image
imagewidth (px) 205
980
| latex
stringlengths 132
39.9k
| filename
stringlengths 18
19
|
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{DrotAA n = 882} & \textbf{Non-DrotAA n = 11,610} & \textbf{Total n = 12,492} & \textbf{value P} \\
\hline
Medical/Surgical Status, n (\%): & & & & <0.001 \\
\hline
Medical & 540 (61.2) & 7232 (62.3) & 7772 (62.2) \\
\hline
Surgical – Elective & 127 (14.4) & 1205 (10.4) & 1332 (10.7) \\
\hline
Surgical – Emergency & 215 (24.4) & 3173 (27.3) & 3388 (27.1) \\
\hline
SIRS criteria met, n (\%): & (n = 858) & (n = 11,241) & (n = 12099) & <0.001 \\
\hline
0 & 2 (0.2) & 29 (0.3) & 31 (0.3) \\
\hline
1 & 5 (0.6) & 188 (1.7) & 193 (1.6) \\
\hline
2 & 57 (6.6) & 1198 (10.7) & 1255 (10.4) \\
\hline
3 & 268 (31.2) & 4063 (36.1) & 4331 (35.8) \\
\hline
4 & 526 (61.3) & 5763 (51.3) & 6289 (52.0) \\
\hline
Source of infection, n (\%): & (n = 856) & (n = 11,260) & (n = 12,116) & <0.001 \\
\hline
Community acquired & 529 (61.8) & 6033 (53.6) & 6562 (54.2) \\
\hline
Nosocomial – hospital acquired & 217 (25.4) & 3172 (28.2) & 3389 (28.0) \\
\hline
Nosocomial – ICU acquired & 110 (12.9) & 2055 (18.3) & 2165 (17.9) \\
\hline
Type of infection, n (\%): & (n = 675) & (n = 8380) & (n = 9055) \\
\hline
\multirow{2}{*}{Gram negative} & 392 (58.1) & 4795 (57.2) & 5187 (57.3) & 0.67 \\
\hline
(n = 681) & (n = 8396) & (n = 9077) \\
\hline
\multirow{2}{*}{Gram positive} & 371 (54.5) & 3668 (43.7) & 4039 (44.5) & <0.001 \\
\hline
(n = 682) & (n = 8678) & (n = 9360) \\
\hline
Fungal & 103 (15.1) & 986 (11.4) & 1089 (11.6) & 0.003 \\
\hline
Primary site of infection, n (\%): & (n = 861) & (n = 11,301) & (n = 12,162) & 0.35 \\
\hline
Abdominopelvic & 227 (26.4) & 2642 (23.4) & 2869 (23.6) \\
\hline
Bone or joint & 13 (1.5) & 160 (1.4) & 173 (1.4) \\
\hline
Hematogenous & 59 (6.9) & 738 (6.5) & 797 (6.6) \\
\hline
Indwelling catheter-dialysis access & 3 (0.3) & 79 (0.7) & 82 (0.7) \\
\hline
Indwelling catheter-vascular access & 11 (1.3) & 163 (1.4) & 174 (1.4) \\
\hline
Lung & 366 (42.5) & 5282 (46.7) & 5648 (46.4) \\
\hline
Meninges & 12 (1.4) & 169 (1.5) & 181 (1.5) \\
\hline
Skin or skin structure & 44 (5.1) & 586 (5.2) & 630 (5.2) \\
\hline
Urinary tract & 71 (8.2) & 887 (7.8) & 958 (7.9) \\
\hline
Other & 55 (6.4) & 595 (5.3) & 650 (5.3) \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{DrotAA n = 882} & \textbf{Non-DrotAA n = 11,610} & \textbf{Total n = 12,492} & \textbf{P value} \\
\hline
IV fluid resuscitation, n (\%) & (n = 782) 718 (91.8) & (n = 10,492) 9053 (86.3) & (n = 11,274) 9771 (86.7) & <0.001 \\
\hline
Mechanical ventilation, n (\%) & (n = 882) 842 (95.5) & (n = 11,609) 9838 (84.7) & (n = 12,491) 10,680 (85.5) & <0.001 \\
\hline
Vasopressors, n (\%) & (n = 882) 828 (93.9) & (n = 11,608) 9005 (77.6) & (n = 12,490) 9833 (78.7) & <0.001 \\
\hline
Nutrition: \\
\hline
Enteral, n (\%) & (n = 882) 678 (76.9) & (n = 11,588) 8369 (72.2) & (n = 12,470) 9047 (72.6) & 0.003 \\
\hline
Parenteral, n (\%) & (n = 882) 383 (43.4) & (n = 11,601) 3726 (32.1) & (n = 12,483) 4109 (32.9) & <0.001 \\
\hline
Heparin: \\
\hline
Low molecular weight & (n = 871) 418 (48.0) & (n = 11,586) 3879 (33.5) & (n = 12,457) 4297 (34.5) & <0.001 \\
\hline
Unfractionated & (n = 868) 345 (39.8) & (n = 11,601) 4628 (39.9) & (n = 12,469) 4973 (39.9) & 0.932 \\
\hline
Steroids: \\
\hline
Low dose & (n = 878) 499 (56.8) & (n = 11,559) 3994 (34.6) & (n = 12,437) 4493 (36.1) & <0.001 \\
\hline
High dose & (n = 880) 156 (17.7) & (n = 11,600) 1397 (12.0) & (n = 12,480) 1553 (12.4) & <0.001 \\
\hline
Mechanical VTE prophylaxis & (n = 765) 295 (38.6) & (n = 10,371) 2407 (23.2) & (n = 11,136) 2702 (24.3) & <0.001 \\
\hline
Renal replacement therapy & (n = 876) 283 (32.3) & (n = 11,598) 2383 (20.6) & (n = 12,474) 2666 (21.4) & <0.001 \\
\hline
Platelet transfusion & (n = 780) 178 (22.8) & (n = 10,483) 1677 (16.0) & (n = 11,263) 1855 (16.5) & <0.001 \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{DrotAA n = 882} & \textbf{Non-DrotAA n = 11,610} & \textbf{Total n = 12,492} & \textbf{P value} \\
\hline
Number of organ dysfunctions (OD): & (n = 703) & (n = 8910) & (n = 9613) & <0.001 \\
\hline
1 & 18 (2.6) & 1042 (11.7) & 1060 (11.0) \\
\hline
2 & 93 (13.2) & 1861 (20.9) & 1954 (20.3) \\
\hline
3 & 169 (24.0) & 2045 (23.0) & 2214 (23.0) \\
\hline
4 & 161 (22.9) & 1778 (20.0) & 1939 (20.2) \\
\hline
5 & 143 (20.3) & 1171 (13.1) & 1314 (13.7) \\
\hline
6 & 87 (12.4) & 677 (7.6) & 764 (8.0) \\
\hline
7 & 32 (4.6) & 336 (3.8) & 368 (3.8) \\
\hline
Type of dysfunction, n (\%): \\
\hline
Cardiovascular & (n = 882) 791 (89.7) & (n = 11,565) 8536 (73.8) & (n = 12,447) 9327 (74.9) & <0.001 \\
\hline
Respiratory & (n = 880) 788 (89.5) & (n = 11,550) 9357 (81.0) & (n = 12,430) 10,145 (81.6) & <0.001 \\
\hline
Hematologic & (n = 879) 314 (35.7) & (n = 11,475) 3773 (32.9) & (n = 12,354) 4087 (33.1) & 0.08 \\
\hline
Renal & (n = 879) 523 (59.5) & (n = 11,480) 5117 (44.6) & (n = 12,359) 5640 (45.6) & <0.001 \\
\hline
Hepatic & (n = 771) 150 (19.5) & (n = 10,188) 2111 (20.7) & (n = 10,959) 2261 (20.6) & 0.40 \\
\hline
Metabolic & (n = 867) 542 (62.5) & (n = 11,266) 4745 (42.1) & (n = 12,133) 5287 (43.6) & <0.001 \\
\hline
Central nervous system & (n = 767) 276 (36.0) & (n = 9987) 3686 (36.9) & (n = 10,754) 3962 (36.8) & 0.61 \\
\hline
APACHE II score, mean ($\pm$ SD) & (n = 610) 25.6 ($\pm$ 8.5) & (n = 8513) 23.2 ($\pm$ 8.2) & (n = 9123) 23.4 ($\pm$ 8.3) & <0.001 \\
\hline
Total SOFA score, mean ($\pm$ SD) & (n = 334) 10.3 ($\pm$ 3.4) & (n = 4785) 9.2 ($\pm$ 3.9) & (n = 5119) 9.3 ($\pm$ 3.9) & <0.001 \\
\hline
Total MODS score, mean ($\pm$ SD) & (n = 171) 8.6 ($\pm$ 3.7) & (n = 2244) 6.4 ($\pm$ 3.6) & (n = 2415) 6.5 ($\pm$ 3.6) & <0.001 \\
\hline
SAPS II score, mean ($\pm$ SD) & (n = 165) 50.2 ($\pm$ 18.5) & (n = 2831) 49.0 ($\pm$ 17.3) & (n = 2996) 49.1 ($\pm$ 17.4) & 0.48 \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{DrotAA n = 882} & \textbf{Non-DrotAA n = 11,610} & \textbf{Total n = 12,492} & \textbf{P value} \\
\hline
Diabetes, n (\%) & (n = 766) 164 (21.4) & (n = 10,352) 2441 (23.6) & (n = 11,118) 2605 (23.4) & 0.17 \\
\hline
Chronic lung disease, n (\%) & (n = 870) 136 (15.6) & (n = 11,447) 1924 (16.8) & (n = 12,317) 2060 (16.7) & 0.37 \\
\hline
Active cancer, n (\%) & (n = 844) 102 (12.1) & (n = 11,101) 1787 (16.1) & (n = 11,945) 1889 (15.8) & 0.002 \\
\hline
Congestive heart failure, n (\%) & (n = 879) 97 (11.0) & (n = 11,460) 1630 (14.2) & (n = 12,339) 1727 (14.0) & 0.009 \\
\hline
Chronic renal insufficiency, n (\%) & (n = 872) 54 (6.2) & (n = 11,481) 1285 (11.2) & (n = 12,353) 1339 (10.8) & <0.001 \\
\hline
Chronic liver disease, n (\%) & (n = 843) 48 (5.7) & (n = 11,142) 727 (6.5) & (n = 11,985) 775 (6.5) & 0.34 \\
\hline
Other, n (\%) & (n = 768) 197 (25.7) & (n = 10,369) 2473 (23.9) & (n = 11,125) 2670 (24.0) & 0.90 \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & & \multicolumn{2}{c|}{\textbf{DrotAA-treated patients}} \\
\hline
\textbf{Country} & \textbf{Number of sites} & \textbf{Enrolled patients, n (\% overall) (n = 12,492)} & \textbf{n, (\% of total DrotAA patients) [Overall rank] (n = 882)} & \textbf{Within-country DrotAA use, \% (DrotAA patients/Total patients) [Rank]} \\
\hline
Germany* & 17 & 1810 (14.5) & 98 (11.1) [3] & 5.4 (98/1810) [11] \\
\hline
Argentina* & 18 & 1269 (10.1) & 22 (2.5) [9] & 1.7 (22/1269) [15] \\
\hline
Canada*† & 12 & 1213 (9.7) & 101 (11.5) [2] & 8.3 (101/1213) [7] \\
\hline
Brazil*† & 9 & 968 (7.7) & 65 (7.4) [4] & 6.7 (65/968) [9] \\
\hline
India* & 21 & 803 (6.4) & 29 (3.3) [8] & 3.6 (29/803) [12] \\
\hline
United States*† & 26 & 760 (6.1) & 206 (23.3) [1] & 27.1 (206/760) [2] \\
\hline
Australia*† & 4 & 667 (5.3) & 53 (6.0) [6] & 7.9 (53/667) [8] \\
\hline
Malaysia* & 4 & 641 (5.1) & 12 (1.4) [11] & 1.9 (12/641) [14] \\
\hline
Philippines* & 10 & 489 (3.9) & 10 (1.1) [12] & 2.0 (10/489) [13] \\
\hline
Mexico*† & 10 & 475 (3.8) & 54 (6.1) [5] & 11.4 (54/475) [6] \\
\hline
Belgium† & 7 & 360 (2.9) & 43 (4.9) [7] & 11.9 (43/360) [5] \\
\hline
Poland† & 10 & 210 (1.7) & 29 (3.3) [8] & 13.8 (29/210) [4] \\
\hline
New Zealand† & 1 & 145 (1.2) & 9 (1.0) [13] & 6.2 (9/145) [10] \\
\hline
Turkey† & 16 & 128 (1.2) & 43 (4.9) [7] & 33.6 (43/128) [1] \\
\hline
Algeria† & 6 & 105 (0.8) & 19 (2.2) [10] & 18.1 (19/105) [3] \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_5 |
|
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Mode l} & \textbf{Hospital Mortality Adjusted by Treatme\textbf{n}t a\textbf{n}d} & \textbf{n} & \textbf{Adjusted R2 Value} & Good\textbf{n}ess of Fit Chi-square & P value for Treatme\textbf{n}t Factor i\textbf{n} Multivariate Model & Odds Ratio, Poi\textbf{n}t Estimate (95\% CI*) & Relative Risk Reductio\textbf{n} \\
\hli\textbf{n}e
1 & Prope\textbf{n}sity Quartiles† & 880 6 & 0.034 & 0.002 & 0.0005 & 0.745 (0.631, 0.879) & 15\% \\
\hli\textbf{n}e
2 & Age, Prope\textbf{n}sity Quartiles & 880 6 & 0.083 & 0.548 & 0.001 & 0.755 (0.638, 0.893) & 14\% \\
\hli\textbf{n}e
3 & Age, 7 OD1 & 893 9 & 0.159 & 0.073 & 0.0056 & 0.788 (0.665, 0.933) & 13\% \\
\hli\textbf{n}e
4 & 7 OD, Prope\textbf{n}sity Quartiles & 880 6 & 0.133 & 0.14 & 0.0002 & 0.722 (0.609, 0.857) & 17\% \\
\hli\textbf{n}e
5 & Age, 7 OD, Prope\textbf{n}sity Quartiles & 880 6 & 0.161 & 0.258 & 0.0005 & 0.735 (0.618, 0.874) & 16\% \\
\hli\textbf{n}e
6 & Age, 7 OD, Vasopressors, Prope\textbf{n}sity Quartiles & 880 6 & 0.190 & 0.178 & 0.0006 & 0.739 (0.622, 0.878) & 16\% \\
\hli\textbf{n}e
7 & Age, 7 OD, Site of I\textbf{n}fectio\textbf{n}, Prope\textbf{n}sity Quartiles & 880 6 & 0.173 & 0.68 & 0.0009 & 0.744 (0.625, 0.866) & 15\% \\
\hli\textbf{n}e
8 & Age, 7 OD, Active Ca\textbf{n}cer Descriptio\textbf{n}, Prope\textbf{n}sity Quartiles & 880 6 & 0.170 & 0.821 & 0.0012 & 0.751 (0.631, 0.893) & 15\% \\
\hli\textbf{n}e
9 & Age, 7 OD, Active Ca\textbf{n}cer, Prope\textbf{n}sity Quartiles & 840 8 & 0.167 & 0.952 & 0.0003 & 0.72 (0.603, 0.860) & 17\% \\
\hli\textbf{n}e
10 & Age, 7 OD, Active Ca\textbf{n}cer, Source of I\textbf{n}fectio\textbf{n}, Prope\textbf{n}sity Quartiles & 814 2 & 0.172 & 0.852 & 0.0002 & 0.712 (0.594, 0.854) & 18\% \\
\hli\textbf{n}e
11 & Age, 7 OD, Active Ca\textbf{n}cer, Source of I\textbf{n}fectio\textbf{n}, Vasopressors, Prope\textbf{n}sity Quartile & 814 2 & 0.200 & 0.131 & 0.0003 & 0.717 (0.598, 0.860) & 18\% \\
\hli\textbf{n}e
12 & Age, 7 OD, Active Ca\textbf{n}cer, Vasopressors, Prope\textbf{n}sity Quartile & 840 8 & 0.197 & 0.278 & 0.0004 & 0.726 (0.607, 0.867) & 18\% \\
\hli\textbf{n}e
13 & APACHE2 II Score, Prope\textbf{n}sity Quartiles & 643 1 & 0.162 & 0.658 & 0.0007 & 0.692 (0.559, 0.856) & 18\% \\
\hli\textbf{n}e
14 & Imputed APACHE II Score, Prope\textbf{n}sity Quartiles & 880 6 & 0.128 & 0.956 & <0.0001 & 0.71 (0.599, 0.843) & 17\% \\
\hli\textbf{n}e
15 & Age, 7 OD, Imputed APACHE II Score, Prope\textbf{n}sity Quartiles & 880 6 & 0.198 & 0.765 & 0.0002 & 0.714 (0.599, 0.851) & 18\% \\
\hli\textbf{n}e
16 & Age, 7 OD, Regio\textbf{n}3, Prope\textbf{n}sity Quartiles & 880 6 & 0.170 & 0.559 & 0.004 & 0.77 (0.644, 0.92) & 14\% \\
\hli\textbf{n}e
17 & Age, 4 OD (\textbf{n}o Cardiologic, Metabolic, Re\textbf{n}al), Mecha\textbf{n}ical Ve\textbf{n}tilatio\textbf{n}, Re\textbf{n}al Replaceme\textbf{n}t Therapy, Platelet Tra\textbf{n}sfusio\textbf{n}, E\textbf{n}teral Nutritio\textbf{n}, Mecha\textbf{n}ical-VTE- Prophylaxis, LMWH, Active Ca\textbf{n}cer, Prope\textbf{n}sity Quartiles & 828 3 & 0.278 & 0.028 & 0.0115 & 0.783 (0.647, 0.947) & 13\% \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table} | PMC2717475_table_6 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{DrotAA n = 882} & \textbf{Non-DrotAA n = 11,610} & \textbf{Total n = 12,492} & \textbf{value P} \\
\hline
Discharge location by DrotAA use, n (\%): & (n = 807) & (n = 10,537) & (n = 11,344) & <0.001 \\
\hline
Died & 400 (49.6) & 5236 (49.7) & 5636 (49.7) \\
\hline
Community & 236 (29.2) & 3652 (34.7) & 3888 (34.3) \\
\hline
Other hospital & 73 (9.0) & 856 (8.1) & 929 (8.2) \\
\hline
Extended/Chronic care Institution & 83 (10.3) & 620 (5.9) & 703 (6.2) \\
\hline
Other/Unknown & 15 (1.9) & 173 (1.6) & 188 (1.7) \\
\hline
Hospital mortality for DrotAA therapy, adjusted for Age, 7 OD*, Active Cancer, and Propensity Quartiles† & Adjusted Odds Ratio & 95\% Confidence Interval & ---- & P value \\
\hline
All patients** & 0.72 & 0.603 – 0.86 & ---- & 0.0003 \\
\hline
\end{tabular}
\end{table} | PMC2717475_table_7 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Virus} & \textbf{Serotypes} \\
\hline
Rhinovirus & > 101 \\
\hline
Influenza & A, B \\
\hline
RSV & A, B & Panel A63B \\
\hline
Metapneumovirus & A, B \\
\hline
Parainfluenza virus & I, II, III \\
\hline
Adenovirus & > 13 serotypes of groups B, C, E \\
\hline
Coronavirus & OC43, 229E, NL63, SARS \\
\hline
Enterovirus & > 34 & Panel C3B \\
\hline
\end{tabular}
\end{table} | PMC2717562_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Acute (n = 70)}} & \multicolumn{2}{c|}{\textbf{Stable (n = 80)}} & \textbf{Value P} \\
\hline
& \textbf{\textbf{No.}} & \textbf{\textbf{\%}} & \textbf{\textbf{No.}} & \textbf{\textbf{\%}} \\
\hline
Gender \\
\hline
Male & 52 & 74.3 & 62 & 77.5 & 0.646 \\
\hline
Female & 18 & 25.7 & 18 & 22.5 \\
\hline
Age (years) \\
\hline
Mean (SD) & 8.0 & (3.5) & 8.8 & (3.2) & 0.171 \\
\hline
Ethnicity \\
\hline
African & 29 & 41.4 & 29 & 36.3 & 0.018 \\
\hline
Asian Indian & 20 & 28.6 & 11 & 13.8 \\
\hline
Mixed (African & Asian Indian) & 21 & 30.0 & 40 & 50.0 \\
\hline
Season specimen was collected \\
\hline
Dry & 21 & 30.0 & 17 & 21.3 & 0.219 \\
\hline
Rainy & 49 & 70.0 & 63 & 78.8 \\
\hline
\end{tabular}
\end{table} | PMC2717562_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Virus} & \multicolumn{2}{c|}{\textbf{Acute (N = 70)}} & \multicolumn{2}{c|}{\textbf{Stable (N = 80)}} \\
\hline
& \textbf{\textbf{No.}} & \textbf{\textbf{\%}} & \textbf{\textbf{No.}} & \textbf{\textbf{\%}} \\
\hline
Total virus (p = 0.018) & 24 & 34.3 & 14 & 17.5 \\
\hline
\textbf{Virus} not present & 46 & 65.7 & 66 & 82.5 \\
\hline
RV (p = 0.005) & 18 & 25.7 & 7 & 8.8 \\
\hline
RV/Total virus & 0.75 & 75.0 & 0.50 & 50.0 \\
\hline
RSVA & 0 & 0.0 & 0 & 0.0 \\
\hline
RSV B & 2 & 2.9 & 4 & 5.0 \\
\hline
Influenza A & 2 & 2.9 & 0 & 0.0 \\
\hline
Influenza B & 0 & 0.0 & 0 & 0.0 \\
\hline
Coronavirus OC43 & 1 & 1.4 & 0 & 0.0 \\
\hline
Coronavirus NL63 & 0 & 0.0 & 1 & 1.3 \\
\hline
Coronavirus 229E & 0 & 0.0 & 0 & 0.0 \\
\hline
Coronavirus SARS & 0 & 0.0 & 0 & 0.0 \\
\hline
EV & 1 & 1.4 & 2 & 2.5 \\
\hline
PIV 1 & 1 & 1.4 & 0 & 0.0 \\
\hline
PIV 2 & 1 & 1.4 & 0 & 0.0 \\
\hline
PIV 3 & 0 & 0.0 & 0 & 0.0 \\
\hline
hMPV & 0 & 0.0 & 1 & 1.3 \\
\hline
Adenovirus & 0 & 0.0 & 0 & 0.0 \\
\hline
Co-infection with 2 viruses & 2 & 2.9 & 1 & 1.3 \\
\hline
-Influenza A & RSV B & 1 & 1.4 & 0 & 0.0 \\
\hline
- Influenza A &RV & 1 & 1.4 & 0 & 0.0 \\
\hline
- RV & RSV B & 0 & 0.0 & 1 & 1.3 \\
\hline
\end{tabular}
\end{table} | PMC2717562_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Patient's Characteristics} \\
\hline
Male/Female ratio & 1:1 \\
\hline
Age (y), median (range) & 4.5 (6.0 mo-10 y) \\
\hline
Total serum IgE at baseline (IU/mL) & 335,93 \\
\hline
Positive Skin Prick Tests to: (n) \\
\hline
Cow's milk & 27 \\
\hline
Ass's milk & 2 \\
\hline
Wheat & 2 \\
\hline
Hen's egg & 7 \\
\hline
Soy & 4 \\
\hline
Pollens & 5 \\
\hline
Dust mite & 7 \\
\hline
Molds & 2 \\
\hline
Pets with fur & 4 \\
\hline
Positive specific IgE to: (n) \\
\hline
alpha-lactalbumin & 21 \\
\hline
beta-lactoglobulin & 17 \\
\hline
casein & 9 \\
\hline
Ass's milk & 2 \\
\hline
\end{tabular}
\end{table} | PMC2717565_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{W (Kg) mean $\pm$ SD} & \textbf{H (cm) mean $\pm$ SD} & \textbf{BMI mean $\pm$ SD (centiles)} \\
\hline
All children \\
\hline
T0 17,3 $\pm$ 9,6 & T0 100,3 $\pm$ 14,9 & T0 16,1 $\pm$ 1,5 (50°) \\
\hline
T1 19,4 $\pm$ 11,6 & T1 105,4 $\pm$ 23,2 & T1 16,0 $\pm$ 2,1 (50°) \\
\hline
p = 0.02 & p < 0.001 & p = ns \\
\hline
Boys \\
\hline
T0 16,9 $\pm$ 6,7 & T0 102,2 $\pm$ 23,7 & T0 15,8 $\pm$ 1,1 (50°) \\
\hline
T1 18,3 $\pm$ 7,2 & T1 106,3 $\pm$ 20,8 & T1 15,6 $\pm$ 0,8 (50°) \\
\hline
p < 0.01 & p = 0.03 & p = ns \\
\hline
Girls \\
\hline
T0 17,9 $\pm$ 13,3 & T0 98,1 $\pm$ 29,0 & T0 16,5 $\pm$ 2,0 (50°) \\
\hline
T1 20,6 $\pm$ 16,4 & T1 104,2 $\pm$ 28,2 & T1 16,6 $\pm$ 3,0 (50°) \\
\hline
p = ns & p < 0.01 & p = ns \\
\hline
\end{tabular}
\end{table} | PMC2717565_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Entry vector type} & \textbf{Compatible Destination vectors} & \textbf{Incompatible Destination vectors} \\
\hline
\multirow{4}{*}{pENTR/pSM2 Series (non-GFP)} & pLenti X1 Series & Seriesb pLenti PGK \\
\hline
pLenti X2 Series & Seriesb pLenti CMV \\
\hline
pLenti CMV GFP & Seriesb pLenti CMV/TO \\
\hline
Seriesa pQCXI RNAi X2 & Seriesb pQCXI CMV/TO \\
\hline
\multirow{4}{*}{pENTR/pSM2(CMV-GFP)} & pLenti X1 Series & Seriesc pLenti X2 \\
\hline
& GFPd pLenti CMV \\
\hline
& Seriesb pQCXI CMV/TO \\
\hline
& Seriesc pQCXI RNAi X2 \\
\hline
\multirow{4}{*}{pENTR/pTER+ pENTR/pSUPER+} & pLenti X1 Series & Seriesb pLenti PGK \\
\hline
pLenti X2 Series & Seriesb pLenti CMV \\
\hline
pLenti CMV GFP & Seriesb pLenti CMV/TO \\
\hline
pQCXI RNAi X2 Series & Seriesb pQCXI CMV/TO \\
\hline
\multirow{6}{*}{pEF-ENTR Series} & pLenti X1 Series & Seriesc pLenti X2 \\
\hline
pLenti CMV GFP & Seriesb pLenti PGK \\
\hline
& Seriesb pLenti CMV \\
\hline
& Seriesb pLenti CMV/TO \\
\hline
& Seriesb pQCXI CMV/TO \\
\hline
& Seriesc pQCXI RNAi X2 \\
\hline
\multirow{4}{*}{pENTR-Fusion Series} & pLenti PGK Series & Seriese pLenti X1 \\
\hline
pLenti CMV Series & Seriesc,e pLenti X2 \\
\hline
pLenti CMV/TO Series & GFPe pLenti CMV \\
\hline
pQCXI CMV/TO Series & pQCXI RNAi X2 Seriesc,e \\
\hline
\end{tabular}
\end{table} | PMC2717805_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Vector} & \textbf{Inducible expression in a T-REx cell line} \\
\hline
pENTR/pSUPER+ & NO \\
\hline
+ pENTR/pTER & YES \\
\hline
pENTR/pSM2(U6) & NO \\
\hline
pENTR/pSM2 (CMV) & NO \\
\hline
pENTR/pSM2 (CMV/TO) & YES \\
\hline
pLenti CMV Series & NO \\
\hline
pLenti CMV/TO Series & YES \\
\hline
pLenti PGK Series & NO \\
\hline
pQCXI CMV/TO Series & YES* \\
\hline
pQCXP & YES \\
\hline
\end{tabular}
\end{table} | PMC2717805_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Vector Series} & \textbf{pSUPER, pTER} & \textbf{pSM2-CMV, CMV/TO} & \textbf{pSM2 CMV-GFP} & \textbf{pEF-Series} \\
\hline
Lenti X2 Blast & 104 & & N/A & N/A \\
\hline
Lenti X2 Hygro & 105 & 104 & N/A & N/A \\
\hline
Lenti X2 Neo & 105 & 105 & N/A & N/A \\
\hline
Lenti X2 Puro & 105 & & N/A & N/A \\
\hline
Lenti X2 Zeo & 105 & & N/A & N/A \\
\hline
Lenti X1 Puro & 105 & 105 & 104 \\
\hline
Lenti X1 Zeo & 105 \\
\hline
Lenti X1 GFP-Zeo & 105 & & N/A \\
\hline
QCXIN X2 & 105 & 103 & N/A & N/A \\
\hline
QCXIP X2 & 105 & & N/A & N/A \\
\hline
\end{tabular}
\end{table} | PMC2717805_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Tag sequence} & \textbf{Number of tags in disease libraries*} & \textbf{Number of tags in normal libraries} & \textbf{Gene} & \textbf{Fold increase from normal} & \textbf{RefSeq accession number} \\
\hline
& & CINIII \\
\hline
GACCCAAGATAAAAGAA & 704 & 16 & PIGR & 22.4 & NM_002644 \\
\hline
ATCCCCCTGGGCATCGG & 52 & 2 & SLC39A3 & 13.2 & NM_144564 \\
\hline
ACTCAGACCAGGTCCCA & 94 & 4 & STRA6 & 11.4 & NM_022369 \\
\hline
ACACAGTATTCGCTCTT & 44 & 2 & ITR & 11.2 & NM_180989 \\
\hline
TTACTTCCCCACCCCTA & 84 & 4 & FADS2 & 10.7 & NM_004265 \\
\hline
GGAACTGTGAAGAGGCA & 230 & 12 & TSPAN1 & 9.7 & NM_005727 \\
\hline
GCACCTGTCGCCCAGTG & 36 & 2 & ANPEP & 9.2 & NM_001150 \\
\hline
CCTGATCTGCGGTGTCC & 308 & 18 & MUC16 & 8.7 & NM_024690 \\
\hline
CGTTTTCTGATAACTCA & 68 & 4 & PTP4A2 & 8.6 & XM_001132367 \\
\hline
CAAATAAATTATGCGAT & 98 & 6 & TMPRSS2 & 8.3 & NM_005656 \\
\hline
TGCTCCTACCCTGCTCT & 2022 & 190 & FCGBP & 5.4 & XM_001131379 \\
\hline
GCAGTGCCACTCAAGAA & 726 & 68 & SRD5A2L & 5.4 & NM_024592 \\
\hline
CCTGGGAAGTGTTGTGG & 730 & 98 & MUC1 & 3.8 & NM_001044391 \\
\hline
AATATTTATATTGTATG & 1880 & 400 & CEACAM5 & 2.4 & NM_004363 \\
\hline
GTTCACATTAGAATAAA & 3424 & 762 & CD74 & 2.3 & NM_001025158 \\
\hline
GGGCATCTCTTGTGTAC & 1602 & 350 & HLA-DRA & 2.3 & NM_019111 \\
\hline
TGCTGCCTGTTGTTATG & 826 & 192 & BST2 & 2.2 & NM_004335 \\
\hline
CTGACCTGTGTTTCCTC & 596 & 144 & HLA-B & 2.1 & NM_005514 \\
\hline
GCAGGGCCTCATCTCAC & 1950 & 484 & FXYD3 & 2.0 & NM_005971 \\
\hline
& & CINI \\
\hline
GCACCTGTCGCCCAGTG & 42 & 2 & ANPEP & 36.5 & NM_001150 \\
\hline
ATGTTAATAAAATAGGC & 66 & 4 & GPC4 & 28.7 & NM_001448 \\
\hline
ATAAATGATTAGACTAC & 32 & 2 & CLIC6 & 27.8 & NM_053277 \\
\hline
GGCCAAGAACTTTCACT & 28 & 2 & C14orf101 & 24.3 & NM_017799 \\
\hline
GACCCAAGATAAAAGAA & 262 & 16 & PIGR & 23.0 & NM_002644 \\
\hline
TAGGTCAGGACCTTGGC & 26 & 2 & PTP4A3 & 22.6 & NM_032611 \\
\hline
GTATATAACTCTTAAAG & 24 & 2 & LOC644410** & 20.8 & XM_001133198 \\
\hline
CCAGCTGCCTGGAGGAG & 22 & 2 & MGC45438 & 19.1 & NM_152459 \\
\hline
ATAAAAATTAGGGGGAT & 22 & 2 & SLC30A1 & 19.1 & NM_021194 \\
\hline
TGAGCTACCCCAGAGTC & 20 & 2 & FER1L4 & 17.4 & NR_001442 \\
\hline
TACATCAGTAAAGAGTT & 374 & 42 & GAS1 & 12.5 & NM_002048 \\
\hline
CATCACGGATCAATAGA & 330 & 64 & IL1R1 & 7.2 & NM_000877 \\
\hline
CCTGGGAAGTGTTGTGG & 334 & 98 & MUC1 & 4.1 & NM_001044391 \\
\hline
TGCAGATTGCAGTTCTG & 366 & 132 & PROM1 & 3.9 & NM_006017 \\
\hline
CACTTCAAGGGCAGCCT & 238 & 102 & LY6E & 3.3 & NM_002346 \\
\hline
GTTCACATTAGAATAAA & 1660 & 762 & CD74 & 3.1 & NM_001025158 \\
\hline
GGGCATCTCTTGTGTAC & 734 & 350 & HLA-DRA & 3.0 & NM_019111 \\
\hline
TGCTCCTACCCTGCTCT & 402 & 190 & FCGBP & 3.0 & XM_001131379 \\
\hline
CTGACCTGTGTTTCCTC & 256 & 144 & HLA-B & 2.5 & NM_005514 \\
\hline
\end{tabular}
\end{table} | PMC2717845_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Trait} & \textbf{Marker*} & \textbf{Beta**} & \textbf{t-value} & \textbf{R2 Adjusted} & \textbf{Signifi cance (P)} \\
\hline
\multirow{5}{*}{TLD} & 825.9 & –0.874 & 5.404 & 0.738 & 0.000 \\
\hline
+835.11 & 0.361 & 3.032 & 0.863 & 0.016 \\
\hline
+825.2 & 0.270 & 3.725 & 0.947 & 0.007 \\
\hline
+811.3 & –0.165 & 3.041 & 0.976 & 0.023 \\
\hline
+807.4 & –0.124 & 4.658 & 0.995 & 0.006 \\
\hline
\multirow{5}{*}{LWT} & 830.8 & –0.933 & 8.957 & 0.859 & 0.000 \\
\hline
+851.1 & –0.374 & 3.649 & 0.930 & 0.004 \\
\hline
+836.4 & 0.196 & 3.834 & 0.969 & 0.003 \\
\hline
+886.13 & –0.127 & 3.528 & 0.986 & 0.006 \\
\hline
+886.6 & –0.097 & 3.943 & 0.994 & 0.004 \\
\hline
\multirow{5}{*}{CWT} & 830.8 & –0.943 & 8.529 & 0.878 & 0.000 \\
\hline
+810.2 & 0.268 & 3.640 & 0.948 & 0.007 \\
\hline
+844.5 & –0.206 & 4.332 & 0.984 & 0.003 \\
\hline
+830.7 & –0.191 & 3.996 & 0.995 & 0.007 \\
\hline
+864.7 & 0.074 & 6.087 & 0.999 & 0.002 \\
\hline
\multirow{5}{*}{SWT} & 830.8 & –0.909 & 6.559 & 0.808 & 0.000 \\
\hline
+834.11 & 0.359 & 3.870 & 0.925 & 0.005 \\
\hline
+886.5 & 0.263 & 4.040 & 0.974 & 0.005 \\
\hline
+885.13 & –0.146 & 3.947 & 0.992 & 0.008 \\
\hline
+818.1 & 0.081 & 3.199 & 0.997 & 0.024 \\
\hline
\multirow{6}{*}{SR} & 830.8 & –0.823 & 4.344 & 0.641 & 0.002 \\
\hline
+834.11 & 0.459 & 3.255 & 0.826 & 0.012 \\
\hline
+884.9 & –0.313 & 3.482 & 0.927 & 0.010 \\
\hline
+826.5 & –0.200 & 3.014 & 0.966 & 0.024 \\
\hline
+811.4 & –0.141 & 4.842 & 0.993 & 0.005 \\
\hline
+827.2 & 0.063 & 4.456 & 0.999 & 0.011 \\
\hline
\multirow{7}{*}{Floss} & 830.8 & 0.812 & 4.818 & 0.631 & 0.000 \\
\hline
+835.5 & 0.449 & 2.893 & 0.771 & 0.015 \\
\hline
+884.1 & –0.471 & 3.861 & 0.899 & 0.003 \\
\hline
+811.3 & –0.276 & 4.515 & 0.966 & 0.001 \\
\hline
+830.11 & –0.150 & 4.545 & 0.989 & 0.002 \\
\hline
+851.3 & –0.074 & 3.772 & 0.996 & 0.007 \\
\hline
+886.4 & 0.049 & 4.282 & 0.999 & 0.005 \\
\hline
\multirow{6}{*}{Silk waste} & 881.4 & –0.769 & 4.168 & 0.557 & 0.001 \\
\hline
+885.7 & 0.443 & 3.108 & 0.743 & 0.010 \\
\hline
+825.6 & –0.403 & 5.359 & 0.927 & 0.000 \\
\hline
+836.15 & –0.245 & 5.033 & 0.979 & 0.001 \\
\hline
+886.6 & 0.147 & 4.578 & 0.993 & 0.002 \\
\hline
+826.3 & 0.068 & 4.185 & 0.998 & 0.004 \\
\hline
\end{tabular}
\end{table} | PMC2717847_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Total (N = 119)}} & \multirow{2}{*}{\textbf{With Data* (N = 78) N (\%)}} & \multirow{2}{*}{\textbf{Without Data* (N = 41) N (\%)}} \\
\hline
\\
\hline
Sex \\
\hline
Male & 64 (53.8) & 44 (56.4) & 20 (48.8) \\
\hline
Female & 55 (46.2) & 34 (43.6) & 21 (51.2) \\
\hline
Race/ethnicity \\
\hline
Hispanic & 25 (21.0) & 16 (20.5) & 9 (22.0) \\
\hline
Black & 62 (52.1) & 43 (55.1) & 19 (46.3) \\
\hline
White/Asian/Other & 4 (3.4) & 2 (2.6) & 2 (4.9) \\
\hline
More than one race & 24 (20.1) & 14 (17.9) & 10 (24.4) \\
\hline
Unknown & 4 (3.4) & 3 (3.9) & 1(2.4) \\
\hline
NICU admissions & 8 (6.7) & 4 (5.3) & 4 (9.8) \\
\hline
Maternal History** \\
\hline
Eczema & 37 (33.0) & 23 (31.9) & 14 (35.0) \\
\hline
Asthma & 59 (53.2) & 40 (55.6) & 19 (48.7) \\
\hline
Hay fever & 51 (46.4) & 34 (48.6) & 17 (42.5) \\
\hline
Paternal History** \\
\hline
Eczema & 22 (17.5) & 13 (21.0) & 3 (8.3) \\
\hline
Asthma & 35 (27.8) & 20 (32.3) & 9 (25.0) \\
\hline
Hay fever & 30 (25.9) & 15 (27.8) & 12 (34.3) \\
\hline
\end{tabular}
\end{table} | PMC2717905_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Total (n = 82)}} & \multirow{2}{*}{\textbf{With Data (N = 52) N (\%)}} & \multirow{2}{*}{\textbf{Without Data (N = 30) N (\%)}} \\
\hline
\\
\hline
Race/ethnicity \\
\hline
Hispanic & 24 (29.6) & 16 (31.4) & 8 (26.7) \\
\hline
Black & 40 (49.4) & 20 (39.2) & 20 (66.7) \\
\hline
White/Asian/Other & 7 (8.6) & 6 (11.8) & 1 (3.3) \\
\hline
More than one race & 10 (12.4) & 9 (17.7) & 1 (3.3) \\
\hline
Atopic disease \\
\hline
Eczema & 30 (37.0) & 19 (37.3) & 11 (36.7) \\
\hline
Asthma* & 48 (60.0) & 26 (51.0) & 22 (75.9) \\
\hline
Hay fever & 39 (49.4) & 27 (55.1) & 12 (40.0) \\
\hline
\multirow{2}{*}{Intake of steroids during pregnancy} & 18 (22.0) & 11 (21.2) & 7 (23.3) \\
\hline
& Mean (SD) \\
\hline
Age & 26.1 (6.7) & 26.9 (7.2) & 24.7 (5.7) \\
\hline
\end{tabular}
\end{table} | PMC2717905_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{Cord Blood}} & \multicolumn{3}{c|}{\textbf{Maternal Peripheral Blood}} \\
\hline
& \textbf{\textbf{N}} & \textbf{\textbf{Median \%}} & \textbf{\textbf{Range}} & \textbf{\textbf{N}} & \textbf{\textbf{Median \%}} & \textbf{\textbf{Range}} & \textbf{Wilcoxon p-value} \\
\hline
CD4+CD25+ & 114 & 6.9 & 0.9–17.7 & 79 & 13.3 & 3.3–38.1 & <0.0001 \\
\hline
CD4+CD25+bright & 114 & 1.4 & 0.2–8.5 & 79 & 1.9 & 0.6–4.5 & 0.002 \\
\hline
CD4+CD25+FOXP3 & 63 & 3.3 & 0.1–7.8 & 78 & 3.1 & 0.5–6.7 & 0.71 \\
\hline
\end{tabular}
\end{table} | PMC2717905_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{c|}{\textbf{Proliferation Index (PI)*}} \\
\hline
& & \multicolumn{2}{c|}{\textbf{CD25+ Undepleted}} & \multicolumn{2}{c|}{\textbf{CD25+ Depleted}} \\
\hline
& \textbf{N} & \textbf{\textbf{Median}} & \textbf{\textbf{Range}} & \textbf{\textbf{Median}} & \textbf{\textbf{Range}} & \textbf{Wilcoxon p-value} \\
\hline
Cord blood & 78 & 101.8 & 5.7–776.7 & 109.9 & 5.4–943.6 & 0.56 \\
\hline
Maternal Peripheral blood & 52 & 216.7 & 1.0–713.8 & 238.3 & 0.7–798.0 & 0.02 \\
\hline
\end{tabular}
\end{table} | PMC2717905_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{lactate+1B} & \textbf{lactate+2B} & \textbf{lactate+3B} \\
\hline
#6 & 0.80\% & 0.36\% & 1.89\% \\
\hline
#7 & 0.00\% & 1.83\% & 4.84\% \\
\hline
#8 & 2.94\% & 0.16\% & 3.31\% \\
\hline
#9 & 0.00\% & 4.11\% & 3.47\% \\
\hline
#10 & 2.01\% & 1.00\% & 6.37\% \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Compound} & \multicolumn{2}{c|}{\textbf{\% [U-13C]-AlaA}} & \multicolumn{2}{c|}{\textbf{\% [U-13C]-LactateA}} & \multicolumn{2}{c|}{\textbf{\% [U-13C]-GlucoseA}} & \multicolumn{2}{c|}{\textbf{\% [13C-2]-GluA}} \\
\hline
& \textbf{\textbf{\textbf{\textbf{Non-cancerous}}}} & \textbf{\textbf{\textbf{\textbf{Cancer}}}} & \textbf{\textbf{\textbf{\textbf{Non-cancerous}}}} & \textbf{\textbf{\textbf{\textbf{Cancer}}}} & \textbf{\textbf{\textbf{\textbf{Non-cancerous}}}} & \textbf{\textbf{\textbf{\textbf{Cancer}}}} & \textbf{\textbf{\textbf{\textbf{Non-cancerous}}}} & \textbf{\textbf{\textbf{\textbf{Cancer}}}} \\
\hline
\textbf{Mean} & \textbf{1.8} & \textbf{9.1} & \textbf{8.6} & \textbf{15.1} & \textbf{15.5} & \textbf{NDB} & \textbf{5.4} & \textbf{8.3} \\
\hline
SDC & 0.9 & 4.9 & 4.6 & \textbf{5.4} & 2.3 & - & 1.1 & 1.9 \\
\hline
p valueD & \multicolumn{2}{c|}{0.009} & \multicolumn{2}{c|}{0.02} & \multicolumn{2}{c|}{-} & \multicolumn{2}{c|}{0.012} \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}ompound} & \multicolumn{2}{c|}{\textbf{#6 sq\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B}, grade II}} & \multicolumn{2}{c|}{\textbf{#7 adeno\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B}, grade II}} & \multicolumn{2}{c|}{\textbf{#8 sq\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B}, grade II-III}} & \multicolumn{2}{c|}{\textbf{#9 sq\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B}, grade II}} & \multicolumn{2}{c|}{\textbf{#10 sq\textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B}, grade III}} \\
\hline
& \textbf{\textbf{\textbf{\textbf{\textbf{N}}}}B} & \textbf{\textbf{\textbf{\textbf{\textbf{C}}}}B} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{C}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{C}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{C}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{C}}}} \\
\hline
Total Ala & 4.67 & 15.76 & 6.25 & 6.44 & 4.97 & 9.28 & 5.14 & 15.08 & 5.42 & 27.34 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Ala\textbf{\textbf{\textbf{\textbf{C}}}} & 0.03 & 0.28 & 0.15 & 0.34 & 0.09 & 0.57 & 0.21 & 0.79 & 0.29 & 1.60 \\
\hline
Total Asp & 1.32 & 4.27 & 3.83 & 3.09 & 2.67 & 1.51 & 1.94 & 4.78 & 2.27 & 1.66 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Asp\textbf{\textbf{\textbf{\textbf{C}}}} & 0.18 & 0.59 & 0.36 & 0.44 & 0.35 & 0.24 & 0.21 & 0.82 & 0.36 & 0.31 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}3-Asp\textbf{\textbf{\textbf{\textbf{C}}}}, D & < 0.004 (< 0.3\%) & 0.058 (1.4\%) & 0.009 (0.2\%) & 0.005 (0.16\%) & 0.006 (0.2\%) & 0.009 (0.6\%) & < 0.004 (< 0.2\%) & 0.024 (0.5\%) & 0.004 (0.17\%) & 0.020 (1.2\%) \\
\hline
Total \textbf{\textbf{\textbf{\textbf{C}}}}itB & 0.60 & 1.32 & 1.21 & 1.18 & 1.28 & 1.56 & 0.77 & 1.53 & 0.74 & 1.37 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-\textbf{\textbf{\textbf{\textbf{C}}}}itB, \textbf{\textbf{\textbf{\textbf{C}}}} & 0.03 & 0.10 & 0.02 & 0.05 & 0.08 & 0.12 & 0.03 & 0.11 & < 0.004 & 0.12 \\
\hline
Total Glu & 0.24 & 4.80 & 2.96 & 2.97 & 1.88 & 3.25 & 1.91 & 4.78 & 1.82 & 3.28 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Glu\textbf{\textbf{\textbf{\textbf{C}}}} & 0.03 & 0.16 & < 0.004 & < 0.004 & < 0.004 & 0.22 & < 0.004 & 0.36 & 0.10 & 0.36 \\
\hline
Total Gln & 0.56 & 7.68 & 1.41 & 1.02 & 0.64 & 1.32 & 0.74 & 2.71 & 0.79 & 2.99 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Gln\textbf{\textbf{\textbf{\textbf{C}}}} & 0.07 & 0.34 & 0.07 & 0.00 & 0.04 & 0.00 & 0.00 & 0.21 & 0.00 & 0.04 \\
\hline
Total LacB & 2.66 & 29.55 & 11.80 & 10.62 & 9.44 & 17.72 & 19.52 & 25.31 & 8.27 & 29.67 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Lac\textbf{\textbf{\textbf{\textbf{C}}}} & < 0.004 & 0.66 & 0.19 & 0.63 & 0.19 & 0.88 & < 0.004 & 1.44 & 0.03 & 0.94 \\
\hline
Total SuccB & 0.17 & 1.34 & 0.50 & 0.70 & 0.89 & 1.84 & 0.64 & 1.59 & 1.14 & 3.13 \\
\hline
13\textbf{\textbf{\textbf{\textbf{C}}}}-Succ\textbf{\textbf{\textbf{\textbf{C}}}} & 0.02 & 0.08 & 0.01 & 0.03 & 0.03 & 0.11 & 0.08 & 0.14 & 0.06 & 0.19 \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{R2}} \\
\hline
\textbf{PlotsB} & \textbf{Non-cancerous} & \textbf{Cancer} \\
\hline
[Ala] versus [succinate] & 0.025 & 0.761 \\
\hline
[13C-Ala] versus [13C-succinate] & 0.483 & 0.792 \\
\hline
[lactate] versus [succinate] & 0.056 & 0.395 \\
\hline
[13C-lactate] versus [13C-succinate] & 0.412 & 0.374 \\
\hline
[Glu] versus [succinate] & 0.018 & 0.343 \\
\hline
[13C-Glu] versus [13C-succinate] & 0.072 & 0.912 \\
\hline
[citrate] versus [succinate] & 0.061 & 0.133 \\
\hline
[13C-citrate] versus [13C-succinate] & 0.069 & 0.789 \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{7}{c|}{\textbf{Fold ChangeA}} \\
\hline
\textbf{GenesB} & \textbf{PC} & \textbf{GLS} & \textbf{IDH3} & \textbf{OGDH} & \textbf{SDH} & \textbf{FH} & \textbf{MDH2} \\
\hline
AverageC & 3.36 & 0.52 & 0.67 & 0.58 & 0.93 & 1.01 & 1.53 \\
\hline
SD & 1.13 & 0.16 & 0.13 & 0.09 & 0.19 & 0.23 & 0.29 \\
\hline
p-valueD & 0.03 & 0.04 & 0.05 & 0.01 & 0.24 & 0.31 & 0.04 \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene/accession no} & \textbf{Forward sequence} & \textbf{Reverse sequence} \\
\hline
FH/NM_000143.2 & TCTGGTCCTCGGTCAGGTCTG & GACAGTGACAGCAACATGGTTCC \\
\hline
GLS/NM_014905 & GCACAGACATGGTTGGTATATTAG & AGAAGTCATACATGCCACAGG \\
\hline
IDH3/NM_005530.2 & CAACTGCCCCTTCTCCTATCCC & AGCCCAAGCCTAAGCCCAAG \\
\hline
MDH2/NM_005918.2 & CGGAGGTGGTCAAGGCTAAAG & CAGCGGTGTGGAGAAGTAGG \\
\hline
OGDH/NM_002541.2 & GTGAGAATGGCGTGGACTAC & CGATTGATCCTGCGGTGATAC \\
\hline
PC/NM_022172 & GCGTGTTTGACTACAGTGAG & TCTTGACCTCCTTGAACTTG \\
\hline
SDH/NM_004168.2 & CATCGCATAAGAGCAAAGAAC & CCTTCCGTAATGAGACAACC \\
\hline
18S/NR_003286 & ATCAGATACCGTCGTAGTTCC & CCGTCAATT CCTTTAAGTTTCAG \\
\hline
\end{tabular}
\end{table} | PMC2717907_table_5 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Patient} & \textbf{Tissuea} & \textbf{Env clone} & \textbf{MDM entryb} & \textbf{b12 IC50c} & \textbf{b6 IC50c} & \textbf{sCD4 IC50c} & \textbf{PS IC50c} \\
\hline
\multirow{4}{*}{MACS2} & FL & 8–12 & 35478 & 3.37 & > 20 & 1.03 & 80.9 \\
\hline
& 9–15 & 1765 & 1.15 & > 20 & 0.22 & 76.4 \\
\hline
LN & 10–15 & 13001 & 0.99 & > 20 & > 20 & < 50 \\
\hline
SP & 6–18 & 59224 & 10.89 & > 20 & > 20 & < 50 \\
\hline
\multirow{4}{*}{MACS3} & FL & 12–27 & 13810 & > 20 & 1.87 & 1.10 & < 50 \\
\hline
& 5 & 3402 & > 20 & 6.78 & 0.40 & < 50 \\
\hline
LN & 2 & 1957 & > 20 & > 20 & 3.22 & < 50 \\
\hline
& 20 & 16658 & > 20 & > 20 & > 20 & < 50 \\
\hline
\multirow{3}{*}{UK1} & FL & 2–13b & 4378 & 0.05 & > 20 & 5.44 & < 50 \\
\hline
SP & 6–20 & 812689 & 0.03 & > 20 & 2.39 & 124.2 \\
\hline
& 20 & 35723 & 0.03 & > 20 & 0.27 & 230.2 \\
\hline
\multirow{4}{*}{UK7} & FL & 6–24 & 9659 & 5.53 & > 20 & 7.68 & 145 \\
\hline
& 1–4 & 13207 & 11.37 & > 20 & > 20 & 128 \\
\hline
isolate & br34 & 496588 & 0.26 & > 20 & 0.45 & 332.2 \\
\hline
LN & 7–6 & 5260 & 5.55 & > 20 & > 20 & < 50 \\
\hline
\multirow{4}{*}{controls} & & YU2 & 38052 & 5.47 & > 20 & 1.14 & 72.4 \\
\hline
& YU2 N386D & 114755 & 2.79 & > 20 & 0.45 & 115.2 \\
\hline
& JRFL & 215305 & 0.18 & > 20 & 3.72 & 107.3 \\
\hline
& JRFL N386D & 320642 & 0.09 & > 20 & 6.05 & 92.7 \\
\hline
\end{tabular}
\end{table} | PMC2717910_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Stain} & \textbf{Stock solution} & \textbf{Stain}ing procedure \\
\hline
\multirow{5}{*}{PTA} & 1\% (w/v) phosphotungstic acid in water & Mix 30 ml 1\% PTA solution + 70 ml absolute ethanol to make 0.3\% PTA in 70\% ethanol. Keeps indefinitely. \\
\hline
& Take samples to 70\% ethanol. \\
\hline
& \textbf{Stain} overnight or longer. \\
\hline
& Change to 70\% ethanol. \textbf{Stain}ing is stable for months. \\
\hline
& Scan samples in 70\% – 100\% ethanol \\
\hline
\multirow{5}{*}{IKI} & 1\% iodine metal (I2) + 2\% potassium iodide (KI) in water & Dilute to 10\% in water just before use. \\
\hline
& Rinse samples in water. \\
\hline
& \textbf{Stain} overnight. \\
\hline
& Wash in water. \\
\hline
& Can be scanned in water or dehydrated to alcohol. \\
\hline
\multirow{5}{*}{I2E, I2M} & 1\% iodine metal (I2) dissolved in 100\% ethanol (I2E) or methanol (I2M) & Use at full concentration or dilute in absolute alcohol. \\
\hline
& Take samples to 100\% alcohol. \\
\hline
& \textbf{Stain} overnight or longer. \\
\hline
& Wash in alcohol. \\
\hline
& \textbf{Stain} does not need to be completely washed out before scanning. \\
\hline
\multirow{2}{*}{Osmium tetroxide} & standard EM post-fixation & Same as routine EM processing. \\
\hline
& Osmium-stained samples can be scanned in resin blocks, with some loss of contrast. \\
\hline
\end{tabular}
\end{table} | PMC2717911_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Fixative} & \textbf{Notes} \\
\hline
\multirow{4}{*}{neutral-buffered formalin (10\% NBF)} & Formalin = 37\% formaldehyde solution (aq.). \\
\hline
Normally used at 10\% dilution in phosphate buffer at pH 7.0 \\
\hline
Commercial formalin usually contains about 10\% methanol. \\
\hline
The most common, but rarely the best fixative. [23,24] \\
\hline
\multirow{2}{*}{paraformaldehyde} & Polymerized formaldehyde, usually dissolved in buffer (e.g. PBS) at 4\% w/v when a chemically-controlled fixative is required. \\
\hline
Action is generally similar to 10\% NBF. [23,24] \\
\hline
gluteraldehyde & Strong cross-linking fixative, often prepared in cacodylate buffer or a less toxic alternative such as HEPES. Common fixative for electron microscopy. [23,24] \\
\hline
\multirow{2}{*}{4F1G} & 4\% (or 3.7\%) formaldehyde + 1\% gluteraldehyde in phosphate buffer. \\
\hline
Takes advantage of the faster penetration of formaldehyde and the superior fixing action of gluteraldehyde. Common fixation for electron microscopy. [25] \\
\hline
\multirow{4}{*}{Bouin's fluid} & 75 parts (v/v) saturated aqueous picric acid, \\
\hline
25 parts formalin (37\% formaldehyde), \\
\hline
5 parts glacial acetic acid. \\
\hline
A standard and excellent histological fixative. [24] \\
\hline
\multirow{2}{*}{alcoholic Bouin's} & Refers to either a mixture of Bouin's fluid and ethanol (1:1), or to the fixative also known as Bouin-Duboscq- Brasil [24]. The two are similar in final composition. \\
\hline
The alcoholic solutions penetrate more readily and are sometimes favored for arthropods. \\
\hline
\multirow{3}{*}{glyoxal} & A cross-linking dialdehyde (OCHCHO) prepared in acidic buffers and marketed as formalin substitutes: Prefer (Anatech Ltd.; http://www.anatechltdusa.com) and Shandon Glyo-Fixx (Thermo Scientific; http:// www.thermo.com). \\
\hline
Much less volatile and toxic than formaldehyde. \\
\hline
Very good tissue preservation; especially good for immunostaining. \\
\hline
\multirow{2}{*}{Dent's fixative} & 80\% methanol, 20\% DMSO \\
\hline
Rapid dehydrating fixative. Expect some tissue shrinkage. Often used for immunostaining. \\
\hline
\multirow{2}{*}{hot alcohol} & Samples are dropped into 70\% ethanol at about 60°C. \\
\hline
Mainly used for fixing soft-bodied animals, such as insect larvae and pupae. \\
\hline
\end{tabular}
\end{table} | PMC2717911_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Employment rights} & \multicolumn{5}{c|}{\textbf{Category of employment}} \\
\hline
& \multicolumn{4}{c|}{\textbf{Non-permanent worker}} & \textbf{Permanent worker} \\
\hline
& \textbf{Political appointment} & \textbf{Temporary contract} & \textbf{Subcontract} & \textbf{Trainee} & \textbf{Municipal Health Secretariat of the City of Belo Horizonte (SMSA-BH)} \\
\hline
Entry & Nomination & Application & Application & Selection & Public competitive examination \\
\hline
Working week & 40 hours exclusive contract. & 40 hours per week & 44 hours & 20 hours (trainee) 30 hours (subcontractor) & 20 hours or more \\
\hline
Holidays & 25 working days & 20 days every 12 months (when less than 3 absences during the period) & 30 calendar days & Not specified & 25 working days \\
\hline
13th Salary & 1/12 year worked & 1/12 year worked & 1/12 year worked & Not specified & 1/12 year worked \\
\hline
Sick leave & Time necessary for recuperation & Maximum of 2 days per month & Time necessary for recuperation & Not specified & Time necessary for recuperation \\
\hline
Validity of contract or competitive examination & Duration of political mandate & 6 months, renewable 4 times & Indefinite & 6 months to 2 years (trainee) Indefinite (subcontractor) & Permanent after 730 days worked. \\
\hline
Prior Notice & Not specified & 15 calendar days & 30 calendar days & Not specified & 30 calendar days \\
\hline
Increase & According to Public Service increments & Not specified & Collective negotiations & Not specified & Collective negotiations \\
\hline
\end{tabular}
\end{table} | PMC2717912_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Political appointees} & \textbf{Permanent workers} \\
\hline
Leave & Leave \\
\hline
Maternity & Maternity \\
\hline
Adoption & Adoption \\
\hline
Infant feeding & Infant feeding \\
\hline
Paternity & Paternity \\
\hline
Taking care of sick family member & Taking care of sick family member \\
\hline
\multirow{6}{*}{Accident at work} & Accident at work \\
\hline
Taking care of spouse or partner \\
\hline
Military service \\
\hline
Election candidate \\
\hline
Personal business \\
\hline
Professional training \\
\hline
Entitlement & Entitlement \\
\hline
\multirow{8}{*}{None} & Retirement \\
\hline
Good attendance bonus \\
\hline
Five-year length of service bonus \\
\hline
Special workday for students \\
\hline
Shorter workday to take care of dependent with special needs \\
\hline
Transport voucher \\
\hline
Meal voucher \\
\hline
Time allowance for decease/death of relatives; blood donation, jury, military or administrative service; marriage; force majeure; voter registration or military conscription process and designated off-duty periods – compensation for hours worked in special cases. \\
\hline
\end{tabular}
\end{table} | PMC2717912_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Year} & \textbf{Ratio of permanent to non-permanent workers} \\
\hline
2002 & 5.49:1 \\
\hline
2003 & 3.02:1 \\
\hline
2004 & 2.35:1 \\
\hline
2005 & 2.04:1 \\
\hline
2006 & 1,48:1 \\
\hline
\end{tabular}
\end{table} | PMC2717912_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{RNAeasy} & \textbf{Trizol} \\
\hline
8.1 & 7.3 \\
\hline
8.8 & 7.4 \\
\hline
8.2 & 6.7 \\
\hline
\end{tabular}
\end{table} | PMC2717914_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{minus 70°C} & \textbf{Boonfix} & \textbf{B-RLT} & \textbf{RNAlater} \\
\hline
\multirow{3}{*}{True cut (dry)} & 7.9 & 7.0 & 8.7 & 9.2 \\
\hline
8.7 & 7.3 & 8.6 & 8.5 \\
\hline
8.4 & 7.2 & 8.2 & 8.6 \\
\hline
\multirow{3}{*}{Blind biopsy (NaCl)} & 8.1 & 8.1 & 9.1 & 9.1 \\
\hline
9.1 & 7.4 & 9.3 & 9.2 \\
\hline
9.0 & 7.1 & 9.0 & 8.5 \\
\hline
\end{tabular}
\end{table} | PMC2717914_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Mean score (SD)} \\
\hline
Overall QoL and general health perceptions & 2.9 (0.8) \\
\hline
Physical & 13.3 (3.2) \\
\hline
Psychological & 13.7 (2.3) \\
\hline
Independence & 14.5 (3.2) \\
\hline
Social relationships & 13.9 (2.6) \\
\hline
Environment & 12.3 (2.1) \\
\hline
Spiritual & 12.8 (2.9) \\
\hline
\end{tabular}
\end{table} | PMC2717916_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{INPUT FACTORS (controlled on-line)}} & \multicolumn{5}{c|}{\textbf{MEASURABLE OUTPUT (measured offline)}} \\
\hline
\textbf{T (°C)} & \textbf{pH} & \textbf{DO (\%)} & \textbf{OD595} & \textbf{RFU (mL-1)} & Specific RFU (mL-1 \textbf{OD595}-1) & Specific yield (ng mL-1 \textbf{OD595}-1) & SD; n = 3 (ng mL-1 \textbf{OD595}-1) \\
\hline
19 & 6 & 60 & 20.3 & 8651 & 426.2 & 127.9 & 3.2 \\
\hline
19 & 8 & 60 & 0.8 & 1015 & 1268.8 & 380.6 & 3.9 \\
\hline
19 & 7 & 30 & 13.1 & 10984 & 838.5 & 251.6 & 1.3 \\
\hline
19 & 7 & 90 & 12.4 & 9259 & 746.7 & 224.0 & 2.1 \\
\hline
24 & 6 & 30 & 24.4 & 8061 & 330.4 & 99.1 & 1.6 \\
\hline
24 & 6 & 90 & 16.2 & 11951 & 737.7 & 221.3 & 5.6 \\
\hline
24 & 8 & 30 & 4.7 & 1564 & 332.8 & 99.8 & 1.1 \\
\hline
24 & 8 & 90 & 1.3 & 1954 & 1503.1 & 450.9 & 1.3 \\
\hline
24 & 7 & 60 & 17.6 & 21382 & 1214.9 & 364.5 & 10.1 \\
\hline
29 & 7 & 30 & 24.8 & 25392 & 1023.9 & 307.2 & 0.2 \\
\hline
29 & 8 & 60 & 4.4 & 1413 & 321.1 & 96.3 & 1.5 \\
\hline
29 & 6 & 60 & 21.7 & 10349 & 476.9 & 143.1 & 0.3 \\
\hline
29 & 7 & 90 & 15.1 & 17495 & 1158.6 & 347.6 & 3.5 \\
\hline
\end{tabular}
\end{table} | PMC2717918_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Source} & \textbf{Degrees of Freedom} & \textbf{Sum of Squares} & \textbf{Mean Square} & \textbf{F statistic} & \textbf{p value} \\
\hline
Regression & 6 & 1288405 & 214734 & 1.96 & 0.217 \\
\hline
Linear & 3 & 586988 & 223083 & 2.04 & 0.21 \\
\hline
Square & 1 & 326196 & 326196 & 2.98 & 0.135 \\
\hline
Interaction & 2 & 375221 & 187610 & 1.71 & 0.258 \\
\hline
Residual & 6 & 657203 & 109534 \\
\hline
Total & 12 & 1945608 \\
\hline
\end{tabular}
\end{table} | PMC2717918_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{T(°C)} & \textbf{pH} & \textbf{DO(\%)} \\
\hline
20 & 7.5 & 60 \\
\hline
20 & 7.7 & 80 \\
\hline
27 & 8 & 50 \\
\hline
28 & 7.5 & 90 \\
\hline
28 & 6 & 80 \\
\hline
23.6 & 7.25 & 60 \\
\hline
27.5 & 6.7 & 80 \\
\hline
27.5 & 6.5 & 60 \\
\hline
27.5 & 6.3 & 60 \\
\hline
21.5 & 7.6 & 20 \\
\hline
21.5 & 7.6 & 40 \\
\hline
21.5 & 7.6 & 60 \\
\hline
\end{tabular}
\end{table} | PMC2717918_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Time (min)} & \textbf{T (°C)} & \textbf{pH} & \textbf{DO (\%)} \\
\hline
0 & 30 & 6 & 30 \\
\hline
15 & 28 & 6.4 & 45 \\
\hline
30 & 25 & 6.8 & 60 \\
\hline
45 & 23 & 7.2 & 75 \\
\hline
60 & 21.5 & 7.6 & 90 \\
\hline
75 & 21.5 & 7.6 & 90 \\
\hline
\end{tabular}
\end{table} | PMC2717918_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{No. (sample code) (bleeding date)} & \textbf{PR3-ANCA (U/ml)} & \textbf{MPO-ANCA (U/ml)} \\
\hline
1. (Q9-40) (5/9/1996) & 29.2 & < 1.3 \\
\hline
(R9-10) (9/27/1996) & 19.1 & < 1.3 \\
\hline
(S9-31) (11/21/1996) & 10.7 & < 1.3 \\
\hline
2. (R9-7) (9/27/1996) & 3.8 & < 1.3 \\
\hline
(S9-29) (11/19/1996) & 3.5 & < 1.3 \\
\hline
3. (S9-32) (11/21/1996) & 18.8 & < 1.3 \\
\hline
4. (D10-41) (4/4/2000) & 14.0 & < 1.3 \\
\hline
5. (M10-24) (2/3/2004) & < 1.3 & < 1.3 \\
\hline
6. (M10-28) (2/3/2004) & < 1.3 & < 1.3 \\
\hline
7. (G10-37) (5/15/2002) & < 1.3 & < 1.3 \\
\hline
8. (H10-51) (9/2/2002) & < 1.3 & < 1.3 \\
\hline
\end{tabular}
\end{table} | PMC2717921_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Patient without palsy (n = 56)} & \textbf{Patient with Palsy (n = 18)} \\
\hline
Sex (M/F) & 36/20 & 12/6 \\
\hline
Mean age at surgery (years) & 60.63 & 61.61 \\
\hline
Duration of symptom before operation (months) & 12.42 & 15.06 \\
\hline
Disease etiology (\%) \\
\hline
- CSM & 40 (71.4) & 12 (66.7) \\
\hline
- OPLL & 11 (19.6) & 5 (27.8) \\
\hline
- PID & 5 (8.9) & 1 (5.6) \\
\hline
Type of operation (\%) \\
\hline
- Laminoplasty & 53 (94.6) & 15 (83.3) \\
\hline
- Posterior decompression with internal fixation & 3 (5.4) & 3 (16.7) \\
\hline
Extent of decompression (\%) \\
\hline
- C2–C7 & 1 (1.8) & 0 (0) \\
\hline
- C3–C7 & 25 (44.6) & 9 (50) \\
\hline
- C3–C6 & 21 (37.5) & 8 (44.4) \\
\hline
- C3–C5 & 4 (7.1) & 0 (0) \\
\hline
- C4–C7 & 3 (5.4) & 0 (0) \\
\hline
- C4–C6 & 2 (3.6) & 1 (5.6) \\
\hline
Mean Preoperative JOA score & 10.55 & 11.22 \\
\hline
Mean Postoperative JOA score & 13.66 & 14.22 \\
\hline
Recovery rate (\%) & 52.37 & 48.34 \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{JOA SCORE} \\
\hline
\multirow{5}{*}{I. Motor function of the upper extremity} & 0. Impossible to eat with chopsticks or spoon \\
\hline
1. Possible to ear with spoon, but not with chopsticks \\
\hline
2. Possible to eat with chopsticks, but inadequate \\
\hline
3. Possible to eat with chopsticks, but awkward \\
\hline
4. Normal \\
\hline
\multirow{5}{*}{II. Motor function of the lower extremity} & 0. Impossible to walk \\
\hline
1. Needs cane or aid on flat ground \\
\hline
2. Needs cane or aid only on stairs \\
\hline
3. Possible to walk without cane or aid but slowly \\
\hline
4. Normal \\
\hline
\multirow{6}{*}{III. Sensory function} & A. Upper extremity \\
\hline
0. Apparent sensory loss \\
\hline
1. Minimal sensory loss \\
\hline
2. Normal \\
\hline
B. Lower extremity (same as A) \\
\hline
Trunk (same as A) \\
\hline
\multirow{4}{*}{IV. Bladder function} & 0. Complete retention \\
\hline
1. Severe disturbance (sense of retention, dribbling, incomplete continence) \\
\hline
2. Mild disturbance (urinary frequency, urinary hesitancy) \\
\hline
3. Normal \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Case no.} & \textbf{Age (yr)/Sex} & \textbf{Etiology} & \multicolumn{3}{c|}{\textbf{Presentation}} & \textbf{Onset (days)} & \textbf{Duration of recovery (days)} & \textbf{Laterality} & \textbf{Level of involvement} & \textbf{HIA on preop. MRI} \\
\hline
& & & \textbf{Dysesthesia} & \textbf{Sensory deficit} & \textbf{Motor deficit (MMT)} \\
\hline
1 & 72/M & CSM & Yes & No & No & 5 & 2 & Left & C5 & - \\
\hline
2 & 80/M & CSM & Yes & No & Yes (4 to -3) & 7 & 42 & Left & C5 & C3/4, C6/7 \\
\hline
3 & 71/F & CSM & Yes & No & Yes (5 to 4) & 2 & 42 & Bilateral & C5, C8 & C5 \\
\hline
4 & 54/F & CSM & Yes & No & No & 1 & 8 & Left & C5 & C6/7 \\
\hline
5 & 50/M & OPLL & Yes & Yes & Yes (5 to 3) & 1 & 31 & Right & C6, C7 & C3/4 \\
\hline
6 & 74/M & CSM & Yes & No & No & 3 & 95 & Right & C5 & C3/4, C5/6 \\
\hline
7 & 51/M & CSM & Yes & No & Yes (5 to 4) & 4 & 5 & Right & C5–7 & C4/5 \\
\hline
8 & 50/M & PID & Yes & No & No & 3 & 1 & Right & C5 & C3–5 \\
\hline
9 & 54/M & CSM & Yes & No & No & 6 & 1 & Right & C5 & - \\
\hline
10 & 78/M & CSM & Yes & No & Yes (4 to -3) & 1 & 21 & Bilateral & C5–6 & C5/6 \\
\hline
11 & 49/F & OPLL & Yes & No & No & 2 & 2 & Left & C5 & - \\
\hline
12 & 68/F & OPLL & Yes & Yes & Yes (5-4) & 1 & 182 & Bilateral & C5, C8, T1 & - \\
\hline
13 & 61/F & OPLL & Yes & No & No & 1 & 15 & Left & C5 & C4/5 \\
\hline
14 & 49/M & CSM & Yes & No & No & 1 & 27 & Bilateral & C5 & - \\
\hline
15 & 59/F & OPLL & Yes & No & No & 1 & 11 & Bilateral & C5 & - \\
\hline
16 & 84/M & CSM & No & No & Yes (4-3) & 4 & 15 & Left & C5–7 & C3/4, C6/7 \\
\hline
17 & 60/M & CSM & Yes & No & No & 2 & 5 & Right & C5 & C4/5, C5–6 \\
\hline
18 & 45/M & CSM & Yes & No & Yes (5-0) & 1 & 120 & Bilateral & C5-T1 & C3/4, C6/7 \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{\textbf{P}ure dysesthesia (n = 10)} & \textbf{Dysesthesia with motor deficit (n = 8)} & \textbf{P} \\
\hline
Mean age (years) & 58.2 & 65.9 & 0.199 \\
\hline
Mean recovery time (days) & 16.7 & 57.3 & 0.082 \\
\hline
Sex (M/F) & 6:4 & 6:2 & 0.502 \\
\hline
HIA in T2-weighted MRI (\%) & 5 (50) & 7 (87.5) & 0.152 \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{\textbf{P}atient without palsy (n = 56)} & \textbf{\textbf{P}atient with palsy (n = 18)} & \textbf{P} \\
\hline
\textbf{P}avlov ratio (mean) \\
\hline
C3 & 0.7125 & 0.6916 & 0.363 \\
\hline
C4 & 0.6870 & 0.6701 & 0.495 \\
\hline
C5 & 0.6836 & 0.6805 & 0.890 \\
\hline
C6 & 0.7198 & 0.6783 & 0.058 \\
\hline
Average & 0.7017 & 0.6804 & 0.271 \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Patient without \textbf{p}alsy (n = 56)} & \textbf{Patient with \textbf{p}alsy (n = 18)} & \textbf{OR} & \textbf{p} \\
\hline
Average Pavlov ratio < 0.65 & 10 (17.9) & 8 (44.4) & 3.68 & 0.027 \\
\hline
Level of com\textbf{p}ression in Preo\textbf{p}erative MRI (\%) \\
\hline
C2/3 (\%) & 3 (5.4) & 1 (5.6) & 1.039 & 0.974 \\
\hline
C3/4 (\%) & 32 (57.1) & 16 (88.9) & 6 & 0.025 \\
\hline
C4/5 (\%) & 40 (71.4) & 16 (88.9) & 3.2 & 0.149 \\
\hline
C5/6 (\%) & 42 (75.0) & 10 (55.6) & 0.417 & 0.122 \\
\hline
C6/7 (\%) & 25 (44.6) & 10 (55.6) & 1.55 & 0.421 \\
\hline
C7/T1 (\%) & 1 (1.8) & 0 (0) \\
\hline
3 or more com\textbf{p}ression levels in MRI (\%) & 27 (48.2) & 13 (72.2) & 2.79 & 0.082 \\
\hline
HIA in T2 weighted MRI image (\%) & 44 (78.6) & 11 (61.1) & 0.955 & 0.943 \\
\hline
\end{tabular}
\end{table} | PMC2717922_table_5 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{High expressing (LA/LA)} & \textbf{Intermediate expressing (LA/SA)} & \textbf{Low expressing (SA/SA and LG/SA)} \\
\hline
Male & 4 & 3 & 5 \\
\hline
Female & 8 & 14 & 9 \\
\hline
Total & 12 & 17 & 14 \\
\hline
\end{tabular}
\end{table} | PMC2717925_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Exercisers n = 52} & \textbf{Non-exercisers n = 69} & \textbf{Total MS sample n = 121} \\
\hline
Age (yr) & 50 $\pm$ 10 & 50 $\pm$ 11 & 50 $\pm$ 10 \\
\hline
Sex (\% male) & 23.1 & 15.9 & 19.0 \\
\hline
Disease duration (yr) & 12 $\pm$ 8 & 11 $\pm$ 8 & 12 $\pm$ 8 \\
\hline
Disease Steps Score (\%) \\
\hline
0 & 15.4 & 8.7 & 11.6 \\
\hline
1 & 26.9 & 24.6 & 25.6 \\
\hline
2 & 17.3 & 13.0 & 14.9 \\
\hline
3 & 5.8 & 11.6 & 9.1 \\
\hline
4 & 19.2 & 17.4 & 18.2 \\
\hline
5 & 11.5 & 11.6 & 11.6 \\
\hline
6 & 3.8 & 13.0 & 9.1 \\
\hline
MSIS-29 & 61 $\pm$ 18** & 77 $\pm$ 26 & 70 $\pm$ 24 \\
\hline
Disease Course (\%)* \\
\hline
Relapsing-remitting & 51.9 & 55.1 & 53.7 \\
\hline
Secondary progressive & 23.1 & 13.0 & 17.4 \\
\hline
Primary progressive & 1.9 & 17.4 & 10.7 \\
\hline
Progressive relapsing & 0.0 & 4.3 & 2.5 \\
\hline
Unknown & 23.1 & 10.1 & 15.7 \\
\hline
\end{tabular}
\end{table} | PMC2717927_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{BDI} & \textbf{SF36PF} & \textbf{SF36RP} & \textbf{SF36BP} & \textbf{SFGH} \\
\hline
Exercise Status & 5.632* & 12.983** & 1.236 & 2.149 & 9.325** \\
\hline
Disease Severity & 1.159 & 39.953** & 10.437** & 4.921** & 2.810* \\
\hline
\multirow{2}{*}{Interaction effect} & 0.822 & 2.527* & 0.988 & 2.754* & 2.004 \\
\hline
SF36VT & SF36SF & SF36RE & SF36MH & SF36PCSS \\
\hline
Exercise Status & 5.631* & 7.440** & 3.074 & 7.398** & 5.532* \\
\hline
Disease Severity & 3.752** & 1.527 & 0.791 & 0.839 & 23.693** \\
\hline
\multirow{2}{*}{Interaction effect} & 1.191 & 0.406 & 0.430 & 0.450 & 2.314* \\
\hline
SF36MCSS & MFISphy & MFIScog & MFISpsy & MFIStot \\
\hline
Exercise Status & 5.436* & 9.247** & 1.153 & 4.547** & 1.549 \\
\hline
Disease Severity & 0.671 & 10.624** & 3.986** & 10.489** & 7.160** \\
\hline
Interaction effect & 0.202 & 0.707 & 1.813 & 0.486 & 0.413 \\
\hline
\end{tabular}
\end{table} | PMC2717927_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{H. sapiens versus M. musculus \% sequence identity}} & \multicolumn{2}{c|}{\textbf{H. sapiens versus G. gallus \% sequence identity}} \\
\hline
& \textbf{\textbf{Whole length}} & \textbf{\textbf{Signal peptide}} & \textbf{\textbf{Whole length}} & \textbf{\textbf{Signal peptide}} \\
\hline
AMH & 74.0 & 40.0 & 45.1 & 43.3 \\
\hline
BMP2 & 92.4 & 93.3 & 81.3 & 66.7 \\
\hline
BMP3 & 81.1 & 63.3 & 67.2 & 36.7 \\
\hline
BMP4 & 97.5 & 100.0 & 85.3 & 90.0 \\
\hline
BMP5 & 93.2 & 86.7 & 92.7 & 70.0 \\
\hline
BMP6 & 91.9 & 96.7 & 85.1 & 16.7 \\
\hline
BMP7 & 97.7 & 100.0 & 91.4 & 30.0 \\
\hline
BMP9 (GDF2) & 80.4 & 53.3 & 61.8 & 30.0 \\
\hline
BMP10 & 85.5 & 73.3 & 74.7 & 46.7 \\
\hline
BMP14(GDF5) & 92.3 & 90.0 & 70.6 & 33.3 \\
\hline
BMP15 & 64.2 & 60.0 & 47.0 & 13.3 \\
\hline
GDF3 & 71.1 & 33.3 & 48.9 & 33.3 \\
\hline
MSTN (GDF8) & 96.3 & 80.0 & 92.0 & 53.3 \\
\hline
GDF9 & 74.1 & 66.7 & 589 & 20.0 \\
\hline
\end{tabular}
\end{table} | PMC2717928_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Year} & \textbf{1\%} & \textbf{2\%} & \textbf{5\%} & \textbf{7\%} & \textbf{10\%} & \textbf{20\%} & \textbf{30\%} \\
\hline
2002 & 0.60 & 0.56 & 0.49 & 0.49 & 0.42 & 0.42 & 0.41 \\
\hline
2003 & 0.66 & 0.64 & 0.60 & 0.62 & 0.62 & 0.60 & 0.65 \\
\hline
2004 & 0.51 & 0.50 & 0.43 & 0.40 & 0.39 & 0.26 & 0.24 \\
\hline
2005 & 0.51 & 0.48 & 0.46 & 0.45 & 0.36 & 0.40 & 0.36 \\
\hline
2006 & 0.63 & 0.57 & 0.54 & 0.52 & 0.46 & 0.41 & 0.57 \\
\hline
2007 & 0.53 & 0.55 & 0.49 & 0.48 & 0.47 & 0.45 & 0.42 \\
\hline
2008 & 0.43 & 0.47 & 0.33 & 0.35 & 0.29 & 0.27 & 0.34 \\
\hline
All years & 0.72 & 0.72 & 0.64 & 0.63 & 0.64 & 0.60 & 0.60 \\
\hline
Overall average & 0.58 & 0.56 & 0.50 & 0.49 & 0.46 & 0.43 & 0.45 \\
\hline
\end{tabular}
\end{table} | PMC2717929_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Treatment} & \multicolumn{3}{c|}{\textbf{Maximal changes in}} \\
\hline
& \textbf{MSAP (mmHg)} & \textbf{HR (bpm)} & \textbf{Power Density (mmHg2)} \\
\hline
aCSF & +3.3 $\pm$ 0.4 & +4.9 $\pm$ 0.6 & +0.7 $\pm$ 0.5 \\
\hline
ICI 182780 (0.25 pmol) & +3.3 $\pm$ 0.6 & +5.5 $\pm$ 0.8 & +0.7 $\pm$ 0.5 \\
\hline
ICI 182780 (0.5 pmol) & +2.5 $\pm$ 0.5 & +3.5 $\pm$ 0.8 & +0.6 $\pm$ 0.6 \\
\hline
R,R-THC (50 pmol) & +6.4 $\pm$ 0.6 & +6.5 $\pm$ 1.0 & +0.8 $\pm$ 0.4 \\
\hline
MPP (1 nmol) & +6.1 $\pm$ 0.8 & +6.6 $\pm$ 0.8 & +0.9 $\pm$ 0.7 \\
\hline
L-NAME (5 nmol) & +3.8 $\pm$ 0.6 & +5.6 $\pm$ 0.6 & +0.9 $\pm$ 0.6 \\
\hline
SMT (25 pmol) & +3.7 $\pm$ 0.8 & +5.3 $\pm$ 0.8 & +0.7 $\pm$ 0.5 \\
\hline
7-NI (0.5 pmol) & -2.7 $\pm$ 0.8 & -3.3 $\pm$ 0.5 & -0.6 $\pm$ 0.8 \\
\hline
L-NIO (2.5 pmol) & -1.9 $\pm$ 0.8 & -3.6 $\pm$ 0.7 & -1.0 $\pm$ 0.6 \\
\hline
\end{tabular}
\end{table} | PMC2717931_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{N} & \textbf{AGE} & \textbf{SIDE} & GE\textbf{N}DER & \textbf{CEAP} & \textbf{Total Vol.} & \textbf{Volume Post-rest} & \textbf{Volume Post-exercise} \\
\hline
01- & 60 & R & F & C3 & 3570 & -120 & -1–145 \\
\hline
02- & 47 & L & F & C5 & 4845 & -25 & -90 \\
\hline
03- & 66 & L & F & C5 & 3390 & -40 & ---125 \\
\hline
04- & 40 & L & F & C3 & 3040 & -50 & -88 \\
\hline
05- & 50 & R & F & C3 & 3970 & -80 & -110 \\
\hline
06- & 45 & L & F & C3 & 4480 & -100 & -140 \\
\hline
07- & 56 & R & F & C3 & 3902 & -65 & -230 \\
\hline
08- & 74 & L & F & C4 & 3275 & -40 & -69 \\
\hline
09- & 49 & L & F & C4 & 4060 & -280 & -216 \\
\hline
10- & 53 & R & M & C5 & 3410 & -113 & -120 \\
\hline
11- & 57 & R & F & C4 & 2990 & -160 & -190 \\
\hline
12- & 45 & L & F & C4 & 4310 & -65 & -95 \\
\hline
13- & 50 & R & F & C3 & 4121 & -20 & -132 \\
\hline
14- & 69 & L & F & C5 & 4200 & -60 & -90 \\
\hline
15- & 61 & R & F & C5 & 4775 & -65 & -115 \\
\hline
16- & 46 & L & F & C4 & 4910 & -100 & -110 \\
\hline
17- & 72 & R & M & C5 & 5420 & -164 & -245 \\
\hline
18- & 39 & R & F & C5 & 3431 & -66 & -278 \\
\hline
19- & 63 & L & F & C5 & 4960 & -85 & -140 \\
\hline
20- & 63 & R & F & C4 & 3610 & -30 & -90 \\
\hline
21- & - & L & F & C3 & 3270 & -40 & -90 \\
\hline
22- & 38 & R & F & C5 & 3360 & -90 & -30 \\
\hline
23- & - & L & F & C4 & 3220 & -100 & -95 \\
\hline
24- & 60 & R & F & C4 & 4700 & -80 & -90 \\
\hline
25- & - & L & F & C5 & 4490 & -80 & -110 \\
\hline
26- & 54 & R & F & C3 & 4700 & -70 & -20 \\
\hline
27- & - & L & F & C4 & 4490 & -395 & -420 \\
\hline
28- & 36 & R & M & C5 & 4775 & -20 & -120 \\
\hline
\end{tabular}
\end{table} | PMC2717934_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Geometric Mean} & \multicolumn{7}{c|}{\textbf{Selected Percentiles}} \\
\hline
& & \textbf{10th} & \textbf{25th} & \textbf{50th} & \textbf{75th} & \textbf{90th} & \textbf{95th} & \textbf{Max.} \\
\hline
HCB \\
\hline
Serum & 0.093 & 0.051 & 0.069 & 0.090 & 0.114 & 0.151 & 0.195 & 2.31 \\
\hline
FF & 0.032 & 0.017 & 0.025 & 0.035 & 0.044 & 0.057 & 0.072 & 0.588 \\
\hline
Oxychlordane \\
\hline
Serum & 0.045 & 0.024 & 0.033 & 0.046 & 0.062 & 0.088 & 0.094 & 0.156 \\
\hline
FF & 0.011 & 0.006 & 0.008 & 0.012 & 0.014 & 0.018 & 0.023 & 0.036 \\
\hline
Trans-nonachlor \\
\hline
Serum & 0.090 & 0.045 & 0.068 & 0.092 & 0.128 & 0.168 & 0.205 & 0.485 \\
\hline
FF & 0.018 & 0.008 & 0.013 & 0.020 & 0.027 & 0.031 & 0.040 & 0.138 \\
\hline
Mirex \\
\hline
Serum & 0.014 & 0.006 & 0.010 & 0.014 & 0.022 & 0.031 & 0.051 & 0.100 \\
\hline
FF & 0.004 & 0.001 & 0.002 & 0.004 & 0.006 & 0.008 & 0.009 & 0.040 \\
\hline
p,p'-DDE \\
\hline
Serum & 1.23 & 0.430 & 0.700 & 1.08 & 1.81 & 3.93 & 8.75 & 24.2 \\
\hline
FF & 0.384 & 0.123 & 0.223 & 0.363 & 0.878 & 1.85 & 4.26 & 6.74 \\
\hline
p,p'-DDT \\
\hline
Serum & 0.065 & 0.030 & 0.040 & 0.063 & 0.086 & 0.119 & 0.346 & 1.98 \\
\hline
FF & 0.013 & 0.005 & 0.009 & 0.014 & 0.019 & 0.028 & 0.047 & 0.116 \\
\hline
PCB 118 \\
\hline
Serum & 0.091 & 0.041 & 0.056 & 0.088 & 0.145 & 0.205 & 0.320 & 0.540 \\
\hline
FF & 0.028 & 0.010 & 0.017 & 0.032 & 0.047 & 0.073 & 0.096 & 0.132 \\
\hline
PCB 138 \\
\hline
Serum & 0.149 & 0.073 & 0.103 & 0.153 & 0.206 & 0.295 & 0.313 & 1.11 \\
\hline
FF & 0.043 & 0.019 & 0.034 & 0.047 & 0.071 & 0.100 & 0.139 & 0.380 \\
\hline
PCB 153 \\
\hline
Serum & 0.257 & 0.119 & 0.181 & 0.260 & 0.358 & 0.521 & 0.591 & 2.33 \\
\hline
FF & 0.064 & 0.024 & 0.047 & 0.072 & 0.110 & 0.148 & 0.211 & 0.778 \\
\hline
PCB 180 \\
\hline
Serum & 0.159 & 0.073 & 0.119 & 0.168 & 0.229 & 0.293 & 0.350 & 1.98 \\
\hline
FF & 0.039 & 0.013 & 0.021 & 0.045 & 0.060 & 0.100 & 0.111 & 0.640 \\
\hline
ΣPCB \\
\hline
Serum & 1.41 & 0.754 & 1.06 & 1.40 & 1.84 & 2.49 & 3.01 & 10.3 \\
\hline
FF & 0.350 & 0.127 & 0.252 & 0.384 & 0.534 & 0.709 & 0.970 & 3.23 \\
\hline
\end{tabular}
\end{table} | PMC2717935_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Molecular weight} & \textbf{Mean} & \multicolumn{8}{c|}{\textbf{Selected Percentiles}} \\
\hline
& & & \textbf{Min.} & \textbf{10th} & \textbf{25th} & \textbf{50th} & \textbf{75th} & \textbf{90th} & \textbf{95th} & \textbf{Max.} \\
\hline
HCB & 285 & 0.39 & 0.13 & 0.22 & 0.29 & 0.37 & 0.49 & 0.55 & 0.60 & 0.69 \\
\hline
p,p'-DDE & 318 & 0.32 & 0.03 & 0.18 & 0.24 & 0.32 & 0.41 & 0.46 & 0.49 & 0.55 \\
\hline
PCB 118 & 326 & 0.32 & 0.06 & 0.18 & 0.22 & 0.30 & 0.39 & 0.46 & 0.48 & 1.38* \\
\hline
p,p'-DDT & 355 & 0.22 & 0.02 & 0.11 & 0.14 & 0.22 & 0.27 & 0.32 & 0.36 & 0.47 \\
\hline
PCB 138 & 361 & 0.31 & 0.04 & 0.17 & 0.24 & 0.30 & 0.37 & 0.43 & 0.51 & 0.99* \\
\hline
PCB 153 & 361 & 0.27 & 0.03 & 0.14 & 0.20 & 0.25 & 0.34 & 0.39 & 0.41 & 0.79* \\
\hline
PCB 180 & 395 & 0.25 & 0.02 & 0.12 & 0.18 & 0.25 & 0.31 & 0.40 & 0.41 & 0.94* \\
\hline
Oxychlordane & 426 & 0.24 & 0.06 & 0.12 & 0.17 & 0.24 & 0.29 & 0.35 & 0.37 & 0.52 \\
\hline
Trans-nonachlor & 444 & 0.21 & 0.05 & 0.10 & 0.16 & 0.20 & 0.25 & 0.29 & 0.32 & 0.71* \\
\hline
Mirex & 546 & 0.24 & 0.06 & 0.11 & 0.17 & 0.22 & 0.30 & 0.39 & 0.42 & 0.54 \\
\hline
ΣPCB & & 0.27 & 0.06 & 0.14 & 0.19 & 0.26 & 0.33 & 0.38 & 0.42 & 0.97* \\
\hline
\end{tabular}
\end{table} | PMC2717935_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Wet-weight concentrations}} & \multicolumn{2}{c|}{\textbf{Lipid-standardized}} \\
\hline
& \textbf{All samples; n = 266} & \textbf{Excluding baseline; n = 178} & \textbf{All samples; n = 173} & \textbf{Excluding baseline; n = 105} \\
\hline
HCB & 0.95 (0.93, 0.96) & 0.97 (0.95, 0.98) & 0.95 (0.92, 0.97) & 0.97 (0.95, 0.98) \\
\hline
Oxychlordane & 0.85 (0.80, 0.90) & 0.91 (0.86, 0.94) & 0.90 (0.85, 0.93) & 0.93 (0.88, 0.96) \\
\hline
Transnonachlor & 0.88 (0.83, 0.91) & 0.94 (0.92, 0.96) & 0.95 (0.92, 0.97) & 0.94 (0.90, 0.97) \\
\hline
Mirex & 0.88 (0.83, 0.91) & 0.95 (0.93, 0.97) & 0.90 (0.85, 0.93) & 0.95 (0.92, 0.97) \\
\hline
p,p'-DDE & 0.98 (0.97, 0.99) & 0.98 (0.97, 0.99) & 0.98 (0.97, 0.99) & 0.98 (0.97, 0.99) \\
\hline
p,p'-DDT & 0.93 (0.91, 0.95) & 0.96 (0.95, 0.98) & 0.95 (0.92, 0.97) & 0.96 (0.92, 0.98) \\
\hline
PCB 118 & 0.92 (0.89, 0.94) & 0.97 (0.96, 0.98) & 0.97 (0.95, 0.98) & 0.97 (0.95, 0.99) \\
\hline
PCB 138 & 0.91 (0.87, 0.93) & 0.96 (0.94, 0.97) & 0.96 (0.94, 0.98) & 0.97 (0.95, 0.98) \\
\hline
PCB 153 & 0.91 (0.88, 0.94) & 0.96 (0.93, 0.97) & 0.97 (0.95, 0.98) & 0.97 (0.94, 0.98) \\
\hline
PCB 180 & 0.91 (0.87, 0.93) & 0.95 (0.93, 0.97) & 0.96 (0.94, 0.97) & 0.97 (0.95, 0.98) \\
\hline
Sum PCB & 0.83 (0.77, 0.88) & 0.92 (0.89, 0.95) & 0.88 (0.83, 0.92) & 0.93 (0.88, 0.96) \\
\hline
Cholesterolb & 0.58 (0.43, 0.71) & 0.67 (0.49, 0.82) \\
\hline
Triglyceridesb & 0.85 (0.78, 0.90) & 0.86 (0.77, 0.92) \\
\hline
Total lipidsb & 0.78 (0.69, 0.86) & 0.83 (0.71, 0.90) \\
\hline
\end{tabular}
\end{table} | PMC2717935_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{Follicular fluid}} & \multicolumn{3}{c|}{\textbf{Serum}} \\
\hline
& \textbf{Phase 1 (1994–1998); n = 31} & \textbf{Phase 2 (1999–2003); n = 41} & \textbf{\textbf{p-value}} & \textbf{Phase 1 (1994–1998); n = 56} & \textbf{Phase 2 (1999–2003); n = 54} & \textbf{\textbf{p-value}} \\
\hline
HCB & 0.036 & 0.029 & 0.2 & 0.104 & 0.083 & 0.05 \\
\hline
Oxychlordane & 0.013 & 0.010 & 0.02 & 0.052 & 0.039 & 0.003 \\
\hline
Trans-nonachlor & 0.021 & 0.016 & 0.09 & 0.106 & 0.075 & 0.001 \\
\hline
Mirex & 0.004 & 0.003 & 0.10 & 0.015 & 0.013 & 0.2 \\
\hline
p,p'-DDE & 0.48 & 0.32 & 0.2 & 1.53 & 0.98 & 0.01 \\
\hline
p,p'-DDT & 0.017 & 0.010 & 0.02 & 0.086 & 0.049 & <0.0001 \\
\hline
PCB 118 & 0.034 & 0.025 & 0.08 & 0.106 & 0.079 & 0.02 \\
\hline
PCB 138 & 0.056 & 0.035 & 0.04 & 0.181 & 0.122 & 0.0004 \\
\hline
PCB 153 & 0.086 & 0.052 & 0.02 & 0.306 & 0.214 & 0.0002 \\
\hline
PCB 180 & 0.051 & 0.032 & 0.01 & 0.187 & 0.134 & 0.005 \\
\hline
Sum PCB & 0.47 & 0.28 & 0.004 & 1.57 & 1.26 & 0.03 \\
\hline
\end{tabular}
\end{table} | PMC2717935_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{No. of Patients} & \textbf{No. of Deaths} & \textbf{MST (months)} & \textbf{P*} \\
\hline
Total subjects Age (mean) & 167 & 60 & & 0.339 \\
\hline
57 years & 68 & 27 & 21.2 \\
\hline
>57 years & 99 & 33 & 31.0 \\
\hline
Gender & & & & 0.988 \\
\hline
Male & 114 & 41 & 23.3 \\
\hline
Female & 53 & 19 & 28.9 \\
\hline
Ethnicity & & & & 0.297 \\
\hline
White & 117 & 45 & 28.8 \\
\hline
Non-White† & 50 & 15 & 19.1 \\
\hline
Smoke & & & & 0.475 \\
\hline
Never & 34 & 14 & 20.6 \\
\hline
Ever & 133 & 46 & 30.1 \\
\hline
Alcohol & & & & 0.809 \\
\hline
Never & 62 & 23 & 23.2 \\
\hline
Ever & 105 & 37 & 29.3 \\
\hline
Location & & & & 0.069 \\
\hline
Stomach & 118 & 36 & 24.3 \\
\hline
Esophagus & 25 & 13 & 27.2 \\
\hline
GEJ & 24 & 11 & 16.6 \\
\hline
Histology & & & & 0.356 \\
\hline
Intestinal & 118 & 45 & 28.1 \\
\hline
Signet ring & 49 & 15 & 24.6 \\
\hline
Differentiation & & & & 0.694 \\
\hline
Poor & 96 & 37 & 21.8 \\
\hline
Moderate-poor & 28 & 10 & 29.8 \\
\hline
Moderate-Well & 42 & 13 & 22.6 \\
\hline
Clinical Stage & & & & < 0.001 \\
\hline
I + II & 65 & 9 & 30.4 \\
\hline
III + IV & 101 & 51 & 22.7 \\
\hline
Metastasis & & & & < 0.001 \\
\hline
yes & 90 & 49 & 21.2 \\
\hline
no & 77 & 11 & 34.2 \\
\hline
Chemotherapy & & & & < 0.001 \\
\hline
yes & 121 & 54 & 26.3 \\
\hline
no & 46 & 6 & 10.4 \\
\hline
Surgery & & & & < 0.001 \\
\hline
yes & 63 & 11 & 39.2 \\
\hline
no & 104 & 49 & 18.4 \\
\hline
\end{tabular}
\end{table} | PMC2717936_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Experimentals (n = 3)} & \textbf{Controls (n = 2)} \\
\hline
Brain & 3/3 & 0/2 \\
\hline
Spinal cord & 1/3 & 0/1b \\
\hline
Adrenal & 0/3 & 0/1b \\
\hline
Stomachs & 2/3 & 0/2 \\
\hline
Liver & 0/3 & 0/2 \\
\hline
Lung & 0/3 & 0/2 \\
\hline
Heart & 1/3 & 0/2 \\
\hline
Pectoral muscle & 0/3 & 0/2 \\
\hline
skin & 0/3 & 0/2 \\
\hline
\end{tabular}
\end{table} | PMC2717941_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Day} & \textbf{Pattern I} & \textbf{Pattern I}I & \textbf{Total} \\
\hline
7 & 9 (40.9\%) & 13 (59.1\%) & 22 \\
\hline
10 & 7 (29.2\%) & 17 (70.8\%) & 24 \\
\hline
18 & - & 22 (100\%) & 22 \\
\hline
\end{tabular}
\end{table} | PMC2717942_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Day} & \textbf{Pattern Vpr} & \textbf{Pattern Tat} & \textbf{Total} \\
\hline
3 & 6 (42.8\%) & 8 (57.2\%) & 14 \\
\hline
7 & 9 (52.9\%) & 8 (47.1\%) & 17 \\
\hline
10 & 11 (73.3\%) & 4 (26.7\%) & 15 \\
\hline
18 & 13 (86.7\%) & 2 (13.3\%) & 15 \\
\hline
\end{tabular}
\end{table} | PMC2717942_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Number screened} & \textbf{Number positive} & \textbf{Number negative} \\
\hline
Males & 97 & 13(13.40\%) & 84(86.59\%) \\
\hline
Females & 91 & 14(15.38\%) & 77(84.61\%) \\
\hline
Total & 188 & 27(14.36\%) & 161(85.64\%) \\
\hline
\end{tabular}
\end{table} | PMC2717943_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{AGE GROUP}} \\
\hline
& \textbf{18–27} & \textbf{28–37} & \textbf{38–47} & \textbf{48–57} & \textbf{58–67} \\
\hline
No. Screened & 44 & 24 & 17 & 10 & 2 \\
\hline
Demographics/Socials \\
\hline
Married & 4 & 10 & 17 & 10 & 2 \\
\hline
Single & 40 & 14 & - & - & - \\
\hline
Alcohol Consumption & 21 & 14 & 10 & 4 & 2 \\
\hline
Blood Transfusion & 10 & 6 & 3 & 3 & 1 \\
\hline
Tattoo/Body Piercing & 6 & 5 & 4 & 3 & 1 \\
\hline
Regular Exercise & 26 & 10 & 9 & 4 & 1 \\
\hline
HCV Positive & 7 & 1 & 4 & 1 & 0 \\
\hline
Percentage Positive & 3.72 & 0.53 & 2.13 & 0.53 & 0 \\
\hline
HCV Negative & 37 & 23 & 13 & 9 & 2 \\
\hline
Percentage Negative & 19.68 & 12.23 & 6.91 & 4.79 & 1.06 \\
\hline
\end{tabular}
\end{table} | PMC2717943_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{AGE GROUP}} \\
\hline
& \textbf{18–27} & \textbf{28–37} & \textbf{38–47} & \textbf{48–57} & \textbf{58–67} \\
\hline
No. Screened & 41 & 35 & 10 & 4 & 1 \\
\hline
Demographics/Socials \\
\hline
Married & 10 & 27 & 10 & 4 & 1 \\
\hline
Single & 31 & 8 & - & - & - \\
\hline
Alcohol Intake & 2 & 7 & 3 & 1 & - \\
\hline
Blood Transfusion & 11 & 15 & 3 & 2 & - \\
\hline
Tattoo/B. Piercing & 35 & 31 & 8 & 4 & 1 \\
\hline
Regular Exercise & 21 & 20 & 2 & - & - \\
\hline
HCV Positive & 3 & 7 & 3 & 1 & 0 \\
\hline
Percentage Positive & 1.60 & 3.72 & 1.60 & 0.53 & 0 \\
\hline
HCV Negative & 38 & 28 & 7 & 3 & 1 \\
\hline
Percentage Negative & 20.21 & 14.89 & 3.72 & 1.60 & 0.53 \\
\hline
\end{tabular}
\end{table} | PMC2717943_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{VARIABLE} & \textbf{TOTAL NOS(\%)} & \textbf{NOS OF POSITIVE (\%)} & \textbf{P VALUE} \\
\hline
Marital status \\
\hline
Married & 95 (50.53\%) & 19 (10.11\%) & 0.026 \\
\hline
Single & 93 (49.47\%) & 8 (4.26\%) \\
\hline
Sex \\
\hline
Male & 97 (51.60\%) & 14 (7.45\%) & 0.977 \\
\hline
Female & 91 (48.40\%) & 13 (6.91\%) \\
\hline
Age \\
\hline
18–27 & 85 (45.21\%) & 10 (5.32\%) & 0.364 \\
\hline
28–37 & 59 (31.38\%) & 8 (4.26\%) \\
\hline
38–47 & 27 (14.36\%) & 7 (3.72\%) \\
\hline
48–57 & 14 (7.45\%) & 2 (1.06\%) \\
\hline
58–67 & 3 (1.60\%) & - (0.00\%) \\
\hline
Blood transfusion \\
\hline
YES & 54 (28.72\%) & 7 (3.72\%) & 0.728 \\
\hline
NO & 134 (71.28\%) & 20 (10.64\%) \\
\hline
Tattoo/body piercing \\
\hline
YES & 98 (52.13\%) & 12 (6.38\%) & 0.338 \\
\hline
NO & 90 (47.87\%) & 15 (7.98\%) \\
\hline
Alcohol intake \\
\hline
YES & 64 (34.04\%) & 7 (3.72\%) & 0.218 \\
\hline
NO & 124 (65.96\%) & 20 (10.64\%) \\
\hline
Exercise \\
\hline
YES & 92 (48.94\%) & 14 (7.45\%) & 0.743 \\
\hline
NO & 96 (51.06\%) & 13 (6.91\%) \\
\hline
\end{tabular}
\end{table} | PMC2717943_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Men}} & \multicolumn{2}{c|}{\textbf{Women}} \\
\hline
& \textbf{\textbf{AST (\%)}} & \textbf{\textbf{ALT (\%)}} & \textbf{\textbf{AST (\%)}} & \textbf{\textbf{ALT (\%)}} \\
\hline
Nos showing normal level & 12(12.37) & 10(10.31) & 10(10.99) & 9(9.89) \\
\hline
Nos showing abnormal level & 2(2.06) & 4(4.12) & 3(3.29) & 3(3.29) \\
\hline
\end{tabular}
\end{table} | PMC2717943_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Quality Statistic1} & \textbf{Description} \\
\hline
mean.raw.int, sd.raw.int, median.raw.int, interQuartile.raw.int & mean, standard deviation, median and inter-quartile range of raw log intensity distribution. \\
\hline
q.5.raw.int, q.95.raw.int & 5th and 95th percentile of raw log intensity distribution. \\
\hline
slope.bias, p.bias & slope parameter and associated p-value of linear regression of log expression level versus probe number, as computed by R affy library function AffyRNAdeg(). \\
\hline
mean.norm.int, sd.norm.int, median.norm.int, interQuartile.norm.int, q.5.norm.int, q.95.norm.int & mean, standard deviation, median, inter-quartile range, and 5th and 95th percentiles of normalized log intensity distribution. \\
\hline
PLM.w.q.0.001, PLM.w.q.0.01, PLM.w.q.0.1, PLM.w.q.0.2 & 0.1th, 1st, 10th and 20th percentile of the probe-level model weights, computed using affyPLM library functionality. \\
\hline
PLM.res.q.0.01, PLM.res.q.0.1, PLM.res.q.0.25, PLM.res.q.0.75, PLM.res.q.0.9, PLM.res.q.0.99 & 1st, 10th, 25th, 75th, 90th, and 99th percentile of probe-level model residuals, computed using affyPLM library functionality. \\
\hline
RLE.median, RLE.interQuartile, RLE.lower.whisker, RLE.upper.whisker & median, inter-quartile range, lower tail and upper tail of "relative log intensity", computed using affyPLM library functionality. \\
\hline
\end{tabular}
\end{table} | PMC2717951_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Quality Statistic1} & \textbf{Description} \\
\hline
pm.mean & mean of the raw intensity for all PM probes, prior to any normalizations. \\
\hline
bgrd.mean & mean of the raw intensity for all probes used to compute background intensity. (Note: may be higher than pm.mean because GC compositions of probes used to compute background and PM probes can be quite different.) \\
\hline
pos.vs.neg.auc & area under ROC curve discriminating between positive control probesets and negative control probesets. \\
\hline
probeset.mean, probeset.stdev & mean and standard deviation of probeset signals after normalization. 2 \\
\hline
probeset.mad.residual.mean, probeset.mad.residual.stdev & mean and standard deviation of the absolute deviations of the RMA probe level model residuals from the median across chips. 2 \\
\hline
probeset.rle.mean, probeset.rle.stdev & mean and standard deviation of the absolute values of the relative log expression (RLE) for all probesets. 2 \\
\hline
\end{tabular}
\end{table} | PMC2717951_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{\% Example of the DOTcvp simple input file for the drug displacement problem}} \\
\hline
\textbf{data.name} & \textbf{= 'DrugDisplacement';} & \textbf{\% name of the problem} \\
\hline
\textbf{data.odes.parameters(1)} & \textbf{= {'A = 232'};} & \textbf{\% constant parameters before ODE} \\
\hline
data.odes.parameters(2) & = {'B = 46.4'}; \\
\hline
data.odes.parameters(3) & = {'C = 2152.96'}; \\
\hline
data.odes.res(1) & \multicolumn{2}{c|}{= {'((1+0.2*(y(1)+y(2)))^2/(((1+0.2*(y(1)+y(2)))^2+A+B*y(2))*((1+0.2*(y(1)+y(2)))^2+A+B*y(1))- C*y(1)*y(2)))*(((1+0.2*(y(1)+y(2)))^2+A+B*y(1))*(0.02-y(1))+B*y(1)*(u(1)-2*y(2)))'};} \\
\hline
data.odes.res(2) & \multicolumn{2}{c|}{= {'((1+0.2*(y(1)+y(2)))^2/(((1+0.2*(y(1)+y(2)))^2+A+B*y(2))*((1+0.2*(y(1)+y(2)))^2+A+B*y(1))- C*y(1)*y(2)))*(((1+0.2*(y(1)+y(2)))^2+A+B*y(2))*(u(1)-2*y(2))+46.4*(0.02-y(1)))'};} \\
\hline
data.odes.res(3) & = {'1'}; \\
\hline
data.odes.ic & = [0.02 0.0 0.0]; & \% vector of initial conditions \\
\hline
data.odes.tf & = 300.0; & \% final time \\
\hline
data.nlp.RHO & = 5; & \% CVP discretization level \\
\hline
data.nlp.J0 & = 'y(3)'; & \% performance index, min-max(performance index) \\
\hline
data.nlp.u0 & = 4.0; & \% initial guess for control values \\
\hline
data.nlp.lb & = 0.0; & \% lower bounds for control values \\
\hline
data.nlp.ub & = 8.0; & \% upper bounds for control values \\
\hline
data.nlp.solver & = 'IPOPT'; & \% ['FMINCON'|'IPOPT'|'SRES'|'DE'|'ACOMI'|'MISQP'|'MITS'] \\
\hline
data.nlp.FreeTime & = 'on'; & \% ['on'|'off'] set 'on' if free time is considered \\
\hline
data.nlp.eq.status & = 'on'; & \% ['on'|'off'] switch on/off of the equality constraints \\
\hline
data.nlp.eq.NEC & = 2; & \% number of active equality constraints \\
\hline
data.nlp.eq.eq(1) & = {'y(1)-0.02'}; & \% first equality constraint \\
\hline
data.nlp.eq.eq(2) & = {'y(2)-2.0'}; & \% second equality constraint \\
\hline
data.nlp.eq.time(1) & = data.nlp.RHO; & \% to indicate that it is an end-point constraint \\
\hline
data.nlp.eq.time(2) & = data.nlp.RHO; & \% to indicate that it is an end-point constraint \\
\hline
data.options.trajectories & = size(data.odes.res,2)-1; & \% how many state trajectories will be displayed \\
\hline
\end{tabular}
\end{table} | PMC2717952_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Men}} & \multicolumn{2}{c|}{\textbf{Women}} \\
\hline
& \textbf{\textbf{General Workforce}/1} & \textbf{\textbf{Index Group}} & \textbf{General Workforce} & \textbf{\textbf{Index Group}} \\
\hline
Number & 1691 & 41 & 794 & 56 \\
\hline
Age in years/2 & 38.5 & 38.4 & 40.6 & 40.5 \\
\hline
Years of Work Experience/2 & 9.8 & 9.0 & 10.5 & 9.9 \\
\hline
CD4 count for initiating ART \\
\hline
Mean & & 144 & & 183 \\
\hline
Median & & 145 & & 187 \\
\hline
IQR & & 68–224 & & 105–270 \\
\hline
\end{tabular}
\end{table} | PMC2717954_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Organizational model} & \textbf{Definition} & \textbf{Example} \\
\hline
Small family doctor based models (registration at a & family doctor practice) \\
\hline
Individual general family practice & The GP takes care of his own patients 24 hours a day, 7 days a week. & Rural areas of Austria \\
\hline
Rota groups (rota) & GPs who are active in the same region take turns being on duty out-of-hours for the patient population of all (up to 15) members of the rota group & Municipalities in Norway \\
\hline
Large family doctor based models (independent of & registration at a family doctor practice) \\
\hline
GP cooperatives & GPs work in a non-profit organization and take turns being on duty out-of-hours for the patient population of all participating GPs. These are large-scale organizations that are supported by nurses, management, chauffeurs, et cetera. & Mostly used model for out-of-hours primary care in the Netherlands \\
\hline
Primary care centers (PCC) & Centers, which patients can visit without an appointment for minor injuries or illnesses. Such centers operate under supervision of a general practitioner or family physician. & In Slovenia one PCC (of all daytime centers) functions as out-of-hours center \\
\hline
Deputizing services & Commercial agencies that employ GPs to take over duties of other GPs. & NHS direct is common in the United Kingdom \\
\hline
Minor injury centers or walk-in-centers & Centers, which patients can visit without an appointment for minor injuries or illnesses in order to ask a trained nurse for health information, advice and treatment. & Ireland has a few privately organized models \\
\hline
Hospital based and national models \\
\hline
Telephone triage and advice services (TTA) & Patients have contact with a medically trained professional via a fixed, non-regional, telephone number. This person advises or refers the patient to the most suitable professional. & National call center in Portugal \\
\hline
Emergency departments of hospitals (A&E) & Emergency departments of hospitals taking care of patients out-of-hours. & Unofficially used by patients in Belgium \\
\hline
Primary out-of-hours care integrated in the hospital & Primary out-of-hours care integrated in the hospital (for example, in emergency departments). & Some experiments in Italy \\
\hline
\end{tabular}
\end{table} | PMC2717955_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Country} & \textbf{#} \\
\hline
Australia & 2 \\
\hline
Austria & 3 \\
\hline
Belgium & 7 \\
\hline
Canada & 2 \\
\hline
Croatia & 1 \\
\hline
Czech Republic & 2 \\
\hline
Denmark & 1 \\
\hline
France & 3 \\
\hline
Germany & 1 \\
\hline
Greece & 5 \\
\hline
Iceland & 2 \\
\hline
Ireland & 1 \\
\hline
Israel & 1 \\
\hline
Italy & 4 \\
\hline
The Netherlands & 2 \\
\hline
New Zealand & 2 \\
\hline
Norway & 6 \\
\hline
Poland & 3 \\
\hline
Portugal & 1 \\
\hline
Slovenia & 6 \\
\hline
Spain & 1 \\
\hline
Sweden & 5 \\
\hline
Switzerland & 4 \\
\hline
United Kingdom & 4 \\
\hline
United States of America & 2 \\
\hline
Total & 71 \\
\hline
\end{tabular}
\end{table} | PMC2717955_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Country} & \textbf{Respondents (N)} & \textbf{Models (N)} & \textbf{Dominant model*} & \textbf{Planned changes} \\
\hline
Croatia & 1 & 3 & Emergency department & - \\
\hline
Czech Republic & 2 & 3 & Primary care integrated in hospital & Upscale care, patient fee, integrate GP coop and A&E department \\
\hline
Denmark & 1 & 4 & Telephone triage and advice service & Upscale care \\
\hline
Israel & 1 & 4 & Emergency department & - \\
\hline
Portugal & 1 & 4 & Primary care center & - \\
\hline
The Netherlands & 2 & 4 & GP cooperative & Upscale care, integrate CP coop and A&E department \\
\hline
Germany & 1 & 5 & Rota group & - \\
\hline
Iceland & 2 & 5 & Primary care center GP cooperative & - \\
\hline
Slovenia & 6 & 6 & Rota group & Change organization, upscale care \\
\hline
Spain & 1 & 6 & Telephone triage and advice service & Upscale care \\
\hline
Austria & 3 & 7 & Rota group & Upscale care, change structure \\
\hline
Greece & 5 & 7 & Individual general family practice & Upscale care, change organization \\
\hline
Poland & 3 & 7 & - & Change organization \\
\hline
France & 3 & 8 & Emergency department Rota group & Upscale care \\
\hline
Sweden & 5 & 8 & GP cooperative & Centralization of out-of-hours calls and triage, change organization \\
\hline
Switzerland & 4 & 8 & Rota group & Upscale care, call center service \\
\hline
Belgium & 7 & 9 & Rota group & Upscale care, centralization of out-of-hours calls and triage \\
\hline
Canada & 2 & 9 & Emergency department & Upscale care \\
\hline
Italy & 4 & 9 & Other (Guardia Medica) & Upscale care \\
\hline
New Zealand & 2 & 9 & GP cooperative Rota group & - \\
\hline
Australia & 2 & 10 & Individual general family practice GP cooperative & Improve access to high quality health care services \\
\hline
Ireland & 1 & 10 & GP cooperative & Upscale care \\
\hline
Norway & 6 & 10 & Rota group & Upscale care, enhance uniformity \\
\hline
United Kingdom & 4 & 10 & Deputizing service & - \\
\hline
United States of America & 2 & 10 & Rota group & Many different approaches \\
\hline
\end{tabular}
\end{table} | PMC2717955_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Small family doctor based models}} & \multicolumn{3}{c|}{\textbf{Large family doctor based models}} & \multicolumn{3}{c|}{\textbf{Hospital based and national models}} \\
\hline
& \textbf{Individual general family practice (N = 3)} & \textbf{Rota group (N = 21)} & \textbf{GP coopera- tive (N = 9)} & \textbf{Primary care center (N = 5)} & \textbf{Deputizing service (N = 3)} & \textbf{A&E department (N = 7)} & \textbf{Telephone triage and advice (N = 3)} & \textbf{Integrated care (N = 1)} \\
\hline
Continuity of care & - & 0 & 0 & - & - & - & - & + \\
\hline
Efficiency & 0 & 0 & + & - & - & - & 0 & + \\
\hline
Accessibility & + & + & + & + & 0 & - & + & 0 \\
\hline
Coordination of care & 0 & 0 & + & - & - & - & 0 & + \\
\hline
Satisfaction physicians & 0 & - & + & - & 0 & 0 & - & 0 \\
\hline
Satisfaction other professionals & 0 & 0 & + & 0 & + & 0 & - & 0 \\
\hline
Satisfaction patients & 0 & + & + & 0 & 0 & + & + & - \\
\hline
Safety of triage & 0 & + & + & 0 & 0 & 0 & 0 & + \\
\hline
\end{tabular}
\end{table} | PMC2717955_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Trial characteristic} & & \textbf{Number of Included RCT Reports (\%)} \\
\hline
\multirow{6}{*}{Journal} & NEJM & 39 (29.3) \\
\hline
Lancet & 31 (23.3) \\
\hline
JAMA & 25 (18.8) \\
\hline
BMJ & 15 (11.3) \\
\hline
Annals of Internal Medicine & 13 (9.8) \\
\hline
Annals of Surgery & 10 (7.5) \\
\hline
\multirow{4}{*}{Sample Size} & <200 & 33 (24.8) \\
\hline
200–449 & 37 (27.8) \\
\hline
450–749 & 31 (23.3) \\
\hline
750+ & 32 (24.1) \\
\hline
\multirow{2}{*}{Centres} & Multiple & 95 (71.4) \\
\hline
Single & 38 (28.6) \\
\hline
\multirow{3}{*}{Study Design} & Parallel & 125 (94.0) \\
\hline
Factorial & 5 (3.8) \\
\hline
Crossover & 3 (2.3) \\
\hline
\multirow{5}{*}{Number of Arms} & Two & 103 (77.4) \\
\hline
Three & 14 (10.5) \\
\hline
Four & 12 (9.0) \\
\hline
Five & 2 (1.5) \\
\hline
Six & 2 (1.5) \\
\hline
\multirow{4}{*}{Interventions} & Drug & 68 (51.1) \\
\hline
Surgery & 21 (15.8) \\
\hline
Allied/Complementary Medicine & 20 (15.0) \\
\hline
Othera & 24 (18.1) \\
\hline
\multirow{2}{*}{Nature of Control Arm} & Active Control & 63 (47.4) \\
\hline
Placebo Control & 70 (52.6) \\
\hline
\multirow{2}{*}{Funding Source} & Externalb & 123 (92.5) \\
\hline
Internal/Not statedc & 10 (7.5) \\
\hline
\end{tabular}
\end{table} | PMC2717957_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Journal} & \textbf{Yes completely (\%)} & \textbf{Yes partially (\%)} & \textbf{No (\%)} \\
\hline
JAMA (n = 25) & 20 (80.0) & 5 (20.0) & 0 \\
\hline
Annals Int. Med. (n = 13) & 10 (76.9) & 2 (15.4) & 1 (7.7) \\
\hline
BMJ (n = 15) & 10 (66.7) & 5 (33.3) & 0 \\
\hline
Lancet (n = 31) & 16 (51.6) & 15 (48.4) & 0 \\
\hline
NEJM (n = 39) & 7 (17.9) & 10 (25.6) & 22 (56.4) \\
\hline
Annals Surgery (n = 10) & 1 (10.0) & 4 (40.0) & 5 (50.0) \\
\hline
Total (n = 133) & 64 (48.1) & 41 (30.8) & 28 (21.1) \\
\hline
\end{tabular}
\end{table} | PMC2717957_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Current stagea} & \textbf{Next stagea} & \textbf{Number of studiesb} & \textbf{Median progressing to next stage} & \textbf{First and third quartiles} & \textbf{Minimum and maximum} \\
\hline
Invited to eligibility assessment & Attended eligibility assessment & 13 & 70\% & 44\%, 96\% & 15\%, 100\% \\
\hline
Attended eligibility assessment & Found to be eligible & 71 & 70\% & 49\%, 88\% & 6\%, 100\% \\
\hline
Found to be eligible & Randomised to a treatment arm & 75 & 90\% & 77\%, 100\% & 20\%, 100\% \\
\hline
Randomised to a treatment arm & Outcome assessed & 113 & 93\% & 86\%, 99\% & 49\%, 100\% \\
\hline
Outcome assessed & Included in analysis & 111 & 100\% & 100\%, 103\%c & 100\%, 202\%c \\
\hline
\end{tabular}
\end{table} | PMC2717957_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Number of studiesa} & \textbf{Median \% of sample size required} & \textbf{First and third quartiles} & \textbf{Minimum and maximum} \\
\hline
Invited to screening & 12 & 410\% & 288\%, 951\% & 131\%, 2549\% \\
\hline
Attend screening & 62 & 230\% & 132\%, 379\% & 83\%, 2361\% \\
\hline
Eligible & 58 & 130\% & 108\%, 160\% & 72\%, 431\% \\
\hline
Randomised & 106 & 110\% & 100\%, 128\% & 43\%, 213\% \\
\hline
Outcome assessed & 94 & 100\% & 92\%, 111\% & 36\%, 158\% \\
\hline
In analysis & 102 & 103\% & 98\%, 117\% & 43\%, 169\% \\
\hline
\end{tabular}
\end{table} | PMC2717957_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{Screened and eligible}} & \multicolumn{3}{c|}{\textbf{Eligible and randomised}} & \multicolumn{3}{c|}{\textbf{Randomised and outcome assessed}} \\
\hline
\textbf{Factor & level} & \textbf{\textbf{\textbf{Median}}} & \textbf{\textbf{\textbf{IQR}}} & \textbf{\textbf{\textbf{Number of studies}}} & \textbf{\textbf{\textbf{Median}}} & \textbf{\textbf{\textbf{IQR}}} & \textbf{\textbf{\textbf{Number of studies}}} & \textbf{\textbf{\textbf{Median}}} & \textbf{\textbf{\textbf{IQR}}} & \textbf{\textbf{\textbf{Number of studies}}} \\
\hline
Study size \\
\hline
<200 & 78 & 63, 95 & 25 & 90 & 79, 100 & 26 & 92 & 86, 94 & 32 \\
\hline
200–449 & 71 & 56, 95 & 18 & 93 & 78, 99 & 21 & 92 & 86, 99 & 29 \\
\hline
450–749 & 51 & 33, 64 & 15 & 86 & 66, 97 & 15 & 93 & 84, 98 & 23 \\
\hline
\multirow{2}{*}{750+} & 71 & 41, 80 & 13 & 91 & 85, 100 & 13 & 97 & 89, 100 & 29 \\
\hline
& & p = 0.026 & & & p = 0.99 & & & p = 0.24 \\
\hline
Number of arms \\
\hline
2 & 72 & 48, 93 & 56 & 90 & 78, 100 & 59 & 94 & 88, 99 & 89 \\
\hline
\multirow{2}{*}{3+} & 68 & 51, 79 & 15 & 89 & 70, 97 & 16 & 86 & 76, 94 & 24 \\
\hline
& & p = 0.33 & & & p = 0.75 & & & p = 0.0035 \\
\hline
Multi-centre? \\
\hline
Yes & 75 & 42, 86 & 44 & 92 & 73, 99 & 47 & 94 & 85, 99 & 79 \\
\hline
\multirow{2}{*}{No} & 64 & 50, 94 & 27 & 87 & 78, 100 & 28 & 93 & 88, 96 & 34 \\
\hline
& & p = 0.91 & & & p = 0.70 & & & p = 0.64 \\
\hline
Treatment focus \\
\hline
Drug & 71 & 53, 86 & 29 & 94 & 73, 100 & 30 & 94 & 86, 99 & 56 \\
\hline
Surgery & 75 & 48, 99 & 10 & 89 & 63, 100 & 10 & 99 & 92, 100 & 17 \\
\hline
Allied & 67 & 50, 88 & 17 & 91 & 81, 99 & 18 & 90 & 85, 94 & 18 \\
\hline
\multirow{2}{*}{Other} & 64 & 44, 86 & 15 & 86 & 79, 93 & 17 & 92 & 84, 96 & 22 \\
\hline
& & p = 0.89 & & & p = 0.56 & & & p = 0.014 \\
\hline
Control \\
\hline
Active & 70 & 51, 86 & 30 & 88 & 74, 95 & 32 & 92 & 85, 98 & 52 \\
\hline
\multirow{2}{*}{Placebo} & 68 & 49, 88 & 41 & 94 & 77, 100 & 43 & 93 & 86, 99 & 61 \\
\hline
& & p = 0.82 & & & p = 0.24 & & & p = 0.46 \\
\hline
Time to assessment \\
\hline
0 to 4 weeks & 8 & 33, 86 & 10 & 83 & 63, 94 & 11 & 99 & 93, 100 & 26 \\
\hline
>4 weeks to 6 months & 7 & 51, 78 & 23 & 91 & 81, 100 & 24 & 92 & 87, 94 & 30 \\
\hline
>6 to 18 months & 74 & 40, 93 & 20 & 94 & 72, 99 & 21 & 88 & 79, 98 & 31 \\
\hline
\multirow{2}{*}{>18 months} & 75 & 63, 93 & 16 & 91 & 83, 100 & 16 & 95 & 86, 100 & 23 \\
\hline
& & p = 0.087 & & & p = 0.242 & & & p = 0.075 \\
\hline
Funding \\
\hline
Pharma & 74 & 54, 93 & 28 & 94 & 83, 100 & 29 & 93 & 85, 99 & 56 \\
\hline
Government/charity & 67 & 48, 86 & 38 & 85 & 70, 97 & 40 & 93 & 86, 96 & 49 \\
\hline
\multirow{2}{*}{Internal/unstated} & 56 & 51, 56 & 5 & 98 & 94, 100 & 6 & 95 & 91, 100 & 8 \\
\hline
& & p = 0.51 & & & p = 0.048 & & & P = 0.50 \\
\hline
\end{tabular}
\end{table} | PMC2717957_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Total number of patients} & & \textbf{47} \\
\hline
Male & & 24 \\
\hline
Female & & 23 \\
\hline
Age at start of ART (months) & Median (range) & 98 (8–151) \\
\hline
\multirow{2}{*}{WHO stage} & II & 22 \\
\hline
III & 25 \\
\hline
\multirow{4}{*}{Immunological stage} & I & 1 \\
\hline
II & 8 \\
\hline
III & 36 \\
\hline
Not classified & 2 \\
\hline
\end{tabular}
\end{table} | PMC2717958_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Total no. of visits with appointments given (\%)} & \textbf{401 (100)} \\
\hline
As scheduled & 206 (51) \\
\hline
Before appointment & 58 (15) \\
\hline
Within 1 week after appointment & 63 (16) \\
\hline
More than 1 week after appointment & 74 (18) \\
\hline
\end{tabular}
\end{table} | PMC2717958_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Demographics} & \textbf{N = 395*} \\
\hline
Gender (\% females) & 28.9\% \\
\hline
Age, years; mean (SD) & 39.1 (8.2) \\
\hline
Age at onset of disease, years; mean (SD) & 23.1 (7.1) \\
\hline
Severity of Psychopathology \\
\hline
Previous number of episodes; mean (SD) & 6.65 (8.3) \\
\hline
PANSS overall score; mean (SD) & 2.76 (0.46) \\
\hline
PANSS negative; mean (SD) & 2.83 (0.81) \\
\hline
PANSS positive; mean (SD) & 3.18 (0.66) \\
\hline
Quality of Life Functional Domains \\
\hline
QLS Instrumental Role Functioning; mean (SD) & 3.35 (0.90) \\
\hline
QLS Interpersonal Relations; mean (SD) & 2.57 (1.16) \\
\hline
QLS Intrapsychic Foundation; mean (SD) & 2.99 (1.13) \\
\hline
Cognitive Subdomains (z scores against healthy controls) \\
\hline
Working Memory; mean (SD) & -1.01 (1.12) \\
\hline
Verbal Memory; mean (SD) & -1.41 (1.3) \\
\hline
Processing Speed; mean (SD) & -1.12 (0.80) \\
\hline
\end{tabular}
\end{table} | PMC2717959_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{QLS Intrapsychic} & \textbf{QLS Intpersonal} & \textbf{Processing Speed} & \textbf{Working Memory} & \textbf{Verbal Memory} & \textbf{Neg} & \textbf{Pos} & \textbf{PANSS Overall} \\
\hline
QLS Instrumental & 0.58*** & 0.47*** & 0.15** & 0.13** & 0.16** & -0.23*** & -0.22*** & -0.32*** \\
\hline
\textbf{QLS Intrapsychic} & & 0.64*** & 0.21*** & 0.16** & 0.15** & -0.48*** & -0.26*** & -0.47*** \\
\hline
QLS Interpersonal & & & 0.15** & 0.02 & 0.02 & -0.38*** & -0.26*** & -0.37*** \\
\hline
\textbf{Processing Speed} & & & & 0.55*** & 0.53*** & -0.16** & -0.03 & -0.08 \\
\hline
\textbf{Working Memory} & & & & & 0.48*** & -0.02 & -0.09 & -0.10 \\
\hline
\textbf{Verbal Memory} & & & & & & -0.07 & -0.02 & -0.11* \\
\hline
PANSS \textbf{Neg} & & & & & & & 0.13* & 0.61*** \\
\hline
PANSS \textbf{Pos} & & & & & & & & 0.72*** \\
\hline
\end{tabular}
\end{table} | PMC2717959_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{QLS Intrapsychic} & \textbf{QLS Interpersonal} & \textbf{Processing Speed} & \textbf{Working Memory} & \textbf{Verbal Memory} & \textbf{Neg} & \textbf{Pos} & \textbf{PANSS Overall} \\
\hline
QLS Instrumental & 0.33*** & 0.23*** & 0.17* & 0.06 & 0.03 & -0.16* & -0.07 & -0.14* \\
\hline
\textbf{QLS Intrapsychic} & & 0.46*** & 0.22** & 0.11 & 0.06 & -0.38*** & -0.02 & -0.17* \\
\hline
\textbf{QLS Interpersonal} & & & 0.04 & -0.11 & -0.01 & -0.17* & -0.09 & -0.16* \\
\hline
\textbf{Processing Speed} & & & & 0.29*** & 0.25*** & -0.17* & 0.06 & -0.05 \\
\hline
\textbf{Working Memory} & & & & & 0.08 & 0.04 & -0.02 & 0.04 \\
\hline
\textbf{Verbal Memory} & & & & & & -0.15* & 0.12 & -0.05 \\
\hline
PANSS \textbf{Neg} & & & & & & & 0.12 & 0.60*** \\
\hline
PANSS \textbf{Pos} & & & & & & & & 0.75*** \\
\hline
\end{tabular}
\end{table} | PMC2717959_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Sample Size} & \textbf{Age (years)} & \textbf{Follow-up (months)} & \textbf{Baseline GFR (ml/min/1.73 m2) (inulin clearance)} & \textbf{Baseline creatinine (μmol/L)} & \textbf{Number of GFR measurements} & \textbf{Final GFR (ml/min/1.73 m2) (inulin clearance)} & \textbf{Final Creatinine (μmol/L)} \\
\hline
Whole group & 126 & 40.36 $\pm$ 12.48 [17–69] & 37.56 $\pm$ 27.04 [6–117] & 71.03 $\pm$ 24.02 [20–138] & 119.03 $\pm$ 50.85 [49–319] & 3.43 $\pm$ 2.06 [2–11] & 71.19 $\pm$ 26.93 [18–140] & 123.24 $\pm$ 69.195 [53–485] \\
\hline
Patients with deterioration in renal function & 65 & 39.15 $\pm$ 12.50 [20–65] & 42.86 $\pm$ 29.47 [6–117] & 75.30 $\pm$ 26.15 [20–138] & 123.15 $\pm$ 57.85 [49–316] & 3.72 $\pm$ 2.2 [2–11] & 61.67 $\pm$ 25.49 [18–118] & 141.81 $\pm$ 85.97 [63–485] \\
\hline
Patients with improvement in renal function & 61 & 41.65 $\pm$ 12.43 [17–69] & 31.91 $\pm$ 23.11 [6–93] & 66.47 $\pm$ 20.78 [24–124] & 114.81 $\pm$ 42.21 [53–285] & 3.13 $\pm$ 1.8 [2–10] & 81.32 $\pm$ 24.79 [25–140] & 103.45 $\pm$ 36.31 [53–247] \\
\hline
\end{tabular}
\end{table} | PMC2717960_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Accuracy 10\% (95\% CI)} & \textbf{Accuracy 30\% (95\% CI)} & \textbf{Accuracy 50\% (95\% CI)} \\
\hline
Cockcroft-Gault formula & 43.6\% [35\% – 52\%] & 41.3\% [33\% – 50\%] & 15\% [9\% – 22\%] \\
\hline
BSA-Cockcroft Gault formula & 53.2\% [44\% – 61\%] & 39.6\% [31\% – 48\%] & 7.1\% [3.6\% – 13\%] \\
\hline
Abbreviated MDRD equation & 37.3\% [29\% – 46\%] & 52.4\% [43\% – 60\%] & 10.3\% [6\% – 16,9\%] \\
\hline
Mayo Clinic Quadratic equation & 27.7\% [20\% – 36\%] & 39.7\% [31\% – 48\%] & 32.6\% [24\% – 41\%] \\
\hline
\end{tabular}
\end{table} | PMC2717960_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Method of GFR estimation} & \textbf{Slope of GFR (ml/min/1.73 m2/year) Median and [range]} & \textbf{p value in the Friedman test (non parametric ANOVA)} & \textbf{P value in Dunn's multiple comparison post-test} \\
\hline
\multirow{5}{*}{Subgroup of patients with deteriorating renal function (n = 65)} & Inulin Clearance & -3.72 [-0.48 to -72] \\
\hline
GFR Cockcroft-Gault & -4.08 [-0.36 to -60] & & NS \\
\hline
BSA-modified Cockcroft- Gault Formula & -3.48 [-0.24 to -56] & p = 0.29 & NS \\
\hline
Abbreviated MDRD equation & -3.12 [0 to -64] & & NS \\
\hline
Mayo Clinic Quadratic equation & -3.73 [0 to -78] & & NS \\
\hline
\multirow{5}{*}{Subgroup of patients with improving renal function (n = 61)} & Inulin Clearance & +6 [+0.36 to +99] \\
\hline
GFR Cockcroft-Gault & +4.2 [0 to +102] & p < 0.001 & p < 0.05 \\
\hline
BSA-modified Cockcroft- Gault Formula & +3.36 [+0.12 to +109] & & p < 0.05 \\
\hline
Abbreviated MDRD equation & +5.04 [0 to +138] & & p < 0.05 \\
\hline
Mayo Clinic Quadratic equation & +4.74 [0 to +53] & & p < 0.05 \\
\hline
\end{tabular}
\end{table} | PMC2717960_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \textbf{Original Cockcroft and Gault formula (CG)} & \textbf{BSA-modified- Cockcroft and Gault formula (BSA-CG)} & \textbf{Abbreviated MDRD equation (A-MDRD)} & \textbf{Mayo Clinic Quadratic equation (MCQ)} \\
\hline
\multirow{3}{*}{Subgroup of patients with deteriorating renal function (n = 65)} & Spearman Correlation coefficient (95\% confidence interval) with inulin clearance & r = 0.64 (0.43 – 0.78) & r = 0.67 (0.46 – 0.80) & r = 0.63 (0.41 – 0.78) & r = 0.49 (0.23 – 0.69) \\
\hline
Patients correctly classified as having deteriorating renal function & 74\% & 77\% & 75\% & 74\% \\
\hline
Bias (SD of bias) versus inulin clearance & 0.98 (6.08) & 1.37 (6.88) & 1.30 (5.95) & 1.32 (13.61) \\
\hline
\multirow{3}{*}{Subgroup of patients with improving renal function (n = 61)} & Spearman Correlation coefficient (95\% confidence interval) inulin clearance & 0.75 (0.58 – 0.86) & r = 0.75 (0.58 – 0.86) & r = 0.72 (0.54 – 0.84) & r = 0.46 (0.19 – 0.67) \\
\hline
Patients correctly classified as having improving renal function & 74\% & 74\% & 66\% & 68\% \\
\hline
Bias (SD of bias) versus inulin clearance & 3.08 (7.98) & 2.98 (7.63) & 1.27 (8.87) & 3.02 (15.46) \\
\hline
\end{tabular}
\end{table} | PMC2717960_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Cell population} & \multicolumn{2}{c|}{\textbf{ANTEROGRADE EVENTS (μm/sec Mean Velocity $\pm$ SE)}} & \multicolumn{2}{c|}{\textbf{RETROGRADE EVENTS (μm/sec Mean Velocity $\pm$ SE)}} \\
\hline
\textbf{Hippocampal neurons} & \textbf{\textbf{Axons}} & \textbf{\textbf{Dendrites}} & \textbf{\textbf{Axons}} & \textbf{\textbf{Dendrites}} \\
\hline
1–2 DIV & 0.23 $\pm$ 0.02 (142) & 0.25 $\pm$ 0.02 (114) & 0.29 $\pm$ 0.05 (22) & 0.20 $\pm$ 0.05 (9) \\
\hline
3–4 DIV & 0.26 $\pm$ 0.01 (214) & 0.36 $\pm$ 0.02 (199) & 0.43 $\pm$ 0.20 (5) & 0.27 $\pm$ 0.03 (44) \\
\hline
> 7 DIV & 0.33 $\pm$ 0.02 (86) & 0.22 $\pm$ 0.03 (68) & 0.35 (1) & 0.18 $\pm$ 0.03 (21) \\
\hline
PC12 Cells & \multicolumn{2}{c|}{0.18 $\pm$ 0.003 (382)} & \multicolumn{2}{c|}{0.17 $\pm$ 0.01 (86)} \\
\hline
\end{tabular}
\end{table} | PMC2717962_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Socioeconomic characteristic} & \textbf{– The least poor 'Abagaiga'} & \textbf{– 'Abafuni' (The Medium wealth category)} & \textbf{Abaavu – The poorest} \\
\hline
Income (financial capital) & Income generating activity e.g. shop or other business with capitalization from 400,000 – 1 million UGX & Low earning, unable to save & - Unable to raise small amounts (2,000 Ushs) in a crisis e.g. police bond or cannot have on them 1000 Ushs - Lacks a job that can bring in daily income - May have small amount of capital from 20,000 – 30,000 Ushs \\
\hline
Assets (physical and natural capital) & Means of transport – car or motorcycle; House – building materials – bricks, plastered walls, iron sheets, glass windows; state of maintenance and surrounding compound as important as building materials; Farmed land up to 5 acres & Cows, goats, hens with value up to 100,000 Ushs & Doesn't have anything Squalid home Poor beddings No material things to sell \\
\hline
Occupation & Self-employed in some business & Primary school teachers, petty traders & Does not work due to advanced age, illness, irresponsible social behavior, appearance (cannot obtain employment) Employment of casual nature \\
\hline
Ability to survive & Can obtain all needs in a timely manner without straining themselves & Can solve problems of magnitude up to 100,000 & - Lives hand to mouth - Cannot survive without borrowing or asking for assistance - Survives on social/community support e.g. needs to borrow or ask for help to obtain certain elements for survival - Usually lacks close family relatives \\
\hline
\end{tabular}
\end{table} | PMC2717964_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Category} & \textbf{Total number of participants} & \textbf{Men} & \textbf{Women} & \textbf{Occupations of participants} & \textbf{Other observations} \\
\hline
Least Poor "Abagaiga" & 8 & 5 & 3 & Mulimi (1 acre of rice, 1 acre of maize), produce buyer; Affiliate manager for habitat for humanity; health worker/nurse; peasant animal farmer with 1–2 cows & Observation – the rich were contacting each other with mobile phones to come for the meeting \\
\hline
Middle wealth category "Abafuni" & 15 & 11 & 4 & Mainly peasant farmers who also trade in farm produce, rear chicken, goats for trade on a small scale, primary school teachers \\
\hline
Poorest "Abaavu" & 12 & 11 & 1 & Types of occupation present – peasant crop farmers (ages, 23, 47, 55 yrs), local security man, 70 year old – can't dig anymore, another too old to work since 1992 has been sickly, not able to work, another urethral obstruction, difficult vision, no savings; no energy to dig has hernia, backache, poor vision 62 year old, 48 year old – no job, casual laborer. & The LC 1 chairman was present at this meeting \\
\hline
\end{tabular}
\end{table} | PMC2717964_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Village name} & \textbf{Least Poor} & \textbf{Medium wealth category} & \textbf{Poorest} & \textbf{Total} \\
\hline
Nawangisa & 8 & 15 & 12 & 35 \\
\hline
Men & 5 & 11 & 11 & 27 \\
\hline
Women & 3 & 4 & 1 & 8 \\
\hline
Kakongoka & 9 & 8 & 8 & 25 \\
\hline
Men & 5 & 4 & 4 & 13 \\
\hline
Women & 4 & 4 & 4 & 12 \\
\hline
Namundudi & 7 & 12 & 9 & 28 \\
\hline
Men & 5 & 6 & 5 & 16 \\
\hline
Women & 2 & 6 & 4 & 12 \\
\hline
\textbf{Total} & 24 & 35 & 29 & 88 \\
\hline
\end{tabular}
\end{table} | PMC2717964_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & & \multicolumn{5}{c|}{\textbf{Weight of tumor (g)}} \\
\hline
\textbf{Group (n = 12)} & \textbf{Dose (mg/kg)} & \textbf{Inhibition rate (\%)} & \textbf{Mean} & \textbf{SD} & \multicolumn{3}{c|}{\textbf{Percentiles}} \\
\hline
& & & & & \textbf{25th} & \textbf{50th (median)} & \textbf{75th} \\
\hline
Control & - & - & 1.368 & 0.388 & 1.070 & 1.229 & 1.718 \\
\hline
\multirow{2}{*}{Cyclophosphamide} & 60 × 1 & 67.81 & 0.440 & 0.084 & 0.371 & 0.415*** & 0.523 \\
\hline
2 × 6 & 42.85 & 0.782 & 0.154 & 0.634 & 0.790*** & 0.946 \\
\hline
\multirow{2}{*}{Acetylshikonin} & 1 × 6 & 21.86 & 1.067 & 0.214 & 0.850 & 1.010* & 1.273 \\
\hline
0.5 × 6 & 11.11 & 1.307 & 0.364 & 0.962 & 1.376 & 1.640 \\
\hline
\end{tabular}
\end{table} | PMC2717966_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & & & \multicolumn{3}{c|}{\textbf{Percentiles}} \\
\hline
\textbf{Group (n = 10)} & \textbf{Dose (mg/kg)} & \textbf{Mean} & \textbf{SD} & \textbf{25th} & \textbf{50th (median)} & \textbf{75th} \\
\hline
Bax \\
\hline
Control & - & 13633 & 2531 & 11244 & 13712 & 15634 \\
\hline
\multirow{3}{*}{Acetylshikonin} & 2 × 6 & 48678 & 2534 & 46432 & 48519*** & 51406 \\
\hline
1 × 6 & 28502 & 5064 & 23628 & 30232*** & 33082 \\
\hline
0.5 × 6 & 21844 & 4882 & 16476 & 22988** & 26209 \\
\hline
bcl-2 \\
\hline
Control & - & 19859 & 2822 & 17076 & 20065 & 22292 \\
\hline
\multirow{3}{*}{Acetylshikonin} & 2 × 6 & 8126 & 1115 & 7267 & 7926*** & 8596 \\
\hline
1 × 6 & 11171 & 1459 & 9916 & 10814*** & 12478 \\
\hline
0.5 × 6 & 15652 & 1724 & 14447 & 15234** & 16742 \\
\hline
Bax/bcl-2 \\
\hline
Control & - & 0.70 & 0.17 & 0.58 & 0.74 & 0.79 \\
\hline
\multirow{3}{*}{Acetylshikonin} & 2 × 6 & 6.11 & 0.92 & 5.54 & 6.05*** & 6.26 \\
\hline
1 × 6 & 2.56 & 0.36 & 2.34 & 2.47*** & 2.77 \\
\hline
0.5 × 6 & 1.41 & 0.32 & 1.14 & 1.29** & 1.77 \\
\hline
Caspase-3 \\
\hline
Control & - & 12746 & 3155 & 10359 & 12019 & 13714 \\
\hline
\multirow{3}{*}{Acetylshikonin} & 2 × 6 & 31618 & 3155 & 29396 & 31226*** & 33530 \\
\hline
1 × 6 & 22653 & 4647 & 18898 & 21756*** & 25119 \\
\hline
0.5 × 6 & 13582 & 3737 & 10009 & 13186 & 17705 \\
\hline
\end{tabular}
\end{table} | PMC2717966_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Accession} & \textbf{Name} & \textbf{Def allele} \\
\hline
JI 116 & cv. Parvus & Def (wild type) \\
\hline
JI 2822 & RIL, research line & Def (wild type) \\
\hline
JI 1184 & Priekuskij-341-def & def (mutant) \\
\hline
JI 3020 & cv. Nord & def (mutant) \\
\hline
\end{tabular}
\end{table} | PMC2717967_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene identification/Gene description} & \textbf{E value/ID (\%)} & \textbf{Primer sequence/Amplicon size} & \textbf{Amplification efficiency $\pm$ SD*} & \textbf{GeneBank Accession Number} \\
\hline
BbrizEF1 Elongation factor-1 alpha & 4e-89/ 166/179 (92\%) & 5'ACCCTCCTCTTGGTCGTT TT3' 5'AGCCCCTCATTTCTTCTT GG 3' 105 bp & 0.87 $\pm$ 0.012 & EZ000623 \\
\hline
BbrizEIF4A Eukaryotic initiation factor 4A & 4e-41/ 88/100 (88\%) & 5'TAAGGTGGGGCTTGTTTT TG3' 5'ACAGCAGCACATACCACA GG3' 164 bp & 0.94 $\pm$ 0.011 & EZ000622 \\
\hline
BbrizGAPDH glucose-6-phosphate dehydrogenase & 2e-39/ 86/121 (71\%) & 5'TGAATCTAGTCCATCCGC TTG3' 5'TCATCAGGCAGGGAAGCT A3' 124 bp & 0.97 $\pm$ 0.009 & GE617483 \\
\hline
BbrizGDP glyceroldehyde-3-phosphate dehydrogenase & 6e-22/ 48/55(87\%) & 5'GGGCATTTTGGGTTATGT TG3' 5'TCCCCACTCGTTGTCATA CC3' 146 bp & 1.01 $\pm$ 0.009 & EZ000624 \\
\hline
BbrizSUCOA succinyl-CoA ligase (GDP- forming) beta-chain & e-107/ 203/236 (86\%) & 5'CAGCAAGGGAGGAACCAG TA3' 5'TAGCGCAAGACCATCAAC AA3' 130 bp & 1.00 $\pm$ 0.008 & GE617476 \\
\hline
BbrizTUB putative tubulin alpha-5 chain & 4e-51/ 96/98 (97\%) & 5'ATGAAGGCGATGAAGGAG AA3' 5'GTACGCAATGGAATGGAA CC3' 112 bp & 1.01 $\pm$ 0.019 & GE617477 \\
\hline
BbrizUBCE1 Ubiquitin-conjugating enzyme BbrizUBCE2 & 4e-31/ 64/74 (86\%) & 5'GGTCTTGCTCTCCATCTG CT3' 5'CGGGCTGTCGTCTCATAC TT3' 114 bp 5'ACCAGCACAAATCAAAGG A3' 5'GCCAAAGTATGAGACGAC AGC3' 149 bp & 0.92 $\pm$ 0.013 0.95 $\pm$ 0.015 & GE617481 \\
\hline
BbrizUBI ubiquitin/ribosomal protein & 4e-06/ 28/49 (57\%) & 5'GTCACTAAGCCATCGGTC GT3' 5'ACACGGACACAACCAGTT CA3' 112 bp & 0.94 $\pm$ 0.020 & GE617482 \\
\hline
\end{tabular}
\end{table} | PMC2717968_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Exons} & \textbf{PCR product size (bp)} & \textbf{PCR anealing temperature (°C)} & \textbf{Primers} \\
\hline
\multirow{2}{*}{1A} & 305 & 62 & F 5'-CTTGAACCCGCGAACAGGCGA \\
\hline
& & R 5'-TCTCGGGCACCTGCGCTGGA \\
\hline
\multirow{2}{*}{1B} & 365 & 68 & F 5'-GCAGAGCAGCGGCAGCGGGTAT \\
\hline
& & R 5'-TATTTTACCGCCGCGCGGCGCA \\
\hline
\multirow{2}{*}{2} & 241 & 65 & F 5'-CTCAAGAAAGGGGCTAACTTCTCAA \\
\hline
& & R 5'-GCACTTCCTGGCTTTTAAGATTGGG \\
\hline
\multirow{2}{*}{3+4} & 352 & 60 & F 5'-CAGGCCAACTTCTAACCACACACCT \\
\hline
& & R 5'-CCGAAGCTGGCCATGCTGGG \\
\hline
\multirow{2}{*}{5} & 295 & 65 & F 5'-CTGTCTGTGTGTCTGTCTGTCC \\
\hline
& & R 5'-GGCCAGCCTGGCAGGCGGGAAGG \\
\hline
\multirow{2}{*}{6} & 264 & 58 & F 5'-ACTCCCCGAAGAGGGGTTCAAGG \\
\hline
& & R 5'-GAGGCTCCTGAGTACCACCC \\
\hline
\multirow{2}{*}{7} & 234 & 65 & F 5'-CAAGGTCAGTTCCTCCACCTTGCC \\
\hline
& & R 5'-GAAGAGTAGCCCTGCAGGGTGACT \\
\hline
\multirow{2}{*}{8} & 164 & 72 & F 5'-GGAGCTAAGGCGAGCTCTGGC \\
\hline
& & R 5'-GGCATGCTCCTGGGGACTGGG \\
\hline
\multirow{2}{*}{9} & 253 & 72 & F 5'-CAAGGAGCCCATTCTCTCCCTT \\
\hline
& & R 5'-TGCCTTGCTGGGCCTCGAAGG \\
\hline
\multirow{2}{*}{10} & 318 & 72 & F 5'-CTGAGAGAGCTGGTGCTGAGG \\
\hline
& & R 5'-AGGCCGCCCACCCTCCACACT \\
\hline
\multirow{2}{*}{11} & 160 & 65 & F 5'-GCAGGCAGTGGCATCAGCAAG \\
\hline
& & R 5'-CCCCATAGCCCACAGGTATGCAGG \\
\hline
\multirow{2}{*}{12+13A} & 368 & 72 & F 5'-TGTGTGCCACCGGCCTCCCA \\
\hline
& & R 5'-GGGAAGGAGGGTGGCCGTGG \\
\hline
\multirow{2}{*}{13B} & 364 & 68 & F 5'-GTGGGTGAACCCCCACAAGGTC \\
\hline
& & R 5'-TGGCCCCACTCAGGAGTGAGAC \\
\hline
\multirow{2}{*}{13C} & 377 & 68 & F 5'-CCATTCGTCTGTCCCAGAGCTTA \\
\hline
& & R 5'-TGGGACAAGGAAGTGGGTCCTCA \\
\hline
\end{tabular}
\end{table} | PMC2717975_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & & & \multicolumn{2}{c|}{\textbf{Haemoglobinuria Kinh N = 82}} & \textbf{Healthy Kinh N = 266} & \textbf{Healthy S'tieng N = 258} \\
\hline
\textbf{Variant} & \textbf{Variant} name & \textbf{Amino acid substitution} & \textbf{Mutation classa} & \textbf{G6PD+ N = 34} & \textbf{G6PD- N = 48} & \textbf{G6PD- N = 23} & \textbf{G6PD- N = 36} \\
\hline
Non-synonomous \\
\hline
G7A & Vietnam 1 & Glu3Lys & * & & 1 \\
\hline
A95G & Gaohe Gaozhou & His32Arg & 3 & & 1 \\
\hline
T10148G & Vietnam 2 & Phe66Cys & * & & & 1 \\
\hline
C11763T & Coimbra Shunde & Arg198Cys & 2 & 1 & & 1 \\
\hline
G13031A & Viangchan Jammu & Val291Met & 3,2 & 1 & 17 & 2 & 13 \\
\hline
C13184T & Chinese-5 & Leu342Phe & 3 & 0 & 1 & 3 & 1 \\
\hline
synonomous \\
\hline
C10170T & Vietnam 3 & Ser73Ser & & & & 1 \\
\hline
C13714T & nt13714C>T & Tyr437Tyr & & 10 & 14 & 9 & 21 \\
\hline
\end{tabular}
\end{table} | PMC2717975_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{G6PD} & \textbf{Hburiac Kinh N = 82} & \textbf{Healthy Kinh N = 266} & Hburia Kinh \textbf{G6PD}- N = 48 & Healthy Kinh \textbf{G6PD}- N = 23 & \textbf{OR} & \textbf{95\%CI} & \textbf{P value} \\
\hline
deficiencya & 48 & 23 & & & 14.9 & 7.74 – 28.9 & < 0.0001 \\
\hline
definiteb & 23 & 23 & & & 4.11 & 2.04–8.24 & < 0.0001 \\
\hline
Viangchan Jammu & & & 17 & 2 & 5.7 & 1.14 – 55.4 & 0.022 \\
\hline
Chinese-5 & & & 1 & 3 & 0.14 & 0.002 – 1.9 & 0.09 \\
\hline
Vietnam 1 & & & 1 & 0 \\
\hline
Gaohe Gaozhou & & & 1 & 0 \\
\hline
Vietnam 2 & & & 0 & 1 \\
\hline
\end{tabular}
\end{table} | PMC2717975_table_2 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.