", "insert into Logs (id, num) values ('5', '1')", "insert into Logs (id, num) values ('6', '2')", "insert into Logs (id, num) values ('7', '2')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef consecutive_numbers(logs: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers":{"Logs":["id","num"]},"rows":{"Logs":[[1,1],[2,1],[3,1],[4,2],[5,1],[6,2],[7,2]]}} | {"mysql": ["Create table If Not Exists Logs (id int, num int)"], "mssql": ["Create table Logs (id int, num int)"], "oraclesql": ["Create table Logs (id int, num int)"], "database": true, "name": "consecutive_numbers", "pythondata": ["Logs = pd.DataFrame([], columns=['id', 'num']).astype({'id':'Int64', 'num':'Int64'})"], "postgresql": ["Create table If Not Exists Logs (id int, num int)"], "database_schema": {"Logs": {"id": "INT", "num": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
181 | Employees Earning More Than Their Managers | employees-earning-more-than-their-managers | <p>Table: <code>Employee</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| name | varchar |
| salary | int |
| managerId | int |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table indicates the ID of an employee, their name, salary, and the ID of their manager.
</pre>
<p> </p>
<p>Write a solution to find the employees who earn more than their managers.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+-------+--------+-----------+
| id | name | salary | managerId |
+----+-------+--------+-----------+
| 1 | Joe | 70000 | 3 |
| 2 | Henry | 80000 | 4 |
| 3 | Sam | 60000 | Null |
| 4 | Max | 90000 | Null |
+----+-------+--------+-----------+
<strong>Output:</strong>
+----------+
| Employee |
+----------+
| Joe |
+----------+
<strong>Explanation:</strong> Joe is the only employee who earns more than his manager.
</pre>
| Easy | 784K | 1.1M | 783,967 | 1,100,973 | 71.2% | [] | ['Create table If Not Exists Employee (id int, name varchar(255), salary int, managerId int)', 'Truncate table Employee', "insert into Employee (id, name, salary, managerId) values ('1', 'Joe', '70000', '3')", "insert into Employee (id, name, salary, managerId) values ('2', 'Henry', '80000', '4')", "insert into Employee (id, name, salary, managerId) values ('3', 'Sam', '60000', NULL)", "insert into Employee (id, name, salary, managerId) values ('4', 'Max', '90000', NULL)"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef find_employees(employee: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Employee": ["id", "name", "salary", "managerId"]}, "rows": {"Employee": [[1, "Joe", 70000, 3], [2, "Henry", 80000, 4], [3, "Sam", 60000, null], [4, "Max", 90000, null]]}} | {"mysql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, managerId int)"], "mssql": ["Create table Employee (id int, name varchar(255), salary int, managerId int)"], "oraclesql": ["Create table Employee (id int, name varchar(255), salary int, managerId int)"], "database": true, "name": "find_employees", "pythondata": ["Employee = pd.DataFrame([], columns=['id', 'name', 'salary', 'managerId']).astype({'id':'Int64', 'name':'object', 'salary':'Int64', 'managerId':'Int64'})\n"], "postgresql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, managerId int)"], "database_schema": {"Employee": {"id": "INT", "name": "VARCHAR(255)", "salary": "INT", "managerId": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
182 | Duplicate Emails | duplicate-emails | <p>Table: <code>Person</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| email | varchar |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table contains an email. The emails will not contain uppercase letters.
</pre>
<p> </p>
<p>Write a solution to report all the duplicate emails. Note that it's guaranteed that the email field is not NULL.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Person table:
+----+---------+
| id | email |
+----+---------+
| 1 | a@b.com |
| 2 | c@d.com |
| 3 | a@b.com |
+----+---------+
<strong>Output:</strong>
+---------+
| Email |
+---------+
| a@b.com |
+---------+
<strong>Explanation:</strong> a@b.com is repeated two times.
</pre>
| Easy | 816.6K | 1.1M | 816,564 | 1,130,857 | 72.2% | [] | ['Create table If Not Exists Person (id int, email varchar(255))', 'Truncate table Person', "insert into Person (id, email) values ('1', 'a@b.com')", "insert into Person (id, email) values ('2', 'c@d.com')", "insert into Person (id, email) values ('3', 'a@b.com')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef duplicate_emails(person: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Person": ["id", "email"]}, "rows": {"Person": [[1, "a@b.com"], [2, "c@d.com"], [3, "a@b.com"]]}} | {"mysql": ["Create table If Not Exists Person (id int, email varchar(255))"], "mssql": ["Create table Person (id int, email varchar(255))"], "oraclesql": ["Create table Person (id int, email varchar(255))"], "database": true, "name": "duplicate_emails", "pythondata": ["Person = pd.DataFrame([], columns=['id', 'email']).astype({'id':'Int64', 'email':'object'})"], "postgresql": ["Create table If Not Exists Person (id int, email varchar(255))"], "database_schema": {"Person": {"id": "INT", "email": "VARCHAR(255)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
183 | Customers Who Never Order | customers-who-never-order | <p>Table: <code>Customers</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| name | varchar |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table indicates the ID and name of a customer.
</pre>
<p> </p>
<p>Table: <code>Orders</code></p>
<pre>
+-------------+------+
| Column Name | Type |
+-------------+------+
| id | int |
| customerId | int |
+-------------+------+
id is the primary key (column with unique values) for this table.
customerId is a foreign key (reference columns) of the ID from the Customers table.
Each row of this table indicates the ID of an order and the ID of the customer who ordered it.
</pre>
<p> </p>
<p>Write a solution to find all customers who never order anything.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Customers table:
+----+-------+
| id | name |
+----+-------+
| 1 | Joe |
| 2 | Henry |
| 3 | Sam |
| 4 | Max |
+----+-------+
Orders table:
+----+------------+
| id | customerId |
+----+------------+
| 1 | 3 |
| 2 | 1 |
+----+------------+
<strong>Output:</strong>
+-----------+
| Customers |
+-----------+
| Henry |
| Max |
+-----------+
</pre>
| Easy | 971.7K | 1.4M | 971,704 | 1,379,694 | 70.4% | [] | ['Create table If Not Exists Customers (id int, name varchar(255))', 'Create table If Not Exists Orders (id int, customerId int)', 'Truncate table Customers', "insert into Customers (id, name) values ('1', 'Joe')", "insert into Customers (id, name) values ('2', 'Henry')", "insert into Customers (id, name) values ('3', 'Sam')", "insert into Customers (id, name) values ('4', 'Max')", 'Truncate table Orders', "insert into Orders (id, customerId) values ('1', '3')", "insert into Orders (id, customerId) values ('2', '1')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef find_customers(customers: pd.DataFrame, orders: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Customers": ["id", "name"], "Orders": ["id", "customerId"]}, "rows": {"Customers": [[1, "Joe"], [2, "Henry"], [3, "Sam"], [4, "Max"]], "Orders": [[1, 3], [2, 1]]}} | {"mysql": ["Create table If Not Exists Customers (id int, name varchar(255))", "Create table If Not Exists Orders (id int, customerId int)"], "mssql": ["Create table Customers (id int, name varchar(255))", "Create table Orders (id int, customerId int)"], "oraclesql": ["Create table Customers (id int, name varchar(255))", "Create table Orders (id int, customerId int)"], "database": true, "name": "find_customers", "pythondata": ["Customers = pd.DataFrame([], columns=['id', 'name']).astype({'id':'Int64', 'name':'object'})", "Orders = pd.DataFrame([], columns=['id', 'customerId']).astype({'id':'Int64', 'customerId':'Int64'})"], "manual": false, "postgresql": ["Create table If Not Exists Customers (id int, name varchar(255))", "Create table If Not Exists Orders (id int, customerId int)"], "database_schema": {"Customers": {"id": "INT", "name": "VARCHAR(255)"}, "Orders": {"id": "INT", "customerId": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
184 | Department Highest Salary | department-highest-salary | <p>Table: <code>Employee</code></p>
<pre>
+--------------+---------+
| Column Name | Type |
+--------------+---------+
| id | int |
| name | varchar |
| salary | int |
| departmentId | int |
+--------------+---------+
id is the primary key (column with unique values) for this table.
departmentId is a foreign key (reference columns) of the ID from the <code>Department </code>table.
Each row of this table indicates the ID, name, and salary of an employee. It also contains the ID of their department.
</pre>
<p> </p>
<p>Table: <code>Department</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| name | varchar |
+-------------+---------+
id is the primary key (column with unique values) for this table. It is guaranteed that department name is not <code>NULL.</code>
Each row of this table indicates the ID of a department and its name.
</pre>
<p> </p>
<p>Write a solution to find employees who have the highest salary in each of the departments.</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+-------+--------+--------------+
| id | name | salary | departmentId |
+----+-------+--------+--------------+
| 1 | Joe | 70000 | 1 |
| 2 | Jim | 90000 | 1 |
| 3 | Henry | 80000 | 2 |
| 4 | Sam | 60000 | 2 |
| 5 | Max | 90000 | 1 |
+----+-------+--------+--------------+
Department table:
+----+-------+
| id | name |
+----+-------+
| 1 | IT |
| 2 | Sales |
+----+-------+
<strong>Output:</strong>
+------------+----------+--------+
| Department | Employee | Salary |
+------------+----------+--------+
| IT | Jim | 90000 |
| Sales | Henry | 80000 |
| IT | Max | 90000 |
+------------+----------+--------+
<strong>Explanation:</strong> Max and Jim both have the highest salary in the IT department and Henry has the highest salary in the Sales department.
</pre>
| Medium | 472.3K | 872K | 472,253 | 872,022 | 54.2% | ['highest-grade-for-each-student'] | ['Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)', 'Create table If Not Exists Department (id int, name varchar(255))', 'Truncate table Employee', "insert into Employee (id, name, salary, departmentId) values ('1', 'Joe', '70000', '1')", "insert into Employee (id, name, salary, departmentId) values ('2', 'Jim', '90000', '1')", "insert into Employee (id, name, salary, departmentId) values ('3', 'Henry', '80000', '2')", "insert into Employee (id, name, salary, departmentId) values ('4', 'Sam', '60000', '2')", "insert into Employee (id, name, salary, departmentId) values ('5', 'Max', '90000', '1')", 'Truncate table Department', "insert into Department (id, name) values ('1', 'IT')", "insert into Department (id, name) values ('2', 'Sales')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef department_highest_salary(employee: pd.DataFrame, department: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Employee": ["id", "name", "salary", "departmentId"], "Department": ["id", "name"]}, "rows": {"Employee": [[1, "Joe", 70000, 1], [2, "Jim", 90000, 1], [3, "Henry", 80000, 2], [4, "Sam", 60000, 2], [5, "Max", 90000, 1]], "Department": [[1, "IT"], [2, "Sales"]]}} | {"mysql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)", "Create table If Not Exists Department (id int, name varchar(255))"], "mssql": ["Create table Employee (id int, name varchar(255), salary int, departmentId int)", "Create table Department (id int, name varchar(255))"], "oraclesql": ["Create table Employee (id int, name varchar(255), salary int, departmentId int)", "Create table Department (id int, name varchar(255))"], "database": true, "name": "department_highest_salary", "pythondata": ["Employee = pd.DataFrame([], columns=['id', 'name', 'salary', 'departmentId']).astype({'id':'Int64', 'name':'object', 'salary':'Int64', 'departmentId':'Int64'})", "Department = pd.DataFrame([], columns=['id', 'name']).astype({'id':'Int64', 'name':'object'})"], "postgresql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)", "Create table If Not Exists Department (id int, name varchar(255))"], "database_schema": {"Employee": {"id": "INT", "name": "VARCHAR(255)", "salary": "INT", "departmentId": "INT"}, "Department": {"id": "INT", "name": "VARCHAR(255)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
185 | Department Top Three Salaries | department-top-three-salaries | <p>Table: <code>Employee</code></p>
<pre>
+--------------+---------+
| Column Name | Type |
+--------------+---------+
| id | int |
| name | varchar |
| salary | int |
| departmentId | int |
+--------------+---------+
id is the primary key (column with unique values) for this table.
departmentId is a foreign key (reference column) of the ID from the <code>Department </code>table.
Each row of this table indicates the ID, name, and salary of an employee. It also contains the ID of their department.
</pre>
<p> </p>
<p>Table: <code>Department</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| name | varchar |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table indicates the ID of a department and its name.
</pre>
<p> </p>
<p>A company's executives are interested in seeing who earns the most money in each of the company's departments. A <strong>high earner</strong> in a department is an employee who has a salary in the <strong>top three unique</strong> salaries for that department.</p>
<p>Write a solution to find the employees who are <strong>high earners</strong> in each of the departments.</p>
<p>Return the result table <strong>in any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Employee table:
+----+-------+--------+--------------+
| id | name | salary | departmentId |
+----+-------+--------+--------------+
| 1 | Joe | 85000 | 1 |
| 2 | Henry | 80000 | 2 |
| 3 | Sam | 60000 | 2 |
| 4 | Max | 90000 | 1 |
| 5 | Janet | 69000 | 1 |
| 6 | Randy | 85000 | 1 |
| 7 | Will | 70000 | 1 |
+----+-------+--------+--------------+
Department table:
+----+-------+
| id | name |
+----+-------+
| 1 | IT |
| 2 | Sales |
+----+-------+
<strong>Output:</strong>
+------------+----------+--------+
| Department | Employee | Salary |
+------------+----------+--------+
| IT | Max | 90000 |
| IT | Joe | 85000 |
| IT | Randy | 85000 |
| IT | Will | 70000 |
| Sales | Henry | 80000 |
| Sales | Sam | 60000 |
+------------+----------+--------+
<strong>Explanation:</strong>
In the IT department:
- Max earns the highest unique salary
- Both Randy and Joe earn the second-highest unique salary
- Will earns the third-highest unique salary
In the Sales department:
- Henry earns the highest salary
- Sam earns the second-highest salary
- There is no third-highest salary as there are only two employees
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>There are no employees with the <strong>exact</strong> same name, salary <em>and</em> department.</li>
</ul>
| Hard | 465.2K | 814.1K | 465,207 | 814,076 | 57.1% | [] | ['Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)', 'Create table If Not Exists Department (id int, name varchar(255))', 'Truncate table Employee', "insert into Employee (id, name, salary, departmentId) values ('1', 'Joe', '85000', '1')", "insert into Employee (id, name, salary, departmentId) values ('2', 'Henry', '80000', '2')", "insert into Employee (id, name, salary, departmentId) values ('3', 'Sam', '60000', '2')", "insert into Employee (id, name, salary, departmentId) values ('4', 'Max', '90000', '1')", "insert into Employee (id, name, salary, departmentId) values ('5', 'Janet', '69000', '1')", "insert into Employee (id, name, salary, departmentId) values ('6', 'Randy', '85000', '1')", "insert into Employee (id, name, salary, departmentId) values ('7', 'Will', '70000', '1')", 'Truncate table Department', "insert into Department (id, name) values ('1', 'IT')", "insert into Department (id, name) values ('2', 'Sales')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef top_three_salaries(employee: pd.DataFrame, department: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Employee": ["id", "name", "salary", "departmentId"], "Department": ["id", "name"]}, "rows": {"Employee": [[1, "Joe", 85000, 1], [2, "Henry", 80000, 2], [3, "Sam", 60000, 2], [4, "Max", 90000, 1], [5, "Janet", 69000, 1], [6, "Randy", 85000, 1], [7, "Will", 70000, 1]], "Department": [[1, "IT"], [2, "Sales"]]}} | {"mysql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)", "Create table If Not Exists Department (id int, name varchar(255))"], "mssql": ["Create table Employee (id int, name varchar(255), salary int, departmentId int)", "Create table Department (id int, name varchar(255))"], "oraclesql": ["Create table Employee (id int, name varchar(255), salary int, departmentId int)", "Create table Department (id int, name varchar(255))"], "database": true, "name": "top_three_salaries", "pythondata": ["Employee = pd.DataFrame([], columns=['id', 'name', 'salary', 'departmentId']).astype({'id':'Int64', 'name':'object', 'salary':'Int64', 'departmentId':'Int64'})", "Department = pd.DataFrame([], columns=['id', 'name']).astype({'id':'Int64', 'name':'object'})"], "postgresql": ["Create table If Not Exists Employee (id int, name varchar(255), salary int, departmentId int)\n", "Create table If Not Exists Department (id int, name varchar(255))\n"], "database_schema": {"Employee": {"id": "INT", "name": "VARCHAR(255)", "salary": "INT", "departmentId": "INT"}, "Department": {"id": "INT", "name": "VARCHAR(255)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
186 | Reverse Words in a String II | reverse-words-in-a-string-ii | null | Medium | 172.8K | 309.2K | 172,768 | 309,175 | 55.9% | ['reverse-words-in-a-string', 'rotate-array'] | [] | Algorithms | null | ["t","h","e"," ","s","k","y"," ","i","s"," ","b","l","u","e"] | {
"name": "reverseWords",
"params": [
{
"name": "s",
"type": "character[]"
}
],
"return": {
"type": "void"
},
"output": {
"paramindex": 0
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Two Pointers', 'String'] |
187 | Repeated DNA Sequences | repeated-dna-sequences | <p>The <strong>DNA sequence</strong> is composed of a series of nucleotides abbreviated as <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, and <code>'T'</code>.</p>
<ul>
<li>For example, <code>"ACGAATTCCG"</code> is a <strong>DNA sequence</strong>.</li>
</ul>
<p>When studying <strong>DNA</strong>, it is useful to identify repeated sequences within the DNA.</p>
<p>Given a string <code>s</code> that represents a <strong>DNA sequence</strong>, return all the <strong><code>10</code>-letter-long</strong> sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in <strong>any order</strong>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre><strong>Input:</strong> s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
<strong>Output:</strong> ["AAAAACCCCC","CCCCCAAAAA"]
</pre><p><strong class="example">Example 2:</strong></p>
<pre><strong>Input:</strong> s = "AAAAAAAAAAAAA"
<strong>Output:</strong> ["AAAAAAAAAA"]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= s.length <= 10<sup>5</sup></code></li>
<li><code>s[i]</code> is either <code>'A'</code>, <code>'C'</code>, <code>'G'</code>, or <code>'T'</code>.</li>
</ul>
| Medium | 441.4K | 866.7K | 441,412 | 866,693 | 50.9% | [] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n vector<string> findRepeatedDnaSequences(string s) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public List<String> findRepeatedDnaSequences(String s) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def findRepeatedDnaSequences(self, s):\n \"\"\"\n :type s: str\n :rtype: List[str]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def findRepeatedDnaSequences(self, s: str) -> List[str]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nchar** findRepeatedDnaSequences(char* s, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public IList<string> FindRepeatedDnaSequences(string s) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {string} s\n * @return {string[]}\n */\nvar findRepeatedDnaSequences = function(s) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function findRepeatedDnaSequences(s: string): string[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String $s\n * @return String[]\n */\n function findRepeatedDnaSequences($s) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func findRepeatedDnaSequences(_ s: String) -> [String] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun findRepeatedDnaSequences(s: String): List<String> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n List<String> findRepeatedDnaSequences(String s) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func findRepeatedDnaSequences(s string) []string {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {String} s\n# @return {String[]}\ndef find_repeated_dna_sequences(s)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def findRepeatedDnaSequences(s: String): List[String] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn find_repeated_dna_sequences(s: String) -> Vec<String> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (find-repeated-dna-sequences s)\n (-> string? (listof string?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec find_repeated_dna_sequences(S :: unicode:unicode_binary()) -> [unicode:unicode_binary()].\nfind_repeated_dna_sequences(S) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec find_repeated_dna_sequences(s :: String.t) :: [String.t]\n def find_repeated_dna_sequences(s) do\n \n end\nend"}] | "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" | {
"name": "findRepeatedDnaSequences",
"params": [
{
"name": "s",
"type": "string"
}
],
"return": {
"type": "list<string>"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Hash Table', 'String', 'Bit Manipulation', 'Sliding Window', 'Rolling Hash', 'Hash Function'] |
188 | Best Time to Buy and Sell Stock IV | best-time-to-buy-and-sell-stock-iv | <p>You are given an integer array <code>prices</code> where <code>prices[i]</code> is the price of a given stock on the <code>i<sup>th</sup></code> day, and an integer <code>k</code>.</p>
<p>Find the maximum profit you can achieve. You may complete at most <code>k</code> transactions: i.e. you may buy at most <code>k</code> times and sell at most <code>k</code> times.</p>
<p><strong>Note:</strong> You may not engage in multiple transactions simultaneously (i.e., you must sell the stock before you buy again).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> k = 2, prices = [2,4,1]
<strong>Output:</strong> 2
<strong>Explanation:</strong> Buy on day 1 (price = 2) and sell on day 2 (price = 4), profit = 4-2 = 2.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> k = 2, prices = [3,2,6,5,0,3]
<strong>Output:</strong> 7
<strong>Explanation:</strong> Buy on day 2 (price = 2) and sell on day 3 (price = 6), profit = 6-2 = 4. Then buy on day 5 (price = 0) and sell on day 6 (price = 3), profit = 3-0 = 3.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= k <= 100</code></li>
<li><code>1 <= prices.length <= 1000</code></li>
<li><code>0 <= prices[i] <= 1000</code></li>
</ul>
| Hard | 569.3K | 1.2M | 569,253 | 1,227,669 | 46.4% | ['best-time-to-buy-and-sell-stock', 'best-time-to-buy-and-sell-stock-ii', 'best-time-to-buy-and-sell-stock-iii', 'maximum-profit-from-trading-stocks'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int maxProfit(int k, vector<int>& prices) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int maxProfit(int k, int[] prices) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def maxProfit(self, k, prices):\n \"\"\"\n :type k: int\n :type prices: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def maxProfit(self, k: int, prices: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int maxProfit(int k, int* prices, int pricesSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int MaxProfit(int k, int[] prices) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} k\n * @param {number[]} prices\n * @return {number}\n */\nvar maxProfit = function(k, prices) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function maxProfit(k: number, prices: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $k\n * @param Integer[] $prices\n * @return Integer\n */\n function maxProfit($k, $prices) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func maxProfit(_ k: Int, _ prices: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun maxProfit(k: Int, prices: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int maxProfit(int k, List<int> prices) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func maxProfit(k int, prices []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} k\n# @param {Integer[]} prices\n# @return {Integer}\ndef max_profit(k, prices)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def maxProfit(k: Int, prices: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn max_profit(k: i32, prices: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (max-profit k prices)\n (-> exact-integer? (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec max_profit(K :: integer(), Prices :: [integer()]) -> integer().\nmax_profit(K, Prices) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec max_profit(k :: integer, prices :: [integer]) :: integer\n def max_profit(k, prices) do\n \n end\nend"}] | 2
[2,4,1] | {
"name": "maxProfit",
"params": [
{
"name": "k",
"type": "integer"
},
{
"name": "prices",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
189 | Rotate Array | rotate-array | <p>Given an integer array <code>nums</code>, rotate the array to the right by <code>k</code> steps, where <code>k</code> is non-negative.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [1,2,3,4,5,6,7], k = 3
<strong>Output:</strong> [5,6,7,1,2,3,4]
<strong>Explanation:</strong>
rotate 1 steps to the right: [7,1,2,3,4,5,6]
rotate 2 steps to the right: [6,7,1,2,3,4,5]
rotate 3 steps to the right: [5,6,7,1,2,3,4]
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [-1,-100,3,99], k = 2
<strong>Output:</strong> [3,99,-1,-100]
<strong>Explanation:</strong>
rotate 1 steps to the right: [99,-1,-100,3]
rotate 2 steps to the right: [3,99,-1,-100]
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 10<sup>5</sup></code></li>
<li><code>-2<sup>31</sup> <= nums[i] <= 2<sup>31</sup> - 1</code></li>
<li><code>0 <= k <= 10<sup>5</sup></code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong></p>
<ul>
<li>Try to come up with as many solutions as you can. There are at least <strong>three</strong> different ways to solve this problem.</li>
<li>Could you do it in-place with <code>O(1)</code> extra space?</li>
</ul>
| Medium | 3M | 7.1M | 3,018,879 | 7,077,343 | 42.7% | ['rotate-list', 'reverse-words-in-a-string-ii', 'make-k-subarray-sums-equal', 'maximum-number-of-matching-indices-after-right-shifts'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n void rotate(vector<int>& nums, int k) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public void rotate(int[] nums, int k) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def rotate(self, nums, k):\n \"\"\"\n :type nums: List[int]\n :type k: int\n :rtype: None Do not return anything, modify nums in-place instead.\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def rotate(self, nums: List[int], k: int) -> None:\n \"\"\"\n Do not return anything, modify nums in-place instead.\n \"\"\"\n "}, {"value": "c", "text": "C", "defaultCode": "void rotate(int* nums, int numsSize, int k) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public void Rotate(int[] nums, int k) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @param {number} k\n * @return {void} Do not return anything, modify nums in-place instead.\n */\nvar rotate = function(nums, k) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n Do not return anything, modify nums in-place instead.\n */\nfunction rotate(nums: number[], k: number): void {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @param Integer $k\n * @return NULL\n */\n function rotate(&$nums, $k) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func rotate(_ nums: inout [Int], _ k: Int) {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun rotate(nums: IntArray, k: Int): Unit {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n void rotate(List<int> nums, int k) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func rotate(nums []int, k int) {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @param {Integer} k\n# @return {Void} Do not return anything, modify nums in-place instead.\ndef rotate(nums, k)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def rotate(nums: Array[Int], k: Int): Unit = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn rotate(nums: &mut Vec<i32>, k: i32) {\n \n }\n}"}] | [1,2,3,4,5,6,7]
3 | {
"name": "rotate",
"params": [
{
"name": "nums",
"type": "integer[]"
},
{
"name": "k",
"type": "integer"
}
],
"return": {
"type": "void"
},
"output": {
"paramindex": 0
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Math', 'Two Pointers'] |
190 | Reverse Bits | reverse-bits | <p>Reverse bits of a given 32 bits unsigned integer.</p>
<p><strong>Note:</strong></p>
<ul>
<li>Note that in some languages, such as Java, there is no unsigned integer type. In this case, both input and output will be given as a signed integer type. They should not affect your implementation, as the integer's internal binary representation is the same, whether it is signed or unsigned.</li>
<li>In Java, the compiler represents the signed integers using <a href="https://en.wikipedia.org/wiki/Two%27s_complement" target="_blank">2's complement notation</a>. Therefore, in <strong class="example">Example 2</strong> above, the input represents the signed integer <code>-3</code> and the output represents the signed integer <code>-1073741825</code>.</li>
</ul>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> n = 00000010100101000001111010011100
<strong>Output:</strong> 964176192 (00111001011110000010100101000000)
<strong>Explanation: </strong>The input binary string <strong>00000010100101000001111010011100</strong> represents the unsigned integer 43261596, so return 964176192 which its binary representation is <strong>00111001011110000010100101000000</strong>.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> n = 11111111111111111111111111111101
<strong>Output:</strong> 3221225471 (10111111111111111111111111111111)
<strong>Explanation: </strong>The input binary string <strong>11111111111111111111111111111101</strong> represents the unsigned integer 4294967293, so return 3221225471 which its binary representation is <strong>10111111111111111111111111111111</strong>.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The input must be a <strong>binary string</strong> of length <code>32</code></li>
</ul>
<p> </p>
<p><strong>Follow up:</strong> If this function is called many times, how would you optimize it?</p>
| Easy | 973.8K | 1.6M | 973,774 | 1,557,109 | 62.5% | ['reverse-integer', 'number-of-1-bits', 'a-number-after-a-double-reversal'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n uint32_t reverseBits(uint32_t n) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "public class Solution {\n // you need treat n as an unsigned value\n public int reverseBits(int n) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution:\n # @param n, an integer\n # @return an integer\n def reverseBits(self, n):\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def reverseBits(self, n: int) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "uint32_t reverseBits(uint32_t n) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public uint reverseBits(uint n) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} n - a positive integer\n * @return {number} - a positive integer\n */\nvar reverseBits = function(n) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function reverseBits(n: number): number {\n\t\n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n /**\n * @param Integer $n\n * @return Integer\n */\n function reverseBits($n) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func reverseBits(_ n: Int) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n // you need treat n as an unsigned value\n fun reverseBits(n:Int):Int {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func reverseBits(num uint32) uint32 {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} n, a positive integer\n# @return {Integer}\ndef reverse_bits(n)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n // you need treat n as an unsigned value\n def reverseBits(x: Int): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn reverse_bits(x: u32) -> u32 {\n \n }\n}"}] | 00000010100101000001111010011100 | {
"name": "reverseBits",
"params": [
{
"name": "n",
"type": "string"
}
],
"return": {
"type": "integer"
},
"manual": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"]} | ['Divide and Conquer', 'Bit Manipulation'] |
191 | Number of 1 Bits | number-of-1-bits | <p>Given a positive integer <code>n</code>, write a function that returns the number of <span data-keyword="set-bit">set bits</span> in its binary representation (also known as the <a href="http://en.wikipedia.org/wiki/Hamming_weight" target="_blank">Hamming weight</a>).</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">n = 11</span></p>
<p><strong>Output:</strong> <span class="example-io">3</span></p>
<p><strong>Explanation:</strong></p>
<p>The input binary string <strong>1011</strong> has a total of three set bits.</p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">n = 128</span></p>
<p><strong>Output:</strong> <span class="example-io">1</span></p>
<p><strong>Explanation:</strong></p>
<p>The input binary string <strong>10000000</strong> has a total of one set bit.</p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">n = 2147483645</span></p>
<p><strong>Output:</strong> <span class="example-io">30</span></p>
<p><strong>Explanation:</strong></p>
<p>The input binary string <strong>1111111111111111111111111111101</strong> has a total of thirty set bits.</p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= n <= 2<sup>31</sup> - 1</code></li>
</ul>
<p> </p>
<strong>Follow up:</strong> If this function is called many times, how would you optimize it? | Easy | 1.8M | 2.4M | 1,755,076 | 2,370,978 | 74.0% | ['reverse-bits', 'power-of-two', 'counting-bits', 'binary-watch', 'hamming-distance', 'binary-number-with-alternating-bits', 'prime-number-of-set-bits-in-binary-representation', 'convert-date-to-binary'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int hammingWeight(int n) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int hammingWeight(int n) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def hammingWeight(self, n):\n \"\"\"\n :type n: int\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def hammingWeight(self, n: int) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int hammingWeight(int n) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int HammingWeight(int n) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number} n\n * @return {number}\n */\nvar hammingWeight = function(n) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function hammingWeight(n: number): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer $n\n * @return Integer\n */\n function hammingWeight($n) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func hammingWeight(_ n: Int) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun hammingWeight(n: Int): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int hammingWeight(int n) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func hammingWeight(n int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer} n\n# @return {Integer}\ndef hamming_weight(n)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def hammingWeight(n: Int): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn hamming_weight(n: i32) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (hamming-weight n)\n (-> exact-integer? exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec hamming_weight(N :: integer()) -> integer().\nhamming_weight(N) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec hamming_weight(n :: integer) :: integer\n def hamming_weight(n) do\n \n end\nend"}] | 11 | {
"name": "hammingWeight",
"params": [
{
"name": "n",
"type": "integer"
}
],
"return": {
"type": "integer"
},
"manual": false
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Divide and Conquer', 'Bit Manipulation'] |
192 | Word Frequency | word-frequency | <p>Write a bash script to calculate the <span data-keyword="frequency-textfile">frequency</span> of each word in a text file <code>words.txt</code>.</p>
<p>For simplicity sake, you may assume:</p>
<ul>
<li><code>words.txt</code> contains only lowercase characters and space <code>' '</code> characters.</li>
<li>Each word must consist of lowercase characters only.</li>
<li>Words are separated by one or more whitespace characters.</li>
</ul>
<p><strong class="example">Example:</strong></p>
<p>Assume that <code>words.txt</code> has the following content:</p>
<pre>
the day is sunny the the
the sunny is is
</pre>
<p>Your script should output the following, sorted by descending frequency:</p>
<pre>
the 4
is 3
sunny 2
day 1
</pre>
<p><b>Note:</b></p>
<ul>
<li>Don't worry about handling ties, it is guaranteed that each word's frequency count is unique.</li>
<li>Could you write it in one-line using <a href="http://tldp.org/HOWTO/Bash-Prog-Intro-HOWTO-4.html">Unix pipes</a>?</li>
</ul>
| Medium | 60.9K | 225.7K | 60,930 | 225,715 | 27.0% | ['top-k-frequent-elements'] | [] | Shell | [{"value": "bash", "text": "Bash", "defaultCode": "# Read from the file words.txt and output the word frequency list to stdout.\n"}] | a | {
"shell": true,
"manual": true
} | {"bash": ["Bash", "<p><code>Bash 5.2.21</code>.</p>"]} | ['Shell'] |
193 | Valid Phone Numbers | valid-phone-numbers | <p>Given a text file <code>file.txt</code> that contains a list of phone numbers (one per line), write a one-liner bash script to print all valid phone numbers.</p>
<p>You may assume that a valid phone number must appear in one of the following two formats: (xxx) xxx-xxxx or xxx-xxx-xxxx. (x means a digit)</p>
<p>You may also assume each line in the text file must not contain leading or trailing white spaces.</p>
<p><strong class="example">Example:</strong></p>
<p>Assume that <code>file.txt</code> has the following content:</p>
<pre>
987-123-4567
123 456 7890
(123) 456-7890
</pre>
<p>Your script should output the following valid phone numbers:</p>
<pre>
987-123-4567
(123) 456-7890
</pre>
| Easy | 100.4K | 370.4K | 100,444 | 370,382 | 27.1% | [] | [] | Shell | [{"value": "bash", "text": "Bash", "defaultCode": "# Read from the file file.txt and output all valid phone numbers to stdout.\n"}] | 0 | {
"shell": true,
"manual": true
} | {"bash": ["Bash", "<p><code>Bash 5.2.21</code>.</p>"]} | ['Shell'] |
194 | Transpose File | transpose-file | <p>Given a text file <code>file.txt</code>, transpose its content.</p>
<p>You may assume that each row has the same number of columns, and each field is separated by the <code>' '</code> character.</p>
<p><strong class="example">Example:</strong></p>
<p>If <code>file.txt</code> has the following content:</p>
<pre>
name age
alice 21
ryan 30
</pre>
<p>Output the following:</p>
<pre>
name alice ryan
age 21 30
</pre>
| Medium | 31.7K | 112.8K | 31,709 | 112,803 | 28.1% | [] | [] | Shell | [{"value": "bash", "text": "Bash", "defaultCode": "# Read from the file file.txt and print its transposed content to stdout.\n"}] | a | {
"shell": true,
"manual": true
} | {"bash": ["Bash", "<p><code>Bash 5.2.21</code>.</p>"]} | ['Shell'] |
195 | Tenth Line | tenth-line | <p>Given a text file <code>file.txt</code>, print just the 10th line of the file.</p>
<p><strong class="example">Example:</strong></p>
<p>Assume that <code>file.txt</code> has the following content:</p>
<pre>
Line 1
Line 2
Line 3
Line 4
Line 5
Line 6
Line 7
Line 8
Line 9
Line 10
</pre>
<p>Your script should output the tenth line, which is:</p>
<pre>
Line 10
</pre>
<div class="spoilers"><b>Note:</b><br />
1. If the file contains less than 10 lines, what should you output?<br />
2. There's at least three different solutions. Try to explore all possibilities.</div>
| Easy | 126.5K | 368.6K | 126,504 | 368,649 | 34.3% | [] | [] | Shell | [{"value": "bash", "text": "Bash", "defaultCode": "# Read from the file file.txt and output the tenth line to stdout.\n"}] | Line 1\nLine 2\nLine 3\nLine 4\nLine 5\nLine 6\nLine 7\nLine 8\nLine 9\nLine 10 | {
"shell": true,
"manual": true
} | {"bash": ["Bash", "<p><code>Bash 5.2.21</code>.</p>"]} | ['Shell'] |
196 | Delete Duplicate Emails | delete-duplicate-emails | <p>Table: <code>Person</code></p>
<pre>
+-------------+---------+
| Column Name | Type |
+-------------+---------+
| id | int |
| email | varchar |
+-------------+---------+
id is the primary key (column with unique values) for this table.
Each row of this table contains an email. The emails will not contain uppercase letters.
</pre>
<p> </p>
<p>Write a solution to<strong> delete</strong> all duplicate emails, keeping only one unique email with the smallest <code>id</code>.</p>
<p>For SQL users, please note that you are supposed to write a <code>DELETE</code> statement and not a <code>SELECT</code> one.</p>
<p>For Pandas users, please note that you are supposed to modify <code>Person</code> in place.</p>
<p>After running your script, the answer shown is the <code>Person</code> table. The driver will first compile and run your piece of code and then show the <code>Person</code> table. The final order of the <code>Person</code> table <strong>does not matter</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Person table:
+----+------------------+
| id | email |
+----+------------------+
| 1 | john@example.com |
| 2 | bob@example.com |
| 3 | john@example.com |
+----+------------------+
<strong>Output:</strong>
+----+------------------+
| id | email |
+----+------------------+
| 1 | john@example.com |
| 2 | bob@example.com |
+----+------------------+
<strong>Explanation:</strong> john@example.com is repeated two times. We keep the row with the smallest Id = 1.
</pre>
| Easy | 692.6K | 1.1M | 692,633 | 1,082,588 | 64.0% | [] | ['Create table If Not Exists Person (Id int, Email varchar(255))', 'Truncate table Person', "insert into Person (id, email) values ('1', 'john@example.com')", "insert into Person (id, email) values ('2', 'bob@example.com')", "insert into Person (id, email) values ('3', 'john@example.com')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef delete_duplicate_emails(person: pd.DataFrame) -> None:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Person": ["id", "email"]}, "rows": {"Person": [[1, "john@example.com"], [2, "bob@example.com"], [3, "john@example.com"]]}} | {"mysql": ["Create table If Not Exists Person (Id int, Email varchar(255))"], "mssql": ["Create table Person (Id int, Email varchar(255))"], "oraclesql": ["Create table Person (Id int, Email varchar(255))"], "database": true, "manual": true, "name": "delete_duplicate_emails", "pythondata": ["Person = pd.DataFrame([], columns=['id', 'email']).astype({'id':'int64', 'email':'object'})"], "postgresql": ["Create table If Not Exists Person (Id int, Email varchar(255))\n"], "database_schema": {"Person": {"Id": "INT", "Email": "VARCHAR(255)"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
197 | Rising Temperature | rising-temperature | <p>Table: <code>Weather</code></p>
<pre>
+---------------+---------+
| Column Name | Type |
+---------------+---------+
| id | int |
| recordDate | date |
| temperature | int |
+---------------+---------+
id is the column with unique values for this table.
There are no different rows with the same recordDate.
This table contains information about the temperature on a certain day.
</pre>
<p> </p>
<p>Write a solution to find all dates' <code>id</code> with higher temperatures compared to its previous dates (yesterday).</p>
<p>Return the result table in <strong>any order</strong>.</p>
<p>The result format is in the following example.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong>
Weather table:
+----+------------+-------------+
| id | recordDate | temperature |
+----+------------+-------------+
| 1 | 2015-01-01 | 10 |
| 2 | 2015-01-02 | 25 |
| 3 | 2015-01-03 | 20 |
| 4 | 2015-01-04 | 30 |
+----+------------+-------------+
<strong>Output:</strong>
+----+
| id |
+----+
| 2 |
| 4 |
+----+
<strong>Explanation:</strong>
In 2015-01-02, the temperature was higher than the previous day (10 -> 25).
In 2015-01-04, the temperature was higher than the previous day (20 -> 30).
</pre>
| Easy | 1M | 2.1M | 1,048,789 | 2,098,992 | 50.0% | [] | ['Create table If Not Exists Weather (id int, recordDate date, temperature int)', 'Truncate table Weather', "insert into Weather (id, recordDate, temperature) values ('1', '2015-01-01', '10')", "insert into Weather (id, recordDate, temperature) values ('2', '2015-01-02', '25')", "insert into Weather (id, recordDate, temperature) values ('3', '2015-01-03', '20')", "insert into Weather (id, recordDate, temperature) values ('4', '2015-01-04', '30')"] | Database | [{"value": "mysql", "text": "MySQL", "defaultCode": "# Write your MySQL query statement below\n"}, {"value": "mssql", "text": "MS SQL Server", "defaultCode": "/* Write your T-SQL query statement below */\n"}, {"value": "oraclesql", "text": "Oracle", "defaultCode": "/* Write your PL/SQL query statement below */\n"}, {"value": "pythondata", "text": "Pandas", "defaultCode": "import pandas as pd\n\ndef rising_temperature(weather: pd.DataFrame) -> pd.DataFrame:\n "}, {"value": "postgresql", "text": "PostgreSQL", "defaultCode": "-- Write your PostgreSQL query statement below\n"}] | {"headers": {"Weather": ["id", "recordDate", "temperature"]}, "rows": {"Weather": [[1, "2015-01-01", 10], [2, "2015-01-02", 25], [3, "2015-01-03", 20], [4, "2015-01-04", 30]]}} | {"mysql": ["Create table If Not Exists Weather (id int, recordDate date, temperature int)"], "mssql": ["Create table Weather (id int, recordDate date, temperature int)"], "oraclesql": ["Create table Weather (id int, recordDate date, temperature int)", "ALTER SESSION SET nls_date_format='YYYY-MM-DD'"], "database": true, "name": "rising_temperature", "pythondata": ["Weather = pd.DataFrame([], columns=['id', 'recordDate', 'temperature']).astype({'id':'Int64', 'recordDate':'datetime64[ns]', 'temperature':'Int64'})"], "postgresql": ["Create table If Not Exists Weather (id int, recordDate date, temperature int)"], "database_schema": {"Weather": {"id": "INT", "recordDate": "DATE", "temperature": "INT"}}} | {"mysql": ["MySQL", "<p><code>MySQL 8.0</code>.</p>"], "mssql": ["MS SQL Server", "<p><code>mssql server 2019</code>.</p>"], "oraclesql": ["Oracle", "<p><code>Oracle Sql 11.2</code>.</p>"], "pythondata": ["Pandas", "<p>Python 3.10 with Pandas 2.2.2 and NumPy 1.26.4</p>"], "postgresql": ["PostgreSQL", "<p>PostgreSQL 16</p>"]} | ['Database'] |
198 | House Robber | house-robber | <p>You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed, the only constraint stopping you from robbing each of them is that adjacent houses have security systems connected and <b>it will automatically contact the police if two adjacent houses were broken into on the same night</b>.</p>
<p>Given an integer array <code>nums</code> representing the amount of money of each house, return <em>the maximum amount of money you can rob tonight <b>without alerting the police</b></em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> nums = [1,2,3,1]
<strong>Output:</strong> 4
<strong>Explanation:</strong> Rob house 1 (money = 1) and then rob house 3 (money = 3).
Total amount you can rob = 1 + 3 = 4.
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> nums = [2,7,9,3,1]
<strong>Output:</strong> 12
<strong>Explanation:</strong> Rob house 1 (money = 2), rob house 3 (money = 9) and rob house 5 (money = 1).
Total amount you can rob = 2 + 9 + 1 = 12.
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>1 <= nums.length <= 100</code></li>
<li><code>0 <= nums[i] <= 400</code></li>
</ul>
| Medium | 2.8M | 5.4M | 2,807,559 | 5,389,110 | 52.1% | ['maximum-product-subarray', 'house-robber-ii', 'paint-house', 'paint-fence', 'house-robber-iii', 'non-negative-integers-without-consecutive-ones', 'coin-path', 'delete-and-earn', 'solving-questions-with-brainpower', 'count-number-of-ways-to-place-houses', 'house-robber-iv', 'mice-and-cheese', 'largest-element-in-an-array-after-merge-operations'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int rob(vector<int>& nums) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int rob(int[] nums) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def rob(self, nums):\n \"\"\"\n :type nums: List[int]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def rob(self, nums: List[int]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int rob(int* nums, int numsSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int Rob(int[] nums) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {number[]} nums\n * @return {number}\n */\nvar rob = function(nums) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function rob(nums: number[]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param Integer[] $nums\n * @return Integer\n */\n function rob($nums) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func rob(_ nums: [Int]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun rob(nums: IntArray): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int rob(List<int> nums) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func rob(nums []int) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Integer[]} nums\n# @return {Integer}\ndef rob(nums)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def rob(nums: Array[Int]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn rob(nums: Vec<i32>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (rob nums)\n (-> (listof exact-integer?) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec rob(Nums :: [integer()]) -> integer().\nrob(Nums) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec rob(nums :: [integer]) :: integer\n def rob(nums) do\n \n end\nend"}] | [1,2,3,1] | {
"name": "rob",
"params": [
{
"name": "nums",
"type": "integer[]"
}
],
"return": {
"type": "integer"
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Dynamic Programming'] |
199 | Binary Tree Right Side View | binary-tree-right-side-view | <p>Given the <code>root</code> of a binary tree, imagine yourself standing on the <strong>right side</strong> of it, return <em>the values of the nodes you can see ordered from top to bottom</em>.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,2,3,null,5,null,4]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1,3,4]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/11/24/tmpd5jn43fs-1.png" style="width: 400px; height: 207px;" /></p>
</div>
<p><strong class="example">Example 2:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,2,3,4,null,null,null,5]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1,3,4,5]</span></p>
<p><strong>Explanation:</strong></p>
<p><img alt="" src="https://assets.leetcode.com/uploads/2024/11/24/tmpkpe40xeh-1.png" style="width: 400px; height: 214px;" /></p>
</div>
<p><strong class="example">Example 3:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = [1,null,3]</span></p>
<p><strong>Output:</strong> <span class="example-io">[1,3]</span></p>
</div>
<p><strong class="example">Example 4:</strong></p>
<div class="example-block">
<p><strong>Input:</strong> <span class="example-io">root = []</span></p>
<p><strong>Output:</strong> <span class="example-io">[]</span></p>
</div>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li>The number of nodes in the tree is in the range <code>[0, 100]</code>.</li>
<li><code>-100 <= Node.val <= 100</code></li>
</ul>
| Medium | 1.8M | 2.7M | 1,754,853 | 2,650,991 | 66.2% | ['populating-next-right-pointers-in-each-node', 'boundary-of-binary-tree'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * TreeNode *left;\n * TreeNode *right;\n * TreeNode() : val(0), left(nullptr), right(nullptr) {}\n * TreeNode(int x) : val(x), left(nullptr), right(nullptr) {}\n * TreeNode(int x, TreeNode *left, TreeNode *right) : val(x), left(left), right(right) {}\n * };\n */\nclass Solution {\npublic:\n vector<int> rightSideView(TreeNode* root) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * int val;\n * TreeNode left;\n * TreeNode right;\n * TreeNode() {}\n * TreeNode(int val) { this.val = val; }\n * TreeNode(int val, TreeNode left, TreeNode right) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\nclass Solution {\n public List<Integer> rightSideView(TreeNode root) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode(object):\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution(object):\n def rightSideView(self, root):\n \"\"\"\n :type root: Optional[TreeNode]\n :rtype: List[int]\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode:\n# def __init__(self, val=0, left=None, right=None):\n# self.val = val\n# self.left = left\n# self.right = right\nclass Solution:\n def rightSideView(self, root: Optional[TreeNode]) -> List[int]:\n "}, {"value": "c", "text": "C", "defaultCode": "/**\n * Definition for a binary tree node.\n * struct TreeNode {\n * int val;\n * struct TreeNode *left;\n * struct TreeNode *right;\n * };\n */\n/**\n * Note: The returned array must be malloced, assume caller calls free().\n */\nint* rightSideView(struct TreeNode* root, int* returnSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public int val;\n * public TreeNode left;\n * public TreeNode right;\n * public TreeNode(int val=0, TreeNode left=null, TreeNode right=null) {\n * this.val = val;\n * this.left = left;\n * this.right = right;\n * }\n * }\n */\npublic class Solution {\n public IList<int> RightSideView(TreeNode root) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * function TreeNode(val, left, right) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n */\n/**\n * @param {TreeNode} root\n * @return {number[]}\n */\nvar rightSideView = function(root) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * val: number\n * left: TreeNode | null\n * right: TreeNode | null\n * constructor(val?: number, left?: TreeNode | null, right?: TreeNode | null) {\n * this.val = (val===undefined ? 0 : val)\n * this.left = (left===undefined ? null : left)\n * this.right = (right===undefined ? null : right)\n * }\n * }\n */\n\nfunction rightSideView(root: TreeNode | null): number[] {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * public $val = null;\n * public $left = null;\n * public $right = null;\n * function __construct($val = 0, $left = null, $right = null) {\n * $this->val = $val;\n * $this->left = $left;\n * $this->right = $right;\n * }\n * }\n */\nclass Solution {\n\n /**\n * @param TreeNode $root\n * @return Integer[]\n */\n function rightSideView($root) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "/**\n * Definition for a binary tree node.\n * public class TreeNode {\n * public var val: Int\n * public var left: TreeNode?\n * public var right: TreeNode?\n * public init() { self.val = 0; self.left = nil; self.right = nil; }\n * public init(_ val: Int) { self.val = val; self.left = nil; self.right = nil; }\n * public init(_ val: Int, _ left: TreeNode?, _ right: TreeNode?) {\n * self.val = val\n * self.left = left\n * self.right = right\n * }\n * }\n */\nclass Solution {\n func rightSideView(_ root: TreeNode?) -> [Int] {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "/**\n * Example:\n * var ti = TreeNode(5)\n * var v = ti.`val`\n * Definition for a binary tree node.\n * class TreeNode(var `val`: Int) {\n * var left: TreeNode? = null\n * var right: TreeNode? = null\n * }\n */\nclass Solution {\n fun rightSideView(root: TreeNode?): List<Int> {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode {\n * int val;\n * TreeNode? left;\n * TreeNode? right;\n * TreeNode([this.val = 0, this.left, this.right]);\n * }\n */\nclass Solution {\n List<int> rightSideView(TreeNode? root) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "/**\n * Definition for a binary tree node.\n * type TreeNode struct {\n * Val int\n * Left *TreeNode\n * Right *TreeNode\n * }\n */\nfunc rightSideView(root *TreeNode) []int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# Definition for a binary tree node.\n# class TreeNode\n# attr_accessor :val, :left, :right\n# def initialize(val = 0, left = nil, right = nil)\n# @val = val\n# @left = left\n# @right = right\n# end\n# end\n# @param {TreeNode} root\n# @return {Integer[]}\ndef right_side_view(root)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "/**\n * Definition for a binary tree node.\n * class TreeNode(_value: Int = 0, _left: TreeNode = null, _right: TreeNode = null) {\n * var value: Int = _value\n * var left: TreeNode = _left\n * var right: TreeNode = _right\n * }\n */\nobject Solution {\n def rightSideView(root: TreeNode): List[Int] = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "// Definition for a binary tree node.\n// #[derive(Debug, PartialEq, Eq)]\n// pub struct TreeNode {\n// pub val: i32,\n// pub left: Option<Rc<RefCell<TreeNode>>>,\n// pub right: Option<Rc<RefCell<TreeNode>>>,\n// }\n// \n// impl TreeNode {\n// #[inline]\n// pub fn new(val: i32) -> Self {\n// TreeNode {\n// val,\n// left: None,\n// right: None\n// }\n// }\n// }\nuse std::rc::Rc;\nuse std::cell::RefCell;\nimpl Solution {\n pub fn right_side_view(root: Option<Rc<RefCell<TreeNode>>>) -> Vec<i32> {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "; Definition for a binary tree node.\n#|\n\n; val : integer?\n; left : (or/c tree-node? #f)\n; right : (or/c tree-node? #f)\n(struct tree-node\n (val left right) #:mutable #:transparent)\n\n; constructor\n(define (make-tree-node [val 0])\n (tree-node val #f #f))\n\n|#\n\n(define/contract (right-side-view root)\n (-> (or/c tree-node? #f) (listof exact-integer?))\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "%% Definition for a binary tree node.\n%%\n%% -record(tree_node, {val = 0 :: integer(),\n%% left = null :: 'null' | #tree_node{},\n%% right = null :: 'null' | #tree_node{}}).\n\n-spec right_side_view(Root :: #tree_node{} | null) -> [integer()].\nright_side_view(Root) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "# Definition for a binary tree node.\n#\n# defmodule TreeNode do\n# @type t :: %__MODULE__{\n# val: integer,\n# left: TreeNode.t() | nil,\n# right: TreeNode.t() | nil\n# }\n# defstruct val: 0, left: nil, right: nil\n# end\n\ndefmodule Solution do\n @spec right_side_view(root :: TreeNode.t | nil) :: [integer]\n def right_side_view(root) do\n \n end\nend"}] | [1,2,3,null,5,null,4] | {
"name": "rightSideView",
"params": [
{
"name": "root",
"type": "TreeNode"
}
],
"return": {
"type": "list<integer>",
"dealloc": true
}
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Tree', 'Depth-First Search', 'Breadth-First Search', 'Binary Tree'] |
200 | Number of Islands | number-of-islands | <p>Given an <code>m x n</code> 2D binary grid <code>grid</code> which represents a map of <code>'1'</code>s (land) and <code>'0'</code>s (water), return <em>the number of islands</em>.</p>
<p>An <strong>island</strong> is surrounded by water and is formed by connecting adjacent lands horizontally or vertically. You may assume all four edges of the grid are all surrounded by water.</p>
<p> </p>
<p><strong class="example">Example 1:</strong></p>
<pre>
<strong>Input:</strong> grid = [
["1","1","1","1","0"],
["1","1","0","1","0"],
["1","1","0","0","0"],
["0","0","0","0","0"]
]
<strong>Output:</strong> 1
</pre>
<p><strong class="example">Example 2:</strong></p>
<pre>
<strong>Input:</strong> grid = [
["1","1","0","0","0"],
["1","1","0","0","0"],
["0","0","1","0","0"],
["0","0","0","1","1"]
]
<strong>Output:</strong> 3
</pre>
<p> </p>
<p><strong>Constraints:</strong></p>
<ul>
<li><code>m == grid.length</code></li>
<li><code>n == grid[i].length</code></li>
<li><code>1 <= m, n <= 300</code></li>
<li><code>grid[i][j]</code> is <code>'0'</code> or <code>'1'</code>.</li>
</ul>
| Medium | 3.3M | 5.4M | 3,348,963 | 5,413,257 | 61.9% | ['surrounded-regions', 'walls-and-gates', 'number-of-islands-ii', 'number-of-connected-components-in-an-undirected-graph', 'battleships-in-a-board', 'number-of-distinct-islands', 'max-area-of-island', 'count-sub-islands', 'find-all-groups-of-farmland', 'count-unreachable-pairs-of-nodes-in-an-undirected-graph', 'maximum-number-of-fish-in-a-grid'] | [] | Algorithms | [{"value": "cpp", "text": "C++", "defaultCode": "class Solution {\npublic:\n int numIslands(vector<vector<char>>& grid) {\n \n }\n};"}, {"value": "java", "text": "Java", "defaultCode": "class Solution {\n public int numIslands(char[][] grid) {\n \n }\n}"}, {"value": "python", "text": "Python", "defaultCode": "class Solution(object):\n def numIslands(self, grid):\n \"\"\"\n :type grid: List[List[str]]\n :rtype: int\n \"\"\"\n "}, {"value": "python3", "text": "Python3", "defaultCode": "class Solution:\n def numIslands(self, grid: List[List[str]]) -> int:\n "}, {"value": "c", "text": "C", "defaultCode": "int numIslands(char** grid, int gridSize, int* gridColSize) {\n \n}"}, {"value": "csharp", "text": "C#", "defaultCode": "public class Solution {\n public int NumIslands(char[][] grid) {\n \n }\n}"}, {"value": "javascript", "text": "JavaScript", "defaultCode": "/**\n * @param {character[][]} grid\n * @return {number}\n */\nvar numIslands = function(grid) {\n \n};"}, {"value": "typescript", "text": "TypeScript", "defaultCode": "function numIslands(grid: string[][]): number {\n \n};"}, {"value": "php", "text": "PHP", "defaultCode": "class Solution {\n\n /**\n * @param String[][] $grid\n * @return Integer\n */\n function numIslands($grid) {\n \n }\n}"}, {"value": "swift", "text": "Swift", "defaultCode": "class Solution {\n func numIslands(_ grid: [[Character]]) -> Int {\n \n }\n}"}, {"value": "kotlin", "text": "Kotlin", "defaultCode": "class Solution {\n fun numIslands(grid: Array<CharArray>): Int {\n \n }\n}"}, {"value": "dart", "text": "Dart", "defaultCode": "class Solution {\n int numIslands(List<List<String>> grid) {\n \n }\n}"}, {"value": "golang", "text": "Go", "defaultCode": "func numIslands(grid [][]byte) int {\n \n}"}, {"value": "ruby", "text": "Ruby", "defaultCode": "# @param {Character[][]} grid\n# @return {Integer}\ndef num_islands(grid)\n \nend"}, {"value": "scala", "text": "Scala", "defaultCode": "object Solution {\n def numIslands(grid: Array[Array[Char]]): Int = {\n \n }\n}"}, {"value": "rust", "text": "Rust", "defaultCode": "impl Solution {\n pub fn num_islands(grid: Vec<Vec<char>>) -> i32 {\n \n }\n}"}, {"value": "racket", "text": "Racket", "defaultCode": "(define/contract (num-islands grid)\n (-> (listof (listof char?)) exact-integer?)\n )"}, {"value": "erlang", "text": "Erlang", "defaultCode": "-spec num_islands(Grid :: [[char()]]) -> integer().\nnum_islands(Grid) ->\n ."}, {"value": "elixir", "text": "Elixir", "defaultCode": "defmodule Solution do\n @spec num_islands(grid :: [[char]]) :: integer\n def num_islands(grid) do\n \n end\nend"}] | [["1","1","1","1","0"],["1","1","0","1","0"],["1","1","0","0","0"],["0","0","0","0","0"]] | {
"name": "numIslands",
"params": [
{
"name": "grid",
"type": "character[][]"
}
],
"return": {
"type": "integer"
},
"manual": true
} | {"cpp": ["C++", "<p>Compiled with <code> clang 19 </code> using the latest C++ 23 standard, and <code>libstdc++</code> provided by GCC 14.</p>\r\n\r\n<p>Your code is compiled with level two optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>"], "java": ["Java", "<p><code>OpenJDK 21</code>. Using compile arguments: <code>--enable-preview --release 21</code></p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n<p>Includes <code>Pair</code> class from https://docs.oracle.com/javase/8/javafx/api/javafx/util/Pair.html.</p>"], "python": ["Python", "<p><code>Python 2.7.18</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/2/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/2/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/2/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>\r\n\r\n<p>Note that Python 2.7 <a href=\"https://www.python.org/dev/peps/pep-0373/\" target=\"_blank\">is not maintained anymore</a>. For the latest Python, please choose Python3 instead.</p>"], "c": ["C", "<p>Compiled with <code>gcc 14</code> using the gnu11 standard.</p>\r\n\r\n<p>Your code is compiled with level one optimization (<code>-O2</code>). <a href=\"https://github.com/google/sanitizers/wiki/AddressSanitizer\" target=\"_blank\">AddressSanitizer</a> is also enabled to help detect out-of-bounds and use-after-free bugs.</p>\r\n\r\n<p>Most standard library headers are already included automatically for your convenience.</p>\r\n\r\n<p>For hash table operations, you may use <a href=\"https://troydhanson.github.io/uthash/\" target=\"_blank\">uthash</a>. \"uthash.h\" is included by default. Below are some examples:</p>\r\n\r\n<p><b>1. Adding an item to a hash.</b>\r\n<pre>\r\nstruct hash_entry {\r\n int id; /* we'll use this field as the key */\r\n char name[10];\r\n UT_hash_handle hh; /* makes this structure hashable */\r\n};\r\n\r\nstruct hash_entry *users = NULL;\r\n\r\nvoid add_user(struct hash_entry *s) {\r\n HASH_ADD_INT(users, id, s);\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>2. Looking up an item in a hash:</b>\r\n<pre>\r\nstruct hash_entry *find_user(int user_id) {\r\n struct hash_entry *s;\r\n HASH_FIND_INT(users, &user_id, s);\r\n return s;\r\n}\r\n</pre>\r\n</p>\r\n\r\n<p><b>3. Deleting an item in a hash:</b>\r\n<pre>\r\nvoid delete_user(struct hash_entry *user) {\r\n HASH_DEL(users, user); \r\n}\r\n</pre>\r\n</p>"], "csharp": ["C#", "<p><a href=\"https://learn.microsoft.com/en-us/dotnet/csharp/whats-new/csharp-13\" target=\"_blank\">C# 13</a> with .NET 9 runtime</p>"], "javascript": ["JavaScript", "<p><code>Node.js 22.14.0</code>.</p>\r\n\r\n<p>Your code is run with <code>--harmony</code> flag, enabling <a href=\"http://node.green/\" target=\"_blank\">new ES6 features</a>.</p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "ruby": ["Ruby", "<p><code>Ruby 3.2</code></p>\r\n\r\n<p>Some common data structure implementations are provided in the Algorithms module: https://www.rubydoc.info/github/kanwei/algorithms/Algorithms</p>"], "swift": ["Swift", "<p><code>Swift 6.0</code>.</p>\r\n\r\n<p>You may use the following packages:<br/>\r\n<a href=\"https://github.com/apple/swift-algorithms/tree/1.2.0\" target=\"_blank\">swift-algorithms 1.2.0</a><br/>\r\n<a href=\"https://github.com/apple/swift-collections/tree/1.1.4\" target=\"_blank\">swift-collections 1.1.4</a><br/>\r\n<a href=\"https://github.com/apple/swift-numerics/tree/1.0.2\" target=\"_blank\">swift-numerics 1.0.2</a></p>"], "golang": ["Go", "<p><code>Go 1.23</code></p>\r\n<p>Support <a href=\"https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods@v1.18.1</a> and <a href=\"https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha\" target=\"_blank\">https://pkg.go.dev/github.com/emirpasic/gods/v2@v2.0.0-alpha</a> library.</p>"], "python3": ["Python3", "<p><code>Python 3.11</code>.</p>\r\n\r\n<p>Most libraries are already imported automatically for your convenience, such as <a href=\"https://docs.python.org/3/library/array.html\" target=\"_blank\">array</a>, <a href=\"https://docs.python.org/3/library/bisect.html\" target=\"_blank\">bisect</a>, <a href=\"https://docs.python.org/3/library/collections.html\" target=\"_blank\">collections</a>. If you need more libraries, you can import it yourself.</p>\r\n\r\n<p>For Map/TreeMap data structure, you may use <a href=\"http://www.grantjenks.com/docs/sortedcontainers/\" target=\"_blank\">sortedcontainers</a> library.</p>"], "scala": ["Scala", "<p><code>Scala 3.3.1</code>.</p>"], "kotlin": ["Kotlin", "<p><code>Kotlin 2.1.10</code>.</p>"], "rust": ["Rust", "<p><code>Rust 1.85.0</code>. Your code will be compiled with <code>opt-level</code> 2.</p>\r\n\r\n<p>Supports <a href=\"https://crates.io/crates/rand\" target=\"_blank\">rand v0.8</a> and <a href=\"https://crates.io/crates/regex\" target=\"_blank\">regex\u00a0v1</a> and <a href=\"https://crates.io/crates/itertools\" target=\"_blank\">itertools\u00a0v0.14</a> from crates.io</p>"], "php": ["PHP", "<p><code>PHP 8.2</code>.</p>\r\n<p>With bcmath module</p>"], "typescript": ["Typescript", "<p><code>TypeScript 5.7.3, Node.js 22.14.0</code>.</p>\r\n\r\n<p>Compile Options: <code>--alwaysStrict --strictBindCallApply --strictFunctionTypes --target ES2024</code></p>\r\n\r\n<p><a href=\"https://lodash.com\" target=\"_blank\">lodash.js</a> library is included by default.</p>\r\n\r\n<p>For Priority Queue / Queue data structures, you may use 6.3.2 version of <a href=\"https://github.com/datastructures-js/priority-queue/tree/v6.3.2\" target=\"_blank\">datastructures-js/priority-queue</a> and 4.2.3 version of <a href=\"https://github.com/datastructures-js/queue/tree/v4.2.3\" target=\"_blank\">datastructures-js/queue</a> and 1.0.4 version of <a href=\"https://github.com/datastructures-js/deque/tree/v1.0.4\" target=\"_blank\">datastructures-js/deque</a>.</p>"], "racket": ["Racket", "<p><a href=\"https://docs.racket-lang.org/guide/performance.html#%28tech._c%29\" target=\"_blank\">Racket CS</a> v8.15</p>\r\n\r\n<p>Using <code>#lang racket</code></p>\r\n\r\n<p>Required <code>data/gvector data/queue data/order data/heap</code> automatically for your convenience</p>"], "erlang": ["Erlang", "Erlang/OTP 26"], "elixir": ["Elixir", "Elixir 1.17 with Erlang/OTP 26"], "dart": ["Dart", "<p>Dart 3.2. You may use package <a href=\"https://pub.dev/packages/collection/versions/1.18.0\" target=\"_blank\">collection</a></p>\r\n\r\n<p>Your code will be run directly without compiling</p>"]} | ['Array', 'Depth-First Search', 'Breadth-First Search', 'Union Find', 'Matrix'] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.