Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Aedes aegypti in the presence of optimal and sub-optimal larval diets.Genetic modification of mosquitoes offers a promising strategy for the prevention and control of mosquito-borne diseases. For such a strategy to be effective, it is critically important that engineered strains are competitive enough to serve their intended function in population replacement or reduction of wild mosquitoes in nature. Thus far, fitness evaluations of genetically modified strains have not addressed the effects of competition among the aquatic stages and its consequences for adult fitness. We therefore tested the competitive success of combinations of wild, inbred and transgenic (created in the inbred background) immature stages of the dengue vector Ae. aegypti demonstrated greater performance than the inbred strain, which in turn demonstrated greater performance than the genetically modified strain. Moreover, increasing competition through lowering the amount of diet available per larva affected fitness disproportionately: transgenic larvae had a reduced index of performance (95-119%) compared to inbred (50-88%) and wild type larvae (38-54%). In terms of teneral energy reserves , adult wild type mosquitoes had more reserves directly available for flight, dispersal and basic metabolic functions than transgenic and inbred mosquitoes.The wild strain of Our study provides a detailed assessment of inter- and intra-strain competition across aquatic stages of wild type, inbred, and transgenic mosquitoes and the impact of these conditions on adult energy reserves. Although it is not clear what competitive level is adequate for success of transgenic strains in nature, strong gene drive mechanisms are likely to be necessary in order to overcome competitive disadvantages in the larval stage that carryover to affect adult fitness. Anopheles gambiae Giles and Aedes aegypti L. mosquitoes [The incidence of arthropod-borne diseases is increasing globally ,2. Contrsquitoes -10, vectsquitoes ,12.Of critical importance is the ability of released GM mosquitoes to survive, mate and pass on desirable genetic traits . GM mosqAe. aegypti, but not at varying nutrition levels or with mixtures of transgenic and wild-type mosquitoes, as would eventually occur in nature. Furthermore, other studies have not considered the effects of larval competition and only provided insight into adult survival and fecundity [An unresolved issue is how competition among the immature stages of wild and GM mosquitoes may affect population reduction or replacement. Irvin et al. reportedecundity ,19. AnotAe. aegypti: (1) a wild-type (second generation) strain collected from Mexico (referred to as 'Wild'), (2) Higgs' white eye (HWE), an inbred, white eye mutant strain (referred to as 'Inbred') and (3) a transgenic strain with a green fluorescent protein (GFP) insert (referred to as 'Transgenic'). The latter strain was created using the HWE genetic background. Because breeding sites of Ae. aegypti, such as water storage containers and tires, are often food-limited which may lead to density-dependent competition [Therefore, we evaluated the impact of inter- and intra-strain competition on the performance of three strains of petition -22, we tpetition .2 = 221.47, df = 1, P < 0.001). At high diet conditions, survival ranged from 78 to 100% and at low diet levels from 27 to 76% . This effect was not significant for the Transgenic and Wild strains . At low diet levels, there was no significant interaction, but clear main effects of strain and competitor , whereas Inbred had significantly higher survivorship than Transgenic . A similar ranking was found for the competitor effect whereby Wild had a stronger, negative impact on survival of the other larvae in the well than Transgenic . Although the effect of Inbred on survival of the other strains was intermediate, it did not differ significantly from Wild or Transgenic .At 'high' diet conditions, survival of larvae to the pupal stage was significantly higher than under 'low' diet conditions , subsequent analyses of development time were conducted separately for the four 2 × 2) different level combinations of food and sex. Wild males at optimal food conditions developed significantly faster to the pupal stage than Inbred or Transgenic males , suggesting higher intra-strain than inter-strain competition. This was also the case for females of the Wild and Inbred strain at high diet levels and Wild females at low diet level , but not for Inbred females at low diet level . Such effects were not observed with Transgenic larvae , subsequent analyses of pupal size were performed separately for the four different levels of food and sex (similar to the results on development time). For all four models, significant interactions between strain and competitor existed Table , indicatFigure Glycogen levels of the Wild strain were significantly higher than the Inbred and/or Transgenic strain, except for females at the high diet level Figures and 5-B.Ae. aegypti larvae when compared to their wild counterpart. Clearly, this outcome of competition was mediated by the relative competitive strength of each strain as well as the amount of food available. First, the results of increased development time of Inbred and Transgenic larvae were most pronounced at high diet conditions for both males and females. Second, when competition for food was highest , the wild-type strain was a superior competitor in terms of survival over the inbred strain, which in turn was superior over the transgenic strain . In general, glycogen reserves for the Wild strain were higher than for the Inbred and/or Transgenic strains. Lipid reserves showed a reverse trend for males, but not significantly so, whereas for females lipids showed a similar trend as glycogen levels. This suggests sex-specific variation in energetic budget as demonstrated for the malaria vector gambiae . Because gambiae ,27.Although the inbred and transgenic strains had a different origin than the wild strain (Puerto Rico versus Mexico), and intrinsic genetic differences could not be ruled out completely, our results on reduced competitive ability and altered metabolism are most likely the consequence of detrimental effects of both inbreeding and genetic modification. Ideally, transformation should be conducted on genetically diverse laboratory strains which could mitigate the impact of modification and inbreeding .Although it is not clear just how competitive modified mosquitoes need to be compared with wild type mosquitoes in order to replace vector populations, the fitness effects observed in our study are likely to be relevant. First, the strong dependence on food level suggests that the outcome of competition is not fixed and thus fitness evaluations should not be performed only under 'ideal' laboratory conditions -19. NextFuture studies on competition and fitness of transgenic mosquitoes should address how the competitive ability of various transgenic strains is affected when exposed to different scenarios of density-dependent and density-independent factors . These studies should address both the fitness cost of inbreeding as well as genetic modification. In line with our results, other studies have shown that expression of genetic background strongly depends on environmental conditions (gene by environment interactions) ,34. SimiAe. aegypti: (1) wild-type (Wild); larvae were second generation offspring of field collected pupae from Tapachula, Mexico ; (2) Higgs' white eye (HWE), an eye-pigment deficient variant of the Puerto Rican Rexville D strain [piggyBac transposable element and (3). comm.; ). All stet al. [Ae. aegypti. Wells of 12-well cell culture plates were filled with five ml tap water. Water was added daily to account for evaporation. Newly hatched first-instar larvae (~ 4 h old) were introduced in the following six combinations at high and low diet regimens: (1) 4 Wild larvae, (2) 4 Transgenic larvae, (3) 4 Inbred larvae, (4) 2 Wild plus 2 Transgenic larvae, (5) 2 Wild plus 2 Inbred larvae and (6) 2 Transgenic plus 2 Inbred larvae. We added 0.15, 0.3, 0.6 and 0.6 mg of food per larva on days 0, 1, 3 and 5, respectively, for the high diet regimen . This diet amount was found to be optimal for development of large body size mosquitoes in previous experiments in our laboratory. The low diet consisted of half the amount of the high diet regimen . Mortality was recorded daily and, over the course of the study, the amount of food added to each well was adjusted to the number of larvae remaining. Thirty replicates per treatment were carried out.We followed the approach of Agnew et al. to studyy = 1.110x + 0.014 and y = 0.974x + 0.119 for females and males, respectively, whereby x = cephalothorax length (mm) and y = adult wing length (mm). GFP expression in the eyes of pupae was visualized using a Stemi 2000-C stereomicroscope equipped with an Endura Bright Royal Blue (450 nm) LED-light and a yellow barrier filter . The experiments were terminated when all larvae had died or pupated.Time to pupation was recorded, as well as sex of pupae . Size ofTo test for differences in nutritional reserves of teneral adults emerging from the single species treatment, we determined glycogen, lipid and sugar content using previously published protocols -42. Bodyas a competitor had a greater negative impact on survival, development time or pupal size than the Transgenic strain. Significant interactions between strain and competitor were indicative of intra-strain versus inter-strain differences, i.e. survival, development time and pupal size for larvae reared with their own strain were different than when reared with any of the two other strains. This hypothesis was analyzed by specifying post-hoc contrasts, and significance was evaluated by using Tukey-HSD tests or by correcting significance levels using the Bonferroni correction.Our analyses focused on detecting differences in survival to the pupal stage, development time and pupal size that were inherent to the strain (strain effect), how each strain affected survival, development and size of the other larvae in the same wells (competitor effect), and how these effects changed at optimal and sub-optimal diet levels. Random plate and well effects were not found to be significant in our initial model development; consequently, they were removed from further analysis. Survival data were analyzed with the binomial logistic regression procedure . Analyses of development time and pupal size were performed with standard least squares models . Significant main effects in all models without significant interactions were indicative of a 'ranking' in strain and competitor effects. In that case, post-hoc contrasts were specified to test the hypothesis that the Wild strain was 'stronger' than the Inbred strain , that the Inbred strain was stronger than the Transgenic strain and that the Wild strain was stronger than the Transgenic strain. Similarly, we tested the hypothesis that the Wild or Inbred strain Ideally, the overall impact of transgenesis and inbreeding for cohorts of organisms should be assessed by calculating per capita rates of change. In our study, a simpler index of performance was calculated that combines information about survivorship and fecundity in a way that essentially simulates computation of the per capita rate of change :0 Nrepresents the initial number of females (assumed to be 50% of the starting number in our experiments); x Ais the number of adult females produced at time x of the experiment; ult size . IndicesFinally, strain differences in glycogen, lipid and sugar content per unit body size were evaluated for the adults that emerged from the single species experiments. Standard least square regression procedures were used for this purpose. Post-hoc tests were based on least square differences (LSD).The authors declare that they have no competing interests.CJMK carried out the experimental work, analyzed the data and drafted the manuscript. MK participated in statistical data analyses and helped to draft the manuscript. LCH participated in study design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.This work was funded by a grant from the Foundation for the National Institutes of Health through the Grand Challenges in Global Health Initiative.

Our results illustrate that LILFU can stimulate electrical activity in neurons by activating voltage-gated sodium channels, as well as voltage-gated calcium channels. The LILFU-induced changes in neuronal activity were sufficient to trigger SNARE-mediated exocytosis and synaptic transmission in hippocampal circuits. Because LILFU can stimulate electrical activity and calcium signaling in neurons as well as central synaptic transmission we conclude US provides a powerful tool for remotely modulating brain circuit activity.Possessing the ability to noninvasively elicit brain circuit activity yields immense experimental and therapeutic power. Most currently employed neurostimulation methods rely on the somewhat invasive use of stimulating electrodes or photon-emitting devices. Due to its ability to noninvasively propagate through bone and other tissues in a focused manner, the implementation of ultrasound (US) represents a compelling alternative approach to current neuromodulation strategies. Here, we investigated the influence of low-intensity, low-frequency ultrasound (LILFU) on neuronal activity. By transmitting US waveforms through hippocampal slice cultures and Neuromodulation techniques such as deep brain stimulation (DBS) and repetitive transcranial magnetic stimulation (rTMS) have gained widespread attention due to their therapeutic utility in managing numerous neurological/psychiatric diseases 2, whereas non-thermal therapeutic effects of US have been well described at power levels ranging from 30–500 mW/cm2Coupling its ability to interact with biological tissues 2+ concentration of fibroblasts + influx and efflux Modulation of ionic conductance produced by adiabatic processes as US propagates rapidly and transiently through cellular membranes may alter the activity of individual neurons due to the elastic nature of lipid bilayers and the spring-like mechanics of many transmembrane protein channels. In partial support of this hypothesis, low-power US has been shown to influence the membrane conductance of frog skin epidermis TA ∼80 W/cm2), significantly reduces the amplitude of evoked potentials in CA1 pyramidal neurons. In the dentate gyrus of hippocampal slices, focused US pulses have been shown to both enhance and suppress electrically evoked field potentials 2 continuous wave (5 min) US (3.5 MHz) increased the amplitude of compound action potentials (CAP), while both 2 and 3 W/cm2 intensities decreased CAP amplitudes. Mihran and colleagues (1990) also reported differential excitatory and inhibitory effects of US on frog sciatic CAPs using relatively short irradiation times by delivering 500 µs US pulses (2.0–7.0 MHz) with peak intensities ranging from 100–800 W/cm2. Direct activation of the cat auditory nerve has been achieved in vivo using 5-MHz US pulses In a pioneering study, Fry and colleagues (1950) first demonstrated US is capable of modulating neuronal activity by reporting the temporary suppression of spontaneous activity following US transmission through crayfish ventral nerve cords Although numerous intriguing studies examining the influence of US on neuronal activity have been conducted, these previous investigations have implemented high-intensity US, which can destroy nervous tissue. Thus, we decided to investigate the influence of low-intensity ultrasound on neuronal activity. Most of the prior investigations examining the effect of US on neuronal activity also used high-frequency US of 2.9 W/cm2 and a temporal average intensity (ITA) of 23 mW/cm2. We transmitted LILFU waveforms through hippocampal slice cultures from remotely positioned tissue-matched piezoelectric (PZT) transducers . We cons+ indicator CoroNa Green AM + transients in hippocampal CA1 pyramidal neurons and Sulforhodamine 101 as previously described 2+ transients in both hippocampal pyramidal neurons and glial cells with faster kinetics as expected nearly abolished OGB-1 signals in response to LILFU-1, indicating Ca2+ transients triggered by LILFU are primarily mediated by voltage-gated Ca2+ channels . Similar to water and aqueous buffers, soft biological tissues (including brain) have relatively low acoustic absorption coefficients. Therefore, we sought to determine if LILFU propagated through whole brain tissue was also capable of stimulating neuronal activity. We imaged OGB-1 signals on the dorsal superficial surface of ex vivo brains (n = 3) obtained from wild-type adult mice while transmitting LILFU waveforms through their ventral surfaces mice spH of 18.52±2.2% at individual release sites (n = 148 from 15 slices) in CA1 stratum radiatum, which primarily represent CA3-CA1 synapses in a Ca+ conductance and action potentials in LILFU-triggered synaptic vesicle release (spH by ∼50% compared to controls indicating that LILFU stimulates synaptic transmission (network activity) and not merely exocytosis are known to possess varying degrees of mechanical sensitivity 2+ transients indicating the primary action of LILFU may be on voltage-gated Na+ channels. However, the addition of Cd2+ further reduced LILFU-activated Ca2+ transients, which suggests at least some voltage-gated Ca2+ channels may be sensitive to LILFU. Indeed, L-type, N-type, T-type, and P-type Ca2+ channels have been shown to be mechanically sensitive under various conditions The mechanisms underlying US activation of voltage-sensitive channels in neurons are presently unknown. We postulate however the mechanical nature of US and its interactions with neuronal membranes leads to the opening of mechanically sensitive voltage-gated channels. Supporting this hypothesis, we observed that TTX a voltage-gated NaFurther studies are required to identify which ion channels are sensitive to US, as well as to characterize how these channels respond to US as a function of acoustic intensity. By imaging large fields of view and monitoring the responses from large populations of neurons, we observed that LILFU-1 stimulated activity in ∼30% of the neurons in a given field. These observations raise several interesting issues. We question for instance whether neurons, which have been recently active, are less susceptible to US stimulation. In other words, the kinetic states of a neuron's ion channels may shape how responsive a given cell is to US stimulation. It could also be the case that recently active neurons are more responsive to US stimulation. We are currently in the process of investigating these issues. The individual properties of US waveforms will also likely determine how effective a given waveform is at stimulating neuronal activity. With respect to acoustic intensity for example, we observed that US waveforms having moderate intensities were more robust in triggering synaptic transmission compared to US waveforms possessing lower or higher intensities. Future studies investigating the influence of US on neuronal activity should consider interactions among waveform parameters such as tone-burst duration (pulse length), pulse repetition frequency, exposure time, acoustic frequency, and acoustic intensity. Understanding how waveform characteristics contribute to the actions of US on neuronal activity will be an important issue to resolve. One particularly interesting question is can LILFU be used in a molecularly specific manner–perhaps by inducing protein specific resonances using an optimal acoustic frequency or particular LILFU waveform?2 to modulate neuronal activity in hippocampal brain slices 2 to trigger peripheral pain sensations in humans 2) Having a long and proven safety record, US is widely used for diagnostic medical imaging, as well as in an array of noninvasive therapies in vivo. In most soft tissues, cavitation rarely induces damage at pressures <40 MPa Due to the lack of gas bodies in most soft tissues including brain While we have studied the actions of US on neuronal activity by monitoring ionic conductance and synaptic vesicle exocytosis, we recognize US may influence signaling molecules capable of influencing neuronal function. In other tissues, the activity of several signaling molecules also present in neuronal tissues are known to be influenced by US. For example, low-intensity pulsed US stimulates TGF-β signaling, which triggers the differentiation of human mesynchymal stem cells into chondrocytes Additional actions on conserved cell signaling pathways further support explorations into the use of US as a neuromodulation tool. NF-κB is known to regulate neuronal survival and plasticity As a tool for modulating neuronal function, US has been studied and considered across a range of uses from thermal ablation of nervous tissues to its ability to produce sensory perceptions ex vivo human skulls, the optimal gain for the transcranial US transmission and brain absorption is between 0.60 and 0.70 MHz Transcranial ultrasonography of the basilar artery has been shown to trigger auditory sensations in human subjects in vivo.It is possible to focus US fields using a variety of approaches. Pulsed US (<1 MHz) can be focused through human skulls to points within 1 mm of intended loci using phased US transducer arrays in vitro. We have provided the first direct evidence that US modulates the ionic conductance of neurons and astrocytes to increase cellular activity and synaptic transmission in a manner sufficient to stimulate neuronal circuits. Several issues need to be resolved before the full potential of US in controlling neuronal activity can be realized. Since US is capable of being focused through the human skull however, one tantalizing possibility is that LILFU may permit deep-brain stimulation without the need for surgically implanted devices or other invasive procedures.Our observations demonstrate that LILFU can be used to remotely stimulate the activity of central nervous system neurons and circuits thy-1-spH, thy-1-YFP, or wild-type mice similar to previously described methods in vitro on Millicell-CM filter inserts in a 36°C, 5% CO2, humidified (99%) incubator. Slices were used for experiments between 7 and 12 days in vitro. In some experiments to cleave SNARE-proteins, BoNT/A (250 ng/mL) was added to the slice culture media 24–36 h prior to use.All procedures involving mice were conducted in accordance with federal guidelines and protocols approved by the Institutional Animal Care and Use Committee at Arizona State University. Hippocampal slice cultures were prepared from postnatal day 7–8 ex vivo brains using the following approach. Following CO2 inhalation, wild-type mice were rapidly decapitated and their brains were removed. The dura was carefully removed and the brains were then placed in ice-cold artificial CSF (aCSF) containing (in mM) 83 NaCl, 2.5 KCl, 3.3 MgSO4, 1 NaH2PO4, 26.2 NaHCO3, 22 glucose, 72 sucrose, and 0.5 CaCl2, and equilibrated with 95% O2/5% CO2. Brains were allowed to recover for 5 min in the ice-cold aCSF before recovering for ∼20 min at 37°C. Following this recovery period, ex vivo brains were bulk loaded with OGB-1 AM .We prepared ex vivo brains with OGB-1 AM we used a procedure similar to above, but substituted the slice culture medium for dissection aCSF (see above)–we added 60 µL of the dye-containing solution to 9 mL dissection aCSF. Brains were loaded for 30 min at room temperature then rinsed three times and allowed to recover for an additional 30 min in dissection aCSF at room temperature before use.In order to load slice cultures prepared from wild-type mice with CoroNa Green AM , 5 µL 20% Pluronic F-127 in DMSO (Invitrogen) was added to a 50 µg vial of CoroNa Green AM. The dye solution was then vortexed for 15 min before adding 100 µL culture medium. We then added 5 µL of the dye-containing solution to 1 mL culture medium underneath culture inserts, as well as adding 5 µL to the surface of slices. Following a 10 min incubation time at 36°C, slices were washed three times with slice culture medium, allowed to recover an additional 10 min, and then used for experiments. To load slice cultures with OGB-1 AM, we added 2 µL 20% Pluronic F-127 in DMSO and 8 µL DMSO to a 50 µg vial of OGB-1 AM. The dye-containing solution was then vortexed for 30 M before adding 90 µL culture media. We next added 20 µL of this dye-containing solution to 3 mL culture medium and incubated slices in this solution for 30–40 min at 37°C. Slices were washed three times with slice culture medium, then loaded with sulforhodamine 101 or allowed to recover for 30 min prior to an experiment. To load ex vivo brains were transferred to recording chambers containing recording aCSF (in mM) 136 NaCl, 2.5 KCl, 1.3 MgSO4, 10 HEPES, 10 glucose, and 2.5 CaCl2 , pH 7.4 at room temperature. Recording chambers were affixed above US transducers on a custom built-stage on an Olympus Fluoview FV-300 laser-scanning confocal microscope . Excitation of spH, OGB-1 AM, and CoroNa Green AM was performed using the 488 nm laser-line of an argon laser and in some experiments DiI was excited using a 546 nm HeNe laser. Time-series images were acquired using 20×(0.5 NA) or 40×(0.8 NA) Olympus UMPlanFL water-immersion lens.Slice cultures or whole ex vivo brains, the ventral surface of whole ex vivo brains were glued to the bottom of polystyrene 6-well plates using superglue, which were filled with aCSF and mounted above US transducers using ultrasonic coupling gel. Confocal imaging of OGB-1 fluorescence was conducted on the superficial dorsal surface of ex vivo brains during transmission of LILFU waveforms from the ventral surface of the brain.Slice recording chambers consisted of culture inserts placed inside an aCSF reservoir held in place with either vacuum grease on the silicon face of the transducer. This approach produced ∼4.5 mm standoff distance between the face of the transducer and the imaging plane on the surface of slices. In a subset of experiments, slice cultures (n = 5) were mounted near the top of an aCSF column in a 500 mL beaker containing immersed US transducers, which were affixed to the bottom beakers to provide a 45 mm standoff distance. To image In a subset of experiments we performed whole-cell current clamp recordings from visually identified CA1 pyramidal neurons using standard approaches. Briefly, patch electrode pipettes filled with an intracellular solution containing (in mM) 130 KCl, 10 Na-HEPES, 10 Di-Tris-P-creatine, 0.2 EGTA, 3 Mg-ATP, and 0.5 Na-GTP, 280–290 mOsm, pH 7.2; the final resistance of these unpolished patch electrodes was 5–7 MΩ. Current clamp recordings were performed using a MultiClamp 700B patch-clamp amplifier with pCLAMP 10 software . Following 5–10 min of whole-cell access, changes in membrane voltage were recorded in response to stimulation with LILFU waveforms.In our studies we used custom built PZT ultrasound transducers (d = 35 mm) having a single quarter-wave matching layer, a center frequency of 0.53 MHz, and a −6 dB fractional bandwidth of 65% with two peaks . LILFU waveforms used as stimuli were generated by repeating pulse trains of US tone bursts at a pulse repetition frequency until a desired number of tone bursts had been generated . Ultrasoxyz micromanipulator mounted on the vibration isolation table attached to the microscope stage (PA and ITA) were calculated using published equations and technical standards established by the American Institute of Ultrasound in Medicine and the National Electrical Manufacturers Association To characterize LILFU power levels, we recorded voltage waveforms produced by US pressure waves using a hydrophone and an Agilent DSO6012A 100 MHz digital oscilloscope . To confirm transducers were operating at the intended acoustic frequency, we performed an FFT on hydrophone voltage traces recorded in response to US tone bursts. All pressure waves produced by LILFU waveforms were measured at points corresponding to tissue positions in the actual recording chambers by positioning the hydrophone face using a pe stage . The posImageJ (http://rsb.info.nih.gov/ij/) or the Olympus Fluoview 5.0 software. We express changes in spH fluorescence as a percent change from baseline fluorescence levels. For OGB-1 and CoroNa Green signals, we calculated ΔF/F0 using standard approaches where ΔF = F−F0. LILFU waveforms and electrophysiological analyses were performed offline using Igor Pro . Data shown are mean±S.E.M.Confocal images were analyzed offline using Figure S1Characterization and operation of PZT transducers. Illustration of experimental setup used to operate PZT transducers and transmit LILFU waveforms through neuronal tissue. For measuring PZT properties, as well as the pressure waves produced by US tone bursts, we used a calibrated hydrophone. To investigate the influence of LILFU on neuronal activity, we transmitted LILFU waveforms through a column of aCSF into hippocampal slice cultures while simultaneously performing confocal microscopy (see (2.80 MB TIF)Click here for additional data file.Table S1(0.05 MB DOC)Click here for additional data file.Video S1stratum pyramidale is indicated. The appearance of red stim indicates the delivery of LILFU-1. As indicated by the increase in OGB-1 fluorescence intensity, Ca2+ transients were triggered in response to stimulation with LILFU-1.The video illustrates a time-lapsed series of confocal images obtained from an organotypic slice culture prepared from a wild-type mouse, which was bath-loaded with OGB-1 AM. Hippocampal CA1 (7.87 MB AVI)Click here for additional data file.Video S2stratum pyramidale is in the upper left region of the movie with the proximal portion of stratum radiatum emerging towards the lower right quadrant of the movie. The appearance of red stim indicates the delivery of LILFU-1. As indicated by the increase in spH fluorescence intensity, the induction of vesicle release in response to LILFU can be clearly resolved at individual buttons.The video illustrates a time-lapsed series of confocal images obtained from a thy-1-spH organotypic slice culture. Hippocampal CA1 (7.56 MB AVI)Click here for additional data file.

It is an important regulator of genes induced by oxidative stress, such as glutathione S-transferases, heme oxygenase-1 and peroxiredoxin 1, by activating the antioxidant response element (ARE). We Premalignant lesions and mammary carcinomas were induced by medroxyprogesterone acetate and 7,12-dimethylbenz[a]anthracene treatment. The 10-week pre-malignant study was performed in which 8 groups of 10 each female wild-type (WT) and KO mice were fed either control diet or diets containing auraptene (500 ppm). A carcinogenesis study was also conducted in KO vs. WT mice (n = 30-34). Comparisons between groups were evaluated using ANOVA and Kaplan-Meier Survival statistics, and the Mann-Whitney U-test.All mice treated with carcinogen exhibited premalignant lesions but there were no differences by genotype or diet. In the KO mice, there was a dramatic increase in mammary carcinoma growth rate, size, and weight. Although there was no difference in overall survival, the KO mice had significantly lower mammary tumor-free survival. Also, in the KO mammary carcinomas, the active forms of NF-κB and β-catenin were increased ~2-fold whereas no differences in oxidized proteins were observed. Many other tumors were observed, including lymphomas. Interestingly, the incidences of lung adenomas in the KO mice were significantly higher than in the WT mice.We report, for the first time, that there was no apparent difference in the formation of premalignant lesions, but rather, the KO mice exhibited rapid, aggressive mammary carcinoma progression. Breast cancer is the most common cancer among American women, except for skin cancers. The chance of developing invasive breast cancer at some time in a woman's life is about 1 in 8 12%). In 2009, an estimated 192,370 new cases of invasive breast cancer will be diagnosed among women in the United States anthracene (groups labeled as "DMBA") to induce premalignant lesions. All treatments with DMBA were conducted in a light-protected biosafety cabinet, since DMBA is hazardous and light-sensitive. At the end of the 10 weeks, mice were euthanized by CO2 asphyxiation in a pre-charged chamber, and mammary glands were collected. Mammary fat pads were also fixed in 10% neutral buffered formalin overnight, then treated with graded alcohols followed by paraffin-embedding, sectioning at 4 μm, and H&E staining. Livers were collected for GST activity assays. Additional mammary fat pads were snap-frozen in liquid nitrogen and stored at -80°C for later analysis. Snap-frozen mammary epithelial tissue was isolated from mammary glands using hyaluronidase and collagenase as previously described anthracene; DVL: Dissheveled; FZD: frizzled; GSH: glutathione (reduced form); GST: Glutathione S-transferase; NQO1: NAD(P)H quinone oxidoreductase; HO-1: heme oxygenase 1; MPO: medroxyprogesterone acetate.The authors report no competing interests. All authors have read and agreed to the final version of the manuscript.LB conducted the majority of the premalignant study, wrote the first draft of the manuscript, and presented her poster at the Experimental Biology meeting in Anaheim, 2010. MP bred and genotyped the mice, conducted the comparison study (comparing the two different sources of AUR), maintained the body weight and caliper charts, and assisted in every aspect of the study, including all the necropsies. MM assisted in necropsies, histology, and generation of the stable cell lines. HB assisted in making tissue lysates, conducted all the NF-κB studies, aided in the discussion and interpretation of the q-pcr gene arrays and β-catenin analyses, and compiled Figure LB, B.S., is currently a M.S. student. MP, B.S., is the laboratory manager and student in nursing school. HB, CC, and MB were high-school students. KI, M.D., Ph.D., and MY, M.D., Ph.D. are both Professors in Japan. MM, Ph.D., is a Professor. EO, DVM, is the Associate Director of the Department of Veterinary Medicine. RS, Ph.D. and J.M., Ph.D. are both statisticians. KP is an Assistant Professor. SZ, M.D., Ph.D., is a pathologist. HEK is an Associate Professor and the Director of the Breast Cancer Focus Group at the Feist-Weiller Cancer Center.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/540/prepubAdditional Figures and Tables. Figure S1: Liver cytosolic GST activity in the comparison study using CDNB and DCNB as substrates. Female Nrf2 wild-type or knockout mice (age 6-8 weeks old) were administered vehicle or auraptene (150 mg/kg bw) once a day for 3 consecutive days. At 24 h after the final dose, mice were sacrificed and livers removed. Liver cytosolic fractions were obtained by differential centrifugation. Glutathione S-transferase activity (using either CDNB or DCNB as substrates) was analyzed by the method of Habig. Figure S2. Liver cytosolic GST activity in the premalignant study using CDNB and DCNB as substrates. Cont., control diet, AUR, auraptene diet *Significantly different from vehicle control group with control (AIN76A) diet at p < 0.05 , but not in the KO mice. DMBA groups, WT mice increased in GST activities fed either auraptene or control diet vs. KO mice. Figure S3. Body weight chart from premalignant study. The group of KO mice dosed with carcinogen had a lower bw at the beginning of the study, but they caught up by the end, where there was no significant difference. Figure S4. Body weight chart for the tumor study. No major changes in body weights were observed amongst the groups in the tumor study. Body weights (mean ± SD) are plotted as a function of days on the study. Figure S5. Box plot showing no major changes in body weights were observed amongst the groups in the tumor study. Figures represent area under the curve. Table S6. Rate of growth of mammary carcinomas (linear phase) mm3/day. *Rate of growth was estimated by taking the difference in tumor volume from two dates (or four dates for biphasic curves) in the linear phase of growth. Some curves were wavy, so a best-fit line was drawn to estimate tumor growth. WT mice: Many tumor remained dormant for a long time or throughout the study--tumors that grew very slowly, never got big, or were only found at necropsy, 117 T3, 176 T1, 181 T1, 146 T1, 125 T3, 127 T1, etc. Average (not including slow-growing tumors) = 3/day28 mm. KO mice: tumors that grew slowly, were small, or only found at necropsy: 164 T2, 184 T3, 154 T1-3, 117 T3, 176 T1, 181 T1. Average (not including slow-growing tumors) = 3/day96 mm. Table S7. Necropsy data for Nrf2 mammary carcinogenesis study. "Cause of death" defined as the most likely cause of death. This includes the following: lymphomas causing illness such as breathing difficulties, internal bleeding; Tumor burden, mainly palpable tumors ; Other--either large skin papillomas, ill due to unknown origin (thin), steatosis. Values represent the percentage of mice per category means ± SE . **Significantly different from WT mice p ≤ 0.02.Click here for file

Objective: To audit the referral patterns of burns in an emergency department compared with national referral guidelines. Methods: A retrospective case note audit of patients attending an emergency department with a diagnosis of “burn” in a 1-year period. Results: Only one quarter of the patients were managed according to the suggested national referral criteria for burns. Large and full thickness burns were managed appropriately but those at important anatomical sites and in patients at the extremes of age were managed less well. Conclusion: Increased awareness of the national referral guidelines, along with further education of staff within this department, may improve management of burn injuries. It is likely that referral patterns are similar in other emergency departments and may be improved by training staff in the assessment and management of burns. Increased adherence to the guidelines is likely to improve patient outcome at the expense of increased patient numbers and workloads in regional burns units that have implications for funding and service provision. Burns are potentially devastating injuries that can have long-term physical, psychological, and economic consequences. Mortality rates from major burns are improving and increasingly efforts are focused on improving outcome from relatively minor burns.It has been traditional to refer burn injuries on the basis of total burn size area (TBSA) alone. It is now recognized that this is overly simplistic and that burns should be referred to a specialist burns service on the basis of injury complexity that may itself be suggested by several factors including patient age, anatomical location, and coexisting medical conditions. Because of the serious but potentially preventable long-tem sequelae that can result from even minor burns, it is important to recognize those injuries that require specialist input and refer these patients to the appropriate unit.The British Burns Association (BBA) by way of the National Burn Care Review has proposed guidance on recognizing a potentially complex burn injury that may require assessment and management at a specialist burns unit.There have also been similar guidelines recently published by a European working party for the management of partial thickness burns in a general hospital setting.This study aimed to audit referral patterns of patients with minor burns in a British emergency department (ED) to see how closely the guidelines were being followed and whether there are particular groups of patients who are being either over- or underreferred to burns units.We carried out a retrospective case note audit of all patients presenting to a single ED with a triage diagnosis of “burn.” The University Hospital Birmingham ED has 79,000 new attendances each year and the hospital is also the site of the West Midlands Regional Burns Unit. Tertiary referrals to the burns unit from other hospitals were excluded as these were felt to reflect a different clinical population.The ED case notes were reviewed to gather data including details of the burn injury, examination findings, whether referral to another specialty was made, and outcome of the patient after leaving the department. This information was then compared with the referral guidelines produced by the BBA Fig , allowinFor each patient the information available was used to determine whether the burn was complex in nature, whether a referral to the burns unit for advice or admission was warranted, and whether such a referral was made.In many cases there was insufficient information in the case notes to decide whether a decision was appropriate or not. For example, if there was no TBSA or anatomical site recorded in the case notes then it was not possible to decide whether this could be classified as a complex burn that required referral. Conversely if there was any one of the referral criteria then it was deemed that a referral should have been made, even in the absence of other details.The BBA guidance recognizes the fact that not all the referral criteria are absolute and some may be open to interpretation in the absence of other risk factors for a complex injury. For example, it states that some small injuries to the face or hands could be managed locally providing the patient is followed up in an ED clinic or similar. For the purposes of this study all patients who met any of the referral criteria were deemed to require a referral.The regional burns unit is located on the same site as the ED in this study. Any patient referred to the burns service is seen in the ED by a member of the burns team who then decides on further management including whether admission of the patient is required or not. For the purposes of this study, any patient who was discussed with, or seen by, a member of the burns team before they left the ED was considered to have been referred.Each patient was allocated into one of the following groups: “Appropriately referred” if they met referral criteria and were referred to the burns unit for either advice, outpatient follow-up or admission; “Appropriately not referred” if they had a noncomplex burn and were either discharged or followed up in the ED clinic; “Underreferred” if they met referral criteria but were not referred to the burns unit; “Overreferred” if they were referred to the burns unit despite not meeting the criteria for a complex burn injury; or “Not known” if there was insufficient information in the case notes to decide whether the management was appropriate or not.A total of 785 patients presented to the ED with a triage diagnosis of “burn” within the 1-year study period. Tertiary referrals from other hospitals were excluded, as were those patients whose notes were missing or did not include information about their outcome from the department, leaving 561 patients in this study. Details of the epidemiology of these patients have been presented previously.3Overall, 142 patients (25%) were deemed to have had appropriate management according to the information available. This included 131 patients who required referral and were correctly referred, and further 11 who had noncomplex burn injuries and were correctly managed by the ED or general practitioner. A total of 247 patients were felt to have been underreferred in that they met referral criteria but were not referred to the burns service for an opinion, assessment, or admission. Of these patients, 107 patients were referred to other specialties or followed up in the ED clinic whereas the remaining 140 patients were discharged to the care of their general practitioner. Seventeen patients were overreferred to the burns unit despite not meeting referral criteria and the remaining 155 patients had insufficient information in the case notes. These results are summarized in Figure Of the 561 patients, 378 (67%) met at least 1 criterion for referral to the burns unit. However, of these 378, only 131 (35%) were actually referred. This means that of this sample there were potentially a further 247 patients who warranted referral to the burns unit if the referral criteria are being followed absolutely. In addition, it is likely that there were more patients who would have met the referral criteria if they had adequate information documented in the case notes. Therefore, even allowing for some flexibility in interpretation of the referral guidelines, it is clear that there are a significant number of patients presenting to this ED who may warrant referral because of complex burn injuries and are not currently being referred. The BBA guidelines highlight the need to discuss any case where there is doubt about the need for referral with the burns unit at the time of presentation.Each referral criterion was studied individually to see whether there were particular groups of patients who were being managed inappropriately because of lack of familiarity with the guidelines. This sample of patients contained only a small number (7) of patients who required referral on the basis of TBSA alone but all these patients were correctly referred. Almost all (92%) of patients with full-thickness burns were also correctly referred, even in cases of small or mixed depth burns. However, other criteria were less well adhered to, including only 44% of children younger than 5 being referred and 31% of patients with burns to the hand. Figure Some patients met more than one of the referral criteria, for example a 2-year-old child with a hand burn. The number of referral criteria for each patient ranged from 0 to 4. Of the 247 patients who were underreferred, 189 (77%) met one referral criterion, 52 (21%) of them met 2 referral criteria, and 6 patients (2%) met 3 separate referral criteria and were not referred. It is likely that many of these patients who are not referred to the burns unit are being managed entirely appropriately by the experienced clinical staff in the ED. However, while there is room for some flexibility of the referral guidelines, it is more likely that any patient who meets 2 or 3 different referral criteria should be referred to the burns unit for specialist management and a failure to do this highlights a lack of familiarity with referral guidelines by the ED staff.Burn injuries are relatively common and account for 175,000 ED attendances in the United Kingdom each yearBurns can have many long-term sequelae including hypertrophic scarring, impaired function, and psychological distress. There is increasing recognition that these problems can be seen even after small burns—the so-called “small burn, big problem” patient.4,It has been shown that patients with small burns of less than 1% TBSA can suffer clinically significant levels of psychological morbidity several months after the initial injury.6,9It has been highlighted in several previous papers that assessment of burns by nonspecialists is difficult and can be inaccurate.3Because of the potentially significant and long-term impact of burns, it is very important that all burn injuries are assessed, recognized, and referred correctly by the ED staff that are treating them. This may include nurse practitioners with extended roles as well as medical staff. Bezuhly and colleagues discuss the management of minor burns in EDs and call for stronger educational and clinical ties to be established between EDs and burns units.10A British Regional Burns Centre has previously reported a change in the pattern of adult burn referrals over the last 20 years. The Pinderfields Burns Centre has found that over the last 2 decades they have noted a significant increase in the number of patients admitted but found that there has been a decrease in the size and depth of burns as well as a decrease in the length of inpatient stay and mortality rate. The authors of this article feel that the increase in numbers is due to referring units strictly following the BBA referral guidelines, rather than an actual increase in the number of burn injuries in the region.11In this study, any patient who met a single referral criterion and was not referred was considered to have been inappropriately managed in terms of referral outcome. It is likely that the majority of these patients had their burn injuries well managed with no long-term complications as the referral guidelines simply act to highlight those patients who are at risk of having a complex injury rather than those who will necessarily require specialist input. It is also likely that within the group of patients with insufficient information in their medical records, the majority will have been treated well and appropriately. Although the results of this study may seem to exaggerate the problem, the aim was to highlight current referral patterns along with implications for education, funding, and burns service organization.We feel that the referral patterns demonstrated in this study are likely to be similar across the country. The ED in this study has the regional burns unit on site and it is, therefore, very simple for a member of the burns team to assess the patient in the department prior to their discharge and make a decision regarding their further management. It may be that the proportion of patients referred from other institutions without burns units are even lower because of the increased difficulty in transferring patients to another hospital for assessment. Medical staff in this department work entirely independently of the burns unit staff and are likely to have similar knowledge of burns as staff in other departments within the region or nationally.This highlights the impact that adherence to these referral criteria could have on burns services in this country. It is likely that units will continue to see greater numbers of smaller, but potentially complex, burns. These are associated with shorter inpatient stays but also with increased number of outpatient attendances and clinic sessions. An increase in the number of patients referred with hand burns may require an increase in the number of dedicated hand therapists to optimize patient outcome. The result is likely to have more burns units dealing with larger numbers of small burns, many as outpatients, with fewer units dealing with larger and more complex burns. This coincides with the recommendations of the National Burns Care Review to restructure burn care services in the United Kingdom in line with differing levels of injury complexity.This study has found that overall only one quarter of the patients presenting to this ED are referred appropriately according to information recorded in the medical records and the referral guidelines produced by the BBA. This may be partly due to lack of familiarity with the guidelines, as well as the ability to manage some minor burns in the department with the knowledge that the regional burns unit is on site in case of later complications. Full-thickness and larger burns are consistently referred appropriately but burns of important anatomical sites and those in patients at the extremes of age are not always managed correctly and this can have long-term consequences for the patient who is potentially preventable.The findings from this study are likely to be reflected nationally. We highlight the need for accurate assessment of minor burns, along with increased awareness of burns referral criteria, education of ED staff, and closer links between the burns unit and ED to obtain the best possible outcome for these patients.Increased adherence to the national referral guidelines for burn injuries is likely to improve patient outcome at the expense of increased patient numbers and workloads in regional burns units that have implications for funding and service provision nationally.

The influence of lipid molecules on the aggregation of a highly amyloidogenic segment of human islet amyloid polypeptide, hIAPP20–29, and the corresponding sequence from rat has been studied by all-atom replica exchange molecular dynamics (REMD) simulations with explicit solvent model. hIAPP20–29 fragments aggregate into partially ordered β-sheet oligomers and then undergo large conformational reorganization and convert into parallel/antiparallel β-sheet oligomers in mixed in-register and out-of-register patterns. The hydrophobic interaction between lipid tails and residues at positions 23–25 is found to stabilize the ordered β-sheet structure, indicating a catalysis role of lipid molecules in hIAPP20–29 self-assembly. The rat IAPP variants with three proline residues maintain unstructured micelle-like oligomers, which is consistent with non-amyloidogenic behavior observed in experimental studies. Our study provides the atomic resolution descriptions of the catalytic function of lipid molecules on the aggregation of IAPP peptides. People diagnosed with diabetes have increased from 30 million to 246 million over the last two decades. One hallmark of type 2 diabetes is the formation of amyloid in the pancreatic islet, which is composed of human islet amyloid polypeptide (90%) and lipid molecules (10%). In the long-lasting endeavors against the disease, it is important to understand, at the atomic level, the interaction between peptide aggregation and lipid molecules. In this study, we use molecular dynamics simulations to explore the influence of lipid molecules on the self-assembly process of toxic peptide segments. Moreover, a negative control simulation, employing the non-amyloidogenic rodent sequence, is also performed to evaluate the robustness of the simulation protocol. Our study provides a generic picture of the catalytic role of lipid molecules in the process of amyloidogenesis. A range of human diseases including Alzheimer's disease, Parkinson's disease, the spongiform encephalopathy and type 2 diabetes mellitus (T2DM) is associated with amyloid deposits of normally soluble proteins or peptides Besides the external factors, such as lipid bilayer, pH value, the sequences of peptide themselves have great effects on the aggregation behaviors. Several other species such as non-human primates ab initio folding to form β-sheet oligomers. Albeit simplified models allow studying large-scale systems Due to the metastable and short-lived nature of soluble pre-fibril oligomers at the early steps of fibril formation, experimental data are usually difficult to obtain ab initio REMD folding simulations. The acquirement of abundant intermediate states suggested two possible β-sheet transition pathways. Simulation of four hIAPP peptides without lipid molecule was also performed. Nonamyloidogenic rat IAPP segments were studied as a negative control with the aim of understanding the inhibitory effect of three proline substitutions.In our studies, an enhanced-sampling method, replica exchange molecular dynamics (REMD) in vivo or in vitro20–29 segments seldom exhibit β-sheet structures. Less than 5% residues in the disordered strands adopt β-sheet conformation. Meanwhile, more than 25% residues in hIAPP and hIAPP/lipid participate in β-sheet regions at the end of simulations. On free energy landscapes, the dominant minima are separated by small free energy barriers rIAPP and segment rIAPP20–29 do not form amyloid fibrils barriers . The repOf interest is that the decrease of Cα-atom radius of gyration (Rg) is much faster than the increase of length of β-sheet regions in four hIAPP20–29 strands. Within 5 ns, hIAPP20–29 Cα-Rg rapidly drops from initially ∼1.6 nm to ∼1.1 nm and continues to slowly decrease to ∼0.95 nm in the following 90 ns. Nevertheless, only 5% hIAPP residues are transformed into β-sheet structure and β-sheet composition reaches a relatively stable level (∼20%) after 50 ns. These early stage (5–50 ns) intermediate species are condensed but less structured (low percentage of β-sheet regions), which may be the amorphous aggregates described in other's simulations 20–29 contain both antiparallel and parallel β-sheet structure by using FTIR (Fourier transform infrared spectroscopic) B) and parallel β-bridges (p-NB) during simulation course. From B and p-NB increase at different rates and eventually ap-NB is more than two times favored than the parallel pattern. A β-bridge occurrence contact map which is constructed to disclose the detailed information of β-strand alignment patterns indicates the same orientation preference of the decapeptide is considered to be the core part of β-sheets for fragment hIAPP20–29 by experiments 20–29 sequence shows a rather low propensity for helical structures. In the presence of lipid for the ten residues are analyzed . It is oof lipid , the proIn addition to the disruption of continuity of H-bonds caused by proline, the uniform backbone structure within β-sheets is also perturbed. In total). For both IAPP segments, the inter-peptide interaction (with negative ΔEvdw and ΔEelec) contributes the oligomerization favorably, while the polar solvation energy is unfavorable (positive ΔEgb). The difference of ΔEelec between rIAPP and hIAPP, 122.5 kJ/mol, and the difference of ΔEgb, −96.5 kJ/mol correlates with the fact that there is less backbone H-bonding interaction within rIAPP oligomer, and relatively favorable solvation energy for rIAPP. Overall, aggregation of both peptides is driven by nonpolar interaction.To examine how the disordered rIAPP aggregates lacking of backbone H-bonds can be stabilized, an ensemble of 100 structure snapshots has been extracted from the region with the lowest free energy (free energy = 0 on the free energy landscape) for calculating binding energy. The binding energy was calculated by MM/GBSA method and is specified in 20–29 strands in this study involves complex structural transition from initial amorphous oligomer states to highly ordered β-sheets. The fundamental element of structural transition is the backbone hydrogen bond formation. Thus the number of extended β-bridges (NB) should be a suitable reaction coordinate for describing the conversion process. The ordered oligomer state, namely β-sheet dimer, trimer and tetramer, can also be used to describe the degree of order of an ensemble of structures. The evolution of different β-sheet oligomerization state as a function of NB is elaborated based on the ensemble trajectories at low temperatures. Besides, following a replica trajectory that contains information of a continuous structural evolution, the transition between an amorphous state and an ordered state can be vividly demonstrated.The nucleation process of four hIAPPB is depicted by bar chart in B are plotted as symbols. The population of ensembles with NB value in the range of 2 to7 is large. Those ensembles with large NB (more than 7) are highly ordered but have a relatively small population. The dominant β-sheet oligomer size changes gradually with the increase of NB: unstructured→dimer→trimer→tetramer. The increase of β-sheet oligomer sizes also indicates the transformation from amorphous aggregates to a more ordered state. Such transformation is realized by monomer addition. The ensembles which have two separate dimers are found to be hardly populated.The number of NB is small, the percentage of trimer is larger than that of dimer . Similarly, the percentage of tetramer is larger than that of trimer when NB = 12 for hIAPP, and NB = 11 for hIAPP/lipid. For a clear description, at the transition point, four illustrative sketches for trimeric and tetrameric sheets are drawn, with short dashed lines denoting single β-bridges. Only three out of the ten residues in each strand forming hydrogen bonds are competent to stabilize a tetrameric sheet. This indicates that the β-sheet nucleation site is not necessary to have a long and perfect in-register pattern; a short β-sheet region is capable of being a template to invite free monomers to join the nucleus. The “template” hypothesis was inspired and supported by the work of Kameda and Takada B to develop structures with higher degree of order. And hIAPP/lipid system has more structures with large NB. Clearly the presence of lipid molecule helps to stabilize the ordered structures and therefore accelerates the emergence of higher order of β-sheet oligomer.It is surprising to discover that even when NWe have examined several folded replica trajectories, and key intermediate states from two hIAPP trajectories are shown to demonstrate the detailed transitions from amorphous oligomer to ordered β-sheet oligomer in B needed for the formation of β-sheet oligomers is consistently reduced by one in the presence of the lipid molecule (C) between heavy atoms on lipid head/tail groups and Cα atoms on hIAPP fragment are calculated is 380 K without lipid and increases to 400 K in the presence of lipid. It is well known that amyloid β-sheet structure is stabilized not only by backbone hydrogen bonds network and also by close side chain packing B is needed to maintain β-sheet oligomer in hIAPP/lipid system are indifferent. Their SSP greatly resemble that of counterparts on hIAPP and a certain amount of backbone H-bonds are formed among the two variant residues, indicating a less important function in abolishing rIAPP20–29 aggregation.The difference of five residues between hIAPP and rIAPP in the core region exerts evident effects on aggregation characteristics, among which three proline substitutions have the strongest influences. Proline is commonly found in turns exposed to solvent, which may benefit from its rigidity that costs less entropy penalty upon folding. The cyclic structure of side chain makes proline not compatible to any secondary structures, but it is occasionally found as the first residue of α helices and in the edge strands of β sheets to prevent protein self-assembly. In an atomic detailed level, we have studied how the special structure features of proline, including lacking of amide hydrogen atom and ϕ dihedral angle which is not overlapping with β-structure, influence the aggregation ability of IAPP20–29. The missing hydrogen atoms on proline backbones disrupt the H-bonding network and therefore the β-sheet stability is weakened. Besides, the rigid backbone of proline induces unfavorably high energy to β-conformation. The two reasons explain the loss of amyloid aggregation ability of rIAPPRecent NMR measurements have provided several constraints on hIAPP protofilaments with striated ribbon morphologies The fragment 20–29 was thought to form a highly ordered hydrophobic core in fibrils. Nevertheless, recent studies by ssNMR et al. has proposed a revised nucleated growth mechanism NCC model which depicts that nuclei form through conformational rearrangements within micelle-like, structurally dynamic oligomers The experimentally observed sigmoidal profile of fibrillogenesis kinetics is normally interpreted by a nucleated growth mechanism Although the appearance of β-sheet dimers can perform as the starting point of peptide aggregation, monomer addition is unfavorable until the nucleus reaches a critical size according to nucleated growth mechanism In summary, the present all-atomic REMD simulations suggest an explanation on how the proline substitutions influence the amyloid aggregation capacity of rIAPP20–29. Preference for antiparallel interstrand orientation and the lack of uniform registration alignment are the two characteristics of early-stage per-nucleus oligomers. The rapid-collapsed amorphous aggregates can evolve to partially ordered β-sheets through conformational rearrangements and two pathways of parallel-antiparallel transitions are traced. Meanwhile, key residues which are responsible for either β strand formation or lipid binding are recognized. The specific interaction between lipid tails and hydrophobic residues is found to stabilize the β-sheet region, indicating a catalysis role of lipid molecule in hIAPP peptide self-assembly. These findings are applicable to other types of amyloidogenic peptides and indicate a general pattern of interaction between lipid and amyloidogenic peptides 20–29, 4 hIAPP20–29, and 4 hIAPP20–29 together with DOPC lipid molecule, respectively. The peptides capped by ACE and NME groups in N and C terminals were initially constructed in a fully extended conformation and separated by at least 2 nm from each other to avoid interaction bias. The four identical peptides (rIAPP20–29 or hIAPP20–29) in each system were arranged in parallel or mixed parallel/antiparallel patterns to include all four possible arrangements: (i) N-terminals of all four peptides were placed upwards; (ii) N-terminals of three out of four peptides were placed upwards; (iii) N-terminals of two peptides on one side were placed upwards, and (iv) N-terminals of two peptides on the diagonal directions were placed upwards. The four starting structures in different arrangements were alternately used as the initial frames of 36 replicas to avoid bias in favor of parallel or antiparallel β-sheet alignments during REMD simulations. The initial configurations are shown in Support Information, The peptide segments r/hIAPP20–29 and dioleoylphosphatidylcholine (DOPC) molecule were represented by all-atom OPLS-AA force field The GROMACS program suite 10-helix, π-helix), β-strand and loop . β structures are the dominant secondary structures in our aggregation simulation. β-bridge is the basic unit of β-sheet. Either a parallel or antiparallel β-bridge forms between residues i and j, if there are two H bonds between two nonoverlapping stretches of three residues each, i−1, i, i+1 and j−1, j, j+1. Then β-sheet can be defined accordingly as a set of consecutive β-bridges of identical type . In our study, the size of a β-sheet oligomer is defined more strictly as following: β-sheet dimer is formed only when two β-strands connected by a minimum of two β-bridges (instead of one β-bridge according to DSSP default definition); β-sheet trimer is defined as only one β-strand connected by two other β-strands in the same mode; similarly β-sheet tetramer is identified if two β-strands are connected to two other β-strands respectively.The DSSP algorithm written by Wolfgang Kabsch and Christian Sander was used to identify secondary structure conformation of β-sheet oligomers A modified PCA version, referred to as dihedral angle PCA or dPCA, was used to represent the conformational distribution on the free energy landscape The binding energy of tetrameric oligomers was estimated by equation:Figure S120–29 peptides. Backbones of peptides are shown in cartoon; side chains of Phe23 are explicitly represented in sticks for readily identification of N-terminals. (A) N-terminals of all four peptides point upwards; (B) N-terminals of three out of four peptides point upwards; (C) N-terminals of two peptides on one side point upwards; (D) N-terminals of two peptides on the diagonal point upwards.Initial arrangements of 4 identical hIAPP(0.94 MB TIF)Click here for additional data file.Figure S2Distribution of ϕ dihedral angle of three prolines on rIAPP (black curves) and their counterpart residues on hIAPP (red curves) and hIAPP/lipid (green curves).(4.90 MB TIF)Click here for additional data file.

Characterization of genetic diversity among locally prevalent parasite strains and the ensuing strain-specific immunity will be particularly important in a specific geographical setting for development of vaccine constructs and for planning future vaccination strategies.Plasmodium vivax, 42 kDa fragment of the Merozoite Surface Protein -1 (MSP-142), Apical Membrane Antigen-1 domain II (AMA-1 DII) and the Duffy Binding Protein region II (PvDBPII), in patients infected with P. vivax malaria from two endemic areas, Anuradhapura and Kataragama, in Sri Lanka, where unstable malaria prevails with low transmission, and from a malaria non-endemic area, Colombo, where the patients contracted the infections while visiting areas endemic to vivax malaria. Based on nucleotide sequences, extensive allelic polymorphism was evident in the N-terminal region of MSP-142(Pvmsp-133), Pvama- 1dII and PvdbpII, due to recombination, mutations, natural selection and genetic differentiation. Nucleotide sequences of 42Pvmsp-1(N=95), Pvama-1dII (64) and PvdbpII (100), generated 27, 21 and 33 amino acid (a.a) haplotypes, respectively. Clinical isolates with amino acid haplotypes available for all three antigens (N=24) revealed uniquely different haplotype combinations in each isolate. Conversely, PvMSP-119, domain II loop of PvAMA-1 and the six a.a. in the critical binding domain of PvDBPII responsible for direct binding with the Duffy antigen on human RBC, showed 100% conservation of the amino acid sequences.The present study characterized the prevailing genetic diversity of three major asexual stage putative vaccine antigens of 42, PvAMA-1DII and PvDBPII were aligned with the homologous total (IgM + IgG) antibody responses assayed by ELISA against the recombinant protein of each antigen, and the seven (P01-P07) PvAMA-1DII peptides. Though Anti-PvMSP-119 and anti-P04 antibody prevalence precludes strain-specific immune responses against the highly conserved PvMSP-119 and the P04 peptide on domain II loop of PvAMA-1, a protective immune response was clearly elicited to these two regions by the marked isotype switch from IgM to IgG with increasing exposure in areas of endemicity. Further, the presence of strain transcending (cross reactive) PvDBPII specific functionally active binding inhibitory antibodies were demonstrated among locally exposed P. vivax patients. Thus this study may support the inclusion of PvMSP-119, P04 region of PvAMA-1 domain II and region II of PvDBP as veritable vaccine components for a multi component "cocktail" asexual stage vaccine against P. vivax malaria in Sri Lanka.In order to evaluate whether sequence differences among each antigen was indicative of strain-specific immunity, amino acid sequences of PvMSP-1

The positive end-expiratory pressure (PEEP) for the mechanical ventilation of small animals is frequently obtained with water seals or by using ventilators developed for human use. An alternative mechanism is the use of an on-off expiratory valve closing at the moment when the alveolar pressure is equal to the target PEEP. In this paper, a novel PEEP controller (PEEP-new) and the PEEP system of a commercial small-animal ventilator, both based on switching an on-off valve, are evaluated.The proposed PEEP controller is a discrete integrator monitoring the error between the target PEEP and the airways opening pressure prior to the onset of an inspiratory cycle. In vitro as well as in vivo experiments with rats were carried out and the PEEP accuracy, settling time and under/overshoot were considered as a measure of performance.2O greater than the target in most conditions. The PEEP-new presented steady-state errors smaller than 0.5 cmH2O, with settling times below 10 s and under/overshoot smaller than 2 cmH2O.The commercial PEEP controller did not pass the tests since it ignores the airways resistive pressure drop, resulting in a PEEP 5 cmHThe PEEP-new presented acceptable performance, considering accuracy and temporal response. This novel PEEP generator may prove useful in many applications for small animal ventilators. The choice of the adequate positive end-expiratory pressure (PEEP) is one of the main concerns about ventilatory settings for mechanical ventilation. From normal lung subjects during anesthesia to patients with acute lung injuries (ALI), the use of a PEEP equal to zero is practically absent in the current evidence based ventilatory therapy ,2.In commercial microcontrolled artificial ventilators for humans, the up-to-date technology for PEEP control is most commonly done by an expiratory valve with a membrane that imposes a counter pressure regulated by an electromechanical device. At the beginning of expiration, the pulmonary pressure being higher than the PEEP enables the valve to open and expiration remains until equalization of both pressures or until the expiration ceases because of the start of the next inspiration.An alternative approach is to eliminate the membrane valve by using an on-off valve to set the target PEEP. In this case, the valve is kept open to the atmosphere when expiration begins and closes when the target PEEP is achieved. Some potential benefits may be identified with this technique. First, the driving pressure for expiration is magnified, and consequently the expiratory time may be diminished ,4. SeconThe objective of this work is the evaluation of two PEEP control systems based on switching an on-off valve installed on the expiratory circuit. The first is the PEEP of a commercial ventilator and the second is a prototype developed by the authors. Both systems are based on the same principle, i.e., to close the on-off valve at a certain point of expiration, in order to achieve the target PEEP for the rest of the expiratory time. The performance of both systems for controlling the PEEP was tested in vitro and in vivo in a rat model.The commercial ventilator was an INSPIRA model 557059 . The information available on the website of the manufacturer is that the PEEP feature "allows a positive pressure to be maintained between inspirations instead of falling to zero or near zero at the end of the expiratory phase. When the PEEP pressure is reached, the expiration valve closes until the next inspiration cycle begins." The PEEP generated by this ventilator was denominated PEEP-old. A specimen of the INSPIRA ventilator ASVP, serial number B-45397 regularly purchased has been used in all tests.ao-Inspira) and a binary signal of synchronism (SI-E), in which the logical one indicates the occurrence of the inspiratory cycle and the logical zero, the expiratory cycle. These two signals were acquired at a sampling rate of 1000 Hz by an analog-to-digital (A/D) converter PCM-3718HG installed on a personal computer PCM-6898 running a Simulink model using the Real-Time Windows Target . The controller reads Pao-Inspira and SI-E, and computes the duration of the opening of the on-off valve during the expiration, τexp. From SI-E, for the n-th respiratory cycle the controller calculates the total duration of the expiration as reported by the ventilator, Texp(n). Then, from Pao-Inspira and the target PEEP (PEEPT), the controller updates τexp for the n-th respiratory cycle by the law:In this work, a prototype PEEP controller was designed, to operate in conjunction with the ventilator INSPIRA. The system includes a miniaturized on-off valve 003-0459-900 connected to the exhaust port of the ventilator. To control such valve, two signals, available from the ventilator, were employed: the airways opening pressure (PI is the intrinsic PEEP .Setting the PEEP at PEEPt et al. in presst et al. , seek tot et al. , to minit et al. reportedt et al. . Howevert et al. being moSome limitations of this study must be reported. The present controller, as it is, cannot be used with spontaneously breathing subjects. Furthermore, the present controller was tuned for the mechanical ventilation of rats. In consequence, the reported performance indices cannot be generalized to other species. The controller law parameters may have to be retuned for use with different respiratory mechanics. The hardware presented a respiratory circuit resistance which was appropriate for ventilating rats and mice; however for larger animals, the on-off valve must be less resistive.T may be smaller than 200 μl. The PEEP-new may represent an alternative for an accurate PEEP implementation capable of being computer controlled, as in the time-programmed PEEP step change test shown in Figure ao allows estimating the parameters of respiratory mechanics and, furthermore, the entire system can be programmed to automatically control the PEEP as performed by Jandre and coworkers [The use of small animals for studies related to the mechanical ventilation settings and its effects on ventilator-induced lung injuries and inflammatory responses is very frequent. Some commercial ventilators for humans may be suitable to typical respiratory rates and tidal volumes for rats , albeit oworkers .The PEEP-old controller resulted in PEEP values always higher than the target, in both in vitro and in vivo tests. The PEEP-new controller presented acceptable performance, considering accuracy and temporal response. This novel PEEP generator may be implemented at reasonable costs and may prove useful in many applications for small animal ventilators.The authors declare that they have no competing interests.AGN and FCJ designed the study and wrote the paper. CGMR and FCJ developed the controller. AGN, GCMR, MVLN, JHS participated in the experiments. AGN, GCMR and ELS analyzed the results.All authors have read and approved the final manuscript.

We propose a scheme for the origin of mitochondria based on phylogenetic reconstructions with more than 400 yeast nuclear genes that encode mitochondrial proteins. Half of the yeast mitochondrial proteins have no discernable bacterial homologues, while one-tenth are unequivocally of α-proteobacterial origin. These data suggest that the majority of genes encoding yeast mitochondrial proteins are descendants of two different genomic lineages that have evolved in different modes. First, the ancestral free-living α-proteobacterium evolved into an endosymbiont of an anaerobic host. Most of the ancestral bacterial genes were lost, but a small fraction of genes supporting bioenergetic and translational processes were retained and eventually transferred to what became the host nuclear genome. In a second, parallel mode, a larger number of novel mitochondrial genes were recruited from the nuclear genome to complement the remaining genes from the bacterial ancestor. These eukaryotic genes, which are primarily involved in transport and regulatory functions, transformed the endosymbiont into an ATP-exporting organelle.

Enhanced osteoblast-dependent osteoclastogenesis due to inhibition of Wnt/β-catenin signaling in bone morphogenic protein (BMP)-driven osteoprogenitors has been repeatedly implicated in the natural history of cancer-associated osteolytic lesions, but the mechanism of this bone loss is poorly understood.We examined the impact of secreted Wnt inhibitors from the Dickkopf (Dkk) family on pluripotent mesenchymal cells undergoing BMP2-induced osteoblastic differentiation.3 and Wnt3a/BMP2, respectively. The decoy receptor of RANKL, osteoprotegerin (OPG), was down regulated under the latter conditions. These findings indicated that Dkk1 and -2 facilitate osteoclastogenesis by enhancing RANKL/RANK and M-CSF/c-Fms interactions. Dkk4 weakly shared activities of Dkk-1 and -2, whereas Dkk3 was ineffective.We found that Dkk1 and -2 restored the Wnt3a-dependent reduction of alkaline phosphatase (ALP), Osterix and p53, indicating that mitigated Wnt/β-catenin signaling promotes certain aspects of early osteoblastogenesis through the BMP-p53-Osterix-ALP axis. Dkk1 and -2 increased the expression of the osteoclast differentiation factors, receptor activator of NF-κB ligand (RANKL) and macrophage-colony stimulating factor (M-CSF), upon stimulation with Wnt3a/1,25-dihydroxyvitamine Din vivo promotes, on balance, the heightened formation of osteoclasts. Focally increased Dkk1 production by tumor cells in the bone may thus lead to focal bone loss.Our results suggest that inhibited Wnt/β-catenin signaling in BMP2-induced osteoprogenitors Following pre-incubation for 3 h, cell differentiation was induced by adding Wnt3a-CM and/or L-CM that either contained 100 ng/ml recombinant human BMP2 (R&D Systems) or 10 nM 1,25-dihydroxyvitamine D3 2D3, Sigma). Cells were cultured for 3 days . In some experiments, differentiation occurred in presence of Dkk-CM and/or 100 ng/ml Noggin. Dkk-CM and Wnt3a-CM were added to a final concentration of 20% (v/v), which had been found in pilot studies to result in optimal assay performance in our hands (results not shown).Cells were seeded at 2 × 10Alkaline Phosphatase (ALP)–ALP activity was determined in cells that had been cultured in 24-well plates for 7 days. Cells were washed twice with phosphate-buffered saline, scraped off the plastic surface with a rubber policeman, and lysed for 15 min in 100 μl Passive Lysis Buffer . Cell lysate was spun down at 12,000 × g for 5 min and enzyme activity was determined at 37°C with the ALP LabAssay . Enzyme activity was normalized using total protein (Bio-Rad assay) as reference.Total RNA was isolated using the RNeasy mini kit supplemented with DNase. First-strand cDNA synthesis was performed using the Superscript III kit (Invitrogen) with 1 μg RNA as template. Real-time PCR was carried out with the ABI 7500 cycler . Briefly, 12.5 μl SYBR green PCR master mix (Applied Biosystems) and 5 μl cDNA were added to 200 nM forward and reverse PCR primers in 96-well microplates. Following thorough heat denaturation for 10 min at 95°C, cDNA was amplified in 40 two-step cycles using the following temperature protocol: 95°C for 15 s and 60°C for 60 s. PCR primer sequences and length of amplicons are listed in Table Cell culture supernatant was harvested 3 days after initiation of osteoblast differentiation as described above. OPG, RANKL and M-CSF were determined by sandwich ELISA, using the respective Duo-Sets from R&D Systems.6) were incubated with 0.25 μg biotinylated monoclonal rat antibody to mouse CSF-1 (BD PharMingen) for 1 h at 4°C, followed by incubation with phycoerythin-labeled avidin . After washing in phosphate-buffered saline, cells were analyzed on a FACSCalibur using the CellQuest software for data evaluation. Biotinylated rat IgG2a (eBioscience) was used as control for unspecific antibody binding.Cells were calculated and compared using ANOVA followed by Dunnett's multiple comparison ALP, alkaline phosphataseBMP, bone morphogenic proteinCM, conditioned mediumDkk, DickkopfGFP, green fluorescent proteinLRP, low-density-lipoprotein receptor-related proteinM-CSF, macrophage-colony stimulating factorOPG, osteoprotegerinRANKL, receptor activator of NF-κB ligandsFrp, secreted frizzled-related proteinsTGF-β, transforming growth factor-β2D3, 1,25-dihydroxyvitamine D31,25(OH)The author(s) declare that they have no competing interests.Ken-ichi Fujita performed all experiments contributed to the design of the study. Siegfried Janz designed the study and wrote and approved the article.

With the increasing emphasis on well-sculpted facial features, today there is a growing need for tools to augment the facial skeleton; either for cosmetic reasons or to re-contour deformities-congenital, post-traumatic and post-ablative. The limitations of autogenous materials has lead to evolution of numerous 'alloplasts', of which, high-density porous polyethylene (HDPE) seems to be a promising alternative.To evaluate the long term results of HDPE in facial skeletal augmentation in terms of achieving desired facial contour, patient satisfaction and complications.A tertiary care referral centre in a metropolitan set-up.Case SeriesAll patients undergoing HDPE implant insertion for facial skeletal augmentation between July 2001 and November 2009 were included in the study. A total of 70 HDPE implants were inserted in 44 patients. All procedures were performed by a single surgeon following standardized pre, intra and post-operative protocols. The results were evaluated with respect to improvement in facial contour desired and achieved, overall patient satisfaction and complications encountered.The study included 44 patients with a male:female ratio of 1:1, a mean age of 25.09 years (14 to 58 years) and a mean follow-up of 45.34 months (0.5 to 100 months). HDPE implants were used to augment the nasal dorsum, maxilla, malar eminence, chin, mandibular body and angle, orbital rim and frontal region. The overall recontouring afforded by the HDPE implants was good, with most patients reporting satisfactory results. There were seven complications (10%), including three cases of deviation (4.29%), three cases of exposure (4.29%) and one case of sub-clinical infection (1.43%). None however necessitated implant removal. Nasal dorsal HDPE implants, especially those involving secondary surgery, suffered a much higher complication rate compared to other implants.HDPE is an alternative to autogenous grafts for facial skeletal augmentation with good long-term results and a low incidence of complications, provided there is adequate vascular soft tissue cover. In an increasingly image-conscious world, where 'looking right' can make all the difference, the desFacial skeletal contouring has come a long way from its early days when Tessier showed t5This lead to a search for the ideal alloplastic material8 to replSolid Polyethylene was first used as a substitute for bone or cartilage in humans in the 1940s.Although we performed all augmentations under General Anesthesia, the absence of a donor site for graft harvest would make the use of sedation and regional blocks an extremely viable option—with careful patient selection, one may even consider the possibility of inserting implants as a day-care procedure. Of the 44 patients reviewed, 15 were undergoing revisional surgery, of these, five had been operated once before; the remaining 10 had undergone two or more previous surgeries. We did not encounter any significant difficulty in the insertion of implants in this sub-group despite the fibrosis at the approach sites & the scarred beds. In fact, in one patient, we successfully inserted a HDPE implant for nasal dorsal augmentation under an area of previous grafted skin (STSG), the patient having undergone excision of neurofibromatosis over her face followed by STSG.Overall, patients were satisfied with the aesthetic results of the alloplastic augmentation, as evaluated during post-operative follow-ups, with 93.18% patients saying they are extremely pleased or pleased with their results. A review of literature reveals numerous experimental, animal, histologic and clinical studies confirming the safety and efficacy of HDPE implants in aesthetic and reconstructive craniofacial surgery.141920 We1419We had a total of seven complications (10%) among 70 implants inserted with three instances of implant exposure (4.29%), however significantly, these exposed implants could be trimmed and covered by secondary suturing and none necessitated implant removal. These percentages compare favourably with published foreign series‐152021 r1520non-nasal dorsal implants' . Thus, excluding HDPE implants for nasal dorsal augmentation, the remaining implant sites suffered a complication rate and exposure rate of only 2.38% each.In our experience, six of the seven reported complications and two of the three exposures involved nasal dorsal implants (28 in number). Thus, the nasal dorsal implants suffer a higher complication and exposure rate (21.43% & 7.14%), a finding which is again comparable with several series from the West.21 On theOf the 15 patients undergoing revision surgery, 12 involved nasal dorsal augmentation; i.e. 43% (12/28) nasal dorsal HDPE implants were inserted in previously operated noses. This may account for the higher complication rate in this group of patients in our series. Both the exposed nasal implants involved secondary rhinoplasty patients who had already undergone nasal surgery in the past, leading to thinned out, scarred and fibrotic tissue in the nasal vestibule and implant exposure through the intra-nasal incision site. We believe that adverse results in this group of patients can be avoided by two simple steps—carving an implant of a size 0.5cm shorter than the anticipated requirement and carefully trimming the tip of the implant to a smooth contour, since this is the part that invariably gets exposed due to pressure necrosis of the overlying tissues.Aesthetic facial skeletal augmentation with HDPE implants is an easy, safe and effective procedure with no donor site morbidity, excellent and stable contour enhancement and minimal long-term complication rate. Considering the higher complication rate, it would be prudent to exercise caution in the use of nasal dorsal HDPE implants in cases of secondary surgery with fibrotic tissues. It is vital to counsel patients and establish realistic and precise aesthetic goals preoperatively.

This virus (NL-4/5S6/7SvifS) was supposed to escape from host restriction factors cyclophilin A, CM TRIM5α, and APOBEC3G. However, the replicative capability of NL-4/5S6/7SvifS in human cells was severely impaired.Human immunodeficiency virus type 1 (HIV-1) productively infects only humans and chimpanzees but not Old World monkeys, such as rhesus and cynomolgus (CM) monkeys. To establish a monkey model of HIV-1/AIDS, several HIV-1 derivatives have been constructed. We previously reported that efficient replication of HIV-1 in CM cells was achieved after we replaced the loop between α-helices 6 and 7 (L6/7) of the capsid protein (CA) with that of SIVmac239 in addition to the loop between α-helices 4 and 5 (L4/5) and th helix near L4/5 and L6/7 and is apparently exposed to the protein surface. The amino acid substitution at the 116th position caused a change in the structure of the protein surface because of the replacement of G (which has no side chain) with E (which has a long negatively charged side chain).By long-term cultivation of human CEMss cells infected with NL-4/5S6/7SvifS, we succeeded in rescuing the impaired replicative capability of the virus in human cells. Sequence analysis of the CA region of the adapted virus revealed a G-to-E substitution at the 116th position of the CA (G116E). Introduction of this substitution into the molecular DNA clone of NL-4/5S6/7SvifS indeed improved the virus' replicative capability in human cells. Although the G116E substitution occurred during long-term cultivation of human cells infected with NL-4/5S6/7SvifS, the viruses with G116E unexpectedly became resistant to CM, but not human TRIM5α-mediated restriction. The 3-D model showed that position 116 is located in the 6We succeeded in rescuing the impaired replicative capability of NL-4/5S6/7SvifS and report a mutation that improved the replicative capability of the virus. Unexpectedly, HIV-1 with this mutation became resistant to CM TRIM5α-mediated restriction. Briefly5) were infected with 20 ng of p24 of NL-4/5SvifS, NL-4/5S6/7SvifS, or NL-4/5SG116E6/7SvifS. The culture supernatants were collected periodically, and p24 levels were measured with an ELISA kit. To analyze the viral sensitivity to TRIM5α, 1 × 105 CEMss cells were first infected with SeV expressing each of the TRIM5αs at a multiplicity of infection of 10 plaque-forming units per cell and incubated at 37°C for 9 hours. Cells were then superinfected with 20 ng of p24 of HIV-1 NL4-3 or its derivatives. The culture supernatants were collected periodically, and the levels of p24 were measured with an ELISA kit.CEMss or MT4 cells pseudotyped HIV-1 clones expressing GFP. In case of TK-ts13 hamster cells stably expressing CM, human or CM-SPRY(-) TRIM5α, cells were infected with VSV-G pseudotyped lentivector expressing GFP under the control of cytomegalovirus promoter. Two days after infection, the cells were fixed by formaldehyde, and GFP expressing cells were counted with a flow-cytometer. The percentage of the GFP-positive cells in the presence of TRIM5α was divided by the percentage of GFP-positive cells in the presence of CM-SPRY (-) to define the percent of infection. The differences in percent infection between WT-GFP and G116E-GFP, or 4/5S6/7S-GFP and 4/5SG116E6/7S-GFP were statistically evaluated by using the unpaired t test.The culture supernatants of 293T cells transfected with plasmids encoding HIV-1 NL4-3 derivatives were clarified by low-speed centrifugation. Nine milliliters of the resultant supernatants were layered onto a 2 mL cushion of 20% sucrose in phosphate buffered saline (PBS) and centrifuged at 35,000 rpm for 2 hours in a Beckman SW41 rotor. After centrifugation, the virion pellets were resuspended in PBS, and p24 antigen concentrations were measured by ELISA. Fifty nanograms of p24 of HIV-1 derivatives were applied to SDS-polyacrylamide gel electrophoresis, and the virion-associated proteins were transferred to a PVDF membrane. CA and CypA proteins were visualized with the anti-p24 antibody (Abcam) and anti-CypA antibody , respectively.1GWP) [http://pymol.sourceforge.net/).The structure of the N-terminal domain of the HIV-1 CA protein (PDB number 1GWP) was used1GWP) and visuvif, L6/7 of the SIVmac CA is important for the efficient replication of HIV-1 derivatives in CM cells [vif renamed NL-4/5S6/7SvifS in the present study, was inoculated into CEMss cells; and culture supernatants were periodically assayed for the levels of p24. Progeny virions were first detectable on day 20 after infection and reached a peak titer on day 42 .We previously reported that in addition to L4/5 of the CA and CM cells . While i2 Figure . The vir2 Figure . This tihttp://www.hiv.lanl.gov/, including subtypes A to K of group M, revealed that there was no HIV-1 strain carrying glutamic acid at the 116th position of the CA, although this position was occupied with variable amino acid residues .Analysis of 95 HIV-1 strains in the Los Alamos HIV sequence databases To determine whether the single amino acid substitution at the 116th position of the CA improved the replicative capability of NL-4/5S6/7SvifS in human cells, we introduced the G116E mutation into NL-4/5S6/7SvifS. Resultant viruses were designated NL-4/5SG116E6/7SvifS and inoculated into human CEMss or MT4 cells together with their parental viruses to analyze their replicative capability Figure . As descvif renamed NL-vifS in the present study, did not grow at all in CEMss cells expressing CM TRIM5α. In contrast, NL-4/5SG116E6/7SvifS could grow in CEMss cells expressing CM TRIM5α [th helix near the L4/5 and L6/7 and is apparently exposed to the surface of the protein structure, the 3-D model of the N-terminus of the CA was constructed by homology-modeling on the basis of the published crystal structure of the N-terminus of the CA of NL4-3 (PDB number 1GWP) , a simian tropic HIV-1 that could grow efficiently in CM cells but inefficiently in human cells, we succeeded in rescuing the impaired replicative capability of the virus in human cells. Sequence analysis of the MA-CA region of the adapted virus revealed that the there was a G-to-E single amino acid substitution at the 116th position of the CA. Introduction of this substitution into the molecular DNA clone of NL-4/5S6/7SvifS indeed improved the virus' replicative capability in human cells. We thus concluded that the recovered replicative capability in human cells was mainly the result of acquisition of the single amino acid substitution at the 116th position of the CA, although small effects of mutations in regions other than the MA-CA cannot be fully excluded at present.http://www.hiv.lanl.gov/. On the other hand, most HIV-2 and SIVmac strains have glutamine, which has a long side chain similar to E, at this position, and some strains have E. It is possible that the combination of the amino acid residue at the 116th position and L6/7 is important for viral growth. Consistent with this hypothesis, NL-4/5SG116EvifS, a virus with an HIV-1 derived L6/7 and the G116E substitution, showed impaired growth in MT4 cells (data not shown).Although the 116th position of the CA is highly variable among natural HIV-1 strains from subtypes A to K, no virus with E at the 116th position was found in the Los Alamos HIV sequence database 2009 The precise reasons for the impaired replicative capability of NL-4/5S6/7SvifS and effect of G116E in human cells remain to be elucidated. Analysis of a series of CA mutants shown in Figures th position caused an important change in the structure of the surface composed of L4/5 and L6/7 because G, which has no side chain, was replaced by E, which has a long, negatively charged side chain as shown in Figure Although the G116E substitution occurred during long-term cultivation of human cells infected with NL-4/5S6/7SvifS, the viruses with G116E unexpectedly became resistant to CM TRIM5α-mediated restriction (Figures We succeeded in rescuing the impaired replicative capability of simian tropic HIV-1 NL-4/5S6/7SvifS and unexpectedly identified a single amino acid substitution in the CA that affects viral sensitivity to CM TRIM5α-mediated restriction. This finding will increase our understanding of the detailed molecular interactions between the CA and TRIM5α.HIV-1: human immunodeficiency virus type 1; SIVmac: simian immunodeficiency virus isolated form macaque; CM: cynomolgus monkey; Rh: rhesus monkey; SHIV: HIV-1/SIV chimeric virus; CypA: cyclophilin A; TRIM: tripartite motif; CA: capsid; GFP: green fluorescence protein; VSV-G: vesicular stomatitis virus glycoprotein; SeV: Sendai virus; L4/5: a loop between α-helices 4 and 5; L6/7: a loop between α-helices 6 and 7.The authors declare that they have no competing interests.AK, and EEN performed the in vitro experiments; KB performed computational modeling of CA protein; and AK, TS, KB and EEN wrote the paper.

The rings make dihedral angles of 37.9 (2), 64.4 (2) and 83.6 (2)°. In the crystal, inter­molecular O—H⋯N and O—H⋯O hydrogen bonds link the mol­ecules into chains running along [100].In the title compound, C Å b = 11.0653 (12) Å c = 19.725 (2) Å V = 1687.5 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.09 mmT = 298 K 0.41 × 0.16 × 0.13 mm Bruker SMART APEX CCD area-detector diffractometerSADABS; Sheldrick, 2007T min = 0.966, T max = 0.989Absorption correction: multi-scan (7865 measured reflections1729 independent reflectionsI > 2σ(I)1051 reflections with R int = 0.054 R[F 2 > 2σ(F 2)] = 0.040 wR(F 2) = 0.097 S = 1.07 1729 reflections226 parametersH-atom parameters constrainedmax = 0.14 e Å−3 Δρmin = −0.16 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536810038365/cv2764sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536810038365/cv2764Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Cutaneous mast cell tumours are one of the most common neoplasms in dogs and show a highly variable biologic behaviour. Several prognosis tools have been proposed for canine mast cell tumours, including histological grading and cell proliferation markers. CD117 is a receptor tyrosine kinase thought to play a key role in human and canine mast cell neoplasms. Normal (membrane-associated) and aberrant CD117 immunoexpression patterns have been identified in canine mast cell tumours. Cytoplasmic CD117 expression has been found to correlate with higher histological grade and with a worsened post-surgical prognosis. This study addresses the role of CD117 in canine mast cell tumours by studying the correlations between CD117 immunoexpression patterns, two proliferation markers (Ki67 and AgNORs) histological grade, and several other pathological variables.Highly significant correlations were found between CD117 immunostaining patterns and histological grade, cell proliferation markers and tumoral necrosis. Highly significant correlations were also established between the two cellular proliferation markers and histological grade, tumour necrosis and epidermal ulceration. A significant correlation (p = 0.035) was observed between CD117 expression patterns and epidermal ulceration. No differences were observed between focal and diffuse cytoplasmic CD117 staining patterns concerning any of the variables studied.These findings highlight the key role of CD117 in the biopathology of canine MCTs and confirm the relationship between aberrant CD117 expression and increased cell proliferation and higher histological grade. Further studies are needed to unravel the cellular mechanisms underlying focal and diffuse cytoplasmic CD117 staining patterns, and their respective biopathologic relevance. The bc-kit . Point mc-kit ,21 and oc-kit -26 whileine MCTs -30. This49 (47.6%) tumours presented a membrane-associated CD117 staining pattern Figure and 8 7. Ki67 laC-kit mutations have been shown to induce ligand-independent (constitutive) CD117 phosphorylation and activation in human neoplasms, both by impairing the regulatory functions of the juxtamembrane domain and by directly targeting the kinase domain [C-kit mutations have been shown to correlate with altered CD117 expression, though mutations weren't present in all MCTs with aberrant CD117 expression [versus invasive) and the clinical variables studied have shown no correlations with any of the pathological variables studied. The available survival data doesn't allow for conclusions as to which of the factors now studied is more suitable for prognostic analysis.The predominance of the Boxer breed among the animals studied reflects a well-known breed predisposition for canine MCTs. However, no significant correlations were found between the breed of the animals and any other of the variables now studied, and the significance of breed regarding the biopathology of MCTs remains unclear. The linear correlation observed between Ki67 labelling index and mean AgNOR counts validates the results of each technique and allows for confirmation of differences in cellular proliferation by two independent methods. The Ki67 labelling index increases in a step-wise way from histological grade I to III, but there is considerable overlapping of both AgNORs and Ki67 values between histological grades. Results have highlighted a strong correlation between cytoplasmic CD117 immunoexpression and increased cell proliferation and higher histological grade (itself partly based on mitotic index) when compared with the normal, membrane-associated expression pattern. Two distinct patterns for CD117 cytoplasmic staining have been described -15. In te domain . Such mupression . By elucpression , thus sec-kit mutation. Moreover, cytoplasmic CD117 expression also correlates with increased histological grade, tumour necrosis and epidermal ulceration. No differences were observed between focal and diffuse cytoplasmic staining patterns, suggesting that these represent similar cellular changes, or perhaps a progressive process of cytoplasmic CD117 accumulation. Our future aims are to look for possible mutations in the c-kit gene in canine MCCs.Cytoplasmic expression of CD117 correlates with increased cellular proliferation, as assessed by both Ki67 labelling index and by AgNORs mean counts. This is in accordance with the known functions of CD117 as a growth factor receptor and is probably associated with a 103 MCTs surgically removed from 67 dogs, between 2000 and 2006, were sent for examination at the ICBAS-UP Veterinary Pathology laboratory. The animals comprised 30 males and 37 females, with ages ranging between 2 and 20 years and a mean age of 7.3 years. 33 (49.25%) animals were of the Boxer breed, 18 (26.87%) of mixed breed and 16 (23.88%) of other breeds . All nodules were considered as primary MCTs, even when occurring in a multiple pattern. Samples were fixed in 10% buffered formallin and paraffin-embedded. Thin serial sections were obtained for each sample and used for routine haematoxylin-eosin (H&E) staining, AgNOR staining and immunohistochemical detection of CD117 and Ki67. 3 μm-thick sections were used for all techniques except AgNORs (4 μm).Histological grading was performed on H&E-stained slides, following Patnaik's system , by two AgNOR staining was performed as previously described . The staMonoclonal antibodies against Ki67 and polyclonal antibodies against CD117 were employed, using the avidin-biotin-peroxidase (ABC) method. Heat-induced antigen retrieval (HIER) was performed: for Ki67, slides were incubated for 30 minutes in a commercial antigen retrieval solution (Dako), at 100°C in a water bath. For CD117, slides were incubated in a 10 mM citrate buffer (pH = 6.0) in a steamer, for 2 minutes. Endogenous peroxidase activity was blocked by immersing slides in methanol containing 3% hydrogen peroxide for 10 minutes. Anti-Ki67 and anti-CD117 antibodies were diluted at 1:50 and 1:450 in 5% bovine serum albumin, respectively. Slides were incubated with antibodies overnight at 4°C. Human gastrointestinal stromal tumours (GISTs) were used as positive controls for CD117 staining. Detection was performed using 3,3'-diaminobenzidine substrate (Dako). Sections were then counterstained with Mayer's haematoxylin, dehydrated, cleared and mounted in Entellan mounting medium (Merck). Slides were evaluated under light microscopy. The KI67 index was determined in areas with high labelling immunoreactivity, excluding areas of necrosis and inflammation, per 1000 cells, as previously described . For CD1Nonparametric analysis was conducted, using SPSS 14.0, with a significance level of 5% and bilateral tests. Pearson's independent chi-squared test was used to assess the correlations between CD117 immunostaining patterns and several clinical and pathological variables. Kruskal-Wallis test was used to assess differences between Ki67 median values and AgNORs mean counts of different variables. A Spearman's correlation was calculated between Ki67 labelling index and AgNORs mean counts.RMGC participated in conceiving and designing the study, diagnosed and graded the tumours, interpreted histochemical and immunohistochemical assays and drafted the manuscript; EM performed the statistical analysis, CL and AR carried out the histochemical and immunohistochemical assays; FG conceived and designed the study, participated in diagnosing and grading the tumours and in interpreting the results. MAP participated in designing the study and interpreting the results. All authors read and approved the final manuscript.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed. Harvest femur and tibiae from the hind legs of each. Then, with a razor blade, cut each end of the femurs to remove the hip and knee joints and to expose the marrow.The first step of the procedure is to harvest bone marrow from the femurs and tibiae of a 6- to 12-week old mouse (we are using BALB/c mice but you can do this procedure with any mouse strain). To begin, euthanize the mouse by COIn a similar manner, cut each end of the tibiae to remove the knee and ankle adjacent regions and to expose the marrow.Take a 3 mL syringe with a 26-gauge needle and fill it with RPMI supplemented with 10% FBS, penicillin, streptomycin, and beta-mercaptoethanol (BME = 100 uM). Using tweezers, hold the bone over a Petri dish containing RPMI media. Insert the syringe needle into one end of the bone and depress the plunger to flush out the bone marrow. The syringe needle can be moved up and down inside the bone to flush out residual marrow.Repeat the procedure for all the bones, and then proceed with establishing the cultures. To establish the bone marrow cultures, pipette the flushed bone marrow up and down several times to break up the tissue into a cell suspension.Place a 70 micron filter on top of a 50 mL conical tube, and add the cell suspension to the filter.Rinse the Petri dish one time with RPMI, then add the rinse to the 70 micron filter.Using the rubber end of a 1 mL syringe plunger, grind the bone marrow pieces remaining on top of the 70 micron filter.Wash the filter one time with RPMI.After washing the filter, centrifuge the cell suspension at 1200 rpm for 5 minutes.Wash the cell pellet by resuspending in PBS.Count the cells using a hemocytometer. We typically obtain ~90 million cells from one mouse’s bones (two femurs plus two tibiae). After counting the cells, centrifuge them again at 1200 rpm for 5 minutes.Resuspend the cells in a small amount of RPMI and aliquot them into tissue culture flasks containing enough RPMI so that the final concentration is 1 million cells per mL.Add cytokines to promote the development of your cell type of interest. In this case, the cytokine interleukin-3 (IL-3 = 10 ng/mL) is added to promote the development of basophils and mast cells. To acquire basophils, incubate for 10 days. For mast cells, incubate for 5 weeks. When generating mast cells, the media and IL-3 should be changed once a week.Here is a look at how mast cells should appear just after plating. This image demonstrates the differentiation of mast marrow cells into basophils and mast cells 10 days after the addition of interleukin-3.Once the desired cell type is obtained, proceed with the electroporation step. To begin the electroporation step, determine the number of cells in the culture flask.Cells are typically electroporated at a density of 10 million per mL, so transfer the required cell number to conical tubes and centrifuge the tubes at 1200 rpm for 5 minutes.After centrifuging, aspirate the media, wash the cells with 1X PBS, and centrifuge again at 1200 rpm for 5 minutes.Aspirate the PBS and add Bio-Rad Gene Pulser electroporation buffer to make a cell suspension of 10 million cells per mL.After resuspending the cells, add the desired plasmid DNA at a final concentration of 10 to 20 micrograms per mL.Aliquot 150 microliters of the cell suspension into wells of your choice on a 96-well electroporation plate.Put the electroporation plate in the MXcell plate chamber and close the lid.Prior to transfection of mast cells, an electroporation protocol must be programmed into the MXcell unless using a preset or stored protocol. Through optimization experiments we have discovered that the highest transfection efficiencies of mast cells occur using square wave pulse protocols. We will vary the electroporation conditions on the plate to deliver 300V/20ms, 350/15ms, 350V/20ms, and 350V/10ms square wave pulses at 2000uF and 1000 ohms. Once the protocol has been set and loaded onto the device, press “Pulse” to electroporate the cells.After electroporation is complete, transfer the cells to a tissue culture plate. We typically transfer each 150 microliter electroporation sample to a well in a 48-well tissue culture plate containing 300 microliters RPMI with 10 nanograms per mL interleukin-3. Cells are incubated overnight at 37°C, then assayed 24 hours later for expression and suppression.The fluorescent microscopy image of the cells after successful electroporation using 20 micrograms per mL GFP plasmid is shown in the video. Using the MXcell electroporation system transfection efficiencies of about 30% can be obtained. The system allows you to vary conditions to maximize your transfection efficiency, while maintaining cell viability.As more genomic information emerges and new tools such as siRNA are developed, the use of physiologically relevant cells has become ever more important to further our understanding of disease pathways, protein-protein interactions, and signal transduction. Primary cells are obtained directly from tissues or fluids and cultivated in vitro. These cells can be manipulated in a number of ways, including through the introduction of exogenous genetic material. It is becoming increasingly apparent that the most effective way to introduce plasmid DNA or siRNA into primary cells is electroporation.Electroporation exposes cells to electric pulses in order to transiently increase the permeability of the cell membrane, thereby allowing exogenous nucleic acids to enter the cell. This method of transfection can be optimized to accommodate for differences between different cell types/lines and, thus, can be used to transfect mast cells as well as any other bone marrow-derived cell. Furthermore, unlike viral-mediated transfection, electroporation does not impose limits on the size of transfected DNA, nor require extensive preparation. In contrast to lipid-mediated transfection, electroporation can be less toxic and does not result in endosomal trapping of the transfected nucleic acid.Bio-Rad has developed the MXcell electroporation system specifically for these cells. the MXcell allows you to vary conditions to maximize your transfection efficiency and cell viability. In order to optimize transfection efficiency and minimize cell death, a multitude of electroporation parameters including voltage, capacitance, resistance, and pulse length can be adjusted and evaluated.

Anopheles gambiae, on the basis of similarity to known miRNAs from other species. An. stephensi is the most important malaria vector in Asia and it is becoming a model Anopheline species for physiological and genetics studies.microRNAs (miRNAs) are non-coding RNAs that are now recognized as a major class of gene-regulating molecules widely distributed in metozoans and plants. miRNAs have been found to play important roles in apoptosis, cancer, development, differentiation, inflammation, longevity, and viral infection. There are a few reports describing miRNAs in the African malaria mosquito, An. stephensi female mosquitoes. Seventeen of the 27 miRNAs matched previously predicted An. gambiae miRNAs, offering the first experimental verification of miRNAs from mosquito species. Ten of the 27 are miRNAs previously unknown to mosquitoes, four of which did not match any known miRNAs in any organism. Twenty-five of the 27 Anopheles miRNAs had conserved sequences in the genome of a divergent relative, the yellow fever mosquito Aedes aegypti. Two clusters of miRNAs were found within introns of orthologous genes in An. gambiae, Ae. aegypti, and Drosophila melanogaster. Mature miRNAs were detected in An. stephensi for all of the nine selected miRNAs, including the four novel miRNAs (miR-x1- miR-x4), either by northern blot or by Ribonuclease Protection Assay. Expression profile analysis of eight of these miRNAs revealed distinct expression patterns from early embryo to adult stages in An. stephensi. In both An. stephensi and Ae. aegypti, the expression of miR-x2 was restricted to adult females and predominantly in the ovaries. A significant reduction of miR-x2 level was observed 72 hrs after a blood meal. Thus miR-x2 is likely involved in female reproduction and its function may be conserved among divergent mosquitoes. A mosquito homolog of miR-14, a regulator of longevity and apoptosis in D. melanogaster, represented 25% of all sequenced miRNA clones from 17-day old An. stephensi female mosquitoes. An. stephensi miR-14 displayed a relatively strong signal from late embryonic to adult stages. miR-14 expression is consistent during the adult lifespan regardless of age, sex, and blood feeding status. Thus miR-14 is likely important across all mosquito life stages.We report the cloning and characterization of 27 distinct miRNAs from 17-day old An. stephensi mosquitoes. Comparisons between miRNA gene clusters in Anopheles and Aedes mosquitoes, and in D. melanogaster suggest the loss or significant change of two miRNA genes in Ae. aegypti. Expression profile analysis of eight miRNAs, including the four new miRNAs, revealed distinct patterns from early embryo to adult stages in An. stephensi. Further analysis showed that miR-x2 is likely involved in female reproduction and its function may be conserved among divergent mosquitoes. Consistent expression of miR-14 suggests that it is likely important across all mosquito life stages from embryos to aged adults. Understanding the functions of mosquito miRNAs will undoubtedly contribute to a better understanding of mosquito biology including longevity, reproduction, and mosquito-pathogen interactions, which are important to disease transmission.This study provides experimental evidence for 23 conserved and four new microRNAs in Drosophila, the pri-miRNA is processed by a Drosha-Pasha complex to yield pre-miRNA, small stem-loop structures that are approximately 70 nucleotides (nt) in length [microRNAs (miRNAs) are non-coding RNAs that are now recognized as a major class of gene-regulating molecules widely distributed in metozoans and plants ,2. Many n length . These sn length ,3,6. Then length ,10.Drosophila ovary [D. melanogaster [Drosophila miRNAs, Lai et al. (2003) reported 38 putative miRNAs in the African malaria mosquito, Anopheles gambiae, that are conserved with Drosophila miRNAs [An. gambiae miRNAs on the basis of similarity to known miRNAs [Plasmodium parasites to mature and become infective within a female mosquito [An. stephensi because this species is an important malaria vector in Asia and it is becoming a model Anopheline species for physiological and genetics studies. Here we report direct cloning and characterization of 23 conserved and four new miRNAs from the An. stephensi adult female. Comparative analysis uncovered the loss or significant change of two miRNA genes in a divergent mosquito Ae. aegypti. We also determined the expression profile of several selected miRNAs including the four new miRNAs across all life stages of An. stephensi. We performed further expression analysis on two miRNAs that are implicated in mosquito reproduction and longevity.miRNAs have been found to play important roles in apoptosis, cancer, development, differentiation, inflammation, longevity, and viral infection ,11-17. Ela ovary to a thila ovary . It is enogaster . In flienogaster . In a sti et al. 03 reportn miRNAs ,23. Howemosquito . We usedAn. stephensi small RNA sequences showed 100% match to the An. gambiae genome assembly and were identified as probable miRNA sequences match to published miRNAs from organisms other than mosquitoes have conserved sequences in Ae. aegypti and comparisons between the Anopheles and Aedes hairpins produced miRscan scores ranging from 8.46 to 15.99, supporting their miRNA status , which is reverse complementary to ast-miR-2a. Sequence comparison showed that ast-miR-2a is not derived from aga-miR-2* because of the existence of multiple indels/mismatches between the alignment of aga-miR-2 and aga-miR-2*. The orientation of our cloned ast-mir-2a is consistent with the miRscan prediction based on Anopheles miR-304 and miR-306 do not have conserved sequences in Ae. aegypti. However, they both have homologs in D. melanogaster during miRscan analysis. The failure to produce a positive score by miRscan does not automatically indicate that miR-304 is not a true miRNA because nine out of the 88 known C. elegans/C. briggsae miRNAs produced no scores and two even gave negative scores [An. gambiae suggested that it met all of the previously described criteria for miRNA structures [As mentioned above, e scores . A closeructures ,32.An. gambiae miR-9b and miR-79 is noted on miRBase, but not miR-306; clustering of An. gambiae miR-304, -12, and -283 is not predicted in miRBase [Drosophila serine-threonine kinase group protein. The exons flanking each of the miRNA clusters are conserved between An. gambiae, Ae. aegypti, and D. melanogaster, which indicates that the clusters are orthologous. The order of miRNAs within the introns is conserved between An. gambiae and D. melanogaster, again supporting the miRNA status of the Anopheles miR-304 and miR-306. All miRNAs in the two clusters are in the same orientation as the flanking genes, indicating that these miRNAs may be transcribed from the promoters of their respective flanking genes, which is consistent with previous reports [Anopheles and Drosophila are both correctly annotated because the orientation of transcription of miR-304 is consistent with the flanking gene in both species.Interestingly, miR-304 is closely flanked by miR-12 and miR-283 while miR-306 is in a different cluster with miR-9b and miR-79 or from D. melanogaster of miRNAs, which has not been well studied.As mentioned earlier, miR-304 and miR-306 do not have obvious homologs in D. melanogaster data are available for comparison as in the cases of let-7 and miR-9a, similar expression profiles were found between An. stephensi and D. melanogaster. This is not surprising as these conserved miRNAs are likely to have similar functions in these Dipteran insects. miR-14 was expressed in the same stages in An. stephensi as in D. melanogaster. We provided extended expression analysis on miR-14, the miRNA that represents 25% of the sequenced miRNAs during the cloning of the 17-day old An. stephensi samples. We showed that the miR-14 level increased slightly during embryonic development and remained relatively high through larvae, pupae and adult stages and we did not observe significant changes in adults regardless of age, sex, and blood feeding status. These results do not necessarily imply that mosquito miR-14 is important to longevity, a function of miR-14 demonstrated in D. melanogaster. Nonetheless, it appears that miR-14 is important across different mosquito life stages from embryos to aged adults. Further research on the targets and function of miR-14 in mosquitoes will help determine whether it is important to mosquito longevity. The expression profile of miR-x1 through miR-x4 confirmed our cloning results for these new miRNAs, and provided useful information for future research into their functions. The expression of miR-x2 in An. stephensi was adult specific as well as female specific. miR-x2 was predominantly expressed in the ovary and its level was reduced 72 hrs after blood feeding. These results indicate that miR-x2 is likely involved in An. stephensi female reproduction. The same pattern of expression was shown for miR-x2 in Ae. aegypti, a mosquito that is highly divergent from An. stephensi. Thus the function of miR-x2 may be conserved among divergent mosquitoes.The expression profiles of the eight mosquito miRNAs are informative. When An. stephensi, An. gambiae, and Ae. aegypti, suggesting important functions possibly common to all mosquitoes as the Anopheles and Aedes genera are two of the most divergent among all mosquitoes, separated approximately 145–200 million years ago [We have identified 10 miRNAs previously unknown to mosquitoes, four of which did not match any known miRNAs in any organism. These four miRNAs are conserved between ears ago . ConsideDrosophila [An. gambiae midgut samples infected with Plasmodium bergei [An. stephensi miR-x1 and miR-x2 are nearly identical to An. gambiae miR-996 and miR-989, respectively [Drosophila miRNAs [Drosophila [et al. [An. stephensi miR-x3 and miR-x4 showed no similarity to any miRNAs in the miRbase which included updates from the above three papers. Thus miR-x3 and miR-x4 remain novel and potentially specific to mosquitoes. The final names of these miRNAs as assigned by miRBase are shown in Table et al. [An. gambiae (page 6958). However, we have shown that miR-x2 (miR-989) is predominantly expressed in ovaries in both An. stephensi and Ae. aegypti and miR-x2 was not detected in midguts under our condition. We note that the Figure et al. [Three research articles became available when this manuscript was being reviewed. Two of these papers describe additional miRNAs from osophila ,41 and am bergei . Compariectively and homoa miRNAs ,41. Thusosophila ,41, thus [et al. match fie et al. , which we et al. does shoAn. stephensi mosquitoes. Comparisons between miRNA gene clusters in An. gambiae, Ae. aegypti, and D. melanogaster suggest the loss or significant change of two miRNA genes in Ae. aegypti. Expression profile analysis of eight miRNAs, including the four new miRNAs, revealed distinct patterns from early embryo to adult stages in An. stephensi. Further analysis showed that miR-x2 is likely involved in female reproduction and its function may be conserved among divergent mosquitoes. Consistent expression of miR-14 suggests that miR-14 is likely important across all mosquito life stages from embryos to aged adults. Understanding the functions of mosquito miRNAs will undoubtedly contribute to a better understanding of mosquito biology including longevity, reproduction, and mosquito-pathogen interactions, which are important to disease transmission.This study provides experimental evidence for 23 conserved and four new microRNAs in An. stephensi (Indian wild-type strain) and Ae. aegypti (Liverpool strain) mosquitoes were maintained in humidified incubators at 27°C on a 12 hour light:dark cycle.An. stephensi adults were collected at 17 days post-emergence. Mosquitoes were fed blood and allowed to oviposit prior to collection. Aged females are the most relevant mosquito life stage for malaria transmission as it takes approximately two weeks for Plasmodium parasites to mature within the mosquito to an infective stage [32P by T4 polynucleotide kinase and added to the sample to isolate RNAs between 18 and 24 nt in length. Next, 5' and 3' linkers were sequentially ligated to the isolated small RNA as well as the RNA markers. cDNA were generated by RT-PCR using primers derived from the two linker sequences. cDNA were ligated into a 2.1 TOPO TA vector . Ligated plasmids were transformed in One-Shot Mach 1-T1R Competent cells (Invitrogen). We did not concatemerize cDNA prior to cloning. Sequencing was performed by Virginia Bioinformatics Institute core facilities and the University of Washington High Throughput Genomics Unit.For small RNA cloning, approximately 1000 female ve stage . RNA wasve stage from theve stage ) were puAn. gambiae miRNAs were identified by comparing with the miRBase miRNA registry [An. gambiae miRNA predictions listed in [An. stephensi small RNA sequences that matched the An. gambiae genome assembly were further analyzed to uncover new miRNAs from mosquitoes was unscorable by miRscan . Subsequent steps were based upon Wienholds et al. [An. stephensi miRNAs. The membranes were washed twice for 35 minutes in an Ambion-recommended wash buffer at 42°C, and then once in low stringency buffer for 5 minutes at room temperature. The membranes were incubated for 30 minutes in blocking buffer followed by a 1 hr incubation with Anti-DIG-alkaline phosphatase fAb in blocking buffer. The membranes were washed three times for 15 minutes in low stringency wash buffer followed by twice with alkaline phosphatase buffer. The membranes were then immersed in CDP-Star solution (Roche) for 5 minutes, and placed inside saran wrap for exposure to X-ray film for 30 minutes.Northern hybridizations shown in Figure s et al. . FollowiAn. stephensi adult females as well as 3, 5, 10, and 17 day old An. stephensi adult males that were maintained on sugar water. The same cohort of adult females, which were fed on blood on day 5 after emergence and allowed to oviposit two days later, were collected at day 10, 17, and 24. RNA isolation and northerns were carried out as detailed above. For tissue sample northern blots were collected from 60 bloodfed and 60 non-bloodfed six day old mosquitoes. This procedure was repeated again at 72 hrs after blood feeding with eight day old mosquitoes. The mosquitoes were not permitted to oviposit. All tissues were stored in RNA later (Ambion) during collection, then vortexed and stored in -80°C until RNA isolation as above using a mirVana miRNA Isolation kit (Ambion). Northern hybridization was performed as describe above except that 5 ug of total RNA were used. The same procedure was followed for Ae. aegypti mosquito tissue analysis. In separate experiments, 10 ug of total RNA isolated from whole body were used to compare the expression of miR-x2 in males and non-bloodfed females of both species. We have performed replicates for all expression profile analyses and obtained consistent expression patterns between replicates.For the northern blots shown in Figure s Figure , five daRPA was used to examine ast-miR-76. Double-stranded oligos with a T7 promoter 5' of an antisense sequence of the miRNA were produced by annealing two single-stranded oligos. The annealed oligos were used to synthesize an RNA probe that was 9 nt longer than the miRNA, as seen below:ast-miR-765'TTCGTTGTCGACGAAACCTGTTTTCTCCCTATAGTGAGTCGTATTA 3'3'AAGCAACAGCTGCTTTGGACAAAAGAGGGATATCACTCAGCATAAT 5'32P-UTP, Perkin-Elmer) antisense transcripts. Templates were synthesized for 4 hours, and purified from acrylamide gels by elution and isopropanol precipitation (1× volume) with 1/10 volume 3 M NaOAc and glycogen. 50,000 cpm of probe was added to 5 ug total RNA and denatured at 96°C for 3 minutes followed by 42°C hybridization overnight. Next, the hybridized samples were digested with RNase A/T1 for 45 minutes at 37°C to remove single-stranded RNA, and to trim unhybridized regions of the probes. Afterwards, the samples were ethanol precipitated and resuspended in 5 ul 2 × loading buffer. Resuspended samples were denatured at 96°C for 5 minutes followed by a quick chill on ice before loading. RNA were separated using a 15% denaturing polyacrylamide gel at 150 V. Locations of bands were examined by X-ray film exposure, using an intensifying screen. Size markers were as described for northern blot analysis.Our design also considered the possibility for future multiplexing by adding extra 4 adenosines immediately following +1 which were indigestible according to the instruction manual of the "mirVana miRNA Probe Construction Kit" (Ambion). This permitted the undigested probe to run at ~29 nt, and digested/protected probe to run at ~24 nt. We utilized a "MEGAscript RNAi kit" (Ambion) to synthesize radiolabeled (digoxigenin: DIG; Locked nucleic acid: LNA; microRNA: miRNA; nucleotide: nt; untranslated region: UTR.EAM assisted in experimental design. EAM conducted the experimental work, analyzed data, and wrote a rough draft of the manuscript. ZT prepared the experimental design, helped with data analysis, and revised the manuscript; ZT is the principal investigator who oversaw this project.Click here for file

MYH7) gene. The proband's ominous family history indicates that the combination of the R719Q and T1513S variants in cis may be a “malignant” variant that imparts a poor prognosis in terms of the disease progression and SCD risk.Hypertrophic cardiomyopathy (HCM) is an inherited cardiac disease with an autosomal dominant mode of transmission. Comprehensive genetic screening of several genes frequently found mutated in HCM is recommended for first-degree relatives of HCM patients. Genetic testing provides the means to identify those at risk of developing HCM and to institute measures to prevent sudden cardiac death (SCD). Here, we present an adoptee whose natural mother and maternal relatives were known be afflicted with HCM and SCD. The proband was followed closely from age 6 to 17 years, revealing a natural history of the progression of clinical findings associated with HCM. Genetic testing of the proband and her natural mother, who is affected by HCM, revealed that they were heterozygous for both the R719Q and T1513S variants in the cardiac beta-myosin heavy chain ( MYH7), which is mutated in approximately 15% to 30% of all HCM [MYH7 have also been found to be associated with severe disease, including greater hypertrophy, younger age at diagnosis, and worse prognosis [Hypertrophic cardiomyopathy (HCM), characterized by thickened ventricles, cardiomyocyte hypertrophy, and myofibrillar disarray, is a relatively common inherited cardiac condition, affecting approximately 1 in 500 individuals. HCM, which is the leading cause of sudden cardiac death (SCD) in youth, causes significant morbidity and mortality in affected individuals [rognosis .The proband, an adopted six-year-old girl, and her four-year-old sister were brought to a pediatric cardiologist for evaluation, largely at the insistence of the natural maternal grandmother (MGM), who had maintained contact with the adoptive parents. At the time of the initial evaluation, the proband's family history, obtained through the natural MGM, was notable for hypertrophic cardiomyopathy (HCM) in her maternal uncle (diagnosed on autopsy following SCD at age 15), maternal grandfather (s/p ICD for HCM), and two maternal great aunts (SCD at age 16 and 36) . At the At 8, 11, and 13 years, the proband was largely asymptomatic. The electrocardiograms showed no evidence of ST changes, left ventricular hypertrophy (LVH), or T-wave changes. The echocardiograms were completely within normal limits. She remained a very active child playing soccer and basketball without any exercise intolerance. At 13 years, the proband experienced a syncopal episode lasting a few minutes that was attributed to a vasovagal event. Her ECG and Holter monitoring at the time did not show any abnormalities. At 14 years, the proband continued to be athletic and denied any symptoms. Her physical exam and echocardiogram were normal. However, the proband's ECG did show nonspecific ST-T wave changes . At thisAt 15 years, the proband's ECG showed right bundle branch block, right posterior fascicular block, and Q waves in the lateral and inferior leads . SubsequAt 17 years, the proband's echocardiogram showed very mild concentric LVH , with evidence of diastolic dysfunction . An exercise stress test did not reveal any evidence of ischemia or ectopy, and Holter monitoring was unremarkable. At this time, the proband was restricted from participating in competitive athletics, and genetic testing was performed (see below). An MRI performed two weeks later showed normal overall left ventricular mass at 67 g/m sq and normal interventricular septal and posterior wall thickness, but also revealed a prominent 2.7 cm thickening of the anterior wall at the base of the left ventricle . http://www.hpcgg.org/LMM/), involved sequencing the coding regions and splice sites of the genes encoding the sarcomeric proteins cardiac alpha-actin (ACTC), cardiac myosin-binding protein C (MYBPC3), cardiac beta-myosin heavy chain (MYH7), myosin regulatory light chain (MYL2), cardiac myosin essential light chain (MYL3), cardiac troponin I (TNNI3), cardiac troponin T2 (TNNT2), and tropomyosin 1 (TPM1). In addition, the genetic testing included sequencing the genes for alpha-galactosidase A (GLA), lysosomal associated membrane protein 2 (LAMP2), and AMP-activated protein kinase, gamma-2 subunit (PRKAG2), which are involved in storage diseases that can lead to cardiac hypertrophy [MYH7 gene: the proband was doubly heterozygous for a R719Q variant (2156G>A in Exon19) as well as a T1513S variant (4537A>T in Exon 33). The R179Q variant alone was likely to be causative for HCM as it met the criteria for pathogenity based on segregation studies and frequency [http://www.hpcgg.org/LMM/) and in one patient reported in the literature [The genetic testing, performed by the Harvard-Partners Laboratory for Molecule Medicine or in trans (on different copies of the gene), we contacted the proband's natural birth mother. The natural mother (36 years old) was found to have developed significant hypertrophic cardiomyopathy with debilitating heart failure symptoms. She had received an ICD and was awaiting septal myomectomy. The genetic test on the mother revealed that she too was a heterozygote for both the R719Q and T1513S variants.To determine the significance of the Here, we present a case of a young adoptee with significant family history of HCM and sudden cardiac death who was closely monitored from age 6 to 17. This close follow-up revealed a pattern of natural history of HCM which may be generalizable. Firstly, her ECG began to show subtle changes as early as age 15, when her echocardiogram and MRI were normal. Then, at age 17, her echocardiogram showed diastolic dysfunction in the setting of minimal hypertrophy. Interestingly, an MRI obtained just two weeks later showed focal thickening in the anterior wall not previously seen by echocardiogram. These observations suggest that the appearance of ECG changes and diastolic dysfunction predate gross hypertrophy on echocardiogram, and that cardiac MRI is a more sensitive modality to detect focal hypertrophy .MYH7 gene, indicating that the two variants are on the same copy of the gene. In the only prior report of this variant combination, an implantable cardioverter defibrillator (ICD) was placed partly because of significant family of sudden cardiac death [in cis may be a “malignant” variant that imparts a poor prognosis in terms of the disease progression and the SCD risk. In the previous studies, the R719Q mutation was associated with divergent clinical presentations and prognoses: from mild hypertrophy without incidence of sudden death in a family of Hispanic origin [MYH7 gene's exon 33, where the T1513S variant is situated, was not sequenced in either study, so it is possible that the Chinese family with the malignant phenotype carried an additional mutation in cis, resembling the R719Q and T1513S variant combination reported here. The proband and her mother were both found to have the R719Q and T1513S variants in the ac death . The proc origin to high c origin . HoweverMYH7 gene. Thus, the proband has a 50% of chance of transmitting the disease genotype to each of her children rather than a 100% chance had the two variants been on separate chromosomes. This case highlights the importance of the need for close follow-up and comprehensive genetic evaluation of first degree relatives of patients with hypertrophic cardiomyopathy.This case is notable for the fact that the proband was an adoptee whose adoptive parents have maintained contact with the natural maternal grandmother. This was critical in providing the ominous family history that compelled close cardiac follow despite the lack of overt evidence of HCM for many years. Finally, genetic testing of the affected natural mother provided the critical information establishing that the two variants were on the same copy of the

The previously observed impairment of macrophage activity can then be explained at a subcellular level.Alveolar macrophages have recently been postulated as being involved in the aetiology of adult respiratory distress syndrome (ARDS). To evaluate their role, basal cyclic AMP levels and responsiveness of adenylyl cyclase alveolar macrophages were determined at four intermediate stages of developing respiratory distress in piglets using a protocol with repeated lung lavage. Examination of alveolar cells recovered from the subsequent lavages reveals an influx of granulocytes (neutrophils and eosinophils) within 1 h of two intensive lung lavages. During the developing respiratory distress the basal cyclic AMPlevel of alveolar macrophages increases and adenylyl cyclase responsiveness to prostaglandin E

Sir,Electrotherapy is a part of regular physical therapy practice which forms a main portion of both undergraduate and postgraduate education. It plays a role in providing pain relief for patients with both acute and chronic pain. In this era where a lot of emphasis is placed on appropriate drug management, it is commendable that the authors in their recent study decided TENS is a modality whose effects depend on the intensity used and also on the sensory and motor effects. With regard to this, even a low intensity of TENS could produce an effect on the nerves in the control group. Literature describes an intensity which is comfortable to the patient at a frequency between 80 and 100 Hz. Clarity et al. found that TENS did reduce the rescue medication needed 5 days postoperatively when compared with patients on controlled morphine.[Secondly, the authors mentioned that TENS was used to reduce the usage of adjunctive drug management. Solak morphine. If theseThirdly, with regard to outcomes, we would like to highlight those that we think would be reliable for these patients. They are pulmonary function testing (PFT) as an indicator for airway clearance and patient comfort during activities of daily living (ADL). PFTs have been used in the literature as an outcome measure and have shown improvements with TENS.5 It woulLastly, we believe it would be of great use to the patient if TENS was used in the later stages, especially after the discontinuation of epidural analgesics, as at this point pain forces the patients to be less cooperative with airway clearance techniques and mobilisation. If this occurs, the chances of developing pulmonary complications are high. However, the optimal timing for starting TENS among these patients needs to be determined.et al.[To conclude, the use of TENS should be neither underestimated nor disregarded during the postoperative phase of patients undergoing thoracotomies. The positive results obtained in the study by Chandra et al. and alsoet al.5 show th

In this investigation, the p53 status of a Welsh population of Barrett's-associated oesophageal adenocarcinomas were fully characterised at the gene sequence, chromosomal, mRNA and protein levels. In total, 31 tumours were examined for p53 gene sequence mutations using RFLP with sequencing, allelic loss of the gene was characterised by FISH, mRNA expression by p53 pathway signalling arrays and protein levels by p53 immunohistochemistry. In all, 9.6% of adenocarcinomas harboured p53 mutations, 24% displayed p53 allelic loss and 83% exhibited p53 protein accumulation. Point mutations and deletions of the gene did not coexist within the same samples. All samples containing p53 mutations also displayed positive immunostaining; however; in the majority of cases, p53 protein accumulation developed in the absence of mutations. The gene expression analysis demonstrated no differences in p53 and mdm-2 transcription levels between the p53 immunonegative and immunopositive samples, indicating other mechanisms underlie the proteins' overexpression. In conclusion, p53 mutations and deletions do not appear to be frequent events in oesophageal adenocarcinomas; however, abnormal accumulation of the protein is present in a vast majority of cases. P53 gene mutations are not the primary cause of protein overexpression – an alternative mechanism is responsible for the positive p53 immunohistochemistry detected. The incidence of oesophageal adenocarcinoma has risen at a greater rate than any other malignancy in the USA and most European regions, currently varying from one in 146 to one in 285 cases/patient/year . It is sBarrett's oesophagus and its associated oesophageal adenocarcinoma show p53 alterations like many other malignant conditions, with allelic loss and mutations being the most commonly documented means of gene inactivation. Loss of heterozygosity (LOH) of the p53 locus has been found in 75–80% of oesophageal adenocarcinomas (www.iarc.fr). Mutations at these sites disrupt p53s ability to bind DNA and regulate stress response genes. The result is an accumulation of errors in the genome, which is passed onto daughter cells thus aiding neoplastic progression. This may explain why Barrett's patients with p53 mutations have more advanced tumours, significantly worse prognosis and are on average 15 years younger than those without such alterations .1 × 4 μm sections on glass slides were used for DNA extraction .5 × 4 μm section on an Apes slide was used for investigation using fluorescence in situ hybridisation .1 × 4 μm section also on an Apes slide was for immunohistochemical analysis (protein level investigation).1 × 4 μm section on a glass slide was required for total RNA extraction .1 × 20 In all, 31 cases of Barrett's adenocarcinoma were retrieved from the archives of the Departments of Pathology in Singleton and Morriston Hospitals . The male : female ratio was 4 : 1 with an age range of 42–95 years (median of 66.5 years). The samples had been formalin-fixed then paraffin-embedded and included both biopsies and surgical resections. In total 8 × 4 μm sections/patient. The samples were dewaxed and the DNA extraction was performed utilising a Stratagene Kit .To enrich for tumour cells, DNA was only extracted from the specific neoplastic areas within the 5 × 4 As the final concentration of DNA extracted was low, nested PCR was used to amplify p53 exons 5–8 from each sample and 273 (exon 8), respectively. To characterise hotspot mutations detected by RFLP and identify mutations that lay outside the codons examined, the p53 exons 5–8 from each sample were sequenced in both forward and reverse directions. The primers used for sequencing are detailed in Restriction fragment length polymorphism (RFLP) was employed to rapidly screen for mutations within p53 hotspot codons. The normal sequence at codons 175 (exon 5), 213 (exon 6) and both 248 (exon 7) and 282 (exon 8) were digested with One paraffin-embedded section from each of the 31 oesophageal adenocarcinomas was processed, according to the standard ABC immunoperoxidase procedure for p53 immunohistochemical analysis and using mouse anti-human monoclonal antibody DO-7 . The antibody was diluted 1 : 50 in PBS and was applied as previously described . The immSlides were dewaxed in three 10-min xylene washes, dehydrated in two 5-min 100% ethanol washes and then allowed to air dry. Tissue sections were permeabilised using a Paraffin Pre-treatment Reagent Kit according to the manufacturers' instructions; however, the protease solution digestion was extended to 25 min.FISH probes LSI p53 (orange) and CEP 8 (green) were subsequently cohybridised onto to the pretreated sections from each sample as previously described . The isolated RNAs from the immunopositive samples were pooled together, as were the RNA extracted from the five immunonegative tissues, to collect a sufficient quantity for the subsequent gene expression analysis. Pooling the samples increased their total volume to 50 μl; hence, to further concentrate them, the RNA was precipitated and resuspended in 10 μl sterile RNase-free water.The total RNA was extracted from 2 × fresh biopsies taken within an area of normal squamous cell epithelium from 3 patients using the TRIspin method were applied to the GEArray Q Series Human p53 Signalling Pathway Gene Array , according to the manufacturers' instructions. A total of 96 genes involved in p53 upstream and downstream signalling, in addition to the p53 family itself, were represented on the arrays utilised.The integrated results for the p53 mutation, deletion and immunohistochemical analyses are detailed in Mutations in the p53 gene were found in 9.6% (3/31) of oesophageal adenocarcinomas. Four base substitutions were identified in total of oesophageal adenocarcinomas. The proportion of cells within each sample containing this aberration ranged from 14 to 24% . The celFigure 1Accumulation of the p53 protein was detected in 83% (24/29) of the oesophageal adenocarcinomas examined. Weak-to-moderate nuclear p53 immunostaining was observed in five samples, while the remaining 19 samples all had strong immunostaining for the protein .Immunopositivity for the p53 protein was detected far more frequently than mutation or deletion of the gene. Only three out of 24 cases immunopositive for p53 contained a mutated gene. Two out of the three samples with mutations exhibited strong p53 staining, but the sample harbouring two mutations in the p53 gene (number 7) only scored moderately for p53 protein accumulation.Oesophageal adenocarcinomas with p53 mutations did not contain gene deletions in addition. Notably, allelic loss of p53 was associated with 40% (two out of five) of the p53 immunonegative samples.The arrays employed harboured two spots for each of five constitutively expressed control genes, which displayed strong hybridisation signals on all arrays utilised. Hence, validating the adequate quality of RNA extracted from both fresh and archival material. Figure 2When comparing gene expression patterns in the adenocarcinomas (both immunonegative and immunopositive) to the normal squamous tissues, the most striking difference observed was the loss of p16 gene expression in both cancer arrays . A slighvs immunonegative oesophageal adenocarcinomas. The preliminary data indicated there was a slight downregulation of the HSP70 and GADD45A genes; however, no further RNA was available to verify this observation by quantitative PCR. It was also notable that no increase in expression of the p53 and mdm-2 genes was seen in the immunopositive samples, despite the presence of strong p53 protein accumulation . This discrepancy could be due to several factors. Differing methodologies may be responsible, for example, PCR-based techniques alone may introduce artefacts (due to errors introduced by the polymerase enzyme) if they are not confirmed by a second independent experiment. Additionally, RFLP and sequencing will only identify mutations if they are present in over 10% of cells within the tumour. If mutations were present in a very small subclone of cells, then they may not have been detected with the techniques employed in this study. Hence, investigations using more sensitive molecular techniques may result in the identification of rare p53 mutations may cause variability, as would different populations and their habits . Finally, variation in the statistical methods applied may provide another source of discord.Only 10% of the oesophageal adenocarcinomas examined were found to contain a mutation within the p53 gene. Just one of these was identified within a hotspot (codon 245), while those remaining were detected directly adjacent to the hotspot codons. The mutation frequency determined in this investigation was considerably lower than reported in the general literature; nevertheless, two other studies documented comparably lower p53 mutation frequencies of 8 and 12% ; therefore, indicating nonmutational p53 protein stabilisation is responsible. A recent publication has demonstrated p53 immunostaining in a variety of normal tissues when using the D07 antibody (The most important finding in this investigation was that while 83% (24 out of 29) of the adenocarcinomas were immunopositive for p53 protein, only 9.6% (three out of 31) contained a gene mutation. The remaining 21 cases with p53 immunoreactivity all had a normal p53 sequence between exons 5–8. It is possible that mutations may be present in the exons that were not evaluated in this study. However, this would be unlikely to account for the high level of p53 protein positivity detected, as very few mutations have been detected outside of exons 5–8 (The transcripts examined in the present study were expressed at similar levels in both the p53 protein positive and negative samples; in addition, there was no difference in the expression levels of the p53 and mdm-2 genes . AlthougThe gene expression patterns between the normal squamous epithelium and oesophageal adenocarcinoma were also compared. Expression of the p16 tumour suppressor gene was considerably down regulated; hence, was probably a common event in all of the tumours, which is in agreement with the literature. LOH at the p16 locus and methylation of the genes' promoter region have been frequently identified in both premalignant Barrett's epithelium and oesophageal adenocarcinoma – events that have been strongly associated with loss of p16 expression (Paraffin-embedded tissues are an invaluable source of material for molecular investigations. However, reliable extraction of RNA from archival samples is problematic. The most successful RNA extraction method to date was utilised in the present study (To summarise, this investigation has demonstrated that 9.6, 24 and 83% of oesophageal adenocarcinomas contained p53 gene mutations, deletions and p53 protein immunopositivity, respectively. Mutations did not coexist with deletions of the gene and although all cases with a p53 mutation were immunopositive, most immunopositive cases had no demonstrable p53 mutation. Thus, immunohistochemistry is a poor indicator of p53 gene mutations in oesophageal adenocarcinoma. Although overexpression of the mdm-2 and p53 genes can be ruled out as possible causes, the underlying mechanism responsible for the accumulation of the protein has yet to be determined and requires further investigation.

For large tumors and tumors with small motion range (around 1 cm), the 4D dosimetry did not differ appreciably from the static plans. The dose-volume histogram (DVH) analysis shows that the inclusion of only extreme respiratory phases in 4D dosimetry is a reasonable approximation of all-phase inclusion for lung cancer cases similar to the ones studied, which reduces the calculation in 4D dosimetry.Thoracic cancer treatment presents dosimetric difficulties due to respiratory motion and lung inhomogeneity. Monte Carlo and deformable image registration techniques have been proposed to be used in four-dimensional (4D) dose calculations to overcome the difficulties. This study validates the 4D Monte Carlo dosimetry with measurement, compares 4D dosimetry of different tumor sizes and tumor motion ranges, and demonstrates differences of dose-volume histograms (DVH) with the number of respiratory phases that are included in 4D dosimetry. BEAMnrc was used in dose calculations while an optical flow algorithm was used in deformable image registration and dose mapping. Calculated and measured doses of a moving phantom agreed within 3% at the center of the moving gross tumor volumes (GTV). 4D CT image sets of lung cancer cases were used in the analysis of 4D dosimetry. For a small tumor (12.5 cm Monte Carlo simulation is the most accurate radiation dose calculation algorithm in radiotherapy ,2. With To generate a 4D Monte Carlo dose calculation, it is necessary to calculate the dose on CT image sets derived from different time points across the respiratory cycle. These can then be fused together to calculate cumulative doses. Deformable image registration is an integral part of this process. It provides a voxel-to-voxel link between the multiple respiratory phases of a 4D CT image set so that the dose distribution on each phase can correctly be summed to give a path-integrated average dose distribution ,11. DefoIn this study, 4D Monte Carlo dosimetry was presented. The 4D cumulative point dose in a moving phantom was compared with measurement. Clinical lung cancer cases were studied with the goal of determining under which conditions 4D Monte Carlo dosimetry likely differs from a static plan and how many respiratory phases are necessary to be included in 4D dose calculation.3 (about 3 cm in diameter) while for Case 2 it was 159.1 cm3 (about 7 cm in diameter). For the last two cases, 4D CT image sets were generated from a moving phantom with two different motion ranges, to compare the 4D cumulative doses with actual measurements. The 4D scans of the moving phantom contained 90 slices in each of the ten respiratory phases. All 4D CT imaging was performed on a 16-slice Big Bore CT scanner . The transaxial slice resolution was about 1 mm × 1 mm and the slice thickness was 3 mm for all scans.A total of four CT simulation image sets were used in this study. Two were performed on actual patients. Two lung cancer patients underwent 4D CT scanning (Case 1 and Case 2). These 4D CT data sets were comprised of a total of 10 CT scans per patient, taken at equally-spaced intervals across the entire respiratory cycle (phase-based sorting in 4D CT reconstruction). There were 93 and 94 slices in each respiratory phase of the two 4D CT cases, respectively. The GTV moved about 1.5 cm during the respiratory cycle in Case 1 and 1.0 cm in Case 2, predominantly in the SI direction. The GTV volume for Case 1 was 12.5 cm3 were placed inside the acrylic container to simulate normal lung. An acrylic rod of 3 × 3 × 2 cm3 was placed in the center of the cork blocks to simulate a tumor. The center of this rod contained a 0.04 cc Scanditronix CC04 ion chamber to measure the point dose. The motion range was set to 1.5 (Case 3) or 3 cm (Case 4) at a frequency of about 18 cycles per minute to simulate respiration. The same motion pattern was used during both the 4D CT scan and treatment delivery.The moving phantom was custom-designed Figure . Phantom2 beams were used in the phantom study cases due to the regular shape of the acrylic rod which simulated the GTV.A treatment plan was generated for each of the four CT data sets. Simple 3D-conformal plans were utilized. All the plans were calculated for a Varian Clinac 2100EX linear accelerator . Photon beams of 6 MV in energy were used. The margin from gross tumor volume (GTV) to block edge is 0.5 cm (Case 2) and 1 cm . MLC was used for the conformal plans in Case 1 and 2. Open 5 × 5 cmvide infra). A dose-volume-histogram (DVH) was obtained for each of the respiration phases and the 4D integrated DVH was obtained from the 4D cumulative dose distribution.For Case 1 and Case 2, the tumors were contoured on the maximum inspiration phase of the respective 4D CT image sets and the isocenters were set accordingly. A 3D plan was then generated for each patient. For Case 1, a wedged 3-beam 3D plan was created. A wedged two-field 3D-conformal plan was designed for Case 2. The respective treatment plans were then copied over from the maximum inspiration scan to each of the other nine phases of the CT scan for that patient. A Monte Carlo simulation was used to calculate the dose distribution on each phase. The dose distributions from all other phases were mapped to the maximum inspiration phase using deformation matrices generated via deformable image registration between all the other phase and the maximum inspiration phase. A 4D cumulative dose distribution was created from an equally-weighted average of the dose distributions. This 4D Monte Carlo dosimetry method was applied to the two cases over all ten phases (vide infra). The 4D cumulative doses were generated.For the moving phantom cases, a lateral-opposed 2-beam plan was designed to cover the simulated tumor during the maximum inspiration phase. These beams were copied to the nine other phases of CT scans and the doses were calculated using Monte Carlo methods , the particles stored in the phase space files were recycled 4 times. No specific variance reduction technique was applied. The cutoff energies for electrons (ECUT) and for photons (PCUT) were 0.7 and 0.01 MeV respectively. Dose calculation for one respiratory phase took about 20 hours of CPU time on a 2.66 GHz single-processor personal computer with 2 GB RAM, running Linux.Another EGSnrc based software, DOSXYZnrc , was useThe optical flow method of deformable image registration was then applied to calculate the deformation matrices between the CT images from the different respiratory phases. These matrices were used to map the dose distributions from the various respiratory phases to an average integral dose. The 3D optical flow program was based upon the 2D Horn and Schunck algorithm ,17.2/pixel, each deformable image registration required about three minutes on a personal computer with a single 2.66 GHz CPU and 4 GB RAM. Thus, for a respiratory cycle divided into 10 phases, about half an hour was required to calculate all the deformation matrixes.For typical 4D CT image sets with a sub-sampled slice resolution of 2 × 2 mm2 field at 100 cm of source to surface distance (SSD). This absolute dose conversion assumed that the Monte Carlo calculated reference dose was 1 cGy per monitor unit (MU) which agreed with the accelerator calibration.Absolute dose was used in the 4D dosimetry of the moving phantom by normalizing the dose matrix to the reference dose which was the maximum value of the central depth dose of a 10 × 10 cm2 field demonstrated a 27.5% ± 0.7% drop compared to the static phantom case, while the 4D dosimetry calculation showed a 25.0% ± 1.1% drop. With a motion range of 1.5 cm (Case 3), the central point dose was equivalent for both the phantom measurement and 4D dose calculation due to the fact that the central point was well covered by the treatment beams, given the relatively short motion range.With different motion ranges, the central point dose measurements and 4D dose calculations showed an agreement better than 3%. With a tumor motion range of 3 cm (Case 4), the measured central point dose for a 5 × 5 cmFigure Figure In general, the DVH of the 4D cumulative dose distribution from the mapped doses lies between the optimized static dose DVH at the maximum inspiration (0%) phase and the maximum expiration (50%) phase. However, at times, it can exceed or trail the curve for any individual phase. In Figure When evaluating a treatment plan, one also needs to consider the DVH curves for the normal structures. In particular, different portions of lung move in and out of the treatment field, which causes the 4D cumulative lung DVH to vary from that for any given respiratory phase. This is evident in Figure We next investigated how many respiratory phases are necessary to include in the 4D calculations to reasonably estimate the average dose to the GTV as calculated when incorporating all ten respiratory phases. Figure 3) than in Case 1 (12.5 cm3). This translates into a much smaller percentage volume change for Case 2 when compared to Case 1.In Case 2, the GTV motion is about 1 cm, but the DVH variation is much smaller than that in Case 1 even with a block margin of 0.5 cm across the GTV Figure . This caIn this study, discrepancy between a point dose measurement in a moving phantom and the calculated 4D cumulative dose was less than 3%. The variance is multifactorial, representing a combination of errors from Monte Carlo simulation, image registration, and phantom measurements.In the Monte Carlo simulations, the statistical uncertainties in the high dose regions, such as the GTV, are below 1%. Other error sources include electron source parameters, linear accelerator geometry and materials. Any discrepancies of these items between simulation and reality could introduce variability between calculations and measurements. As shown previously, these differences were within 2% for most cases in our study.Errors in image registration can also affect the calculated dose. There are three root causes for errors in image registration. Artifacts in the 4D CTs, the aperture effect , and theet al [The aperture effect is introduced in regions of flat intensity within the images. When there is no variation in intensity within a region, the voxel-to-voxel correspondence becomes vague. Thus the registration may have larger errors in low contrast regions. For human CT data, detailed anatomic structures, such as veins, help reduce the aperture effect. Our prior research has shown that the average magnitude of this error is smaller than an image voxel size in the thoracic regions . Anotheret al showed tOcclusion may cause motion discontinuity in other image registration applications, such as daily patient CT registration when rectal filling varies. For 4D CT images, occlusion is not a problem since there is no topological change between the respiratory phase images.et al [The Monte Carlo method applied in this study is a classical full Monte Carlo method. The calculation time was long for each case. In recent a few years, various techniques have helped in increasing the computational efficiency of Monte Carlo simulation and reducing its calculation time ,22-24. Uet al is appliIn our 4D test cases, the method noticeably altered the dose calculation compared to static plans only when the tumor was small and the respiratory motion was comparatively large.et al [et al [Vinogradskiy et al demonstrl [et al studied The treatment plans generated for this study were not intended for clinical use. The phase for the original plan was randomly picked between the two extreme phases and the isocenter was placed on the GTV center of the corresponding phase. The margins in the plans were purposely set small compared to the motion ranges so that target volume coverage loss, thus DVH variation of the target volume versus respiratory phase, was more pronounced. The conditions used in our study tended to exaggerate coverage loss and hence was more adverse against the above conclusion. The conclusion is thus deemed more confident when applied to real clinical cases which are usually with better coverage. However, due to limited number of cases studied, this conclusion should not be applied to cases of larger or irregular motions. When large motion is reduced to be within certain range (< 1 cm) by applying a motion-reducing technique, such as abdominal compression which is often used in stereotactic lung treatments, this conclusion should apply as long as the beam margins are large enough for the motion ranges.Monte Carlo methodology provides more accurate dose calculation across an inhomogeneous substrate such as the lung . For somWith the combination of Monte Carlo simulation and the optical flow method, 4D dosimetry is proved accurate based on point-dose measurement in a moving phantom. Monte Carlo 4D dose calculation would provide a planned dose distribution that is closer to the delivered dose than a static plan does, especially when dose variation is large between respiratory phases. Based on the cases studied, large dose variation between respiratory phases is more likely for small tumor volumes with relatively large motion. The inclusion of only two extreme respiratory phases in 4D cumulative dose calculation would be a reasonable approximation to all-phase inclusion for cases similar to the ones studied.The authors declare that they have no competing interests.TC: performed most data measurement and calculation; contributed in data analysis; carried out programming; participated draft of manuscript. JA: participated data acquisition; contributed in draft of manuscript. TD: provided patient contours and treatment prescriptions; guided treatment plans; contributed in draft of manuscript. TH: coordinated the collaboration; contributed in data analysis and draft of manuscript. GZ: contributed the frame work of the project, participated data analysis; contributed in draft of manuscript; supervised the project. All authors read and approved the final manuscript.

This CD phenotype suggests a lineage relationship between cancer cells and luminal cells. The Gleason grade of tumors is a descriptive of tumor glandular differentiation. Higher Gleason scores are associated with treatment failure.Prostate cancer cells in primary tumors have been typed CD10+ cancer cells were isolated from Gleason 3+3 (G3) and Gleason 4+4 (G4) tumors by cell sorting, and their gene expression or transcriptome was determined by Affymetrix DNA array analysis. Dataset analysis was used to determine gene expression similarities and differences between G3 and G4 as well as to prostate cancer cell lines and histologically normal prostate luminal cells.CD26The G3 and G4 transcriptomes were compared to those of prostatic cell types of non-cancer, which included luminal, basal, stromal fibromuscular, and endothelial. A principal components analysis of the various transcriptome datasets indicated a closer relationship between luminal and G3 than luminal and G4. Dataset comparison also showed that the cancer transcriptomes differed substantially from those of prostate cancer cell lines.Genes differentially expressed in cancer are potential biomarkers for cancer detection, and those differentially expressed between G3 and G4 are potential biomarkers for disease stratification given that G4 cancer is associated with poor outcomes. Differentially expressed genes likely contribute to the prostate cancer phenotype and constitute the signatures of these particular cancer cell types. Tumor glands can appear from well-differentiated to poorly differentiated. The degree of differentiation is scaled from 3 to 5 (grades 1 and 2 are no longer in wide use), with 3 to indicate tumors with glandular differentiation, 4 to indicate tumors with aglandular differentiation, and 5 to indicate no differentiation with cancer cells not organized into recognizable structures. Each tumor is assigned a score of two Gleason grades. Gleason 3+3 is associated with favorable outcomes and patient survival while tumors containing 4 or 5 components have a poorer prognosis. A molecular correlate of the Gleason grade was reported where grade 3 could be distinguished from grades 4 and 5 by gene expression, whereas grades 4 and 5 were indistinguishable by gene expression [et al. , none so+ luminal cells, CD104+ basal cells, CD49a+ stromal fibromuscular cells, and CD31+ endothelial cells from prostate tissue samples by magnetic cell sorting (MACS) for microarray analysis using the Affymetrix GeneChip to determine cell type-specific gene expression or transcriptome [+ prostate cancer cells of Gleason 3+3 and Gleason 4+4 tumor specimens. These specimens, unlike those of 3+4 or 4+3, ensured that cells representative of only grade 3 or 4 would be obtained. The transcriptomes were then compared with each other to identify differentially expressed genes, as well as with those of the normal cell types. Furthermore, dataset comparisons between the transcriptomes of primary tumor cells and prostate cancer cell lines, which were established from metastatic lesions and showed unique CD expression [We have previously shown that prostate tumors contained multiple Gleason grades as well as multiple cancer cell types distinguishable by their cluster designation (CD) phenotypes ,8. CD anpression , demonst-8 M dihydrotestosterone on a magnetic stirrer at room temperature overnight. The resultant cell suspension was filtered with 70-μm Falcon cell strainer to remove debris, diluted with equal volume of Hanks balanced salt solution (HBSS), and aspirated with 18-gauge needle. Cells were pelleted by centrifugation and the digestion media was analyzed by Western blotting for TIMP1 protein [Anonymized tissue samples were obtained at radical prostatectomy under approval by the University of Washington Institutional Review Board. Pertinent pathology information was requested from a research coordinator who was authorized to access the patient database in the Department of Urology. The resected glands were cut into 3-mm thick transverse blocks, and frozen sections from representative right and left areas of the apex, middle and base regions were stained to locate the tumor foci. With the stained sections as guide, tumor tissue samples were excised from the corresponding regions and placed in sterile tubes. Processing of tissue pieces for cell sorting was as described ,12. The protein to gauge+ fractions were used for microarray analysis [Gradient-purified epithelial cells were labeled with phycoerythrin (PE)-conjugated anti-CD26 and sorted by MACS as described previously for the normal cell types . Aliquotanalysis . The sorProstate cancer cell lines LNCaP, C4-2, CL1 (and its subclones CL1.1 and CL1.31), DU145 and PC3 were cultured and harvested for array analysis as described in our previous report on differential gene expression between LNCaP and C4-2 .Serial 5-μm sections were prepared from frozen blocks, fixed in cold acetone, and processed for immunohistochemistry using a three-step indirect avidin-biotin-peroxidase procedure. The primary antibodies used were the CD antibodies described in our previous reports ,16. AntiCell-free tissue digestion media preparations (g tissue/ml media) diluted in equal volume of HBSS were resolved by gradient polyacrylamide gel electrophoresis and transferred to membrane filter for probing by AGR2 antibody . The 17-kDa AGR2 protein was visualized using ECL . Prostate specific antigen (PSA) antibody was used as sample loading control.In vitro transcription was performed with biotinylated ribonucleotides, and the biotin-labeled cRNA was hybridized to the GeneChips. The chips were washed and stained with streptavidin-PE using FS-450 fluidics station (Affymetrix). Data was collected with Affymetrix GeneChip Scanner 3000. A total of three CD26+ prostate cancer array datasets were obtained from two patients; with 05-179 analyzed twice and 08-032 analyzed once. Two replicates were run for each prostate cancer cell line: CL1, CL1.1, CL1.31, DU145 and PC3. Datasets previously obtained from five non-sorted whole-tissue tumor specimens and their matched non-cancer specimens were used for comparison [http://scgap.systemsbiology.net/, which makes them available for data query [Quality and concentration of RNA were determined using Agilent 2100 Bioanalyzer and RNA Nano or Pico Labchip where appropriate. Only RNA samples of sufficient concentration and showed no degradation as evidenced by distinct 18S and 28S ribosomal bands were used for microarray experiments. The Human Genome U133 Plus 2.0 GeneChips were used for expression profiling. The U133 array contains probesets representing 54,675 genes, splice variants, and ESTs. The GeneChips were prepared, hybridized, and scanned according to the protocols provided by Affymetrix (P/N 702232 Rev. 2) ,15. In bet al. [X = log2. This step was carried out using the standard robust multi-array average (RMA) method [Mi = log2(ratio) = iX-aX, where a represented one particular cell type and i represented each given cell type in the set: B , L , S , E , G3 (Gleason 3) or G4 (Gleason 4). To estimate reliability, the HTself method used virtual self-self experiments to derive intensity-dependent cutoffs. Accordingly, a probeset was considered significantly differentially expressed if at least 80% of its log-ratio combinations were outside the 99.9% credibility intensity-dependent cutoff. Moreover, an average greater than 8-fold difference in expression level was chosen. The computational analysis results were verified by dataset query of known differentially expressed genes. In principal components analysis (PCA) of the various transcriptome datasets, a gene expression subspace was obtained that brought out the principal sources of variability among transcriptomes of the different prostate cell types. The rotation matrix was obtained by using averages of G3X, G4X, LX, BX, SX, and EX, and these were plotted as projections on the principal components space. The various transcriptomes were then projected into this PCA-generated subspace, which could be rotated freely to visualize the spatial separation of the individual nodes. Pathway analysis of selected genes was done with KEGG [For differential gene expression, datasets were analyzed by HTself, a self-self based statistical method for low replication microarrays using a et al. . To appl) method , impleme) method . The strith KEGG .+ prostate cancer cells were isolated from tumor specimen 05-179, split into two aliquots, and each was analyzed by DNA array. The 05-179 tumor was scored Gleason 3+3 with negative margins . Cancer cells of the 05-179 tumor glands were characterized as CD26+/CD13-/CD10- . Immunostaining of all representative 05-179 tissue sections containing cancer did not detect the CD10+ cancer cell type, which has a frequency of ~30% [CD26- Figure , the pre+ G3 cancer transcriptome and the previously determined transcriptome of the normal counterpart, CD26+ luminal [+ G3 cancer cells and the previously determined principal cell types of the prostate [+ cancer was closer to that of luminal than basal, in agreement with previous CD phenotype analysis [For the single specimen of 05-179 cancer, statistical analysis of gene expression with traditional methods was not applicable. Instead, HTself was used to analyze for differential gene expression between the CD26analysis .Mi = log2(ratio) = Xi-Xa, where a represented cancer and i represented normal. For dataset query, we enabled simple searches to display results in downloadable formats as previously described [+/CD13-/CD10-; increased CD24 and decreased CD38 compared to luminal cells , HPN (hepsin) and PCA3 (prostate cancer antigen 3). These results indicated minimal contamination of CD26+ luminal cells from non-cancer tissue that might be present in the tumor specimen. In the same display, the expression profiles of these CD in the various prostate cancer cell lines were in agreement with their CD expression previously determined by flow cytometry [+; C4-2 differs from LNCaP in being CD26+; PC3 is CD13+, DU145 is CD24+. Overall, the gene expression and CD phenotype of the CD26+ cancer cells differed substantially from those of the cancer cell lines indicating that it is unlikely that any of the cell lines, which were established from metastatic lesions, could have derived from the CD26+/CD10-/CD13- cancer cell type found in a majority of tumors.The array data was reported as RMA-normalized Affymetrix signal intensities implemented in SBEAMS or as a composite value escribed . Query rs Figure . The CD2ytometry . For exa+ G3 cancer cells and CD26+ luminal cells analyzed by HTself identified 121 genes with increased cancer expression and 86 genes with decreased cancer expression by at least 8-fold relative to luminal cells constitute the well-known three most abundant prostatic secretory products. Unlike KLK3 and ACPP, luminal expression of MSMB appears not to be regulated by stromal influence [Differential gene expression between CD26nfluence .The 08-032 tumor was scored Gleason 4+4, margin positive with seminal vesicle involvement. The Gleason scoring of 08-032 indicated that virtually all the cancer cells represented the Gleason grade 4 (G4) type while those of 05-179 the G3 type (no frozen tumor tissue block was available for 08-032 for CD immunohistochemistry). Verification of the "purity" of this rather large (6 g) tumor specimen, i.e., absence of non-cancer, was determined by Western blot analysis of tissue collagenase digestion media for TIMP1 protein (data published in ref. ). TIMP1 + G3 and G4 cancer cells were more characteristic of luminal cells than basal cells in gene expression as well as CD phenotype.PCA Figure displaye+ cancer cell transcriptome datasets were compared to those of five matched cancer (CP) and non-cancer (NP) tissue specimens obtained also via Affymetrix GeneChips by us [+), especially in the higher Gleason grades [i M= log2(ratio) = iX-aX. For most, there was concordance between sorted cell and tissue expression . The main apparent discordance was seen in genes analyzed as down-regulated by cell datasets but not by tissue datasets. This could be explained by the likelihood that these genes were expressed by cell types other than luminal or cancer epithelial in the tissue specimens. Expression of stromal cell genes PENK [+ stromal cells [The combined CD26ps by us . Patholon grades ,8, was anes PENK and THY1nes PENK was minial cells , the oth+ cancer cells.FZD8, WIF1 and SOX7 were identified by HTself as differentially expressed between cancer and luminal cells, and in whole tissue CP compared to NP identified in the cancer cell transcriptomes. The fold increase in CD26for ATF3 and ERG for ATF3 . ATF3 isfor ATF3 . DLX1 mafor ATF3 , as pros+ cancer cells: AGR2, BCMP11, CEACAM5/CD66e, CRISP3, KCNG3, KCNH8, LOX and NEO1 , their signal intensity indicated that their abundance was in the moderate class . BCMP11 was originally discovered by proteomics in breast cancer cell lines T-47D and MCF-7 [vs. NP media confirmed overexpression of AGR2 protein in cancer were exe et al. reportedl lipids .cf. Figure vs. G4 cells were: AGR2 = 13.4, BCMP11 = 18.6, CEACAM5 = 8.6, CRISP3 = 0.1, KCNG3 = 0.5, KCNH8 = 2.0, LOX = 2.5, NEO1 = 1.6 , KLK2/hK2, KLK3, and MSMB showed a trend toward down-regulation relative to luminal cells Figure . With reThe LNCaP genes as potential markers of metastatic potential were also queried between G3 and G4 Figure . Note thvs. G4 cancer analysis result was uploaded to KEGG. Notable networks for the data included EXTRACELLULAR MATRIX-RECEPTOR INTERACTION and CYTOKINE-CYTOKINE RECEPTOR INTERACTION. One of the most differentially up-regulated genes in G4 cells was CCL3 , cell isolation methods (MACS vs. LCM), cancer/normal comparison . When GSE6099 and GSE5132 were compared for the best correlation possible, the result was also poor with a mean of 0.25 . We created an Excel-based query tool to display the expression pattern of a particular gene across all these datasets . The fold decrease was largest between CD26+ G3 cancer cells and luminal cells, as possible from a cell-to-cell comparison. FZD8 was shown up-regulated in CD26+ G3 cancer cells, and the GSE6099 dataset also showed agreement; GSE5132 contained no information regarding FZD8. For the candidate secreted biomarkers, there was no information for CRISP3, KCNG3 or KCNH8 in GSE6099; for BCMP11, CEACAM5, CRISP3, KCNG3 or LOX in GSE5132. AGR2 in the GSE6099 dataset is shown, and increased expression was detected in PIN. Immunohistochemistry had previously shown AGR2 expression in high-grade PIN [Two publicly available high throughput gene expression datasets available for comparison with our data were GSE6099 and GSE5r Figure . It is is Figure . For exa+ prostate cancer cells demonstrated that it was possible to isolate and characterize gene expression in cancer cells from solid tumors weighing 0.5 g or more utilizing our cell sorting methodology. The extensive tissue processing also did not appear to alter substantially the gene expression profiles of the cancer cells or the tumor-associated stromal cells reported previously [+ cancer datasets obtained were representative of Gleason grades 3 and 4. Grade 3 tumors show a glandular morphology whereas grade 4 tumors are typically less glandular. Sorting for grade 5 is problematic as Gleason 5+5 tumors are rarely seen. According to many pathologists, cells of Gleason grade 3 are those that are first recognizable as cancerous. Compared to the normal counterpart luminal cells, the expression of a variety of genes was found to be different. This could be due to the altered expression of several transcription factors. Some of the genes identified are involved in cell division and response to apoptotic signaling. Genes of the Wnt pathway, which is important in epithelial-stromal cell interaction, appeared to be dysregulated to produce increased Wnt signaling in the cancer cells. Targeting this particular pathway may prove effective in prostate cancer.Transcriptome analysis of CD26eviously . Because- luminal-like types, although one populated a Gleason 3+3 tumor and the other a Gleason 4+4 tumor. Their respective transcriptomes represent the signatures of two distinct prostate cancer cell types. As greater numbers of cancer cell types from different cases are analyzed, it will be interesting to determine if dissimilarities in gene expression increase with higher Gleason grades. This could be visualized using PCA. The number of possible prostate cancer cell types is currently unknown, and tumor behavior could be dependent on its composition of various cancer cell types. For example, the CD10+ type is associated with lymph node metastasis and poor outcomes [+ and CD10 staining of biopsy is currently not a standard practice. Other cell types like CD44+ [The cancer cell types profiled in this study were the CD10outcomes ,45. Isolke CD44+ are evenThe identification of candidate biomarkers for cancer detection and disease stratification in this study is of practical utility. Their identity would provide for a targeted approach to analyze for their presence in body fluids such as urine and blood. Genes that encode secreted proteins are particularly useful as most, if not all, clinical tests are based on immunodetection of these types of molecules. Since cancer cells are non-functional, it was not expected that many such proteins would be found. As can be inferred from the array signal intensity levels, expression of the major functional prostatic secretory proteins ACPP, AZGP1, KLK2, KLK3, and MSMB was down-regulated in the cancer cells compared to the luminal cells. Of the candidates, AGR2 appeared most promising. AGR2 is a relatively small protein and is produced apparently at a high level based on the array signals (>4000). AGR2 was also readily detectable in the tissue digestion media of cancer specimens by Western blot analysis. AGR2 expression may be decreased in higher Gleason tumors. Thus, AGR2 could potentially serve as a target biomarker for early disease detection. In contrast, the secreted CCL3/CCL4 could serve as a biomarker of tumors containing a G4 cancer cell type. Care must be taken to ensure that these potential biomarker proteins are not produced significantly by other cell types. Expression of these candidates will be examined in greater detail by tissue microarray analysis. A multimarker panel could conceivably be generated to incorporate all informative genes to diagnose prostate cancer.+ primary prostate cancer cells isolated from Gleason grade 3 and grade 4. Grade 4 is usually associated with poor clinical outcomes. Therefore, genes differentially expressed between these two grades have prognostic potential. The method we have described to isolate primary prostate cancer cells for transcriptome analysis should be applicable to other solid tumors.In summary, we have determined the transcriptomes of CD26The authors declare that they have no competing interests.LEP and AYL designed research; LEP, LSP, ESL, CPS, PT, BM, and AYL performed research; LDT provided pathology analysis, assisted with study design and helped write the manuscript. LEH assisted with study design. LEP, RZNV, and AYL analyzed data; LEP, RZNV and AYL wrote the manuscript with contribution from the coauthors. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/452/prepubDifferentially expressed genes in cancer. Differentially expressed genes between G3 CD26+ cancer cells and CD26+ luminal cells were identified by HTself. Genes with ≥8-fold difference in expression are listed. Entries in green were previously reported in other public datasets. ESTs are highlighted in tan. Wnt pathway genes are highlighted in yellow.Click here for fileSelf-self experiment with HTself cutoff for differential expression. The HTself method was applied to self-self experiments (orange points) with a 99.9% credibility interval to generate the intensity-dependent curve (green). The x-axis represents the RMA-normalized intensity average (Xi/2 + Xj/2) and the y-axis represents the logarithmic ratio (Xi - Xj) using self-self data (cancer i vs. cancer j). Actual data points (non-self-self) are compared against the intensity-dependent cutoffs. See ref. 18 for details.Click here for fileDifferentially expressed genes in G3 and G4. Differentially expressed genes between G3 CD26+ cancer cells and G4 CD26+ cancer cells were identified by HTself. Genes with ≥8-fold difference in expression are listed.Click here for file

The cation is weakly hydrogen-bonded to the anion by an N—H⋯Br inter­action. The crystal studied was found to be a racemic twin, with a twin component of nearly 50%.In the title salt, C The 4-dimethyl­amino­pyridinium cation furnishes a number of salts with organic and inorganic acids. For 4-dimethyl­amino­pyridinium bromide, see: Mayr-Stein & Bolte pyridine hydro­bromide perbromide, = 0.021 wR(F 2) = 0.051 S = 0.98 1256 reflections100 parameters60 restraintsH-atom parameters constrainedmax = 0.42 e Å−3 Δρmin = −0.34 e Å−3 ΔρAbsolute structure: Flack 1983, 480 FriFlack parameter: 0.47 (4) APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008X-SEED (Barbour, 2001publCIF (Westrip, 2009Data collection: 10.1107/S1600536809017048/hb2966sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809017048/hb2966Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Recent studies have shown that the use of cytokines such as granulocyte colony-stimulating factor (G-CSF) to ameliorate chemotherapy-induced myelosuppression may enhance the viability of tumour cells with functional receptors for these cytokines. In this study, therefore, we used murine bone marrow (BM) cells in an in vitro model in an attempt to determine whether topoisomerase inhibitors induce myelosuppression (BM cell death) and whether novel treatments other than the administration of G-CSF can be used for rescue from myelosuppression. DNA fragmentation assay, ultrastructural analysis and cell cycle analysis demonstrated that these chemotherapeutic agents induced apoptosis in BM cells. We demonstrated in addition that enforced expression of the bcl-2 gene in BM cells by MPZenNeo (bcl-2) retroviral gene transfer increased resistance to the apoptosis induced by these agents. These findings suggest the possibility that enforced expression of the bcl-2 gene in BM cells using gene transfer techniques may enable rescue from chemotherapy-induced myelosuppression.

P = 0.03) and a more prominent lymphoid infiltrate (P = 0.04). Similar associations were noted in the EBV-positive carcinomas. The high-level MIs were more commonly located in the antrum, whereas the EBV-associated carcinomas were mostly located in body. Thirteen cardia cases were negative for both high-level MI and EBV. All patients aged below 55 were MI negative (P = 0.049). Of the high-level MIs, 80% had mutation in TβR-II, 40% in BAX and 0% in IGF-IIR. Of low-level MIs, 33% also had TβR-II mutation. These mutations were absent in the MI-negative cases. Of three lymphoepithelioma-like carcinomas, two cases were EBV positive and MI negative, one case was EBV negative but with high-level MI. In conclusion, high-level MIs were present regardless of the EBV status, and were found in a particular clinicopathological subset of gastric carcinoma patient. Inactivation of important growth regulatory genes observed in these carcinomas confirms the importance of MI in carcinogenesis. © 1999 Cancer Research CampaignMicrosatellite instability (MI), the phenotypic manifestation of mismatch repair failure, is found in a proportion of gastric carcinomas. Little is known of the links between MI and Epstein–Barr virus (EBV) status and clinicopathological elements. Examination of genes mutated through the MI mechanism could also be expected to reveal important information on the carcinogenic pathway. Seventy-nine gastric carcinomas from local Hong Kong Chinese population, an intermediate-incidence area, were examined. Eight microsatellite loci, inclusive of the A10 tract of type II transforming growth factor β receptor (TβR-II), were used to evaluate the MI status. MI in the BAX and insulin-like growth factor II receptor (IGF-IIR) genes were also examined. High-level MI (>40% unstable loci) was detected in ten cases (12.7%) and low-level MI (1–40% unstable loci) in three (3.8%). High-level MI was detected in two EBV-associated cases (11%) and the incidence was similar for the EBV-negative cases (13%). The high-level MIs were significantly associated with intestinal-type tumours (

In each mol­ecule, two intramolecular O—H⋯N bonds generate S(6) motifs. The N atoms are also in close proximity to two H atoms of the dimethyl­propane groups, with H⋯N distances between 2.59 and 2.62 Å. The imine group is coplanar with the benzene ring. The dihedral angles between the benzene rings in the two independent mol­ecules are 58.20 (12) and 47.95 (12)°. The structure displays short inter­molecular Cl⋯Cl [3.3869 (11) Å] and Cl⋯O [3.175 (2)–3.204 (2) Å] inter­actions. The crystal structure is further stabilized by weak inter­molecular C—H⋯O, C—H⋯π and π–π [centroid–centroid distances 3.6416 (13)–3.8705 (14) Å] inter­actions.The crystal of the title Schiff base compound, C Å b = 6.2236 (2) Å c = 37.9015 (10) Å β = 99.779 (1)°V = 7365.2 (4) Å3 Z = 16 Kα radiationMo −1 μ = 0.37 mmT = 100.0 (1) K 0.35 × 0.06 × 0.04 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T min = 0.882, T max = 0.986Absorption correction: multi-scan (38685 measured reflections8427 independent reflectionsI > 2σ(I)5995 reflections with R int = 0.071 R[F 2 > 2σ(F 2)] = 0.061 wR(F 2) = 0.116 S = 1.12 8426 reflections467 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.36 e Å−3 Δρmin = −0.28 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808038014/is2362sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808038014/is2362Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

An intra­molecular hydrogen bond between the carbonyl O atom and the NH group of pyrrole correlates with the Z arrangement of the substituents at the C=C bond. In the crystal, inversion dimers occur, linked by pairs of N—H⋯O bonds.The title compound, C Å b = 6.1270 (4) Å c = 22.8912 (16) Å β = 91.390 (1)°V = 1066.92 (12) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 293 (2) K 0.35 × 0.24 × 0.08 mm Bruker APEX diffractometerSADABS; Sheldrick, 1996T min = 0.964, T max = 0.992Absorption correction: multi-scan (12282 measured reflections2552 independent reflectionsI > 2σ(I)2167 reflections with R int = 0.022 R[F 2 > 2σ(F 2)] = 0.054 wR(F 2) = 0.137 S = 1.10 2552 reflections154 parametersH-atom parameters constrainedmax = 0.23 e Å−3 Δρmin = −0.22 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL and publCIF (Westrip, 2008Data collection: 10.1107/S1600536808040178/si2132sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808040178/si2132Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The ZnII atom (site symmetry trans-ZnN2O4 octa­hedral geometry defined by two monodentate N-bonded and two bidentate O,O-bonded ppa monoanions. The extended two-dimensional structure arising from this connectivity is a square grid and the disordered uncoordinated water mol­ecules occupy cavities within the grid. An N—H⋯O hydrogen bond occurs.The title compound, {[Zn(C DOI: 10.1107/S1600536809036939/hb5062Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Pharmacokinetic models and mechanistic hypotheses may provide insights into the biological behavior of the agent; however, they must be adequately tested before being used to evaluate human cancer risk.Conflicting views have been expressed frequently on assessments of human cancer risk of environmental agents based on animal carcinogenicity data; this is primarily because of uncertainties associated with extrapolations of toxicologic findings from studies in experimental animals to human circumstances. Underlying these uncertainties are issues related to how experiments are designed, how rigorously hypotheses are tested, and to what extent assertions extend beyond actual findings. National and international health agencies regard carcinogenicity findings in well-conducted experimental animal studies as evidence of potential carcinogenic risk to humans. Controversies arise when both positive and negative carcinogenicity data exist for a specific agent or when incomplete mechanistic data suggest a possible species difference in response. Issues of experimental design and evaluation that might contribute to disparate results are addressed in this article. To serve as reliable sources of data for the evaluation of the carcinogenic potential of environmental agents, experimental studies must include Over the past several years, problems related to conflicts of interest in peer review have received considerable attention in the scientific literature and national press . In respIn contrast to these circumstances, conflicts of interest are an inherent component of science-based litigation and generally include presentations and interpretations of studies that are fashioned to appear consistent and favorable with the position of the sponsor. This situation puts an enormous burden on judges and juries, forcing them to wade through disguised biases in order to decipher assertions from facts. Because of uncertainties in extrapolations of toxicologic findings from studies in experimental animals to human risk and uncertainties in the costs associated with reduction or elimination of human exposures to those agents, numerous conflicts have arisen and continue to arise over the reliability of identified health effects of specific substances. In one view, precautionary health measures to prevent disease are advocated in spite of uncertainties of the magnitude of potential human risks, whereas the alternative perspective argues that additional costs for exposure reduction are not warranted until adverse health effects are clearly demonstrated in humans. Conflicting views on the relative importance of toxicologic research seem to originate largely from concerns of predictability and impacts on human health risks versus impacts on costs and profits.Although science seeks to expand our knowledge of facts and truths through the principles of hypothesis generation and hypothesis testing, the way in which our knowledge grows and reflects the truth depends on how questions are framed, how rigorously hypotheses are tested, and to what extent assertions extend beyond actual findings and are portrayed as established facts. Consequently, there are several ways in which conflicting views may arise in health effects research. Failure to adequately test hypotheses or speculations with appropriately challenging experiments does not advance science and, more important, can produce erroneous opinions of potential health effects of particular agents. Reliance on untested hypotheses that are promoted to explain away adverse outcomes may have serious public health consequences if future testing of alleged mechanisms shows them to be incorrect . This arThere are several advantages and disadvantages in assessing human cancer risk from animal studies. Animal models are used in preclinical trials of new pharmaceutical agents before testing in humans because of species similarities in the biology of disease processes. The same predictive value of experimental animal studies has been applied to assessments of potential toxic and carcinogenic agents in our environment. A major advantage of animal studies is the elimination of the need to wait for a high incidence of human cancers before implementing public health–protective strategies. Because exposure conditions can be finely controlled in animal studies, they are easier to interpret and assign causality. In contrast, retrospective epidemiology studies typically have limited exposure information, especially at times early in tumor development, and confounding factors are not always known.Animal carcinogenicity studies can be performed in less time and at lower costs than epidemiology studies. The major disadvantages of animal studies are that they require extrapolations across species and dose. Furthermore, animal studies do not capture the full range of human variability due to differences in genetics, health status, diet, lifestyle, and other exposures.Because all known human carcinogens that have been studied adequately in experimental animals produced positive carcinogenic results, public health agencies, including the International Agency for Research on Cancer , the Natin the absence of adequate data in humans, it is biologically plausible and prudent to regard agents and mixtures for which there is sufficient evidence of carcinogenicity in experimental animals as if they presented a carcinogenic risk to humans. a) an increased incidence of malignant or malignant and benign tumors combined in two or more species or at multiple sites, b) an increased incidence in two or more independent studies in one species, or c) an increased incidence in a single study in one species if malignant tumors occur to an unusual degree in incidence, site, type, or age of onset. As noted below, mechanistic data on relevant biological activities of the substance can also influence the overall cancer risk classification.No alternative experimental approach has been shown to be as reliable for assessing human cancer risk . Hence, The outcome of an animal carcinogenicity study may be affected by several experimental design factors. Differences in experimental design can lead to inconsistent results and conflicting views on the potential health effects of the agent under study. For example, early studies on benzene failed to detect carcinogenic effects in animals, even though epidemiology studies had demonstrated a causal association between benzene exposure and leukemia in humans. Deficiencies in the early animal studies included too few animals, lack of controls, short study duration, and inadequate levels of exposure. Subsequent, better-designed studies by To best understand the toxicologic properties of a particular agent, the chemical should be tested at high purity. This ensures that the agent under study is responsible for any observed effects and that contaminants are not the cause or modifier of that response. When a potentially active contaminant is present, claims are frequently made that the contaminant and not the principal agent is responsible for any observed carcinogenic response. For example, when the hepatocarcinogenicity of industrial-grade trichloroethylene (TCE) in mice was reported by the Before exposing animals to the agent, it is necessary to ascertain the stability and exposure uniformity of the chemical under conditions that simulate the conditions of the study . If the Rats and mice are the two species most typically used in cancer bioassays because they have life spans of about 2.5 years and studies of up to 1,000 animals can be performed in reasonably sized animal rooms. Strains of animals used should be ones that have adequate longevity, genetic stability, and few spontaneous diseases that might shorten their life span, mask any chemical-induced effects, or impair metabolism/elimination of the test agent . It is dA major shortcoming of the rodent cancer bioassay is its limited statistical power to estimate the true response rate . Power iBecause of the limited statistical power of the bioassay when group size is only about 50 animals per sex per dose, high doses are necessary to identify potential carcinogenic hazards, whereas multiple dose groups are used to characterize dose–response relationships. The selection of dose levels is a critical aspect of the experimental design and is a major source of conflicting views in the interpretation of study results. Data from prechronic or subchronic studies (4–13 weeks’ duration) are used to estimate the maximally tolerated dose or the minimally toxic dose (MTD).p-dichlorobenzene failed to detect a carcinogenic effect in rats or mice exposed up to 500 ppm by inhalation for 76 or 57 weeks, respectively are used in case the highest dose selected for the chronic study is found to be too high and to provide information on dose–response relationships . Pharmacectively ; in contectively .Typical carcinogenicity studies in rats and mice involve exposures beginning at 6 weeks of age and continuing for 2 years; this exposure period corresponds roughly with early adulthood through most of an occupational life span. Earlier periods of exposure should be included if there is reason to believe that susceptibility may be greater during growth and early developmental stages, for example, mutagens and endoThe conduct and evaluation of a cancer bioassay require a multidisciplinary effort, including expertise from toxicologists, laboratory animal veterinarians, chemists, histologists, pathologists, cellular/molecular biologists, and statisticians. Topics that affect the interpretation of a properly conducted carcinogenicity study include the thoroughness of the histopathologic evaluations, the statistical analyses, and the appropriate application of mode-of-action hypotheses.The detection of nonneoplastic and neoplastic lesions in animals depends on the thoroughness of the necropsies and the microscopic examinations performed. A proper evaluation necessitates that all organs and tissues be examined and that moribund animals be removed from the study and sacrificed immediately to avoid autolytic destruction of cells and tissues . Tissue a) the occurrence of common versus uncommon tumors; b) evidence of progression of lesions, such as benign to malignant where it is appropriate to combine (c) tumor occurrence with reduced latency; d) multiplicity in a site-specific tumor response; e) evidence of metastases; and f ) supporting evidence of proliferative preneoplastic lesions at the same site or detection of the same lesion in the other sex or species. Ignoring this type of information could lead to faulty interpretations of chemical-induced carcinogenic effects. For example, a nonstatistically significant increase in urinary bladder tumors in female rats is considered to be related to anthraquinone exposure because of the low historical rate of this neoplasm (0.1%) and the marginally increased incidences of hyperplasia of the bladder transitional epithelium , these findings were dismissed by the authors, as well as by an IARC review panel models. PBPK models represent in quantitative terms the complex physiologic and biochemical processes that affect the absorption, distribution, metabolism, and elimination of the agent of concern. These models are developed to describe relationships between exposure to toxic agents, the internalized dose, and the time-dependent tissue concentrations of parent compound and biologically active metabolites. Conflicting views in estimations of human dose may arise because of various assumptions used to determine chronic dose levels by scaling or PBPK modeling. For example, the assumption made in many models that a unique set of metabolic parameters, which in some cases are derived from short exposures of young healthy individuals, can be scaled as a function of body weight to provide precise estimates of the behavior of the agent in genetically diverse populations , as well as other types of tumors, in rats and mice , vinyl bromide (VBr), and vinyl fluoride (VF). These three chemicals are activated by enzymes found in humans to epoxides that can react with DNA to form and mice . To consp-dioxin (TCDD) from “prOn the other hand, IARC downgraded the classification of di(2-ethylhexyl)phthalate (DEHP) from “possibly” to “not classifiable as to its carcinogenicity to humans” . This waPeroxisomes are subcellular structures that contain several oxidase enzymes. Agents that cause increases in their numbers are called peroxisome proliferators. Many peroxisome proliferators are rodent carcinogens, and the mode of action proposed for rodent liver tumor induction by peroxisome proliferators involves activation of the peroxisome proliferator–activated receptor (PPARα), which results in altered transcription rates of genes that regulate cell proliferation and apoptosis (programmed cell death) . HoweverPeroxisome proliferation per se does not appear to be a causal event in liver carcinogenesis and therAppropriately conducted animal cancer studies remain the most reliable means of identifying agents that pose a potential human cancer risk. However, as noted above, there are numerous ways in which experimental designs and interpretations can be or have been manipulated or misinterpreted to produce false-negative responses. Studies that use too low doses, too few animals, or too short a duration, as well as evaluations that are based on incomplete necropsy or histopathology, do not combine related tumor effects, fail to adjust for differences in animal survival, or incorrectly use historical control data, would not be expected to produce reliable information on chemical carcinogenesis. It is also important to recognize that rats and mice may be insensitive to certain types of cancers and that timing of exposure may be critical in initiating a carcinogenic response. Thus, the lack of an increased tumor incidence in an adequately conducted 2-year animal study does not necessarily signify that the chemical lacks carcinogenic activity in people.The observation of consistent dose–response relationships between early cellular and molecular responses and tumor induction in laboratory animals may serve as the basis for developing hypotheses linking the early biological event with the tumor response. However, such hypotheses must be tested rigorously to demonstrate that a causal relationship exists rather than simply a correlation of potentially unlinked events. Similarly, assumptions and predictions of dosimetry models must be validated by experimentation before being used in human risk assessments. Public health decisions that could lead to unrestricted use and exposure to carcinogenic agents should not rely on untested hypotheses .When high-quality human dose–response data are available, they are used preferentially over animal data to assess human cancer risk . HoweverSimilar to animal studies, epidemiologic studies may not detect a significant cancer response if group size is too small or if exposures are of insufficient magnitude or duration. On the basis of cancer risk estimates from animal studies on acrylamide, Differences in exposure scenarios between animals and humans might affect the ability of epidemiologic studies to detect a tumor response identified in animal studies. For example, if gestational or early childhood exposure is important for tumor induction, then studies of male workers would not be expected to produce the same response as animal studies that include exposures during these stages of development. Other reasons why an epidemiologic study may not detect a true increase in risk of certain cancers in exposed human populations include inadequate exposure information, mis-classifications, insufficient follow-up, and/or inadequate study power. Because of the much greater genetic diversity in humans compared with specific strains of laboratory animals, the range of expected human response may include subgroups that are less, equally, or more sensitive than the animals used in the experimental studies. More research is needed to understand and adequately account for factors that might contribute to variability in human susceptibility to chemical carcinogenesis. In the meantime, it is prudent to assume that an induced carcinogenic response in animals is a reliable indicator of potential cancer risk in humans .

Mycobacterium tuberculosis, MVA85A, induces high levels of cellular immune responses in UK volunteers. We assessed the safety and immunogenicity of this new vaccine in West African volunteers.Vaccination with a recombinant modified vaccinia Ankara expressing antigen 85A from We vaccinated 21 healthy adult male subjects (11 BCG scar negative and 10 BCG scar positive) with MVA85A after screening for evidence of prior exposure to mycobacteria. We monitored them over six months, observing for clinical, haematological and biochemical adverse events, together with assessment of the vaccine induced cellular immune response using ELISPOT and flow cytometry. MVA85A was well tolerated with no significant adverse events. Mild local and systemic adverse events were consistent with previous UK trials. Marked immunogenicity was found whether individuals had a previous BCG scar or not. There was not enhanced immunogenicity in those with a BCG scar, and induced T cell responses were better maintained in apparently BCG-naïve Gambians than previously studied BCG-naïve UK vaccinees. Although responses were predominantly attributable to CD4+ T cells, we also identified antigen specific CD8+ T cell responses, in subjects who were HLA B-35 and in whom enough blood was available for more detailed immunological analysis.These data on the safety and immunogenicity of MVA85A in West Africa support its accelerated development as a promising booster vaccine for tuberculosis.NCT00423839ClinicalTrials.gov Tuberculosis (TB) causes approximately 2 million deaths annually; most of these occur in developing countriesM. tuberculosis (antigen 85A) in the non-replicating modified vaccinia viral vector (MVA) strongly boosts BCG primed T cell responses in several species, including humans. Importantly, BCG-MVA85A prime-boost regimens have greater protective efficacy than BCG alone in several animal models of TB, including non-human primates.We have developed a prime-boost strategy that seeks to overcome this limitationWe have reported the immunogenicity of MVA85A in UK volunteersThe protocols for this trial and the supporting CONSORT checklist are available as supporting information; see 7 plaque forming units (pfu) of MVA85A (135 µl). A second vaccination was given 3 weeks later to the BCG scar negative vaccinees, in the right deltoid muscle. Subjects were observed for one hour following immunisation and vital signs were recorded. They were then seen on day one and two. Follow-up visits were made spanning the length of ESAT-6 and CFP-10, were used in pools at 2.5 µg/ml . M. tuberculosis purified protein derivative was used at 5 µg/ml. ELISPOT plates were incubated overnight at 37°C. For the BCG scar negative group, positive wells were pre-defined to contain at least 30 Spot Forming Units/million cells (SPM) more than, and at least twice as many as, negative control wells for these antigens. Following the UK trials, a much stronger response to vaccination was expected in the BCG primed group. Therefore, positive wells were pre-defined to contain at least 10 SPM more than, and at least twice as many as, negative control wells. After acceptable safety data were obtained in BCG scar negative group, the PPD ELISPOT screening criterion was relaxed to at least 100 SPM.We used an IFN-γ ELISPOT assay to screen volunteers at recruitment and monitor the immunogenicity of MVA85A, as previously describedTo monitor Ag85A immunogenicity we used the ELISPOT response to a sum of 66 pooled peptides (7 pools of 6–10 peptides). This method will count twice a T cell that responds to any of the 10-mer overlap regions that occur in two pools with adjacent peptides. To monitor individual peptide responses we used Ag85A peptide pools in different combinations so that an individual peptide response would be clearly identifiable when two pools with the same peptide responded within a matrix. We used recombinant Ag85A protein (Leiden University), and PPD-T. ELISPOT plates were counted using an automated ELISPOT reader with correction for artefacts. The positive control was Phytohaemaglutinin . All antigens were tested in duplicate wells.An aliquot of whole blood (200 µl) was harvested after 20 h of culture at 37°C alone or stimulated with 5.0 µg/ml Ag85A peptide pool, 2.0 µg/ml PPD-T and 10 µg/ml PHA. After incubation, cells were stained for 30 min at room temperature with a monoclonal antibody cocktail mix containing anti-CD4 FITC, anti-CD69 PE, anti-CD8 PerCP and anti-CD3 APC . Red blood cells were lysed and lymphocytes washed, fixed in 2% p-formaldehyde and acquired with a Cell Quest software by live gating on CD3+ T cells (50000 events) on a four-colour flow cytometer . Analyses were carried out using FlowJo software .5/well in a 96 U well microtitre plate with p23 peptide (10 µg/ml) in RPMI-1640 supplemented with 5% AB serum, L-glutamine 2mM and antibiotics. On the 3rd and 7th days IL-2 (20 IU/ml) was added. The expanded lymphocytes were harvested, washed, re-stimulated with p23 (10 µg/ml), PHA (10 µg/ml) or medium alone in separate tubes in the presence of Brefeldin A (10 µg/ml) for six hours. Cells were harvested and washed with FACs buffer lysed with BD FACS™ Lysing Solution. Cells were then washed and permeabilized with BD FACS Permeabilizing Solution. After an additional wash, cells were divided into two tubes. Surface and intracellular staining antibodies in tube 1 and anti human in tube 2 were added in a single staining step. Finally, the cells were washed and fixed for flow cytometric analysis.Cryopreserved PBMC were thawed, washed and re-suspended at 2×10ex vivo ELISPOT assay. Recovered cells were rested in medium containing 5% human AB serum for at least 2 hours before being washed and set up in an ELISPOT assay with the CD8+ epitope.The Ag85A HLA-B35 restricted CD8+ epitope MPVGGQSSF was used to stimulate the cryopreserved PBMC isolated on day 7 after vaccination in an All data were either double entered, or electronically transferred, into an ACCESS database and manually validated. ELISPOT counts were corrected for the background in the negative control well. Those beyond the upper limit of detection of the ELISPOT reader were arbitrarily given a count of 500 spots/well. All comparisons were within subject and were performed using a Wilcoxon matched pairs test.We screened 240 subjects to identify 10 to 12 individuals for each arm of the study. Some subjects showed transient ESAT-6/CFP-10 ELISPOT positivity after enrolment, consistent with fluctuations in responses to these antigens seen in other Gambian studiesOverall, 21 volunteers were enrolled and 31 doses of MVA85A were administered. One subject in the BCG scar negative group did not receive the second vaccination because he became ESAT-6 ELISPOT positive on day 7. On subsequent assays this reverted to negative. No significant changes occurred in vital signs during the one-hour post-vaccination observation or follow-up periods. There were minimal reports of any systemic side effects; specifically no symptoms of a flu-like illness or lymphadenopathy. One subject had a mild headache and diarrhoea in the first 24 hours after vaccination, both resolved quickly. No other reports or documentation of headache, myalgia, fever, or malaise were made. 11 BCG scar negative subjects were immunised with MVA85A . There was a high degree of variability between individuals in the vaccine induced immune responses; these data are shown as median ELISPOT frequencies in After the first week, the response contracted to a stable plateau frequency, higher than before vaccination, which was maintained until the end of the trial. The frequency of the Ag85A ELISPOT response to peptides at the end of the trial was significantly higher than the frequency at the start (p = 0.004). A consistent hierarchy of responses to antigens was found in a predictable order, from highest to lowest: summed pooled peptides, Ag85A, and PPD-T. It was not possible to accurately quantify differences at the peak of response, as many were beyond the upper limit of detection. However the original hierarchy was maintained as the response waned. A second MVA85A vaccination given 3 weeks after the first did not boost the ELISPOT response further, consistent with the UK trials On the basis of the data from the BCG scar negative subjects, where there was no significant increase in the immune response to a second vaccination, it was decided that the second immunisation with MVA85A at week 3 should be omitted in the BCG scar positive group . An extrWe stimulated the whole blood of 3 volunteers with all 66 Ag85A peptides and monitored the proportion of CD4+ and CD8+ cells activated by upregulation of expression of CD69 . A high To understand responding phenotypes in more detail we looked for unambiguous peptide pool responses, consistent with a single epitope being maintained throughout the entire monitoring period. After analysing all peptide pool responses we identified a single epitope in 2 subjects, which was due in both cases to the response to a single peptide (p23). Short term cell lines to p23 were generated with PBMC recovered 28 days after vaccination, and the CD4/CD8 phenotype was analysed by IFN-γ ICS. For one subject (volunteer 1), both CD4 and CD8 p23 specific responses were identified , while aAn HLA-B*3501 (abbreviated to HLA-B35) class I restricted CTL epitope within Ag85A p23 sequence had previously been reported in The GambiaM. tuberculosis, have commenced. This vaccine was found to be highly immunogenic in the studies reported here, inducing exceptionally high frequencies of antigen specific CD4+ T cells as well as some antigen specific CD8+ T cells.We report the first trial of a new generation TB vaccine in Africa. MVA85A was administered intra-dermally to two groups of volunteers with increasing evidence of prior mycobacterial exposure. The vaccine was found to be safe in these volunteers, enabling further studies to proceed in larger numbers of individuals to fully evaluate the adverse event profile and frequency. Since safety was demonstrated in these trials in The Gambia, further trials with this vaccine in TB endemic areas in individuals more representative of the general population, including subjects latently infected with The peak responses to vaccination with MVA85A, in the UK and The Gambia, are the highest reported for any subunit vaccine in humans, at least using ELISPOT assaysThe lack of any boosting effect seen with the second MVA85A vaccination mirrors the findings of the UK trial.Unlike the MVA85A trial in the UK,An interesting difference is observed between the plateau level of T cell response in the Gambian vaccinees and in subjects receiving the same vaccine in the UK. While the peak responses were little different, the plateau response in BCG naïve Gambians of over 200 SPM to antigen 85A peptides was higher than that observed in the UK (median 105 SPM). Whether this relates to higher pre-vaccination levels of central memory cells in Gambians, or more frequent low level boosting by recurrent exposure to low doses of environmental mycobacteria in Africa, requires further study.M. tuberculosis infection in The Gambia M. marinum, express these two antigens Whilst we went to significant efforts to ensure that the first volunteers were as mycobacterially naïve as possible, it is likely that most if not all individuals had been exposed to mycobacteria beforeIn conclusion, MVA85A appears safe and highly immunogenic in Africa. The data from this study support accelerated development of this candidate towards a large scale efficacy trial in Africa and subsequent licensure. Further phase I and II trials are now in progress in a South African population and a phase II trial in Gambian infants is also underway.Checklist S1Consort Checklist.(0.06 MB DOC)Click here for additional data file.Protocol S1Trial Protocol.(0.21 MB PDF)Click here for additional data file.Protocol S2Trial Protocol.(0.21 MB PDF)Click here for additional data file.

Non-pharmaceutical interventions (NPI) are the first line of defense against pandemic influenza. These interventions dampen virus spread by reducing contact between infected and susceptible persons. Because they curtail essential societal activities, they must be applied judiciously. Optimal control theory is an approach for modeling and balancing competing objectives such as epidemic spread and NPI cost.We apply optimal control on an epidemiologic compartmental model to develop triggers for NPI implementation. The objective is to minimize expected person-days lost from influenza related deaths and NPI implementations for the model. We perform a multivariate sensitivity analysis based on Latin Hypercube Sampling to study the effects of input parameters on the optimal control policy. Additional studies investigated the effects of departures from the modeling assumptions, including exponential terminal time and linear NPI implementation cost.An optimal policy is derived for the control model using a linear NPI implementation cost. Linear cost leads to a "bang-bang" policy in which NPIs are applied at maximum strength when certain state criteria are met. Multivariate sensitivity analyses are presented which indicate that NPI cost, death rate, and recovery rate are influential in determining the policy structure. Further death rate, basic reproductive number and recovery rate are the most influential in determining the expected cumulative death. When applying the NPI policy, the cumulative deaths under exponential and gamma terminal times are close, which implies that the outcome of applying the "bang-bang" policy is insensitive to the exponential assumption. Quadratic cost leads to a multi-level policy in which NPIs are applied at varying strength levels, again based on certain state criteria. Results indicate that linear cost leads to more costly implementation resulting in fewer deaths.The application of optimal control theory can provide valuable insight to developing effective control strategies for pandemic. Our findings highlight the importance of establishing a sensitive and timely surveillance system for pandemic preparedness. Emerging influenza is threatening the world with the next pandemic . The curNPIs were implemented during the 1918 pandemic and more recently during the severe acute respiratory syndrome (SARS) outbreak of 2003. Although research on these events confirms the importance of NPIs, sub-optimal triggering during the 1918 pandemic rendered NPIs only moderately effective at reducing mortality -12. DuriMathematical models are often used to study disease spread, with the Susceptible-Infectious-Recovered (SIR) model being preferred for diseases spread via droplet and aerosol. The SIR model has been used to study pandemic flu ,12,16-25Sethi derived optimal closed-form results for isolation and immunization policies ,38 usingOverall, we think the underlying assumptions of currently published results are questionable. It is not the case that all infectious can be immediately identified and isolated. Further, planners do not know when vaccines will become available, and even when available, it is not true that mass prophylaxis is instantaneous. Finally, during a pandemic, people will die. The current models do not account for mortality, which could be significant for viral strains such as H5N1.In this work, we use an expanded SIR model to develop triggers for NPI implementation to minimize expected person-days lost resulting from influenza related deaths and NPI implementation. NPI policies are derived for a deterministic control model. Results are compared with the most relevant optimal control papers discussed above. Multivariate sensitivity analyses based on Latin Hypercube Sampling are performed to investigate the effects of input parameters on the control policy structure and the mean cumulative deaths. Additional studies investigate the effects of departures from the modeling assumptions, which include exponential terminal time and linear NPI implementation cost.In this section, we formulate an optimal control problem with an expanded epidemic model to compute NPI implementation strategy. To understand the following discussion, the reader is referred to Figure t ≥ 0, the community is composed of S(t) susceptible, I(t) infectious, R(t) recovered, and D(t) deceased individuals. The population is closed, ignoring the demographic turnover or immigration, i.e. S(t) + I(t) + R(t) + D(t) = N. To make the analysis independent of population size, we normalize the model by letting x(t) = (s(t), i(t), r(t), d(t)).1. At any time, 2. The population is homogeneously mixed and people make contact at random.γ, or die at a constant rate, τ. People recovered are assumed to be immune within our study horizon.3. People susceptible are able to get infected when they contact infectious people. Once infected, they move into the infectious compartment. People infected can either recover at a constant rate, u(t), where 0 ≤ u(t) ≤ b <β. NPI implementation reduces the rate of contact between susceptible and infectious individuals, and thus dampens the infection rate from β to a lower level, β - u(t). In this paper, we only consider NPIs that will disrupt the normal societal functions and result in significant economic impact, such as school closure, work space distancing and voluntary isolation and quarantine. We assume these NPIs have the same effect in reducing disease spread.4. NPI implementation is modeled by the decision variable c ≤ 1 will be person-days lost due to NPI implementation. The cost c is a weight of NPI cost relative to death. It measures the loss of productivity (person-days) due to implementing NPIs. To determine the value of c, the public health officials need to consider many factors, such as culture of the community, perceptions to death, consequences of pandemic and of the NPIs, economic constraints, and etc. We assume that cost of NPI implementation increases with implementation strength. In particular, we consider two cost structures, a linear structure in which cost is proportional to NPI strength, and a quadratic structure in which the change in cost with NPI strength is more variable. This paper is focused most extensively on the linear structure.5. We let person-days lost due to death be unit cost, while T is assumed to be the time when effective vaccine becomes available to the community. Although the production of the first doses of vaccine is estimated to take 4-6 months once the virus strain can be identified, nobody knows exactly when circulating virus can be identified. Along with vaccine development, there are issues regarding manufacturing, delivery, and deployment. To capture the uncertainty in vaccine arrival time, we let T follow an exponential distribution. We can derive a model with a more general vaccine arrival time, but the problem is not currently numerically tractable, that is, algorithms for the general terminal time case present significant challenges and yet to be developed and tested. The exponential assumption ensures we get the discounted value function, which allows for a solution and some insights about the policy. In later sections we tested the model sensitivity to the exponential assumption. The probability density function (pdf) of T is written as f = ΦeT-Φ, where T ≥ 0.6. The optimization horizon Because NPI implementation disrupts daily activities vital to a productive society, they should only be used when they will be effective. Thus, in developing triggers, NPI cost must be balanced with NPI effectiveness. In this work, we use person-days lost to measure NPI cost and effectiveness. NPIs cause person-day losses by shutting down vital activities, but mitigate person-day losses by reducing mortality. By capturing the dynamic relationship between NPI implementation, mortality, and associated person-day losses, our model provides a mechanism for finding an NPI triggering scheme that helps minimize total person-days lost during the time period before vaccines become available.The dynamics of the controlled epidemic are given by the non-linear differential equations + i(t) + r(t) + d(t) = 1, s(t), i(t), r(t), d(t) ≥ 0, and the control, u(t), takes values in . The total person-days lost for a pandemic under a policy which prescribes an admissible control, u, will be denoted by the value function V , which is defined as:where T, which is assumed to be the time when effective vaccine becomes available to the community. An admissible control, u*, which minimizes V will be called optimal, and the corresponding value function is denoted by:The objective is to minimize expected person-days lost over the time horizon, s(t) and i(t) determines the other two, thus we focus our analysis on the susceptible and infectious compartments. This reduces the system to two dimensions, S and I. Thus, we study the control system in the -plane, defined as Ω = {, s, i ≥ 0, s + i ≤ 1}. We let represent the initial state x(0) = (s(0), i(0)), and V = V ; u) be the associated value function, which captures total person-days lost starting in state ∈ Ω and operating under control u. The expected value of V* is calculated by integrating V , u)·f over the range of T:From Eqs. (1) and (3) we can see that the knowledge of the state variables By changing the order of integration, the problem is converted to an infinite horizon discounted problem:V*. This is called the Hamilton-Jacobi-Bellman (HJB) equation:Based on Pontryagin's Maximum Principle , which gV* at the point .where u, thus the optimal control will be "bang-bang" control [u*, should satisfy:Eq. (5) is a linear function of control , i.e., tψ is the coefficient of u in Eq. (5), defined as:where the switching curve u* is pushed to its lower/upper bound depending on the sign of its coefficient, the switching curve ψ , because the HJB equation, Eq. (5), is linear in the control, u. However, if the HJB is nonlinear in u, the optimal control will not be bang-bang. An example will be the linear quadratic optimal control problem, where the optimal policy is a linear state feedback [The optimal control feedback .u*, the NPIs should be implemented at the maximum level when ψ (x) <0. To understand this, assume the community is in state xA = and consider exerting an instantaneous and small control, δu, which will move the system to state xB = instantaneously. The exertion will cost csδu person-days lost. If V*(xA)-V* (xB) exceeds csδu, then it is cost-effective to implement the NPIs. Here, V* (xA)-V* (xB) is the rate of change of the value function V* in the direction, i.e., ψ (x) > 0.By the bang-bang nature of candidate ψ (x), has no closed form. To find ψ (x), we use an algorithm based on Dynamic Programming [Due to the complexity of the Eq. (5), the switching curve, gramming , which rgramming .u*, is obtained by solving the HJB equation (Eq. (5)). Figure u* for two infection rates, 0.4 and 0.6, given a recovery rate of 0.25 and a death rate of 0.05 . The maximum impact of NPIs on the infection rate is assumed to be a 20% reduction. Note that the basic reproductive number R0 without any control is given by R0 = β = (γ + τ).The optimal control, ken from ). PersonFigures β = 0.6 and R0 = 2.0, Figure We compare our policy against the most relevant optimal isolation policies derived in . FiguresFigure R0 > 1, i.e., the uncontrolled infection spreads rather than dying out. Figures We illustrate cases for which Figures We also computed control policies for systems assuming quadratic control cost instead of linear cost, i.e., the value function is written as rinciple , we can u, thus the optimal control will not be "bang-bang" control. The candidate control u* should satisfy:Eq. (8) is now a quadratic function of β = 0.4 and R0 = 1.33. Figure u* ≈ 50% of maximum impelmentation level is very similar in shape and location to the boundary between Ω1 and Ω2 in Figure β = 0.6. The two boundaries between Ω1 and Ω2 in Figure u* ≈ 50% of maximum impelmentation level in Figure u* in the upper corner and lower right corner of Figure By solving Eq. (8), we obtained the NPI policies for systems assuming quadratic control cost shown in Figure R0, γ, τ, c, b) on a performance measure, ω, defined as the proportion of the control space to the total state space, i.e., ω because it captures the overall intensiveness of NPI implementations. In addition, we investigated the effect of these parameters on the outcome of applying the control policy, defined as the mean cumulative death, dT . We simulated the SIRD system under the optimal policy starting from all state , where s0 > 80%, i0 <20%, and d0 = 0. The simulation was terminated at a randomly selected exponential terminal time, and we recorded and analyzed the cumulative number of deaths. The mean cumulative death was calculated by taking the average of cumulative deaths over all tested initial states.A multivariate uncertainty and sensitivity analysis was performed to study the effects of input parameters on the control policy for the linear cost model. This analysis investigated the effects of five inputs are estimated based on the 1918 pandemic [β can be written as R0(γ + τ). The effect of NPIs, b, was found to reduce the infection rate, β, by up to 30-50% in 1918 and in many cases the effect of NPIs was very limited [b, follows Uniform. We are not able to find any empirical data on the cost of NPI, c. This value is a relative cost, which depends on decision makers' perceptions of saving lives versus maintenance of daily societal functions. In our analysis we let c take the value from 0 to 0.25 uniformly, which would imply that the cost of four sessions of maximal NPI implementation is equivalent to the cost of one death.Table pandemic . Note th limited ; thus weω and dT are given in Table ω and dT .We sampled ranges of the parameters 1000 times using Latin Hypercube Sampling (LHS) to generate 1000 scenarios -48. Thenω and dT obtained from 1000 LHS scenarios and Table ω revealed a wide range of estimates due to the uncertainty in estimating the values of the five input parameters. Sixty percent of ω estimates are less than 2.3%, with a minimum of 0% and a maximum of 98.7%. For ω, the PRCCs are all statistically significant, i.e. p < 0.05. The cost of NPI implementation, c, the time when a death occurs after infection, 1/τ, and the time for an infectious person to recover, 1/γ, are the most statistically influential (|PRCC| > 0.5). An increase in c or 1/τ corresponds to a decrease in ω; while an increase in the infection period 1/γ corresponds to an increase in ω. The CDF of dT shows that the mean of cumulative death is 14.25%, with a minimum of 0.63% and a maximum of 76.39%. For dT, the PRCCs are are all statistically significant, i.e. p < 0.05. The most statistically influential inputs are 1/τ, R0, and 1/γ (|PRCC| > 0.5) while the other two parameters are lessinfluential. A decrease in 1/τ corresponds to an increase in dT; while an increase in R0 or 1/γ corresponds to an increase in dT .Figure Exponential(0.0056) and a value Gamma as the vaccine arrival time . The sampling was repeated 20 times for each scenario. Then, we simulated the SIRD system starting from an initial state applying the corresponding NPI policy. The simulation was terminated at the sampled vaccine arrival times and the cumulative deaths were recorded. A total of 210 initial states were selected, where s0 ≥ 80% and i0 ≤ 20%, for a total of 210, 000 simulations. We studied the difference in cumulative deaths under these two vaccine arrival assumptions. Table To test the sensitivity of our control policy to the terminal time assumption, we simulated the disease propagation and studied the outcome of applying our NPI policy to settings with an exponential and a gamma terminal time. For each flu scenario specified in the sensitivity analysis, a corresponding NPI policy can be obtained. We randomly selected a value from tial0.005 and a vamean = 3.49%). The distribution of difference in cumulative deaths is left-skewed, with 91.8% of these differences being less than 10%. There are a few cases where the cumulative deaths differ significantly (≥ 30%). These cases all started from initial states where only a small proportion people are infectious, i.e., i0 ≤ 1%, and the difference between the selected gamma and exponential terminal time exceeds 60% of the maximum of these two. For example, in a case where i0 = 1%, S0 = 95%, gamma terminal time = 235 days and exponential terminal time = 55 days, the difference in cumulative death is 32.04%.Overall, the difference in cumulative deaths under exponential and gamma terminal times is small in determining the intensity of NPI implementation. Different communities have different perspectives of death versus disruption of daily societal functions. The range of c should be determined by decision makers after carefully evaluating the demographic, cultural, and economic characteristics of the community.Cumulative death was most affected by the death rate, the basic recovery number and the recovery rate. For higher death rates, a higher proportion of infected people will die. For higher basic reproductive number, more people will be infected, resulting in more deaths even when the death rate is smaller. For lower recovery rate, infected people recover at a slower rate, and thus more people will be infected. This suggests that an influenza virus with a high death rate, a high basic reproductive number and a small recovery rate is less affected by NPI implementation. NPI cost does not seem to affect the cumulative death. However, NPI cost was identified as the most influential < 0, for all ∈ Ω1 according to Eq. 7. So s, i) ∈ Ω1. Together with Eq. 9, we have u* > 0 for these states in the quadratic model.If the cost function is linear, the control policy is bang-bang, which suggests implementing NPIs at the maximum strength or not implementing at all as shown in Figure u* ≈ 50% of maximum implementation.Thus, a quadratic cost structure will require NPIs to be implemented in more states but with much lower intensity in those states. Overall, a linear cost structure leads to higher average NPI intensity than the quadratic cost. In the examples observed, the boundaries between control and non-control regions in linear model resemble the quadratic contour lines X% of maximum. This requires determining which NPIs will be implemented for each control level. The bang-bang policy, on the other hand, has only two levels, which is easier to understand and implement. Finally, it is not clear that a direct comparison between policies obtained under linear and qudratic cost structures is appropriate, because the value functions are defined differently. More research needs to be done to better define the NPI levels and interpret the policy if a non-linear cost function is chosen.Moreover, the linear cost model appears to place more weight on death, thus implementing more control and saving more lives as shown in Table We are currently not able to derive an optimal control policy for a general terminal time assumption. Although the exponential optimal policy will not be optimal for cases with general terminal time, results shown in Table Our model was limited in several ways. First, although HJB can be derived for models assuming general terminal time , so far the control policy can only be computed assuming exponential terminal time. Second, the present modeling framework does not capture uncertainty in parameter estimation, i.e. the model accuracy relies on accurate estimation of input parameters. In practice, collection of accurate data and estimation of input parameters from data can be challenging and time consuming. Third, the present modeling framework assumes equal effect of various NPIs in a homogeneously-mixed population, while different NPIs will have distinct impacts for disparate population groups. Finally, bang-bang control must be further refined since it is not clear that on/off implementation is realistic for larger communities. To better apply optimal control methods in disease control problems, continued efforts should be made to refine the present model and to better estimate the input parameters.To conclude, we have considered a problem of non-pharmaceutical intervention (NPI) implementation for pandemic control using optimal control theory to develop triggers that minimize expected person-days lost associated with infection related death and NPI implementation over an exponential time horizon. The best control strategy for the model depends on the transmission characteristics of the influenza virus, the state of the pandemic, and the cost and implementation levels of NPIs.We present the computed policies under different transmission characteristics, where it is optimal to activate all NPIs when the system state falls in the control region, Ω1. The optimal policy can be calculated for any combination of flu and cost parameters. We compare the impacts of NPIs triggered at different states, which supports the idea of early containment. For comparison, we present the NPI policies assuming quadratic control cost. The quadratic cost assumption introduces additional complexity into parameter estimation, computation and policy interpretation, thus more research needs to be done to better define the NPI levels and interpret the policy. We perform multivariate sensitivity analysis, which identifies important parameters that affect the intensity of control and the outcome of applying the policy. The findings highlight the importance of establishing a sensitive and timely surveillance system. Finally, we study the outcome of applying our NPI policy under exponential and gamma terminal times, and find small difference in the cumulative death.Many uncertainties exist in estimating flu parameters, future research directions include developing a model that allows using stochastic rather than deterministic inputs and updates the control polices in real time. Since NPI implementation is not mandatory, compliance to NPI requirements is crucial for successful implementation. Community engagement, job security, and disruption of daily life affect compliance to NPI implementation . MoreoveThe authors declare that they have no competing interests.LF conducted the research, including model design, acquisition of data, analysis and interpretation of data, and manuscript drafting. KM provided important guidance in model design and methods. He also revised the manuscript critically for important intellectual content. ML supervised the study. He had actively involved in model design and interpretation of data. He also revised the manuscript critically for important intellectual content. All the authors have given approval of the version to be published.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/32/prepub

Brucella strains are widely used to vaccinate animals. However these live Brucella vaccines can cause disease and are unsafe for humans. Killed Brucella or subunit vaccines are not effective in eliciting long term protection. In this study, we evaluate an approach using a live, non-pathogenic bacteria (E. coli) genetically engineered to mimic the brucellae pathway of infection and present antigens for an appropriate cytolitic T cell response.There is no safe, effective human vaccine against brucellosis. Live attenuated E. coli was modified to express invasin of Yersinia and listerialysin O (LLO) of Listeria to impart the necessary infectivity and antigen releasing traits of the intracellular pathogen, Brucella. This modified E. coli was considered our vaccine delivery system and was engineered to express Green Fluorescent Protein (GFP) or Brucella antigens for in vitro and in vivo immunological studies including cytokine profiling and cytotoxicity assays.E. coli vaccine vector was able to infect all cells tested and efficiently deliver therapeutics to the host cell. Using GFP as antigen, we demonstrate that the E. coli vaccine vector elicits a Th1 cytokine profile in both primary and secondary immune responses. Additionally, using this vector to deliver a Brucella antigen, we demonstrate the ability of the E. coli vaccine vector to induce specific Cytotoxic T Lymphocytes (CTLs).The E. coli can be used as a vaccine vector for delivery of antigens and therapeutics mimicking the infection of the pathogen and inducing cell mediated immunity to that pathogen.Protection against most intracellular bacterial pathogens can be obtained mostly through cell mediated immunity. Data presented here suggest modified Brucella species [Brucella can be transmitted by aerosolization, and the unpredictable timing of the onset of symptoms raise the specter of a potentially insidious bioterror attack [Brucella are actively phagocytosed by macrophages or other phagocytic cells where they prevent phagosome-lysosome fusion, persist and replicate in endocytic compartments that acquire endoplasmic reticulum membranes [Brucella strains are widely used to vaccinate animals against brucellosis. However, these live Brucella vaccines can cause disease and are unsafe for humans [Brucella or subunit vaccines are not effective in eliciting long term protection [There is no safe, effective human vaccine against brucellosis . Brucell species ,5. The er attack -9. Durinembranes ,11. Bactembranes ,13. Liver humans -17. Killotection . TherefoBrucella infection. Numerous studies have shown that Th1 or cell mediated immunity is crucial for protection against brucellosis [Brucella immune T cells protects mice against virulent Brucella infection [+ and CD8+ T cells involved in immunity [+ T cells compared to CD4+ T cell deficient mice or wild type mice [Brucella immunity [Eliciting a specific T cell response is necessary to fight cellosis however cellosis -23. Adopnfection ,25 with immunity ,27. Neveype mice . In factimmunity ,28-30.Escherichia coli to mimic the intracellular pathogen Brucella melitensis in delivery and presentation of antigens to stimulate a Th1 and CTL response. E. coli are normally extracellular while Brucella are intracellular bacteria. Therefore, we engineered E. coli (DH5α) to express a plasmid containing the inv gene from Yersinia pseudotuberculosis and the hly gene from Listeria monocytogenes [inv confers E. coli invasion of host cells by binding the αβ1-integrin heterodimer. Upon clustering of integrins, invasin activates signaling cascades. One signaling pathway causes activation of components of focal adhesion complexes including Src, focal adhesion kinase, and cytoskeletal proteins, leading to the formation of pseudopods that engulf the bacteria into the host cell. Binding of invasin to β1-integrin is necessary and sufficient to induce phagocytosis of the bacteria even by non-professional phagocytic cells. A second pathway including activation of Rac1, NF-κB, and mitogen-activated protein kinase, leads to production of proinflammatory cytokines [E. coli is taken into the phagosome/lysosome where lysis of the bacterium occurs. The hly gene product, along with other bacterial proteins, is release into the lysosomal vesicle. The sulfhydryl-activated hly, also known as listeriolysin O (LLO) is a pore-forming cytolysin capable of binding and perforating phagosomal membranes at low pH [E. coli into the cytosol where further processing by proteosomes and translocation by TAP into the endoplasmic reticulum lumen occurs for MHC class I presentation [E. coli that are phagocytosed by Antigen Presenting Cells (APC) such as macrophages and dendritic cells [E. coli, others have shown successful delivery of genes and molecules [inv-hly expressing recombinant E. coli as a vaccine vector for immunization against the intracellular pathogen, Brucella.Our approach utilizes a non-pathogenic ytogenes . Introduytokines . After it low pH . The cytentation . LLO is ic cells ,35. Usinolecules ,34-44. ICells were maintained in RPMI 1640 medium (Invitrogen) supplemented with 10% fetal calf serum (FCS), 4.5% dextrose, 1 mM sodium pyruvate, and antibiotic-antimycotic solution . In addition, drugs used for selection were: Blasticidin-S and G418-sulfate . Cell lines included: D17 (ATCC CCL-183), TB1 (ATCC CCL-88), J774A.1 (ATCC TIB-67), HeLa S3 (ATCC CCL-2.2), RAW 264.7 (ATCC TIB-71), HEK 293 (ATCC CRL-1573), FLK , and thed), 4–6 wks old were purchased from Jackson Laboratory and injected with 0.1 ml of PBS i.p. one day prior to E. coli vaccinations to prevent the mice from succumbing to LPS-induced endotoxic shock from live E.coli. Intraperatoneal (i.p.) route of vaccination was chosen to best deliver live E. coli vector vaccine to mice based on consistency of results and ease of method. Recombinant E. coli vaccines were injected i.p. with 2 × 107 E.coli in PBS. PBS was used for negative controls. For experiments examining primary immune response cytokine profiles, mice were injected with E. coli vector vaccine and after 5 h, euthanized and spleens removed. For experiments enumerating antigen-specific CD8+ T cells, RAW264.7 macrophages (H-2d) expressing GFP with animals anesthetized using Isofluorane. IVIS image analysis was performed using Living Image 3.0 software . Each group of mice consisted of 4 animals. All animal experiments were conducted with approval from the Institutional Animal Care and Use Committee.BALB/c female mice was subinvasin from Yersinia pseudotuberculosis and listeriolysin O (LLO) from Listeria monocytogenes; pMC221 [luxCDABE operon for engineering bioluminescent Gram-negative bacteria. The eukaryotic expression vector pEYFP-N1 was purchased from Clontech and expresses enhanced yellow fluorescent protein (EYFP); pORF-mIL12 was purchased from Invivogen and expresses both chains of a functional murine IL-12 connected by a linker. The retroviral vector pLNCX2/EYFP [Brucella BMEII1097 gene from pDONR201/BMEII1097 of the Brucella ORFeome purchased from OPEN Biosystems [syrB. This retroviral vector was used to transduce Raw 264.7 cells to be used as targets for CTL assays. The prokaryotic expression vector pDEST17/BMEII1097 was engineered from pDEST17 (invtrogen) and pDONR201/BMEII1097.The prokaryotic expression vector pGB2Ωinv-hly except for recombinants expressing pDEST17 vectors were we used BL21-AI™ (Invitrogen). Table E. coli vector vaccines.All 5 cells/well in a six-well plate (or two well chambered coverslips for fluorescent microscopy) in 2 ml/well RPMI with 10% fetal calf serum (Invitrogen) and grown in a humidified CO2 incubator at 37°C. E. coli were grown overnight in a shaking incubator at 37°C in LB broth (Difco) supplemented with appropriate antibiotic for plasmid selection. The following day, bacteria were counted by 600 nm absorbance spectrometry and added to washed eukaryotic cells in fresh medium without antibiotic at the specified MOI. Bacteria were then centrifuged onto the monolayer at 2 krpm for 5 min at room temperature. Cells were incubated for 90 min, washed and fresh medium added supplemented with 100 μg/ml gentamicin to kill extracellular bacteria. For invasion assays, cells were incubated for an additional 90 min to kill extracellular bacteria, then washed and lysed in 200 μl of 1% triton X-100 for 5 min at room temperature. Finally, 800 μl of LB broth was added to each well and CFU were determined on LB agar plates supplemented with chloramphenicol, the selection drug for the GFP plasmid. For gene delivery assays, cells were incubated then analyzed by fluorescent microscopy. Random fields of cells were counted and scored for fluorescence at indicated times. For IL-12 assays, infected cells were fixed and permeabilized using Cytofix/Cytoperm™ (BD Biosciences) following the manufacturer's protocol. Samples were stained using IL-12 (p40/p70) PE conjugated monoclonal antibody (BD Biosciences) and analyzed by flow cytometry.One day prior to cell infection, eukaryotic cell lines were seeded at 2 × 106 T cells were then used for flow cytometry or cytokine profiling. R-PE labeled Pro5® MHC class I pentamers GFP antigen specific for T cell receptors of H-2Kd HYLSTQSAL were co-stained with FITC labeled rat anti-mouse CD8α and used for flow cytometry along with controls following the manufacturer's suggested protocol (Proimmune). Controls included R-PE labeled rat anti-mouse CD3ε (SouthernBiotech), and R-PE and FITC anti-rat IgG2a and anti-rat IgGκ (BD Biosciences). Flow cytometry analysis was performed on 3.5 × 105 cells for each immunization group. For cytokine profiling, T cells from immunized and control mice were incubated with gamma-irradiated (2 KR) RAW 264.7 macrophages on 6 well plates with or without the addition of 50 mM GFP peptide for 3 days. Supernatant was harvested, centrifuged to remove cell debris and processed using a Th1/Th2 cytokine kit by cytometric bead array (BD Biosciences). Data acquisition and analysis was performed according to the manufacturer's instructions using flow cytometry.Pooled splenocytes from four mice per immunization group were isolated and density gradient purified (Fico/Lite-LM (Mouse); Atlanta Biologicals). Leukocytes were subjected to non-T cell depletion using a Pan T Cell Isolation Kit and MACS separation (Miltenyi Biotec) following the manufacturer's protocol. Aliquots of 2 × 10in vitro by growth on confluent 2 KR gamma-irradiated target cells in six-well plates supplemented with 10% T-stim without Con A (BD Biosciences) for three days. Effector cells were then washed and purified through a density gradient. Cells were counted and assayed using a CytoTox 96® Non-Radioactive Cytotoxicity kit (Promega) following the manufacturer's protocol with 4 h incubation.Splenocytes from immunized mice were isolated and gradient purified (described above) for use as effector cells. Transduced RAW 264.7 cells expressing GFP or BMEII1097 were cloned by limiting dilution and used as target cells. Cytotoxic effector cells were expanded Acquisition was performed on a FACSCalibur flow cytometer (BD Biosciences) and analyzed using FlowJo 8.7.1 software .Retrovirus-mediated gene transfer was accomplished using the BD Retro-X System (BD Biosciences) following the manufacturer's suggested protocol. Briefly, 100 × 20 mm tissue culture dishes were seeded with the packaging cell line GP2-293 at 70–90% confluency. GP2-293 cells were co-transfected with 5 μg each of retroviral vector and the envelope glycoprotein expression vector pVSV-G using 15 μl/transfection of Lipofectamine 2000 (Invitrogen) for 3 h in a total volume of 5 ml medium/dish. Subsequently, transfection medium was replaced with 10 ml growth medium, and the cells incubated for 72 h. Retrovirus-containing supernatant was harvested, filtered (0.45 μm), and concentrated by ultracentrifugation. Supernatant was removed and virus resuspended in the residue (~200 μl) and frozen (-80°C). Cells for transduction were plated on 6-well tissue culture plates at 50% confluency. Concentrated retrovirus (titer unknown) along with polybrene (8 μg/ml) were added to 1 ml/well cells and incubated overnight. Transduction medium was replaced with fresh growth medium, and the following day cells were split into appropriate selective medium.5 cells/well) were incubated on glass coverslips in six-well plates overnight at 37°C in a CO2 humidified incubator. Using conditions as with invasion assays, invasive or non-invasive E. coli were incubated with the cells at MOI 100 for 90 min. The cells were thoroughly washed to remove extracellular bacteria followed by gentimycin incubation for an additional 90 min. Cells were washed in PBS and fixed in Karnovsky's Fixative (Electron Microscopy Sciences) following manufacturer's protocol. TEM was performed at the University of Wisconsin Medical School Electron Microscope Facility . Figures were imported using Adobe Photoshop CS3 10.0.1.Cell lines (2 × 10Student's t-test was performed and results expressed as the arithmetic mean with the variance of the mean (mean ± SE).Escherichia coli and genetically engineer it to mimic infectivity and intracellular antigen trafficking of a pathogen such as Brucella melitensis. The engineered bacteria would then be employed as a vaccine vector for Brucella antigen delivery and evaluated for immune response. E. coli are normally extracellular, and taken up and destroyed by phagocytic cells such as macrophages. We transformed GFP expressing E. coli DH5α (E. coli gfp) with a plasmid encoding invasin from Yersinia pseudotuberculosis and LLO from Listeria monocytogenes (E. coli gfp+inv) and tested whether these E. coli were invasive to non-professional as well as professional phagocytic cell lines. Non-invasive E. coli (E. coli-gfp) or invasive E. coli (E. coli gfp+inv) were added to different cell lines and analyzed by fluorescent microscopy. Addition of invasive E. coli to all cell lines, phagocytic and non-phagocytic, resulted in intracellular fluorescent bacteria. However, only minimal non-invasive E. coli fluorescence was observed in non-phagocytic cell lines , but was present in macrophage cell lines (RAW and J774). An example with TB1 and RAW264.7 cells is shown in Figure E. coli were intracellular, invasion assays were performed .The objective of this study was to take a non-pathogenic organism such as E.coli as a live vaccine vector, we examined localization and persistence of the vector in vivo. We transformed lux operon expressing E. coli DH5α (constitutively bioluminescent) with the inv-hly encoding plasmid as our invasive E. coli (inv E. coli). Mice were intraperitoneal injected with non-invasive or invasive bioluminescent E. coli and analyzed by biophotonic imaging over time. Both bioluminescent species trafficked to the spleen. However, the invasive E. coli vector persisted longer at the site of injection suggesting an extended period of antigen delivery to enhance MHC class I presentation of antigens carried by the invasive E. coli vaccine vector. Hemolysin (hly) or LLO perforates phagosomal membranes at low pH and the contents of the vaccine are released into the cytosol of the cell [hly gene product in the E. coli vector, we first examined delivery of a eukaryotic expression plasmid, pEYFP-N1 expressing yellow fluorescent protein (YFP) under control of the eukaryotic CMV promoter, using fluorescent microscopy. Table E. coli vector transferred functional YFP plasmid to all mammalian cells tested. Interestingly, the number of YFP positive cells per total cells increased as time progressed. Also, two days post-infection no YFP positive macrophages were observed, but after seven days fluorescent positive cells were similar to the non-phagocytic cell lines.Unlike ost cell . Eschericlass II ,50. Therthe cell . To testE. coli vaccine vector and tested for delivery and expression of IL12 in cell culture. Using human HeLa cells, microfluorimetry analysis demonstrated greater than 70% of E. coli vaccine infected cells were positive for murine IL12 or a Th2 immune response is dependent mainly on the balance between interleukin-12 (IL12), favoring a Th1 response, and interleukin-4 (IL4), favoring a Th2 response ,53. Vacc+ T cells. Performing real-time PCR gene expression profiling analysis on splenocytes from mice 5 h following vaccination with invasive E. coli vaccine or non-invasive E. coli, we analyzed for differences in primary immune response profiles. This time-point was chosen because typically, cytokines that promote T cell responses are measured 5 h post-immunization [E. coli vaccine compared to control E. coli. The data were difficult to interpret since both key Th1 and Th2 cytokines were upregulated in E. coli vaccine immunized animals compared to E. coli control immunized animals. Most likely, the complexity of the cytokine profile can be attributed to the highly stimulatory LPS of E. coli [E.coli vaccinated animals to PBS control animals were also performed (data not shown), but the results were not relevant to our objective of determining whether the recombinant E. coli vaccine would elicit a different cytokine profile relative to control E. coli.Since we were interested in preparing a vaccine that would stimulate cell mediated immunity, we analyzed for a Th1 cytokine profile and specific CD8nization . Table 4 E. coli ,59. Compd-binding peptide HYLSTQSAL of GFP and supernatants were measured for cytokines after three days. GFP nonamer treated cultures showed a large increase in Th1 cytokine levels in E. coli vaccine immunized T cell groups with negligible change or decrease in Th2 cytokine levels co-stained with CD8+ antibody and analyzed by flow cytometry. As shown in Figure E. coli vaccine induced GFP peptide specific CD8+ T cells at a significant level (p < 0.05) greater than the non-vaccinated (PBS) and empty vaccine controls and at similar levels to mice given syngeneic APC's constitutively expressing the antigen (RAW/GFP). However, the non-invasive E. coli vaccine control (GFP) also induced notable levels of CD8+ T cells not significantly different than the vaccines (GFP inv and GFP inv IL12). The high number of specific CD8+ T cells induced by the invasive E. coli vaccines correlated with the Th1 cytokine up-regulation induced in the secondary immune response by these cells in vitro response.To determine the proportion of CD8l p < 0.0 greater E. coli vaccine vector expressing the GFP antigen were used as effector cells in cytotoxicity assays against RAW/GFP target cell lines. As shown in Figure E. coli vaccine vectors elicited marked CTL response against the target cells versus the control non-invasive E.coli (GFP) and mock immunized (PBS) mice. To optimize the immunization protocol, we repeated this experiment with mice vaccinated with different doses of E. coli vaccine ranging from 104 to 108 cells in both primary and booster vaccines. Results (not shown) demonstrated that the highest vaccine dose (108) elicited the highest CTL results.Splenocytes of mice immunized with the invasive E. coli vaccine expressing B. melitensis ORF BmeII-1097 (designated B7) as well as vaccine vector without antigen expression (designated Empty) was included. Antigen of this Brucella ORF had been determined by RANKPEP computer algorithm [d. BmeII-1097 is a putative transcriptional regulator with homology to syrB. Cytotoxicity assays affirmed that CTLs generated by the invasive E. coli vaccine were specific to the expressed antigen of the vector . These data had been confirmed by others [E. coli.Recombinant invasive ic cells ,66-70. Ty others and suggBrucella have not been identified but involve lipid rafts and components of this micro domain [Brucella endocytic pathway is distinct from the classical endosome-lysosome pathway in that Brucella inhibit phagosome-lysosome fusion [Brucella infection of macrophages is inefficient with only 40–60% of cells infected in vitro after 1 hour [E. coli are efficiently engulfed and processed through the classical endosome-lysosome pathway. However, this leads to rapid destruction of the bacteria and MHC class II presentation of antigen [E. coli vector to express invasin from Yersinia. This effectively made the vector 80–100% invasive to not only professional phagocytic cells, but to all cells expressing β1-integrin for a prolonged period at the site of immunization for binding and internalization of o domain . The Brue fusion . Furtherr 1 hour . In cont antigen . To avoirs Table whereas M Figure where thinvasin of Yersinia pseudotuberculosis our recombinant E. coli vaccine vector co-expressed the hly gene of Listeria monocytogenes on the same vector. Modification of the bacterial vaccine to express listeriolysin O (LLO) was to increase MHC I presentation of the expressed antigen delivered by the vaccine. As reported by others [In vitro, this LLO-mediated process has been shown to improve MHC I presentation of antigens by macrophages and dendritic cells [In vivo, E. coli vaccines expressing LLO induced a very strong anti-tumor CTL response [E. coli without LLO (Table + regulatory T cell (Treg) inhibition of antigen-specific CD8+ T cell expansion [E.coli vaccine vector revealed a mixed Th1/Th2 profile suggesting a high population of CD4+ T cells and possibly Tregs common to different groups of pathogens. The toll-like receptor (TLR) family has emerged as a major group of signaling receptors for PAMPs ,80. ClasE. coli) that was not pathogenic to the host and engineering it to mimic the bacterial pathogen Brucella intracellular infection to stimulate a protective cellular immune response. Our data show that this vaccine vector could efficiently infect cells of multiple tissues. These vaccine infected cells acting as antigen presenting cells can stimulate a cellular immune response with Th1 cytokine profile and specific CTLs. Studies are now in progress to determine whether this recombinant invasive E. coli vaccine vector, expressing pools of immunodominant Brucella antigens, would be sufficient to induce a protective immune response in mice. Our studies show that this novel vaccine could be applied to any disease where cellular immunity is required.We began our studies with the goal of developing a live vaccine vector using an organism (The authors declare that they have no competing interests.JH, MD, and DD participated in mouse vaccination studies. JH and DD carried out pentamer staining and cytokine profiling. MD performed IL12 expression studies and flow cytometry. JH performed molecular and cell biology studies engineering and immunoassays. JH and GS conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Lamins are major structural proteins of the nucleus and contribute to the organization of various nuclear functions. Mutations in the human lamin A gene cause a number of highly degenerative diseases, collectively termed as laminopathies. Cells expressing lamin mutations exhibit abnormal nuclear morphology and altered heterochromatin organization; however, the mechanisms responsible for these defects are not well understood.The lamin A rod domain mutants G232E, Q294P and R386K are either diffusely distributed or form large aggregates in the nucleoplasm, resulting in aberrant nuclear morphology in various cell types. We examined the effects of these lamin mutants on the distribution of heterochromatin protein 1 (HP1) isoforms. HeLa cells expressing these mutants showed a heterogeneous pattern of HP1α and β depletion but without altering HP1γ levels. Changes in HP1α and β were not observed in cells expressing wild-type lamin A or mutant R482L, which assembled normally at the nuclear rim. Treatment with proteasomal inhibitors led to restoration of levels of HP1 isoforms and also resulted in stable association of lamin mutants with the nuclear periphery, rim localization of the inner nuclear membrane lamin-binding protein emerin and partial improvement of nuclear morphology. A comparison of the stability of HP1 isoforms indicated that HP1α and β displayed increased turnover and higher basal levels of ubiquitination than HP1γ. Transcript analysis of components of the ubiquitination pathway showed that a specific F-box protein, FBXW10 was induced several-fold in cells expressing lamin mutants. Importantly, ectopic expression of FBXW10 in HeLa cells led to depletion of HP1α and β without alteration of HP1γ levels.Mislocalized lamins can induce ubiquitin-mediated proteasomal degradation of certain HP1 isoforms by activation of FBXW10, a member of the F-box family of proteins that is involved in E3 ubiquitin ligase activity. LMNA) are associated with at least 15 highly degenerative, inherited diseases collectively termed laminopathies. The majority of mutations in LMNA are missense mutations, though small deletions and truncations have also been identified. Most of the mapped mutations cause Emery-Dreifuss muscular dystrophy (EMD) and dilated cardiomyopathy while other mutations are associated with progerias and lipodystrophies such as familial partial lipodystrophy (FPLD) Lamins are type V intermediate filament proteins that are the major structural proteins of the nucleus in metazoan cells. Lamins form a filamentous meshwork underlying the inner nuclear membrane that extends into the nucleoplasm. Two types of lamins are found in most species. The B-type lamins B1 and B2 are expressed in all somatic cells and are coded by separate genes. The A-type lamins A and C are encoded by a single lamin A gene through alternative splicing and their expression is detectable in several differentiated cell types. Lamins are important for maintenance of nuclear shape and integrity and are involved in the organization of nuclear functions such as DNA replication and transcription; the A-type lamins have also been proposed to play important roles in cell differentiation and gene regulatory pathways. Mutations in the human lamin A gene and lamina-associated polypeptides (LAPs) like LAP2α In the present study, we analyzed the levels and stability of the heterochromatin marker, heterochromatin protein 1 (HP1) in HeLa cells expressing disease-causing lamin A mutants. As our data showed a substantial loss of specific isoforms of HP1 in cells expressing the rod domain mutants G232E, Q294P and R386K that form intranuclear aggregates, we determined whether this downregulation was due to proteasomal degradation by using proteasomal inhibitors, analyzed the distribution of lamin A in treated cells and studied the turnover rates and ubiquitination levels of HP1 isoforms. Furthermore, we compared the expression levels of a number of components of the ubiquitination pathway and studied the effects of overexpression of one F-box protein, FBXW10 that was highly induced in mutant-expressing cells. Our findings indicate that lamin mutants can induce ubiquitin-dependent proteolysis of specific HP1 isoforms by activation of a distinct F-box protein that is involved in E3 ubiquitin ligase activity.We examined the expression of heterochromatin markers in HeLa cells expressing GFP fused constructs of wild-type lamin A, the rod domain EMD mutants G232E, Q294P and R386K or the tail domain FPLD mutant R482L. Our previous studies with these constructs showed that wild-type GFP-lamin A and R482L were localized at the nuclear periphery in a typical rim pattern, whereas G232E, Q294P and R386K did not assemble at the nuclear periphery but mislocalized to the nucleoplasm where they formed varying numbers of aggregates, resulting in disruption of the lamina and abnormal nuclear morphology As HP1α and β proteins bind to histone H3 trimethylated at lysine 9 (H3K9me3), which is a molecular mark of constitutive heterochromatin and is associated with silenced genes The above results were substantiated by western blot analysis of cell lysates from FACS-sorted cells followedWe next examined the possibility that depletion of HP1α and β might be due to proteasomal degradation by checking the effects of proteasomal inhibitors. We observed that addition of MG132 led to restoration of HP1α and β levels in transfected cells. As shown in As we had noted that lamin mutants were localized at the nuclear periphery after treatment with proteasomal inhibitors, we sought to determine the stability of this structure. Staining of cells with an antibody to emerin, a lamin-binding protein localized in the inner nuclear membrane, indicated a depletion of emerin at the rim and a dispersed, cytoplasmic staining in untreated cells expressing G232E, Q294P or R386K, as observed in earlier studies with these constructs To investigate whether factors other than restoration of emerin might be involved in location of lamin mutants at the nuclear periphery, the following experiments were carried out. We firstly analyzed the effects of MG132 on cells expressing LAΔ50, as this relocation could be due to MG132-induced changes in C-terminal farnesylation or processing. A number of studies have shown that the lobulated nuclear morphology of cells expressing LAΔ50 can be improved by drugs that block farnesylation of the C-terminus We also assessed the effects of ectopically expressed HP1β on the nuclear morphology of G232E, Q294P or R386K-expressing cells. When GFP-HP1β was co-transfected with mRFP-lamin A constructs into HeLa cells, mutant lamin A aggregates persisted in the nuclear interior, nuclear morphology remained distorted and G232E, Q294P or R386K were not localized to the nuclear periphery . OccasioThe specific degradation of HP1α and β but not HP1γ by lamin misexpression prompted us to compare the stability and solubility properties of the individual isoforms. An initial assessment of their inherent stability was obtained by analysis of basal turnover rates using the protein synthesis inhibitor cycloheximide. HeLa cells were treated with cycloheximide in a time-course experiment and levels of HP1 isoforms were analyzed by western blotting . We obseThe induction of proteasomal degradation by lamin mutants prompted us to check whether specific components of the ubiquitin-proteasome system were activated by the mutants. This system is comprised of an E1 ubiquitin activating enzyme, an E2 ubiquitin conjugating enzyme and an E3 ubiquitin ligase. Substrate specificity is conferred by the large variety of E3 enzymes that can recognize distinct substrates through specific domains or modules As the F-box proteins are important determinants of substrate specificity in the ubiquitination process, we carried out further experiments with FBXW10. The gene was cloned by PCR and expressed as an epitope-tagged protein in HeLa cells. RFP-FBXW10 was located mostly in the cytoplasm of transfected cells. Interestingly, expression of FBXW10 resulted in the depletion of HP1α and β in 80–90% of cells without alteration of HP1γ levels . In the In this study, we report that HP1α and β undergo proteasomal degradation in cells expressing lamin mutants that predominantly form intranuclear aggregates. Treatment with proteasomal inhibitors restores HP1α and HP1β, and locates G232E, Q294P and R386K together with emerin to the nuclear periphery. Analysis of components of the ubiquitination pathway indicates that expression of the F-box protein FBXW10 is highly induced in mutant-expressing cells, and ectopic expression of FBXW10 results in specific depletion of HP1α and β. The implications of our results are discussed with respect to the effects of lamin misexpression on chromatin organization, lamina assembly and protein ubiquitination.−/−Lmna mouse cardiomyocytes C. elegansAt the nuclear periphery, the lamina is closely associated with inner nuclear membrane proteins such as lamin B receptor and emerin, and the chromatin-binding protein BAF Expression of LAΔ50 or higher levels of pre-lamin A is toxic to cells due to persistence of farnesylated lamins, and results in changes in heterochromatin organization accompanied by alterations in histone methylation and HP1 distribution Wild-type lamins form highly stable polymeric species at the nuclear periphery while several rod domain lamin A mutants form less stable aggregates in the nucleoplasm Mammalian HP1 isoforms are specifically enriched in heterochromatin or euchromatin and their domains of localization in turn influence their activities The cullin-based E3 ubiquitin ligases, also known as RING E3 ubiquitin ligases, perform most of the targeted protein ubiquitination that occurs in eukaryotic cells LMNA nonsense mutation (Y259X) which leads to absence of lamin A, the integral membrane proteins emerin and nesprin-1α are mislocalized to the ER and subsequently degraded by the proteasomal machinery A role for misexpression of lamin A in activating the ubiquitin-proteasome system is supported by the finding that in fibroblasts from a human patient with a homozygous In summary, our study shows for the first time that inappropriate assembly of lamin A/C leads to proteasomal degradation of specific heterochromatin proteins by activation of a distinct F-box protein. Thus ubiquitin-mediated proteasomal degradation of essential nuclear proteins may afford a distinct mechanism for the deleterious effects of disease-causing lamin mutants. Future studies should give insights into the precise mechanism of action of FBXW10, as well as the involvement of other components of the E3 ubiquitin ligase systems in these processes.Wild-type GFP-lamin A and lamin mutant constructs have been described earlier 5′ccgctcgagcgATGGAAAACCTGGAATCAAGGCTC3′; reverse: 5′CTCTTGGGCTGTGAACCTGAAT3′; (ii) middle fragment, forward: 5′CCTGTGGACTGCATACCAGAACGA3′; reverse: 5′GCTAGCATGCGGTTTGGTTT3′; (iii) 3′ fragment, forward: 5′CCCCAGCCCATGATTATCC3′; reverse: 5′cgggatcccgTCCCAAGGCTGGTTTAGAT3′.(i) 5′ fragment, forward: 2. Plasmid constructs were transiently transfected into HeLa cells for 24 h using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Stably transfected cells expressing wild-type, G232E or R386K GFP-lamin constructs were obtained by blasticidin selection of HeLa cells transfected with pEGFP lamin plasmids in which the neomycin resistance cassette was replaced by a blasticidin resistance cassette. A similar strategy was used for isolating cells stably transfected with pEGFP control vector. Alternately, cells transiently expressing wild-type or mutant GFP-lamin A were enriched by sorting for GFP expression on a Moflo cell sorter at 488 nm excitation wavelength (which enriched transfected cells to ∼99%) for western blot analysis, as the above strategy was not successful for obtaining cells stably expressing Q294P. For treatment with proteasomal inhibitors, cells were incubated with 6 µM MG132 or 10 µM lactacystin for 18 h, starting at 6 h after transient transfection of plasmids. For protein half-life studies, cells were treated with 100 µg/ml cycloheximide for 0–28 h. Nuclear extractions of cell monolayers were carried out by a mild extraction protocol using Triton X-100 as described by De Conto et al.et al.HeLa cells were routinely grown in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere containing 5% COPolyclonal antibodies to lamin A/C or the C-terminus of pre-lamin A and a mouse mAb to tubulin were obtained from Santa Cruz Biotechnology. Polyclonal antibodies or mouse mAbs to HP1α, β and γ were obtained from Upstate or Chemicon. Polyclonal antibodies to H4K20me3 and H3K9me3 were from Abcam and Upstate respectively. Mouse mAbs to emerin (clone 4G5) and ubiquitin were from Novocastra Laboratories and Calbiochem respectively. For western blot analysis, samples were lysed in Laemmli's sample buffer, boiled and electrophoresed through SDS-10% polyacrylamide gels. Gels were electroblotted onto PVDF membrane filters and blocked overnight in 5% BLOTTO in Tris-buffered saline containing 0.1% Tween-20. Filters were incubated with primary antibody for 2 h, followed by peroxidase conjugated-secondary antibody in Tris-buffered saline containing 0.1% Tween-20 for 1 h. Bound antibody was visualized using a chemiluminescence kit from Roche Applied Science. For immunoprecipitation assays, cells were lysed in cold RIPA buffer containing 20 mM Tris.HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM PMSF, 20 mM NaF, 1 mM sodium vanadate and protease inhibitors. The precleared samples were immunoprecipitated with primary antibody followed by protein A-Sepharose beads and the bound proteins were analyzed by western blotting.Transfected HeLa cells were washed with PBS and then fixed with 4% formaldehyde in phosphate-buffered saline (PBS) for 10 min followed by treatment with 0.5% (vol/vol) Triton X-100 for 6 min at room temperature. Cells were then incubated with 0.5% gelatin in PBS for 1 h followed by incubation with primary antibody for 1 h and then Cy3- or FITC-conjugated secondary antibody for 1 h at room temperature. Samples were mounted in Vectashield (Vector Laboratories) containing 1 µg/ml DAPI. Fluorescence microscopy of fixed cells was performed on an LSM510 META or LSM510 META/NLO confocal microscope. DAPI staining was routinely viewed in the transmission mode. Images were analyzed with LSM 510 META software and assembled using Adobe Photoshop.−ΔΔCt method was used for quantitation with HPRT1 (hypoxanthine phosphoribosyl transferase 1) as endogenous control. The analysis for each gene was done in triplicate and three independent biological replicates were performed. Gene expression in transfected cells was expressed as fold change in comparison with untransfected HeLa cells. The gene specific primers used for the analysis are given in Total RNA was extracted from stably transfected HeLa cells and 1 µg of RNA was reverse transcribed using Superscript II reverse transcriptase kit (Invitrogen) as per the manufacturer's instructions. Amplification of PCR products was quantitated using SyBR green dye (ABI), and fluorescence was monitored on an ABI prism 7900HT sequence detection system. Melting curve analysis was done for each amplicon. The 2Table S1List of primers used for real-time PCR analysis.(0.05 MB DOC)Click here for additional data file.

Dermatological remedies make up at least one-third of the traditional pharmacopoeia in southern Italy. The identification of folk remedies for the skin is important both for the preservation of traditional medical knowledge and in the search for novel antimicrobial agents in the treatment of skin and soft tissue infection (SSTI). Our goal is to document traditional remedies from botanical, animal, mineral and industrial sources for the topical treatment of skin ailments. In addition to SSTI remedies for humans, we also discuss certain ethnoveterinary applications.Field research was conducted in ten communities in the Vulture-Alto Bradano area of the Basilicata province, southern Italy. We randomly sampled 112 interviewees, stratified by age and gender. After obtaining prior informed consent, we collected data through semi-structured interviews, participant-observation, and small focus groups techniques. Voucher specimens of all cited botanic species were deposited at FTG and HLUC herbaria located in the US and Italy.We report the preparation and topical application of 116 remedies derived from 38 plant species. Remedies are used to treat laceration, burn wound, wart, inflammation, rash, dental abscess, furuncle, dermatitis, and other conditions. The pharmacopoeia also includes 49 animal remedies derived from sources such as pigs, slugs, and humans. Ethnoveterinary medicine, which incorporates both animal and plant derived remedies, is addressed. We also examine the recent decline in knowledge regarding the dermatological pharmacopoeia.The traditional dermatological pharmacopoeia of Vulture-Alto Bradano is based on a dynamic folk medical construct of natural and spiritual illness and healing. Remedies are used to treat more than 45 skin and soft tissue conditions of both humans and animals. Of the total 165 remedies reported, 110 have never before been published in the mainland southern Italian ethnomedical literature. The folk-medical treatment of dermatological conditions is prevalent in southern Italy and elsewhere. Dermatological conditions are particularly common in rural agro-pastoral communities, where skin abrasions and small cuts are regularly exposed to bacteria found in the soil and animal faeces. At least one-third of all traditional remedies used in the south Italian folk pharmacopoeia are directly relevant to the skin.Staphylococcus aureus (MRSA), are an ever-increasing source of death and high healthcare costs worldwide. In the US alone, over 126,000 hospitalizations each year are due MRSA infections [Skin and soft tissue infection (SSTI) caused by multidrug-resistant bacteria, such as methicillin-resistant Ten communities in the Vulture-Alto Bradano area of the Basilicata province were the focus of this study. Basilicata, a region of southern Italy bordering the Tyrrhenian and Ionian Seas, is divided into two Provinces: Potenza and Matera. It is bounded by the regions of Puglia (north and east), Calabria (south), and Campania (west). The territory is roughly divided into a mountainous western section, which is dominated by the Appennino Lucano, an eastern section of wide valleys and low hills, and flat plains to the south along the Ionian Sea.2, and based on a 2001 census of The Italian National Statistical Institute (ISTAT), Basilicata has a population of about 600,000. ISTAT also reports that the Basilicata region has the lowest percentage of urban population , the highest life expectancy , and presents the lowest utilization of allopathic medical services in all of Italy [Basilicata region covers 9,992 kmBasilicata has been influenced by historical immigration flux from both Greece and Albania. Today, immigrants come mainly from Eastern Europe or from Northern Africa. The majority of recent immigrants into the smaller communities, such as those included in this study, come from Eastern Europe seeking work as housekeepers and caretakers for the elderly, whereas North Africans typically seek employment in the larger cities.aglianico variety of grapes are the predominant crops. Small-scale pastoral activity is also important, and goat and sheep cheeses are produced locally. Regional industry, other than agriculture, is scarce, but some local artisans produce ceramics and a substantial portion of the population between 20–45 years old are currently employed in the Fiat automobile factory or other associated factories.The Vulture-Alto Bradano area of northern Basilicata is characterized by its proximity to the dormant volcano, Monte Vulture . The soil of this region is particularly rich due to the presence of tuffaceous-clayey-volcanic soil and the local economy is founded in large part on agriculture. Durum wheat, olives, and the Based on data from historic ethnic Albanian communities in the Vulture-Alto Bradano, traditional knowledge (TK) related to household remedies corresponds with age and gender. The likelihood of TK transmission is affected by work patterns, which influences the amount of time an individual spends in the natural environment performing agricultural work. Women are the primary carriers of knowledge for folk remedies, as well as the primary providers of household medicine. Older generations are more knowledgeable of plant sources of both wild foods and medicines -8. FurthIn the past 50 years, only a few ethnobotanical studies have been focused on Basilicata -14. The Field research was conducted in ten communities situated in the Vulture-Alto Bradano area of Basilicata, Italy from April-July of 2006 Figure . Random Università degli Studi della Basilicata (HLUC) in Potenza, Italy and Fairchild Tropical Botanic Gardens (FTG) in Miami, FL, USA. Bulk samples (100–300 g per species) were collected for bioassays. Plant materials were shipped to the USA under USDA permit #DP63438.All plants mentioned by interviewees were collected and identified following the standard work of the Italian flora . FamiliaThe transcription of vernacular names of traditional remedies described in the local pharmacopoeia follows the rules of the Italian language. The neutral centralized vowel 'schwa' of the southern Italian dialect spoken in the studied area, often marked by some linguists as (') has been denoted in this study with the symbol "ē". The collected data have been compared with all of the ethnobotanical studies conducted thus far in mainland southern Italy, including Abruzzo, Molise, Campania, Puglia, Calabria and Basilicata.Statistical analyses of data, including calculation of mean values and standard deviations, were calculated using Microsoft Excel. Differences between means were analyzed with a one way ANOVA, followed by a series of 2-sample t-tests on SPLUS software. Differences were considered significant with P-values < 0.05.Skin and soft tissue infections (SSTIs) are treated in different manners, depending on the perceived causation of the illness. Illnesses with a naturalistic causation are treated in a non-ritual context and involve the topical application of either a plant, animal, mineral, or industrial product as the therapeutic agent. This is usually carried out by the individual being treated or by the female head of household (mother or grandmother).mal vjntē (wind illness) or fuoco morto (dead fire illness). These cases are treated ritualistically, and a plant, animal, mineral, or industrial product is employed strictly as a ritual object in the ceremony, rather than as the therapeutic agent. Furthermore, the ritual treatment can be performed only by specific healers (most of whom are women) who are recognized in the community for their healing powers. The treatments for south Italian spiritual illnesses in Basilicata have been discussed in previous publications [Illnesses of perceived spiritualistic causation are treated much differently. Some manifestations of inflammation on the skin, for example, are believed to be caused by malevolent spirits, such as ications -21.We documented the topical application of 38 plant species from 27 families, comprising 116 distinct remedies , toothache, anti-inflammatory, anti-sting/anti-itch (for insect bites), antiseptic (for lacerations), anti-furuncle, haemostatic, suppurative, emollient, and anti-abscess. Roughly 14% of plant-based remedies are applied for the treatment of abscess and furuncle Figure . Here weLa malva, da ogni mal' ti salva, . Common mallow is most often cited for its restorative properties for cold, flu, and stomach-ache and as a post-partum depurative [Common mallow is a herbaceous species common throughout most of Europe, except in the most northern regions. It is one of the most important medicinal species in the southern Italian folk pharmacopoeia. Its use as a panacea is reinforced by a local saying, purative ,11. In tIt is also important in topical remedies for the treatment of toothache due to dental abscess or decay, heat- and diaper- rash, bruise, furuncle, abscess, and mastitis. The application of remedies from this plant to a number of SSTIs, most of which are typically associated with bacterial infection, suggests that this plant may exhibit antibacterial properties and should be subjected to further study.A maruggē, ognē malē struggē (the white horehound destroys every disease). In previous studies on south Italian ethnopharmacology, the use of white horehound decoctions as an expectorant, hepatoprotective agent, and cure-all has been described [White horehound is a perennial herb native to Europe, northern Africa, and temperate Asia. Much like common mallow, white horehound is also an extremely important species in the folk pharmacopoeia of southern Italy. It, too, is considered a panacea and is associated with the following saying, escribed ,7,11. Thescribed .A decoction of the aerial parts can be used as a rinse to treat several important SSTIs, including general dermatitis, athlete's foot, furuncle, abscess, cyst, and wart in both humans and animals. Investigation of the anti-MRSA potential of this species and its phytochemical components could be promising.in vitro anti-staphylococcal activity [in vivo [German chamomile is best known for its anxiolytic and sedative properties. In the Vulture-Alto Bradano, it is also commonly used as a wash for skin conditions such as rash, acne and dermatitis and also as an anti-conjunctivital eye-wash Figure . Applicaactivity and has [in vivo . The Ger[in vivo .The treatment of ailments with remedies made from animals and their products is known as zootherapy . Since aRemedies of mineral and industrial origin are also important, and include sources such as copper sulphate, salt, soot, and old gas, among others. They are employed in the treatment of burn wound, furuncle, facial wrinkle, abscess, broken bone, bruise, chapped skin, conjunctivitis, bronchitis, wart, acne, stomach ulcer, callus, cradle-cap, and dermatitis.Forty-nine remedies from 30 animal, mineral, or industrial sources are used in topical applications , has been briefly mentioned in previous work by our group [Therapies involving the slug ur group . The mosur group . This maHuman breast milk is a popular zootherapeutic remedy, and is applied in the treatment of conjunctivitis, chapped nipples, and cradle-cap. The topical application of breast milk to infected eyes was cited by nearly one-third of the interviewees. This remedy was also frequently cited during a previous field study by our group in the Lucanian Dolomite region of Basilicata . This usEthnoveterinary practices have been reported on in Italy in the regions of Basilicata , CalabriIn Vulture-Alto Bradano, the topical application of traditional remedies to treat wounds and inflammation in livestock was particularly important in the smallest communities surveyed, primarily in the localities of Montemarcone Alto, Sant'Andrea, and Pierno. Many families in these communities are economically dependent on agropastoral activities, and the health of their animals is a central concern Figure . Plant, verderammē) is a bright blue-green mineral sold locally as a chemical fungicide for plants sulphate is massaged into the legs of horses and asses to treat tendonitis. This remedy has also been described in Tuscan ethnoveterinary practices [H. perfoliatum, have been reported in Sicily for use as a disinfectant and to promote healing of burn wounds [Hypericum species are well known [An oleolite made from an olive oil infusion of the aerial parts of St. John's Wort . This lack of difference in TK for men may be explained by historic emigration patterns. A large portion of men from the oldest subsets sampled emigrated to northern Italy and Switzerland in their youth for work. Later in life, these men returned to the community of their birth, but the substantial number of years away from their native environment and traditions was detrimental to their level of TK. In addition, younger men, like the young women, did not acquire much TK due to dynamic of the local economy.Another pattern in TK levels related to the size of communities was notable. Younger men from the smaller communities , who were actively involved in agriculture – either in farming crops or pastoral activities, had much higher levels of TK for skin remedies than young men from larger, less isolated communities. For example, one young shepherd from the locality of Sant'Andrea was able to describe more than 40 remedies related to the skin. Young men who either worked in factory jobs or were unemployed from a larger community, like Ripacandida, could typically only cite 4 to 7 remedies. This reflects the importance of daily interaction with the environment and its role in the acquisition and retention of TK of plant derived remedies. A qualitative analysis of the data also reflects a greater level of TK retention and transmission between generations in the smallest communities.In summary, the likelihood of a continued decline in TK transmission across generations is great and will be most notable amongst women. Socioeconomic factors and shifts in the dynamics of women's roles in the home have perhaps the greatest influence on this paradigm. Stronger dependence on allopathic, rather than traditional medical care is expected in the coming years.We identified 165 remedies derived from plant, animal, mineral and industrial sources with particular relevance to skin and soft tissue infection. Of the remedies reported, 110 have never before been published in the mainland southern Italian ethnomedical literature. Moreover, some of the botanical sources for SSTI remedies have never been investigated for their antimicrobial properties and further investigation of the phytochemical constituents of these species is recommended.Transfer of knowledge regarding household medicine is declining, especially amongst women. These findings are important because women have traditionally been the keepers of knowledge regarding folk remedies and the providers of household medicine. This loss of knowledge is intrinsically linked with shifting socioeconomic dynamics in the area and is not expected to be reversed. This reinforces the importance of recording ethnomedical and ethnobiological data now before it is lost with the passing of the oldest generations.The author(s) declare that they have no competing interests.CQ carried out the field research, analyzed the data and wrote the manuscript. BB and AP participated in the design of the study, taxonomic identification of botanic species, and helped to revise the manuscript. All authors read and approved the final manuscript.Popular uses of botanical materials for dermatological conditions and topical applications.Click here for filePopular uses of animal, mineral, or industrial materials for dermatological conditions and topical applications.Click here for file

Aqueous humor is intimately related to the cells of the anterior and posterior chambers, which affect its composition. Aqueous analysis provides useful information regarding physiological and pathophysiological processes in the eye. Human aqueous samples are typically less than 100 µl, limiting the usefulness of the analysis with traditional Enzyme-Linked immunoSorbant Assay (ELISA) techniques. The specific aim of this study was to investigate if whether large numbers of analytes can be identified in clinically available samples of aqueous humor and to document the detectability of certain biomarkers in the aqueous.We used a technology developed by Luminex xMAP to analyze hundreds of analytes in a small sample. Aqueous from eight normal and two diabetic patients was analyzed.Of the 90 analytes evaluated, 52 (57%) were detectable in the normal aqueous. To place these results in biological context, we analyzed the list of expressed analytes using the MetaCore database. The functional pathways, networks, biological processes, and disease processes that these analytes represented were identified. Several ocular pathology-related processes were represented in the aqueous. The detected analytes represented biomarkers of several relevant disease processes including vascular diseases, arteriosclerosis, ischemia, necrosis, and inflammation. To provide the proof of principle that the aqueous profile could offer useful information about the pathophysiological processes, we analyzed two aqueous samples from diabetic patients. These limited samples showed the differences between normal and diabetic samples, including those relevant to diabetic retinopathy such as vascular endothelial growth factor (VEGF), C reactive protein, glutathione, and cytokines. Several biomarker groups for disease processes relevant to diabetes were perturbed.These results demonstrate that multiplex analysis of the aqueous can be a useful tool in screening for any pathophysiological changes of the ocular environment. Moreover, ocular pathology/pathophysiology-specific Multi-analyte profiles MAPs can be developed and used to analyze the aqueous. Aqueous humor, a product of the ciliary process, occupies the anterior and posterior chambers of the eye. It supplies nutrients to the nonvascularized cornea, lens, and trabecular meshwork. It is drained through two major pathways, the iridocorneal and the uveoscleral outflows I mean the constitution of aqueous humor affects the functioning of cells, and also the functioning of cells affects the aqueous composition. In addition, functional barriers between the anterior and posterior segments are not strict. The composition of the aqueous is also likely to be affected by the physiology/pathophysiology of the retina. Consequently, several growth factors have been detected in the aqueous humor, and the composition of these proteins changes dramatically in different ocular conditions, especially in inflammation and glaucoma ,2.Evaluation of the aqueous composition can be a powerful tool in understanding the pathophysiology and treatment response to many ocular conditions. Assessment of cytokines in uveitis patients revealed the presence of Interleukin (IL)-2, 6, 10, 12, Interferon (IFN)-γ, tumor growth factor (TGF)-β2, tumor necrosis factor (TNF)-α, and macrophage migration inhibitory factor. One major limitation of testing the aqueous is that only small sample volumes can be obtained from human eyes. Typically 50-150 µl of aqueous can be obtained from one human eyes, which is barely sufficient to test a few cytokines using traditional ELISA techniques including sequential ELISA. Alternatively, the samples can be pooled, but this can mask individual patient differences. However, with the introduction of flow cytometric bead-based technology, multiple cytokine analytes can now be quantified simultaneously and rapidly in individual samples. This technique has better reproducibility and sensitivity than the traditional ELISA . The cytThe aim of this study was to investigate whether large numbers of analytes can be identified in clinically available aqueous samples. Large numbers of analytes are needed to perform global analysis for identifying maps, networks, pathways, and disease processes. Such an analysis would be useful to compare ocular environment in different conditions. Another aim of this study was to document the detectability of certain biomarkers in the aqueous.Aqueous samples were collected from eight non-diabetic and 2 diabetic patients undergoing cataract surgery. Aqueous humor (80–100 µl) was withdrawn through a limbal paracentesis site using a 27 gauge needle in a tuberculin syringe. Care was taken to avoid touching intraocular tissues and to prevent contamination of aqueous samples with blood. The samples were immediately frozen and stored at −80 °C. Patients with other ocular or systemic diseases such as inflammatory diseases were excluded from the study. Informed consent was obtained from the patients, and the research was in compliance with the tenets of the University of Florida and the Declaration of Helsinki for experiments involving human tissue.Multiplex analysis was performed at Rules-Based Medicine , which uses Multi-Analyte Profiles (MAPs) based on powerful Luminex xMAP® technology to discover biomarker patterns within very small sample volumes. The aqueous samples were thawed at room temperature, vortexed, and then spun at 13,000x g for 5 min to remove any precipitates. Maximum available volume (80–100 µl) was removed and placed into a master microtiter plate for MAP antigen analysis. Using automated pipetting, an aliquot of each sample was introduced into one of the capture microsphere multiplexes of the human antigen MAP. The sample and capture microspheres were thoroughly mixed and incubated at room temperature for 1 h. Multiplexed cocktails of biotinylated reporter antibodies for each multiplex were then added robotically and thoroughly mixed. After this, the mixture was incubated for an additional hour at room temperature. Multiplexes were developed using an excess of streptavidin-phycoerythrin solution, which was thoroughly mixed into each multiplex and incubated for 1 h at room temperature. The volume of each multiplexed reaction was reduced by vacuum filtration, and the volume increased by dilution into a matrix buffer for analysis. Analysis was performed in a Luminex 100 instrument , and the resulting data stream was interpreted using proprietary data analysis software . For each multiplex, calibrators and controls were both included on each microtiter plate. Eight-point calibrators were run in the first and last column of each plate, and three-level controls were included in duplicate. Testing results were first determined for the high, medium, and low controls of each multiplex to ensure proper assay performance. Unknown values for each of the analytes that localized in a specific multiplex were determined using weighted and non-weighted curve fitting algorithms included in the data analysis package.The value for each analyte was obtained as a concentration . The values of eight samples were averaged and compared to the sensitivity of the system. An analyte was considered “detectable” if the levels exceeded the minimal detectable levels.The detectable analytes were further analyzed to identify biological/disease processes and the involved pathways/networks they participated in by using MetaCore™ analysis software . The manually annotated database includes over 160,000 human protein interactions and metabolic reactions. The whole data set of 52 detectable analytes was imported in MetaCore to build an analysis of functional ontologies including GeneGo process, GeneGo disease process, canonical pathway maps, and networks. Calculation of statistical significance throughout MetaCore for maps, networks, and processes are based on p value, which are calculated based on hypergeometric distribution. P values essentially represent the probability of particular mapping arising by chance given the numbers of genes in the set of all genes on maps/networks/processes, genes on a particular map/network/process, and genes in the experiment [The experimental data were input to build networks. The three different scoring functions used to rank the small subnetworks created by the network building algorithms were zScore, gScore, and p value. The zScore ranks the subnetworks with regards to their saturation with genes from the experiment. A high zScore means the network is highly saturated with genes from the experiment. In other words, it means that relatively larger number of genes/analytes in a particular network were present in the aqueous sample. Each network is comprised of canonical pathways. The gScore modifies the zScore based on the number of canonical pathways used to build the network. If a network has a high gScore, it is saturated with expressed genes (from the zScore), and it contains many canonical pathways.A total of 90 predetermined analytes were analyzed. All 90 analytes could be analyzed in at least one sample from normal patients. In normal samples, 57% (52 out of 90) of the analytes were detectable (above the sensitivity of the method), and 42% of analytes (38 out of 90) were undetectable either because their values were below the sensitivity of the method or their quantities were insufficient to assign a value . A list of detectable proteins is provided in SwissProt IDs) for the analytes in The detected analytes were evaluated by MetaCore software to identify possible relations among proteins. The accession numbers algorithm, which is a variant of the shortest paths algorithm, with main parameters of (1) relative enrichment with the uploaded data and (2) relative saturation of networks with canonical pathways. Subnetworks are ranked by a p value and gScore and interpreted in terms of Gene Ontology. All 52 proteins identified were present in the MetaCore database on networks .The content of about 110 cellular and molecular processes is defined and annotated by GeneGo. Each process represents a preset network of protein interactions characteristic to the process. Of the 52 proteins identified, 41 were present in the MetaCore database on GeneGo processes. The top 10 processes represented in the normal aqueous samples are given in There are over 500 human diseases with gene content annotated by GeneGo and organized in disease folders, which are further organized into a hierarchical tree. Certain factors may affect p value prioritization for diseases. For example, the gene content may vary greatly between complex diseases (such as cancers and some Mendelian diseases), and also, the coverage of different diseases in the literature may be skewed. Of the 52 proteins identified, 50 were present in the MetaCore database on diseases. The diseases whose biomarkers were detectable in the aqueous are relevant conditions of the retina including vascular (together with vascular occlusive and cardiovascular diseases), arteriosclerosis, ischemia, necrosis, and inflammation. A list of top 10 disease processes represented is given in To provide the proof of principle that functional analysis of the aqueous using multiplex technology could provide useful information and identify differences between normal and disease conditions, we also performed the analysis on two diabetic samples. Out of 90 analytes, 44 (49%) were detected and 33 were not detected (36%). Quantity was not sufficient to analyze 13 analytes.The comparison identified significant differences between the two groups with several analytes showing upregulation and downregulation. Analytes that showed twofold or more changes are shown in MAPs are a fully developed and validated technique ,7. Rule Multiplex analysis has been performed on aqueous samples in the past but with smaller numbers of analytes ,10. Our The MAP that we used was not specifically designed for ocular conditions. However, a specifically designed MAP for investigating ocular disease processes such as response of treatment can provide valuable and relevant information. It can also provide a method for subclassifying/staging diseases based on the pathophysiological processes.TM or any other similar program is that the output is not specific for ocular diseases. Output of our results included disease processes such as myocardial infarction and cardiovascular diseases. It is because the program outputs any disease processes where the input analytes participate. Therefore, these results should be interpreted in the context of ocular physiology. At a molecular level, aqueous analysis could identify the canonical pathways and the associated gene networks. The MAP used in this study did not include analytes uniformly across all the cellular/disease processes. Therefore, the data cannot be taken as a representation of these processes in physiological/pathological conditions. Nevertheless, our results demonstrate that the functional processes can be studied using this technology. Moreover, application of specific MAPs can be created to suit specific needs.We further analyzed the detected analytes to demonstrate the usefulness of global analysis in identifying cellular, biological, and disease processes to obtain an overall view of ocular physiology. Analytes represented a large number of pathways, albeit only a small number of proteins represented many of these. It should be noted that the MAP we used in this study did not represent all the cellular processes uniformly. Therefore, our data does not indicate if any cellular process is more prevalent in aqueous than another. We also did not make any attempt to compare the extent of any cellular process represented in the MAP with that expressed in the aqueous. The results demonstrate that aqueous analysis can provide useful information about cellular and disease processes. One of the limitations of using MetacoreAnother potential use of such an analysis could be comparing two samples for a global view of changes in the functional processes associated with the ocular environment. Such information may be useful in understanding the pathobiology of a disease, assessing progression of a disease, or response to a treatment. The analysis of diabetic samples provided proof of principle for this hypothesis. The aqueous from diabetic patients showed differences in expected and relevant cellular as well as disease processes. Some processes relevant to diabetic retinopathy were found upregulated in diabetic aqueous samples including CD40, C reactive protein, erythropoietin, fatty acid binding protein, FGF basic, fibrinogen, IL-1ra, IL-8, leptin, macrophage-derived chemokine (MDC), MMP-2, and VEGF ,18. Equa

The pancreas is a well-documented but relatively uncommon site of non-small-cell cancer metastases. However, at the time of diagnosis the disease is usually locoregionally advanced, therefore therapeutic management is mostly palliative and symptomatic.We report the case of a 77-year-old Caucasian male patient who presented initially with a clinical picture of acute cholangitis approximately 2 years after a left lower lobectomy for a low-grade squamous lung carcinoma. CT scan imaging of the abdomen and chest revealed an abnormal growth of the pancreatic head and distention of both the intra- and extra-hepatic billiary tree, whereas osteolytic abnormalities were observed of the 5th left rib, consistent with secondary deposits. Initially an endoscopic retrograde cholangio-pancreatography (ERCP) and sphincterectomy was performed and a plastic stent was placed in the common bile duct to decompress the biliary tree. Cytological examination of the aspirate collected by FNA of the pancreatic lession under EUS guidance revealed cells consistent with a low grade squamous lung carcinoma. Two months later an open cholecystectomy along with a gastrojejunostomy was performed to relieve the patient's gastric outlet obstruction symptoms. Following remission of the patient's attack of acute cholangitis and excessive vomiting he was released from the hospital and instructed to initiate chemotherapy with vinorelbine. The patient succumbed to disseminated disease almost 5 months later.Symptomatic metastatic lesions of the pancreas from squamous cell carcinoma of the lung are infrequent. Typically, the patients remain asymptomatic until their disease reaches a fairly advanced stage and therapeutic options are limited to palliative measures. A high index of suspicion is the only way of early detection and potentially effective treatment for this rare localization of metastatic squamous lung carcinoma. A variety of malignant tumors have been documented to metastasize to the pancreas. The most common primary site for pancreatic metastases is the lung 18-27%) [8-27% 1,. These cIn this report, we present the case of 77-year-old patient with non-small-cell lung carcinoma who presented with a metachronous solitary pancreatic metastases that became clinically evident with recurring episodes of cholangitis and obstructive jaundice, as well as symptoms of gastric outlet obstruction.A 77-year-old Caucasian male patient, with a history of triscupid deficiency, coronary heart disease, arterial hypertension and a permanent pacemaker placement due to bradyarrythmia was diagnosed with a solitary lesion of the lower lobe of the left lung on September 2006, an incidental finding in a routine chest x-ray. This finding was confirmed by a chest CT, which in turn revealed a 2.5 × 2 cm solitary lesion on the lower lobe of the left lung. At that time, no evidence of metastatic disease was demonstrated from the patient's additional radiologic examination. Subsequently, he underwent a lower lobectomy of the left lung with an uneventful recovery.Pathological examination confirmed a low-grade squamous carcinoma of the lung, with peripheral spots of adenocarcinoma with clear surgical margins and negative lymph nodes. Postoperatively the patient received a regime of adjuvant chemotherapy consisting of 4 cycles of Paclitaxel (Taxol) and Carboplatin.th left rib, consistent with secondary deposits [Figure For the following 2 years the patient did well without any evidence of local or systemic recurrence. On November 2008 a routine follow-up chest CT revealed osteolytic abnormalities of the 5s Figure . A few ds Figure , 4. Two The patient had an uneventful recovery and remained in good clinical condition for the following three months. Progressively he developed symptoms of disseminated disease and finally died five months post-laparotomy.The pancreas is a relatively infrequent site of distant metastasis. Moreover, metastatic tumors to the pancreas rarely become clinically evident, although their incidence has been reported to be approximately 12% in autopsy reports of patients suffering from other malignancies .The most frequent sources of pancreatic malignant metastases originate from the lung, breast, kidney, gastrointestinal tract, thyroid, melanoma, and liver. Melanomas and osteosarcomas are also among the tumors that metastasize to the pancreas. The route of metastases is lymphatic (28%), vascular (27%), lymphatic - vascular 19%) and by direct invasion (18%) 9% and by. The mosPrimary lung cancer metastasizes to distant organs quite frequently. The most common sites of lung cancer metastases are the bones, liver and adrenal glands. The pancreas is a rather uncommon location of metastatic lung cancer. Evidence about it is based on scattered case reports in the literature that usually concern patients at an advanced stage of their disease, thus eligible only for palliative treatment. It is estimated that the incidence of secondary pancreatic deposits resulting from the various types of lung cancer range from 14.2% - 18. 2% . The majSymptoms caused by metastatic pancreatic lesions are variable and most patients are free of organ - specific complaints. Metastatic disease is usually incidentally detected on abdominal CT scan during the follow-up period. Those patients that do have clinical manifestations may present with abdominal or back pain, nausea, weight loss, jaundice, gastrointestinal haemorrhage or intestinal obstruction . MoreoveThe diagnosis is usually confirmed by percutaneous fine needle aspiration of the pancreatic lesion under CT guidance or endoscopic ultrasound (EUS) or by cytological examination of brushing specimens obtained during endoscopic retrograde cholangiopancreatography (ERCP)).Treatment options for metastatic lung cancer lesions to the pancreas are mainly of palliative intent. They can be either non-invasive or invasine - surgical. Non-invasive treatment options can be chemotherapy and/or common bile duct stenting, in order to relieve the patient from jaundice and its symptoms. When surgical treatment is contemplated this is usually limited to by-pass procedures in patients with obstructive jaundice. There have been a few reports of patients who underwent pancreatic resections for metastatic lung cancer lesions, but this was either in ignorance of or overseeing the fact that the aetiology of the obstruction was of metastatic origin ,12. TherNon-small cell lung cancer with distant metastases (stage IV) has a poor prognosis. Platinum-based chemotherapy regimens have been shown to improve survival and enhance quality of life, and they are also cost effective. This treatment is most appropriate for patients with a good performance status. EGFR inhibitors are used as second or third line therapy. They are most effective in women, in patients who have never smoked, or are diagnosed with adenocarcinoma. Studies of other novel agents and non-platinum-based regimens are ongoing. Median survival has been reported to improve from 3.6 to approximately 6.5 months after chemotherapy . WhetherFinally, the information above highlights the fact that a high index of suspicion should be raised for every patient with a previous history of cancer, who presents with a pancreatic mass. Therefore, before making any therapeutic decision, any correlation of the pancreatic mass with the patient's previous cancer history should be thoroughly examined.Symptomatic metastatic lesions of the pancreas from squamous cell carcinoma of the lung are extremely rare. Typically, the patients remain asymptomatic until their disease reaches a fairly advanced stage, and therapeutic options are then limited to palliative measures. FNA of the suspsicious lession is fundamental in order to achieve differential diagnosis from other primary pancreatic tumors. A high index of suspicion is the only way of early detection and potentially effective treatment for this rare localization of metastatic squamous lung carcinoma.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the journal's Editor-in-Chief.The authors declare that they have no competing interests.MAK: designed and drafted the manuscript. CS: participated in the acquisition of data and preparation of the manuscript. MK: responsible for critical revision of scientific content.TK: assisted in the preparation of the manuscript. CZ: assisted in the preparation of the manuscript. ET: performed histopathological, immunohistochemical and cytological analysis.PD: participated in the acquisition of data and preparation of the manuscript. INN: the surgeon, approved the final version of the manuscript for publication. All authors read and approved the final version of the manuscript.

Conjugate gradient method is verified to be efficient for nonlinear optimization problems of large-dimension data. In this paper, a penalized linear and nonlinear combined conjugate gradient method for the reconstruction of fluorescence molecular tomography (FMT) is presented. The algorithm combines the linear conjugate gradient method and the nonlinear conjugate gradient method together based on a restart strategy, in order to take advantage of the two kinds of conjugate gradient methods and compensate for the disadvantages. A quadratic penalty method is adopted to gain a nonnegative constraint and reduce the illposedness of the problem. Simulation studies show that the presented algorithm is accurate, stable, and fast. It has a better performance than the conventional conjugate gradient-based reconstruction algorithms. It offers an effective approach to reconstruct fluorochrome information for FMT. Light with wavelength in the near-infrared range canpropagate a few centimeters through the tissue because of low tissue absorptionin the spectral of “near-infrared window.” This finding has encouraged thedevelopment of fluorescence techniques to visualize specific biochemical eventsinside living subjects , 2. In rSeveral reconstruction approaches for FMT have beenproposed. Most of them are based on the diffusion model –10. The r is the positionvector belonging to the image region Ω. Φx,m(r) represents thephoton density at r for theexcitation light (subscript x) or thefluorescent emission light (subscript m). Dx,m(r) is defined asthe diffusion coefficientμax,m(r) and μsx,m(r) are theabsorption and scattering coefficients, respectively. g is theanisotropy parameter. The absorption of the excitation light due tofluorophores is described as μaf(r) and thefluorescent yield ημaf(r) is required forfluorescence parameter.When an external excitation light source works atcontinuous wave mode (CW mode), the following diffusion equation can beemployed to model the propagation of the excitation light and the fluorescentemission light –10:(1)x, an N × 1 vector, denotesthe real fluorescent source distribution to be reconstructed. I, a M × 1 vector, is theemission data computed from the measurement at the surface of the tissue. And W, a M × N matrix, is theweighting matrix generated from the forward model. Generally, the inverseproblem for FMT is to find the fluorescent source distribution x in the targettissue from the measured data I and theprecalculated matrix W. As mentioned before, the problem in is theregularization or penalty term chosen on various purposes. Then the N-CG methodcan be adopted to find the optimal solution of =x* in PLN-CGbegins with an initial guess x0, and takes a steepest descent first step. The sketchof the scheme is shown in The searching process for the optimal solution x*, that is, Ω2. Because L-CG has a better orientating ability, andneeds less computation, it can find Ω2 faster and moreaccurately, while it does not have to expose its fragility under noise.At first, the search is general and the effect ofnoise is low, so L-CG is employed to find the rough region of the optimalsolution WT is thetranspose of W. ThusW* = WTW, is an N × N symmetricmatrix. The reconstruction problem has become a standard linear one, as isrequired by L-CG.Transformation has to be made to to make x0, the solution can be updated iterativelybyαk is the stepsizerk is the gradientof each step. It is defined in L-CG as the residue of the linear system, whichis obtained iteratively bypk is thesearching direction andStarting from an initial guess xk enters theregion Ω2. The definition of the region Ω2 is determinedby a restarting parameter, which is described in the following section.The L-CG searching iteration process will cease when x0 at every restartingtime for the new iteration process.The restart strategy is a modification that is oftenused in nonlinear conjugate gradient procedures , 21. Therk represents thegradient of ϕ(xk). When |rk| satisfies is a penaltyterm which will be discussed in Now, problem is transαk, a line search method is used to identify anapproximate minimum of the nonlinear function ϕ(x) along thesearching direction pk [ϕ(x) in L-CG issimply the residue of the linear system that can be obtained iteratively. Whilefor N-CG, it must be replaced by the gradient of the nonlinear objective ϕ(x), that is, ∇ϕ(x).The N-CG method differs from L-CG mainly in two ways.Firstly, rather than using a standard iterative function to find the steplength tion pk , 17, 19.xk obtained fromL-CG as the initial guess x0 for N-CG, thesolution is updated iteratively:αk is the stepsize that is computed by a line search method,pk is thesearching direction andrk is the gradientof the objective function ϕ(x) at currentpoint, that is,Thus, using the It is known that a major problem of the conventionalgradient-based methods is that they are mainly designed for unconstrainedproblems, but the fluorescent source distribution in the biological tissue hasto be constrained to a nonnegative region , 22.Herxi is the ith element of x, u(x) is the unitstep function. During the searching procedure, when the searched result x at currentiteration has negative values, the penalty term will be increased. In this way,it will penalize x and force it togo back. γ is a penaltyweighting parameter, which will gradually become zero as the iteration numberincreases. Thus, the solution of the new unconstrained problem in γ = γ = γ fixSimulation studies above were based on two excitationsources, in order to demonstrate the qualities of the PLN-CG approach better.When the number of sources is increased, a larger dataset can be obtained. Itwill improve the information content of the measurements and reduce theillposedness of the inverse problem . Thus, iγ was simply setto 50 for all cases because the difference among the iteration numbers wassmall. It is shown that as the source number increases, the qualities of thereconstructed images are in progress. The reconstructed fluorochrome regionmarked with the small black circle is more even and closer to the originalvalue.In each experiment, sources were turned on in turn and32 detector readings were available for each source. Results with clean datawere obtained with a hundred iterations for about 2.99 seconds in the 4 sourcescase . While tAfter the experiments using clean data describedabove, white Gaussian noise with a constant variance was added to the detectorreadings. The noise level was 10%. It is shown that the reconstructed resultsbecome clearer and better when the sources number increases from 2 to 4 Fi and 8 F. HoweverThe goal of this work was to establish a fast andaccurate algorithm for FMT reconstruction, which is illposed. In order toachieve this goal, a penalized linear and nonlinear combined conjugate gradientalgorithm was developed. Simulation studies have indicated that this PLN-CGmethod can exhibit very favorable performance and produce relatively stablebehavior. Further studies show that, when using sixteen sources, the reconstructionalgorithm can work under 15% noise, which is sufficient for practical use. Thebetter performance is partly achieved by the combination of L-CG and N-CG. L-CGmakes the algorithm faster and more accurate. While at the same time, N-CGgives the whole algorithm a better capacity to deal with noise. It introducesthe penalty method to get a nonnegative constraint and reduce the uncertaintyof the problem. The restart strategy also improves the efficiency of thealgorithm by refreshing the algorithm periodically.Further improvement can be made for the PLN-CGalgorithm in future. Some kind of regularization techniques can be employed toregularize the results and smoothen the images . The pri

In addition, Israel is believed to be a nuclear power while Iran (and possibly Syria as well) is also suspected of developing nuclear weapons. Despite the technological sophistication that has enabled the 11 nuclear weapons states to produce and deliver nuclear bombs, most of these nations simultaneously also suffer from high internal rates of poverty and endemic neglected diseases. They include high prevalence rates of neglected tropical diseases in India, China, Pakistan, Iran, and Syria, and related neglected infections of poverty in the US and Europe. Indeed, the 11 nuclear weapons states together account for up to one-half of the global disease burden from all neglected diseases. However, for a tiny fraction , defined as chronic and debilitating parasitic and other infectious diseases that occur in association with extreme poverty The four major soil-transmitted helminth infections of humans include ascariasis (roundworm), trichuriasis (whipworm), hookworm infection, and strongyloidiasis (threadworm) India accounts for roughly one-quarter of the world's 120 million cases of lymphatic filariasis, a disfiguring and stigmatizing vector-borne infection associated with elephantiasis Leishmania donovani in Asia and the Middle East) is the most severe and is associated with profound pancytopenia, hepatosplenomegaly, and failure to thrive when it occurs in childhood. Annually, there are approximately 500,000 new cases of visceral leishmaniasis worldwide with more than one-half of these cases occurring in India alone L. infantum with dogs as the major animal reservior, and recognized as an opportunistic infection with patients with HIV/AIDS L. major or L. tropica. Cutaneous leishmaniasis is disfiguring and highly stigmatizing, especially for young women L. mexicana and possibly other species has emerged along the border with Mexico Leishmaniasis is a serious sandfly-transmitted neglected tropical disease endemic to the Asian and Middle Eastern nuclear states where it is associated with extreme poverty Almost one-half of the world's 60–80 million trachoma cases occur in nuclear weapons states, with China having the highest number of cases of any nation th of the estimated $10 trillion committed for nuclear weapons.Although the world's nuclear states have up to one-third of the world's cases of soil-transmitted helminth infections, more than one-half of the world's new cases of leishmaniasis and leprosy, and approximately one-half of the global disease burden of trachoma, they have chosen to devote their major resources to weapons production instead of neglected disease control While some may argue that the trillions of dollars spent on nuclear weapons may have served as a successful deterrent for an all-out US-Soviet, a Sino-Soviet, or an Indo-Pakistan conflict and was therefore an actual investment in peace, imagine a world in which the nuclear weapons states increased their neglected disease control budgets more than 10-fold thereby, reducing the global nuclear weapon–to–neglected disease gap to 1,000 to 1. Ten billion dollars devoted to neglected diseases would be sufficient to effect large-scale control or elimination for most of the high-prevalence neglected tropical diseases in the 56 nations where five or more of these conditions are endemic Scientific and technical cooperation between nuclear weapons states should also be enhanced in order to improve sanitation and water quality through collaborative ventures in engineering and urban planning, and to promote R&D for new drugs and vaccines to combat neglected tropical diseases

In the crystal structure, the anions and cations are connected by inter­molecular N—H⋯Cl and C—H⋯Cl hydrogen bonds, forming a three-dimensional network. The crystal structure is further stabilized by π–π inter­actions between pyridinium rings [centroid–centroid distance = 3.695 (1) Å].The asymmetric unit of the title compound, C Å b = 12.5175 (2) Å c = 11.6520 (2) Å β = 98.979 (1)°V = 1581.42 (5) Å3 Z = 8 Kα radiationMo −1 μ = 0.75 mmT = 100 K 0.34 × 0.32 × 0.13 mm Bruker APEX DUO CCD area-detector diffractometerSADABS; Bruker, 2009T min = 0.787, T max = 0.907Absorption correction: multi-scan (22610 measured reflections5736 independent reflectionsI > 2σ(I)4042 reflections with R int = 0.035 R[F 2 > 2σ(F 2)] = 0.045 wR(F 2) = 0.109 S = 1.03 5736 reflections253 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.44 e Å−3 Δρmin = −0.22 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536810003624/wn2374sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810003624/wn2374Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The detection of any abrupt change in the environment is important to survival. Since memory of preceding sensory conditions is necessary for detecting changes, such a change-detection system relates closely to the memory system. Here we used an auditory change-related N1 subcomponent (change-N1) of event-related brain potentials to investigate cortical mechanisms underlying change detection and echoic memory.Change-N1 was elicited by a simple paradigm with two tones, a standard followed by a deviant, while subjects watched a silent movie. The amplitude of change-N1 elicited by a fixed sound pressure deviance (70 dB vs. 75 dB) was negatively correlated with the logarithm of the interval between the standard sound and deviant sound , while positively correlated with the logarithm of the duration of the standard sound . The amplitude of change-N1 elicited by a deviance in sound pressure, sound frequency, and sound location was correlated with the logarithm of the magnitude of physical differences between the standard and deviant sounds.The present findings suggest that temporal representation of echoic memory is non-linear and Weber-Fechner law holds for the automatic cortical response to sound changes within a suprathreshold range. Since the present results show that the behavior of echoic memory can be understood through change-N1, change-N1 would be a useful tool to investigate memory systems. Immediate detection of an abrupt change in the environment is one of the most important functions of sensory systems. Actually, neural networks sensitive to sensory changes are known in humans ,2. If a Change-N1, which is elicited by a sudden change in a continuous tone and peaks approximately 100 ms after the onset of the change, has been also used to investigate higher auditory processes -15. The Change detection has long been studied in psychophysics using a sensory threshold. Weber first poIn this study, we investigated the relationship between cortical responses and the magnitude of differences in various stimulus parameters by using the change-N1 component in the auditory system that serves as an indicator of the brain's change-detection system. Change-N1 was also expected to provide clues about echoic memory that is auditory equivalent of sensory memory. Since change detection has been shown to be affected by the timing of the deviant stimulus during the standard-deviant sequence (i.e. status of the auditory memory trace), at first, we changed the interval between the standard and deviant stimuli to examine change detection and echoic memory decay through the change-N1 response (Experiment 1) and then, changed the duration of the standard stimulus to examine echoic memory storage (Experiment 2) using two tones of different sound pressure (70 vs 75 dB) under a simple even probability paradigm. In Experiment 3, we examined effects of the magnitude of the deviance using changes in repetitive brief tones.2 = 0.96) or power (r2 = 0.97) of the interval for averaged data . The peak latency of change-N1 increased with an increase in the interval with a logarithmic function for the averaged data (r2 = 0.99). However, for individual data, results of the curve fitting usually did not reach a significant level for either the logarithmic (r2 = 0.54 ± 0.25), power (0.54 ± 0.25), exponential (0.61 ± 0.35), or linear (0.59 ± 0.33) function.Effects of the interval between the standard sound and deviant sound on change-N1 were examined by varying the interval between two stimuli from 1 to 1000 ms. Results of each experiment are summarized in Fig. ata Fig. . In indi2 value was largest for the logarithmic function (0.95 ± 0.04) followed by the power (0.92 ± 0.07), exponential (0.84 ± 0.14), and linear (0.81 ± 0.12) functions. The peak latency tended to decrease with an increase in the duration in all the subjects. However as in Experiment 1, the curve fitting in individual subjects was sometimes difficult .We examined the effects of the duration of the standard sound. The results described above led us to expect that a longer standard sound would increase the memory storage for itself and consequently the deviant sound would evoke a larger change-N1. Results were as expected. The amplitude of change-N1 as a function of the duration of the standard sound showed a positively accelerated curve Figs. and 3. R2 = 0.94 ± 0.04 for sound pressure, 0.94 ± 0.04 for sound frequency, and 0.91 ± 0.1 for sound location) and worst by the linear function . The latency of change-N1 decreased with an increase in the magnitude of the deviance. The r2 value of the curve fitting was largest for the exponential and smallest for the linear functions. In all three experiments , there was a tendency for the amplitude to follow a logarithmic function and for latency to follow an exponential function.Given that several features of a sound can be stored in echoic memory or a lonThe present results suggest that change-N1 is a product of an automatic change-detection system that receives auditory information processed in earlier cortical areas and generates change-specific signals proportional to the magnitude of the deviance, at least under the present experimental conditions. Results of Experiment 3 showed that Weber-Fechner law holds for the automatic cortical response to auditory changes within a suprathreshold range. One weakness of Fechner's formulation is that there is no known relationship between the size of a JND and the rate of growth of subjective magnitude . The preThe results of Experiment 1, that a decay of echoic memory has a non-linear function in time, are consistent with psychological studies using a dichotic listening task showing that recall performance decreases with time in a typical negatively accelerated fashion ,43. Someet al. [et al. [The main component of auditory evoked potentials peaking at around 100 ms (N1 or N100) is known to have several subcomponents . The pret al. found noet al. ,57. As w [et al. found thAlong with the frequency deviance-elicited MMN , Schrögeet al. [It remains to be clarified whether the gradual change of the response obtained in this study is present in each trial for each subject, or observed due to the averaging across trials and/or due to the different thresholds for the change in different participants while the phenomenon actually responds in an all-or-none manner (see ). In theet al. showed iIt is suggested that MMN could be used to determine the degree of abnormality in auditory perception, attention, and memory, and in fact, previous studies have found an attenuated or delayed MMN in clinical disorders such as schizophrenia . We beliThe present findings suggest that temporal representation of echoic memory is non-linear and Weber-Fechner law holds for the automatic cortical response to sound changes within a suprathreshold range. Although whether this rule can be applied to other more complicated memory systems is unclear, these results might show one fundamental mechanism of memory. Since the behavior of echoic memory can be understood through change-N1, change-N1 would be a useful tool to investigate memory systems.The experiment was performed on seven healthy right-handed volunteers, aged 26-45 (31 ± 7) years. The study was approved in advance by the Ethics Committee of the National Institute for Physiological Sciences, Okazaki, Japan, and written consent was obtained from all the subjects.Creating an abruptly changing sound stimulus without distorting the sound waveform at the transition is difficult. In the present study, we used a train of brief tone pulses Fig. 5A5A. The tEvoked potentials were recorded in Experiments 1 ~ 3 for all of the seven subjects. An exploring electrode was placed at Fz referenced to the linked mastoids (P9-P10) of the 10-10 system, since the main component at around 100 ms shows a maximum amplitude at Fz (negativity), and a positive counterpart at P9 and P10 . The masThe experiments were conducted in a quiet, electrically shielded room. The subjects sat in a chair and watched a silent movie on a screen 1.5 m in front of them throughout the experiments. Fig. First, effects of the interval between the Standard and Deviant stimuli on change-N1 were examined. The Deviant stimulus was a 500-ms 800 Hz tone at 70 dB (standard sound) followed by a deviant sound of 100 ms at 75 dB. The interval between the standard and deviant sounds was either 1, 10, 100, or 1000 ms. The Standard stimulus was identical to the Deviant stimulus except that a 70 dB sound was used instead of the deviant 75 dB sound Fig. . The twoSecond, effects of the duration of the standard sound were examined. The Deviant stimulus consisted of two sounds. The first sound (standard) was an 800 Hz tone at 70 dB with a duration of 25, 100, 500, or 1000 ms, and the second sound was a 100-ms 800 Hz tone at 75 dB. There was no blank between the two sounds. The Standard stimulus was similar to the Deviant stimulus but with a 70 dB sound for the second sound. The two stimuli were presented at an even probability but randomly with an inter-trial interval of 300 ms. The order of the four sessions (four different durations) was randomized among subjects.Third, effects of the magnitude of the physical difference between the standard and deviant sounds were examined for sound frequency, sound pressure, and sound location. In all three experiments, the Deviant stimulus was a 250-ms 800 Hz tone at 70 dB (standard sound) followed without a blank by a 250-ms deviant sound. The Standard stimulus was a 500-ms 800 Hz sound at 70 dB. For the experiment on frequency change, the deviant sound was 808, 816, 824, 840, or 880 Hz. The deviant sound for the experiment on sound pressure change was 72, 73, 74, 75, or 76 dB. The deviant sound for the experiment on sound location change was created by inserting a blank of 0.1, 0.2, 0.3, 0.4, or 0.5 ms into the sound for one ear, that is, an interaural time delay (ITD) of 0.1 ~ 0.5 ms. All the subjects reported that the sound abruptly moved to the left (or right) on hearing the Deviant stimulus with an ITD of 0.5 ms. The blank was inserted into the left sound for three subjects and into the right sound for four. To confirm that the effect of the ITD on change-N1 is actually due to the phase shift between both ears, we additionally tested an insertion of 1.25 ms silence into the left sound (insertion of a longer silent period but without an ITD) in three subjects. However, this deviant sound did not evoke change-N1 at all in two subjects and evoked a small change-N1 at a longer latency (215 ms) than those for the other five ITD sounds (100 ~ 130 ms) in one subject, which was probably due to gap detection.The two stimuli (Standard and Deviant) were presented at an even probability randomly with an inter-trial interval of 300 ms. The order of the five sessions (five different Deviant stimuli) was randomized among subjects.In all the experiments, the amplitude of change-N1 was measured and compared among conditions. The amplitude of change-N1 was determined as the amplitude between the peak of change-N1 and the nearest positive peak at an earlier latency. This procedure minimizes problems due to a baseline shift. Although we considered that the amplitude and latency of N100 and P150 evoked by sound changes basically behave similarly under the experimental conditions in the present study, P150 tended to jitter more than N100 in latency. Therefore, we used N100 in this study.1x + b1), logarithmic (y = a2ln (x - b2)), power (y = xa3), and exponential (y = a4 +b3exp (-x/t)) functions. However, statistical analyses among models were not done because there were only four or five plots in each experiment.In each experiment, the behavior of the amplitude and latency of change-N1 against variables of each subject were fitted with linear (y = aITD: interaural time delay; MMN: mismatch negativity.KI contributed to planning the study, data collection and analysis, and drafting the paper. TU, KY, NO, and MN contributed to data collection and analysis. YT contributed to constructing devices. SK contributed to revising the paper. RK contributed to drafting the paper. All authors read and approved the final manuscript.

A yeast-based small molecule screen identifies a novel activator of human HSF1 and protein chaperone expression and which appears to alleviate the toxicity of protein misfolding diseases. Neurodegenerative diseases such as Huntington disease are devastating disorders with no therapeutic approaches to ameliorate the underlying protein misfolding defect inherent to poly-glutamine (polyQ) proteins. Given the mounting evidence that elevated levels of protein chaperones suppress polyQ protein misfolding, the master regulator of protein chaperone gene transcription, HSF1, is an attractive target for small molecule intervention. We describe a humanized yeast-based high-throughput screen to identify small molecule activators of human HSF1. This screen is insensitive to previously characterized activators of the heat shock response that have undesirable proteotoxic activity or that inhibit Hsp90, the central chaperone for cellular signaling and proliferation. A molecule identified in this screen, HSF1A, is structurally distinct from other characterized small molecule human HSF1 activators, activates HSF1 in mammalian and fly cells, elevates protein chaperone expression, ameliorates protein misfolding and cell death in polyQ-expressing neuronal precursor cells and protects against cytotoxicity in a fly model of polyQ-mediated neurodegeneration. In addition, we show that HSF1A interacts with components of the TRiC/CCT complex, suggesting a potentially novel regulatory role for this complex in modulating HSF1 activity. These studies describe a novel approach for the identification of new classes of pharmacological interventions for protein misfolding that underlies devastating neurodegenerative disease. The misfolding of proteins into a toxic state contributes to a variety of neurodegenerative diseases such as Huntington, Alzheimer, and Parkinson disease. Although no known cure exists for these afflictions, many studies have shown that increasing the levels of protein chaperones, proteins that assist in the correct folding of other proteins, can suppress the neurotoxicity of the misfolded proteins. As such, increasing the cellular concentration of protein chaperones might serve as a powerful therapeutic approach in treating protein misfolding diseases. Because the levels of protein chaperones in the cell are primarily controlled by the heat shock transcription factor 1 [HSF1], we have designed and implemented a pharmacological screen to identify small molecules that can promote human HSF1 activation and increase the expression of protein chaperones. Through these studies, we have identified HSF1A, a molecule capable of activating human HSF1, increasing the levels of protein chaperones and alleviating the toxicity of misfolded proteins in both cell culture as well as fruit fly models of neurodegenerative disease. Neuronal tissues are exquisitely sensitive to defective protein folding, and the accumulation of misfolded proteins is proteotoxic due to dominant effects of insolubility, inappropriate intermolecular interactions, and long half-lives. Protein misfolding is associated with neurodegenerative diseases that include Parkinson disease, amyotropic lateral sclerosis (ALS), transmissible spongiform encephalopathies (prion diseases), and other devastating diseases A variety of individual protein chaperones and cochaperone complexes function to fold, process, and degrade proteins, thereby playing a central role in cellular protein homeostasis cis-acting promoter sequences called heat shock elements (HSEs) trans-activation Drosophila and mammalian HSF1 can be converted from a monomer to a homotrimer in vitro in response to thermal or oxidative stress In eukaryotic cells, multiple genes encoding protein chaperones are coordinately transcriptionally activated in response to proteotoxic conditions, such as acute increases in temperature, by the heat shock transcription factor 1 (HSF1) protein and trans-activation were shown to promote yeast prion formation, implying a potential role for HSF target gene products in the prevention of prion generation or propagation −/−hsf1 mice inoculated with Rocky Mountain Laboratory prions exhibited a shorter lifespan as compared to wild-type mice Previous reports demonstrate that the conversion of HSF1 to the high-affinity DNA binding homotrimer is not robust in neuronal cells Saccharomyces cerevisiae. This screen, insensitive to established proteotoxic agents and Hsp90 inhibitors, identifies novel small molecules that activate HSF1 in the amelioration of neurodegenerative phenotypes in metazoan models of polyQ-based disease.Previous screens utilizing an HSF1-dependent reporter gene as a readout for HSF1 activation in mammalian cells have identified activators of HSF1 S. cerevisiae cells lacking endogenous HSF We previously demonstrated that expression of human HSF1 is unable to suppress the viability defect of S. cerevisiae strain was created harboring a deletion of the chromosomal yeast HSF locus (yhsfΔ) and which expresses a wild-type episomal copy of yeast HSF from the galactose-inducible, glucose-repressible GAL1 promoter. Moreover, this strain expresses the wild-type human HSF1 protein from the plasmid-borne constitutive GPD promoter. To maximize small molecule uptake and retention, this strain was further modified by deleting the genes encoding the drug efflux pumps, Pdr5 and Snq2, as well as the gene encoding Erg6, an enzyme involved in ergosterol biosynthesis, which increases the permeability of small molecules through the plasma membrane, to create strain DNY75 For this humanized yeast screen, an Strain DNY75 was grown to mid-log phase in galactose-containing medium to drive expression of yeast HSF and then shifted to dextrose-containing medium to extinguish expression of yeast HSF, rendering growth entirely dependent on the activation of human HSF1. Cells were seeded at low density to 96-well microtiter dishes and incubated with either DMSO solvent or an aliquot of a small molecule library. A nonbiased chemical library of over 10,000 compounds yhsfΔ yeast strain in the absence of human HSF1, confirming that HSF1A functions in an HSF1-dependent manner to support yeast cell growth −/−hsf1 cells, demonstrating that HSF1A functions in the activation of mammalian protein chaperones through HSF1. As previously demonstrated, wild-type MEFs exhibited robust expression of Hsp70 and Hsp25 in response to an acute heat shock that was absent in −/−hsf1 MEFs. Interestingly, although HSF1C was also able to promote Hsp70 activation in mammalian cells, it did so at lower potency than HSF1A, mimicking the human HSF1 activation potential of both molecules in yeast containing 74 glutamines fused to green fluorescent protein (GFP) (httQ74-GFP) is expressed in rat phaeochromocytoma (PC12) cells, a rat neuronal precursor cell line, via a doxycycline-inducible promoter. As shown in A cell culture model of Huntington disease was used determine whether the ability of HSF1A to promote protein chaperone expression can reduce the formation of protein aggregates and the cytotoxicity associated with polyQ protein overexpression We tested whether the ability of HSF1A to reduce protein aggregation might also reduce the cytotoxicity associated with polyQ protein overexpression, as previous reports have shown that prolonged expression of httQ74-GFP results in a large percentage of the cell population undergoing apoptosis Drosophila melanogaster has been used as an elegant metazoan model of human neurodegenerative diseases that include Huntington, Machado-Joseph disease (MJD) and Parkinson disease Drosophila HSF shares strong structural conservation and is regulated via steps that are similar to that of mammalian HSF1 Drosophila S2 cells were used to test whether HSF1A is capable of promoting Hsp70 expression, indicative of Drosophila HSF1 (dHSF1) activation. Treatment of S2 cells with a range of HSF1A concentrations for 15 h strongly activated the expression of Hsp70 , is expressed under the control of the UAS promoter gmr driver. Due to the eye-specific expression of MJDtrQ78, cytotoxicity is manifested as disruption of eye morphology, depigmentation, and reduction in eye size and is observed in the progeny almost immediately after eclosion We utilized a SSA3-lacZ reporter gene, reflective of their previously established function as Hsp90 inhibitors in yeast Previous studies suggest that Hsp90 and additional cochaperones exist in a heteroprotein complex that, in addition to their central role in cellular signaling, function to repress HSF1 in the absence of stress. In response to proteotoxic stress or pharmacological inhibitors of Hsp90, this complex dissociates, resulting in the multimerization of HSF1 Many pharmacological inhibitors of Hsp90 such as geldanamycin and 17-AAG target the amino-terminal ATP binding pocket of Hsp90, thereby inhibiting its chaperone function In order to identify potential targets of HSF1A, we utilized the HSF1A-biotin conjugate to identify proteins that associated with HSF1A in whole-cell extracts generated from MEF cells. SDS-PAGE in conjunction with silver staining revealed that several proteins between 50–60 kDa in size consistently copurified with HSF1A-B . SimilarSSA3-LacZ reporter gene in yeast since its activation is dependent on the stress-induced activation of yeast HSF in response to the accumulation of unfolded proteins SSA3-lacZ reporter gene, no activation of this reporter was detected after treatment with 20 µM HSF1A  = 0.0005 in SC-URA-TRP containing 4% dextrose to extinguish expression of yeast HSF. Using a Beckman Biomek FX robot, 200 µl of the yeast culture were pipetted into each well of a 96-well plate and supplemented with compounds from a combinatorial compound library (PPD Discovery) containing 10,440 compounds 600 using a Spectra Max 384 plate reader (Molecular Devices). Chemicals promoting yeast cell growth were selected from the library and further validated in two additional rounds of screening. In total, we identified 33 positive-hit molecules (0.32% hit rate) able to promote human HSF1-dependent yeast growth. Growth curve experiments were carried out in 96-well plates. Data shown for all growth curves are averages of four independent experiments with associated standard deviations. High-throughput screening (HTS) assays are usually assessed for their suitability using a statistical Z′-factor by comparing positive and negative controls c++3σc−)/(|μc+−μc−|)], where σ = standard deviation, μ = mean, c+ = HSF1A, and c− = DMSO of the growth rate of the yeast culture between day 1 to day 4. The Z′-factor was calculated to be 0.51, indicating that this assay is appropriate for further HTS studies.To screen for small molecule activators of human HSF1 in yeast, we generated yeast strain DNY75 that expresses yeast HSF under control of the galactose-inducible and glucose-repressible MATa ade2 trp1 leu2 his3 ura3 hsf1Δ::LEU2 Ycp50gal-yHSF1) PDR5, SNQ2, and ERG6 in successive steps using a loxP-KanMX4-loxP deletion cassette. After deletion of PDR5 and SNQ2, the KanMX4 gene was removed by recombination via expression of the Cre-recombinase-expressing plasmid pSH47 KanMX4 gene was not removed after the disruption of the ERG6 gene. For screening of hHSF1-activating molecules, DNY75 was transformed with pRS424-GPD-hHSF1 by electroporation. DNY227 was derived from DNY75 by exchanging the inducible plasmid Ycp50GAL-yHSF1 with the constitutively expressed pRS314-yHSF1.Strain DNY75 was derived from PS145 was incubated with either GD-biotin (Biomol) or HSF1A-biotin for 1 h at 4°C, and bound Hsp90 was then captured by incubating with neutravidin-agarose beads for 30 min at 4°C. The beads were washed three times in Hsp90 binding buffer, and Hsp90 was eluted from the beads by incubating in Laemmli Sample Buffer at 95°C for 5 min. For competition experiments, Hsp90α was pre-incubated with either 17-AAG or HSF1A for 30 min at 4°C prior to the addition of GD-biotin.Purified Hsp90α in Hsp90 binding buffer supplemented with 1% Triton X-100 and protease inhibitors. A total of 1 mg of a whole-cell extract was incubated with 100 µM HSF1A-biotin for 15 h at 4°C. HSF1A-biotin-associated proteins were captured by incubating with neutravidin-agarose beads for 90 min at 4°C. The beads were washed three times in biotin binding buffer and the associated proteins were eluted from the beads by incubating in Laemmli Sample Buffer at 95°C for 5 min. Proteins that co-purified with HSF1A-biotin were resolved on a 4–20% SDS-PAGE gel and visualized by colloidal blue or silver staining. Protein bands were excised from the gel, and the gel slice was subjected to in-gel digestion (detailed protocol at http://www.genome.duke.edu/cores/proteomics/sample-preparation/), followed by LC-MS/MS analysis using a nanoAcquity liquid chromatograph and a QToF Premier mass spectrometer (Waters Corp). The top three most intense multiply-charged ions from each MS scan were interrogated by tandem MS. Raw data were processed using Mascot Distiller v2.0 and searched against the SwissProt database with Mus musculus taxonomy using Mascot v2.2 database search engine, with 20 ppm precursor and 0.04 Da product ion tolerance. Iodoacetamide derivative of cysteine (fixed) and oxidation of methionine (variable) were specified in the Mascot search. Scaffold was used to validate MS/MS-based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 80.0% probability as specified by the Peptide Prophet algorithm. Protein identifications were accepted if they could be established at greater than 95.0% probability and contained at least two identified peptides.Protein extracts were generated from mammalian and yeast cell cultures using biotin binding buffer . Protein extracts (50 µg) were incubated with either DMSO or 0.5 mM EGS for 30 min at 24°C. The cross-linking reaction was quenched via the addition of 50 mM glycine/0.025 mM Tris (pH = 7.5) for 15 min at 24°C. Proteins were fractionated through a 7.5% SDS-polyacrylamide gel and analyzed by immunoblotting with a polyclonal antibody specific to human HSF1. Primary antibodies used were anti-Hsp90α , anti-Hsc70/Hsp70 , anti-Hsp25 , anti-c-fos , anti-SOD1 , anti-dHsp70 , anti-actin , anti-TCP1 , anti-CCT8 , anti-TCP1 , and anti-GFP used according to the provider's instructions and an affinity-purified rabbit polyclonal anti-HSF1 antibody directed against the HSF1 sequence ISLLTGTEPHKAKDPTVS, which cross reacts with mouse, rat, and human HSF1 was used at a 1∶1,000 dilution.Protein extracts were generated from cell cultures using cell lysis buffer supplemented with protease inhibitors. Protein concentrations were quantified using the BCA assay and 10–20 µg of total protein was resolved by SDS-PAGE, transferred to a nitrocellulose membrane, and proteins of interest detected by immunoblot analysis following standard procedures. For HSF1 phosphorylation experiments, protein extracts were isolated either in the presence or absence of the Halt phosphatase inhibitor cocktail (Pierce). For nuclear localization experiments, nuclear and cytoplasmic fractions were isolated using the NE-PER kit (Pierce). HSF1 multimerization state was assessed using the amine-specific cross-linker ethylene glycol bis-succinimidyl succinate (EGS) (Pierce). DNY227 was grown in the presence of DMSO or 20 µM HSF1A for 18 h to a final OD6 cells/plate) and exposed to either DMSO or HSF1A for 6 h or heat shocked at 42°C for 2 h followed by a 15-h recovery at 37°C. mRNA was isolated from cells using the RNeasy Kit (Qiagen) according to the manufacturer's recommendations. Total RNA (10 µg) was analyzed as described MEF Cells were seeded into 10-cm plates , treated with 10 µM HSF1A or DMSO for 15 h and expression httQ74-GFP induced by the addition of 1 µg/ml doxycycline. Fluorescence was analyzed using a Zeiss Axio Observer fluorescence microscope and images deconvoluted with MetaMorph software. For quantification of fluorescence microscopy analysis, approximately 800 cells were counted for each treatment. The number of cells containing aggregates was calculated as a percentage of the total number of cells counted. The data shown are derived from four independent experiments and are given as averages with associated standard deviations. Statistical significance was calculated with Prism 4 using the unpaired Student t-test. **p<0.01; ***p<0.001.PC12 cells expressing httQ74-GFP were seeded into 6-well glass bottom plates (6×104 cells/well) were treated with increasing concentrations of HSF1A for 15 h, at which time httQ74-GFP expression was stimulated by incubation in the presence of 1 µg/ml doxycycline for 5 d. Cell viability was assessed via the XTT viability assay (Roche) per the manufacturer's recommendations. ***p<0.001.PC12 cells seeded into a 96-well plate (5×105 cells/well) into a 6-well plate and treated with either DMSO or 10 µM HSF1A for 15 h, at which time expression of httQ74-GFP was induced via the addition of 1 µg/ml doxycycline followed by a 48 h incubation. Extracts were prepared, and soluble and insoluble fractions were separated by centrifugation and analyzed by immunoblotting as previously described PC12 cells were seeded Structure of HSF1C. (B) Yeast cells (DNY75) expressing wild-type human HSF1 were supplemented with 10 µM HSF1A, 10 µM HSF1C or DMSO, and grown in 96-well plates for 4 d. Growth was monitored by measuring OD600. (C) HSF1+/+ MEFs were treated with DMSO, 100 µM HSF1A, or 100 µM HSF1C for 15 h or heat shocked for 2 h at 42°C followed by a 15-h recovery. Total protein was analyzed for Hsp70 by immunoblotting. GAPDH serves as a loading control.(0.59 MB TIF)Click here for additional data file.Figure S2HSF1A promotes expression of Hsp70 in human cells. HeLa cells were treated with increasing concentrations of HSF1A for 15 h or heat shocked for 2 h at 42°C followed by a 15-h recovery. Total protein was extracted and analyzed for Hsp70 expression by immunoblotting. GAPDH serves as a loading control.(0.46 MB TIF)Click here for additional data file.Figure S3HSF1A promotes Hsp70 expression at low micromolar concentrations. PC12 cells were incubated with increasing concentrations of HSF1A for 72 h, and Hsp70 concentration was measured as a function of total protein concentration by ELISA (Assay Designs).(0.18 MB TIF)Click here for additional data file.Figure S4HSF1A-dependent activation of human HSF1 in yeast is not repressed by DTT. DNY75 cells were treated with 10 µM HSF1A in the absence or presence of 250 µM DTT and grown in 96-well plates for 4 d. Growth was monitored by measuring OD600.(0.26 MB TIF)Click here for additional data file.Figure S5HSF1A does not reduce polyQ toxicity in flies carrying the 4hsf allele.4hsf, UAS-MJDtrQ78 recombinant flies were crossed to gmr-GAL4 flies in the chronic presence of food supplemented with DMSO or 400 µM HSF1A and maintained at 25°C, a semipermissive temperature for 4hsf activity. No reduction in polyQ-related phenotypes is observed in response to HSF1A treatment, suggesting that full HSF activity is required for HSF1A-dependent amelioration of polyQ induced phenotypes.(2.01 MB TIF)Click here for additional data file.Figure S6Geldanamycin and radicicol promote activation of SSA3-lacZ. Yeast strain DNY227, harboring the yHSF1-dependent SSA3-lacZ reporter gene, was exposed to DMSO, 10 µM geldanamycin (GD), or 10 µM radicicol for 3 h upon which time reporter gene activation was assessed by β-galactosidase activity assays.(0.26 MB TIF)Click here for additional data file.Figure S71H/13C, and EIMS data of HSF1A. (B) Structure, 1H/13C, and EIMS data of HSF1A-biotin.(A) Structure, (0.62 MB TIF)Click here for additional data file.Figure S8HSF1A does not activate yeast HSF. Yeast cells expressing the yHSF1-dependent SSA3-lacZ reporter gene were grown at 30°C and exposed to 20 µM HSF1A or DMSO for 6 h or heat shocked at 39°C for 3 h. Reporter gene activation was assessed by β-galactosidase activity assays.(0.29 MB TIF)Click here for additional data file.Figure S9Human HSF1 is not activated in yeast by proteotoxic agents. Yeast cells were treated with either HSF1A, resveratrol (RV), azetidine (AZC), TPCK, TLCK, puromycin (PM), or menadione (MD) at a concentration of 10 µM and for 4 d. Growth was monitored by measuring OD600. OD600 readings at day 4 are shown.(0.25 MB TIF)Click here for additional data file.

As a matter of public utility, the guidelines in the diagnosis and treatment of such patients will have to be cheap, available, easily reproducible, and ideally will furnish answers for the clinician questions not in a binary "black or white" manner, but with graduations, so if possible it has to be quantitative. The present paper aim to focus on the current clinical applications of tissue Doppler and of left atrial function and remodeling, and its pathophysiologic relationship with the left ventricle, as will be cleared in the documented review of echocardiography that follows, considering that the need of universal data on the syndrome of the failing heart does not mean, unfortunately, that all patients and clinicians in developing countries have at their own health facilities the same imaging tools, since they are, as a general rule, expensive.Multiparametric echocardiographic imaging of the failing heart is now increasingly used and useful in decision making in heart failure. The reasons for this, relies on the need of different strategies of handling these patients, as differentiation of systolic or diastolic dysfunction, as well as on the gamma of approaches available, such as percutaneous and surgical revascularization, devices implantations, and valvular regurgitations and stenosis corrections. Congestive heart failure in patients with normal left ventricular diameters or preserved left ventricular ejection fraction had been pointed out recently as present in a proportion so high as 40 to 50 percent of cases of heart failure, mainly due to the epidemics in well developed countries, as is the problem of not well controlled metabolic states (such as obesity and diabetes), but also due to the Heart failure is considered a world endemic problem and data ratified by The European Society of Cardiology (ESC), according to recent publications, estimates a prevalence of symptomatic manifestations in the general European population ranging from 0.4 to 2% . In otheSociedade Brasileira de Cardiologia [American College of Cardiology/American Heart Association [Under the physiopathologic point of view, CF is characterized as myocardial function failure. Without neglecting the autonomous nervous system hormonal mechanisms or the other adapting or deleterious bimolecular implications, the most relevant aspect is that, in this case, the cardiac structure does not provide contraction and ejection with sufficient systolic volume, and does not promote the adequate diastolic arrangements or both situations are not processed appropriately. And this heart dysfunction is closely associated with the heart geometric structural alterations. According to this statement, the aggregation of CF diagnostic stratification is mentioned, not only based on clinical symptom classes but also associated with structural dysfunction stages proposed by the diologia and the ociation the guidociation . A direcociation ,7. Recenociation . TherefoThe LV diastolic function can be measured by estimate or index direct measurement through various cardiovascular imaging methods: radioisotopic ventriculography, heart catheterization, and magnetic resonance imaging, however, the echocardiographic-Doppler study is the most applied tool, due to its high feasibility of transmitral Doppler indices, almost universal availability and low cost .Since 1980, the pulsed Doppler technique for the left ventricular analysis allows the diastole study in a noninvasive form, initially in animals then in human beings . The infPseudonormal pattern: it presents an E/A > 1 ratio as the normal pattern; however, it reflects a velocity increase of the E-wave flow secondary to the pressure elevation in the left atrium, a relaxation deficit and an initial decrease of the LV compliance. The IVTR is diminished due to the higher initial transmitral gradient. The pulmonary venous flow presents abnormal D velocity predominance as this one relates with the increase of the early mitral flow (E-wave). This situation represents an ischemia dysfunction progression, hypertensive or LV overload eventually becoming difficult to differentiate in relation to the real normal pattern; (c) restrictive pattern: the velocity of the early diastolic filling is increased which results in E/A ratio > 2 and in an IVTR and EDT decrease. In this case, the rapid blood flow to the less complacent ventricle results in a rapid elevation of the LV filling pressure, supplanting the atrial pressure which could also cause ventricle-atrial regurgitation in the diastolic phase. As it was observed in the previous pattern, there is here a pulmonary venous flow diastolic increase which corresponds to the transmitral E-wave elevation. The AR and the AR-dur are increased and they keep a positive correlation with the LV final diastolic pressure. The restrictive pattern is related to advanced stages of heart failure and with the worst clinical prognosis recognizing normal and alternate diastole patterns. According to the technical point of view, the TD analyzes the blood flow by measuring the high frequency signals and the low amplitude of the blood cells . The metpseudonormalization or even a restrictive pattern type; the heart rate elevation leads to the velocity alterations and often to the spectral Doppler wave fusion with a consequent loss of the qualification analysis of the ratio between the waves. Meanwhile, the LV preload variable status can also set alterations inversely proportional in the TMD indices. It is reasonable, however, that this method is complemented with others for a comprehensive ventricular filling function analysis [The TMD index contribution to the CF diagnostic and prognostic measurement is undeniable -15, evenanalysis .The tissue pulsed Doppler (TPD) consists of a modality linked with the echocardiography by Doppler which allows the estimate of the myocardial displacement velocity during the cardiac cycle analysing signals of low frequency and high amplitude produced by the myocardial tissue .The myocardial velocity phenomenon can be analyzed by three models: bidimensional coded by color, unidimensional coded by color, and the more commonly used, the pulsed spectral mode, with which the systolic myocardial displacement S', and the E' and A' waves can be respectively registered Figures and 3.The tissue Doppler E' velocity index is primarily influenced by left atrial pressure, left ventricle relaxation and left ventricle systolic pressure in order of decreasing significance , and forpseudonormalized patterns [The TMD index susceptibility, in relation to the LV preload variations, represents this method main disadvantage for the diastolic analysis in a global manner. The TPD indices contribute to a less susceptible measurement to the preload variation. In a recent study performed by our research group, we have observed that in the hypertensive diastolic measurement, there was not significant variation of E' index with the bedside noninvasive maneuvers that induces the preload elevation , while the TMD index E has varied significantly (E = 68.9 ± 11.9 cm/s × E = 75.8 ± 15.7 cm/s), Figure . This prpatterns ,20.pseudonormalized was observed after the infusion of 500 to 700 ml of saline physiological solution (0.9% NaCl concentration), but the TPD diastolic pattern analysis did not show any significant alteration .In the invasive study model, Sohn et al , alreadyTau index (time constant isovolumic relaxation), considered the gold-standard for LV myocardial relaxation, according to Sohn et al. [Tau in 38 volunteers with relaxation abnormalities. Recently, an important study has been published by Nagueh et al. [This TPD index behavior was partially questioned in a recent publication by Hsiao et al. in whichn et al. . In thish et al. in whichTau index and the pressure negative variation over the LV time variation (-dP/dt) , another parameter used in the LV relaxation assessment, aiming at better studying myocardial diastolic velocity determinants by Doppler tissue in animal sample with left atrium (LA) and LV pressure catheterization and measurement. For the first time in this study, the LA hemodynamic data are investigated invasively in relation to the TPD indices presenting a significant association between them: the A' late diastolic velocity was significantly correlated with the dP/dt , and with the LA relaxation index . Additionally, there was an inverse and significant correlation with the LA final diastolic pressure, which also reflects indirectly the LA hemodynamic behavior . Another concern, regarding the diastolic evaluation in patients with probable CF, is the lack of an isolated TMD index reproducibility when evaluated in an altered rhythmic situation, as is the case of atrial fibrillation or sinus tachycardia. Some studies, including the TPD indices, have approached this problem recently. In 1999, Sohn et al. [When both methods (MTD and TPD) were used in E/E' ration, a strong and statistically significant correlation was obtained with the capillary pressure measured by catheter . Besides, the study allowed the verification of patients with E/E' ration > 10 predicting a pulmonary capillary pressure > 15 mmHg with 97% sensibility and 78% specificity, and this study has placed the E/E' ratio in a quite promising position, as a diastolic index, stimulating many other subsequent studies. Ommen et al. , while an et al. studied n et al. , while eThe evidences of such transversal study commented here for small populations, and some of them not using the real gold-standard for comparison, can still be questioned regarding its validity. However, when information arises from some recent data from a group of people added, involving Doppler indices in patients with CF, there is an awareness of the prognostic prediction power in mortality regarding hard events in patient groups with chronic atrial fibrillation , survivaThe LV remodeling is generated by mechanical, neurohumoral, and possibly genetic factors which alter the ventricular dimension, morphology and function. It can occur in response to the aggressions in many clinical conditions including severe or chronic ischaemia, cardiomyopathies, hypertension and valvular and infectious disease. In the structural alteration diagram, hypertrophy, myocyte loss and the interstitial fibrosis increase, compose the tissue physiopathologic aspect associated with a progressive dysfunction. In its conception, the CF cause and consequence precepts are superimposed , as the The study of the changes in the association in ventricular geometry with the worsening of specific diastolic stages – LV relaxation, and compliance or stiffness – represents an interesting focus. While still insisting on the association between SAH and ventricular dysfunction remodeling in a patient with CF, it is important to remember that, in this case, the hypertrophy works as an adaptive mechanism for the LV pressure overload involving the muscular and non muscular heart compartment. Various studies suggest the role of the contractile protein increase in the myocyte with a subsequent increase of this cell, and followed by the collagen matrix remodeling and the sustained growth in the deposition of this element in the interstitial space. The natural history of this process is the worsening of the myocardium active relaxation and the increase of the chamber stiffness causing LV filling dysfunction . StudiesTau index, rectifying previous findings [Hypertension Research [HyperGEN Study [European Society of Cardiology [The hypertrophy relation with LV relaxation alteration has also been investigated and deserves some special consideration. In relation to patients with systemic arterial hypertension, Oki et al. have stufindings . The clafindings have fouResearch a study Research , and meaEN Study with 1,3rdiology was obseThe discussion on the left atrial physiology must be preceded by a brief review of the liquid dynamic concepts and based on this, a combination with the basic notions of its wall contractility, compliance and relaxation biological properties. The LA is a functioning chamber more complex than it seems and it is not a LV simple appendix or a pulmonary vein final chamber but an structure with direct implication on the heart rhythm, on the pulmonary circulation and on the LV filling modulation, with a defined clinical importance and has been largely discussed in the real scenario in the heart failure syndrome, systemic arterial hypertension clinical context, and even in normal, athletic or sedentary patients . Even thThe remodeling indices and the left atrial function have already been related to systemic arterial hypertension, age and a variety of other situations, and the interaction with the LV function represents an important focus of interest to understand the CF myocardial physiopathology. The left atrium contractile function is the most emphasized item when this issue is discussed – LA and the LV function. The awareness regarding the contribution of the atrial systole for the increase of the relation LV pressure/final diameter has opened new perspectives for the understanding of the geometry relation model, the left atrium function and its relation with the LV . Kono etWake Forest University [However, what would be the correlation between the atrioventricular remodeling variables, LV myocardial dysfunction by pressure overload in heart adaptation initial stages to systemic arterial hypertension? In an attempt to clarify this question, a study by Tsioufis et al. has showiversity has studMayo Clinic, in which a cohort from Olmsted, Minnesota, USA was investigated with 1,375 elderly people (≥ 65 years of age) with preserved systolic function (≥ 50% of LV ejection fraction), it was identified that a left atrial volume ≥ 32 ml/m2 was an independent predictor for the first manifestation of CF (P < 0.001) in a follow up of 4.3 ± 2.7 years of age and a higher LA volume progression was observed in follow up of people who developed CF [The Strong Heart Study [These findings emphasize the importance of the left atrium as an actor in CF patients independently of the case of depressed or preserved LV ejection fraction, validating the applicability of this parameter in patients in this age group with diastolic CF. In short, it is possible to state that there is some evidence support which points out to a clear idea of an interaction between the geometry data and the LV and LA function. The next step is to establish and to quantify the importance of all information for clinical handling. And, more recently, in agreement with this idea, many studies were published, transcending concepts obtained in a transversal way for studies of longitudinal follow up which emphasized this issue relevance. In at least four studies published in the last time, a left atrial index prognostic correlation could be observed. Tsang et al. have obsloped CF . There art Study conductert Study . Studiesrt Study . As in hThe diagnostic evaluation of the patient with a suspicion of CF is not always simple, mainly when there is a normal or slightly altered LV ejection fraction, since this is the case in half of the CF cases. The echocardiographic tools for diastolic evaluation, despite the improvement already attained, sometimes are not enough if they are analyzed separately Figure . The LV The authors declare that they have no competing interests.This review article is part of the doctoral thesis of the author LCD under orientation of MRT, his advisor; LCB and IK participated in the examining commission of the author (in order to obtain his degree) and helped much in the process of writing and reviewing o this manuscript. All authors read and approved the final manuscript.The authors declare that they have no source(s) of funding.

Peroxisome proliferator-activated receptor (PPAR)-beta/delta is a nuclear receptor transcription factor that regulates gene expression in many important biological processes. It is expressed ubiquitously, especially white adipose tissue, heart, muscle, intestine, placenta and macrophages but many of its functions are unknown. Saturated and polyunsaturated fatty acids activate PPAR-beta/delta, but physiological ligands have not yet been identified. In the present study, we investigated the anti-inflammatory effects of PPAR-beta/delta activation, through the use of GW0742 i.p), a synthetic high affinity ligand, on the development of zymosan-induced multiple organ failure (MOF).Multiple organ failure (MOF) was induced in mice by administration of zymosan . The control groups were treated with vehicle , while the pharmacological treatment was the administration of GW0742 . MOF and systemic inflammation in mice was assessed 18 hours after administration of zymosan.Treatment with GW0742 caused a significant reduction of the peritoneal exudate formation and of the neutrophil infiltration caused by zymosan resulting in a reduction in myeloperoxidase activity. The PPAR-beta/delta agonist, GW0742, at the dose of 0,3 mg/kg in 10% DMSO, also attenuated the multiple organ dysfunction syndrome caused by zymosan. In pancreas, lung and gut, immunohistochemical analysis of some end points of the inflammatory response, such as inducible nitric oxide synthase (iNOS), nitrotyrosine, poly (ADP-ribose) (PAR), TNF- and IL-1as well as FasL, Bax, Bcl-2 and apoptosis, revealed positive staining in sections of tissue obtained from zymosan-injected mice. On the contrary, these parameters were markedly reduced in samples obtained from mice treated with GW0742In this study, we have shown that GW0742 attenuates the degree of zymosan-induced non-septic shock in mice. Multiple organ dysfunction syndrome (MODS), previously known as multiple organ failure (MOF), is altered organ function in an acutely ill patient requiring medical intervention to achieve homeostasis. Patients suffering from multiple organ dysfunction syndrome comprise a heterogeneous population, which complicates research in its pathogenesis .The condition usually results from infection, injury , hypoperfusion and hypermetabolism. The primary cause triggers an uncontrolled local and systemic inflammatory response initiated by tissue damage. At present there is no agent that can reverse the established organ failure. Intraperitoneal injection of zymosan, in mice or rats leads, in the course of 1 to 2 weeks, to increasing organ damage and dysfunction for 1 week at room temperature, dehydrated by graded ethanol and embedded in Paraplast . Sections (thickness 7 μm) were deparaffinized with xylene, stained with hematoxylin and eosin and observed in Dialux 22 Leitz microscope.Unless stated otherwise, all reagents and compounds were obtained from Sigma Chemical Company .n observations. For the in vivo studies, n represents the number of animals studied. In the experiments involving histology or immunohistochemistry, the figures shown are representative of at least three experiments performed on different experimental days on the tissue sections collected from all animals in each group. The results were analyzed by one-way ANOVA followed by a Bonferroni's post-hoc test for multiple comparisons. A p-value of less than 0.05 was considered significant. Statistical analysis for survival data was calculated by Kaplan-Meier survival analysis The Mann-Whitney U test was used to compare medians between the body weight and the clinical score. For such analyses, p < 0.05 was considered significant.All values in the figures and text are expressed as mean ± standard error of the mean (s.e.m.) of At 18 h after zymosan administration, histological evaluation of pancreas Figure lung Fi and gut Administration of zymosan caused severe illness in the mice, characterized by systemic toxicity and significant loss of body weight Figure , 1B. At The development of acute peritonitis occurred 18 h after zymosan administration was indicated by the production of turbid exudates Figure . The totZymosan injection in mice was associated with an increase in PEC counts at 18 h, when compared to the saline controls Figure . Since tTo investigate the inflammatory cellular mechanisms by which treatment with GW0742 may attenuate the development of zymosan-induced injury, we evaluated IκB-α degradation and nuclear NF-κB p65 translocation by Western Blot analysis. A basal level of IκB-α was detected in the lung tissues of sham-animals Figure , whereasThe modulation of GW0742 on the inflammatory process through the regulation of cytokine secretion was assessed by determination of plasmatic levels of the pro-inflammatory cytokines TNF-α and IL-1β. A substantial increase in TNF-α and IL-1β formation was observed in zymosan-treated mice when compared to sham mice , an enzyme that is contained in (and specific for) PMN lysosome dysfunction ,25. At 1The analysis of exudates Figure and plas"peroxynitrite formation" and/or other nitrogen derivatives produced during multiple organ failure, zymosan-induced nitrotyrosine, a specific marker of nitrosative stress, was measured by immunohistochemical analysis in sections of pancreas, lung and gut tissues, using a specific anti-nitrotyrosine antibody. The samples obtained from sham-operated mice did not stain for nitrotyrosine (data not shown), while sections from zymosan-induced mice exhibited positive staining for nitrotyrosine in pancreas polymerase (PARP), that has been implicated in the pathogenesis of multiple organ failure. Thus, we used an immunohistochemical approach to assess the presence of PAR, an indicator of PARP activation s Figure , lung , whereas in zymosan-administered mice, Bcl-2 staining was significantly reduced Figure . GW0742 2 -β/δ compared to the other members of the steroid hormone nuclear receptor family, PPAR-α and PPAR-γ . Recentlsyndrome . Though in vivo model system, GW0742 appeared to inhibit NF-κB activation, maintaining high cytoplasm levels of IkBα.Our results demonstrate that GW0742, through the activation of its PPAR-β/δ receptor, not only mediates anti-inflammatory effects but also attenuates cell death and apoptosis processes, ameliorating organ dysfunction and/or improving survival. We clearly demonstrate that GW0742 significantly reduced exudate formation and the degree of PEC count. Moreover, during the study of other inflammatory diseases, it been shown that several transcription factors, important to the regulation of acute inflammation, serve as substrates for PPARs ,32. ThesPPAR-β/δ activation also attenuates the increase of many cytokines, such as TNF-α and IL-1β, involved in the inflammatory response. There is evidence that the pro-inflammatory cytokines, TNF-α and IL-1β help to propagate the extension of a local or systemic inflammatory process ,40. In tMoreover, in zymosan-induced shock and inflammation the role of nitric oxide (NO), a reactive nitrogen species, has been demonstrated because Nitrotyrosine formation, along with its detection by immunostaining, was initially proposed as a relatively specific marker for the detection of the endogenous formation "footprint" of peroxynitrite and an i+ in vitro and a reduction in the rate of glycolysis. As NAD+ functions as a cofactor in glycolysis and the tricarboxylic acid cycle, NAD+ depletion leads to a rapid fall in intracellular ATP. This process has been termed 'the PARP Suicide Hypothesis'. Thus, a markedly immunohistochemical staining of PARP was detected in sections of pancreas, lung and gut from zymosan-treated mice, while, here, we have observed a decrease of PARP activity in samples of mice treated with GW0742.Therefore, in this experiment, it is not unexpected that we found that multiple organ failure results also in the formation of peroxynitrite and it is well known that the nuclear enzyme poly (ADP-Ribose) synthetase (PARS) activation can be a consequence of peroxynitrite production ,47. A nodeath receptor family of apoptosis-inducing cellular receptors [The processes that lead to the activation of inflammatory mediators, such as NF-kB p65 or TNF-α are also crucially involved and closely associated to apoptotic processes, that occur in FasL expression induced by DNA-damaging agents, such as a genotoxic drug and UV radiation . Fas foreceptors . In thiseceptors ,51. As teceptors .Thus, the Western Blot analysis on sections of lung tissue to detect Bax and Bcl-2 expression, supported the idea that the zymosan-injection causes an increase of mitochondrial permeability and severe cellular injury, which leads to a higher expression of Bax than Bcl-2 production, whereas GW0742 administration reduced the apoptosis-induced cell death.Also the immunohistochemical localization of Bax on sections of pancreatic, pulmonary and intestinal tissue has revealed a loss of physiological balance between pro- and anti-apoptotic factors with an increase of Bax and a decrease of Bcl-2 expression in zymosan-administered mice and, in contrast, a reduction of Bax levels in GW0742-treated animals.2, PCO2, HCO3- and pH levels, but also diminishes other blood parameters, such as the levels of AST, ALT, bilirubin and alkaline phosphatase that are altered after the onset of zymosan-induced MOF. Furthermore, high concentrations of lipase, amylase and creatinine, indicating the degree of MODS, are all reduced by GW0742, as shown here on liver, pancreas, kidney and lung, is significantly attenuated by PPAR-β/δ activation by GW0742, reducing the pathophysiology of MOF. A histological resolution of organ damage to administration of GW0742 was highlighted in pancreas, lung and gut by haematoxylin-eosin staining too. Indeed, the degree of histoarchitectural modifications in these tissues decreased significantly after treatment with GW0742.To further confirm these data, we found that GW0742 treatment not only prevents lung dysfunction, and reduces zymosan-induced loss of blood PaOThe multiple organ failure, replicated here through zymosan-injection, is a disease with severe implications, involving several mechanisms not yet fully known.However, our results clearly suggest that the PPAR-β/δ agonist, GW0742 may be used successfully as a therapeutic agent in the treatment of conditions associated with inflammation and multiple organ system dysfunction.2/NO3): Nitrite/nitrate; (MPO): Myeloperoxidase activity; (ALT): alanine aminotransferase; (AST): aspartate aminotransferase; (iNOS): inducible nitric oxide.(DMSO): Dimethyl sulfoxide; (PPARs): Peroxisome proliferator-activated receptors; (PMNs): Polymorphonuclear cells; (PAR): poly(ADP-ribose); (MODS): Multiple organ dysfunction syndrome; (MOF): multiple organ failure; (TNF): tumor necrosis factor α; (IL-6): interleukin-6; (ROS): reactive oxygen species; (PARP): poly (ADP-ribose) polymerase; (NOThe authors declare that they have no competing interests.MG, CC have carried out the molecular biology studies; RDP. IP, TG have carried out the animal studies; EM has carried out the histological/immunohistochemical studies; EC, AK have drafted the manuscript and performed the statistical analysis. SC, CT, PB have participated in the design of the study, have coordinated the study and have finalized the manuscript. All authors have read and approved the final manuscript.

The type of interaction was studied using the area under the survival curve ratios (AUC ratios) obtained by numerical integration. Comparison of the AUC ratio and the surviving fraction (SF) value after taxane alone was made using Student's t-test. The influence of the drug concentration was tested by one-way analysis of variance (Anova). A supra-additive or additive effect was seen when seven ovarian carcinoma cell lines were exposed to paclitaxel or docetaxel concomitantly with cisplatin. A supra-additive effect was found in four cell lines after simultaneous use of cisplatin with all docetaxel concentrations tested, and in two cell lines (UT-OC-4 and SK-OV-3) when cisplatin was used concomitantly with paclitaxel. A more pronounced supra-additive effect was seen with the combination of cisplatin and docetaxel. The degree of supra-additivity was dose dependent, with increasing synergy after a higher taxane dose. The data obtained in this study suggest that a supra-additive or additive effect can be achieved in ovarian carcinoma with the concomitant use of cisplatin and a taxane. © 1999 Cancer Research CampaignThe purpose of this study was to compare the growth-inhibitory effect of cisplatin–paclitaxel with that obtained with a cisplatin–docetaxel combination and to assess the type of interaction. Concomitant use of taxanes and cisplatin was studied in seven human ovarian carcinoma cell lines, using the 96-well plate clonogenic assay. Chemosensitivity was expressed in terms of IC

P<0.05) between normal tissue, vaginal and cervical cancer. Furthermore, protein profiles of pairs of primary vaginal and cervical cancers were found to be very similar. Some of the protein spots that have so far been identified include Tropomyosin 1, cytokeratin 5, 15 and 17, Apolipoprotein A1, Annexin V, Glutathione-S-transferase. Others are the stress-related proteins, calreticulin, HSP 27 and HSP 70. We conclude that cluster analysis of proteomics data allows accurate discrimination between normal vaginal mucosa, primary vaginal and primary cervical cancer. However, vaginal and cervical carcinomas also appear to be relatively homogeneous in their gene expression, indicating similar carcinogenic pathways. There might, further, be a possibility to identify tumour-specific markers among the proteins that are differentially expressed. The results from this study have to be confirmed by more comprehensive studies in the future.Protein patterns in six samples from primary vaginal cancers, in five from normal vaginal tissue and in five primary cervical cancers, were analysed using two-dimensional polyacrylamide gel electrophoresis (2-DE). Protein expression profile was evaluated by computer-assisted image analysis (PDQUEST) and proteins were subsequently identified using matrix-assisted laser desorption/ionisation mass spectrometry. The aim was to analyse the protein expression profiles using the hierarchical clustering method in vaginal carcinoma and to compare them with the protein pattern in cervical carcinoma in order to find a helpful tool for correct classification and for increased biomedical knowledge. Protein expression data of a distinct set of 33 protein spots were differentially expressed. These differences were statistically significant (Mann–Whitney signed-Ranked Test, Primary carcinoma of the vagina (PCV) is a rare disease affecting predominantly postmenopausal women . HistoloIt has been suggested that vaginal and cervical carcinomas have common aetiology since vaginal tumours often occur as second primary malignancy in patients with a history of cervical dysplasia and/or neoplasia or hysterectomy due to these disorders has been used to examine heterogeneity in gene expression in tissues from different tumours with a view to find tumour-specific molecular markers. With 2-DE, the complex polypeptide expression is analysed qualitatively as well as quantitatively. Significant differences in the polypeptide expression between tumour tissues and the corresponding normal tissues have been identified, for example in carcinoma of the bladder were analysed consisting of five biopsies from normal vaginal epithelium, six from primary vaginal carcinomas and five from primary cervical carcinomas. For histopathological data, see In order to ensure sample representativity, the samples were taken by experienced gynaecologists and gynaecological surgeons. Each tissue sample was macroscopically examined and only representative, non-necrotic tissue samples were used. Furthermore, both cytological and histological evaluations of all the samples were made. Only cases in which both histological and cytological features corresponded with each other were included in the study. We did not focus on the HPV status in this study bearing in mind that the limited number of samples will not permit the drawing of any significant conclusion.The five normal vaginal biopsies were obtained from the upper part of the vagina approximately 1 cm from the vaginal fornix in postmenopausal women undergoing total hysterectomy for either benign disease or endometrial/ovarian carcinoma. All the fresh tissue samples were snap-frozen in liquid nitrogen until further processing for 2 DE. All samples were obtained with patient consent. One of the vaginal cancer cases (V32T) had been treated with radiation therapy for squamous cell carcinoma of the cervix 35 years ago. None of the other vaginal and cervical cancer cases had a history of prior gynaecological cancer. None of the vaginal cancer cases had a history of vaginal or cervical dysplasia or hysterectomy.μl lysis buffer containing 7 M urea, 2 M thiourea, 4% SDS, reducing agents and protease inhibitors. Protein concentration was determined using the Bradford method IPG-buffer 4-7 linear) was loaded onto a 17 cm IPG-strip 4–7 linear . This gives better resolution and better overview of protein spots across the entire chosen pH window. In addition, the linear gradient also gives a better estimation of the isoelectric point (pI). Isoelectric focusing was performed for each individual sample to a total of 45.5 kVh using Bio-Rad IEF unit (20°C).For each sample, the equivalent of 100 μm resolution using a laser densitometer, and data were analysed using the PDQUEST™ software . Gel images were compared for qualitative and quantitative differences. Polypeptide quantities were calculated in parts per million (ppm) of the total integrated optical density.The second dimension was carried out in a 10–13% gradient SDS gel, and proteins were visualised by silver staining of total proteins were loaded and subjected to isoelectric focusing. Following 2-DE, gels were stained using Coomassie colloidal stain. The 2-D gels were analysed by PDQUEST software and spots of interest were manually excised using a clean sharp scalpel and transferred into an eppendorf tube. In-gel digestion for peptide mass fingerprint analysis was carried out manually with trypsin (−1) with a saturated matrix solution containing α-cyano-4-hydroxycinnamic acid in 30% acetonitrile/0.1% trifluoroacetic acid. Mass mapping of tryptic peptides was performed using MALDI-TOF (above protocol) or Cap-LC-MS/MS on Micromass Q-TOF Ultima mass spectrometer with LC-packings pep Map C18, 75 μm ID column using a gradient of 7–80% (95% acetonitrile and 0.1% formic acid) over a period of 35 min.Micropreparative gels for protein identification were prepared essentially like the analytical gels, except that larger amounts (750 http://www.matrixscience.com).Trypsin fragments of masses 842.50 and 2211.10 Da were used as internal standards for spectra calibration. Data generated were screened in databases using a mass tolerance ⩽20 ppm. The licensed ProteinLynx™ Software (Micromass) or mascot was used for mass mapping (P<0.05), as calculated by the MASCOT scoring algorithm. In addition, at least four matching peptides should be found and more than 50% of the measured masses should match the theoretical peptide fragments.The above protocol of MALDI-TOF analysis has a sensitivity of femtomole amounts of standard 2-DE gel-separated proteins. For a positive identification of the peptide mass fingerprinting, protein scores greater than 72 were considered significant between normal vaginal tissue and vaginal cancer samples. A similar analysis was made between groups of primary vaginal cancer and primary cervical cancer. These variables were then used for the classification of the samples into different groups.Hierarchical cluster analysis is a statistical method that is based on measured variables capable of identifying relatively similar groups of samples. This method is based on the strong assumption that an appropriate distance measure for comparing cases has been carefully selected. Thus, the outcome of the clustering analysis depends on the method of calculation of the distance between samples being compared. In this study, the degree of similarity was calculated using the Bray Curtis distance metric and a complete linkage clustering method. The clustering patterns are then represented diagrammatically as dendrograms with trees and branches depicting the degree of sample relatedness. The sets of genes used in the cluster analysis were selected using Student's Both quantitative and qualitative differences were taken into account for the statistical analysis.We have used correspondence analysis to further evaluate the same data sets used in hierarchical cluster analysis. This was considered as a means to test if the observed set of genes can indeed discriminate the sample groups, bearing in mind the small sample size of this study.Correspondence analysis is a computational method that is similar to principal component analysis (PCA) with potential to study association between groups of samples based on selected variables.The data being subjected to CA is presented as two-dimensional graphical display. This method is capable of visualising different structures within a complex data set.The principle behind the CA is an attempt to group together objects that are similar while dissimilar objects are separated off. The degree of similarity or difference is measured by distances between objects or groups of objects. The analysis has been used to evaluate different complex microarray data . This similarity in protein expression between vaginal and cervical cancers was observed using the correlation analyses between pairs of samples. When pairs of vaginal and cervical samples were compared, an average correlation coefficient of 0.68 was observed, compared with 0.62 and 0.55 for pairs of normal As shown in However, this is in line with the high degree of similarity found between different subtypes of common epithelial ovarian tumours where a relatively large number of samples were analysed . A similar analysis was carried out for the three groups of samples using Student's t-test analysis, and 94 protein spots differed significantly.A total of 67 proteins were differentially expressed in normal vaginal tissue and vaginal/cervical cancers. The differential analysis takes into consideration both qualitative and quantitative changes observed between two sets of samples. This difference was statistically significant using Mann–Whitney analysis .In an effort to reduce the data set to a reasonable number, we further examined how many protein spots fall in the intersection of the two data sets, resulting in 33 spots common to both data sets. Of these 33 protein spots, only 11 were upregulated in both cervical and vaginal cancers, whereas the remaining 22 spots were downregulated compared with normal vaginal tissue samples. The differential expressions of some of these protein spots are shown in Figure 2The 33 spots were used in the cluster analysis of all the samples. As shown in Figure 3aOwing to the small sample size of this study, we have used correspondence analysis to evaluate the same data sets used in hierarchical cluster analysis. We have used this as a means to test if the observed set of genes can indeed discriminate the sample groups. As shown in This type of analysis allows the identification of potential protein spots that contribute to the overall clustering of the samples.t-test (P<0.05). The expression level of this set of 23 protein spots was used to classify all the samples. Interestingly, all the samples could be correctly classified into three distinct groups , Figure 4A total of 23 protein spots were significantly differentially expressed between pairs of 2-DE gels from only vaginal and cervical cancers using both the Mann–Whitney and the Protein spots with statistically significant variability in the expression pattern between normal vaginal epithelium, cervical and vaginal cancers were selected for identification. Some of these proteins were identified through matching with 2-DE maps of proteins already identified, using bench top MALDI-TOF mass spectrometry. One obvious limitation of working with clinical samples is getting sufficient material for detailed analysis. Therefore, the majority of the protein spots in the data sets for cluster analyses could not be easily identified.S-transferase. Others are the stress-related proteins, calreticulin, HSP 27 and HSP 70. Some of the identified protein spots are shown in Among the protein spots so far identified are high molecular weight Tropomyosin 1, cytokeratins 5, 15 and 17, Apolipoprotein A1, Annexin V, Glutathione-This is the first proteomic study concerning vaginal carcinoma in the literature. As vaginal carcinoma is a rare disease, the numbers of samples collected in this study are quite few.In this investigation, we have used hierarchical cluster analysis based on the protein expression in 2-DE to classify vaginal carcinoma. All samples could be correctly classified into three distinct groups . One of the vaginal cancer cases (V32T) had a history of cervical cancer 35 years ago. This case was originally classified as a new primary vaginal carcinoma and not as a recurrent cervical carcinoma due to the long interval between the two carcinomas. In our study, this classification is supported by the results from the cluster analysis, where this vaginal cancer case was classified as a vaginal carcinoma and 4.Interestingly, pairs of vaginal cancer and cervical cancer showed to be relatively homogeneous in their protein expression. Studies from ovarian carcinoma have shown large heterogeneity between pairs of different ovarian carcinomas with a correlation coefficient of 0.54 (According to a recent study by Previous studies have described marked variations in the expression of cell cycle-related proteins, stress proteins and members of cytoskeletal proteins between benign and malignant epithelial tumours of lung, breast, ovary and prostate gel-separated proteins (This observation may indicate that some proteins that are differentially expressed between benign and malignant epithelial tumours may not be similarly altered in some other epithelial tumours such as squamous cell tumours of the vagina and the cervix. The finding of similar expression pattern of some sets of proteins in both squamous cell tumours and other epithelial malignancies may indicate their potential use as markers of malignancy. In this study, we found that 23 spots enabled clustering of almost all of the samples. This set of proteins is evidently interesting for further studies in the search for potential markers, and may give better insight into the aetiology and progression of vaginal and cervical cancers.According to an earlier study in ovarian carcinoma, cluster analysis of a set of differentially expressed proteins also could be used as a prognostic tool (Most methods of statistical analysis are capable of identifying potential marker variables that show significant differential expression between two or more sets of sample groups. However, data sets used in making predictions between two sample groups may potentially be susceptible to data over-fit. This problem is obvious if there are no real biological differences and if the samples being compared are relatively small. It would, therefore, be interesting to test the set of genes used in the learning data to determine whether it can truly differentiate between the two groups when new samples are added. Unfortunately this was not possible to test in the present study because of the small sample size. However, the observed result from the correspondence analysis is in keeping with the cluster analysis data. Despite the limited sample size, the observed result is encouraging and warrants further validation studies.In conclusion, we have used 2-DE to study protein expression profiles of vaginal and cervical tissue samples and found that hierarchical cluster analysis allowed accurate discrimination between normal vaginal, vaginal and cervical cancer tissue specimens. This study thus indicates that cluster analysis might be utilised for correct classification of the tumours. Further, there might be a possibility to find tumour-specific markers among the differentially expressed proteins.Vaginal and cervical carcinomas were also found to be quite homogeneous in their protein expression, which might indicate similar aetiological pathways.

The Early Treatment for Retinopathy of Prematurity study (ETROP), published in 2003, established new guidelines for treatment of retinopathy of prematurity (ROP) and demonstrated improved outcomes compared to previous guidelines. We examined outcomes before and after implementing the ETROP recommendations.A retrospective chart review was performed using records of infants who had laser ablations for ROP performed from January, 2000 through December, 2005. Data collected included date of birth; birth weight; estimated gestational age (EGA); grading of ROP; date of laser ablation; and outcome of laser surgery. Univariate association with threshold or prethreshold treatment were assessed using t-tests or Wilcoxon tests. Additional comparison between groups was performed using Fisher's exact tests.581 patients were examined before and 464 after December 2003. Of these, 29/581 (5% – Pre-ETROP Group) and 53/464 (11% – Post-ETROP Group) patients advanced to criteria requiring laser treatment respectively (P = 0.0001). The average estimated gestational age (EGA) at birth was 26.3 and 25.2 weeks, with an average birth weight of 888 and 707 grams for Pre and Post-ETROP Groups, respectively. Stage 5 retinal detachment (RD) developed in 10.3% of eyes in the Pre-ETROP Group and 1.9% of eyes in the Post-ETROP Group (P = 0.02).After the ETROP guidelines were implemented, there was a decrease from 10.3% to 1.9% of eyes developing Stage 5 retinal detachment, despite this group having a lower average EGA and lower average birth weight. These results underscore the importance of adoption of the Revised Indications. Retinopathy of prematurity (ROP) is a proliferative vascular retinopathy affecting infants of young gestational age and low birth weight. First described by Terry in 1942, ROP remains a leading cause of lifelong visual impairment among premature children in developed countries .The multi-center trial of Cryotherapy for Retinopathy of Prematurity (CRYO-ROP) showed that 44.4% of eyes with a history of severe ROP had a visual acuity at age 10 years of 20/200 or worse. Of those children with visual acuities better than 20/200, only 45.4% had a visual acuity of 20/40 or better . This prthreshold ROP [In the CRYO-ROP study, peripheral retinal ablation were performed in eyes when the severity of ROP reached a point at which the risk of progression to RD was approximately 50%; this was termed hold ROP -8,11. ThThe National Eye Institute in 1999 sponsored a multicenter study of early treatment for ROP (ETROP study). Eyes of ▪ Zone I, any stage ROP that was less than threshold▪ Zone II, Stage 2 ROP with plus disease▪ Zone II, Stage 3 ROP without plus disease▪ Zone II, Stage 3 ROP with plus disease but fewer than 5 contiguous or 8 cumulative clock hours of neovascularization [The ETROP data, published in December 2003, demonstrated a benefit of earlier treatment compared with conventional management, with regard to both structural outcome and grated visual acuity . In the Our research aim was to compare outcomes of infants with ROP managed according to the CRYO-ROP guidelines to those managed under the ETROP guidelines. The demographics of treated patients were also evaluated.Internal Review Board approval was obtained for a retrospective study of preterm infants who were evaluated and/or underwent treatment for threshold or prethreshold retinopathy of prematurity from January 1, 2000, through December 31, 2005.Using Current Procedural Terminology (CPT) and International Statistical Classification of Diseases and Related Health Care Problems, 9th Edition (ICD-9) coding, the patients were selected from the University of Nebraska Medical Center database.Data was collected from four hospitals served by the University of Nebraska Retina Service, covering Nebraska's two largest cities. This encompasses a metropolitan region of approximately 750,000.The main outcome measure was retinal detachment (RD). Data points collected include date of birth; birth weight; estimated gestational age (EGA) at birth; multiparity; EGA, zone, stage, and presence or absence of "plus" disease at the initial and each subsequent examination; scheduled follow-up examination dates; intervention date; laser spots placed per eye; follow-up examinations; RD, including staging; and complications, including late RD and cataract.Univariate association with threshold or prethreshold treatment were assessed using t-tests or Wilcoxon tests for the following variables: EGA at birth, weight at birth, interval between birth and first examination, interval between birth and surgery, interval between first examination and surgery, and number of laser spots. Fisher's exact tests or χ2 tests were used to determine whether treatment was associated with RD, cataracts, amblyopia, as well as evaluating the extent of zone, stage, and plus disease when the decision was made to go for surgery.For patients who developed RD, Fisher's exact tests were used to determine if threshold versus prethreshold treatment was associated with extent of zone, stage, and plus disease, as well as when the decision was made to go for surgery, grade of RD, and multiparity. Wilcoxon tests were used to determine if provider treatment was associated with the number of spots placed on laser surgery, age at birth, weight at birth, and interval between birth and surgery.For all patients who received laser ablation treatment, as well as for patients who developed a RD, provider reliability was evaluated using Wilcoxon signed rank tests. This evaluated the difference between days scheduled between examinations and actual days elapsed between examinations for each interval between adjacent examinations.In addition, patients were divided into two groups; one had more than 7 days between the previous examination and the examination that determined surgery, and the other group had 7 days or less between these examinations. Birth weight and EGA were compared between these two groups using t-test or Wilcoxon test; and extent of zone, stage, and plus disease were compared between these two groups, when a decision was made to go for surgery, using Fisher's exact tests or χ2 tests.Finally, the average follow-up time for Pre-ETROP and Post-ETROP groups were evaluated using the Wilcoxon test.Of the 1045 patients examined during the six year interval, 581 patients were examined prior to adoption of the ETROP guidelines in December 2003 (group A), with an additional 464 patients evaluated after adoption of the ETROP guidelines (Group B). Twenty nine of the 581 (5%) were treated with laser photocoagulation (Pre-ETROP Group), while 53 of the 464 patients (11.4%) evaluated after adoption of the ETROP guidelines received PRP (Post-ETROP Group).The average EGA at birth of the Pre-ETROP patients was 26.3 weeks, while the average EGA at birth of Post-ETROP patients was significantly lower at 25.2 weeks P = 0.0012) Table . HoweverThe amount of plus disease in treated eyes was found to be significantly higher in the Post-ETROP group (46%) as compared to the Pre-ETROP group 10%) (P = 0.0001) Table . There w0% as compared to the Pre-ETROP group (P = 0.02). The percentage of patients treated with laser (as opposed to eyes) developing stage 5 RD was also lower in the Post-ETROP group than in the Pre-ETROP group , though this difference did not reach statistical significance (P = 0.34) Table .Our experience shows that after the ETROP guidelineswere implemented, there was a decrease from 11% to 1.9% of eyes developing Stage 5 RD, in spite of this group having a lower average EGA and lower average birth weight. The average EGA at birth trended downward, from 26.3 weeks in the Pre-ETROP group, to 25.2 weeks in the Post-ETROP group (P = 0.0012). This is not an unexpected trend, given the increasing survival of preterm infants under the care of our neonatal colleagues. These results underscore the importance of adoption of the ETROP guidelines for treatment.The percentage of infants having treatment increased from 5% to 11.4%. Despite increased treatment, there was no appreciable offsetting detrimental effect from treating twice as many infants. Evaluation of our results showed no increase in patients developing cataracts under the ETROP guidelines; in fact, there is a non-statistically significant trend toward fewer cataracts in Post-ETROP as compared to Pre-ETROP patients . Thus, it is reasonable to assume the benefit of increased treatment in patients who are treated according to the recommendations of the ETROP randomized trial outweighs any unrecognized detrimental effect.eyes that developed Stage 5 ROP. These results are consistent with results from the ETROP trial, which demonstrated a reduction in unfavorable structural outcomes from 15.6% to 9.1% (P < 0.001) [Our data showed a statistically significant difference when examining the percentage of < 0.001) .There was a trend toward a longer interval between birth and laser treatment in Post-ETROP patients Table , althougIn addition, Post-ETROP patients had an increase in the amount of plus disease, as compared to Pre-ETROP patients. This may reflect the earlier gestational age at birth, the smaller birth weight, or simply the increased emphasis on the presence or absence of plus disease in the treatment algorithm of the ETROP guidelines protocol. The emphasis on presence or absence of plus disease in the ETROP guidelines may also contribute to the noted increase in plus disease.Every effort was made to ensure that different providers did not unduly influence the outcome data. There is no difference in the number of laser spots placed between groups or with respect to the treated eye Table . FurtherStrengths of this study include careful evaluation of provider variability, and analysis of baseline characteristics of patients who developed poor structural outcome. The primary weakness of this study is related to the retrospective analysis. In addition, a larger sample size would further strengthen data that trended toward, but did not reach, statistical significance.In summary, we found a statistically significant difference in the outcome of ROP eyes treated under the ETROP criteria. Despite possible over-treatment, structural outcomes have improved, suggesting that the benefit of treating ROP in high-risk prethreshold disease outweighs the possible risks of over-treatment in a given high-risk population. Continuing investigation will allow for determination of even more specific high-risk factors for development of poor structural and visual outcome, narrowing the targeted high-risk population.The authors declare that they have no competing interests.The authors have no proprietary interests in the materials discussed.AA participated in patient care, carried out the background research, generated the database, and drafted the manuscript and subsequent revisions. MM participated in the background research, generated the database, and developed the graphics. TH participated in patient care and revised the manuscript. JM provided statistical analysis. FQ provided statistical analysis. DI participated in patient care. EM participated in patient care, drafted the initial inquiry, participated in background research and database formation, and guided the revision and submission process.The pre-publication history for this paper can be accessed here:

The Morris water maze is widely used to study spatial memory and learning. Animals are placed in a pool of water that is colored opaque with powdered non-fat milk or non-toxic tempera paint, where they must swim to a hidden escape platform. Because they are in opaque water, the animals cannot see the platform, and cannot rely on scent to find the escape route. Instead, they must rely on external/extra-maze cues. As the animals become more familiar with the task, they are able to find the platform more quickly. Developed by Richard G. Morris in 1984, this paradigm has become one of the "gold standards" of behavioral neuroscience. The main component of the water maze set up should be a round pool, about 6 feet in diameter and about 3 feet deep. If you are recording the task with a video camera, make sure all sides of the maze are within the camera’s field of view.Fill up the water maze with tap water, which should be close to 26°C. This may take several hours, so should be done well in advance. Periodically check the water temperature so that it is within one degree of 26°C.Place the escape platform in the center of the pool. During training, it must be exposed, one inch above the water. This teaches the rat that there is a platform, and that it is the way to get out of the water. Later, after the animal is trained and ready for testing, the escape platform will be just below the surface of the water, and will not be visible because the water will be made opaque with milk or non-toxic paint.    Now, the water maze is ready for training the animals.For the water maze training, the platform should be in the center of the pool and exposed one inch above the surface, so the animal knows that it’s there. The water should be within one degree of 26°C.Each animal will undergo three consecutive trials. First, place the animal on the platform for twenty seconds.The water maze has 4 starting positions: north, south, east, or west.  Take the animal to one of these positions.  Lower the animal into the water by supporting it with your hand and bringing it down gently into the water tail-end first. Do not stress the animal out by dunking it in head first.Let the animal swim/search for the platform for a maximum of 60 seconds. At first, the animal may swim around the edge of the pool looking for a way out.  Eventually, the animal will learn to search for the platform and climb up.  Once the rodent reaches the platform, stop the timer, and record the time.  If it doesn’t find the platform in 60 seconds, then record the time for this trial as one minute. Do not pick up the animal if it fails to reach the platform. Teach the animal that it must swim to the platform. Therefore, gently guide the animal to the platform with your hand.  Let the animal sit on the platform for 15 seconds. If it falls or jumps off, gently guide it back. This will train the animal that it must stay on the platform to be rescued from the pool.Repeat the same procedure for two more trials, starting at a different direction for each trial.Once the animal has completed all three trials, dry it off with a towel. Repeat the three-trial training process for all the animals consecutively. Keep the directions the same for all of them, and record their times. Now that the animals are trained, they are ready to perform the water maze test.To begin experimental trials with the water maze, fill up the tank so the platform is one inch below the surface of the water. Use non-fat dry milk, or 125 milliliters of non-toxic white tempera paint, to make the water opaque.  The lighting and water temperature should be the same as in the training process. Each animal will undergo 12 trials, which will be 3 trials for each starting direction. Each trial will last 60 seconds. Before beginning, choose the order of the starting directions. Do not use the same start direction twice in a row, and also do not repeat the same order for any of the directionsFacing the wall of the pool, the animal handler will place the animal in the water, and will then step back from the pool and sit in a designated spot while the animal performs the maze task. An animal behavior tracking system such as the SMART system (San Diego Instruments) can be used to monitor the path, as well as other variables. Videotaping each trial is a less expensive, and perfectly appropriate, alternative.Monitor the animal until it reaches the platform, and record the time it took. If the animal doesn’t reach the platform in 60 seconds, the handler will guide it to the platform, as in training. Either way, let the animal sit for 10 seconds, and then dry it off and return the animal to a holding cage.Continue with each animal for all 12 trials, with the animal handler returning to the same designated spot during each trial. The order of testing should be: trial 1 for all animals, trial 2 for all animals, trial 3 for all animals, etc. There should be an inter-trial interval of at least 2 minutes. Periodically, clean out the pool, make sure the platform is in place, and check that the water temperature is the same.After all animals have completed 12 trials, they will each perform one probe trial, in which the platform is removed from the pool. The probe trial is performed to verify the animal’s understanding of the platform location, and observe the strategy that the animal follows when it discovers the platform is not there. The handler will release the animal starting from the north. Record the number of times the animal crosses the center of the pool during the  30 seconds.When all the probe trials are complete, dry off the animals and drain the pool.5. This task can be altered in numerous ways to investigate working memory, reference memory and task strategy 6. The procedure described here contains two critical variables which represent a deviation from other versions of the water maze: pretraining, and testing on a single day.The water maze task was development by Morris Pretraining - the hippocampus is involved in spatial/relational memory 7-8. The water maze specifically tests spatial memory 3. However, there are numerous other components of the task that do not involve spatial memory: the stress involved with the task, the understanding of the rules of the task , and the understanding that there is a means of escaping the task 9. Learned helplessness also involves a tank of water, but the rules (there is no means of escape) are quite different 10. The three pretraining trials "teach" the animals about these properties of the task. They learn that they will be placed into a pool of tepid water and swim around for a minute, but be removed after. They are taught to find the platform (because it is visible) and that staying on it will lead to their "escape" from the maze. And they are taught that the task has an end. Therefore, this hippocampal-independent learning does not confound the analysis of the water maze testing data. Testing on a single day - Most often, water maze testing occurs across two to four days 3. In this way, acquisition and retention can be assessed. However, in some populations, this is not a viable option. Such is the case when investigating female mammals. Female rodents, humans, primates, etc, all have cyclic changes in steroid hormone levels 11-12. These hormones have profound effects on hippocampal-dependent task performance, hippocampal anatomy and hippocampal cell function 13-14. Testing across multiple days would be akin to testing a single animal across numerous conditions low estradiol and progesterone, elevated estradiol and progesterone, and intermediate estradiol and progesterone. To eliminate this confound, testing occurs across a single day.

Climate change, acid rain, depletion of the ozone layer, species extinction—all of these issues point to one thing: environmental health is a global issue that concerns all nations of the world. Now add environmental justice to the list. From South Bronx to Soweto, from Penang to El Paso, communities all over the world are finding commonality in their experiences and goals in seeking environmental justice.Dumping in Dixie: Race, Class, and Environmental Quality as “the principle that all people and communities are entitled to equal protection of environmental and public health laws and regulations.” In countries around the world, the concept of environmental justice can apply to communities where those at a perceived disadvantage—whether due to their race, ethnicity, socioeconomic status, immigration status, lack of land ownership, geographic isolation, formal education, occupational characteristics, political power, gender, or other characteristics—puts them at disproportionate risk for being exposed to environmental hazards. At a global scale, environmental justice can also be applied to scenarios such as industrialized countries exporting their wastes to developing nations.Environmental justice was defined by Robert Bullard, director of the Environmental Justice Resource Center at Clark Atlanta University, in his seminal 1990 work In either case, “environmental and human rights have no boundaries, because pollution has no boundaries,” says Heeten Kalan, senior program officer of the Global Environmental Health and Justice Fund of the New World Foundation in New York City. “Environmental justice organizations are starting to understand that they are working in a global context.”The history of international efforts in environmental justice parallels the series of agreements and conventions held around the globe to address environmental issues. Bullard recounts that during the 1992 Earth Summit in Rio de Janeiro, Brazil, there was not much official discussion about environmental justice in the context of human health. “Most of the official discussion centered around saving the Amazon and other ecosystems. Human health and urban centers were not considered part of the ‘environment,’” he says.Principles of Environmental Justice, a document to guide grassroots organizing. “When we went to Rio in 1992 we found that some groups had translated the Principles into Portuguese and were circulating the document to local community leaders at the summit,” remembers Bullard.However, Bullard and other U.S. environmental justice leaders had already met in Washington, DC, at the First National People of Color Environmental Leadership Summit a year earlier, where they drafted the Ten years later, during the World Summit on Sustainable Development held in Johannesburg, South Africa, the issue of environmental inequity was formally recognized by the leadership of the summit. “By the time we went to Johannesburg, environmental justice had really caught on across borders as part of the whole idea of sustainable development,” says Bullard. Just two years earlier, the eight UN Millennium Development Goals that resulted from the UN Millennium Summit held in New York City had encompassed environmental sustainability as a goal that would require a reduction in inequality.International organization around environmental justice issues takes several different forms. Broad networks of community-based organizations can work on different issues affecting the disenfranchised and come together on matters related to the environment. Other groups may organize a particular labor sector to improve worker health. On an international scale, community-based groups in different countries who find themselves fighting similar environmental problems can unite in order to synergize their efforts.“The issue of globalization is one of common concern to the environmental justice movement in many developing countries,” says Michelle DePass, program officer of the Environmental Justice and Healthy Communities Program at the Ford Foundation. Concerns about globalization can bring together a wide range of stakeholders including workers, academics, and community leaders for whom increased industrial development is a common denominator.The Brazilian Network on Environmental Justice is an example of how groups can come together to address common concerns. This network brings together about 100 varied organizations including unions, academic centers, associations, ethics groups, community-based organizations of indigenous peoples, and descendants of enslaved Africans brought to Brazil, all with the common goal of improving the conditions for vulnerable populations in that nation.Principles of Environmental Justice, the Brazilian network serves as a forum for debate, strategic planning, and mobilization by organizations and affected populations. Network meetings include members from other South American countries with common interests.Utilizing the Marcelo Firpo, a network organizer and senior researcher at the Oswaldo Cruz Foundation in Rio de Janeiro, sees that what unites these varied organizations is their concern for issues of human rights and the effects of globalization on health and the environment. He offers the example of Petrobras, a Brazilian oil company that has become a major player in the global market. Because the current government in Brazil does not permit oil exploration in the Amazonian native reservations, Petrobras has begun exploration in Ecuador, where there are no such restrictions. “This kind of situation necessitates international collaboration,” says Firpo.Throughout the world, disadvantaged communities typically suffer the highest burdens of environmental degradation. One group that is often threatened by environmental hazards in developed and developing countries alike is rural farmworkers. These workers often suffer from the effects of disproportionate exposure to pesticides and other chemical agents as well as lack of access to health and education services, among other hindrances.In Brazil, for example, 10% of the urban population over 5 years of age is illiterate whereas in the rural population this rate is as high as 30%, according to Frederico Peres, a researcher at the Center for Workers’ Health and Human Ecology at the Oswaldo Cruz Foundation. So workers often cannot understand the written technical information about pesticides provided by chemical manufacturers. Protective gear is often ineffective or nonexistent, and government protections regulating use and disposal of pesticides may not be consistently applied to these vulnerable populations.Peres has mobilized farmworkers and created educational materials on the safe use of pesticides that do not require literacy to be understood by the workers. In conducting this work, Peres connected with similar organizations in Mexico, Chile, Ecuador, Panama, and Argentina and observed that comparable situations take place in these countries. “The problems are the same: illiteracy, lack of government support, the strong influence of chemical industries to promote pesticide use—all of these are the same throughout Latin America,” says Peres.International Journal of Occupational and Environmental Health, “The legacy of apartheid for the health and the dignity of farm workers has proved to be so deep-rooted that efforts towards redress in the new democracy have had only limited success. . . . [I]t is the underlying powerlessness of farm workers that is both at the root of violations of farm workers’ human rights and also responsible for the substantial burden of mortality and morbidity suffered by farm workers and their families.”Farmworkers in South Africa face similar situations as those in Brazil. Labor conditions on South African farms are among the poorest of all employment sectors in that country, and until recently farm work was effectively unregulated. Similar to Brazil for Latin America, South Africa is the largest importer of pesticides in sub-Saharan Africa, so pesticide exposure is a significant hazard for South African farmworkers. Leslie London, a professor of public health at the University of Cape Town, has collaborated with South African farmworkers for many years to address their environmental justice concerns. But as he noted in the January/March 2003 issue of the Upon interacting with each other, some organizations in the environmental justice movement across the globe are discovering that although each case has its own particular circumstances, there are many common experiences that can inform each other’s struggles for environmental justice. For example, members of the Farmworker Association of Florida have been exchanging visits with citrus farmers in Brazil to trade ideas on how to address environmental justice issues. They found that some of their local circumstances were different, primarily the fact that in the United States most of the farmworkers are immigrants, whereas in Brazil they are mostly nationals. “This makes a huge difference since in Brazil [workers] have the right to unionize to seek better working conditions,” says Tirso Moreno, general coordinator of the Farmworker Association of Florida.Yet, during these exchanges, the workers from both countries discovered that they had been facing similar working conditions established by the same multinational agrobusiness companies. “Some of the information that we had [was of use to] the Brazilians and vice versa because many of these multinational companies are the same ones with different names,” says Moreno. “That is why there is a lot more interest in collaborating internationally. While the details may be different in each country, the struggles are the same.”Organizations like Via Campesina, an international organization of small and medium-sized agricultural producers based in Indonesia with members in 56 countries, aim to organize farm workers throughout the world who are affected by similar issues. Jose Adilson de Medeiros, president of the São Lourenço [Brazil] Rural Producers Association, says of these groups, “If [other environmental justice groups] know how to solve a problem, they can tell us how they did it. We learn from each other’s mistakes so we don’t have to make a mistake again to get there.”Another issue-based environmental justice network is the Global Alliance for Incinerator Alternatives (GAIA). This organization, headquartered in the Philippines, aims to coordinate efforts to reduce waste and stop incineration around the world with a particular focus on representing disadvantaged communities in both developed and developing countries.With members from 77 countries and expanding, GAIA can mobilize quickly and globally to take coordinated actions. Its approach includes sharing information electronically, coordinating regional meetings, developing joint strategies for community organizing, and hosting international training sessions where skills can be shared. One effective strategy the group has used is letter-writing campaigns that include signatories representing organizations from many countries. GAIA is current mobilizing Asian members in opposition to an effort by the Japanese government to enter into bilateral agreements allowing the export of waste for burning in less-developed countries in the region.Another approach taken by the environmental justice movement is to address the international bodies that support projects that may affect disadvantaged populations. For example, GAIA has launched a campaign to stop the World Bank from funding incinerators around the world. To achieve this goal, GAIA locates expert researchers who can share needed information on the health effects of incineration with members near the proposed incinerator where the information may not be readily available. They also facilitate linkages between members who may be campaigning against similar technologies or against the same incinerator vendor. In this way, environmental justice organizations can share strategies and information quickly and effectively.The flow of information is highly bidirectional in the international environmental justice movement, providing models for both North-to-South as well as South-to-North exchange. For example, community-based organizations in the Philippines, where the government passed a national ban on incineration in 1999, are able to share with others around the world how they were able to achieve this in their country. And in Kenya, lawyers are required to train in environmental law through continuing education programs such as those managed by the Institute for Law and Environmental Governance (ILEG). “In the United States, we can learn a lot from organizations like ILEG,” says DePass, who is herself an environmental lawyer who will be leading a delegation of U.S. lawyers to visit ILEG for consultation on environmental justice strategies.Increasingly, due to globalization and the advance of multinational corporations, communities around the world find they are fighting the same battles. One such example began in Diamond, a black community in Norco, Louisiana, which is home to 130 petrochemical facilities, incinerators, and landfills in what is known by some as the Chemical Corridor and by others as Cancer Alley. There, a local school teacher named Margie Richard and other neighbors founded Concerned Citizens of Norco in 1990 and began demanding that Shell Corporation, the owner of the nearby petrochemical facilities, take responsibility for its pollution by relocating affected residents to a cleaner area.To achieve this, the group engaged in highly visible campaigns at the state, national, and international levels, culminating with Richard’s presentation in 2001 at the international headquarters of Royal/Dutch Shell in the Netherlands. Shell agreed to relocate those in the community who wished to leave the area and to reduce its emissions by 30%. This unprecedented victory won Richard the 2004 Goldman Environmental Prize . With this increased visibility and recognition, Richard began traveling abroad to talk about the environmental justice movement and likening this experience to the wider issue of international human rights.Communities in other parts of the world are now utilizing tactics similar to those used by Concerned Citizens of Norco. For example, Desmond D’Sa, a resident of South Durban, South Africa, and chairperson of the South Durban Community Environmental Alliance, has engaged the leadership of Shell Corporation directly to deal with environmental issues similar to those in Norco. Other communities in Texas, the Philippines, Nigeria, Brazil, Curaçao, and Russia have brought similar complaints to Shell’s annual General Meetings.Behind the Shine, Tony Juniper, executive director of Friends of the Earth in the UK, states that shareholders and investors in large corporations have rights established in law through which they can hold companies accountable; however, this cannot be said for the people who live next door to polluting facilities. Joining forces therefore helps these communities have their voices heard at the corporate table.Friends of the Earth International, described as the world’s largest grassroots environmental network with 70 national member groups and approximately 5,000 local activist groups, serves as an umbrella organization under which many of the communities organizing for environmental justice can find common ground for action. In a 2003 report titled In recent months, attention has been focused on environmental justice issues within Europe, where poor and ethnically marginalized peoples in Central and Eastern Europe often face harsh environmental health conditions. “With the recent enlargement of the European Union to include countries of Central and Eastern Europe, the need for environmental justice across a more stratified society, especially as it relates to the promotion of human health, is increasingly evident,” says Diana Smith, director of communications at the Health and Environment Alliance (HEAL), headquartered in Brussels. The alliance mainly addresses environmental justice within the context of the 1998 Aarhus Convention, which specifically links environmental rights and human rights.Making the Case for Environmental Justice in Central and Eastern Europe to raise awareness and advocate policy action against the deleterious environmental and human health conditions of poor and otherwise marginalized groups in Central and Eastern Europe. The report cites the case of a displaced persons camp sited near a mine complex in Northern Mitrovica, Kosovo. A 2005 WHO study visit to the camp showed that 88% of the children aged 6 years and younger had lead poisoning severe enough to require immediate medical intervention.HEAL and its member organization, the Centre for Environmental Policy and Law, produced the groundbreaking August 2007 report The global push for environmental justice can only be expected to grow—and the time for action is ripe. As Bullard summarizes, “if you live on the wrong side of the tracks and you are denied a good environment, then you need environmental justice. It is the same struggle everywhere.”

The growth hormone (GH)/insulin-like growth factor 1 (IGF-1) axis regulates cardiac growth, stimulates myocardial contractility and influences the vascular system. The GH/IGF-1 axis controls intrinsic cardiac contractility by enhancing the intracellular calcium availability and regulating expression of contractile proteins; stimulates cardiac growth, by increasing protein synthesis; modifies systemic vascular resistance, by activating the nitric oxide system and regulating non-endothelial-dependent actions. The relationship between the GH/IGF-1 axis and the cardiovascular system has been extensively demonstrated in numerous experimental studies and confirmed by the cardiac derangements secondary to both GH excess and deficiency. Several years ago, a clinical non-blinded study showed, in seven patients with idiopathic dilated cardiomyopathy and chronic heart failure (CHF), a significant improvement in cardiac function and structure after three months of treatment with recombinant GH plus standard therapy for heart failure. More recent studies, including a small double-blind placebo-controlled study on GH effects on exercise tolerance and cardiopulmonary performance, have shown that GH benefits patients with CHF secondary to both ischemic and idiopathic dilated cardiomyopathy. However, conflicting results emerge from other placebo-controlled trials. These discordant findings may be explained by the degree of CHF-associated GH resistance. In conclusion, we believe that more clinical and experimental studies are necessary to exactly understand the mechanisms that determine the variable sensitivity to GH and its positive effects in the failing heart. Growth hormone (GH), a 191 amino acid single-chain peptide, is synthesized and secreted by the somatotroph cells of the anterior pituitary gland . Its sec2 agonists, hypoglycemia and daily life stresses, and inhibited by β and α1 agonists, glucocorticoids and aging [GH secretion is pulsatile, and is regulated by a number of neurologic, metabolic and hormonal influences: during most of the day, the plasma GH level of adults is 5 ng/ml, with one or two sharp spikes three to four hours after meals. The lowest circulating level is early in the morning and highest about one hour after the onset of deep sleep -14. Secrnd aging , 14-17.2+) trafficking, regulating expression of contractile and cytoskeletal proteins and modifying activation of intrinsic neurohormonal networks [The biological effects of GH are mediated by the interaction with a specific receptor (GHR), a single chain trans-membrane protein, expressed in almost all cellular types , 18, 19networks .GH exerts its effects either directly or indirectly , 21, 22.IGF-1, a 70 amino acid single chain protein, structurally homologous to pro-insulin, is synthesized in liver and kidney, although the local production in other tissues appears to be important in mediating, by paracrine or autocrine mechanisms, GH anabolic and growth-promoting effects -33. IGF-The diminished age-related amplitude of GH pulses and the increased resistance to GH action contribute to reduce IGF-1 plasma concentration. The mechanisms underlying these age-related modifications include peripheral influences , changes in hypotalamic neuropeptides and neurotransmitters, and increase in somatostatin secrection. . AlthougGH alters body’s homeostasis and its effects can generally be described as anabolic. GH directly stimulates chondrocyte division and multiplication; it increases calcium retention, thereby strengthening bone mineralization ; promote1).Besides growth promoting and metabolic effects, the GH/IGF-1 axis regulates cardiac growth, stimulates myocardial contractility and influences the vascular system -77. MoreThe GH/IGF-1 axis can also control intrinsic cardiac contractility through different mechanisms: by enhancing myofilament calcium sensitivity , 82, 83,While IGF-1 positively affects cardiac contractility, GH physiological role, although GHRs are expressed on the heart, probably does not include acute modulation of myocardial contractility, but it needs to mediate some other functions such as protein synthesis or local IGF-1 production , 88.Moreover, GH induces myosin phenoconversion toward the low ATPase activity V3 isoform. The prevalence of V3 isoform increases the number of actin-myosin cross-bridges and their attachment time, enhances protein calcium sensitivity and calcium availability and allows the myocardium to function at lower energy cost , 77. V3 Although GH reduces energy output, it favours the conversion of metabolic energy to external work and enhances the intrinsic ability of the myofilament to develop force, resulting in an improvement of LV performance . In concThe relationship between the GH/IGF-1 axis and the cardiovascular system has been extensively demonstrated in numerous experimental studies and confirmed by the derangements of cardiac structure and function reported in patients with both GH excess and GH deficiency (GHD).Acromegaly is a clinical condition consequent to chronic GH excess that affects the heart. Acromegalic cardiac involvement was first described by Huchard in 1895 . SubsequAcromegalic cardiomyopathy can be divided into three main stages , 89. TheThe most relevant histological abnormalities are interstitial fibrosis, reduced capillary density, increased extracellular collagen deposition, myofibrillar derangement, lymphomononuclear infiltration and myocyte death due to necrosis and apoptosis , 116.GH excess seems to exert different and potentially opposite effects on the heart: it enhances cardiac performance in early-stage acromegaly, whereas it causes cardiac dysfunction in the intermediate-late phase. This apparent discrepancy is easily clarified: a physiological GH level or short-term excess exert positive inotropic effect, whereas by causing morphological and functional adaptive changes, long-term exposure to GH excess induces cardiac dysfunction and progression to heart failure , 118.GH/IGF-1 may cause acromegalic morphological and functional changes either directly by affecting myocyte growth and contractility, or indirectly by affecting peripheral vascular resistance, modifying extracellular volume and neurohormonal activity. Subsequently, with the increase of arterial stiffness due to hypertrophy and fibrosis of the arterial muscular tunica, about 20-50% of acromegalic patients become hypertensive . ExperimThere is compelling evidence that IGF-1 is involved in the intricate cascade of events leading to cardiac hypertrophy. In fact, in response to pressure or volume overload, IGF-1 expression increases in parallel to hypertrophy , 132. MoGrowth hormone deficiency produces different clinical features depending on the time of onset and disease severity and duration , 147. GHChildhood-onset GHD is characterized by cardiac atrophy with a significant reduction in LV mass, relative wall thickness and cavity dimensions, compared with age-, sex- and height-matched controls -162. MorEvidence that cardiac alterations in GHD are strictly related to the GH deficiency comes from many GH replacement trials, which taken together show an increase in LV mass and improvement in cardiac performance, diastolic filling and systolic function after GH treatment , 169-172The beneficial cardiovascular effects of GH replacement are related not only to cardiac anabolic actions but also to its peripheral effects. Treatment with GH normalizes NO production, thereby reducing peripheral vascular resistance and modulating cardiac cytoskeletal functions by altering calcium myofilament responsiveness , 157. Moprimum movens of the vicious cycle responsible for pathologic remodelling.The rationale for GH therapy in CHF appears evident when considering the cardiovascular effects of GH and the cardiac morphological and functional features in heart failure. Patients with CHF have reduced myocardial contractility, decreased cardiac output, dilated LV cavity, increased peripheral vascular resistance and enhanced wall stress. Cardiac dilatation, which initially helps to maintain an adequate stroke volume, initiates a vicious cycle whereby dilatation leads to dilatation. GH replacement may be beneficial in all steps of heart failure. By stimulating cardiac growth, GH induces a concentric pattern of remodelling, which reduces wall stress. By decreasing peripheral vascular resistance, GH reduces afterload, attenuates pathologic cardiac remodelling and improves cardiac function. Furthermore, by inducing positive inotropic effects, GH directly counteracts the impaired contractility, which is the +/K+ ATPase activity.The pathogenesis and the progression of CHF seem to be related also to an imbalance between pro-inflammatory/anti-inflammatory factors and endothelial dysfunction. Patients with CHF have excessive plasma levels of pro-inflammatory cytokines and impaired vascular reactivity, which consists of attenuated vasodilatation in response to acetylcholine and preserved response to the direct NO donor nitroprusside. By shifting the cytokine balance toward anti-inflammatory predominance and reducing pro-apoptotic factors, GH positively acts on LV remodelling, increasing LV contractile performance and enhancing exercise capacity. In addition, GH is able to improve vascular reactivity, not only by restoring NO production, but also activating non-endothelium-mediated actions, in particular by modifying intracellular calcium concentration and regulating NaThe first study of the effects of the GH/IGF-1 system in experimental heart failure models dates back to 1992. At that time, Castagnino and colleagues evaluated the effect of GH on the connective tissue, fibroblast growth and proliferation in rats with experimental myocardial infarction, and found a significant decrease in the incidence of ventricular aneurysms . A subsein vivo, IGF-1 mediates the GH-induced cardiac hypertrophy [Cittadini and co-workers administered GH or IGF-1 or GH plus IGF-1 to adult HF rats and found a significant increase in cardiac performance and LV mass, without development of significant fibrosis, and no additional hypertrophy in rats receiving GH plus IGF-1 compared with rats treated singularly with GH or IGF-1 alone. This interesting result suggested that, ertrophy . Subsequertrophy -191.per se does not induce fibrosis, it leaves myocardial defects that are filled with interstitial fluid from myocardial edema, subsequently leading to fibrous tissue accumulation [More recently, Cittadini and colleagues demonstrated, in a rat model of post-infarction heart failure, that GH improves a broad spectrum of structural abnormalities of the extra-cellular matrix . Specifimulation . GH and mulation , 192-195mulation . They almulation . This remulation , 88. In mulation . In contmulation . All themulation , 194.+-H+ and reversed Na+-Ca2+ exchanges [Von Lewinski and colleagues were the first to study the functional effects of IGF-1 in isolated human myocardium. They demonstrated that IGF-1: 1) exerts a concentration-dependent positive inotropic effect, which is almost completely prevented by blocking its receptors or phosphoinositide 3-kinase (PI3-kinase); 2) increases L-type calcium currents; 3) activates Naxchanges . The benxchanges , 197. Alxchanges , 199. Thxchanges -202.1). The first results were limited to case reports showing that GH administration considerably improved cardiac function [Several research groups have studied the effects of GH and IGF-1 in patients with impaired cardiac function and interleukin- 6 (IL-6), their soluble receptors, as well as apoptosis mediators, such as soluble Fas (sFas) and soluble Fas ligand (sFasL) , 216. Th2).In an attempt to gain further insight into the mechanisms by which GH may benefit CHF patients, Fazio and co-workers have recently carried out a double-blind, placebo-controlled study of the effects of GH on physical exercise capacity and cardiopulmonary performance in twenty-two patients with moderate heart failure . PatientMoreover, at transthoracic echocardiography, the GH group had an increase in LV mass index, relative wall thickness and cardiac performance. The LV ejection fraction and early-to-late mitral peak velocity ratio were significantly.The conflicting results of the clinical trials of GH treatment analyzed in this review may be related to the small number of patients enrolled, the different dose and duration of GH treatment, the different CHF etiologies, and differences in the patients' demographic, hemodymamic and clinical characteristics. This discrepancy may also reflect the heterogeneity of IGF-1 increase in response to GH. In fact, a recent meta-analysis, which analyzed all randomized controlled trials and open studies on sustained GH treatment in adults with CHF in the absence of GHD, contained in the Medline, Biosis and EMBASE databases from their inception to June 2005, confirms that there is a close relationship between change in IGF-1 concentration and GH effects . When thAlthough experimental models and preliminary human studies have demonstrated that GH administration may have beneficial cardiovascular effects in CHF, more experimental and clinical studies are necessary to clarify the mechanisms that determine the variable sensitivity to GH and its positive effects in the failing heart.

This allows classification and definition of biologically defined and prognostically relevant subtypes, and allows directed treatment in some subentities. Over the last years the microarray technology has helped to quantify simultaneously the expression status of ten thousands of genes in single experiments. This novel approach will hopefully become an essential tool for the molecular classification of acute leukaemias in the near future. It can be anticipated that new biologically defined and clinically relevant subtypes of leukaemia will be identified based on their unique gene expression profiles. This method may therefore guide therapeutic decisions and should be investigated in a diagnostic setting in parallel to established standard methods.An optimised diagnostic setting in acute leukaemias combines cytomorphology and cytochemistry, multiparameter immunophenotyping, cytogenetics, fluorescence This widened diagnostic spectrum has revealed deeper insights into disease-specific chromosomal and molecular alterations in acute leukaemias and has also led to improved understanding of the genetic heterogeneity of the diverse subtypes. Algorithms for diagnostic questions using these methods in varying combinations are helpful to gather all relevant information in an effective way (trans retinoic acid in acute promyelocytic leukaemia (APL) with PML-RARA, of imatinib in BCR-ABL-positive acute lymphoblastic leukaemia (ALL), or of specific antibodies against the CD20 or CD52 antigens. Nevertheless, well-defined cytogenetic subgroups exhibit considerable heterogeneity with respect to both response to therapy and prognosis may lead to the detection of new biologically defined and clinically relevant subtypes in leukaemias as a basis for specific therapeutic decisions , contain about 42 000 genes probably representing most of the human genome. Common to all expression profiling approaches is the heteroduplex formation: structural features of nucleic acid enable every nucleic acid strand to recognise complementary sequences through base pairing. After hybridisation, complementary fluorescently tagged nucleotides can be detected (Different microarray platforms are available: filter arrays (formerly considered as macroarrays owing to their lower probe density), spotted glass slide arrays that vary according to the immobilised probe, that is, cDNA, oligonucleotides, or genomic fragments, and according to substrate choice for surface modification. With cDNA arrays, PCR products of cDNA clone representing genes of interest are spotted systematically on nitrocellulose filters or glass slides. The construction of spotted arrays is based on the use of cDNA collections that can be focused on genes expressed in a particular context. This array technique can be performed by individual investigators, is easily customisable, and does not require primary knowledge of cDNA sequence because clones can be used before sequencing. Oligonucleotide arrays offer greater specificity than cDNA arrays, because they can be tailored to minimise chances of cross-hybridisation can be used to reduce the dimensionality of array data and to visualise large data sets. The multidimensional and matrix-like structured array data set is reduced to a new set of variables, that is, principle components.www.mged.org), which defined the standards for annotation and publication of microarray experiments.To allow the direct estimation of biologic relevance, an effective annotation of microarray experiments is a major task that has been approached by the MGED group classifications still plays an important role in acute leukaemia diagnostics owing to its fast and easy applicability, and the possibility of guidance of other diagnostic methods. Until now, immunophenotyping by multiparameter flow cytometry has been the standard method for diagnosis and classification of acute leukaemias, especially ALL. In genes most relevant for diagnosis and subclassification of AML and ALL, Cytogenetic aberrations are considered disease-defining in a large number of AML types. They represent the most important prognostic parameter, and have thus been incorporated into the WHO classification of AML /PML-RARA, and inv(16)/CBFB-MYH11 are characterised by distinct morphologic phenotypes and by a favourable prognosis; reciprocal translocations involving the MLL gene on 11q23 are, by contrast, associated with poor prognosis and are frequent in therapy-related AML (t-AML). These reciprocal translocations represent the first hierarchy in the WHO classification of AML. Several groups were able to characterise different and specific gene expression profiles of these subgroups in adults /PML-RARA, core-binding factor (CBF)-leukaemias, and acute megakaryocytic leukaemia with a 100% prediction accuracy in 130 children with AML. In conclusion, GEP confirms the status of these cytogenetic subtypes as distinct biologic entities provided in the WHO classification.The reciprocal translocations t/Trisomy 8 represents a frequent karyotype abnormality in AML as well as isolated change as in combination with other abnormalities. With respect to this chromosomal abnormality in AML, a complete separation with GEP from AML with normal karyotype was not possible in the study of AML1-ETO, inv(16)/CBFB-MYH11, MLL rearrangements, trisomy 8 as sole abnormality, and normal karyotype in 150 cases (RAD21 (1.7-fold), which is involved in double-strand break repair and has antiapoptotic funtion in AML. This confirms the separation of this AML subtype from other cytogenetic subgroups.Because of its very poor clinical course and its characteristic, but not yet well understood biologic features, AML with a complex aberrant karyotype is an outstanding subtype. 50 cases . The disFLT3 kinase, partial tandem duplications within the MLL gene with its many funtions in haematopoiesis, and NPM1 mutations, which affect a nucleocytoplasmic shuttle protein with involvement in a tumour-suppressor-pathway. These molecular markers are not randomly distributed, but are associated with distinct cytogenetic subgroups and represent for some part independent prognostic parameters.Forty-five per cent of all AML patients show a normal karyotype and represent the largest subgroup. In recent years, the spectrum of recurrent molecular mutations in AML has considerably broadened. Around 75–80% cases of normal karyotype can now be further classified by molecular methods. For example, the heterogeneous mutations affect receptor tyrosine III kinases such as the FLT3 length mutations (FLT3-LM) represent a frequent molecular mutation in AML found in 23% of all cases and in 40% of all normal karyotype, and are highly associated with a negative prognosis. FLT3-LM to normal bone marrow samples, AML with t/AML1-ETO, inv(16)/CBFB-MYH11, t/PML-RARA, MLL-translocations, trisomy 8, and complex aberrant karyotype. The FLT3-LM group was discriminated from trisomy 8 cases with 97% accuracy and from all other karyotypically aberrant AML groups with 100% accuracy. However, it was not possible to discriminate within AML with normal karyotype between those with and without FLT3-LM. Neither was it possible after including point mutations in the tyrosine kinase domain (FLT3-TKD) cases into the FLT3 mutated group. Within the distinct cytomorphologic FAB subgroups, however, a clear separation between FLT3-LM positive and negative cases was accomplished. The 20 top discriminative genes varied substantially between the diverse FAB subtypes, although many are downstream target genes of FLT3. These data suggest that the effects of a mutationally activated FLT3 receptor may be different, depending on a primary genetic alteration or the composition of different genetic alterations in addition to the FLT3-LM. These additional alterations may vary between the distinct morphological subtypes, and thus cause a differentiation block at different levels in haematopoiesis.The FLT3-LM and FLT3-TKD, with up to 100% accuracy. This did not apply to NRAS mutations and NRAS wild-type samples, suggesting that only FLT3-LM and FLT3-TKD are associated with a specific signature occur mainly in cytogenetically normal AML and are prognostically unfavourable. It was not possible to define a specific expression profile discriminating positive from negative cases /PML-RARA, inv(16)/CBFB-MYH11), but also by particular genetic mutations and abnormal oncogene expression (EVI1). Thus, GEP seems suitable for the characterization of the large subgroup of AML with normal karyotype. Bullinger was able to separate distinct subgroups with different prognosis within AML and normal karyotype on specific GEPs.Following the results of TEL-AML1/t fusion transcript with its high frequency in childhood ALL and its favourable prognosis represents a distinct gene signature in ALL , BCR-ABL/t, TEL-AML1/t, MLL/11q23 rearrangements, and hyperdiploid karyotype. BCR-ABL and t/MLL-AF4, B-ALL with t/IgH-c-MYC, respectively, and precursor T-ALL.In the above-mentioned study, BCR-ABL gene expression pattern in Philadelphia-positive ALL was identified as more heterogeneous, similar to ALL without known molecular rearrangements in the study of In contrast to most genetic ALL subtypes that could be associated to distinct gene signatures, the The major role of cytogenetic aberrations in the characterisation of acute leukaemia entities has further been proven in an analysis of ALL cases comparing the respective gene expression signatures in children and adults /BCR-ABL. This is in accordance with other analyses demonstrating the difficulty in identifying a specific gene expression signature for B-precursor ALL with t/BCR-ABL (LYL1-positive cases were distinguished from early cortical thymocyte and HOX11-positive cases as well as from TAL1-positive late cortical thymocyte cases.However, cortical T-ALL were found to show distinct clusters from immature T-ALL cases; yet, there was a large overlap between Pro-T-ALL and Pre-T-ALL and even biphenotypic acute leukaemias carrying both T-lymphatic and myeloid features . AccordiSeveral papers used GEP as a global approach for the diagnosis in acute leukaemias (In the past years, several studies further investigated the prediction of response to therapy and biologically directed class discovery using GEP in leukaemia. However, this review is intended to cover only the diagnostic possibilities of microarrays, so these important aspects and contributions cannot be demonstrated in detail.The introduction of microarray technology has been a major step towards the comprehensive biologic characterisation of various diseases and will clearly allow the identification of yet unknown subentities and even new biologically defined entities. In particular, it has become clear that distinct cytogenetically defined subtypes in leukaemia have very specific underlying gene expression profiles that can be used to identify these subtypes based on microarray analyses with very high accuracy. The problems concerning the prediction of some less well-defined leukaemia subclasses might lead to the interpretation that these might not represent real subgroups but rather a heterogeneous mixture of different leukaemias; however, GEP might provide a tool to further delineate the respective subtypes.It is expected that the routine application of microarrays will significantly improve molecular diagnostics in leukaemia and willin situ hybridisation, and quantitative and nonquantitative molecular genetics. This is costly, time-consuming, and requires skilled personnel in centralised reference laboratories. Based on GEP, substantial steps forward have already been made in the direction of both optimising the diagnostic capabilities and reducing the financial reserves. A significant number of today's diagnostic approaches can already be reproduced by GEP, and further clinical trials are on the way to assert the validity of this approach for diagnosis, prognostication, and individual treatment decisions.The adequate diagnosis and subclassification of leukaemias today is based on a combination of various methods including cytomorphology, cytochemistry, multiparameter immunophenotyping, cytogenetics, fluorescence

Metabolically active cells require robust mechanisms to combat oxidative stress. The cytoplasmic thioredoxin reductase/thioredoxin (Txnrd1/Txn1) system maintains reduced protein dithiols and provides electrons to some cellular reductases, including peroxiredoxins.txnrd1 gene, encoding Txnrd1, was specifically disrupted in all parenchymal hepatocytes. Txnrd1-deficient livers exhibited a transcriptome response in which 56 mRNAs were induced and 12 were repressed. Based on the global hybridization profile, this represented only 0.3% of the liver transcriptome. Since most liver mRNAs were unaffected, compensatory responses were evidently effective. Nuclear pre-mRNA levels indicated the response was transcriptional. Twenty-one of the induced genes contained known antioxidant response elements (AREs), which are binding sites for the oxidative and chemical stress-induced transcription factor Nrf2. Txnrd1-deficient livers showed increased accumulation of nuclear Nrf2 protein and chromatin immunoprecipitation on the endogenous nqo1 and aox1 promoters in fibroblasts indicated that Txnrd1 ablation triggered in vivo assembly of Nrf2 on each.Here we generated mice in which the Chronic deletion of Txnrd1 results in induction of the Nrf2 pathway, which contributes to an effective compensatory response. Liver metabolic pathways support organismal homeostasis and detoxify xenobiotics In addition to these constitutive antioxidant systems, hepatocytes have inducible oxidative stress-response pathways txnrd1 gene is lethal in embryogenesis Txnrds are ubiquitous flavin-containing NADPH-dependent enzymes that restore oxidized Txn to a reduced dithiol state txnrd1 allele, entitled condtxnrd1, that converts to a true null (−txnrd1) upon expression of Cre albCre transgene , in which Cre recombinase is expressed exclusively and constitutively by hepatocytes cond/−txnrd1;1albCre and cond/condtxnrd1;1albCre mice, in which all hepatocytes should be −/−txnrd1. Although Txnrd1 is required for embryonic development cond/+txnrd1;0albCre mice served as controls.We previously reported generation of a mouse line bearing a conditional-null cond/−txnrd1;1albCre adults exhibited 80% allelic conversion . An enzymatic assay that measured the combined activities of all Txnrd and GSR enzymes showed a two-fold lower signal in lysates , which w lysates .cond/−txnrd1 progenitor/stem cell population, we generated mice with mosaic livers in which a subset of hepatocytes were converted to −/−txnrd1 by a single intravenous inoculation with replication-defective adenovirus expressing Cre (AdCre) mT-mGROSA indicator allele, which drives ubiquitous red fluorescence in all cells not exposed to Cre and green fluorescence in cells that have been exposed to Cre txnrd1 allelic conversion (−/−txnrd1 (green) hepatocytes persisted, indicating that they were not a rapidly turned-over population reliably differed by 1.5-fold or more , showed higher levels in the −/−txnrd1 nuclei were fused to a luciferase cassette to generate nqo1-luci and aox1-luci reporter plasmids. cond/condtxnrd1;mT-mG/+ROSA MEF cultures were split and portions were transduced with either AdCre or AdGFP (control). After allowing time for pre-formed Txnrd1 protein to decay, cells were transfected with the reporter plasmids. A CMV promoter-driven plasmid was used to control for differences in transfection efficiencies that might result from Txnrd1 disruption and luciferase activities were measured two days later located in the proximal promoter aox1 is not well characterized; however, we identified two putative AREs located in this region. Also, more than half of the xenobiotic/drug metabolism mRNAs that were induced in the −/−txnrd1 liver transcriptome are not, themselves, selenoproteins Txnrd1 is a selenoprotein. All known selenoproteins are oxidoreductases in which a selenocysteine residue in the carboxyl terminus plays a role in enzyme catalysis at the active site of the protein albCre-dependent disruption of this locus in hepatocytes results in animals that survive for only 1- to 3-months, after which they succumb to systemic failure associated with hepatocytic and adipocytic necrosis Disruption of the selenocysteine tRNA locus results in concerted inactivation of all selenoproteins (“selenoprotein-null”), including Txnrd1 −txnrd1 and condtxnrd1 alleles have been reported previously tm4Luo(ROSA)26SormT-mGROSA”) allele, the tm1(cre/Esr1)Nat(ROSA)26SorCreERROSA”) allele, and Tg(Alb-cre)21Mgn albCre”) mice were purchased from Jackson Labs . Genotypes were determined molecularly for all animals by PCR on genomic DNA using primers indicated in All mice were kept under specialized care conditions with a 14 h∶10 h light:dark cycle. Mice bearing the Mouse embryo fibroblast cultures (MEFs) were established from E12.5 mouse fetuses as described previously Liver RNA samples were evaluated on Affymetrix mouse version 430 2.0 microarrays. Because liver gene expression may respond to circadian time, feeding, gender, and age, young male animals were singly housed for ten days and harvested between 2:00 and 2:30 p.m. Liver RNA was purified as described Neurospora−/−txnrd1 hepatocytes in mouse livers were acyclic or cycle-shifted, fixed-timed harvests would not control for circadian defects and could impact transcriptome data. Therefore, experimental or control mice as above were harvested at 4 h intervals. Levels of mRNA encoding the D site-binding protein, DBP, an mRNA with a strong circadian cycle albCre-driven disruption of Txnrd1 . Probe-sets with an average raw value of ≥50 units across all eight arrays were considered above background and were used for further analysis. Of the 45,101 probe-sets on the arrays, 25,565 met this cut-off. Hybridization signals for each probe-set were considered significantly different between experimental and control samples if they differed by 1.5-fold and had a RT-PCR reactions used oligo(dT)-primed cDNAs generated from total RNA preparations with the exception of nuclear pre-mRNA RT-PCR analyses (see below). General reaction conditions were described previously Because commercial antibody raised against Nrf2 oligopeptide antigen proved to be of inadequate quality for these studies (data not shown), we generated our own affinity purified rabbit-anti-mouse Nrf2 antibody. A cDNA fragment corresponding to positions 237 through 2093 of the mouse Nrf2 mRNA (GenBank NM_010902), which encodes the entire Nrf2 open reading frame, was amplified by RT-PCR from C57Bl/6J mouse liver RNA, inserted into pET13a (Novagen) and pGEX4T-1 (Amersham Biosciences) expression vectors, and verified by sequencing. His-tagged recombinant Nrf2 protein was affinity purified on a Ni-column, dialyzed, and used to generate antisera in rabbits. Antibody was affinity purified using the recombinant GST-tagged Nrf2.http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis indicates that Schistosomes have a single GST protein, which has regions of high amino acid identity with mouse α- and μ-class GSTs but only more scattered identity with other mouse GST classes (not shown). Incubations with horseradish peroxidase-conjugated secondary antibody were performed for one hour. Signals were detected using the Supersignal West Pico chemiluminescence system (Pierce).Proteins were separated by SDS-polyacrylamide gel electrophoresis and were transferred onto nitrocellulose membranes. Membranes were blocked in 10% non-fat milk in 1× PBS containing 0.5% Tween-20 and were incubated overnight with primary antibody. Rabbit-anti-Txnrd1 , rabbit-anti-Nrf2 (this study), and goat-anti-schistosome GST polyclonal antibody polyclonal antibodies were used at 1∶300, 200ng/ml, and 1∶500 dilutions, respectively. BLAST and four with AdCre , as above. Dishes were cross-linked with 10 ml of buffer containing a final concentration of 0.93% formaldehyde at room temperature for 10 min. Cross-linking was stopped by adjusting to 120 mM glycine, incubating at room temperature for 5 min, and washing twice with 1× PBS. Rinses were aspirated to completion and cells were harvested by scraping in a total of 5 ml (for 4 dishes) of 10 mM Tris, pH 8, 0.5 mM EDTA, 85 mM KCl, 0.5% Triton X-100, 1× protease inhibitors, 1 mM PMSF. Nuclei were pelleted at 1000×g for 10 min at 4°C, resuspended in 1 ml 50 mM Tris, pH 8, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM EDTA. Chromatin was sheared to 400–1000 bp average-length fragments by sonication and debris was removed by centrifugation at 13,000 r.p.m., 10 min, in a microfuge. DNA was purified from a portion of the supernatent by extraction with phenol/chloroform and precipitation with ethanol, and the DNA concentration and size were verified by spectrophotometry and electrophoresis, respectively. An equal amount of input chromatin (50 µg) was used in each immunoprecipitation; the “input” lanes on gels contained 5% as much chromatin (2.5 µg). To reduce non-specific background, chromatin samples were pre-adsorbed with 20 µl of a 50% slurry of protein-A/G agarose beads that had been pre-blocked with sheared salmon sperm DNA and washed extensively with immunoprecipitation buffer. Immunoprecipitations used 25 µl affinity purified anti-Nrf2 antibody or 25 µl of rabbit-anti-HA as a matched control, and 40 µl of the blocked protein-A/G agarose bead slurry. Washes were as described previously ChIP assays were performed as previously described Unless otherwise indicated, all specialized reagents and substrates for enzyme assays were from Sigma. Mouse livers were homogenized by pulse sonication in ice-cold 1× PBS, pH 7.4, containing 1 mM PMSF and 1× protease inhibitor. Proteins were extracted by addition of Triton X-100 to a final concentration of 1% followed by incubation on ice for 30 min. Debris was removed by centrifugation. Combined reductase activities were determined using 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) as described previously For pull-down assays, Triton X-100-solubilized liver extracts were incubated with glutathione-agarose beads (Sigma G-4510). Beads were washed 3 times with ice-cold 1× PBS, pH 7.4 containing 0.5% Triton X-100 and 0.1 mM PMSF. Bound proteins were eluted by boiling 10 min in loading buffer were separated on SDS-polyacrylamide (10%) gels.aox1 and nqo1 genes amplified from C57Bl/6J genomic DNA using the primers indicated in nqo1, sequences spanned from −985 to +116 from the cap site; for aox1, sequences spanned from −886 to +4. Resultant plasmids “nqo1-luci” and “aox1-luci” were sequenced and were used in transfections of MEFs prepared as described above. Control transfections were performed with pGL3 vector containing 499 bp of the CMV promoter, CMV-luc. Cells were transduced with 1.5×108 PFU of either AdGFP or AdCre. Two days post-transduction, cultures were seeded into 12-well dishes and transfected in triplicate with 1.6 µg of luciferase reporter plasmid using NovaFector transfection reagent . Luciferase activity was measured two days post-transfection.The proximal promoter sequences of the 2O2 for 10 min at room temperature and sections were blocked with 5% BSA in 1× PBST for one hour. Incubation with affinity purified anti-Nrf2 antibody was performed overnight at room temperature followed by standard washes and one-hour incubation with goat HRP-conjugated anti-rabbit IgG (Bio-Rad). Following washes, sections were developed using diaminobenzamidine at pH 7.0 and counter-stained with hematoxylin.Livers were fixed in formalin and embedded in paraffin. Deparaffinized sections (5 µm) were either stained with H&E or used for immunohistochemistry. For antigen retrieval, sections were heated in 100 mM sodium citrate, 90°C, for 10 min followed by gradual cooling to room temperature. Endogenous peroxidases were inactivated with 0.3% HFigure S1mT-mGROSA allelic conversion and condtxnrd1 conversion (A) Efficiency of mT-mGROSA conversion in primary mouse embryo fibroblasts (MEFs). Primary fibroblast cultures were initiated from E12.5 cond/condtxnrd1;mT-mG/+ROSA fetuses. Cultures were transduced with 1 x 108 PFU AdCre vector and were photographed one- and three-days later . At 1d, most MEFs exhibited both red and green fluorescence; by 3d, MEFs were either red (non-converted) or green (converted and the red-fluorescent tdTomato protein had decayed). Cell counts revealed that ∼90% of the MEFs converted to green fluorescence. (B) Efficiency of txnrd1cond conversion in MEFs. DNA was isolated from the cultures at 1, 3, and 5 days after transduction and relative levels of the txnrd1cond allele (top panel), the txnrd1- allele (middle panel), and an arbitrary genomic control allele were measured by PCR. As a control with equimolar representation of both of these txnrd1 alleles, DNA from a cond/−txnrd1 mouse was used (second lane from right). n.t., no template control.Correlation between (0.24 MB JPG)Click here for additional data file.Figure S2txnrd1−/− hepatocytes in mice (A) All hepatocytes in aged txnrd1cond/-;ROSAmT−mG/+;albCre1 mice exhibit allelic conversion. Panels show red, green, and merged red + green + blue fluorescence of a cryosection of liver from a 280 day−old mouse. Capillaries are lined with red-membrane cond/−txnrd1 endothelium (white arrows) because these cells do not express albCre. Other non-hepatocytic cell types, such as Kupffer cells, would also not express albCre and would be cond/−txnrd1 and red. All hepatocytes have green membranes. Scale bars 50 μm. (B) Persistence of −/−txnrd1 cells and/or their progeny. condtxnrd1cond/;mT-mG/mT-mGROSA dams were mated by cond/condtxnrd1;CreER/CreERROSA sires and at E14.5, dams received a single I.P. injection of 500 μg 4-hydroxy Tamoxifen (4OHT) in vegetable oil. At P22 (∼27 days after 4OHT administration) a pup was sacrificed and liver cryosections were prepared. Figure shows merged-color fluoromicrographs taken at low-, medium-, and high-magnification. Low magnification shows that the liver was mosaic, with ∼50% of cells being green −/−txnrd1 and 50% being red txnrd1cond/cond. Yellow arrows indicate binucleate green −/−txnrd1 hepatocytes. Because allelic conversion would only occur during a finite period following 4OHT administration, all green cells must either be cells, or be descendents of cells, that converted to −/−txnrd1 ∼27 days earlier, indicating that individual −/−txnrd1 cells are long-term viable.Extent and persistence of (7.57 MB DOC)Click here for additional data file.Figure S3cond/+txnrd1;albCre0 (control) and four cond/−txnrd1;1albCre adult male mice and lysates were prepared as indicated in Txnrd1-deficient livers do not accumulate oxidized glutathione or peroxidized lipids Livers were harvested from four (0.08 MB JPG)Click here for additional data file.Figure S4Disruption of Hepatocytic Txnrd1 Does Not Affect Diurnal Expression of DBP mRNA, a Circadian Regulated Transcript, in Liver or Kidney Young male mice of the indicated genotypes were singly housed for 10 days under a normal light cycle. Beginning on the 10th day, a single experimental and a single control animal were sacrificed at 4 h intervals for a complete 24 h cycle. Liver and kidney were harvested and RNA was prepared. Olio(dT)-primed RT-PCRs for the mRNAs indicated at left were performed on each sample. Primer sequences for each RT-PCR reaction are in (0.16 MB JPG)Click here for additional data file.Table S1http://www.ncbi.nlm.nih.gov/geo/, accession number GSE16381. b Difference is fold-change, with positive values being higher and negative values being lower in −/−txnrd1 livers. c Average signals for the four biological replicates of the genotype with higher mRNA abundance. For mRNAs with a positive difference value, the −/−txnrd1 average signal is given; for mRNAs with negative difference values, the cond/+txnrd1 average signal is given. d Average signal of three replicates is given e The probe-set used for this entry does not distinguish between Gsta1 and 2.a Transcriptome data from the livers of four animals of each genotype is presented. For inclusion, a probe-set had to show > 1.5-fold difference in abundance between genotypes, an average hybridization value across all 8 arrays of 50 units, and a p-value of < 0.05. In cases where multiple probe-sets for a single gene existed, only one is shown. All raw data are publicly available in the Geo system at (0.11 MB DOC)Click here for additional data file.Table S2aox1 or nqo1 genes for reporter constructs or for cloning Nrf2 open reading frame (ORF) for recombinant protein expression.a All primers are designed using mouse sequences; however some have non-mouse 5' extensions. b Genomic primers for genotyping and in ChIP assay. c RT-PCR designed to cDNA sequences. Most but not all span at least one exon/exon junction. d Primer sets used for cloning proximal promoter regions of (0.61 MB DOC)Click here for additional data file.

For the first time we describe an increase in T cell IL-4 and decrease in IFN-γ expression after a positive challenge with rice (i.e. rice triggered a FPIES attack) and an increase in T cell IL-10 expression after rice challenge 6 months later after a negative challenge in an 8 month old with documented FPIES to rice. A Th2 activation associated with high IL-4 levels may contribute to the pathophysiology of the disease. On the other hand, T cell-derived IL-10 may play a role in the acquisition of immunotolerance by regulating the Th1 and Th2 responses.Food protein-induced enterocolitis syndrome (FPIES) is a non-IgE-mediated food allergy characterized by severe vomiting, diarrhea, and often failure to thrive in infants. Symptoms typically resolve after the triggering food-derived protein is removed from the diet and recur within few hours after the re-exposure to the causal protein. The diagnosis is based on clinical symptoms and a positive food challenge. In this study, we report a case of FPIES to rice in an 8-month-old boy. We performed a double-blind placebo-controlled food challenge (DBPCFC) to rice and we measured the intracellular T cell expression of interleukin-4 (IL-4); IL-10, and interferon Most ofs of age . Moreoveth FPIES –12. Accoth FPIES .An 8-month-old male infant came to our observation for multiple food intolerance and failure to thrive. He had been exclusively breast fed until the age of 4 months, when a partially hydrolyzed cow based whey formula was introduced by the pediatrician due to the mother's agalactia and family history of atopy. The child started to present vomiting and diarrhea after each feeding and a progressive failure to thrive. Blood, feces, and urine exams did not show any sign of infection, blood loss, or anaemia. Suspecting a milk intolerance, an extensively hydrolyzed whey formula was introduced with resolution of the symptoms. Between age of 5 to 7 months, wheat baby cereals and various fruits were introduced without reaction. At the age of 7 months, 50 g of boiled rice was given for the first time. After 4 hours the child had severe vomiting, diarrhea, apnea, and lethargy. The parents took the child to the Emergency Room of a local hospital, where a new feed with 10 g of boiled rice caused the previously described symptoms. The child received intravenous fluid resuscitation and was then transferred to our hospital, Meyer Children's Hospital, University of Florence, Italy, for further evaluation.At admission he was in good general condition, afebrile. His weight was 6920 g (3 percentile) and his height was 71 cm (50 percentile). The physical and neurological exams were irrelevant. Routine blood exams were unremarkable, in particular total IgE level (1 IU/mL), antibodies against endomisius, IgA anti-alpha gliadine and IgG anti-alpha gliadine, ammonium, lactic acid, sweat test, and hemogas analysis were normal. Skin prick test and RAST for major foods , thorax X-Ray, and abdomen sonogram were negative. An endoscopy with duodenal biopsy showed aspecific signs of inflammation.During the hospitalization, open challenges with ricDBPCFC with increasing doses (up to a cumulative dose of 20 g of boiled rice) was performed according to Sicherer protocol . 6 cell/mL) in 24-well plates (Biorad) in RPMI-1640 supplemented with Fetal Bovine Serum at 37°C in 5% CO2 in presence of monensin . After a 6-hour culture, cells were fixed in cold PBS containing 2% paraformaldeheyde and stained for intracellular cytokines as previously described [γ, IL-10 Phycoerythrin (PE) conjugated monoclonal antibodies (mAbs) (rat IgG1 purchased from Pharmingen) and anti-CD3 fluorescein isothiocyanate conjugated (FITC) mAb (Mouse IgG1 purchased from Pharmingen) for 30 minutes on ice. Finally, the cells were analyzed on FACSscan flow-cytometer (Becton Dickinson). Twenty thousand cells were acquired into the list mode and the data were analysed with CELLQuest software (Becton Dickinson). Analysis gates were set on lymphocytes according to forward- and side-scatter properties. Results were expressed as the percentage of cytokine-producing cells in each CD3+ cell population.Peripheral Blood Mononuclear cells (PBMCs) were isolated from heparinised blood by Lymphoprep (Bioclinic) density centrifugation and cultured (4 × 10γ), Th2 (IL-4), and Treg (IL-10) cytokine expression in CD3+ cells. About 4 hours after the challenge with rice, the child started to have severe vomiting, diarrhea, and lethargy, requiring intravenous fluid resuscitation. Differences in the blood count before and after the challenge were observed only in the total white blood cells (WBC) (8800 cells/mm3 versus 10300 cells/mm3) and in lymphocytes (4300 cells/mm3 versus 5900 cells/mm3). No difference was observed in total neutrophils (2800 cells/mm3 versus 2600 cells/mm3) and PLTs (340000 cells/mm3 versus 350000 cells/mm3) counts. The CD3+ intracellular cytokine analysis in postchallnge PBMCs revealed a 1.9 folds increase of IL-4 expression and a 2.4-fold decrease in IFN-γ expression (We hypothesized that a different Th1/Th2/T regulatory (Treg) cytokine expression is induced in peripheral blood lymphocytes in children with FPIES in relation to their tolerance of a triggering food derived protein. In order to test our hypothesis, we performed a DBPFC following Sicherer protocol with boipression . No diffNo differences in blood count and in the intracellular cytokines before and after a challenge with 100 g of Nutrilon Pepti-plus were observed (data not shown). γ (2.09 % versus 4.9%) and slightly reduce IL-10 levels (1.3 versus 0.7%). After the negative rice challenge we observed a 7.68-fold increase of IL-10 expression in CD3+ cells and 2.07-fold decrease in IL-4 expression. No differences were found in IFN-γ levels after challenge (After six months we performed again a DBPCFC with boiled rice and we did the same laboratory determinations. The child did not have any reaction . No diffhallenge . No diffIn this study, we firstly report the modification of the intracellular Th1/Th2/Treg cytokine expression in CD3+ cells following a challenge with boiled rice, in a child affected by FPIES with multiple food intolerance. We did not find the described rise in the absolute neutrophils or PLTs count , howeverγ expression in peripheral T cells (γ suggesting a more prominent Th1 profile. After a clinically negative rice challenge that demonstrated an achieved tolerance for the tested food we observed a 7.68-fold increase in IL-10 expression in CD3+ cells (β [γ in the development of tolerance.A challenge with boiled rice which caused gastrointestinal as well as systemic symptoms, induced an increase in IL-4 and a decrease in IFN- T cells . The inc3+ cells . This stcells (β and T recells (β . On the cells (β . The res

Rhizoxin is a tubulin-binding anti-neoplastic agent which is active in a range of murine tumour models. The recommended schedule, of intravenous (i.v.) bolus administration at a dose of 2 mg m-2 every 3 weeks, has been assessed in three phase II trials of ovarian, renal and colorectal cancer. In general terms the drug was fairly well tolerated, but the response rate was disappointing: 0/18, colorectal cancer; 0/18, renal cancer; 1 partial response (PR)/17, ovarian cancer.

Adenocarcinoma of the ovary is an aggressive neoplasm which often metastasizes to the lung or liver. Metastases rarely occur to the pancreas, but a tissue diagnosis is required to confirm this event. Although most tumors of the pancreas are primary pancreatic neoplasms, metastatic lesions have been reported most commonly as arising from renal cell carcinoma.We report the case of a 51-year-old Caucasian woman with ovarian mucinous adenocarcinoma with metastasis to the head of the pancreas that was originally misdiagnosed as a pancreatic primary tumor.Mucinous ovarian adenocarcinomas rarely metastasize to the pancreas. New pancreatic lesions should be investigated through tissue biopsy and tumor markers, while keeping an open-minded differential diagnosis to avoid a misdiagnosis or a delay in treatment. Although most malignant tumors of the pancreas are primary pancreatic neoplasms, metastatic lesions have been reported most commonly as arising from renal cell carcinoma. Here we present a case of mucinous adenocarcinoma of the ovary that metastasized to the pancreas. The tumor was first diagnosed as a primary pancreatic tumor. Ovarian adenocarcinoma can have distant metastases, but these are most often to the liver or lung. Metastasis to the pancreas is quite rare, and a delay in its diagnosis may occur if the pancreatic tumor is not identified as a metastatic disease.A 51-year-old Caucasian woman complained of fatigue, epigastric discomfort, a left neck mass, and a 10-pound weight loss over the previous six months. Her physical examination revealed supraclavicular lymphadenopathy.A cervical lymph biopsy revealed moderately well-differentiated adenocarcinoma, possibly of pancreatic origin. A metastatic workup including positron emission tomography (PET) scan, computed tomography (CT), bone scan, and breast and pelvic ultrasounds was done. Significant cervical, retrosternal and retroperitoneal lymphadenopathy were seen. A 3.5 × 5-cm pancreatic head mass which blended into the porta hepatis was also noted. The mass encased the left gastric artery and involved the portal vein margins. Multiple liver lesions were also seen. Except for a fibroid uterus, her pelvic CT and ultrasound were unremarkable.A percutaneous liver biopsy of our patient revealed a moderately well-differentiated adenocarcinoma consistent with pancreatic origin. Her CA-19-9 level was 171.5.Our patient was then entered into a trial for advanced pancreatic adenocarcinoma using the tyrosine kinase inhibitor Dasatinib. Her response to the trial, however, was poor and a CT scan two months later showed no reduction in her tumor burden. She was removed from the Dasatinib trial and was started on Gemzar (gemcitabine) and Tarceva (erlotinib).Over the next seven months, our patient developed a moderate response to chemotherapy. However, she developed abdominal fullness and shortness of breath. In just a four-month interval between scans, her CT revealed a new 19 × 18 × 9 cm pelvic mass, ascites, and a large right-sided pleural effusion. A CT-guided biopsy revealed poorly differentiated adenocarcinoma. Metastatic malignant cells were also found in her pleural fluid.Because our patient experienced significant discomfort due to the effects of her pelvic mass, a palliative resection was performed. She had a transient response to chemotherapy, but her disease continued to progress with worsening ascites and pleural effusion.Pathology revealed that her pelvic mass measured 19.0 × 18.0 × 9.0 cm. Sectioning revealed a multi-loculated cystic mass involving her entire ovary Figure . The tumIn view of the presence of metastatic adenocarcinoma to the liver and a cervical lymph node Figure , as wellWhen her ovarian mass stained positive for CK7 but negative for CK20 and estrogen receptor, we repeated the stains on her liver and lymph node biospies, which proved to be a match to the ovarian tumor.The histologic and immunohistochemical findings of our patient's ovarian mass are consistent with the results of her lymph node and liver biopsies. We concluded that the mass was most likely from the ovary and not the pancreas, with the pancreatic mass representing another metastasis of her ovarian adenocarcinoma.Mucinous ovarian adenocarcinomas are uncommon and account for only 10% to 15% of reported cases of ovarian neoplasms . Tumors Often characterized by multiseptated cystic lesions of the adenexa, mucinous adenocarcinomas are filled with a gelatinous material that may freely rupture into the peritoneal cavity, thus causing a dissemination called "pseudomyxoma peritoni" . PseudomCarcinoma metastatic to the pancreas is uncommon and arises by direct extension from retroperitoneal or mesenteric lymph nodes or from isolated metastases to the pancreatic parenchyma . The mosDue to the low incidence of pancreatic metastasis, most masses of the pancreas are assumed to be primary pancreatic neoplasms. However, a tissue biopsy is required to truly differentiate between primary and secondary tumors . A delayDifferentiating primary from secondary pancreatic tumors is important in directing a patient's therapy, both in terms of chemotherapy and surgery. Whenever possible, the resection of pancreatic metastasis can be a reasonably safe palliative procedure . Distal Although most lesions of the pancreas are primary pancreatic neoplasms, a tissue biopsy should be obtained whenever possible to differentiate between primary and secondary tumors. Metastases of ovarian mucinous adenocarcinomas to the pancreas are rare, but have been reported in the literature. Confirmatory tissue biopsies, tumor markers, and being mindful of the possibility of metastatic disease can avoid misdiagnosis and delay in treatment for newly discovered pancreatic masses.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.DS researched the case and was a major contributor in writing the manuscript, particularly the case discussion. DC performed research, contributed in writing the case report, and edited the manuscript for its final version. MF performed the histological examination described in the case report and was a major contributor in writing the manuscript. GB was our patient's attending surgeon and provided information on our patient and contributed to the writing of the manuscript. JA was the primary care provider involved in the case, and similarly provided patient information and contributed in writing the manuscript. All authors read and approved the final manuscript.

Post-transplant anaemia remains a common problem after kidney transplantation, with an incidence ranging from nearly 80% at day 0 to about 25% at 1 year. It has been associated with poor graft outcome, and recently has also been shown to be associated with increased mortality.Our transplant unit routinely administers oral iron supplements to renal transplant recipients but this is frequently accompanied by side effects, mainly gastrointestinal intolerance. Intravenous iron is frequently administered to dialysis patients and we sought to investigate this mode of administration in transplant recipients after noticing less anaemia in several patients who had received intravenous iron just prior to being called in for transplantation.This study is a single-centre, prospective, open-label, randomised, controlled trial of oral versus intravenous iron supplements in renal transplant recipients and aims to recruit approximately 100 patients over a 12-month period. Patients will be randomised to receive a single dose of 500 mg iron polymaltose (intravenous iron group) or 2 ferrous sulphate slow-release tablets daily . The primary outcome is time to normalisation of haemoglobin post-transplant. Prospective power calculations have indicated that a minimum of 48 patients in each group would have to be followed up for 3 months in order to have a 90% probability of detecting a halving of the time to correction of haemoglobin levels to ≥110 g/l in iron-treated patients, assuming an α of 0.05. All eligible adult patients undergoing renal transplantation at the Princess Alexandra Hospital will be offered participation in the trial. Exclusion criteria will include iron overload (transferrin saturation >50% or ferritin >800 μg/l), or previous intolerance of either oral or intravenous iron supplements.If the trial shows a reduction in the time to correction of anaemia with intravenous iron or less side effects than oral iron, then intravenous iron may become the standard of treatment in this patient group. Post-transplant anaemia (PTA) remains a common problem after kidney transplantation, with an incidence ranging from nearly 80% at day 0 to about 25% at 1 year . It has PTA may occur at any time after renal transplantation. Early PTA (post surgery until 3 months) is most likely to be related to pre-transplant anaemia, the surgery itself, iron deficiency, immunosuppression and infection ,7. PTA iOur unit routinely administers oral ferrous sulphate to all post transplant patients, however this is not without problems including gastrointestinal intolerance, and interference with the absorption of immunosuppressant medications by leading to significant constipation.Recently, we have observed that several dialysis patients serendipitously given intravenous iron for treatment of iron deficiency anaemia immediately prior to transplantation, have had better Hb levels in the post-transplant period, without needing oral iron supplementation. In a retrospective case series, Gillespie and Symonds used intravenous ferrous gluconate to treat 15 paediatric and young adult renal transplant recipients and found that doses of up to 250 mg induced a statistically significant increase in mean haemoglobin levels. There were only 4 adverse events reported in 3 patients, all self limiting and none life threatening . However®) may be superior to a protracted course of oral iron.We surmise that giving a single dose of intravenous iron , approval number 2007/142.Inclusion criteria will include new living-donor or deceased-donor renal transplant recipients aged 18 years or over who are able to give written informed consent. Exclusion criteria will include iron overload (transferrin saturation >50% or ferritin >800 μg/l), women lactating, pregnant or of child-bearing potential not using a reliable contraceptive method, patients with a history of psychological illness or condition which interferes with their ability to understand or comply with the requirements of the study, patients who have received a new investigational drug within the last 4 weeks, and intolerance of intravenous or oral iron supplements.This is an open-label, randomised, controlled clinical trial in which the primary outcome measure will be the mean time to resolution of PTA (defined as Hb ≥110 g/l). Patients meeting the inclusion criteria and consenting to participate in the study will be randomly allocated in a 1:1 ratio to either (a) oral iron (ferrous sulphate slow-release 2 tablets mane – the most common current practice in the transplant unit) or (b) intravenous iron polymaltose as a 500 mg single dose given within the first 5 days after transplantation. Randomisation will occur by the use of sequentially numbered, sealed, opaque envelopes with stratification for calcineurin inhibitor type (cyclosporin or tacrolimus).Immunosuppressive therapy will be managed according to the unit's standard protocols. Patients will have blood tests checked as per the unit's follow up protocol for recent transplant recipients. We will collect full blood count, renal function, and calcineurin inhibitor trough levels on a weekly basis, as well as iron studies, B12, and folate at one monthly intervals.Prospective power calculations have indicated that a minimum of 48 patients in each group would have to be followed up for 3 months in order to have a 90% probability of detecting a halving of the time to correction of haemoglobin levels to ≥110 g/l in iron-treated patients, assuming an α of 0.05.Each patient will be observed closely during the period of the study looking for adverse events and if any occur they will be documented on a Case Report Form. Any significant adverse events will also be notified to the P.A. Hospital Research Ethics Committee.Gastrointestinal adverse effects will be defined as the onset of nausea, vomiting, abdominal cramping or diarrhoea. Infusion related reactions will be described as self-limiting flushing sweating, chills, myalgias, arthralgias, bronchospasm and chest pain occurring at the time of the infusion. All infectious episodes and the results of subsequent microbiological investigation will be recorded during the study period.As far as the authors are aware, this will be the first randomised trial of intravenous versus oral iron supplementation for PTA in kidney transplantation. If the trial shows a reduction in the time to correction of anaemia with intravenous iron or alternatively if there is no difference but fewer side effects than oral iron, then intravenous iron may become the preferred treatment in this patient group.The authors declare that they have no competing interests.DM conceived the study, edited the ethics submission, secured the funding and oversaw the running of the trial. KST wrote the ethics submission and supervised recruitment of patients. RM recruited patients. CH performed the statistical power calculations. DJ, SC, NI, CVE and DN all assisted in the trial design and protocol. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2369/10/14/prepub

However, the genotyping of five AI rams producing descendants with this phenotype, failed to reveal any of the known functional MSTN mutations.A phenotype of increased muscle mass (IMM) and reduced fat, comparable to reported effects of deleterious mutations in the MSTN gene was sequenced in a Spælsau ram lamb with this particular phenotype. A one base-pair insertion mutation (c.120insA) producing a premature stop codon in amino acid position 49 was identified. The consequence of this mutation is that the bioactive carboxy-terminal end of the protein is not translated, and a completely non-functional myostatin protein is produced. Among the 98 available AI rams of this breed, all five individuals having descendants with this particular phenotype were found to be heterozygous for the c.120insA mutation. The probability that these five selected AI rams should be heterozygous carriers of the c.120insA mutation purely by chance was calculated to be 3.1 × 10-7. In total, 7 AI rams were found to be heterozygous carriers of c.120insA. The estimated breeding values (EBVs) for EUROP carcass conformation and fat class for these 7 individuals also points towards a strong phenotypic effect of this mutation.In the present study, the coding region of the c.120insA mutation has on myostatin protein function, and the documented phenotypic effect of comparable MSTN mutations in Norwegian White Sheep and other species, we conclude that this mutation is the functional explanation underlying the IMM phenotype in Norwegian Spælsau. The allele distribution among the 98 genotyped AI rams support this conclusion, and also suggests that c.120insA is the most common reason for this phenotype in the Norwegian Spælsau breed.Based upon the completely deleterious effect this novel In the tation c.360G>A idc effect . In the 3) from a Spælsau ram lamb showing the characteristic increased muscle mass (IMM) phenotype were collected and stored in RNA later™ . The IMM lamb was assessed in a commercial abattoir, with a scoring of 12 for carcass conformation class and 2 for fat class , according to the EUROP classification in Norway [Muscle samples for carcass conformation and low EBVs for fat. See Eikje et al for deta® , and the isolated RNA was treated with DNase I (Applied Biosystems). Subsequent synthesis of cDNA followed manufacturer's instructions and combined 1 μg RNA in a 20 μl reaction together with a poly dT-primer and SuperScript™ II Reverse Transcriptase (Invitrogen). Genomic DNA was isolated from semen according to standard protocols.Total RNA was extracted with TRIzolMSTN coding region was amplified using two primer pairs . DNA was amplified using AmpliTaq Gold® using denaturation for 10 min at 95°C, and 40 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 1.5 min. The resulting F1083/R0997 fragment (864 bp) was cloned into the pGEM®-T Easy Vector and sequenced with primers Sp6 and M13, while the F0790/R1566 product (777 bp) was sequenced directly using F0790 and R1566 as sequencing primers. A BigDye® Terminator v3.1 kit and a ABI 3730 instrument (Applied Biosystems) was used for all sequencing.The ovine All genotyping was performed using the Sequenom MassARRAY platform . Amplification MAF1, MAF2) and extension (MAE1) primers are described in Table , MAF2 anMSTN mutation were tested for the previously reported c.960delG [c.2360G>A mutations [MSTN cDNA sequence from this lamb (GenBank accession no. FM207636) was aligned to the corresponding sequence from an individual known to have normal muscle mass (NMM) (GenBank accession no. AM992883). This alignment revealed a 1 bp insertion at nucleotide position 120; c.120insA (numbered according to first base of the translation start codon) in the IMM individual. The insertion of an adenine residue will disrupt the reading frame from amino-acid position 40 and onwards, and generate a premature stop codon at amino-acid position 49. This will generate a significantly truncated protein in the IMM individual compared to the 375 amino-acid protein in the NMM individual.Five AI rams identified as potential carriers of a .960delG and c.23utations . Neitherc.960delG [c.2360G>A mutation [c.120insA mutation identified in the present study. Seven individuals were found to be heterozygous for the c.120insA mutation, and all five AI rams identified as potential IMM carriers were found in this group. The combinatorial probability of obtaining this outcome purely by chance is 3.1 × 10-7. The c.960delG mutation was not found in this material, while 8 individuals were heterozygous and 1 homozygous for the c.2360G>A mutation. No rams carried both the c.120insA mutation and the c.2360G>A mutation. In Figures 2 MSTN-genotypes, together with EBVs for EUROP carcass conformation and fat class, respectively, are presented for each AI ram. The EBVs are shown as deviations from the average of the corresponding EBV in the reference population. Fourteen of the older wildtype rams have missing EBVs, and are therefore not included in the figures.Ninety-eight Spælsau AI rams were genotyped for the .960delG , the c.2c.120insA individuals will not produce a functional myostatin protein. The c.960delG mutation in Norwegian White Sheep [MSTN mutations in both sheep and other species have already established the causal link between a non-functional myostatin protein and increased muscle mass and reduced fat. There is no reason to believe that a deleterious mutation like c.120insA identified in the present study, should produce a phenotype in Norwegian Spælsau deviating from this picture. The likelihood of c.120insA being the causal mutation for the Spælsau IMM phenotype is further strengthen by the fact that the five AI rams with high own EBVs [c.120insA, even in the heterozygous state.The functional domain of the myostatin protein is composed from amino-acid residues 267–375 [te Sheep , result c.2360G>A mutation is also present among the Spælsau AI rams, and this mutation could therefore potentially explain Spælsau IMM phenotypes. However, none of the five rams identified as potential mutation carriers based on phenotypic records have the c.2360G>A allele. This might be explained by the fact that while the c.120insA is completely deleterious to the myostatin protein, the c.2360G>A mutation is reducing the translation rate of the myostatin mRNA [c.120insA mutation, rather than the c.2360G>A mutation that only causes a reduced concentration of the myostatin protein. This is illustrated in Figures c.960delG mutation and c.2360G>A in Norwegian White Sheep [Genotyping revealed that the c.120insA is the functional reason for the pronounced IMM phenotype in the Norwegian Spælsau breed. The 98 genotyped AI rams are considered to be fairly representative of the present gene pool in Norwegian Spælsau. Therefore, we also suggest that c.120insA is the most common reason for IMM phenotype in this breed.We therefore conclude that The authors declare that they have no competing interests.IAB conceived the study and coordinated the sample collection, as well as selected the AI rams based on the SRS. DIV was responsible for the molecular genetics work, analysed the molecular data, and wrote the manuscript together with IAB. Both authors read and approved the final manuscript.

The effects and site(s) of action of progesterone on DMBA mammary carcinogenesis in the rat, when a small dose of the carcinogen was applied directly to the inguinal mammary gland, were investigated. No reduction in tumour yield was apparent when progesterone was administered s.c. for 18 days before dusting DMBA. This finding contrasts with a previously reported inhibitory effect on carcinogenesis when hormone treatment was followed by intragastric administration of DMBA. When progesterone injections were begun either 2 days before or 2 days after direct application of DMBA, and were continued until the end of the experiment (135 or 195 days) an enhancement in carcinogenesis was observed similar to that previously demonstrated after gastric intubation of DMBA. These findings, together with previously reported observations, suggest that progesterone may exert its inhibitory effect on carcinogenesis by acting at a site outside the breast, perhaps on the liver. However, it is likely that the hormone acts directly on the mammary tissue to exert its enhancing effect on tumorigenesis.

The response of 14 mouse tumour sub-lines to the radiosensitizing action of a large single dose of misonidazole (MISO) has been assessed by regrowth delay. In 13 of these, significant enhancement of radiation effect occurred under ambient conditions, indicating sensitization of naturally hypoxic cells. The enhancement observed (SER') varied with the radiation dose, as would be predicted for a mixed oxic/hypoxic cell population. The maximum SER' in these 13 tumours did not depend on histology or regrowth rate. The 14th tumour, a slow-growing sarcoma, was not sensitized under ambient conditions, but showed marked sensitization when clamped to produce acutely hypoxic cells. This is consistent with no hypoxic cells occurring naturally in a sarcoma with a slow rate of growth. Faster-growing variants of this tumour showed radiosensitization under ambient conditions. The slow-growing carcinoma, RH, however, appears to contain hypoxic cells and did show sensitization. The cytotoxic action of MISO was compared with the radiosensitization by administering it after irradiation in 8 of the tumour lines. In 2 tumours no cytotoxicity was observed. In the rest cytotoxicity was significant, but much smaller than the sensitization observed when MISO was administered before irradiation. These regrowth-delay data have been used to calculate hypoxic fractions in 3 ways. Estimates of hypoxic fraction ranged from less than 0.1% in the slow sarcoma to greater than or equal to 30% in several tumours. There is considerable variation in the estimate, according to the technique used.

Histone deacetylase inhibitors (HDACi) are a new class of promising anti-tumour agent inhibiting cell proliferation and survival in tumour cells with very low toxicity toward normal cells. Neuroblastoma (NB) is the second most common solid tumour in children still associated with poor outcome in higher stages and, thus NB strongly requires novel treatment modalities.EL and the inactivation of the anti-apoptotic proteins XIAP, Bcl-xL, RIP and survivin, that further enhanced the apoptotic signal. Interestingly, the activity of these apoptosis regulators was modulated by several different mechanisms, either by caspases dependent proteolytic cleavage or by degradation via the proteasome pathway. In addition, HDACi strongly impaired the hypoxia-induced secretion of VEGF by NB cells.We show here that the HDACi Sodium Butyrate (NaB), suberoylanilide hydroxamic acid (SAHA) and Trichostatin A (TSA) strongly reduce NB cells viability. The anti-tumour activity of these HDACi involved the induction of cell cycle arrest in the G2/M phase, followed by the activation of the intrinsic apoptotic pathway, via the activation of the caspases cascade. Moreover, HDACi mediated the activation of the pro-apoptotic proteins Bid and BimHDACi are therefore interesting new anti-tumour agents for targeting highly malignant tumours such as NB, as these agents display a strong toxicity toward aggressive NB cells and they may possibly reduce angiogenesis by decreasing VEGF production by NB cells. Histone deacetylase inhibitors (HDACi) are promising new anti-tumour agents due to their low toxicity toward normal cells and their ability to inhibit tumour growth in vivo. HDACi are currently under clinical trials and have activity in hematologic malignancies and solid tumours at doses that are well tolerated by patients -3.in vitro and in vivo, and to reduce the expression of pro-angiogenesis factors such as HIF-1α and VEGF [HDACs regulate the expression and the activity of many proteins involved in cancer initiation and progression. HDACs affect gene expression by deacetylation of histones and transcription factors, and also deacetylate numerous other cellular proteins involved in cell growth, cell migration, apoptosis and differentiation ,4,5. Thuand VEGF ,9. Partiand VEGF . For exaand VEGF ,11.in vivo either on HDACi treatment alone or in combination with other treatment modalities [Neuroblastoma is the most common solid extracranial tumour in children and cause 15% of death from neoplasia in children ,13. Therdalities ,19-22. Wdalities .The present study dissects the detailed mechanisms of HDACi anti-tumour activity in NB cells, that revealed to be similar in both the S-type and N-type NB cells, in contrast to the chemotherapeutic drug Doxorubicin . The thrThe anti-tumour activity of three HDACi, NaB, SAHA, and TSA was first analysed in various S-type and N-type NB cells. We observed that these HDACi reduced NB cell viability in a dose-dependent manner Fig. . While SAs HDACi are known to affect both cell survival and cell cycle progression, the effect of NaB, SAHA and TSA on cell cycle progression in NB cells was then measured in SH-EP, IMR32, LAN-1 and IGR-N91 cells. After 16 h of treatment, HDACi induced an accumulation of cells with 4n DNA content indicating a G2/M cell cycle arrest Fig. . Cell cyHDACi-mediated apoptosis induction was then investigated by the propidium iodide staining method in SH-EP, LAN-1 and IMR32 cells. The percentage of sub-G1 population of cells corresponding to apoptotic cells increased over time between 24 h to 48 h Fig. and 2B. To analyse if HDACi induce apoptosis by activating the mitochondrial pathway, we measured the disruption of the transmembrane mitochondrial potential (ΔΨm) Fig. . TreatmeAs apoptosis induced by HDACi was protected by zVAD, this suggests that HDACi activate the caspases cascade. Indeed, immunoblotting analyses revealed that NaB, SAHA and TSA induce the reduction of procaspases-2, -3 and -7 in SH-EP and IMR32 cells after 48 h of treatment, while procaspase-9 was unaffected Fig. . As apopL, and survivin, as well as the activation of Bid and BimEL in a caspases dependent manner [L, RIP, and survivin, and that of the pro-apoptotic proteins Bid and BimEL, as observed in SH-EP cells , or to SAHA and TSA (at microM concentration), as previously described for other tumour types . With thAmong the HDACi-activated antitumoral actions, cell cycle arrest has been described in many type of tumours ,10,11, aWe have shown here that NaB, SAHA and TSA induced caspases dependent apoptosis by the activation of the intrinsic apoptotic pathway in NB cells, as previously described in different tumours ,11, and L and survivin, and the activation of Bid and BimEL, TSA only induced the downregulation of XIAP, RIP and survivin. Thus, different HDACi may act through distinct mechanisms to induce their antitumoral response in the same tumour cell type.In this study we have further analysed in details the mechanisms of apoptosis induction by NaB, SAHA and TSA. The three HDACi increased the ratio between pro- and anti-apoptotic proteins. While NaB and SAHA mediated the downregulation of RIP, XIAP, Bcl-xNaB and SAHA induced the caspases-dependent activation of Bid, as Bid reduction was protected by the pan-caspase inhibitor zVAD, which also occurs in N-type NB cells in absence of caspases-8 and -10 expression. This suggests that the activation of the intrinsic pathway proceeds via an amplification loop that is independent of caspases-8 and -10, but dependent of other caspases as disruption of the ΔΨm was partially protected by zVAD (data not shown). Bid was indeed reported to be the substrate of other caspases, such as caspase-2 or caspase-3 .EL by caspase-3 was previously shown to induce a positive amplification loop by increasing the affinity of BimEL to Bcl-2 [EL may be activated by caspases-dependent cleavage by NaB and SAHA in NB cells, as previously observed by co-treatment with subtoxic doses of HDACi and TRAIL [The activation of Bimto Bcl-2 . Thus, Bnd TRAIL .L and survivin occurred by different mechanisms, either by caspases dependent cleavage or by degradation via the proteasome pathway. Indeed, in contrast to RIP, XIAP, and Bclx, the downregulation of survivin was not protected by the caspases inhibitor zVAD, which strikingly further increased survivin downregulation. In normal cells, survivin is expressed in a cell cycle-dependent manner, with an increased expression during the G2/M phase in normal cells [Interestingly, we have observed that the down-regulation of the anti-apoptotic proteins RIP, XIAP, Bcl-xal cells and surval cells . In tumoal cells . Thus, oal cells and withal cells . Interesal cells . Thus, tal cells . This suin vitro and in vivo, and to reduce the expression of pro-angiogenic factors, such as HIF and VEGF [in vivo by decreasing tumour angiogenesis in addition to tumour cell growth and survival. Indeed, HDACi-mediated reduction of VEGF expression by 4-phenylbutyrate, or decrease of tumour vasculature by MS-27-275 have been previously described in NB tumour xenograft model [In addition to the role of HDACi in reducing tumour initiation by their effects on cell proliferation and survival, HDACi were found to repress angiogenesis and VEGF ,8,9. VEGand VEGF . Most NBand VEGF ,41. Moreand VEGF ,43. We hft model ,20.in vivo. Altogether, our and others observations confirm the interest in HDACi as promising new treatment modalities for patients with recurrent high-risk neuroblastoma.By dissecting the molecular pathways involved in the HDACi-mediated toxicity in NB cells, we have identified the participation of a complex array of distinct mechanisms, that outline the complexity of the HDACi-mediated effects. In addition to the observation that NaB, SAHA and TSA are potent therapeutic agents against highly malignant NB cells, by affecting both cell cycle progression and survival, our study also underlines a possible antiangiogenic action of HDACi in NB. The effect of HDACi on VEGF production thus supports HDACi anti-tumour activity reported in human NB xenograft models ,20 and s2O and stored at -20°C. SAHA (Biovision) and TSA (Sigma) were dissolved in DMSO and store at -20°C. Cells were treated with the caspases inhibitor zVAD-fmk or with Lactacystin when indicated.The S-type NB cells SH-EP, CA2E, and SK-N-AS and the N-type NB cells LAN-1, IMR32, SH-SY-5Y, IGRN-91, IGRN-B8 were grown in DMEM medium supplemented with 2 mM L-glutamine, 100 U/ml Penicillin, 0.1 mg/ml streptomycin, and 10% of FCS. Sodium butyrate (Fluka) was dissolved in H4/well in 96-well-plates; 100 μl) were plated 24 h before treatment and incubated with HDACi for 48 h. Assays were performed in quadruplicates. Viability was measured using the MTS/PMS cell proliferation kit from Promega according to manufacturer's instructions. Percentage of cell viability as compared to untreated controls was calculated.Cells , cells were washed twice in ice-cold PBS, resuspended in 0.2 ml of PBS containing 200 μg/ml RNaseA and 10 μg/ml propidium iodide and incubated for 30 min at room temperature. The stained cells were analyzed using a FACScan flow cytometer (Becton Dickinson).L (BD Transduction Laboratories), Bim (Imgenex), and survivin (R&D systems). Binding of the first antibody was revealed by incubation with either goat anti-mouse IgG-HRP (Jackson ImmunoResearch) or goat anti-rabbit IgG-HRP . Bound antibodies were detected using the Lumi-light western blotting substrate (Roche) according manufacturer's instructions.Whole cell extracts were prepared as already described . ProteinCaspase-3 like activities were measured using the caspases-3 colorimetric protease assay kit from MBL. Cytosolic lysates were prepared after HDACi treatments according to manufacturer instructions. Two hundred μg of protein extracts were incubated with 200 μM of DEVD-pNA colorimetric substrate for 3 h at 37°C. Cell lysates were incubated with 10 μM of caspase inhibitor (zDEVD-fmk) for 30 min before addition of caspase substrate to control the specificity of caspase-3 like activation. Hydrolysed pNA was detected using a microtiter plate reader at 405 nm. Background absorbance from cell lysates and buffers were subtracted from the absorbance of stimulated and unstimulated samples before calculation of relative caspases activities.The disruption of mitochondrial membrane potential ΔΨm was analysed by staining the cells with the fluorescent dye JC-1 according to manufacturer's protocol. Loss of ΔΨm resulting in reduction of red aggregates was measured by flow cytometry using the FL2 channel (550–650 nm) . Results are given in percentage of cells with low ΔΨm compared to untreated controls.6 SH-EP. 3.5*106 LAN-1 and IMR32) were platted in 75 cm2 dishes the day before induction. Cells were treated with HDACi under normoxic condition or under hypoxia (1% O2) for 24 h. Cell free supernatant were collected and whole cell extracts were prepared by incubating cell pellets in lysis buffer supplemented protease inhibitor cocktail tablets for 10 min in ice. Homogenates were centrifuged 20 min. at 16'000 g and supernatant were collected. Protein concentration was measured using the micro BCA protein assay kit (Pierce). Soluble VEGF was measured in 50 μl of supernatants in duplicates using the VEGF DuoSet ELISA kit (R&D system) according to manufacturer's instructions.Cells (2.5*10NB: Neuroblastoma; HDACi: histone deacetylase inhibitors; NaB: sodium butyrate; SAHA: suberoylanilide hydroxamic acid; TSA: Trichostatin A; TRAIL: Tumour Necrosis Factor-related apoptosis-inducing ligand; c-FLIP: cellular Flice inhibitory protein.The authors declare that they have no competing interests.AMM performed all major experimental work, participated in the design, the coordination of the study and drafted the manuscript, KBB participated in all cell culture experiments and performed the immunoblots, caspases activity assays, KA participated in VEGF measurement and in cells stimulation with drugs, MF developed the SH-EP FLIP cells, RM participated in cell treatments with HDACIs, JMJ and NG were involved in the overall design of the study and helped to draft the manuscript.

In recent years, new, so-called structurally constrained (SC) models of protein-coding sequence evolution have been proposed, which use statistical potentials to assess sequence-structure compatibility. In a previous work, we defined a statistical framework for optimizing knowledge-based potentials especially suited to SC models. Our method used the maximum likelihood principle and provided what we call the joint potentials. However, the method required numerical estimations by the use of computationally heavy Markov Chain Monte Carlo sampling algorithms.Statistical approaches for leave-one-out argument coupled to fast gradient descent algorithms. We assess that the leave-one-out potential yields very similar results to the joint approach developed previously, both in terms of the resulting potential parameters, and by Bayes factor evaluation in a phylogenetic context. On the other hand, the leave-one-out approach results in a considerable computational benefit .Here, we develop an alternative optimization procedure, based on a Due to its computational speed, the optimization method we propose offers an attractive alternative for the design and empirical evaluation of alternative forms of potentials, using large data sets and high-dimensional parameterizations. In particular, codon substitution models explicitly formulated in terms of a balance between mutation and selection constitute an attractive strategy -4. By depfix(ss') depends on the particular model chosen.The mutation matrix Among the mutation-selection codon models, we focus on the structurally constrained (SC) models -7 which s to the tertiary structure of the protein, c. This score should be devised so that the fixation probability is low if the proposed mutation destabilizes the structure or complicates the folding process. Since Anfinsen's experiments [Rss'), and thus the structure/sequence score function, have to be computed for each possible nearest neighbor mutant, and for each substitution, along the entire evolutionary tree. Therefore, we need a fast computation of the fixation probability which precludes the use of all-atom force fields.In SC models, the fixation probability of a given mutation depends on a score function assessing the adequacy of a sequence eriments , the releriments , CHARMM eriments ). HoweveAn attractive alternative is provided by knowledge-based potentials. They mimic the Boltzmann law -15 and uprotein folding) or to find a sequence or a set of sequences folding into a given tertiary structure (protein design). However, the same potential may not be best-suited to both goals since the spaces of optimization are very different: in the protein folding problem the search is done over the structure space, while in the protein design problem the search is done over the sequence space. The phylogenetic context described here is more akin to a protein design perspective, as the structure of the protein is assumed constant during evolution, representing a constraint under which the sequence is evolving.Many statistical potentials have been proposed ,19,24,25S given their native structures C and the model parameters , P . This probability was then maximized with respect to the potential parameters (e.g. pairwise contact energy coefficients) by a gradient method. However, the probability P involves a normalizing factor, summing over all possible sequences, which cannot be analytically calculated. We thus had to resort to a Markov Chain Monte Carlo (MCMC) numerical procedure: at each step of the gradient descent, we generated a set of sequences by Gibbs sampling, conditional on the current values of the potential. This set of sequences was then used to estimate the gradient. The Gibbs sampling procedure was the limiting step of our algorithm, restricting the set of alternative potentials that we could explore and empirically test. The potentials we obtained using this method are called joint potentials hereafter.Several methods have been developed to train statistical potentials in a protein design perspective ,24,25. Ileave-one-out procedure to estimate a restricted set of parameters of a free physical energy function in order to do protein design. In this procedure, only one site of the protein is changed at a time, while the other positions are kept fixed in their native state. The procedure is thus similar to training a potential to recognize acceptable sequence variants, given the target structure, among all possible point mutants. The leave-one-out criterion seems to give good results. However, it has never been assessed against alternative methods. Here, we adapt the statistical framework we defined in [Interestingly, Kuhlman and Baker used a lfined in now usins = (si)n 1..of length n according to a probability distribution P , conditional on the conformation c and on a set of potential parameters θ. The parameters are estimated by maximizing the probability of observing a database of N independent sequence-structure pairs (C), with C = (cp)p = 1..N. Here, p-th native sequence of the dataset, np is the lenght of this sequence and cp is the native conformation associated with As in , we formThe probability that we want to maximize can be expressed as follows:θ, this term can be seen as a likelihood. Hereafter, we define the methodology with one protein, but it can be easily generalized to a set of proteins.As a function of Borrowing from , we set:Y is called the normalization factor, and G the inverse potential, defined aswhere E is the statistical potential and F (s) is analogous to a free energy term and can be approximated using the random energy model [where gy model ,28-30:μa, a = {1..20} are unknown parameters, analogous to chemical potentials [where tentials .ω as:In our previous work , we defiθ. Its gradient is:This score function should be minimized conditional to n), this expectation cannot be computed analytically, and therefore, in [where ⟨·⟩ stands for the expectation over sequences drawn from the probability defined by eq. 3. Given the size of the sequence space .This gradient can be analytically calculated, at each step of a gradient descent. We note that the term corresponding to the normalization factor (the second term in eq. 12) can be seen as an expectation over the leave-one-out probability. It is thus analogous to the expectation appearing in the right hand of eq. 7. However, it is defined on a much more restricted universe . We consider that the optimization is complete when the overall maximum gradient is smaller than 10-2. This corresponds to a variation of 10-6, at most, in the value of the potential parameters. Using this stopping condition on the dataset DSl with empirically tuned general steps (e.g for the contact parameters: -5 and for the solvent accessibility parameters: -4), we compare three different gradient descent methods (described in Methods): the simple gradient descent, the inertial gradient descent, and the controlled inertial gradient descent. The values of the parameters stabilized after 14,500 gradient steps for the simplest gradient descent, versus 1,500 gradient steps for the inertial gradient, and 1,200 gradient steps for the controlled inertial gradient. Concerning the last method, if we choose a different general step (e.g. -3 and -2) the procedure automatically reaches the optimal step for that dataset. At the beginning of the optimization procedure, the inertial component of the gradient greatly speeds up the optimization, but is automatically deactivated when the values of the potential parameters are near the optimum, thus avoiding the numerical instabilities usually observed using less adaptive gradient methods.We first run our leave-one-out method on θl), lead to the same final values of ωl fig. and of t θ) fig. . These c θ) fig. . In fig.α and μ, which has been be resolved by including the chemical potentials in the accessibility terms.The contact potentials obtained with the leave-one-out optimization criterion make sense from a biological point of view fig. : as expeIn our previous work, we had to use a MCMC protocol to numerically evaluate the derivative of the gradient (see. eq. 7), which was a computationally demanding task. At each step of the gradient descent, we had to sample a set of sequences by Gibbs sampling, under the current values of the parameters, so as to numerically estimate the gradient of the log-likelihood.inverse potential at a particular site i for one particular amino acid a , eq. 9). This calculation has to be made in both cases. It is explicitly defined in the leave-one-out procedure (eq. 10), and is implicitly used in the joint context: an elementary step of the Gibbs sampling algorithm consist in computing, at a given site i the leave-one-out probability (eq. 9) for each possible amino-acid at this site, conditional on the rest of the sequence, and to choose the new aminoacid at site i according to these probabilities. Performing such an elementary update for every site in turn corresponds to one Gibbs sampling sweep and represents 20·n elementary computations. A reliable estimate of the joint expectation requires K sweeps (burn in included) and so, for a gradient step, we need K·n·20 elementary calculations .To compare the joint and the leave-one-out potentials, we first define an elementary calculation as the evaluation of the n·20 elementary calculations for a gradient step, which thus represents a 1,000-fold increase in computational speed compared to the joint method. In practice, and after the addition of the acceleration of the gradient descent, it took about one week to have a good estimate when we used the joint method, versus less than fifteen minutes when using the leave-one-out approach.In the case of the leave-one-out potential, we only have to make the equivalent of one sweep to exactly compute the gradient (eq. 12). Thus, we only need DSj, and found a high correlation between the two resulting potentials with those of Miyazawa and Jernigan [We applied the two optimization procedures (joint and leave-one-out) to the same dataset als fig. . The corJernigan .G) between the original and the mutated sequences. Let us denote by snuc and saa and s and s' is:In eq. 1, we defined the substitution process of the SC model as a process depending on a mutation rate and a fixation probability. There are many ways the fixation probability could be expressed. Here, we do as in Robinson et al and assusnuc and saa and β ≥ 0 can be considered as the strength of the structure-sequence constraint enforced by the model. Thus, a negative (resp. positive) ΔG means that the mutation is more (resp. less) likely to be accepted than a purely neutral (e.g. synonymous) mutation.where Note that the substitution process defined by eq. 13 is reversible and has a stationary distribution defined by:0(snuc) is the stationary distribution induced by the pure mutation process . In this way, we can readily spot the optimal value of β under each model, and report the Bayes factors under this optimal value . In this section we consider the three versions of the SC model, rve fig. of each ue table .β that we tested. Interestingly, in all but one cases, the Bayes factor appears to be slightly in favor of the leave-one-out potential, although the differences are not significant. As a point of comparison, we also measured the fit of the contact only potential (joint method), to illustrate that the difference between the joint and the leave-one-out methods is small compared to the differences observed between the alternative forms of statistical potential that we would like to empirically compare can be observed also under a potential optimized using the joint method [Qmut matrix in eq. 13) was not explicitly taken into account when optimizing the potential , whereas our phylogenetic model does involve an explicit mutational process. In this sense, in the phylogenetic analysis, there is a potentially redundant modeling of mutational features, in having explicit parameters devoted to these, in combination with the use of the SC setting. This might explain the optimal value of β lower than 0.5. The phenomenon may also be the result of model violations, which are very likely to be present given the simple form of the potentials. Finally, it is also likely that the mutation pressure, or the selection strength (represented by β) is not the same for each protein. Accordingly, two possible improvements to the method can thus be proposed here: the first is to optimize the potential while allowing for different values of β for each protein or each family of protein. The second is to cluster proteins into classes, and optimize a potential specifically for each class.We note that the optimal Apart from these two possible improvements, many other directions of research should now be explored: alternative functional forms for the potential should be implemented and empirically tested. Several methods accounting for negative design, through the use of explicit decoys such as mth cycle, which we write as θm).The increment, ΔThis is the simplest form of the gradient descent. We write:δgrad is the fixed step of the gradient descent. Even though this formalism is simple, the choice of the step is not trivial. Indeed, if the step is too large, the values of the potential will oscillate around the optimal values. Conversely, if the step is too small, the gradient descent will be too slow.where To reduce the optimization time, another method of gradient descent was developed, based on an analogy with the physical phenomenon of inertia.δiner is the damping rate of the inertial component, 0 ≤ δiner < 1. If δiner = 0, eq. 17 reduces to the case of the simple gradient. In practice, we set δiner equal to 0.9.δgrad has to be small enough so that the values of the potential do not oscillate around the optimal values, as in the case of the fixed step gradient.However, there is a drawback when taking into account the previous variation of the parameters: when the directions of the gradient change, the inertial part of the gradient brings the parameters too far beyond the maximum. In addition, the gradient step To avoid these two drawbacks, we define here a controlled inertial gradient descent formalism. Specifically, let us define:θ* to the actual values of parameters θm) (gives a higher likelihood than θm) (of the derivative component (Δθ•) only gives a higher likelihood than the actual values. If it does, the step corresponds to a classical gradient descent. Otherwise, we retry a simple gradient descent with a smaller δgrad.The decision procedure can thus be described as follows , and εab represents the contact potential between amino acids a and b. The second term represents the accessibility free energy: νi is the accessibility class of the site i and a when placed into the accessibility class d (d = {1..D}), where D is the number of accessibility classes.The first term represents the contact free energy (defined between sidechain centers): Δrandom energy model principle to approximate F (s) (eq. 5), so that the inverse potential becomes:We use the As in our previous work we fix the constraints:G is invariant under the following transformations a and μ, which can be resolved by including the chemical potentials in the accessibility terms. Indeed, the μa terms can be seen as an additive constant to each accessibility term for a given accessibility class as described in [SC0 and β. In fact, this procedure provides a complete curve representing the fit of the model as a function of β. Sampling from β = 0 to β = βmax and from β = βmax to β = 0 gives two different curves for the logarithm Bayes factor, which we used as an internal check of the reliability of the method (not shown).Here we compute Bayes factors by thermodynamic integration which was split into two subsets: DS1 , and DS2 . To determine the accessibility classes, we first compute the solvent accessibility area using Naccess 2.1 [The datasets are made of proteins (structure-sequence pairs) culled from the PDB, with less than 25% of mutual sequence identity and a resolution better than 2 Å . This se55 sites . We alsocess 2.1 .LOBIN15-144, LYSIN25-134, ADH23-254 and CALM33-444. GLOBIN15-144 is made of 15 vertebrates sequences of the β-globin gene , with ayes 3.1c (which iyes 3.1c ). LYSIN2equences , with a fined by . ADH23-2osophila , with a fined by . CALM36-ng phyML under thng phyML ,42.CB implemented the leave-one-out and gradient descent methods described here and performed the run of all the experiments. CLK implemented the data pre-processing methods. NR implemented the phylogenetic framework. NL set up the theoretical framework and directed the overall project. All the authors co-wrote the manuscript and approved the final manuscript.Derivatives of the potential parameters.Click here for fileDS1 (X-axis) and DS2 (Y-axis) for contact and accessibility potentials respectivly.XY-comparison of the leave-one-out potentials estimated from two independent datasets: (a) and (b) two independent runs on Click here for fileContact potentials and solvent accessibility potentials written in an alphabetical order.Click here for fileBubble plot of the solvant accessibility potential where we remove from each potential the corresponding natural logarithm frequency of the accessibility class.Click here for fileControlled inertial gradient algorithm.Click here for fileμa in the accessibility terms.Inclusion of Click here for file

Diabetic foot infections are one of the most dreadful and costly complications of diabetes. Efforts have recently focused on preventive measures. The balance of moisture in the neuropathic foot is critical and challenging. Whilst the interdigital areas should be kept dry to prevent maceration and subsequent softening and thinning of the skin other areas of the foot should be managed for optimal moisture to avoid dry skin and resulting cracks. Oftentimes, the primary cause of infection is a breakdown of skin integrity. Several factors may cause a break in healthy skin, however some parts of the foot, notably the interdigital area, are more prone to compromise. The interdigital area, which usually provides entrance points for infectious agents, is a rather closed environment and may therefore be subject to more moisture than any other part of the foot. Excess moisture may in turn cause maceration which increases the likelyhood of skin breakdown and microbial colonisation and invasion. Indeed, it has been shown that the skin in interdigital areas of the diabetic patients has higher PH levels which promotes susceptibility to candidal infections . Many products have been developed for the protection of skin integrity. Topical henna is an extract of the lawsonia plant. Some experimental and clinical studies have reported antibacterial and antifungal effectiveness and wound healing activity of this product –4. HennaAs prevention is of paramount importance, studies should focus more on intensive preventive strategies that are promising in maintaining healthy skin. In this context, henna could be a valuable, inexpensive, and readily accessible product that does not require frequent application to maintain skin integrity in the interdigital area.

Map3k7fl/flK5-Cre) with control mice, we found that the number of hair germs (hair follicles precursors) in Map3k7fl/flK5-Cre mice was significantly reduced at E15.5, and that subsequent hair follicle morphogenesis was retarded. Next, we analyzed the role of TAK1 in the cyclic remodeling in follicles by analyzing hair cycle progression in mice with a tamoxifen-inducible keratinocyte-specific TAK1 deficiency (Map3k7fl/flK14-Cre-ERT2). After active hair growth (anagen) was induced by depilation, TAK1 was deleted by topical tamoxifen application. This resulted in significantly retarded anagen development in TAK1-deficient mice. Deletion of TAK1 in hair follicles that were already in anagen induced premature, apoptosis-driven hair follicle regression, along with hair follicle damage. These studies provide the first evidence that the inflammatory mediator TAK1 regulates hair follicle induction and morphogenesis, and is required for anagen induction and anagen maintenance.Transforming growth factor-β-activated kinase 1 (TAK1) is a member of the NF-κB pathway and regulates inflammatory responses. We previously showed that TAK1 also regulates keratinocyte growth, differentiation, and apoptosis. However, it is unknown whether TAK1 has any role in epithelial–mesenchymal interactions. To examine this possibility, we studied the role of TAK1 in mouse hair follicle development and cycling as an instructive model system. By comparing keratinocyte-specific TAK1-deficient mice ( The NF-κB pathway mediates innate immune or pro-inflammatory responses, such as signaling by Toll-like receptors (TLRs), the IL-1 receptor (IL-1R), and tumor necrosis factor receptor (TNFR) Map3k7fl/flK5-Cre) that TAK1 regulates keratinocyte growth, differentiation, and apoptosis Because members of the NF-κB pathway are increasingly recognized as important in the regulation of epithelial–mesenchymal interaction systems, ranging from tooth development to hair follicle induction and morphogenesis Induction and morphogenesis of the hair follicle The postnatal hair cycle in mice begins with catagen induction around P17, followed by the first telogen. Recently, the EdaR pathway has been shown to be involved in the hair cycle Map3k7fl/flK5-Cre) mice and subsequent hair follicle cycling in tamoxifen-inducible keratinocyte-specific TAK1 deficient mice (Map3k7fl/flK14-Cre-ERT2) to avoid gene-targeting in embryonic development because this might damage the hair follicle, impairing its later capacity to cycle. These studies provide the first evidence that TAK1 regulates hair follicle induction, morphogenesis, and cycling.Since TAK1 is a member of NF-κB pathway, we hypothesized that TAK1 is involved in hair follicle morphogenesis and hair cycle control. To explore this, we studied hair follicle development in keratinocyte-specific TAK1-deficient .The protocol for generating Map3k7 gene. The targeting construct has been described previously Map3k7fl/flK5-Cre) by breeding Map3k7fl/fl mice (C57Bl/6 background) with K5-Cre mice (C57Bl/6 background) TAK1 is encoded by the Map3k7Kfl/fl mice were bred with K14-Cre-ERT2 mice (C57Bl/6 background) Map3k7fl/flK14-Cre-ERT2 mice. We applied 100 µL of 4-hydroxytamoxifen in ethanol at a concentration of 1 mg/mL topically to the dorsal skin of 8-week-old female Map3k7fl/flK14-Cre-ERT2 mice for 5 consecutive days The hair cycle was synchronized in the dorsal skin of 8-week-old female mice by wax depilation, as described previously The stages of hair follicle morphogenesis, cycling, and dystrophic catagen were morphologically defined using dorsal skin of the mice and the score was defined as follows.Map3k7fl/flK5-Cre mice was compared with Map3k7fl/fl mice. Statistical significance was determined using a Mann-Whitney's U-test. A difference of *P<0.01 was considered statistically significant.The hair morphogenesis stage of each hair follicle in each mouse group was evaluated as described previously Map3k7fl/flK14-Cre-ERT2 mice was compared with the control mice. Statistical significance was determined using a Mann-Whitney's U-test. A difference of *P<0.01 was considered statistically significant.The hair cycle stage of each hair follicle in each mouse group was evaluated as described previously Dystrophic catagen was defined according to a previous report Map3k7fl/flK5-Cre) mice were generated, as previously described Map3k7fl/fl mice were used as controls. Histological analysis of hair follicle development is shown in Map3k7fl/flK5-Cre mice was significantly lower than that in Map3k7fl/fl mice , in which Cre-ERT2 was expressed in the epidermis under the control of the K14 promoter Map3k7fl/flK14-Cre-ERT2 mice was induced in resting (telogen) hair follicles by wax depilation RT2 mice . HistoloRT2 mice .Quantitative hair cycle histomorphometry and hair cycle score calculation confirmeT2 activity was noted in ethanol-treated Map3k7fl/flK14-Cre-ERT2 mice : many large, ectopically located melanin clumps, often larger than keratinocyte nuclei, were found not only in their normal location , but also eccentrically in the hair bulb periphery and in the epithelial strand of the involuting catagen hair follicles . Thus, THere, we show by mouse genomics and targeted deletion experiments that TAK1, a member of the NF-κB pathway that has chiefly been recognized as a mediator of innate and adaptive immunity The TAK1-NF-κB pathway regulates not only immune responses Map3k7fl/flK5-Cre mice Since TAK1 regulates keratinocyte function Recently, TAK1 binding protein (TAB) 2 has been identified as a binding partner of EdaR-associated death domain protein (EDARADD) using a yeast two-hybrid screening Map3k7fl/flK5-Cre mice, the number of hair germs was significantly reduced at E15.5, indicating that the development of primary guard hair follicles was greatly impaired. Impaired development of primary guard hair follicles at E15.5 can be explained by the absence of NF-κB activity, due to TAK1 deficiency, consistent with a model in which TAK1 is involved in the EdaA1/EdaR/NF-κB pathway The coats of mice contain four major hair follicle subpopulations: guard hairs, awl and auchene hairs, and zigzag hairs. Formation of each kind of hair follicle starts at E14, E16, and E18-P3, respectively and the regulatory mechanisms of hair follicle development are slightly different among them tabby, downless, and IκBαΔNc mice, even though EdaR/NF-κB-defective, awl/auchene hair follicles subsequently produce abnormal awl-like hair shafts Map3k7fl/flK5-Cre mice at E16.5 are likely to represent placodes of awl/auchene hair follicles. In a recent study, analyses of Eda and EdaR homologue Troy double-mutant mice revealed that, in addition to primary guard hair follicles, awl/auchene hair follicles were defective in these mice Map3k7fl/flK5-Cre mice is controlled by this NF-κB- (and TAK1)-independent pathway . This suggests that TAK1 deletion also affects the morphogenesis of the secondary hair follicles.An interesting difference was observed between Although numerous molecular players have been identified as powerful regulators of hair follicle cycling, the exact molecular machinery that drives the elusive “hair cycle clock” remains unclear In the present study, we have shown that TAK1 deletion severely delays the telogen-anagen transition, although it is not completely suppressed, while deletion of TAK1 in anagen follicles prematurely induces catagen and damages normal hair follicle function. Thus, TAK1 activity is important, but not essential, for anagen initiation and progression, yet is essential for the maintenance of mature anagen follicles, with loss of TAK1 activity resulting in catagen induction. The next challenge is to dissect the upstream and downstream signals of TAK1. Because NF-κB is thought to be a downstream signal of TAK1 in hair morphogenesis, and because strong NF-κB activity is detected in the anagen matrix of pelage follicles of adult mice After chemical, biological, or physical damage, hair follicles develop abnormalities that are collectively called hair follicle dystrophy The evidence reported here, that TAK1, a critical mediator of inflammation

The IAPV genome contains two genes encoding a structural and a nonstructural polyprotein. We applied a recently developed method for the estimation of selection in overlapping genes to detect purifying selection and, hence, functionality. We provide evolutionary evidence for the existence of a functional overlapping gene, which is translated in the +1 reading frame of the structural polyprotein gene. Conserved orthologs of this putative gene, which we provisionally call Colony collapse disorder (CCD) is a syndrome characterized by the mass disappearance of honeybees from hives . CCD impThe genome of IAPV contains two long open reading frames (ORFs) separated by an intergenic region. The 5' ORF encodes a structural polyprotein; the 3' ORF encodes a non-structural polyprotein [Overlapping genes are easily missed by annotation programs , as evidIn the fourteen completely sequenced dicistroviral genomes Table , we idenSolenopsis invicta virus 1 (SINV-1) [p < 0.05), then the overlapping ORF is predicted to be under selection and is most probably functional. The signature of selection was identified for the ORFs in the three bee viruses . The protein product of the orthologous ORF in SINV-1 could not be tested for selection because the amino acid sequence identity between the ORF from SINV-1 and the ORFs from the three bee viruses , Kashmir bee virus (KBV), and (SINV-1) -18. This(SINV-1) . To ascees Table is lowerceteris paribus by the intensity of purifying selection. If both overlapping genes are under similar strengths of selection, the amino-acid sequence identity of one pair of homologous genes would be similar to that of the overlapping pair. On the other hand, if a functional gene overlaps a non-functional ORF, the amino-acid identity between the hypothetical protein sequences of the non-functional ORFs would be much lower than that between the two homologous overlapping functional genes. We found that the degree of amino-acid conservation of the overlapping sequence identity between pairs of overlapping ORFs in cluster A is only slightly lower than that of the known gene . In Figure pog is found in the genomes of four viruses that constitute a monophyletic clade, but not in any other dicistrovirid genome a signature of rhodopsin-like GPCRs (G protein-coupled receptors), and (2) a protein kinase C phosphorylation site Figure . Predictpog, in the genomes of IAPV, ABPV, KBV, and SINV-1. To our knowledge, this putative gene, whose coding region overlaps the structural polyprotein, has not been described in the literature before.In this note, we provide evolutionary evidence (purifying selection) for the existence of a functional overlapping gene, -6). Matching overlapping ORFs were assigned into clusters. Within each cluster, we aligned the amino-acid orthologs by using the sequences of the known genes as references. If alignment length of the overlapping sequence exceeded 60 amino-acids, and if the amino-acid sequence identity among the hypothetical genes within a cluster was higher than 65%, we tested for selection on the hypothetical gene (see below).Fourteen completely sequenced dicistrovirid genomes were obtained from NCBI Table . Each geWe aligned the protein sequences of the two polyproteins with CLUSTAW as impleWe used the method of Sabath et al. for the and the My-Hits server with the following motif databases: PRINTS [We looked for motifs within the inferred protein sequences encoded by the overlapping ORF by using the motif search server : PRINTS , PROSITE: PRINTS , and Pfa: PRINTS . We used: PRINTS to predi: PRINTS to prediThe authors declare that they have no competing interests.NS carried out the analysis and wrote the draft manuscript. NP performed the motif search. DG and NP contributed to the interpretation of the results and the final version.All authors have read and approved the manuscript.In the fourteen completely sequenced dicistroviruse genomes Table , we idenClusters of orthologous overlapping ORFs on the negative strands of dicistrovirid genomes.Click here for fileThe corresponding codon positions of overlapping genes in opposite-strand phase-2. First and second codon positions, in which ~5% and 0% of the changes are synonymous, are marked in red. Third codon positions, in which ~70% of the changes are synonymous, are marked in blue.Click here for file

Correction for:10.1371/journal.pbio.0050219Steiner CC, Weber JN, Hoekstra HE (2007) Adaptive variation in beach mice produced by two interacting pigmentation genes. PLoS Biol 5(9): e219. doi:Figure S2 was erroneously labeled. The caption should read:Agouti Gene Including the Known Cis-Regulatory and Coding Regions Figure S2. Genomic Structure of the In addition, there was an omission in the acknowledgments. The following sentence should be included:T. Glenn, N. Schable, and C. Hagen produced microsatellite libraries and provided PmBW clone sequences that were funded by National Institutes of Health grant R01Gm069601 (to M. Dewey and T. Glenn).

In the crystal structure, weak C—H⋯O hydrogen bonds help to establish the packing.In the title compound, C Å b = 9.7819 (6) Å c = 15.0245 (9) Å α = 89.488 (3)°β = 81.201 (3)°γ = 70.625 (3)°V = 983.19 (10) Å3 Z = 2 Kα radiationMo −1 μ = 0.09 mmT = 296 K 0.42 × 0.28 × 0.22 mm Bruker APEX II CCD diffractometerSADABS; Bruker, 2001T min = 0.963, T max = 0.980Absorption correction: multi-scan (5353 measured reflections3623 independent reflectionsI > 2σ(I)2500 reflections with R int = 0.015 R[F 2 > 2σ(F 2)] = 0.077 wR(F 2) = 0.311 S = 1.01 3623 reflections250 parametersH-atom parameters not refinedmax = 0.81 e Å−3 Δρmin = −0.29 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536810005088/hb5320sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810005088/hb5320Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Streptococcus pyogenes, is used in treating lymphangiomas and carcinomas. We have studied in vitro the role of mononuclear phagocytes (MNPs), including purified monocytes (MOs), in the immune response to OK-432. MIP-1α/β and MCP-1 secretions were assessed in whole blood (WB), peripheral blood mononuclear cells (PBMCs) and purified MOs, after in vitro stimulation with OK-432 with or without adherence for 24 hours.OK-432, penicillin-killed 1 and/or β3 integrins, not β2, whereas β1–3 integrins may act as co-stimulatory receptors for OK-432. Based on direct blockage of CD36 or CD18 by antibodies, MCP-1 production may be mediated by CD18 while MIP-1β and MCP-1 production may occur upon binding to CD36.OK-432 stimulated MNPs to secrete MCP-1 and MIP-1α/β in healthy individuals and in head and neck squamous cell carcinoma (HNSCC) patients, except for OK-432 stimulation of WB giving a minimal MIP-1α/β response. Upon culture on low-attachment wells, a spontaneous chemokine secretion was observed, with an unchanged secretion following OK-432 stimulation. Inhibition of Syk kinase and/or PI-3 kinase did not significantly change the chemokine response to OK-432, except for MIP-1α production being increased upon Syk inhibitor addition and an increased MCP-1 response upon addition of both inhibitors. Adhesion may possibly involve βAdherent human MOs produce MCP-1 and MIP-1α/β upon stimulation with OK-432. CD36 modulates MIP-1β and MCP-1 response. Thus, to some extent OK-432 acts as a substance whereby only MOs adhered to surfaces secrete MCP-1 and MIP-1α/β, in part explaining why OK-432 is suited as a biological response modifying drug. The innate immune system detects and eliminates invading foreign material through non-specific defense mechanisms elicited by, e.g., mononuclear phagocytes (MNP). MNPs originate as monoblasts in the bone marrow, reside as monocytes (MOs) in blood and become, e.g., tissue macrophages (Mϕs) or dendritic cells (DCs) upon extravasation into tissues. The innate immune system is presumably involved when biological response modifiers (BRMs) are utilized in the treatment of diseases such as cancer ,2 and lyStreptococcus pyogenes, denominated OK-432 or picibanil, as a biological response modifier (BRM) for treatment of cancer (70 bp-amplicon); primers: (F) 5'-CTCTCGCCTCCAGCATGAA-3', (R) 5'-GGAATGAAGGTGGCTGCTATGA-3', probe: 5'-CCGCCCTTCTGTGCCTGCTGC-3'and the housekeeping gene used was CD68 [GeneBank: BC015557] (67 bp-amplicon); primers: (F) 5'-CCCCACGCAGCAAAGTG-3', (R) 5'-CCAGGGGTGCTTGGAGATCT-3, probe: 5'-TCTCGGCTCAGAATGCATCCCTTCG-3'). Designed primers and probes were purchased from MedProbe .Primer and probes for the TaqMan assays were designed using the Primer Express software (Applied Biosystems). Intron-spanning primers were used to prevent amplification of genomic DNA. The candidate genes were MCP-1 [GenBank: The ABI PRISM 7700 Sequence Detection System (Applied Biosystems) with 96-well plates was used to perform real-time quantitative RT-PCR. Reactions were carried out in a total volume of 25 μl containing 12.5 μl of 2 × TaqMan Universal PCR Master Mix (Applied Biosystems), 300 nM (0.25 μl) forward primer, 300 nM (0.25 μl) reverse primer, 200 nM (1 μl) TaqMan probe, 8 μl water, and 3 μl cDNA template. Thermocycler conditions were as follows: incubation for 2 minutes at 50°C, followed by incubation for 10 minutes at 95°C and 40 cycles of two-step PCR. As a reference gene, CD68 was used to normalize the gene expression of MCP-1. To generate a standard curve for relative gene expression determination, cDNA synthesized from pooled total RNA of MOs obtained from healthy blood donors was used. The standard curves generated for the cDNA analyzed had slopes with a mean of -3.3.MOs from 7 ml blood were isolated by gradient centrifugation in Lymphoprep-containing LeukoSep tubes, followed by the monocyte negative isolation kit , allowed to adhere for 40 minutes, after which piceatannol or LY294002 or diluent control was added for 30 min, followed by incubation with OK-432 for 15 min. Upon experiment completion, cells were washed once with cold PBS, added lysis buffer ) and scraped gently using a cell scraper. The cell lysate was clarified by centrifugation at 16,000 g for one minute at 4°C. Protein levels were measured using the Bio-Rad BCA Protein Assay . Samples were added 1× loading buffer and the lysate was boiled for 5 minutes. Samples (6 μg/lane) and a Precision Plus Protein Kaleidoscope standard (Bio-Rad) were electrophoresed on a 10% SDS polyacrylamide gel for 60 minutes at 200 V and transferred to nitrocellulose membranes (Bio-Rad) in electroblotting buffer for 60 minutes at 100 V. Membrane was blocked with 5% BSA in TBS-Tween for one hour at RT with gentle tilting. The blots were exposed either to a polyclonal antibody against phosphorylated Syk or PI3 kinase p85/p55 or total Syk or total PI3 kinase p85 overnight at 4°C with gentle shaking. After washing, an HRP-linked goat anti-rabbit IgG (H + L) antibody (Bio-Rad) (1:2000) was added for one hour at room temperature with gentle tilting. Proteins were detected using luminol/enhancer/hydrogen peroxide – based ECL and visualized on the Molecular Imager ChemiDoc XRS System (Bio-Rad).Chemokines in supernatants were detected using the Luminex immunobead technology. A 25-plex or 5-plex chemokine kit , were used to analyze cytokine levels in supernatants from successfully completed experiments. In short, antibody-coupled beads were incubated with target analyte after which they were incubated with biotinylated detection antibody before finally being incubated with streptavidin-phycoerythrin. Standard sensitivity was 10 pg/ml . Samples were then read by the Bio-Plex array reader (Invitrogen/Biosource), using Luminex fluorescent bead-based technology .2O2 were used as substrate. Absorbency values were measured at 450 nm using Softmax Pro version 4.0 on an Emax Precision microtiter plate reader . The lower detection level was 15.62 pg/ml. Chemokine levels obtained with media controls (after 24 h) were substracted from those obtained with OK-432-, LTA-, LPS-stimulation. All media controls tested directly after monocyte purification had nondetectable chemokine levels.The contents of MCP-1 in supernatants were determined by enzyme-linked immunosorbant assay kit (ELISA) manufactured by R&D Systems (R&D Systems). All procedures were performed according to the specifications of the manufacturer. In short, 96-well microtiter plates were coated overnight at room temperature with monoclonal mouse anti-human MCP-1 capture antibodies. Diluted samples and recombinant human MCP-1 standard were added and incubated for 2 h at room temperature followed by addition of biotinylated polyclonal goat anti-human MCP-1. The plates were incubated for 20 minutes at room temperature with streptavidin-conjugated horseradish peroxidase. Tetra-methyl-benzidine (TMB) (Sigma) and Hp < 0.05.The statistical program package Statistical Package for the Social Sciences was used. Chemokine levels and expression were compared by the Wilcoxon signed-rank test (two-tailed). Differences were considered significant at BRM: biological response modifier; HNSCC: head and neck squamous cell carcinoma; MIP: macrophage inflammatory protein; MCP: monocyte chemoattractant protein; pb: peripheral blood; PI: phosphoinositide; pSyk: phosphoSyk; TLR: Toll-like receptor.The authors declare that they have no competing interests.CO performed the Western blot analysis, Multiplex analysis, all the experiments and data analysis. HS did the RT-PCR experiments and analysis. KB operated the Luminex machine. JO provided OK-432. CO and HJA were responsible for the concept and design of the experiments and primarily writing the manuscript. All authors have read and approved the manuscript.

Pityriasis rosea is a frequent papulo-squamous disease and is known for various atypical clinical presentations. We report an adult female patient with a clinical diagnosis of giant pityriasis rosea, which is a rarity in clinical practice. Pityriasis rosea (PR) is a common papulo-squamous disorder characterized by an onset as a herald plaque and followed by a multiple oval to round smaller scaly secondary eruptions delineating to lines of cleavage. Current evidence indicates that PR is a type of viral exanthema and the etiology may be possibly linked to human herpes viruses.–3While most cases present the typical pattern clinically, there are about 20% patients of PR presenting in a deviated clinical appearance and might pose a diagnostic problemSeveral unusual variants are reported in the literature–6 includ77A 35-year-old housewife presented with mildly pruritic scaly eruptions on the back and front of chest for 2 weeks. Earlier, she had a single large similar eruption on left breast 10 days ago. She gave a history of upper respiratory infection 2 weeks before the onset of first lesion, when she had a mild fever, coryza, and malaise lasting for 5 days. She received a combination of ibuprofen+paracetamol and cetrizine orally, prescribed by a family practitioner for 3 days. She had been treated with the same drugs several times earlier by the same physician.There was no history of similar lesions in the past. Her past and family health was unremarkable.There was no history suggestive of allergic or irritant contact dermatitis in the present case. She did not receive any other systemic medications in the recent past. Travel history was insignificant. She distinctly denied a history of tick bites.The first lesion was a large oval plaque measuring approximately 7 cm × 6 cm, almost occupying the whole left breast, with peripheral collarette scaling and central clearing with minimal itching. She was treated by a family physician with topical miconazole cream for 10 days without significant resolution. The patient refused the front of chest to be photographed and hence, a picture of herald plaque could not be taken. Prescriptions brought by the patient were verified specifically and did not contain topical or systemic steroids.She suddenly developed the subsequent lesions as multiple, sharply demarcated, large scaly lesions of irregular shape on front and back of trunk as well as lateral thighs extending upto the hips on both sides somewhat in symmetrical distribution. The size of individual lesions varied from 5 to 7cm in longest diameters. The periphery of few of these lesions still showed collarette scaling at places. Only the plaque on right upper back showed to be placed along the line of cleavage and others were not so classical Figure , 2.All the eruptions consisted of scaly plaques with central clearing and peripheral scales. Collarette scaling was seen at places on the affected areas. There palms and soles and mucosal surfaces were uninvolved.Her general and systemic examinations revealed no abnormality. Investigations including complete blood counts, blood sugar levels, urinalysis, HIV antibodies, and VDRL test (done in repeated dilutions) were negative or normal. The fungal scrapings were repeated twice and did not reveal any evidence of fungal elements. She did not, however, agree for skin biopsy.She was prescribed topical betamethasone dipropionate 0.025% ointment twice a day topical application and desloratidine tablet 5 mg once a day. The lesions slowly resolved within 2 weeks, with slight hypopigmentation. There was no recurrence for 6 months of follow up.Atypical or unusual presentations in PR are often seen in clinical practice. Diagnostic dilemma persists in such patients unless a careful clinical observation and follow up are made.–36 Such 3Considering clinical course, typical herald plaque with collarette scale at the initial lesion and complete resolution within 3 weeks, we believe this case deserves a diagnostic label of gigantic PR. Other possibilities such as secondary syphilis, pityriasis lichenoides, erythema annulare centrifugum, erythema chronicum migrans, tinea corporis, psoriasis, and drug-induced PR were unlikely in our patient. Multiple herald plaques may cause diagnostic confusion in such situations. However, even this was not likely in our case considering primary lesion on left breast 10 days earlier to sudden onset of secondary lesions. Moreover, classical collarette scaling on the breast and at places on the truncal and thigh lesions and resolution within a span of few weeks without recurrence further supports our view of gigantic PR.Scaly annular, larger eruptions are known to occur in another rare variant known as PR of Vidal, which presents at limb girdles involving axilla and inguinocrural areas.–36 Our p3Gigantic PR is rarely reported in the literature and was named after Darier. In his proposed clinical classification in 1924, Klauder described PR gigantean into confluent and diffuse variant according to morphology. Pringle Our case illustrates that PR can present as multiple, large scaly plaques. In such patients, good clinical observation and follow up are keys to diagnosis. Without knowledge of this entity, the diagnosis may be missed. Clinicians need to be alerted to this rare variant of PR. This case is being reported here for its extreme rarity. To the best of our knowledge, this is the first report of gigantic PR in the Indian literature. The variant may be under-reported.

Nostoc punctiforme ATCC 29133 revealed a unique 18-gene cluster (NpR1276 to NpR1259 in the N. punctiforme genome) involved in the biosynthesis of scytonemin. We provide further genomic characterization of these genes in N. punctiforme and extend it to homologous regions in other cyanobacteria.The extracellular sunscreen scytonemin is the most common and widespread indole-alkaloid among cyanobacteria. Previous research using the cyanobacterium N. punctiforme genome), with no previously known protein function and annotated in this study as scyA to scyF, are likely involved in the assembly of scytonemin from central metabolites, based on genetic, biochemical, and sequence similarity evidence. Also in this cluster are redundant copies of genes encoding for aromatic amino acid biosynthetic enzymes. These can theoretically lead to tryptophan and the tyrosine precursor, p-hydroxyphenylpyruvate, (expected biosynthetic precursors of scytonemin) from end products of the shikimic acid pathway. Redundant copies of the genes coding for the key regulatory and rate-limiting enzymes of the shikimic acid pathway are found there as well. We identified four other cyanobacterial strains containing orthologues of all of these genes, three of them by database searches and one by targeted sequencing . Genomic comparisons revealed that most scytonemin-related genes were highly conserved among strains and that two additional conserved clusters, NpF5232 to NpF5236 and a putative two-component regulatory system (NpF1278 and NpF1277), are likely involved in scytonemin biosynthesis and regulation, respectively, on the basis of conservation and location. Since many of the protein product sequences for the newly described genes, including ScyD, ScyE, and ScyF, have export signal domains, while others have putative transmembrane domains, it can be inferred that scytonemin biosynthesis is compartmentalized within the cell. Basic structural monomer synthesis and initial condensation are most likely cytoplasmic, while later reactions are predicted to be periplasmic.Six putative genes in the scytonemin gene cluster (NpR1276 to NpR1271 in the We show that scytonemin biosynthetic genes are highly conserved among evolutionarily diverse strains, likely include more genes than previously determined, and are predicted to involve compartmentalization of the biosynthetic pathway in the cell, an unusual trait for prokaryotes. The sunscreen scytonemin Figure is excluThe UV-absorbing ability of scytonemin is based on its chemical structure, a symmetrical indole-alkaloid consisting of fused heterocyclic units . The bioNostoc punctiforme ATCC 29133 (N. punctiforme), we were able to characterize an 18-gene region associated with the biosynthesis of scytonemin . Di. DiNostoyces sp. . It is itrp and tyr genes are expressed to lead the production of the tryptophan and p-hydroxyphenylpyruvate monomers from chorismate. The production of chorismate from central metabolites is boosted by additional expression of the genes aroG and aroB, which code for the regulatory and rate-limiting enzymes in the shikimic acid pathway, respectively. These precursors are first processed by ScyA, ScyB, ScyC, and NpR1259 in the cytoplasm. The resulting intermediaries are then excreted to the periplasm via some unknown membrane transport mechanism, as no known mechanism is coded for within the scytonemin cluster. There, they are subject to reactions orchestrated by the periplasmic enzymes ScyD, ScyE, ScyF, DsbA, and TyrP to produce the reduced form of scytonemin. Once secreted to the extracellular matrix, it auto-oxidizes and takes on its final yellow-brown appearance. Parallel studies suggest that a type IV secretion system, similar in mechanism to a bacterial conjugation system [et al., unpublished data). Once scytonemin is in the extracellular slime layer in sufficient quantities, it blocks the incoming UVA cue, thus returning the gene expression to background levels and halting the further synthesis of the sunscreen.A working model of the subcellular compartmentalization of scytonemin biosynthesis in the cell, based on the above genomic analyses, is provided in Figure n system , is usedN. punctiforme scytonemin biosynthesis gene cluster and the Chlorogloeopsis gene cluster allows us to predict which genes are important in the biosynthesis of scytonemin. Since scyA to scyF are conserved across all of the strains described above, and are either unknown in function or putatively assigned a function, we expect that these six genes will provide the most useful information for determining the scytonemin biosynthetic pathway. Additionally, we have reason to associate the N. punctiforme genes NpF5232 to NpF5236 with the biosynthesis of scytonemin, and it is likely that the response regulator (NpF1278) and sensor kinase (NpF1277) upstream from the cluster are involved in regulating this system.The conservation of genes and genomic arrangements between the Furthermore, protein sequence data from several of the genes in the cluster provide us with clues regarding scytonemin biosynthesis and localization. While the roles of ScyA and ScyB in the preliminary stages of scytonemin biosynthesis are predicted to occur in the cytoplasm, a working model of scytonemin biosynthesis suggests periplasmic compartmentalization of the later biosynthetic stages. Overall, our analyses have increased our understanding of scytonemin biosynthesis and will facilitate the construction of more direct and efficient hypotheses for future experiments. Furthermore, as scytonemin has been documented as having anti-inflammatory and antiN. punctiforme was grown in Allen and Arnon medium (AA) [Anabaena, Nodularia, and Chlorogloeopsis cultures were grown in BG-11 [Lyngbya was grown in a 1:1 mixture of BG-11 and ASN-III [-1 vitamin B12. Cultures were grown in sterile flasks, under constant white light, at an intensity of 7 W m-2 provided by cool-white fluorescent tubes , while shaking at 25°C.Axenic stock cultures of each strain were maintained on plates solidified with 1.5% Noble agar. ium (AA) preparedin BG-11 , while L ASN-III supplemeN. punctiforme was used in a BLASTp analysis in order to find orthologs in GenBank. Orthologous genes were mapped to establish their arrangement in the genomes of the strains harboring them. To determine whether or not these strains were capable of producing scytonemin, cultures were grown from stocks in liquid cultures [-2) for three days, followed by exposure to white light supplemented with UVA for five continuous days. The UVA was provided by 20-W black-light fluorescent tubes at an intensity of 10 W m-2 with a spectral output of 365 nm, as previously determined [-2 of UVA. Additionally, a control culture for each strain was set under white light only. Following UVA exposure, the cells were harvested and the lipid-soluble pigments were extracted from whole cells in acetone. Extracts were analyzed on a commercial spectrophotometer for absorption from 350 nm to 750 nm, a strong absorption peak at 384 nm indicated scytonemin had accumulated in the cells. Cultures were also observed microscopically for changes in extracellular pigmentation [Amino acid sequences of each protein involved in the biosynthesis of scytonemin from cultures and acclChlorogloeopsis using a PCI extraction protocol [N. punctiforme sequences that were designed to bridge adjacent genes in the cluster. This approach was taken in order to capture the sequences of the corresponding genes and their flanking non-coding regions in Chlorogloeopsis. For PCR, 20 ng of Chlorogloeopsis DNA was used in 50 μL reactions consisting of 1 μM of each specific primer, 5 μL 10× Ex Taq DNA polymerase buffer, 4 μL dNTP mixture (2.5 mM each), and 1.25 units Ex Taq DNA polymerase . N. punctiforme genomic DNA was the positive control while the negative control had no template DNA. PCR was done in a Bio-Rad iCycler Thermal Cycler with the following parameters: 95°C for 5 min then 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, followed by an extension at 72°C for 10 min. Products were confirmed on 1% agarose gels and the band of the expected size for each sample was excised using a sterile scalpel. The PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen Sample and Assay Technologies) and sequenced commercially (Applied Biosystems). Sequences were used in a BLASTn analysis against the N. punctiforme genomic database to verify that the correct region had been amplified. Gene sequences were used to construct the genomic arrangement of the scytonemin gene cluster in Chlorogloeopsis. Nucleotide sequences were submitted to GenBank under accession numbers FJ601359 to FJ601364 and FJ605302 to FJ605317.Total DNA was extracted from cultures of protocol . PresencChlorogloeopsis sequences and UV experiments were done by KP, cultures were provided from and maintained by RMP, and the pathway was analyzed by QG. Manuscript was written by TS with editorial help by VS and FGP. All authors have read and approved the final manuscript.The concept for this study was provided by TS, FGP, and VS. Gene analyses and the working model for scytonemin biosynthesis was developed by TS, Cyanothece sp. strains PCC 7424 and PCC 7822 became available to the public. Both of these strains contain the scytonemin genomic region in an arrangement similar to that found in Lyngbya PCC 8106. The ability of either of these strains to produce scytonemin has not been determined.While the manuscript was in review the genome sequences of

Retained placenta is one of the common causes of maternal mortality in developing countries where access to appropriate obstetrical care is limited. Current treatment of retained placenta is manual removal of the placenta under anaesthesia, which can only take place in larger health care facilities. Medical treatment of retained placenta with prostaglandins E1 (misoprostol) could be cost-effective and easy-to-use and could be a life-saving option in many low-resource settings. The aim of this study is to assess the efficacy and safety of sublingually administered misoprostol in women with retained placenta in a low resource setting.Design: Multicentered randomised, double-blind, placebo-controlled trial, to be conducted in 5 hospitals in Tanzania, Africa.Inclusion criteria: Women with retained placenta, at a gestational age of 28 weeks or more and blood loss less than 750 ml, 30 minutes after delivery of the newborn despite active management of third stage of labour.Trial Entry & Randomisation & Study Medication: After obtaining informed consent, eligible women will be allocated randomly to the treatment groups using numbered envelopes that will be randomized in variable blocks containing identical capsules with either 800 microgram of misoprostol or placebo. The drugs will be given sublingually. The women, maternal care providers and researchers will be blinded to treatment allocation.Sample Size: 117 women, to show a 40% reduction in manual removals of the placenta . The randomization will be misoprostol: placebo = 2:1Primary Study Outcome: Expulsion of the placenta without manual removal. Secondary outcome is the number of blood transfusions.This is a protocol for a randomized trial in a low resource setting to assess if medical treatment of women with retained placenta with misoprostol reduces the incidence of manual removal of the placenta.Current Controlled Trials ISRCTN16104753 The diagnosis 'retained placenta' (RP) is established when the placenta is not expelled after a certain time period following the delivery of the infant,2. The tTanzania is a low resource country with a high maternal mortality rate. It is estimated that 578 women per 100,000 live-births die as a result of pregnancy-related complications .The incidence of RP is approximately 1-2% of all deliveries worldwide, the exact data for Tanzania is not known. The reported incidence of RP is affected by the following four factors: definition of the time interval , gestatiThe incidence of RP in an unselected group of nulliparous women in The Netherlands was 6.3% at 30 minutes and 1.8% at 60 minutes after delivery of the newborn . The incBlood loss associated with RP can be acute life-threatening and requires emergency interventions like administration of uterotonics, correction of hypovolaemia by administration of intravenous fluids, manual removal of the placenta (MRP) under anaesthesia and blood transfusions. All theMedical treatment of RP includes the administration of oxytocin in the umbilical vein, which was reported to be effective in one out of eight women . The disA RCT in The Netherlands showed that administration of 250 microgram prostaglandin E2 (sulprostone) intravenously 60 minutes after delivery of the infant effectively expelled 49% of RP versus 11% in the placebo group within 6The prostaglandin E1 analogue misoprostol is inexpensive and does not need to be stored refrigerated. Therefore, it is of potential use in low-resource countries. In a recent study in which 54 patients with RP were randomised to misoprostol, oxytocin and placebo, administered through the umbilical cord , a signiMisoprostol is an prostaglandin E1-analogue with uterotonic properties that can be administered orally, sublingually, vaginally and rectally . SublingWomen in rural areas in resource-poor settings who deliver at home or in a village health care facility, and in whom the delivery is complicated by RP, have difficulty to reach appropriate medical help in time and have a considerable chance to die because from post partum hemorrhage. Because preliminary evidence suggests that prostaglandins like misoprostol may expel the placenta and reduce blood loss in women with RP, a RCT is designed to compare sublingually administered misoprostol with placebo to tests its effectiveness to reduce the need of MRP and blood transfusion in a low-resource setting.The aims of this randomised, double blind, placebo-controlled trial is to assess if sublingual misoprostol reduces the need of Manual Removal of Placenta (MRP) and the amount of blood loss in women with RP in a low resource setting. The primary outcome variable is reduction in the incidence of MRP and the secondary outcome variable is the reduction in the number of units of packed cells administered.The primary hypothesis of this randomised trial is that the administration of misoprostol to women with RP reduces the number of women who need MRP. The secondary hypothesis is that misoprostol reduces the amount of blood loss in women with RP, especially in those in whom the placenta is expelled by the intervention. Since measurement of blood loss during delivery is not always very reliable, we choose as secondary outcome variable both the measured amount of blood loss and the number of administered packed cells.Multicentered randomised, double-blind, placebo-controlled trial.The study will be conducted in four rural hospitals in Southern Tanzania and in the university teaching hospital in the capital Dar es Salaam. Approval for this study was obtained from the National Institute of Medical Research (NIMR), the Senate Research and Publication Committee of Muhimbili University of Health and Allied Sciences and the Muhimbili National Hospital in Tanzania. A data management safety board has been installed.All labouring women will receive AMTSL and are eligible if 30 minutes after delivery of the infant the placenta has not been expelled and were delivered of a baby of 1 kg or more or at a gestational age of 28 weeks or more. AMTSL is defined as administration of 5IU oxytocin and controlled cord traction (CCT). If the placenta is delivered the uterus will be massaged.Women with one of the following conditions will be excluded from entering the trial:• Haemoglobin concentration less than 100 g/l (6.2 mmol/l)• Blood loss more than 750 ml• Pulse rate more than 120 beats per minute• Diastolic blood pressure reduction after delivery more than 20 mmHgEligible women will be identified in the labour ward at 20 minutes after delivery of the infant. The bladder will be catheterised, an intravenous canula will be inserted and normal saline solution will be started, CCT will be performed again and blood will be taken for cross-match and haemoglobin concentration. They will receive verbal and written information in Kiswahili about participation in the trial and will be asked to give their informed consent. The randomisation schedule uses balanced variable blocks; sealed envelopes containing both registration form and blinded study medication are present in the delivery room. Allocation will be in sequence of enrolment in each of the five labour wards. Each sealed envelop contains two identical capsules with either 800 microgram misoprostol or placebo. The patient, the maternal care providers and the researchers are all blinded to the allocation. Women will enter the study after giving their informed consent at 30 minutes following the delivery of the infant, at which time the envelope will be opened and the two capsules of study medication will be administered sublingually. Figure After administration of the study medication, the doctor or midwife will perform CCT every ten minutes to check if the placenta has separated from the uterine wall. Vaginal blood loss will be measured by weighing self absorbable mattresses. Blood loss exceeding 1500 ml will be considered as indication for emergency MRP. If the placenta is not expelled 30 minutes after the administration of the study medication, the patient will undergo MRP.All women enrolled in the study are followed up for 12-24 hours. Blood pressure, pulse rate uterine contraction and vaginal blood loss are monitored, and the haemoglobin concentration prior to discharge is recorded. Women are receiving blood transfusion and and/or intravenous iron dextrane infusion, according to the hospitals guidelines, if needed. All women receive combined ferrofumerate and folic acid tablets according to the national guideline on care for post partum women.The primary study outcome is:• Manual removal of the placenta.The secondary outcomes are:• Measured post partum blood loss,• Number of units of blood administered,• Adverse outcome for the woman, including side-effects from the study medication and number of emergency MRP needed.The primary endpoint of the study is manual removal of the placenta. For eligible women (with RP 30 minutes after delivery of the infant) the best estimate of MRP is 44% at 60 minutes post partum. Using 2:1 misoprostol to placebo randomisation, a sample size of 117 women will be able to show a 40% reduction in MRP . Thus, 39 patients will receive placebo and 78 will receive misoprostol.Baseline characteristics of all women enrolled in the study are documented and analysed in order to verify the absence of confounding differences in baseline variables between groups. Outcome comparisons for women will be analysed according to 'intention to treat'. Relative risks and 95% confidence intervals will be reported for the primary and secondary outcomes, and the number needed to treat to prevent one MRP will be calculated. A data management safety board will check the data at regular intervals.This is a protocol for RCT assessing the efficacy of sublingual misoprostol in women with a RP 30 minutes after delivery of the infant. The trial is conducted in a low-resource setting in order to establish if misoprostol treatment of RP reduces maternal morbidity associated with retained placenta in such a setting. This study is partially carried out in an environment where communication is difficult and where people have little experience with conducting research. During the research period we have to anticipate unforeseen difficulties like breakdown of equipment, loss of data or study medication and other unpredictable events.When the hypotheses of the study, that misoprostol reduces the amount of MRP and blood loss, is confirmed, it should have consequences for the basic obstetrical care in rural health centres in developing countries. Misoprostol should then be made available to all health facilities and staff should be trained in administering the drugs correctly.The authors declare that they have no competing interests.HJvB, ABP, HF and FKL all contributed to the development of the trial protocol. HJvB drafted this manuscript. All authors reviewed the text critically and gave their approval to the final to be published version of the manuscript.The pre-publication history for this paper can be accessed here:

Ocular manifestations of lymphoma are rare events. Most reports of ocular involvement in lymphoma are case reports or reports of a few patients.To determine the ophthalmic disorders in adult, African, lymphoma patients.A prospective study of ocular disorders in adult patients with lymphoma was conducted at the University of Benin Teaching Hospital, Benin City, Nigeria, between July 2004 and June 2007.The patients were interviewed and examined by the authors and the ocular findings recorded.Data was analyzed on computer with the aid of the Instat GraghPad™ v2.05a statistical package software. The mean, standard deviation, Mann-Whitney U-statistic and P value were calculated.A total of 111 patients with hematological malignancies were seen over a period of three years of which 62 (55.85%) had lymphomas. Of these, 51(82.3%) were non-Hodgkin's lymphoma and 11(17.7%) were Hodgkin's lymphoma. Ocular disorders occurred in 16 patients (31.4%) with non-Hodgkin's lymphoma and none of the patients with Hodgkin's lymphoma . The ocular disorders due to non-Hodgkin's lymphoma were seen as – proptosis in six patients (11.8%), retinopathies in three (5.9%), conjunctival infiltration in three (5.9%), optic atrophy in two (3.9%), keratoconjunctivitis in one (two per cent), desquamating nodular lid lesions in one (two per cent), papilloedema in one (two per cent), and upper lid mass in one (two per cent). Four patients (6.5%) had monocular blindness.Ophthalmic disorders are relatively common in non-Hodgkin's lymphoma. Ophthalmic evaluation is needed in these patients for early identification and treatment of potentially blinding conditions. Lymphomas are a heterogeneous group of malignancies of B cells, T cells and rarely natural killer (NK) cells that usually originate in the lymph nodes but may originate in any organ of the body.810Most reports of ocular involvement in lymphoma are case reports or reports of a few patients.212Intraocular lymphoma is probably the most elusive intraocular tumor to diagnose.211All new adult patients with a diagnosis of any of the lymphomas attending haemato-oncology clinics or admitted into the medical wards of the University of Benin Teaching Hospital, Benin City, Nigeria, between July 2004 and June 2007 were evaluated in the Eye clinic of the hospital. Diagnosis was established based on tissue samples studied by histological examination of a surgical biopsy from an accessible lymph node site or orbito-ocular tissue by the Morbid Anatomy department of the same institution. They were classified as Hodgkin's and non-Hodgkin's lymphoma.Exclusion criteria included all patients who had received chemotherapy, patients on follow-up and children below 17 years. All new adult patients were interviewed by the authors using a standard questionnaire and examined in the eye clinic. The visual acuity was determined using the Snellen's chart or illiterate E chart held at six meters from the patient. When the patient could not read the chart, the ability to count fingers at varying distances, to perceive hand movements or light was determined and recorded. Near vision was tested using the Jaeger's reading chart. The eyes were examined using a pen torch, Haag Streit slit-lamp biomicroscope and direct ophthalmoscope. Fluorescein staining of corneal lesions was done whenever indicated. The intraocular pressure was measured using the Goldmann applanation tonometer mounted on the Haag Streit slit-lamp. Visual field analysis was done using the Kowa automatic visual field plotter. Indirect ophthalmoscopy was done after dilatation of the pupils with 2.5% phenylephrine hydrochloride and 0.5% tropicamide. th revision, 1994) definition which states that blindness is best corrected vision less than 3/60 or inability to count fingers at three meters. Visual impairment was defined as best corrected vision less than 6/18. Ethical approval for this study was obtained from the Ethical Committee of the University of Benin Teaching Hospital, Benin City, Nigeria.Visual acuity was also measured with a pinhole. Those who showed improvement in vision with pinhole and those who complained of difficulty with reading were refracted and appropriate lenses were prescribed. The best corrected visual acuity was used to define blindness. Blindness was defined using the World Health Organization International classification of diseases , standard error of mean (SEM) and 95% confidence intervals (CI) were determined for ages of the patients. Relevant data was displayed in a tabular form. Statistical significance was calculated using the Mann-Whitney U-statistic and a A total of 111 consecutive new adult patients with various hematological malignancies were seen during the period of study. They included 62 cases of malignant lymphomas (55.9%), 37 cases of leukemia (33.3%), nine cases of myelomatosis (8.1%), two cases of polycythemia rubra vera (1.8%) and one case of idiopathic myelofibrosis (0.9%). Of the 62 cases of lymphoma, 51(82.3%) were non-Hodgkin's lymphoma and 11(17.7%) were Hodgkin's lymphoma. None of the patients had received treatment elsewhere before presentation.There were 41 males (66.1%) and 21 females (33.9%) giving a male to female ratio of 1.95:1. The age range was 26 to 75 years with a mean of 49.36 years (SD plus/minus 15.6). The SEM was 4.73 and the median age was 52 years. The 95% CI was 38.82–59.90 years.The most common ocular disorders found on examination of the patients were refractive errors/presbyopia, proptosis, cataract and retinopathies . Table 1No patient with lymphoma was blind at presentation but seven cases (11.3%) were visually impaired .Table 2Late presentation of patients with hematological malignancies is a problem in Nigeria, and this has been documented in previous studies from the same institution.14346111113The lymphomas were grouped simply into Hodgkin's disease and non-Hodgkin's lymphomas because of the lack of adequate facilities to further sub classify them and because of the small numbers available. Using the Revised European-American Lymphoma Classification (REAL),There were more males in this study. This is in agreement with studies that show a male preponderance in lymphoma.The ocular changes result either from a direct effect of metastatic neoplastic infiltration or compression or by circulating antibodies involving paraneoplastic retinal degeneration, or simply from increased susceptibility to infections as a result of immunosuppression that these patients undergo.11The uniocular blinding conditions included cataract, proptosis and optic neuropathy. In addition, retinopathies, age related macula degeneration and uncorrected refractive errors were responsible for visual impairment. All these conditions are either treatable or preventable but early diagnosis is required in most of the cases to prevent blindness.In conclusion, ocular morbidity is relatively common in patients with lymphoma in Benin City, Nigeria. Patients with lymphoma may present first to the eye clinic with proptosis or a mass lesion in the periocular tissues. Several of these are potentially blinding conditions. Early ophthalmic evaluation is recommended to identify and treat those conditions.We wish to acknowledge the assistance of the resident doctors in the Department of Hematology and Ophthalmology of the University of Benin Teaching Hospital, Benin City, Nigeria in data collection.

The tpdaH2 ligand is three-coordinated, with the N atom of the central pyridine ring in the equatorial position [Ni—N = 1.9961 (14) Å] and the N atoms of the peripheral pyridine rings in the axial positions [Ni—N = 1.9668 (15) and 1.9895 (15) Å]. The remaining equatorial positions are occupied by the O atoms of the sulfate ligand and the water molecule. The H atoms of both NH groups of the tpdaH2 ligand are involved in hydrogen bonds with the O atoms of the uncoordinated water mol­ecule and the sulfate group which link the complex mol­ecules, forming an infinite three-dimensional network.The Ni atom in the title complex, [Ni(SO DOI: 10.1107/S1600536808035101/dn2397Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

After many years, during which the assumption prevailed that adjuvant chemotherapy was of no benefit in patients with resectable adenocarcinoma of the colon, findings of several large USA studies published from the late 1980s have caused a marked shift in surgical and medical opinion. Although results in patients with Dukes' B disease have not shown any clear benefit, the efficacy of adjuvant chemotherapy has nevertheless been shown in those with Dukes' C colon cancer. As a result, the Mayo regimen of 5-fluorouracil (5-FU) with low-dose leucovorin (LV) has become accepted as standard adjuvant therapy in these patients. However, the disadvantages associated with standard 5-FU-based treatment, particularly those relating to its toxicity and inconvenience of administration, have generated interest in other regimens and agents. The novel direct and specific thymidylate synthase inhibitor raltitrexed ('Tomudex') has been associated with similar objective response rates to standard therapy with 5-FU plus LV in patients with advanced colorectal cancer. In addition, raltitrexed has an attractive tolerability profile compared with that of 5-FU plus LV , and the simple 3-weekly administration schedule may be considered more convenient by many patients and may reduce healthcare resource consumption. To investigate alternatives to the Mayo regimen in the adjuvant treatment of Dukes' C adenocarcinoma of the colon, two large European trials have been set up: (1) PETACC-1 , to compare raltitrexed with the Mayo regimen of 5-FU and low-dose LV; (2) PETACC-2 , to compare the Mayo regimen with three regimens in which 5-FU is given by prolonged infusion. These trials will provide valuable international data to add to those from the USA and will assess the place of raltitrexed in the adjuvant treatment of Dukes' C colon cancer. They will also compare directly for the first time infusional and bolus 5-FU regimens in the adjuvant setting.

The identification of various individual, social and physical environmental factors affecting physical activity (PA) behavior in Canada can help in the development of more tailored intervention strategies for promoting higher PA levels in Canada. This study examined the influences of various individual, social and physical environmental factors on PA participation by gender, age and socioeconomic status, using data from the 2002 nationwide survey of the Physical Activity Monitor.In 2002, 5,167 Canadians aged 15–79 years, selected by random-digit dialling from household-based telephone exchanges, completed a telephone survey. The short version of the International Physical Activity Questionnaire was used to collect information on total physical activity. The effects of socio-economical status, self-rated health, self-efficacy, intention, perceived barriers to PA, health benefits of PA, social support, and facility availability on PA level were examined by multiple logistic regression analyses.Self-efficacy and intention were the strongest correlates and had the greatest effect on PA. Family income, self-rated health and perceived barriers were also consistently associated with PA. The effects of the perceived health benefits, education and family income were more salient to older people, whereas the influence of education was more important to women and the influence of perceived barriers was more salient to women and younger people. Facility availability was more strongly associated with PA among people with a university degree than among people with a lower education level. However, social support was not significantly related to PA in any subgroup.This study suggests that PA promotion strategies should be tailored to enhance people's confidence to engage in PA, motivate people to be more active, educate people on PA's health benefits and reduce barriers, as well as target different factors for men and women and for differing socio-economic and demographic groups. Regular physical activity (PA) is an important part of a healthy lifestyle. Considerable evidence shows that regular PA has many physical and mental health benefits, such as reduction in all-cause mortality and prevention of cardiovascular diseases, type II diabetes, hypertension, several types of cancers, osteoporosis, anxiety, and depression ,2. In seBecause of the multiple health benefits of regular PA, many health organizations have recommended 30 minutes or more of moderate-intensity PA at least 4 or 5 days a week ,3. DespiWhether people adopt an active lifestyle is a complex behavioural process that is influenced by various factors -7. SociaPeople in various demographic subgroups may differ according to the determinants of PA. Research has shown different patterns of correlates for men and women -13, for Social-ecological models recognize the need to address factors at multiple levels in order to understand and change PA behaviours, and multilevel approaches derived from these models have been recommended to examine PA determinants . Althoug• Do individual factors, social support and physical environment have independent effects on PA in the Canadian population?• Do the influences of these variables on PA vary by gender, age, education level and family income level?This study used data from the 2002 Physical Activity Monitor. It was the ninth nationwide survey on PA conducted by the Canadian Fitness and Lifestyle Research Institute (CFLRI) after the 1981 Canada Fitness Survey, the 1988 Campbell Survey on Well-Being in Canada, and the 1995, 1997, 1998, 1999, 2000 and 2001 waves of the Physical Activity Monitor.The participants were selected using random-digit dialling from household-based telephone exchanges. The random sample of households was selected roughly proportional to the population in each province and territory with a minimum of 250 adults for each jurisdiction. Within each selected household, one individual over the age of 15 was chosen at random, thus providing a random sample of 5,303 individuals in Canada. Data from the Physical Activity Monitor was collected throughout the full calendar year of 2002. The data were captured directly during the interviews using a computer-assisted telephone interview system. The overall response rate was 51%. A total of 5,167 participants aged 15–79 years were used for this analysis.The social-ecological model was used as the framework for the survey. The content of the 2002 Physical Activity Monitor was determined by the CFLRI, in collaboration with the Physical Activity Unit of the Public Health Agency of Canada, and the provincial and territorial government departments concerned with fitness, active living, leisure, sport and recreation through the auspices of the Interprovincial Sport and Recreation Council. The participants were asked about their socio-demographic background information , self-rated health, PA patterns, attitudes, and awareness of PA opportunities.. The physical activity index, Sufficient PA, was defined as at least 3 days of vigorous activity of at least 20 minutes per day; OR 7 days of moderate-intensity activity and/or walking of at least 30 minutes per day; OR 7 days of any combination of walking, moderate-intensity or vigorous-intensity activities achieving a minimum of 840 MET-minutes/week.The PA questionnaire used in this survey is the short form version of the International Physical Activity Questionnaire (IPAQ), which has been shown previously to have an acceptable test-retest reliability and criterion validity . ParticiParticipants were asked: "To what extent do you intend to be physically active over the next six months?" rated via a 7-point Likert scale from 1 to 7 .The perceived health benefits regarding PA were assessed by 4 items. Using a 7-point Likert scale from 1 to 7, where 1 means do not agree and 7 means agree very strongly, participants were asked: "To what extent do you agree with the following statement?": regular PA helps prevent heart disease, prevent cancer, reduce stress, and maintain the ability to do every day tasks in older age. Perceived personal barriers to PA were assessed using 8 items using a 7-point Likert scale, ranging from 1 to 7 (very important). Participants were asked: "How important are each of the following in keeping you from participating regularly in physical activity?": lack of time; lack of energy (/too tired); lack of physical skills; lack of interest or motivation; feeling uncomfortable or ill at ease; long-term illness, disability, injury; fear of being injured; and costs. The internal consistency of the scale was 0.72 for perceived health benefits of PA and 0.81 for perceived barriers to PA.Participants were asked how confident they were that they could regularly do a total of 30 minutes of moderate PA three or four times a week and a total of 60 minutes of light PA each day, using scales where 1 means not at all confident and 7 means very confident. The internal consistency of this scale was 0.74.Social support such as instrumental support (tangible aid and service) and informational support that influences people to engage in PA was assessed by 8 items . Participants were asked how important each of the 8 items would be in making it easier for them to be physically active. The items were presented via a 7-point Likert scale from 1 to 7 (very important). The internal consistence of this scale was 0.86.The availability of PA facilities in respondent's community was appraised by 5 items concerning the number of places to safely walk , number of places to safely ride a bike , number of publicly owned multi-purpose recreation trails, number of facilities, places and programs that are designed specifically for doing PA and sports , and number of other places that could be used for PA (such as school gym used after hours or public places where kids can skateboard). Participants were asked about how many of these 5 types of infrastructure there are in their local communities. The response options were: none at all, some and many.All of the above scales were developed by the Canadian Fitness and Lifestyle Research Institute for the purpose of the national surveys of the Physical Activity Monitor.For perceived health benefits, perceived barriers, self-efficacy, social support and facility availability, a total score for each factor was computed by adding the responses on all items for each factor and then a mean score was obtained by dividing the total score by the number of items for each factor. The mean scores of these 5 factors were used in logistic regression analyses.p < 0.05) with PA. Because education level and family income level were highly correlated and there were 15% of records with a missing value for the family income variable, models were not adjusted for family income level. Age was entered in the models as a continuous variable, gender as a dichotomous variable, self-rated health as an ordinal variable , and education as an ordinal variable . Perceived health benefits, perceived barriers, self-efficacy, and facility availability were entered into the model as continuous variables. Because the interaction effects of gender, age, education level and family income level with some factors on PA were significant and literature suggests that determinants or correlates for PA may differ by age [We used logistic regressions to examine the relationship of PA participation with various socio-demographic factors, self-rated health, intention, perceived health benefits, perceived barriers, self-efficacy, social support and facility availability. When examining these relationships, we took into account the simultaneous effects of other independent variables. The final multivariate models included all variables that showed a statistically significant unadjusted association .The overall sample had a mean value of PA level of 63.27 MET-hours (standard deviation: 64.39) with a median of 41.65 and an interquartile of 72.33. Table The logistic regression result of the effects of various factors on PA, overall and by sex is shown in Table Stratified analyses by age group Table , we founOur study results showed that education, family income, self-rated health, intention, self-efficacy, perceived barriers, perceived health benefits, and facility availability were independently related to PA. Self-efficacy and intention were the strongest correlates and had the greatest effect on PA. Self-rated health, family income, perceived health benefits, and perceived barriers were also consistently associated with PA. In addition, the effects of perceived health benefits, education and family income were more salient to older people, whereas the influence of education was more important to women and the influence of perceived barriers was more salient to women and younger people. Furthermore, facility availability was more strongly associated with PA among people with a university degree than people with a lower education level.This study found that higher self-efficacy was consistently related to higher PA across gender, age group, education level and family income level. This finding is in agreement with other studies on an array of populations ,13,16-22Intention is another important independent correlate for PA in this study. Our finding of the positive influence of intention on PA participation corroborates those of other studies -32. InteThe strong effects of self-efficacy and intention on PA suggest that interventions designed to increase PA should target self-efficacy and intention. Self-efficacy can be influenced by reinforcement history, observational learning, and perceived exertion . TherefoOur results indicate that higher SES, including higher family income level and education level, is positively associated with PA, although the association between education and PA was significant among women but not among men. Many studies found a positive association between higher education or higher income and PA levels ,33-35. PThis study also found that self-rated health was strongly and consistently related to PA across sex, age group and SES. Perceived poor health has been reported to be associated with lower PA level in other studies ,34,39,40Our finding of the positive correlation between perceived health benefits and PA level is in line with other studies ,13,18,30Perceived barriers as an important factor for PA participation have been demonstrated in many studies ,13,32,43Both perceived and objectively measured physical environment factors were found to be positively related to PA level ,18,34,44Although we did not observe an independent effect of social support on PA, many studies have shown the importance of social support in promoting PA ,21,22,47Limitations of our study should be considered when interpreting the results. First of all, our study was a cross-sectional design and causal inferences cannot be made because of the inability to determine temporal sequence. Prospective study designs should be considered in further research on these relationships in order to provide more insight on the question of the causal direction. Secondly, the response rate was low (51%) and there might be inherent differences between people who agreed to participate in the study and those who did not. However, earlier analyses showed no response rate bias . FurtherThis study identified several significant factors that were associated with PA participation. We also found differences between genders, age groups and SES in various correlates of PA. Our findings highlight the need that health promotion programs should be targeting on enhancement of people's confidence and motivation, education on health benefits of PA and reduction of barriers to achieve desired changes. Our findings also imply that interventions to promote PA need to address different factors for men and women as well as for differing socio-economic and demographic groups.The authors declare that they have no competing interests.SYP conceived the study, performed the analyses, wrote the manuscript and incorporated input from all other authors on the manuscript. CC and CLC conceived the socio-ecological elements and methods instrumental to the study and provided critical comments on the manuscript. MD and HM directed the overall study and provided critical comments on the manuscript. XJ helped part of the literature review. All authors have read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:

The prevalence of microembolic signals (MES) during the acute phase of ischemic stroke and its influence on outcome is not well studied. The aim of our study was to determine the prevalence of MES, the different factors that are associated with the presence of MES and the association between MES and outcomes in stroke patients investigated within 6 hours after the onset of ischemic stroke.We included unselected ischemic stroke patients who underwent microemboli-monitoring within six hours after stroke onset. Microemboli-monitoring of both middle cerebral arteries (MCA) was done for a period of 1 hour using 2-MHz probes applied over the trans-temporal window. Prevalence of MES, predictors for the presence of MES and the association between MES and various outcome factors were analyzed.Forty patients were included. The mean age of the patients was 70 years. The prevalence of either ipsilateral or contralateral MES were 25% (n = 10). The predictors for the presence of MES were older age , higher NIHSS , intracranial stenosis and embolic stroke (large-artery atherosclerosis and cardioembolism on TOAST classification) . MES were not independently associated with short-term functional outcome, long-term mortality or future vascular events.MES are moderately frequent following acute ischemic stroke. Microemboli-monitoring helps to better classify the stroke etiology. However, the presence MES did not have any prognostic significance in this study. Previous studies have shown that microemboli to brain occurs following an ischemic stroke -12. ThesThe common source of MES is thought to be from heart or from an atherosclerotic plaque. While these sources are major risk factors for symptomatic thrombo-embolic events, MES per se may not cause symptoms and its clinical significance is not fully known. There is some evidence that microemboli may obstruct small arterioles and lead to subsequent white matter degeneration . TherefoPrevious studies have shown that intravenous anti-platelet medications can reduce microemboli . TherefoThe aim of our study was to assess the prevalence of MES in acute stroke patients within 6 hours after stroke onset. We also aimed to study the etiology associated with MES and its significance on functional and survival outcomes.The study was conducted at Haukeland University Hospital, Bergen, Norway for a period of two years between January 2007 and December 2008. The hospital covers a well-defined geographic area with a population of 235,000. All patients were admitted to stroke unit under the department of Neurology.In this prospective study, we included patients with ischemic stroke or TIA presented within six hours after the onset of symptoms. Patients were included whenever possible, i.e. if an experienced examiner was available, if investigation could be performed in less than six hrs after symptom onset, and if an adequate ultrasound window was found.Microemboli-monitoring using TCD was done earliest possible according to the availability of the investigators (TTI & LT). We used Pioneer Nicolet TC 8080 for TCD examination and microemboli-monitoring. Both MCA were insonated using a trans-temporal approach. Signals were obtained from the most proximal part of MCA . The gain was set to the minimum possible and MES were detected automatically as "HITS" . Sample volume length was set at 10 mm. Machine detected HITS were manually inspected to rule out artifacts. The monitoring was done continuously for one hour. Presence of one or more microemboli during the one-hour monitoring was considered MES positive. Microemboli was defined using the criteria drawn up by the International Consensus Group on Microembolus Detection.All patients underwent TCD study of all segments of MCA and some patients underwent magnetic resonance angiogram of intracranial vessels. A stenosis above 50% on either test was considered positive for intracranial stenosis. TCD criteria used to define 50% stenosis was a mean velocity over 100 cm/sec.A neurologist assessed NIHSS at the time of admission. Eligible candidates received intravenous thrombolysis according to SITS-MOST criteria . PatientActive smoking was defined as the use of at least one cigarette per day prior to stroke onset. History of atrial fibrillation (AF), previous stroke or TIA, coronary artery disease and peripheral vascular disease was registered during hospital stay.All patients underwent Duplex sonography of the carotid arteries. ECG was done on all patients and echocardiography was done on patients with suspected cardiac source of emboli. The etiology of stroke was classified as large-artery atherosclerosis, cardioembolism, small vessel occlusion, stroke of other determined etiology and stroke of unknown etiology based on TOAST criteria. Age was categorized as <65 and ≥ 65 years. Outcome was measured by modified Rankin Scale (mRS) 7 days after stroke onset or on discharge if discharged earlier. Poor outcome was defined as mRS ≥ 3. Survival data was obtained from the National Population Registry of Norway, where all permanent residents are registered. All causes of mortality were included. Patients were followed for a maximum of 2 years for future vascular event rate and survival analysis.Informed consent was obtained from all the patients and the study was approved by the local ethics committee.Continuous variables are expressed as mean and standard deviation for parametric variables and as median and 95%CI for non-parametric variable. Pearson's Chi-square test and Fisher exact test were used to assess odds ratio and significance for fourfold tables. Binary logistic regression was used to analyze the functional outcome. Cox-regression analysis was used for the analysis of survival and future vascular events. Statistical analysis was performed with SPSS 14.0 software.A total of 49 patients underwent microemboli-monitoring during the two-year period. Nine (9) patients were excluded because of poor or absent ultrasound window. The remaining 40 patients were included in the study. The mean age (years) of patients with poor or absent window was higher than the mean age of patients with an adequate ultrasound window . Table Table Patients with embolic etiology (cardioembolism or large-artery atherosclerosis) were seven times more likely to have MES compared to other etiologies based on TOAST criteria (p = 0.03). Eight out of ten patients with MES had an embolic source for stroke. The prevalence of MES in patients with embolic etiology was 33.3% and that of non-embolic etiology was 12.5%. None of the patients with lacunar stroke or stroke from 'other etiology' (one patient with moyamoya disease and one patient with carotid dissection) had MES. Out of nineteen patients with `unknown etiology`, two patients with insufficient stroke work-up had MES. Figure On univariate logistic regression analysis, MES were significantly associated with poor functional outcome . When the analysis was done after adjusting for the confounding factors , the association was no more significant . Isolated ipsilateral MES and isolated contralateral MES were also not associated with functional outcomes Six patients died during the study period of two years. On Cox regression analysis, after adjusting for age, sex and NIHSS, presence of MES were not associated with mortality . Figure Our study shows that the prevalence of MES in stroke patients with thrombo-embolic etiology is moderately frequent while the prevalence of MES in non-thromboembolic stroke is infrequent in the first six hours after stroke. One third of the stroke patients with embolic etiology had MES while only one eighth of the stroke patients with non-embolic etiology had MES. Eight out of ten patients with MES had either large-artery or cardio-embolic etiology.Detection of the source of emboli is important in preventing future strokes. Based on the present stroke classifications such as the TOAST criteria, more than one third of the patients falls under the subgroup of 'undetermined etiology' ,19. In tThe prevalence of microemboli among patients who underwent thrombolysis was higher than in those who did not undergo thrombolysis (29.2% versus18.8%), however did not reach statistical significance (p = 0.36). It is argued that MES in patients who undergo thrombolysis may represent fragmentation of thrombus proximal to insonation by thrombolytic agents. A clear conclusion cannot be drawn from our study because the association was not statistically significant.One of the issues in performing microemboli-monitoring immediately following stroke onset is that it requires considerable time and manpower to set up the machine and to perform monitoring constantly. Unless there is a clear and superior benefit in detecting more patients with MES or in predicting outcomes, it is futile to perform the time-consuming microemboli-monitoring during the phase immediately following stroke. A prevalence of 25% as shown in our study is not considerably higher than in other studies in which monitoring was done beyond the first six hours after stroke onset. Our study also failed to shows any association between MES detected during the acute phase of stroke and stroke outcomes or future vascular events. Thus, the difficulty of performing microemboli-monitoring along with its uncertain association with stroke outcomes and future vascular events questions its clinical utility during the acute phase of stroke. However, this interpretation needs to be taken cautiously since ours is a single-center study of non-consecutive stroke patients. This study may be underpowered to assess the outcomes. Therefore the results need to be confirmed with larger studies. Also, the absence of prognostic significance may not apply to certain specific sub-groups such as symptomatic carotid stenosis, especially those with unstable carotid plaque .This study has some limitations. We did not include all consecutive patients admitted within the first six hours after the stroke. Therefore, the prevalence rate in our study may not represent the actual prevalence. Microemboli-monitoring was done only once. Multiple monitoring during successive days following stroke might yield more patients with microemboli. A single monitoring also makes it difficult to assess the source of microemboli in those patients with intracranial stenosis because microemboli could have originated from a resolving thrombus. Another limitation is a relatively small patient population. A large study, however, may be practically difficult to conduct during the immediate phase following stroke onset.Microemboli-monitoring following acute ischemic stroke helps to better classify the etiology of stroke as embolic versus non-embolic. The usefulness of microemboli-monitoring immediately following stroke onset for prognostication seems questionable.The authors declare that they have no competing interests.TTI & LT: Participated in the design of the study, participated in analysis and interpretation of data, participated in manuscript drafting. HN: Participated in the design of the study, participated in data collection.All the authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2377/10/79/prepub

The benzene rings are almost coplanar, making a dihedral angle of 2.82 (6). The sulfonamide group is twisted away from the attached phenyl ring with an N—S—C—C torsion angle of 64.84 (11)°. An intra­molecular O—H⋯N hydrogen bond stabilizes the mol­ecule, generating an S(6) ring motif. In the crystal, inter­molecular N—H⋯O and C—H⋯O hydrogen bonds link the mol­ecules into a three-dimensional network.The title Schiff base compound, C Å b = 26.4754 (3) Å c = 9.9683 (1) Å β = 131.544 (1)°V = 1337.21 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.27 mmT = 100 K 0.41 × 0.27 × 0.06 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2009T min = 0.896, T max = 0.985Absorption correction: multi-scan (29377 measured reflections4825 independent reflectionsI > 2σ(I)4104 reflections with R int = 0.031 R[F 2 > 2σ(F 2)] = 0.039 wR(F 2) = 0.110 S = 1.06 4825 reflections211 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.60 e Å−3 Δρmin = −0.43 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536810036949/sj5036sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810036949/sj5036Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

We explored the heterogeneity of philadelphia chromosome-positive acute lymphoblastic leukemia (Ph1-ALL) in a study of the effect of early features on prognosis in children. Here we report the long-term results of the FRALLE 93 study conducted in the era before the use of tyrosine kinase inhibitors.Between 1993 and 1999, 36 children with Ph1-ALL were enrolled into the FRALLE 93 protocol. After conventional four-drug induction, children were stratified by availability of an HLA-matched sibling.3 and day-21 M1 marrow had a more favorable prognosis , than the high-risk group (p < 0.005). We also observed a non statistically significant difference (p = 0.14) in outcome between these groups for transplanted patients .Complete remission (CR) was observed in 26 children (72%), of which 13 underwent allogeneic bone marrow transplantation (BMT). Thirty-one children were good responders to prednisone, defined on day 8, and 21 were good responders to chemotherapy, defined by day-21 bone marrow (M1). Overall five-year disease-free survival (DFS) was 42 ± 9.7%. Based on multivariate analysis, two groups showed marked differences in five-year outcome: children with age<10, leukocyte count <100,000/mmAge, leukocyte count and early response to treatment defined by the D21 bone marrow response provide an accurate model for outcome prediction. The combination of available tools such as minimal residual disease assessment with determination of these simple factors could be useful for refining indications for BMT in the current era of tyrosine-kinase inhibitor-based therapy. The philadelphia chromosome Ph1) is detectable in 2% to 5% of children with acute lymphoblastic leukemia (ALL) is detec-5. This BCR-ABL status, which may be useful for developing novel prognostic markers and future patient stratification procedures . Pat. PatBCR-al Table . The remTreatment outcome was analyzed according to indicators of early response to therapy. The prognostic value of persistent lymphoblasts in blood sampled at day 8 and in bone marrow at day 21–22 has been demonstrated in several previous studies -17. We aAnalysis was based on an intent-to-treat principle. CR rates were compared using Fisher's exact test. Censored endpoints were estimated by the non parametric Kaplan-Meier method, and then compared by the log-rank test. Multivariate analyses were carried out to define the set of informative prognostic factors, using regression models adapted to the endpoint, namely the logistic model for CR rates, and Cox model for overall survival (OS) and event free survival (EFS).Type I error was fixed at 5%. All tests were two-tailed. Statistical analysis was performed using SAS 9.1 .BCR-ABL rearrangement was detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in 3% of the B-lineage ALL. Of the 36 Ph1-ALL children, 30 had detectable t and six were identified solely by the presence of the BCR-ABL fusion transcript. Thus, fusion transcript analysis was able to detect nearly 17% more Ph1 patients than conventional karyotype. The m-BCR breakpoint was detected in 30 patients and the M-BCR breakpoint in three others ). At baseline, median age was eight years , male-to-female ratio was 1.1, median leukocyte count was 29.1 × 109/l [Q1–Q3: 12.5–137] and median hemoglobin was 9 g/dl [2.5–15]; four patients displayed central nervous system defects (11.1%).Ph1 was detected by conventional cytogenetic analysis ) or a Complete remission was observed in 26 children (72%), after a median of 40 days [range 32–51] consistent with previous findings [Ten patients did not achieve CR after induction therapy, but CR was observed in seven of them after one further course of chemotherapy. The dexamethasone, cytarabine, cyclophosphamide, etoposide, and idarubicin or daunorubicin (CAZED) scheme was recommended as salvage treatment in the FRALLE 93 protocol and thus was used in five of these seven patients (amsacrine and cytarabine for the 2 others) . All sevPatient follow-up data were updated in February, 2007. In an intention-to-treat analysis, 10 children remained in CR1, giving a five-year disease-free survival (DFS) rate of 42.3% ± 9.7% and a five-year OS rate of 47.2% ± 8.3. Leukemic relapse was the most common cause of adverse events. Eleven children relapsed (no late relapse after 5 years) and five toxic deaths occurred (including one late death from infection). No secondary malignancy was observed.3. Response to chemotherapy based on day 21 bone marrow was only predictive of induction response (p = 0.0004). When incorporated simultaneously in multivariate regression models, only one predictive factor retained significant prognostic value for a particular endpoint: M1 for CR, WBC count >100,000/mm3 for EFS and age ≥ 10 for OS. Combining the information of these three binary variables defined two groups differing widely in terms of outcome: the 14 children with age<10, WBC<100,000/mm3 and M1 defined a group with a favorable prognosis , whereas the remaining 22 children had poorer outcomes (p = 0.14).Table This long-term study, carried out before the introduction of imatinib mesylate, confirmed the prognostic value of two major clinical factors and identified the D21 marrow response as a powerful complementary tool. We did not find prednisone response to have statistically significant predictive value for any endpoint studied, in contrast with earlier reports ,6. This Based on these three easily available indicators , a predictive model can be built to define two subsets of children that differ widely in terms of outcome. Such a model should be further investigated in larger samples and in ongoing pediatric trials integrating tyrosine-kinase inhibitors. The improved early responses observed with imatinib or dasatinib in adult studies, and similar, but very preliminarily, results obtained in one pediatric study with imatinib, now question the appropriate use of allogeneic stem-cell transplantation ,18. IndeThe authors declare that they have no competing interests.All the authors have substantially contributed to the conception and design or acquisition of data or analysis and interpretation of the data in this multicentric study, and participated to drafting and revising the article. SC and MFA performed statistical analysis. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/14/prepub

ATP5O, is reduced in skeletal muscle from T2D patients. Our aims were to investigate mechanisms regulating ATP5O expression in skeletal muscle and association with glucose metabolism, and the relationship between ATP5O single nucleotide polymorphisms (SNPs) and risk of T2D.Impaired oxidative capacity of skeletal muscle mitochondria contribute to insulin resistance and type 2 diabetes (T2D). Furthermore, mRNA expression of genes involved in oxidative phosphorylation, including ATP5O mRNA expression was analyzed in skeletal muscle from young (n = 86) and elderly (n = 68) non-diabetic twins before and after a hyperinsulinemic euglycemic clamp. 11 SNPs from the ATP5O locus were genotyped in the twins and a T2D case-control cohort (n = 1466). DNA methylation of the ATP5O promoter was analyzed in twins (n = 22) using bisulfite sequencing. The mRNA level of ATP5O in skeletal muscle was reduced in elderly compared with young twins, both during basal and insulin-stimulated conditions (p<0.0005). The degree of DNA methylation around the transcription start of ATP5O was <1% in both young and elderly twins and not associated with mRNA expression (p = 0.32). The mRNA level of ATP5O in skeletal muscle was positively related to insulin-stimulated glucose uptake . Furthermore, two SNPs were associated with both ATP5O mRNA expression and glucose uptake in the young twins. However, we could not detect any genetic association with T2D.ATP5O mRNA expression and glucose disposal rate, suggesting that combinations of genetic and non-genetic factors may cause the reduced expression of ATP5O in T2D muscle. These findings propose a role for ATP5O, in cooperation with other OXPHOS genes, in the regulation of in vivo glucose metabolism.Genetic variation and age are associated with skeletal muscle NDUFB6 and COX7A1, respectively, and insulin stimulated glucose uptake in vivoATP5O was the most significantly reduced OXPHOS gene in skeletal muscle from patients with T2D compared with healthy control subjects (p = 0.0027) ATP5O remains unknown.Insulin resistance in skeletal muscle increases with age and during the course of type 2 diabetes mellitus (T2D). Reduced expression of genes from the respiratory chain in the mitochondria may cause impaired oxidative capacity in skeletal muscle which, in turn, has been suggested to contribute to insulin resistance 2 along a series of carrier molecules, protons are pumped across the inner mitochondrial membrane to produce a proton gradient and in a final step ATP is produced from ADP and phosphate 1 subunit) and the membrane proton channel (F0 subunit), thereby influencing transmission of conformational changes and proton conductance Oxidative phosphorylation is a process where electrons are passed from NADH and FADHATP5O expression in skeletal muscle and 2) if single nucleotide polymorphisms (SNPs) in ATP5O are associated with increased risk of T2D.The aims of the present study were to investigate 1) the mechanisms regulating Individuals were identified through The Danish Twin Register This is a family based study established in 1990 aiming at the identification of T2D susceptibility genes All studies were approved by the regional Ethics Committees and conducted according to the Helsinki Declaration. Written consent was obtained from all participants apart from a subset that was enrolled in the Botnia study in the early 90's when only verbal informed consent was obtained.−2 min−1) combined with indirect calorimetry during the basal and insulin-stimulated steady state periods as previously described −1·min−1Each twin pair simultaneously underwent a 2-day clinical examination. The subjects were instructed to restrain from strenuous physical activity for 24 h and to fast overnight (10–12 h) before examination. Anthropometric measures were performed as previously described − Reverse Transcriptase and random hexamer primers . ATP5O mRNA levels were quantified using TaqMan Real-Time PCR with an ABI 7900 system using probe and primer pair specific for ATP5O covering exon boundary 4–5 . For the probe/primer set a standard curve was generated that was confirmed to increase linearly with increasing amounts of cDNA. Each sample was run in duplicates and the transcript quantity was normalized to the mRNA level of cyclophilin A , which expression was tested to not be affected by age.Muscle biopsies were obtained from the vastus lateralis muscle from the twins during both basal and insulin-stimulated states. Total RNA was extracted using Tri Reagent kit and cDNA was synthesized using Superscript II RNase HATP5O locus . The resulting amplicon is 249 basepairs long and includes 19 possible DNA methylation (CpG) sites. This region, which is located within a CpG island, surrounds the ATP5O transcription start site (TSS) including the beginning of exon 1 (−93 to +156 in relation to TSS). The PCR products were cloned into plasmid vectors , further E. coli were transformed and DNA from 10 colonies of each individual muscle sample were isolated . The individual clones were sequenced and the number of methylated sites was determined using BiQ Analyzer Genomic DNA was isolated from muscle biopsies at the same time as RNA using the Tri Reagent kit according to the manufacturer's instructions (Sigma-Aldrich). DNA bisulfite modification was accomplished on DNA from 11 young and 11 elderly twins using the EZ DNA methylation kit . Bisulfite modified DNA was amplified with primers designed using the program MethPrimer Conventional tests of differences between variable (y) means are not valid for twin data due to the strong intrapair correlation. Generalized estimating equations (GEE) methodology (y = α+βx) was used to correct for this dependence and provide valid standard errors for the β-coefficients p>0.05 as the defining criteria for exclusion of model terms. GEE methodology was used to obtain valid tests.To identify factors independently associated with the response variable, we used backward-elimination multivariate regression analysis with ATP5O mRNA expression in monozygotic (MZ) and dizygotic (DZ) twin pairs. The degree of genetic and environmental influence of a phenotypic variable can be estimated using biometric modeling as previously described A) or dominant genetic effects (VD) and environmental variance due to an individual environment not shared with co-twin (VE) or a common environment shared among co-twins (VC). Heritability gives the proportion of the total variation (VT) of a trait attributable to additive genetic variation (VA). We used the MX software package, a programme for linear structural equation modeling, to estimate the variance components and to compare the different models. Biometric modeling was conducted separately in the two age groups. The fit of each model was assessed by maximum-likelihood methods and resulted in a χ2 goodness of fit index and probability value that tested the agreement between the observed and the predicted statistics. A small goodness of fit χ2 value, a high p-value and a low AIC (Akaike's information criterion), which equals the χ2 value minus 2 times the degree of freedom, indicates good correspondence and were used in comparisons of each model leading to a best fitting model.Intra-class correlations, a method to measure resemblance within twin pairs ATP5O gene region and T2D. With a minor allele frequency of 5%, a T2D frequency of 6% and a relative risk of 1.3 at α = 0.05 we have 38% power using a dominant model in the Botnia case control study. Association of individual SNPs with T2D was determined by logistic regression adjusted for BMI, sex and age-at-onset (cases) or age-at-visit (controls), assuming an additive model. Hardy Weinberg p-value, LD and haplotype block structure were calculated using Haploview The Genetic Power Calculator www.dssresearch.com; Fort Worth, TX, USA).Power to detect differences in DNA methylation in our study was calculated to 53.8% (α = 0.05) using DSS research statistical power calculator and insulin-stimulated state (The influence of age on 5) state Fig. 2.ATP5O expression was estimated in young and elderly twins by means of intra-class correlations and biometric modeling. In the young twins, the intra-class correlation for skeletal muscle ATP5O expression was higher in MZ (0.77) as compared to DZ (0.34) with a heritability of 77% and unique (59%) environmental factors during the clamp (2 = 0.96). rs12482697 is located 5 kb upstream from transcription start whereas rs11088262 is a missense polymorphism in exon 4. However, none of the other SNPs were associated with ATP5O expression in skeletal muscle (data not shown).In order to evaluate the genetic factors influencing tag SNPs Fig. 1 wATP5O may influence the mRNA expression in skeletal muscle. The degree of DNA methylation was low in both young and elderly twins and there was no significant difference between the two age-groups (p = 0.16). Of note, eight young and six elderly twins showed no methylation at all of this DNA sequence. Furthermore, we could not observe any significant correlation between ATP5O DNA methylation and mRNA expression .We also tested if DNA methylation around the transcription start of ATP50 expression in muscle a multivariate regression analysis was performed including the following parameters as explanatory variables: basal and insulin-stimulated skeletal muscle PGC-1α and PGC-1β mRNA expression, birth weight, age, sex, BMI and zygosity and inversely related to age and female sex .To examine if additional factors are associated with zygosity Table S1ATP5O expression in skeletal muscle is related to in vivo insulin stimulated glucose uptake in young and elderly twins (n = 155). The following variables were included in the regression model: ATP5O mRNA expression, zygosity, birth weight, age, sex and BMI. Indeed, the mRNA level of ATP5O was positively related to glucose uptake . Furthermore, since rs11088262 and rs12482697 influenced the expression level of ATP5O in skeletal muscle of the young twins, we tested if these polymorphisms also were associated with glucose uptake. Both rs11088262 and rs12482697 showed association with insulin-stimulated glucose uptake in the young twins . A total number of 32 SNPs (including imputed data) were analyzed but none showed evidence for association with T2D.The association between two genetic variants (rs11088262 and rs12482697) and glucose uptake was only seen in young but not in elderly twins. This was in agreement with the heritability estimates, where the heritability of PGC-1α, one of the master regulators of OXPHOS genes, there was no difference in the level of DNA methylation in skeletal muscle of young and elderly twins ATP5O promoter region, but hardly any DNA methylation could be detected and there was no difference between the two age groups.In the promoter region of some but not all OXPHOS genes, increased DNA methylation in elderly subjects has been reported ATP5O mRNA expression and glucose disposal rate, suggesting that combinations of genetic and non-genetic factors may cause the reduced expression of ATP5O in T2D muscle. These findings propose a role for ATP5O, in cooperation with other OXPHOS genes, in the regulation of in vivo glucose metabolism.In conclusion, both genetic variation and age were associated with skeletal muscle Table S1(0.03 MB DOC)Click here for additional data file.Table S2(0.04 MB DOC)Click here for additional data file.

The acetyl group at position 1 has a bis­ectional orientation. The two phenyl rings attached to the piperidine ring at positions 2 and 6 have bis­ectional and axial orientations, respectively, and make a dihedral angle of 75.27 (10)°. The phenyl­acetonitrile group at position 4 has an equatorial orientation. Mol­ecules are linked by C—H⋯N, C—H⋯O inter­molecular and C—H⋯π inter­actions. A C—H⋯O intra­molecular inter­action is also found in the mol­ecule.In the title mol­ecule, C Å b = 10.646 (6) Å c = 10.8860 (18) Å α = 90.45 (2)°β = 99.957 (14)°γ = 101.98 (3)°V = 1048.9 (7) Å3 Z = 2 Kα radiationMo −1 μ = 0.08 mmT = 200 (2) K 0.43 × 0.37 × 0.23 mm Oxford Diffraction Gemini diffractometerAbsorption correction: none14102 measured reflections6736 independent reflectionsI > 2σ(I)2238 reflections with R int = 0.062 R[F 2 > 2σ(F 2)] = 0.054 wR(F 2) = 0.150 S = 0.86 6736 reflections271 parametersH-atom parameters constrainedmax = 0.17 e Å−3 Δρmin = −0.18 e Å−3 Δρ CrysAlis CCD (Oxford Diffraction, 2007CrysAlis CCD; data reduction: CrysAlis RED (Oxford Diffraction, 2007SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997PLATON (Spek, 2003Data collection: 10.1107/S160053680800860X/wn2248sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680800860X/wn2248Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

To better understand the molecular epidemiology of tuberculosis (TB) transmission for culture-confirmed patients <5 years of age, data were analyzed from a population-based study conducted in seven U.S. sites from 1996 to 2000. Mycobacterium tuberculosis isolates were genotyped with IS6110-based restriction fragment length polymorphism analysis and spoligotyping. Case-patient data were obtained from the Centers for Disease Control and Prevention’s national tuberculosis registry and health department records. Routine public health investigations conducted by local health departments identified suspected source patients for 57 (51%) of 111 culture-confirmed patients <5 years of age. For 8 (15%) of 52 culture-confirmed patients <5 years of age and their suspected source patients with complete genotyping results, genotypes suggested infection with different TB strains. Potential differences between sources for patients <5 years of age and source patients that transmitted TB to adolescent and adult patients were identified. The occurrence of tuberculosis (TB) in children is an indicator of ongoing Mycobacterium tuberculosis transmission and of deficiencies in current public health efforts. In the United States, strategies to prevent childhood TB include identifying and promptly initiating treatment for adults with active TB to interrupt transmission –4. SinceFor newly diagnosed TB in children, source-case investigations are conducted to ascertain the source of infection and to prevent ongoing transmission from infectious persons. Despite efforts by TB-control programs, suboptimal numbers of source patients are identified for children –12. PinpThe use of molecular analysis with conventional epidemiology has increased our understanding of TB transmission ,16. In oIn 1996, the Centers for Disease Control and Prevention (CDC) established the National Tuberculosis Genotyping and Surveillance Network (genotyping network) to conduct population-based genotyping in seven U.S. sentinel surveillance sites (To better understand the molecular epidemiology of TB transmission among young children (patients <5 years of age), data collected by the genotyping network were analyzed to report the frequency that suspected source patients were identified for young children, to examine the frequency and characteristics of source patients for young children, and to determine the proportion of isolates from young children and their identified source patients with discordant genotypes. We also investigated potential differences in the characteristics of source patients who transmitted TB to young children as compared to source patients who transmitted to adolescent and adult patients. A detailed description of study participants, population, and methodology is reported elsewhere . In brie Genotyping of M. tuberculosis isolates was conducted in accordance with standardized study protocols . IS6110- Our investigation focused on culture-confirmed patients <5 years of age; TB in young children represents recent transmission, and source patient investigations are routinely conducted for this group. A source patient was defined as a confirmed TB patient who was identified by chart abstraction as the likely source of infection for another reported TB patient. A secondary patient was defined as a confirmed TB patient who was infected by an identifiable source. Epidemiologically related source patients and secondary patients identified through routine public health investigations were considered suspected patient pairs. Because some source patients transmitted TB to more than one secondary patient, the number of suspected patient pairs does not equal the number of source patients. A secondary patient, however, could have only one designated source patient. Genotypes for isolates from suspected patient pairs were compared, and patient pairs were categorized as 1) confirmed patient pairs, if isolates had concordant genotypes 2) refuted patient pairs, if isolates had discordant genotypes, and 3) undetermined patient pairs, if genotypes were unavailable for the patient pair. Data in the multisite genotyping network database were analyzed with SAS version 8.0 and Epi Univariate analysis was conducted to examine factors associated with the identification of source patients for young children and to investigate associations between key variables and the identification of refuted patient pairs. Differences in proportions were assessed with the chi-square statistic or 2-tailed Fisher exact test. Relative risks (RR) and 95% confidence intervals of point estimates were generated where appropriate. Differences in the means of continuous data were tested with the Wilcoxon rank-sum test when sample sizes were small. Unless otherwise noted, p values <0.05 were interpreted as statistically significant differences for all statistical tests. Genotypes of isolates from young children without a known source patient were matched against the genotyping network project database to find previously unidentified adult TB patient(s) whose genotype matched the child’s. Since the sentinel study sites represented geographically dispersed states that did not necessarily share a common border, genotype matches were limited to patients from the same site. To better describe the unique characteristics of patients who transmit TB to young children, source patients (in confirmed patient pairs) who transmitted TB to young children were compared with those who transmitted to adolescents or adult patients. Since source patients who infected children 5 years of age or older may be very similar to source patients who infected children newly born to 4 years of age, two different comparison groups were identified 1) source patients for all secondary patients ≥5 years of age and 2) source patients for secondary patients ≥15 years of age (excluding source patients that transmitted to children 5–14 years of age). From 1996 to 2000, a total of 15,035 TB patients were reported from the seven sentinel surveillance sites; 11,923 (79%) were culture confirmed, and isolates from 10,752 (90%) culture-confirmed patients were genotyped. Of all patients in the study, 518 (3%) patients were <5 years of age. Culture was attempted in 270 (52%) patients <5 years of age, and 122 (45%) of these patients were culture confirmed. Isolates from 114 (93%) culture-confirmed children <5 years of age were genotyped. Texas and California sites reported 73 (60%) of the 122 culture-confirmed patients <5 years of age; the Michigan and New Jersey sites reported 18 patients each, and the remaining three sites reported ≤6 patients each. Most (65%) of the study patients were <2 years of age, and 49% were girls. Forty-three percent were black, non-Hispanic; 37% Hispanic; 15% Asian; 4% white, non-Hispanic, and 2% Native-American or Alaskan Native. Of the 11 foreign-born patients <5 years of age, 4 were from Mexico, 2 were from Kenya, and 5 were from other countries. Two thirds of the young children had pulmonary TB disease, 15% had extrapulmonary disease, and 20% had both pulmonary and extrapulmonary TB. With some notable exceptions, culture-confirmed patients <5 years of age had demographic or clinical characteristics similar to those of the 396 young children from the surveillance area who were either culture-negative or did not have a specimen collected for culture. The culture-confirmed group was more likely to be ≤1 year old ; whereas white, non-Hispanic children and those treated only by private providers were underrepresented in the sample of culture-confirmed patients.Results of routine investigations used in identifying source patients for culture-confirmed children <5 years of age are presented in To examine factors associated with the identification of source patients for culture-confirmed children <5 years of age, we compared young children with a suspected source patient to patients with an unknown source of infection . ChildreOf the 57 culture-confirmed patients <5 years of age for whom a source patient was identified, 91% (52) had genotyping results for both the young child and the suspected source patient . Forty-fFor the nine young patients who had at least one epidemiologically related patient identified by public health investigations but for whom the source patient could not be determined, genotyping patterns from the isolates of the epidemiologically related cases and the young child were identical, almost without exception. The only two discordant genotypes were in young children with a single related case, not among the five young children with multiple related patients.Genotyping also identified patients in the local surveillance site who had the same genotype as young children without an identified source patient. Isolates were genotyped from 40 of 45 patients <5 years of age without a known source patient. Of these genotyped isolates, 23 (58%) matched the strain from at least l adult pulmonary TB case in the local surveillance site. For most young children (13 [57%] of 23) without an identified source patient, at least 5 adult pulmonary TB patients with genotypes matching the child’s were identified. We found a wide range in the number of adult patients (2–128) with genotypes matching the genotypes of these young children.To better characterize the unique attributes of patients who transmit TB to young children, characteristics of their source patients (in confirmed patient pairs) were compared with those for adults and adolescents. No significant differences were found when the comparison group for this analysis consisted of all sources to secondary patients ≥5 years of age or when the comparison group was limited to sources to secondary patients ≥15 years of age. The results of the latter comparison are presented. More than 60% (354 of 584) of the suspected patient pairs in which the secondary patient was not a child were genotyped, and 240 (68%) of these patient pairs had concordant genotypes . The lik Univariate associations between source patient characteristics and transmission to young children were assessed . AlthougDespite the continued decline in the number of TB patients in the United States, ongoing TB transmission persists in many communities. For public health agencies, TB in young children signals recent transmission and missed opportunities for TB prevention. In this investigation, molecular tools were used in conjunction with information from conventional public health investigations to better understand issues related to the identification of source patients for young children. In this multisite study, 57 (51%) of 111 culture-confirmed patients <5 years of age had a source patient identified by routine investigations. Although this finding is comparable to the frequency of source patient identification reported for other subpopulations of children with TB ,10–11, t Children <5 years of age with an unknown source of infection composed a substantial proportion of the study population (41%), a finding that underscores shortcomings in identifying all contacts of infectious patients. While molecular data alone are not enough to prove recent transmission, the presence of infectious TB patients in the community who share the same strain with a young child without a known source suggests the possibility of casual transmission. Other impediments in identifying source patients may include barriers in completing contact investigations, delays in evaluation, and problems in identifying source patients who reside outside the health department’s jurisdiction . Eighty- Of particular concern is the finding that 16 (14%) of 111 culture-confirmed young children had more than one epidemiologically related TB source identified. This finding indicates that a substantial number of children have multiple TB exposures that need to be carefully assessed. For most, the source of infection was ascertained and later confirmed by genotyping analysis. When multiple epidemiologically related patients existed, but none was identified as the source patient, genotyping analysis did not provide added benefit since the related patients were more likely to have the same genotype. Clinicians and TB-control programs often rely on the drug-susceptibility results of the suspected source patient to guide the treatment of the child since specimens for culture are not frequently collected from children . Previou The high frequency (85%) of concordant genotypes among young children and their source patients represents good news for public health agencies; when a potential source of infection was identified in this population, it was most often accurate. However, for as many as 15%, the true source was not identified and presumably could have contributed to the further spread of disease in the community. Because young children may have more limited opportunities for exposure than older children, we anticipated that the frequency of confirmed patient pairs would be associated with young age. We also speculated that foreign-born children, especially those from high TB-prevalence areas, might have an increased risk of being involved in a refuted patient-pair. These children might have had multiple opportunities for exposure to active TB before entering the United States, which may increase the possibility that the source of infection could have been someone other than the suspected source patient. However, this potential association could not be assessed because our sample of foreign-born children with culture-confirmed TB was small. The increased likelihood of concordant genotypes among suspected patient pairs involving young children as compared with suspected patient pairs that did not include children (85% vs. 68%) may be explained by a number of factors, including the greater number of casual contacts with whom adults interact, biases in the case-finding practices for these groups, and potential for coincidental reactivation of a latent TB infection in older patient pairs. Source patients who transmitted TB to young children were more likely to be Hispanic, foreign-born, a household member, and not receiving directly observed therapy as compared to sources for adolescents or adults. The latter may indicate nonadherence of source patients to drug treatment and corroborates an observation by Kimerling et al. . HoweverA key limitation in this study was the inability to assess the effect of potential confounding factors, such as differences in case-finding methods on the outcome of interest . These data represented the sites’ routine public health practices and policies, since uniform policies for public health investigations were not instituted, and potential systematic variances across sites were not ascertained by the project. In addition, analysis of epidemiologic investigations for infectious patients in the community who shared the same TB strain as the young child but were not identified from public health investigators was outside the scope of this paper. A follow-up investigation to find epidemiologic connections among patients currently linked by genotyping results alone may provide important data regarding potential missed opportunities in this group. Finally, the predictive value of a discordant genotype result is not yet known. Although study protocols instituted quality-control measures across genotyping laboratories, a subset of isolates from suspected patient pairs who were determined to have discordant genotypes might include TB strains that are potentially the same. Thus, the proportion of discordance observed in this study may represent an overestimate of the actual frequency of suspected patient pairs with discordant genotypes.This study highlights the challenges in identifying the sources of infection for culture-confirmed children under 5 years of age and potential weakness in our current TB-control and prevention practices in this population. Although contact and source patient investigations are central to any TB-control strategy, the usefulness of these activities in identifying the true source of infection in young children has not been previously evaluated for a large population of children by using molecular methods. While indicating a high degree of concordance between genotypes from young children and their identified sources, genotyping analysis also refuted some source patients and pointed to other potential sources in the community who were previously unsuspected. Further assessment of shortcomings in current methods to prevent transmission to children and to identify their source of infection is warranted to ultimately eliminate TB in young children in the United States.

After a large outbreak of Legionnaires’ disease in the Netherlands, we determined risk factors for intensive care unit (ICU) admission and death and the impact of adequate therapy on ICU-free survival among 141 hospitalized patients. Overall mortality rate was 13%, and ICU mortality rate was 36%. Smoking, temperature >38.5°C, and bilateral infiltrates shown on chest x-ray were independent risk factors for ICU admission or death . Starting adequate therapy within 24 hours after admission resulted in a higher ICU-free survival rate compared to therapy initiation after 24 hours: 78% versus 54%, respectively (p=0.005). However, delay in providing therapy to patients with urinary antigen tests with negative results did not influence outcome. These data suggest that by using the urinary antigen test on admission a more tailored approach to patients with community-acquired pneumonia may be applied. Severe Legionnaires’ disease has an overall mortality rate of 10% to 30% . One of In March 1999 one of the largest outbreaks of Legionnaires’ disease since the first described outbreak in Philadelphia occurredOn March 12, 1999, the Dutch population was alerted by newspapers and a special broadcast that a flower show was identified as probable origin of an outbreak of Legionnaires’ disease (The following definitions were used to categorize the patients:“confirmed Legionnaires’ disease” was defined as the presence of a new infiltrate shown on the chest x-ray on admission and one or more of the following laboratory criteria: 1) isolation of L. pneumophila from a respiratory sample (28 patients), 2) detection of L. pneumophila serogroup 1 antigen in a urine sample (86 patients), 3) seroconversion to positive immunoglobulin (Ig)G or IgM (or both) antibody levels to L. pneumophila, or a fourfold rise in antibody titers to L. pneumophila in paired acute-phase and convalescent-phase sera (62 patients). Antibodies to L. pneumophila were determined by using a commercial enzyme linked immunosorbent assay or a microagglutination antibody assay . In three patients, a commercial enzyme immunoassay was positive in concentrated urine, while other diagnostic tests were negative.“Probable Legionnaires’ disease” was defined as the presence of a new infiltrate shown on the chest x-ray on admission and either a single high antibody titer or a positive polymerase chain reaction analysis of sputum (1 patient) . PatientData on the following variables were collected from the medical chart : ,1) Premorbid conditions: age, sex, smoking >1 cigarette per day), alcohol intake (>2 units per day), use of immunosuppressive medication (ongoing treatment with chemotherapy or steroids >10 mg/day), underlying diseases such as chronic obstructive pulmonary disease, diabetes mellitus, chronic renal insufficiency, cancer (solid or hematologic neoplasm), and chronic cardiac disease (considered present if cardiac medication was used at the time of the flower show visit). 2) Day of visiting the flower show, first day of illness, and date of admission 3) Symptoms and results of physical examination on admission. 4) Routine biochemical and hematologic laboratory tests obtained on admission. 4) Urinary antigen test results collected from the microbiologic laboratory that performed the test. The overall agreement between the Binax NOW and the enzyme immunoassay Binax EIA (Binax Legionella Urinary Antigen EIA Kit: Binax) has been found to be 98% . 6) ChesAt the time of the patient’s admission, Legionnaires’ disease was defined as severe when two or more of the following conditions were present: 1) respiratory rate >30 breaths /minute, 2) chest radiograph showing bilateral involvement or involvement of multiple lobes, 3) shock (systolic blood pressure below 90 mmHg or diastolic blood pressure below 60 mmHg), 4) PaO2 <60 mmHg or arterial oxygen saturation <92%. For assessment of severity, we used the minor criteria for severity of community-acquired pneumonia described by the American Thoracic Society since thThe independent relation between clinical factors and the dependent variable, ICU admission or death (whatever came first), were assessed with univariate and multivariate logistic-regression models. Factors with a p value >0.20 in the multivariate analysis were excluded from the final multivariate analysis. Continuous variables were compared using a t test for groups; categorical variables were compared by using the chi-square test. A two-tailed p value of 0.05 or less was considered to indicate statistical significance.Kaplan Meier survival analysis was used to compare the ICU-free survival between patients in whom adequate therapy was initiated within or later than 24 hours after admission. ICU-free survival was defined as survival without admission to the ICU during hospitalization.Of 188 identified patients with confirmed or probable Legionnaires’ disease during the outbreak . Since sForty-two (30%) of these 141 patients were admitted to the ICU, 40 (95%) of whom had confirmed Legionnaires’ disease. Overall mortality rate was 13%, and ICU mortality rate was 36% . The medThe nationwide alert on March 12 led to an increase in hospital admissions. Patients admitted after the alert (n=71) were less severely ill: 21% had severe Legionnaires’disease in contrast to 44% before the alert (n=70). As expected, patients with severe Legionnaires’ disease had an increased risk for ICU admission or death compared with nonseverely ill patients , p=0.001).The patients’ clinical, laboratory, and radiologic data on admission are shown in During hospitalization, lung infiltrates shown on the chest x-ray progressed within 24–48 hours in 40% of the patients. This progression was not associated with ICU admission or death. In 39 patients (35%), renal insufficiency developed during admission (serum creatinine level above 130 μmol/L at any time during admission). Development of renal insufficiency was associated with ICU admission or death . None of the patients who survived had persistent renal insufficiency. In this large group of patients with Legionnaires’ disease, no other symptoms suggested extrapulmonary foci of infection.Of the 70 patients admitted before the nationwide alert on March 12, 44 (63%) were treated with adequate antibiotics with a median delay of 1.5 days (range 0–14 days). After the alert, antibiotics were changed to a macrolide or a fluoroquinolone for 21 patients, and 5 patients were never treated with adequate antibiotics (three of them died). All patients admitted after the alert received adequate therapy within a median of 0 days (range 0–3 days). Next, we studied the influence of immediate start of adequate treatment compared with delayed treatment on the outcome. Initiation of adequate therapy within 24 hours after admission resulted in a higher ICU-free survival rate compared with initiation after 24 hours: 78% versus 54% (A Binax Now urinary antigen test with positive results can provide a diagnosis of Legionella pneumonia within 1 hour. This test was positive in 86/141 (61%), negative in 51/141 (36%) and not done in 4/141 (3%) of the patients. In addition, 36 (38%) of 95 patients with nonsevere Legionnaires’ disease were treated with adequate antibiotic therapy >24 hours after admission; 13 of those patients (36%) had a poor outcome. In 10 (77%) of these patients, the urinary antigen test was positive for L. pneumophila, indicating that these patients should have been identified as high risk on admission. Since the first outbreak of Legionnaires’ disease in Philadelphia in 1976 –16. The The endpoint of either ICU admission or death was chosen because only 18 patients died, which strongly decreased the power of the analysis. In clinical practice, preventing ICU admission with all the disadvantages of such an admission in terms of sickness and death, is one of the goals of early treatment. Since >80% of the diseased patients were first admitted to the ICU, we chose to combine ICU admission and death as a composite primary outcome parameter.We analyzed 141 hospitalized patients and excluded 20 outpatients. However, this group represents only 20 out of 161 patients, and the described 141 patients represent 88% of all patients. In a study by Boshuizen et al. , a surveThe case definition for probable cases was broad enough to ensure inclusion of patients who died before the diagnostic work-up for Legionella was completed. Of the 21 probable case-patients, 18 had no single diagnostic test with positive results and showed no evidence of infection by other microorganisms (4 ICU admissions of which 2 died). Despite clinical and epidemiologic features suggestive of Legionnaires’ disease, other undetected causes of pneumonia cannot be excluded.Patients with Legionnaires’ disease are more likely to have severe pneumonia requiring ICU admission than are patients with community-acquired pneumonia caused by other organisms ,18,19. IFor all patients, the exposure day and the date when first symptoms occurred were known. The incubation time ranged from 1 to 18 days, which is longer than the upper limit of 12 days reported previously ,20. The Male gender, older age, underlying diseases like chronic obstructive pulmonary disease, diabetes mellitus, and immunosuppressive medication, reported by others as predictors for fatal outcome –4, were Patients who sought treatment with bilateral infiltrates (27%) and with pleural effusion (11%) had an increased risk for ICU admission or death. In a prospective study on chest radiographic findings in patients with community-acquired Legionnaires’ disease, 16% of the patients had bilateral involvement, and 23% had pleural effusions on admission, which increased to 30% and 63%, respectively, during hospitalization (Identification of patients with Legionnaires’ disease has important implications for the choice of initial therapy. Studies comparing the clinical manifestations of Legionella pneumonia to other types of pneumonia have indicated that Legionnaires’ disease is not “atypical” and that individual clinical features such as diarrhea, confusion, hyponatremia, and chest x-ray findings are not sufficiently distinctive to distinguish Legionnaires’ disease from other types of community-acquired pneumonia ,24–26. TDetection of L. pneumophila antigens in a urine sample provides a diagnosis within 1 hour, with a specificity of 95% to 100% Binax N. AlthougIncreased deaths associated with delay of adequate treatment for Legionnaires’ disease has been reported earlier ,5; in paThe results of our study suggest that a more tailored approach of patients with community-acquired pneumonia may be possible. When Legionnaires’ disease is considered in the differential diagnosis of patients with community-acquired pneumonia, a urinary antigen test should be done on admission. If test results are positive, the patient should be treated immediately with a fluoroquinolone or a macrolide since a positive urinary test on admission identifies the patients with Legionnaires’ disease caused by L. pneumophila serogroup 1 and a high risk for ICU admission or death. If the urinary antigen test gives negative results, deferring anti-Legionella therapy for the first 24 hours after admission, pending the diagnostic work-up, may be justified because the outcome in Legionnaires’ disease is not influenced. In this way, unnecessary use of antibiotics in patients hospitalized with community- acquired pneumonia may be avoided.

The 20 non-H atoms are coplanar. The structure is stabilized by intra­molecular O—H⋯O hydrogen bonds and inter­molecular O—H⋯O and C—H⋯O hydrogen bonds, forming bilayers of mol­ecular tapes with alternating stacking directions along the a axis.The title compound, C Å b = 5.669 (1) Å c = 20.231 (3) Å β = 110.62 (4)°V = 1132.1 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.12 mmT = 293 (2) K 0.60 × 0.39 × 0.14 mm Nonius KappaCCD diffractometerAbsorption correction: none14030 measured reflections2298 independent reflectionsI > 2σ(I)1554 reflections with R int = 0.029 R[F 2 > 2σ(F 2)] = 0.051 wR(F 2) = 0.150 S = 1.06 2296 reflections181 parametersH-atom parameters constrainedmax = 0.27 e Å−3 Δρmin = −0.20 e Å−3 Δρ DENZO (Otwinowski & Minor, 1997COLLECT (Nonius, 1999DENZO and COLLECT; data reduction: SCALEPACK (Otwinowski & Minor, 1997SIR97 (Altomare et al., 1999SHELXL97 (Sheldrick, 2008PLATON (Spek, 2003Mercury (Macrae et al., 2006SHELXL97 and publCIF (Westrip, 2008Data collection: 10.1107/S1600536808004169/bg2162sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808004169/bg2162Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Bleeding from antral and duodenal varices is anuncommon feature in patients with portal hypertension.We report a patient with cirrhosis and portalvein thrombosis, who had a massive bleed fromantral and duodenal varices. Bleeding was controlledwith endoscopic injection of varices usinghistoacryl. Endoscopic treatment and the relativelyuncommon occurrence of antral and duodenalvarices are highlighted.

Doxorubicin resistance was not induced in the presence of dexrazoxane (P< 0.0001) for several months. In parallel, the expression of functional P-glycoprotein was delayed after concomitant addition of dexrazoxane to the selecting medium (P< 0.001). Dexrazoxane did not act as a conventional modulator of P-glycoprotein. These results suggest that dexrazoxane may delay the development of MDR1, thus allowing responders to the FAC regime to continue to respond. © 2001 Cancer Research Campaign http://www.bjcancer.comDexrazoxane combined with doxorubicin (+ 5-fluorouracil + cyclophosphamide – the FAC regime) leads to a significant decrease in doxorubicin cardiotoxicity and a significant increase in median survival time for patients with advanced breast cancer responsive to FAC. The reason for this increase in survival may be due to interference with the mechanism involved in the emergence of multidrug resistance (MDR). In order to test this hypothesis, we induced resistance to doxorubicin in the K562 cell line by growing cells in increasing concentrations of doxorubicin (10–30 nM) in the presence and absence of dexrazoxane (20 nM). The doxorubicin sensitivity of all resultant sublines was measured using the MTT assay. Flow cytometry was used to assess the MDR1 phenotype, measuring P-glycoprotein expression with MRK 16 antibody and drug accumulation in the presence and absence of PSC 833 for functional P-glycoprotein. Long-term growth in doxorubicin increased the cellular resistance (IC

Regeneration of transgenic cells remains a major obstacle to research and commercial deployment of most taxa of transgenic plants, and woody species are particularly recalcitrant. The model woody species Populus, due to its genome sequence and amenability to in vitro manipulation, is an excellent species for study in this area. The genes recognized may help to guide the development of new tools for improving the efficiency of plant regeneration and transformation.Our aim is to improve knowledge of gene regulatory circuits important to dedifferentiation, redifferentiation, and adventitious meristem organization during in vitro dedifferentiation and shoot regeneration using an Affymetrix array representing over 56,000 poplar transcripts. We focused on callus induction and shoot formation, thus we sampled RNAs from tissues: prior to callus induction, 3 days and 15 days after callus induction, and 3 days and 8 days after the start of shoot induction. We used a female hybrid white poplar clone that is used widely as a model transgenic genotype. Approximately 15% of the monitored genes were significantly up-or down-regulated when controlling the false discovery rate (FDR) at 0.01; over 3,000 genes had a 5-fold or greater change in expression. We found a large initial change in expression after the beginning of hormone treatment , and then a much smaller number of additional differentially expressed genes at subsequent regeneration stages. A total of 588 transcription factors that were distributed in 45 gene families were differentially regulated. Genes that showed strong differential expression included components of auxin and cytokinin signaling, selected cell division genes, and genes related to plastid development and photosynthesis. When compared with data on in vitro callogenesis in Arabidopsis, 25% of up-regulated and 22% (748) of down-regulated genes were in common with the genes regulated in poplar during callus induction.We analyzed gene expression during poplar The major regulatory events during plant cell organogenesis occur at early stages of dedifferentiation. The regulatory circuits reflect the combinational effects of transcriptional control and hormone signaling, and associated changes in light environment imposed during dedifferentiation. In vitro regeneration is a common research tool and important method for plant propagation. It is also essential for most forms of genetic transformation, which require the regeneration of single transgenic cells into non-chimeric organisms [rganisms ,2. Both in vitro conditions are less complex and more robust. During organogenesis, explants are generally subjected to four sequential stages: direct or indirect callus induction, adventitious shoot (or root) formation, adventitious root (or shoot) formation, and micropropagation using axillary or apical meristem containing tissues based on either shoot or root cuttings.Organogenesis systems are more widely applied than embryogenic systems, particularly in dicotyledenous plants, because the explants and in vitro explants were shown to be largely controlled by the balance of cytokinin and auxin [in vitro regeneration [About a half century ago, the developmental fates of nd auxin . When cynd auxin -6, as weneration -9, the sArabidopsis have focused on indirect regeneration via root explants rather than shoot explants [Array studies of regeneration in explants , and useexplants .Populus has emerged as a model system for plant and tree biology [Populus trichocarpa (Torr. & Gray) produced by the USA Department of Energy Joint Genome Institute [in vitro propagation, rapid growth, extensive natural diversity, many natural and bred interspecific hybrids, and diverse environmental and economic values [in vitro, has motivated a large number of studies of the biology and management of regeneration systems [The genus biology . Its utinstitute . The valc values -14. Its systems .STM-homolog over-expressing poplars, 102 and 173 genes were identified as up- or down-regulated by two-fold or greater, respectively, using a NimbleGen platform [Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) in Populus , the genes in a subgroup of Aux/IAA showed differential expression among different tissue types [Microarrays have successfully identified many of the genes and regulatory factors related to specific physiological states in poplar. Wood formation has been intensively studied using microarrays. For example, changes in gene expression induced by gibberellic acid (GA) in the developing xylem was studied using a cDNA-based microarry analysis . By compue types .Populus, and compare them to results from Arabidopsis and other species. Characterization of the regulatory networks from poplar--with its distinct in vitro system and phylogeny compared to the other species studied to date--should give new insights into the conserved mechanisms for maintenance and regulation of plant stem cells. We conducted a genome-scale transcriptome analysis using the Affymetrix Poplar Genome GeneChip. It monitors more than 56,000 transcripts based on poplar genome and EST sequences. In this report, we describe the identities and biological roles of more than 9,000 unique regulated genes observed over five stages of regeneration.The goal of this study was to characterize the changes in gene expression that accompany dedifferentiation and organogenic regeneration in We studied gene expression during dedifferentiation and regeneration of shoots via organogenesis. Similar in vitro methods are widely using in the regeneration and transformation of Populus and many other plant species. Two biological replicates were used for each of five time points from pre-induction to shoot regeneration, and the RNAs hybridized to genome-scale arrays.in vitro shoot organogenesis, we carried out a preliminary regeneration experiment where 3 to 4 mm internodal stem segments to test if a functional class was over-represented; when the normalized frequency of a functional class was larger than 1, this functional class was presumed to be over-represented in a group of genes.To identify the over-represented molecular functions and biological processes at each stage, we categorized the groups of the up-or down-regulated genes at each stage by their Gene Ontology (GO) class distributed in 42 families were differentially expressed Figure and 5C. A number of genes that take part in cytokinin signaling were regulated during regeneration were flagged "present" for the both biological replicates prior to callus induction . Based on variance between biological replications after normalization and exclusion of any genes flagged "non-present" for one of the biological replicates, the mean, standard deviation, and coefficient of variation of signal intensity over biological replicates was 7.70, 0.20, and 3.18%, respectively. The mean standard error over biological replicates was 0.14 (1.84% relative to the mean). Thus, the precision in our estimates of approximately 2% is very small in relation to the large changes of gene expression observed, which often exceeded several hundred percent.From the sequential comparisons of regulated genes, we found that there was a massive reorganization of gene expression shortly after the start of callus induction, but before visible changes in explant morphology were obvious. Changes in gene regulation after this point were far smaller, and decreased over time. Surprisingly, there were no substantial changes in gene expression observed after transfer to shoot induction medium. It may also reflect the observation that even after callus induction there was some meristematic activity observed in a number of explants, including the production of root initials. This may have coincided with a large and complex set of alterations in gene expression that are not substantially or simultaneously reset with the increase in cytokinin provided by the SIM medium.The changes in GO categories reflect the large reorganization that tissues are undergoing during regeneration. Genes related to mitochondria, cell wall, ER, cell organization, and biogenesis were highly up-regulated during callus induction. This is a likely consequence of increased protein synthesis to support cell division and wall formation during callus induction. In contrast, chloroplast/plastid genes are strongly down-regulated gene during callus induction, which likely corresponds to the transition from autotrophy to heterotrophy at this developmental transition. It also likely reflects the suppressive effect of callus development in the dark in our regeneration system on light regulated, photosynthesis associated genes.Two F-box proteins were regulated during regeneration. TIR1 and other three auxin F-box proteins have been suggested as auxin receptors involved in the regulation of auxin-responsive genes -22. AuxiThere was strong and complex regulation of cell-cycle genes. In the JGI annotation, 110 genes have been assigned to GO:0007049, the cell cycle category . Of thesArabidopsis and poplar [MYBs) showed regulated expression, and the number of down-regulated MYBs were roughly double the number of up-regulated MYBs at any stage. Not surprisingly, it appears that many Mybs play important roles in organogenesis.MYB proteins are a large group of transcription factors that have a wide variety of roles in development. For example, expression of many Myb genes is correlated with secondary wall formation, both in d poplar ,30. Duriin vitro development, and for modifying development for better control of regeneration. For example, many new gene family members and unknown genes could be characterized biochemically or via reverse genetic screens such as with RNAi or overexpression to identify their roles in control of regeneration. Induced expression of genes that appear to regulate cell cycle such as the cyclins, or of transcription factors that are associated with dedifferentiation such as some of the MYBs, might be useful for promoting regeneration of transgenic plants [Arabidopsis, and the low level of conservation between poplar and rice, are not surprising given the considerably larger phylogenetic distance between rice, a monocot, and poplar and Arabidopsis, two dicots. Most important, however, is the likelihood that organogenesis in poplar was based on redifferention from shoot explants, whereas root explants were employed in Arabidopsis; and in rice, the distinctive embryogenic regeneration pathway was studied. These results suggest that transcriptome studies of a number of species and regeneration systems are needed in order to more fully understand--and thus to more rationally modify--the diverse in vitro regeneration pathways important to plant biology and biotechnology.The catalogs of regulated genes we have identified provide candidates for further analysis of their roles in c plants . Microarin vitro organogenesis in poplar occurred during the early stages of dedifferentiation. Nearly 10,000 genes were differentially expression during the onset of callus induction. A much smaller number of differentially expressed genes were detected at subsequent regeneration stages. A total of 588 transcription factors that were distributed in 45 gene families were differentially regulated. Genes involved in auxin signaling, cytokinin signaling, and secondary meristem regulation (eg. MYBs) were among the most abundantly regulated classes of transcription factors. Genes related to auxin signaling were highly regulated during regeneration. Two auxin F-box receptors, and more than a dozen Aux/IAAs and ARFs, showed differential expression. Differential expression of genes associated with cytokinin signaling included regulation of cytokinin histidine kinase receptors, two phosphotransfer proteins, and A-, B-type, and pseudo response regulators. Most of the identified cell cycle genes were up-regulated during callus induction. Substantial components of the regulatory circuits were conserved between Arabidopsis and poplar during callus induction, though different explants (stems vs. roots) were employed. Approximately one-fourth of the regulated genes in Arabidopsis were shared with poplar.The major transcriptional events in regulation of Populus tremula × P. alba) was used for all experiments. Plants were propagated in vitro according to published protocols [in vitro micropropagated plants were cut and incubated on callus induction medium and 5 μM N6-(2-isopentenyl) adenine (Sigma) at 22°C in darkness for 15 days. Shoots were induced by culturing explants on shoot induction medium .Hybrid poplar clone INRA 717-1 B4 that had been grown under the same growth conditions but three weeks apart in February 2007. For both, samples were collected at five time points: prior to callus induction, 3 days on CIM, 15 days on CIM (then transferred to SIM), and 3 days and 8 days on SIM. Approximately 10-15 stem explants from the same plate were pooled for RNA extraction for each biological replicationPopulus species from the predicted gene set v1.1 from the Populus genome project of the pacific northwestern USA [The Poplar Genome Array was designed by Affymetrix. It contains more than 61,000 probe sets representing over 56,000 transcripts and gene predictions. The probes are based on content from UniGene Build #6 , GenBank mRNAs, and ESTs for all Poptr1_1/. The gentern USA .Total RNA was isolated and purified according to the RNeasy Mini Protocol for Isolation of Total RNA from Plant Cells and Tissues and Filamentous Fungi . A260/A280 ratios of RNA samples dissolved in 10 mm Tris pH 7.6 ranged from 1.9 to 2.1. The integrities of RNA samples were examined by the Agilent 2100 Bioanalyzer; their RINs (RNA Integrity Number) ranged from 8.6 to 10.0, and they showed no evidence of degradation.lys, phe, thr, dap), hybridization controls , internal control genes (3' to 5' ratios of β-actin and GAPDH), percent present, scaling, and normalization factors. The reliability and repeatability of this microarray platform was also evaluated by the correlations between the two biological replicates.The arrays were labeled and hybridized at the Center for Genomics and Biocomputing at Oregon State University accordinThe probe-level data were normalized and summarized using the GC Robust Multichip Average (GCRMA) algorithDifferentially expressed genes were identified by LIMMA (Linear Models for Microarray Data) ,39. LIMMTo reveal both global expression changes compared to the starting explant developmental state, and the specific expression changes taking place at each stage, two sets of contrasts between time points were used. First, the expression during each of the stages was compared with the baseline explant (CIM0). Second, the expression at each stage was compared with that of the previous time point.Because of the well-established precision of the Affymetrix platform, and that our goal was to broadly cataloging patterns of gene expression, not to precisely estimate expression changes for specific genes, we did not conduct RT-PCR validation studies. Quality control studies have shown that results from RT-PCR are in agreement with microarray for genes with medium and high expression, and is not substantially more precise than the array platform employed itself .Arabidopsis homolog, and functional annotation.All annotation information for the Affymetrix Poplar Genome Array was retrieved from PopARRAY . The annPopulus trichocarpa. DPTF currently contains 2,576 putative transcription factors gene models, distributed in 64 families.The JGI gene model IDs of all transcription factors were download from the Database of Poplar Transcription Factors (DPTF) . DPTF caHierarchical clustering was performed using MeV 4.0 (MultiExperiment Viewer) with theArabidopsis Functional Genomics [Arabidopsis matches. The normalized frequencies were calculated as frequency of the class in the input data set divided by the frequency of the class in the whole genome. The class frequency was calculated as the ratio of the number of regulated genes in that class divided by the total number of genes in the class in the input data set, and the frequency of the class in the genome was calculated as the ratio of the total number of genes for that class in the genome divided by the total number of genes in the genome. The approximate reliability of over- or under- representation was evaluated by graphical presentation of standard errors based on 100 bootstraps of the input set. Because of the lack of a detailed genome annotation and associated statistics for poplar, the percentage of each functional class in the poplar genome was assumed to be approximately equal to that in Arabidopsis.GO annotation and categorization were done at the Bio-Array Resource for Genomics with preArabidopsis homologs to a group of regulated poplar or rice genes detected under similar conditions. Data on Arabidopsis and rice was downloaded from the online supporting materials of the relevant publications [Arabidopsis, root explants had been preincubated on CIM for 4 days and then transferred to cytokinin-rich SIM. Among the monitored 22,810 transcripts on the Affymetrix ATH1 GeneChip, 5,038 (up-regulated) and 3,429 (down-regulated) genes exhibited regulated expression profiles with a false discovery rate of 0.01. During early shoot development, 478 and 397 genes were specifically up-regulated and down-regulated, respectively. For rice, somatic embryos generated from cell culture were used to induce shoots. By comparing gene expression 7 days on SIM with somatic embryos with a 70-mer long oligo microarray containing 37,000 probe sets, 433 and 397 gene were found up-or down-regulated, respectively [Arabidopsis homolog ID (identification) numbers of the rice genes that were given in the online supporting tables [Arabidopsis homolog IDs of the poplar genes from the PopArray database, were compared with the Arabidopsis IDs in [Arabidopsis if their Arabidopsis homolog ID matches the Arabidopsis ID.Comparative studies were carried out by comparing the regulated ications ,9. For AYB carried out the experiments, interpreted the data, and drafted the manuscript. PD and TCM gave extensive advice on microarray data analysis. SHS conceived of the study, provided funding, directed the overall project, and played a significant part in writing and interpretation. All authors read and approved the final manuscript.Detail on quality assessment of microarray hybridization.Click here for fileRegulated genes at each stage identified by LIMMA. 2a. CIM3-CIM0 down. 2b. CIM3-CIM0 up. 2c. SIM0-CIM0 down. 2d. SIM0-CIM0 up. 2e. SIM3-CIM0 down. 2f. SIM3-CIM0 up. 2g. SIM8-CIM0 down. 2h. SIM8-CIM0 upClick here for fileCounts and percentages of regulated genes by GO category.Click here for fileRegulated transcription factors at each stage. 4a. CIM3-CIM0 down. 4b. CIM3-CIM0 up. 4c. SIM0-CIM0 down. 4d. SIM0-CIM0 up. 4e. SIM3-CIM0 down. 4f. SIM3-CIM0 up. 4g. SIM8-CIM0 down. 4h. SIM8-CIM0 upClick here for fileRegulation of auxin signaling.Click here for fileRegulation of cytokinin signaling.Click here for fileDifferentially expressed cell cycle genes.Click here for fileUp-regulated genes at early callus induction common to Arabidopsis and poplar.Click here for fileDown-regulated genes at early callus induction common to Arabidopsis and poplar.Click here for fileUp-regulated genes during shoot induction common to Arabidopsis, poplar, and rice.Click here for fileDown-regulated genes during shoot induction common to Arabidopsis, poplar and rice.Click here for file

The commonest, and dose-limiting, toxicity was pain in the infusion arm. One patient given DACA through a central venous catheter experienced chest pain with transient electrocardiogram changes, but no evidence of myocardial infarction. At the highest dose levels, several patients also experienced flushing, pain and paraesthesia around the mouth, eyes and nose and a feeling of agitation. Other side-effects, such as nausea and vomiting, myelosuppression, stomatitis and alopecia, were uncommon. There was one minor response but no objective responses. DACA pharmacokinetics were linear and did not differ between days 1 and 3. The pattern of toxicity seen with DACA is unusual and appears related to the mode of delivery. It is possible that higher doses of DACA could be administered using a different schedule of administration. © 1999 Cancer Research CampaignDACA, also known as XR5000, is an acridine derivative active against both topoisomerase I and II. In this phase I study, DACA was given as a 3-h intravenous infusion on 3 successive days, repeated every 3 weeks. A total of 41 patients were treated at 11 dose levels between 9 mg m

Fast moving animals depend on cues derived from the optic flow on their retina. Optic flow from translational locomotion includes information about the three-dimensional composition of the environment, while optic flow experienced during a rotational self motion does not. Thus, a saccadic gaze strategy that segregates rotations from translational movements during locomotion will facilitate extraction of spatial information from the visual input. We analysed whether birds use such a strategy by highspeed video recording zebra finches from two directions during an obstacle avoidance task. Each frame of the recording was examined to derive position and orientation of the beak in three-dimensional space. The data show that in all flights the head orientation was shifted in a saccadic fashion and was kept straight between saccades. Therefore, birds use a gaze strategy that actively stabilizes their gaze during translation to simplify optic flow based navigation. This is the first evidence of birds actively optimizing optic flow during flight. Navigating through a complex environment requires a specific set of information. It is essential to quickly get an impression of the three dimensional composition of the environment. This impression would consist of the distances between the observer and the objects in the environment, as well as among those objects. Such information may be used to anticipate the future path of movement, and to decide when to execute manoeuvres necessary to follow that path without the risk of collisions.Several mechanisms are known to allow the estimation of distance, but doing so during fast locomotion presents special challenges. Sharp retinal images of objects or edge detection are very difficult to obtain due to motion blur. Also, using accommodation mechanisms for distance estimation would be too slow for fast navigation in difficult and unknown terrain Optic flow fulfils the requirements for fast detection of information relevant for visually guided navigation of fast moving animals. It refers to the velocities with which environmental objects are displaced in the retinal image of the moving animal. Optic flow follows basic geometric rules that allow a moving human or animal observer to estimate its relative distance to environmental objects by analyzing these movements Optic flow is produced by self motion: During straight motion, the retinal images of objects in the visual field move with different velocities according to their distances from the observer. The images of objects that are far away move slowly while those of near objects move fast. In addition, the images of approaching objects expand while images of receding objects contract. Hence an animal can estimate distances to and among objects from the optic flow experienced during translational self-motion. However, many movements have an additional rotational component due to turns of the head or the body. The optic flow generated by such rotational movement does not provide any distance information because the velocities of retinal images of differently distant objects do not differ Here we investigate whether birds exhibit similar active gaze behaviour that would facilitate the use of optic flow during free flight. Many avian species move very fast in three dimensions and, therefore, may have evolved a well developed a navigational system based on optic flow. As yet, behavioural evidence that birds actually make use of optic flow during flight is rare, probably because their size and speed would require too much space. The few experiments that have been done focussed on a single task such as plummeting or landing We filmed zebra finches flying around an obstacle with two high-speed cameras, and analyzed the recorded head movements to obtain information on their gaze strategies during flight. Eye movements were neglected for methodological reasons. This protocol is justified by the findings of Gioanni et al For insights into natural optic flow processing in the brain, the flight behaviour of white zebra finches might be of special interest. This albinotic mutation is known to have strong anatomical and physiological changes of the central visual system leading to enhanced neuronal responses in areas ipsilateral to the stimulated eye The primary goal of the present experiments is to examine whether zebra finches use a behavioural strategy to separate the translational and the rotational component of optic flow. As stated above, only the translational component, that is optic flow induced by straight flight, contains the distance information needed for manoeuvring. Turning movements of the head, which add a rotational component of optic flow, should therefore be avoided. If turning movements are necessary as for example when flying around an obstacle, a bird should develop a strategy where turning movements and straight flight alternate instead of being intermingled. Demonstration of such a strategy would prove that optic flow is an important tool for flight path control and may be universally used throughout the animal kingdom.Taeniopygia guttata), a small Australian songbird, raised and kept at the department's animal care facilities. Ten individuals were accustomed to the flight arena, 5 of them being white, the others wild type birds of the normal grey colour.The experiments were performed with the zebra finch glass window at the front side of the cage. Then the glass pane at the front and the mesh wire at the top of the central compartment were removed to allow video recordings. As stated above, the birds did not attempt to fly through these opening during experiments.High speed cameras were used for video recording. The top camera was situated 125 cm above the upper rim of the cage with a 12.5 mm objective. The front camera stood 153 cm away from the front rim of the cage. For later analysis the recordings of both cameras had to be synchronized. This was accomplished by using the Red Lake ‘Midas’ software.To reconstruct the position and orientation of the bird's head we manually marked discrete points of the bird's beak in every frame of both recordings with the help of ‘Fly Trace’ We calculated the beak orientation within the horizontal plane from the position data of the base and the tip of the beak to estimate gaze direction see , 3. The As we wanted to reconstruct the position and orientation of the head in three dimensions, we had to obtain calibration data that allowed us to calculate the real spatial position from the pixel coordinates. This was done with the J.Y. Bouguett camera calibration toolbox for Matlab (MathWorks USA) To search the data for sequences of high rotational head velocities, that is saccadic gaze shifts, we defined two search parameters. First, the angular velocity had to be larger than 400°/s for at least four consecutive frames (i.e. for at least 8 ms). Second, the angular velocity had to reach a peak of at least 700°/s during such a turn.Finally we examined the orientation of the head in the vertical plane. We randomly selected three birds of each morph and analysed the recordings of the lateral view of their flights. Only the short flight path intercepts where the birds flew parallel to the frontal border of the cage allowed us to obtain the pitch angle of the head exactly enough. The raw head orientation values within each flight were normalised by subtracting the mean orientation to get a single dataset for each bird.The original research reported herein was performed under guidelines established by the German Welfare Law.We recorded 97 flights in a flight arena with an obstacle. Fifty of these were performed by white zebra finches, 47 by wild type birds. Due to the experimental procedure, about half of the flights (46) were from left to right comprising a left turn around the obstacle in the central compartment, the other half (51 flights) was from the right to the left with a left turn around the obstacle. Neither the colour morph nor the flight direction affected the experimental results. We therefore pooled the entire data set.The recordings were made after the birds had been acclimatized to the cage and reliably traversed the central compartment without colliding with the obstacle or arena walls. The birds flew with a relatively high speed of 2.49±0.033 m/s, so that the central compartment was usually crossed in less than half a second. Accordingly, few wing beats were performed. The wings were opened only when a bird changed its flight direction. In between, they were flattened along the body .The birds had to fly into the middle compartment of the cage through an entrance facing the obstacle. Therefore, a bird entering at the left entrance first had to turn right, then perform a leftwards turn to fly around the obstacle and eventually turn right to reach the exit window. Accordingly the turns were in opposite direction when the bird entered the central cage from the right entrance. Although the birds executed two or three turns in the setup, only the turn around the obstacle was reliably recorded. The other turns occurred at the beginning or end of the flight and were often recorded incompletely or not at all. We, therefore, limited our analysis to the turn around the obstacle.When the bird flew around the obstacle, it decelerated and turned into the new direction of its flight path. During this manoeuvre, the wings were opened and the body turned and pushed forward relative to the head while the tail feathers were spread . Then thTo define criteria for a computer-based identification of saccades we examined results such as presented in The number of saccades made during a flight depends on the speed of the bird along the flight trajectory. It slightly decreased with increasing speed , althougThe spatial distribution of the first and second saccades is rather broad, occurring almost at any location along the analysed section of the flight trajectories . HoweverUp to now we have shown that birds are using a saccadic gaze strategy in our flight arena: they are alternating during flights on a curved path between times where they keep the head orientation relatively constant followed by saccadic head movements.The mean angular velocity of saccades (n = 178) was about 1082.89±22.43°/s, the fastest saccade reaching 2154°/s. Average angular speed of intersaccadic intervals (n = 82) was about 114.75±7.86°/s. So between saccades head rotational movements in the horizontal plane were comparably slow . The mean duration of saccades (defined by velocities above 400°/s) was 15.6±0.4 ms, while intersaccadic intervals lasted 91.9±3.93 ms. This means that when seen from above, the head was held in a constant direction for 83% of the flight around an obstacle.Usually, when examining rotations, changes and velocities are presented with algebraic signs to indicate direction. Here we pooled saccades of different direction and, therefore, used absolute values of the data. This could be done because all flights from one direction (left or right turn) only produced saccades of the same direction see .Constant translational flow can only be obtained if there is also no rotational motion component around other axes of the head either. Examination of changes in pitch angle was possible only for a restricted set of our data (see above), i.e., during those sections of the intersaccadic intervals during which the bird flew parallel to the cage's frontal edge. The measurements confirm Optic flow is an important visual source that provides information about a complex three dimensional environment. Only translational optic flow provides information about the three dimensional structure of the environment while rotational components do not First of all, we did not observe saccadic fast body turns as was shown for the blowfly. The force that has to be overcome when changing direction is proportional to mass and velocity. Zebra finches have approximately ten times the length of a blowfly (12 cm) and 100–140 times the mass (10–14 g). The velocities of the zebra finches in our experiment reached up to 3.5 m/s while Schilstra and van Hateren However, while the body moves smoothly the head either turns rapidly or is held constant in orientation even when manoeuvring . We use The gaze shifts of birds and flies are similar not only to the fact that there are phases of fast and slow head turns, but also to some parameter values of these phases. For example, the maximum angular velocity of saccades measured by Schilstra and van Hateren We wanted to compare two morphs of zebra finches, because investigating optic flow processing in a deviating visual system such as that of the white morph might reveal some additional insight. Surprisingly, wild type and white zebra finches did not show significant differences. The strong deviations of the visual system in the white morph which were assumed to have some major influence on the AOS and thus on optic flow processing did not seem to have any effect on the overall flight performance. This is congruent to Eckmeier and Bischof Taken together, our experiments demonstrate that birds use a gaze strategy separating rotational and translational optic flow. This is achieved by an alternation of fast rotational head shifts and intersaccadic periods where head rotations are minimal. Eye movements probably enhance gaze shift during saccades and minimize it during intersaccadic intervals. To this end, head and eye saccades of birds appear to be analogous to body and head saccades in flies. Both, flies and birds, exhibit similar kinetic characteristics of gaze control. By exhibiting an active gaze strategy similar to that of the blowfly, zebra finches are able to use optic flow for distance estimation.Video S1The video shows one of the analysed flights. The view of both cameras are presented simultaneously. The white morph performs a left curve around the obstacle. When red circles appear the bird is going to shift gaze in a saccade.(0.76 MB MOV)Click here for additional data file.

Ostreopsis. Since these dinoflagellates are also found in other tropical and even in temperate regions, the formerly unsuspected broad distribution of these toxins was revealed. Toxicological studies with these compounds shows repeatedly low LD50 values in different mammals, revealing an acute toxic effect on several organs, as demonstrated by different routes of exposure. Bioassays tested for some marine invertebrates and evidences from environmental populations exposed to the toxins also give indications of the high impact that these compounds may have on natural food webs. The recognition of its wide distribution coupled with the poisoning effects that these toxins can have on animals and especially on humans have concerned the scientific community. In this paper, we review the current knowledge on the effects of PTX and its analogs on different organisms, exposing the impact that these toxins may have in coastal ecosystems.Palytoxin (PTX) is a potent marine toxin that was originally found in soft corals from tropical areas of the Pacific Ocean. Soon after, its occurrence was observed in numerous other marine organisms from the same ecological region. More recently, several analogs of PTX were discovered, remarkably all from species of the dinoflagellate genus For com50 for PTX in rats and mice is 0.089 and 0.045 μg/kg, respectively or by intravenous (0.15–0.74 μg/kg) administration. Corroborating these findings, the 24 h LD50 value for PTX in the mouse bioassay by intraperitoneal injection was recently [50 . Regarding the PTX analogs, ostreocin-D injected by intraperitoneal route has a LD50 of 0.75 μg/kg in mouse, a value similar to PTX, while mascarenotoxin-A from a crude extract of Ostreopsis mascarenensis has showed much lower toxicity, presenting a LD50 value of 900 μg/kg [O. lenticularis, the classification of these compounds as PTX analogs is still unclear. This is because, so far, analytical methods for these molecules are still lacking [Ostreopsis spp. or from toxic fish and crabs: uncoordinated movement and paralysis are early observations; dyspnea, cyanosis and exophthalmus precede death, while convulsions and diarrhea have been described in some cases. Riobó et al. [50, death may occur up to 48 h after toxin administration by intraperitoneal route. The characteristic initial symptoms of mice intoxication (within 15 min after administration) were stretching of hind limbs, lower backs and concave curvature of the spinal column, whether the mice died or stayed alive. The authors state that these early symptoms are sufficiently distinctive for allowing the identification of the presence of PTX regardless the presence of other toxins in the sample.Several studies ,49 pointrecently establis00 μg/kg . Despite00 μg/kg mouse le lacking ,54. Some lacking ,53,55 shó et al. observed50 of >40 μg/kg in rats and 510 μg/kg in mice, by intragastric injection [50 was established at 767 μg/kg, a result somewhat comparable to that presented above. At lethal doses, the symptoms are similar to those observed after intraperitoneal administration , suggesting that skeletal muscles, including the respiratory musculature, may be primary targets of PTX. These findings are supported by additional ultrastructural and hematoclinical data [Although the risk associated with ingestion of contaminated seafood is well recognized , PTX is njection ,49. Recenjection . Neverthnjection , despitecal data . At sub-cal data . Both tocal data . Controvcal data and 200 cal data , respect50 of 0.36 μg/kg . The only documented effect of PTX in sea urchins reproduction is the inhibition of sperm motility [Ostreopsis siamensis isolates from New Zealand was studied for the brine shrimp Artemia salina and to larvae of the marine gastropod Haliotis virginea [O. siamensis killed brine shrimps, even at low cell numbers (250 cells per test well). The time until morbidity was 4 h, while the time until 50% death (LT50) was 24 h (50–1 h), but death did not occur within the 24 h of the bioassay, even at 1000 cells per test well. In this case, morbidity was characterized by retracted viscera, settled and velum lost.Not much is known about the effect of PTX and its analogs in invertebrates, and particularly in respect to developmental aspects. The few existing data are mainly related to ecological studies on the impact of motility . Some otvirginea . This divirginea . O. siamwas 24 h . The dinThe motility of sperm from hamsters, guinea pigs, rabbits, cattle, humans and from the invertebrate sea urchins is inhibited by PTX exposure . Its man+-K+ transporters and thus to depolarize the cell membrane is used. This capability was explored in such a study for Xenopus laevis [Xenopus (FETAX). By using this method, Franchini et al. [In animal developmental studies, the ability of PTX to block the Nas laevis , in whics laevis . Some oti et al. evaluateThese data highlight the putative morpho-functional changes that can be induced by exposure to PTX in vertebrates.Palythoa spp. [Ostreopsis also presents PTX-like compounds. Despite the uncertainty about the true origin for the production of these compounds discussed above (Section 1), Palythoa and Ostreopsis spp. are recognized as producers, and represent the major known sources for these toxins. In view of the fact that these two types of organisms were described from tropical and sub-tropical areas around the world, PTX and PTX-like compounds appeared to be confined to these biogeographic regions and thus largely overlooked. Nevertheless, possible new routes of exposure must be taken into account, such as the previously discussed cases of Palythoa corals present in aquariums. Moreover, Ostreopsis spp. have a broad geographical distribution than formerly thought [Ostreopsis spp. in tropical waters is well documented since the 1980s, the number of studies of these benthic dinoflagellates in temperate regions has increased substantially in the last few years [Ostreopsis spp. to temperate regions may be due in part to ballast water of cargo ships and also to marginal changes in climate conditions, enough to induce bloom formation [Toxin distribution, source organisms, and routes of exposure of PTX and its analogs are interrelated aspects that represent the main concern in respect to marine ecosystems and to human health issues. Since its discovery, PTX has been repeatedly documented in tropical Indo-Pacific seawaters, not only on the soft coral hoa spp. , but alshoa spp. . Later, thought , and are thought . Actuallew years . These Pew years , Pacificew years ,63–65, Tew years ,66, Gulfew years ,68 and Mew years ,70–72,77ormation . DinoflaNot surprisingly, due to the impact that these blooms may have, some studies ,71 have Ostreopsis spp., in Brazil and New Zealand [Alutera scripta [Ostreopsis spp. have been recorded raises the possibility that ostreocin-D or other PTX analog could have been the cause [Ostreopsis ovata [The high toxicity of PTX and its analogs has resulted several times in animal fatalities. Beside the few reports about human victims , animal Zealand ,55,65, a scripta . In New he cause . In Italhe cause , and visis ovata ,71.Palythoa spp. and Ostreopsis spp.) or indirectly via vectors that accumulate the toxin, which may be susceptible to the toxin or not. The entrance, diffusion and sequestration of PTX into the food chain have been recognized elsewhere [Palythoa spp. The later include sponges, other soft corals, mussels, gorgonians and crustaceans or predators that feed on Palythoa spp. colonies such as the polychaete worm Hermodice carunculata, the starfish Acanthaster planci and the fish Chaetodon spp. [Toxicological effects may arise directly from the toxin-producers itself , in numbers representative of a dense bloom. While the oysters contained detectable amounts of toxin in hepatopancreas, muscle, and roe, the scallops showed higher concentrations but only in the hepatopancreas. Unlikely these two shellfish, the green-lipped mussel Perna canaliculus, which was tested in the same study, did not present PTX-like substances in any of evaluated parts. Thus, it appears not to accumulate the toxin.Filter-feeding invertebrates are also organisms in which PTX or analogs accumulation is a well known phenomenon, especially during harmful algal blooms ,59,74,75hoa spp. . It was hoa spp. ,76. Morehoa spp. , the scaOstreopsis spp., no cases of human intoxications through consumption of contaminated shellfish have been noticed. The only suspected occurrence is a human shellfish poisoning that occurred with wild mussels collected in Tasmania [O. siamensis cells.Notwithstanding the capability of shellfish to uptake PTX-like compounds after feeding on toxic Tasmania . As statTasmania , using eMytilus galloprovincialis, a shellfish used for human consumption and widely used as a model. Nevertheless, it still lacks knowledge about the effects that this toxin can exert on mollusks in the long-term and in natural conditions.Concerning the effects that the toxin accumulation may have in such bivalves, little information is available. In one of the few exceptions , it was Equinometra lucunter individuals showed alterations on their exoskeleton, accompanied by high mortality. It did coincide with an outbreak of a benthic dinoflagellate, previously reported as belonging to Prorocentrum sp. but after confirmed to be Ostreopsis ovata [Artemia salina assay (O. ovata cells [O. ovata extracts from the Mediterranean Sea revealed a similar association between Artemia salina mortality after 24 h and the number of algal cells [O. siamensis killed sea urchins in New Zealand [Evechinus chloroticus and the benthic cover of O. siamensis was demonstrated. The echinoderm densities declined by 56–60% at bloom sites over the study period (Other marine organisms known to be affected by the toxins are sea urchins, an ecologically important herbivore. In southeastern Brazil, is ovata . Furtherna assay . This mata cells . Chemicaal cells ,77. In t Zealand . Another Zealand . A strony period .per se, and so a combination of fast and confirmatory methods still seems to be the more appropriate approach for monitoring purposes. Moreover, it is also expected that once the biochemistry and molecular genetics involved in the biosynthesis of these toxins is elucidated, new methodological approaches will be possible for the detection of PTX and PTX-like producers.PTX and its analogs are potent marine toxins known to cause fatality of several animals, including humans. Even so, despite this obvious acute biological impact, little is known about the real consequences that these toxins may have on coastal communities. Because of the human health risks, attempts continue to be made aiming for the development of a validated assay for the rapid, sensitive and specific detection of PTX and/or analogs. The accomplishment of these requisites and its optimization have been evaluated or developed in some of the aforementioned studies and comprise either analytical methods or biological assays. Nevertheless, none are able to meet all the requirements ex situ toxicological studies and from a few reports about community structure changes observed in natural populations. This information is an important contribution to better understand the effect that these toxins may have in marine food webs and ecosystem structure and function. However, the true ecological impact of the distribution of PTX and its analogs still needs to be assessed. It will be relevant that future studies highlight the impact of the toxins along horizontal and vertical levels of the food chain, in different ecosystems, and to the mid- and long-term. Moreover, it will be important to survey the dynamics of the expansion of these toxins worldwide, in particular by monitoring other temperate regions.Marine organisms associated with soft corals in tropical and subtropical regions appear to be adapted to the presence of PTX. Respecting to temperate climates, where the biota are supposed to be more susceptible to the toxin, the impact is quite obvious. Data on the biological and ecological effects of these toxins presented previously expose these findings. They show that different organisms, belonging to diverse trophic levels of the marine food chain, are susceptible to being affected by these toxins, some of them commercially valuable seafood products. Nevertheless, the data are retrieved mainly from

The expression of genes involved in starch synthesis in wheat was analyzed together with the accumulation profiles of soluble sugars, starch, protein, and starch granule distribution in developing caryopses obtained from the same biological materials used for profiling of gene expression using DNA microarrays. Multiple expression patterns were detected for the different starch biosynthetic gene isoforms, suggesting their relative importance through caryopsis development. Members of the ADP-glucose pyrophosphorylase, starch synthase, starch branching enzyme, and sucrose synthase gene families showed different expression profiles; expression of some members of these gene families coincided with a period of high accumulation of starch while others did not. A biphasic pattern was observed in the rates of starch and protein accumulation which paralleled changes in global gene expression. Metabolic and regulatory genes that show a pattern of expression similar to starch accumulation and granule size distribution were identified, suggesting their coinvolvement in these biological processes. Seed starch is the major storage compound in cereals providing as much as 80% of the calories consumed by mankind. This starch is also a major source of feed, fiber, biofuels, and biopolymers in many industrial applications. Understanding the molecular basis of starch physicochemical properties and the control of its synthesis in the seed is a necessary step in improving and modifying starch properties tailored to an increasing variety of end-uses.α-1,4-linked glucose residues with a few α-1,6-glycosidic linkages. The degree of polymerization of glucose in amylose molecules is species dependent and averages about 800 residues in wheat [α-1,6-glycosidic linkages [Starch is deposited as discrete, water-insoluble semicrystalline granules in the plastid. It is composed of two glucose polymers, called amylose and amylopectin, which share the same basic glucan structure but differ in length and degree of branching. Amylose is essentially a linear molecule of linkages . The bralinkages and its μm in diameter, and make up to 70% of the volume and 10% of the total number of starch granules [μm in diameter, and represent ~30% of the volume and 90% of the total number of granules. More recent evidence indicates the presence of C-type starch granules with diameter less than 5 μm [In wheat, starch granules exhibit a bimodal size distribution—a characteristic unique to members of the grass Triticeae family. The starch granules, designated A-, and B-starch granules , can be granules , 6. In chan 5 μm , 7. The han 5 μm , 8, 9. Bhan 5 μm . The posttranslational control of many enzymes involved in starch biosynthesis has been well documented –15. In cIn this report, results of a global gene expression profiling experiment were overlaid with the analysis of soluble sugar accumulation, starch content, and starch granule particle size distribution on the same batch of biological materials used for the microarray experiment. Results showed multiple temporal expression patterns of key genes involved in starch synthesis, suggesting the relative importance of the different enzymes throughout caryopsis development. Correlative analysis identified genes that showed similar patterns of expression to the accumulation profiles of starch and amylose and the distribution of starch granules—suggesting these as possible candidate genes for further investigation for their roles in seed starch synthesis and potential targets for modulating carbohydrate metabolism in wheat by genetic engineering or molecular breeding efforts.Triticum aestivum L. cv. Bobwhite and cv. Hereward plants used for tissue sampling and RNA extraction for cDNA and oligoarrays experiments, respectively, were grown in the greenhouse under conditions as previously described [escribed , 22. CarThe total starch and total protein data obtained from our earlier published work were useμL of water. Samples were filtered through a 0.45 μm filter and injected onto a Hamilton RX-10 Anion exchange column . Soluble sugars were determined at 7, 14, 21, 28, and 35 DPA by boiling each sample in 5 mL 80% (v/v) ethanol for 5 minutes. The samples were centrifuged at 4000 × g for 15 minutes, the ethanol was decanted, and an additional 5 mL ethanol added to the pellet which was resuspended and boiled again for 5 minutes. This was done three times, each time pooling the ethanol soluble fraction. The ethanol was removed by drying samples in a speed-vac and the residue reconstituted in 300 μL injected on to the column at a flow rate of 2.0 mL/min. Trehalose eluted at 2.7 minutes, glucose at 6.1 minutes, fructose at 7.6 minutes, and sucrose at 9.6 minutes. The amounts were expressed as milligrams per gram of dry weight of tissue.Sucrose, fructose, and glucose were measured by HPLC on a Dionex BioLC system with Pulse Amperometric Detection. The gradient elution schedule consisted of 15 minutes of 15% of 200 mM NaOH, then 30% over 7 minutes, and 15% NaOH for 10 minutes. Standard solutions of sucrose, fructose, and glucose were mixed and 10 μM mesh filter, and the retentate was collected and gently ground further to release starch. This procedure was repeated until most of the starch was washed off from this fraction. No preferential loss of small-granules was detected as monitored by iodine-staining of the flow-thru in each wash. Starch fractions collected were resuspended by vortexing in 5 volumes of 0.5 M NaCl, and then centrifuged at 10,000 g for 10 minutes. Debris at the starch-liquid interface was carefully removed and the pellet resuspended in 0.5 M NaCl and then recentrifuged. This step was repeated until most of the debris was removed. The pellet was then washed in water (three times), 2% (v/v) SDS (twice), in water (three times), and once with 80% (v/v) acetone and then dried overnight. The fractionated starch was checked for debris by light microscopy. Approximately 50 mg of purified starch was diluted in 50 mL of water and particle size analysis was processed using the Horiba 900 Laser Scattering Particle Size Distribution Analyzer . For the 7 DPA sample, 13 mg of purified starch was analyzed. For granule volume calculations the correction factor developed by Wilson et al. [μm were considered spherical and those bigger than 5 μm in diameter were considered oblate spheroid with thickness of 5 μm and varying equatorial diameters.Starch granules from caryopses at each time-point were isolated and purified using a established protocol . Freeze n et al. was adapStarch granules purified from the different developmental stages were dusted on the surface of a carbon adhesive tab and sputter coated with gold palladium particles using Dentum Vacuum Desk II. Samples were viewed at 2.0 kV with the Hitachi Model S-4700 scanning electron microscope.T. aestivum cv. Bobwhite was examined using RNA from six time-points which covered the critical stages in caryopsis development—from coenocytic to desiccation stage. The 3 DPA data were omitted for correlative analyses since starch accumulation begins at about 5 DPA and at earlier times nonendosperm tissues predominate. Data visualization and coordinate transcript expression analyses were accomplished using the built-in statistical modules in Genespring GX software . The TIGR website (http://compbio.dfci.harvard.edu/tgi/) was used to determine if different ESTs belonged to the same contig, therefore belonging to the same tentatively unique gene.Two sets of microarray data were examined for expression of genes involved in starch metabolism in the developing wheat caryopsis. The first data set was obtained from our previous work which utT. aestivum cv. Hereward caryopses at ten time-points covering the onset of grain-filling stage to grain maturation. New analyses were carried out on 20 oligoarrays corresponding to the caryopses developmental series downloaded from the Gene Expression Omnibus to allow extraction of gene expression profiles relevant to the current report. Probe set signal normalization and summarization was carried out using GCRMA [http://www.plexdb.org/ [T. aestivum unigene 6869.The second data set was derived from a time-series experiment in grain development using thng GCRMA , the modxdb.org/ was usedFor the purpose of this work, a probe set is deemed to represent a potentially unique wheat gene and the accumulation of its transcript as measured by the signal intensities in each probe set represents the “expression” of the gene. In this study, it will be understood that “transcript accumulation” and “gene expression” will refer to gene transcript steady-state levels and will be considered to approximate the level of expression of the relevant gene. The MapMan software was adapThe soluble sugar content measured in developing caryopses showed that sucrose, fructose and glucose were at their highest levels at 7 DPA, then decreased to lower levels by about 21 DPA, and remained fairly constant through 35 DPA . FructosThere were 49, 377, and 409 genes which expression correlated with sucrose, glucose, and fructose pattern of accumulation, respectively . Among the specific genes correlating with changes in sucrose levels include a putative transcription factor (TF) described as BTF3, as well as with another putative TF, some carbohydrate-metabolic genes, and an ATP/ADP carrier protein . GlucoseWhen the data were further examined for genes correlating to more than one of the 3 sugars, only two showed shared genes in common, both involving glucose. Of the 23 genes that correlated with glucose and sucrose, only the ATP/ADP carrier protein was known to be involved in the starch synthesis pathway; there were no regulatory factors identified . Of the 249 genes that correlated well with the changes in the levels of both fructose and glucose were metabolic and transcriptional regulatory genes, for example, putative pyruvate kinase, a yabby protein, a probable kinase, 14-3-3 regulatory proteins, a PISTILLATA-like MADS-box protein, and other TFs. We observed 249 overlapping coexpressed genes with the levels of fructose and glucose in the grain, even though fructose levels were about three times higher than glucose levels at 7 and 14 DPA . There wα- and γ-gliadins (Bt1), two sucrose synthase clones, and several regulatory proteins. The accumulation of storage reserves in the developing caryopsis showed that total protein, total starch, and the amylose content steadilygliadins . The ratChanges in the proportion of starch as amylopectin correlated well with four clones for putative Zn-finger proteins, a putative kinase interacting protein, a putative LRK1 (receptor-type) protein kinase, a probable protein kinase, as well as with carbohydrate-metabolic genes . When thDetailed inspection of the rate of storage product accumulation revealed a biphasic pattern . The ratT. aestivum var. Butte 86 [To verify whether the biphasic pattern of storage reserve rate of accumulation we observed is not exclusive to the biological material we used, a set of external data independently obtained from another cultivar were similarly analyzed for rates of starch accumulation. Measurements of storage starch accumulation in the control (untreated) sample used in determining the effect of high temperature in developing caryopsis of Butte 86 , 31 showThe observed biphasic pattern in the rates of protein, amylose and starch accumulation , coincidμm in size may contribute to total volume of B-type granules at 14 DPA. In fact, SEM image of starch granules at 14 DPA shows the presence of oblate spheroid granules, a characteristic shape of growing A-type granules, at 10 μm in diameter or less . Growth of the C-granules probably increased its contribution to the volume of the small-sized granules from ~37% at 28 DPA to ~56% at 35 DPA. The formation and size distribution of starch granules in developing caryopses were monitored by laser diffraction and the or less . At 21–2r = 0.922; and BE422634, r = 0.832), a putative DEAD box RNA helicase (r = 0.849), and chitinase2 (r = 0.811). The profile of B-granule distribution (number and volume) and the ratio of B- to A-granules in terms of their volume and number correlated predominantly with the changes in transcriptional expression of storage protein genes —a tetrameric enzyme composed of two catalytic small subunits (SSUs) and two regulatory large subunits (LSUs), both encoded by several genes in wheat. The cDNA array detected expression of AGPase SSU and LSU Examination of the AGPase SSU and LSU gene expression profiles using the oligoarray also detected different patterns of expression Figures . Two disTwo patterns were also detected with the oligoarray for AGPase LSU gene expression. Ta.23665 showed a slight increase in expression from 6 DPA to 8 DPA and then gradually dropped from 17 DPA onward, whereas the two Ta.2797 probesets, derived from different regions of the same sequence, showed peaked expression at 14 DPA and remained high thereafter. Ta.23665 showed close similarity to a gene (GenBank ID X14348) that encodes the plastidic isoforms of the enzyme AGPase LSU. Ta.2797 matches all contigs from the cDNA array , which pα-1,4-linked glucan polymer. The starch synthases are grouped into five classes by DNA sequence; that is, SSI, SSII, SSIII, SSIV, and GBSS [Starch synthases (SSs) catalyze the transfer of the glucose moiety from ADP-glucose to the reducing end of a preexisting and GBSS , and eacand GBSS , 31. GBSThe SSI, , SSII F, and SSIα-1,4-glucan linkage and form an α-1,6 glucosidic bond on C6 of a glucosyl moiety of an α-1,4 glucan to form a branch. The cDNA array expression profiles of SBEIIa (Starch branching enzymes (SBEs) catalyze the hydrolysis of an f SBEIIa , SBEIIb f SBEIIa , and SBEf SBEIIa categorif SBEIIa , Ta.39, T. aestivum SBEIIb (AY740401), whereas the BE424382 sequences align with the same gene at the 3′-end. The three clones for SBEIIa on the cDNA array showed sThe SBEIIb genes on the oligoarrays catalyze the hydrolysis allinity , 40. Theallinity . The expThe phosphoglucose isomerase gene detected by the cDNA array encodes a plastidic isoform and was an Early Expresser , whereasUDP-glucose pyrophosphorylase is a cytosolic enzyme involved in the synthesis of starch in the developing caryopsis as part of the main path of glucose into plastids. The expression of genes encoding for UGPase expression was similar to the Early Expresser pattern as detected by both cDNA and oligSucrose synthase catalyzes the reversible conversion of sucrose and UDP into UDP-glucose and fructose. At least three isoforms are known for maize and six Sucrose phosphate synthase catalyzes the conversion of fructose-6-phosphate and UDP-glucose into sucrose-6-phosphate and UDP. Recent reports have shown that plants have multiple forms of SPS and are encoded by five different families of genes in wheat . The twoWhen focusing on specific known pathways, the most striking example of correlations using the cDNA arrays was for sugar accumulation and synchronous expression of glycolytic and OPPP (oxidative pentose phosphate pathway) genes . These pathways provide reducing power (NADH), intermediates, and ATP for starch biosynthesis. Most of these genes are early expressers; for example, FBPA has been shown to be definitively involved in the regulation of starch metabolism . Therefoα-zein transcript, which encodes for a maize storage protein, and mature kernel dry weight, suggesting that α-zein synthesis might in some way be linked to carbohydrate formation. In wheat, genes for HMW-glutenin subunits and AgpL shared common regulatory loci that mapped to different chromosome arms [Some of the starch biochemical determinants we assayed correlated very well with transcript levels of major seed storage proteins. For example, changes in starch amount, B-granule number, and volume throughout development correlated with the expression pattern of genes for low and high-molecular weight glutenins, as well as with different classes of gliadins . Several studies in maize , 65 simiome arms . Severalome arms , 68 and ome arms . Our datome arms –72. Thushttp://wheat.pw.usda.gov/pubs/2009/Laudencia/.The Supplementary Materials reported in this paper are available at

Changes in neuronal synchronization have been found in patients and animal models of Alzheimer's disease (AD). Synchronized behaviors within neuronal networks are important to such complex cognitive processes as working memory. The mechanisms behind these changes are not understood but may involve the action of soluble β-amyloid (Aβ) on electrical networks. In order to determine if Aβ can induce changes in neuronal synchronization, the activities of pyramidal neurons were recorded in rat prefrontal cortical (PFC) slices under calcium-free conditions using multi-neuron patch clamp technique. Electrical network activities and synchronization among neurons were significantly inhibited by low dose Aβ42 (1 nM) and initially by high dose Aβ42 (500 nM). However, prolonged application of high dose Aβ42 resulted in network activation and tonic firing. Underlying these observations, we discovered that prolonged application of low and high doses of Aβ42 induced opposite changes in action potential (AP)-threshold and after-hyperpolarization (AHP) of neurons. Accordingly, low dose Aβ42 significantly increased the AP-threshold and deepened the AHP, making neurons less excitable. In contrast, high dose Aβ42 significantly reduced the AP-threshold and shallowed the AHP, making neurons more excitable. These results support a model that low dose Aβ42 released into the interstitium has a physiologic feedback role to dampen electrical network activity by reducing neuronal excitability. Higher concentrations of Aβ42 over time promote supra-synchronization between individual neurons by increasing their excitability. The latter may disrupt frontal-based cognitive processing and in some cases lead to epileptiform discharges. Neuronal synchronization at different frequency bands may underlie a variety of cognitive processes, including perception, motor performance, attention, learning and memory The accumulation of soluble beta-amyloid (Aβ), especially Aβ42 ex vivo brain slices. The basis for those changes was further examined by collecting crucial parameters of neuronal excitability–action potential (AP)-threshold and after-hyperpolarization (AHP). We found that low and high doses of Aβ42 induced opposite changes in electrical network activity and in neuronal excitability.Electrical networks are prominently involved in memory formation n = 108; 3–12 months, n = 8). The recorded spontaneous responses included bursts and short depolarizations . Synchronized responses were obtained in 6% of simultaneously recorded individual neuron pairs (n = 11/183 pairs). They varied from having an equal time course to a 750 ms difference in duration . There were no detectable changes in the individual threshold voltages for APs during these recordings, which were all made under calcium-free conditions . To dissect the induction of a provoked burst, a subthreshold depolarization, akin to a field potential experienced by a single neuron, was produced immediately after a weaker extracellular stimulus. Increasing the extracellular stimulus provoked a burst of APs and they were synchronized in 63% of simultaneously recorded pyramidal pairs (n = 38/60 pairs).Notable differences in the durations of spontaneous synchronized responses suggested that synchronization among neurons was initiated by a local change in field potential p = 0.001). The enhanced responses included short depolarizations, bursts and tonic firing Table S1). Spontaneous responses were also found to be synchronized more frequently among recorded neurons (n = 7). This percentage of post stimulus evoked synchronized spontaneous responses was significantly higher than the basal rate of such occurrences (6%) in the absence of any extracellular stimulus (Chi-square test: p<0.0001). These findings indicate that brief extracellular stimuli can prime a local electrical network to produce synchronized activities between individual neurons.In the course of a 100 s recording, the percentage (33%) of cells that had spontaneous responses was almost doubled (65%) after three brief extracellular stimuli at 30 s intervals pre-application, b) application and c) washout of Aβ42. In a representative experiment, the evoked and spontaneous responses that were frequently synchronized in the control condition , were notably inhibited after application of 1 nM Aβ42 for 10 min . These responses and their synchronicity tended to recover on washout of Aβ42 for 15 min. . Similar phenomena were observed in the recordings from 5 other pairs and another triplet of neurons.We next examined the effect of Aβ42 peptide on bursts and depolarizations and on their synchronization within electrical networks. Under calcium-free conditions, pairs or triple neuron assemblies were simultaneously recorded while three extracellular stimuli (10–100 µA for 2 ms) were delivered locally at 30 s intervals as above. Thereafter, the recording was extended for more than 100 s to capture more spontaneous responses. This recording procedure was repeated under three conditions: p = 0.010, n = 16) and occurred less frequently . After a 10–30 min. washout, evoked responses tended to recover, especially in their duration Fig. 3. p = 0.017, n = 10) and occurrence (lower panel). Furthermore, in 5 out of 15 recorded neurons (n = 5/15), tonic firing was induced that often lasted for ≥10 min. and was followed by the intensive firing of APs and/or a notable depolarization shift of membrane potentials (rd trace and p = 0.012). In one pair-recording, ‘hyper-synchronized’ responses were obtained during such a tonic response period (p = 0.004) (p = 0.445). Moreover, the average amplitude of responses (1.49±0.14 mV) was higher than the control. The inhibition of spontaneous subthreshold responses is consistent with the low dose (and high dose but short applications) Aβ42-induced decrease in the occurrence of post-stimulus bursts and depolarizations . In contrast, after 500 nM Aβ42 was applied for more than 30 min., the AP-threshold was significantly reduced from −49.1±1.0 mV to −52.5±1.0 mV . Net changes in the two cases were opposite and statistically different . These opposing changes in neuronal excitability match the aforementioned observations pertaining to electrical network activities.In view of the opposite effects on electrical network activities by low and high dose Aβ42 when applied for more than 30 min., we examined the effects of these exposures on intrinsic membrane properties of neurons Table 1.We undertook this study in PFC because it is affected pathologically with Aβ early in AD and is the seat of working memory. Working memory is a brain function that is considerably reliant on neuronal synchronization Aβ is considered to have physiological functions in part because it is normally present in cerebrospinal fluid at low levels in vivo or in vitro conditions, are interpreted as arising from electrical-based interactions over networks and have been demonstrated in both physiologic and pathologic states Wistar rats were used acutely for the purpose of obtaining and preparing brain slices. Housing and surgical procedures of animals used for recording were in accordance with the National Institutes of Health guidelines and the Tufts University Institutional Animal Care and Use Committee.2 and 5% CO2. Brain slices were incubated at 34°C for 30 minutes and then at room temperature for at least 30 minutes before recording. During recording, brain slices were maintained at 34°C in a recording chamber and perfused with oxygenated ACSF at a flow rate of 0.75–1.0 ml/min. The ACSF volume in the tube leading to and including the recording chamber was 1.5–2.0 ml. This enabled the quick replacement of recording solutions (≤3 min.) during different experimental procedures. After recording, brain slices were fixed with 2% paraformaldehyde and 1% glutaraldehyde and histochemically stained.Prefrontal cortical slices (300 µm) were prepared from young (P16–P30) and adult rats (3–12 months) using a published protocol 3, 1.25 NaH2PO4, and 1 MgCl2. Access resistance was monitored. Only the neurons with stable access resistance were included in the statistical analyses. But for the observation of synchronized responses, some neurons with increased access resistance were still included. All recordings were performed at resting membrane potentials of neurons. To deliver extracellular stimuli, glass electrodes (2–3 MΩ pipette resistance) were filled with calcium-free ACSF and placed 100–200 µm away from recorded neurons. Neurons were filled with biocytin by diffusion during recording for later identification of PCs by morphology and AP firing properties Under calcium-free conditions, multi-neuron patch clamp recordings were carried out to capture synchronized responses, both spontaneous and provoked, between single neurons Spontaneous responses were recorded from individual PCs in layer 5 of the PFC using multi-neuron whole-cell patch clamp technique. Evoked bursts and depolarizations were obtained after a brief extracellular stimulus (10–100 µA for 2 ms) delivered nearby simultaneously recorded neurons. The extracellular stimulus strength was first gradually increased and was then set after a burst was provoked in at least one of the recorded neurons. Neuronal synchronization was identified according to the coordinated occurrence of responses between multiple neurons. The duration and occurrence of evoked bursts and depolarizations were analyzed using the Igor program. The frequency and amplitude of spontaneous subthreshold responses were analyzed using the software Origin .Intrinsic membrane properties of PCs were obtained from the recording of a large set of stimulations a) pre-application, b) application and c) washout of Aβ. Aβ42 was applied for periods lasting 30 to 90 min. Spontaneous subthreshold responses were recorded for up to 20 min. The Aβ-washouts were recorded for periods lasting 10 to 60 min.Synthetic Aβ42 peptide was purchased from Biosource . Aliquots of 5 nmol Aβ42 treated by 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) were stored at −80°C Paired t-test was used for the comparison of a variant between different recording procedures. Student t-test was used for the comparison of a variant between different treatments of Aβ. Chi-square test was used for the comparison between two percentage values. Data were shown as mean±SE .(4.07 MB TIF)Click here for additional data file.Figure S2Experimentally provoked depolarization and burst. Under calcium-free conditions, an extracellular stimulus of 20 µA with a 2 ms duration was delivered near a PC. The stimulus artifact is shown (arrowhead). Thereafter, a short depolarization (red trace) was provoked. An increase of the extracellular stimulus to 25 µA provoked a burst after the stimulating pulse.(0.22 MB TIF)Click here for additional data file.Figure S3Prolonged application of 500 nM Aβ42 promotes tonic firing of a neuron. Under calcium-free conditions, a brief burst firing (red trace) was induced by the current injection of a depolarizing step into the soma of a PC. After applying 500 nM Aβ42 for 30 min., the same stimulus induced a burst followed by an extended AP firing for several hundred milliseconds (light green trace). After applying 500 nM Aβ42 for 60 min., the same stimulus induced a burst followed by tonic AP firing (dark green trace).(2.57 MB TIF)Click here for additional data file.Figure S4Identification of pyramidal cells that were recorded from PFC slices. A. Histochemical staining of two layer 5 PCs after recording. Two PCs in layer 5 were filled with biocytin during recording and then later stained. B. Stepped-depolarization-current injections evoked non-accommodating AP firing patterns typical for layer 5 PCs in the PFC . The recording was performed under calcium-free conditions.(4.20 MB TIF)Click here for additional data file.Table S1Percentage of cells with different responses before and after stimuli.(0.03 MB DOC)Click here for additional data file.Table S2Changes in intrinsic membrane properties of PCs by prolonged application of low and high dose Aβ42. Note 1: During application of Aβ, AP and AHP were recorded while clamping membrane potential at the same level as control. Note 2: Data are mean±SD. Note 3: The AHP notably varied among the recorded neurons, ranging from 14 mV/ms to 75 mV/ms in the max fall rate and from −5 mV/ms to −36 mV/ms in the max rise rate. The difference in the max fall/rise rates of the AHP did not reach statistical significcance between the two groups in the control condition .(0.04 MB DOC)Click here for additional data file.

Tbx1 in transgenic mice generates phenotypes similar to those associated with loss of a Bmp receptor. One phenotype could be rescued by transgenic Smad1 expression. Our data indicate that Tbx1 interferes with Bmp/Smad1 signaling and provide strong evidence that a T-box transcription factor has functions unrelated to transactivation.Tbx1 is a T-box transcription factor implicated in DiGeorge syndrome. The molecular function of Tbx1 is unclear although it can transactivate reporters with T-box binding elements. We discovered that Tbx1 binds Smad1 and suppresses the Bmp4/Smad1 signaling. Tbx1 interferes with Smad1 to Smad4 binding, and a mutation of Tbx1 that abolishes transactivation, does not affect Smad1 binding nor does affect the ability to suppress Smad1 activity. In addition, a disease-associated mutation of TBX1 that does not prevent transactivation, prevents the TBX1-SMAD1 interaction. Expression of TBX1 cause DiGeorge syndrome Tbx1 is in heart development, where it is required to sustain proliferation of mesodermally-derived cardiac progenitors of the second heart field (SHF), a cardiac progenitor cell population that contributes to the development of most of the heart, including the outflow tract and right ventricle Tbx1 is associated with increased expression of differentiation markers of the myocardium, suggesting that Tbx1 may also regulate negatively cardiomyocyte differentiation Tbx1 is a T-box transcription factor required for pharyngeal and cardiovascular development of humans and mice Tbx1, most clearly after 4 days of treatment (F148Y (missense mutation in the T-box region G310S (missense mutation in a conserved region downstream to the T-box region G145R), which has been shown to prevent DNA binding To identify Tbx1 interacting proteins in mammalian cells, we performed affinity purification of Tbx1-interactors complexes followed by identification of co-purified proteins. To this end, we assembled a mammalian expression vector (referred to as P19-Tbx1-PA) coding for a fusion protein consisting of Tbx1 fused to protein A (PA) via a tobacco etch virus (TEV) protease cutting site . We thenreatment . Thus, wreatment and procreatment . Reciproreatment . We thenreatment . The intreatment . We nextTbx1 and assessed the transactivation ability of Smad1. We carried out a luciferase assay in Cos-7 and C2C12 cells with the Smad-responsive reporter NTK-tetramer-luc, which contains four copies of a Smad consensus-binding element SMAD1 expression vector in Cos7 cells or by adding BMP4 to the culture media of C2C12 cells with or without increasing amounts of TBX1 into BMP4-treated C2C12 cells and carried out co-immunoprecipitation of nuclear extracts using an anti-flag antibody. Western blot analysis of immunoprecipitated material using an anti-Smad4 antibody revealed, in the absence of transfected TBX1, the presence of Smad4, which was strongly reduced in samples co-transfected with TBX1. This effect was dosage-dependent , expressing Tbx1 upon Cre-mediated recombination IREScreAp2a/+ driver Bmpr1a caused cleft lip IREScreAp2a/+; COET animals did not survive after birth (data not shown) and examination of E18.5 embryos revealed bilateral cleft lip , suggesting that additional Smad1 expression in the ectoderm and neural crest, where endogenous Smad1 is normally expressed, did not cause any obvious developmental anomaly. Next, we crossed COET;Fsmad1 mice with IREScreAp2a/+ mice and examined the progeny at E18.5. No obvious abnormalities were detected in IREScreAp2a/+;Fsmad1, but, as expected, all the IREScreAp2a/+;COET examined (n = 7) exhibited cleft lip and cardiac outflow tract defects , a BMP antagonist, is a mild modifier of the Tbx1 mutant phenotype. Indeed, Choi and Klingensmith Chrd enhances the craniofacial phenotype of Tbx1 mutants. This effect can be interpreted on the basis of our findings, i.e. at least part of the Tbx1 mutant phenotype is due to excessive BMP signaling, thus removing an antagonist of BMP in a Tbx1 mutant background further enhances the excess of BMP. The heart phenotype was not affected by Chrd mutation presumably because this gene is not expressed in heart tissues.Among the various developmental roles, Tbx1 is thought to maintain proliferation of mesodermally-derived cardiac progenitors of the second heart field (SHF) Tbx1 has been shown to regulate, directly or indirectly, several of the major signaling systems, i.e. the fibroblast growth factor (FGF) signaling Finally, and perhaps most surprisingly, we show that the Smad1 modulatory effect of Tbx1 is not dependent upon DNA binding, therefore, this represents the first example of a transcription-independent function of a T-box transcription factor.7 P19CL6 cells were electroporated with 10 µg of DNA of an expression vector containing the cmv promoter driving a mouse Tbx1 cDNA fused with a TEV target site and a Protein A coding cDNA following the manufacturer protocol. After 24–48 h after transfection, cells were washed, scraped in cold PBS, and collected by centrifugation using a refrigerated centrifuge at 1000 rpm for 10 min. The pellet was resuspended in 5 pellet volumes of cold CE buffer , and centrifuged at 1400 rpm for 4 min. The nuclei were washed with 5 pellet volumes of cold CE buffer without detergent and spinned as above at 1400 rpm for 4 min. 2x pellet volume of NE buffer were added to the nuclear pellet incubating on ice for 30 min. Nuclear and cytosolic extracts were recovered spinning at maximum speed for 30 min to pellet any nuclei.Native affinity purification was performed with strains P19-Tbx1-PA and P19-PA as previously described For co-immunoprecipitation experiments, cells were lysed at 4°C in Nonidet P-40 lysis buffer. Extracts were quantified using a modified Bradford procedure . Co-immunoprecipitation of TBX1 and Flag-SMAD1 was accomplished using an antibody-coupling gel to precipitate the bait protein and co-immunoprecipitate the interacting prey protein. Anti-Tbx1 (Zymed Laboratories) or anti-Flag M2 antibody (SIGMA) was coupled to an amine-reactive gel using slow agitation at 4°C O.N. The precipitated protein complexes were run on a 10% SDS-acrylamide gel, and analysed by Western blotting.Cos-7 cells were grown in 24-well plates and transfected with 100 ng of NTK-tetramer-luc vector All the experiments involving mice were done according to a protocol reviewed and approved by the Institutional Animal Care and Use Committee of Institute of Biosciences and Technology, in compliance with the USA Public Health Service Policy on Humane Care and Use of Laboratory Animals.IREScre used in this study has been previously reported IRESCre/+ animals to generate embryos of the appropriate stage and genotype. The FSMAD1 transgene was genotyped with the following primers: 1) 5′- caaagacgacgatgacaagg -3′ and 2) 5′- agctcaaggccttttccagt -3′. Phenotypic analyses of mutant embryos were carried out by gross morphological analyses, embryo dissection and hystological analyses. In some cases, we used digital images of 10 mm-thick histological sections to carry out three-dimensional reconstructions using the software AMIRA 4.1.2 (Mercury Computer Systems).The mutant AP2αMsx1 probe was kindly provided by James F. Martin .Whole mount in situ hybridization was performed by standard methods. The mouse The anti-Tbx1 antibody was obtained from Zymed Laboratories; the anti-P-Smad1 (Ser463/Ser465) from Chemicon; The anti Smad1, P-Smad2 (Ser465/Ser467), Smad4, Smad5, and Smad6 where all purchased from Cell Signaling. Recombinant proteins BMP4 and TGFβ1 were obtained from R&D Systems.Figure S1Endogenous Tbx1 expression during cardiomyocite differentiation of P19Cl6 cells. RT-PCR analyses for the indicated mRNAs were performed on differentiating P19Cl6 cells. The Tbx1 amplification signal is more clearly evident starting from day 4 of differentiation.(1.71 MB TIF)Click here for additional data file.Figure S2P-Smad2, Smad4, 5, and 6 do not interact with Tbx1. Nuclear extracts of mouse P19-Cl6 cells induced to differentiate with 1% DMSO were purified by binding to IgG-Sepharose, digested with TEV protease and immunoblotted with (a) anti-Smad5, (b) anti-Smad4 and (c) anti-Smad6 antibodies. Lane 1: Purified nuclear extracts of cells expressing Tbx1-TEV-PA. Lane 2: Total nuclear extracts of cells expressing Tbx1-TEV-PA. Lane 3: Purified nuclear extracts of cells expressing TEV-PA alone. (d) NIH-3T3 cells were transiently transfected with TBX1, stimulated with 5 ng/ml of TGFβ1 for 1 hour and protein extracts were coimmunoprecipitated with anti-Tbx1 and immunoblotted with anti-Phospho-Smad2 antibody.(8.51 MB TIF)Click here for additional data file.Figure S3TBX1 or TBX1G415R are both capable of suppressing a Smad reporter after BMP4 activation. a) Luciferase assay using a Smad reporter (NTK-tetramer-luc) with C2C12 cells exposed to BMP4. Increased amounts of TBX1 expression vector DNA (from 5 ng to 100 ng) is associated with reduced luciferase activity. b) In a similar experiment, a vector encoding the mutant TBX1G145R isoform, which cannot transactivate a T-box reporter, has a similar capacity to suppress the Smad-reporter activity as the wild type isoform. The mean data are representative of three replicates for each condition and the error bars show the standard error.(8.81 MB TIF)Click here for additional data file.Figure S4TBX1 does not affect the level of P-Smad1/5/8, Smad1 and inhibitory Smad6. Western blot analyses of protein extracts from BMP4-induced and non induced C2C12 cells, with or without TBX1 transfection. None of the immunoreactivities tested in this figure is affected by TBX1 expression.(7.23 MB TIF)Click here for additional data file.Figure S55′- caaagacgacgatgacaagg -3′ and 2) 5′- agctcaaggccttttccagt -3′ Schematic representation of the transgenic construct, which includes a chicken b-actin promoter, a loxP-flanked promoterless neo resistance cassette with 3 copies of a polyadenilation signal, and a cDNA encoding human SMAD1 tagged at the N-terminal with flag. b) Southern-blot of BamHI-digested DNA from ES-cell clones probed with a Flag-SMAD1-specific probe. The position of the BamHI restriction sites is indicated on panel a. c) Western-blot analysis of protein extracts from parental and transgenic ES clones after transient Cre recombinase expression, using an anti-Flag antibody. A transgenic protein of the appropriate size is clearly evident in the transgenic cell line. d) PCR analysis of DNA from transgenic embryos using FSMAD1-specific the oligonucleotides 1) (4.93 MB TIF)Click here for additional data file.

Freezing of gait (FOG) in Parkinson's disease (PD) rises in prevalence when the effect of medications decays. It is known that auditory rhythmic stimulation improves gait in patients without FOG (PD-FOG), but its putative effect on patients with FOG (PD+FOG) at the end of dose has not been evaluated yet. This work evaluates the effect of auditory rhythmic stimulation on PD+FOG at the end of dose. 10 PD+FOG and 9 PD-FOG patients both at the end of dose periods, and 10 healthy controls were asked to perform several walking tasks. Tasks were performed in the presence and absence of auditory sensory stimulation. All PD+FOG suffered FOG during the task. The presence of auditory rhythmic stimulation led PD+FOG to significantly reduce FOG. Velocity and cadence were increased, and turn time reduced in all groups. We conclude that auditory stimulation at the frequency proposed may be useful to avoid freezing episodes in PD+FOG. The gait of people with Parkinson's disease (PD) is characterised by a number of well-defined features. From a kinematic point of view PD exhibit a reduction in step length and velocity FOG is typical in advanced phases of the disease and it seems associated with disease duration, its grade of development, longer duration of levodopa treatment, levodopa-induced dyskinesias Three main forms of FOG have been identified stride-time in advanced PD Based on the poor correlation between FOG and UPDRS sub-scores FOG is chiefly triggered at onset of walking and during turning, but also at narrow spaces (such as doorways) during their Participants in the study were recruited from a total of 80 patients belonging to the Asociación Parkinson Galicia and the Asociación Parkinson Ferrol (Spain). All patients were only orally medicated, without surgical operation for PD.Patients in this group, who exhibited significant FOG (PD+FOG), had to match the following criteria:diagnosis of idiopathic PD based on the UK Parkinson's Disease Society Brain Bank for clinical diagnostic criteriaFreezing of Gait Questionnaire (FOGQ) history of freezing during walking from medical records, and score >10 in the predictable motor fluctuation related to dose intake, determined from medical records and examination by a neurologistlack of auditory-visual impairment, musculoskeletal injury, and MMSE score >24at the moment of testing, during the end of dose period, they should be able to walk 6m unaided, turn around and come back despite the freezing episodes, which should be present during preferred walking condition during ON periods they should be able to walk without freezingQ score 16.70 (±4.81). Patients did not expect any benefit in their gait patterns from the cues, as their use was explained to be a method to characterize gait. No patient had previous experience on gait cueing.10 volunteer PD+FOG matched the criteria and underwent the experimental protocol , trochanteral height 0.89 m (±0.06), FOGQ had to be zero to be a possible subject in this group.9 volunteer PD, without history of FOG (PD-FOG), were also recruited , trochanteral height 0.88 m (±0.04). Inclusion criteria were the same as stated for PD+FOG, with the exception of those criteria related to FOG. The score in the FOG10 healthy subjects (people from our institution and relatives) were selected as the Control group , trochanteral height 0.89 m (±0.04); they were also screened for gait or balance impairment.Subjects were asked to walk along a corridor (with a door in the middle), touch a button on the wall at the end, turn around, come back and touch the button on the other wall, this task in conception and distance included FOG evoking elements.on and the first two trials (Baseline) at their preferred walking pattern without the door in the middle of the corridor in order to determine baseline cadence, for which the turn was excluded; all this was carried out during patients' ON-periods duration of benefit after a given dose of L-dopa.” During the next day, at the end of dose, patients performed the UPDRS-III and 4 trials and 2 with the stimulation at a frequency 10% faster than the cadence at baseline (110A), both with the door in the middle of the corridor); healthy controls performed the 6 trials in the same day. End of dose was defined as ““walk along the corridor as you normally do, touch the button on that wall and without stopping turn around, come back, and touch this other button on this wall” were sent to a receiver unit connected to the computer. This configuration allowed the stride cycle time to be registered.Two photocells, placed 5.98 m apart, were connected to the recording system so that the records from the moment subjects crossed them were acquired. A portable in-house device provided auditory stimulation (a click) by means of headphones, which subjects wore regardless of whether or not they were stimulated. The sound was a tone with wave-frequency of 4,625 Hz, and the intensity was adjusted to be clearly perceived by the subjects without being annoying. The stimuli were delivered in pulses of 50 ms and the inter-pulse duration was customized to obtain the desired stimulation frequency.“One freezing episode was defined as stop and/or hesitation until the next step was accomplished independently of the number of hesitations in place”.The number of freezing episodes and their duration were measured by analysis of video footage by a specialist with 10 years experience working in a rehabilitation centre for PD, who was unaware of the protocol. Video samples were analysed by means of video software which allows frame identification (and/or sequencing) by simply keyboard strokes, allowing the identification of freezing start and end, duration and number of FOG episodes. Videos to the specialist were presented in random order and were encoded to avoid any kind of identification during evaluation; sound was off. Freezing episodes were defined following the work by Kompoliti et al. In other to characterize FOG, the freezing episodes were grouped by duration Some other kinematic variables were analysed:Velocity: Calculated as a function of the time to cover the straight section between the photocells, expressed as m/sec.Cadence: Obtained from footswitch data corresponding to the straight section of the test, expressed as steps/sec.Step length: Expressed in m as a function of the velocity and the cadence, again measured only over the straight section.Turn around time: Time taken from the photocell at the end of the corridor , which wThe value for each kinematic variable was the mean obtained from the two trials performed in each condition.All subjects were informed about the nature of the test and signed consent forms. The protocol was in compliance with the Helsinki declaration and was approved by the University of A Coruña Ethics Committee.A student “t” test for independent samples was used to compare the grade of disability between the groups of patients (UPDRS-III).One-way ANOVA was used to assess differences in motor behaviour at baseline (PW) between groups of patients and controls, also for demographics. Alternatively, a non-parametric Kruskal-Wallis test, and subsequent Mann-Whitney were performed for those variables not matching normality.In order to determine the effect of stimulation on the kinematics, a 2x3 ANOVA model with repeated measures was performed. Two factors were defined: (i) within-subjects, ); and (ii) between-subjects, . Given the parametric nature of this analysis a Logarithmic Transformation was performed when normality was not assumed (in the case of Turning Time for PD+FOG), so that the variables could be introduced into the analysis. Normality of distribution was assessed by means of one sample KS test.2) was performed in order to assess differences in proportions of type of freezing episodes. Given the task involved passing through a doorway, approaching a point, and start walking twice each trial, and just one turn, the number of three first types was adjusted by dividing each by two. Number and mean duration of the freezing episodes in the PD+FOG in presence vs. absence of stimulation were assessed by means on non-parametric Wilcoxon test. Significance was set at p≤0.05.A one-way Chi-Square (χDifferences in the UPDRS motor scores between PD+FOG and PD-FOG were not significant (t(17) = 1.163 p = 0.261); proving groups of patients were comparable in the overall disease development, (though clearly they differed in respect of the presence of FOG); demographics were not different along groups p>0.05  = 1.305 p = 0.288; trochanteral height: F = 0.029 p = 0.972).During straight walking, gait patterns exhibited some other characteristic differences between groups . One-way2(3) = 18.75 p<0.001). Only 6 freezing episodes lasted more than 10 sec; 16 lasted between 3–10 sec; and 37 lasted less than 3 sec (χ2(2) = 25.46 p≤0.001).All the PD+FOG experienced freezing during the task. A total of 59 freezing episodes see were regThe main outcome of this study is that the number of freezing episodes were significantly reduced in patients in presence of auditory stimulation, from 59 to 14 . Mean duration was also significantly reduced (Z = 2.395 p = 0.017); see It is possible that the significant reduction in the number and duration of FOG is due to change in very few subjects, rather than to the whole population. For example, PD+FOG subjects number 3 and number 10 display For the rest of variables, stimulation proved to affect the same way all groups, as demonstrated by the lack of significant interactions cue*group. Taking this into account the stimulation led to reduce the time to turn, to increase cadence, and to increase velocity, as proved by a main effect of factor cue for each of those kinematics see . The incIn absence of auditory stimulation the gait of the Parkinsonian patients who “freeze” compared to those without freezing, and the latter compared to controls, exhibited lower velocity, and shorter step length, and such differences from Controls are in agreement with previous work However, the main outcome of our study is that auditory stimulation at the frequency proposed significantly reduces the number and the mean duration of the freezing episodes in a FOG eliciting task, aimed to reproduce daily activities stride-timeThe reduction in FOG is in contrast to a previous study which reported a lack of effect of auditory stimulation on FOG The presence of the auditory stimulation interacted with the kinematic variables the same way across our different groups of subjects Despite our results some questions about the effectiveness of cueing on FOG are still open. Here, the impact of stimulation was assessed for limited period of time, so it is pertinent to ask about its effectiveness during repeated, daily use, give the possibility of habituation to stimulation. Some work has reported rhythmic auditory stimulation entrainment in PD after a programme of auditory stimulation, modifying EMG patterns during gait We conclude that auditory stimulation may be used in order to minimize FOG at the end of dose in affected Parkinsonian patients. Results from our study support the use of a frequency slightly above the preferred walking frequency (as measured during ON-periods in absence of FOG), which can then be used at the end of dose phase. This point strongly supports other work on the suitability of using auditory cues to improve quality of life in PD either in controlled or uncontrolled environments Video S1Example of a patient (Example1) with motor blocks (mainly at turning) during preferred walking (no stimulation).(7.39 MB MPG)Click here for additional data file.Video S2Example of the same patient shown in S1 (Example1) with motor blocks during auditory stimulation. Walking and turning were clearly improved.(2.56 MB MPG)Click here for additional data file.Video S3Example of another patient (Example2) with motor blocks (mainly at crossing the door) during preferred walking (no stimulation).(9.21 MB MPG)Click here for additional data file.Video S4Example of the same patient showed in V3 (Example2) with motor blocks (mainly at crossing the door) during auditory stimulation. Walking through the door was clearly improved.(5.70 MB MPG)Click here for additional data file.

The other Mn atom is also six-coordinate, binding to six carboxyl­ate O atoms from different 1,4-bdc ligands. The dicarboxyl­ate groups chelate and bridge the two Mn atoms and a symmetry-related Mn atom to form a trimanganese unit. Bridging of the trinuclear MnII clusters leads to a two-dimensional structure.In the title compound, [Mn For related structures, see: Chen & Liu 2002. 3(C8H4O4)3(C14H8N4)2] = 0.047 wR(F 2) = 0.098 S = 1.05 5424 reflections340 parametersH-atom parameters constrainedmax = 0.30 e Å−3 Δρmin = −0.39 e Å−3 Δρ PROCESS-AUTO used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL-Plus (Sheldrick, 2008SHELXL97.Data collection: 10.1107/S1600536808019752/dn2359sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808019752/dn2359Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Popliteal artery aneurysms representing 80% of peripheral artery aneurysms rarely rupture (a reported incidence of 0.1–2.8 %) and second commonest in frequency after aorto-iliac aneurysms. They usually present with pain, swelling, occlusion or distal embolisation and can cause diagnostic difficulties. We report a 78 year old man who was previously admitted to hospital with a pulmonary embolus secondary to deep venous thrombosis. He was heparinized then warfarinised and was readmitted with a ruptured popliteal aneurysm leading to a large pseudo aneurysm formation. The pulmonary embolus had been due to popliteal vein thrombosis and propagation of the clot. A thorough review of literature identified only one previously reported case of ruptured popliteal artery aneurysm and subsequent large pseudo aneurysm formation. We feel it is important to exclude a popliteal aneurysm in a patient with DVT. This may be more common than the published literature suggests. Popliteal artery aneurysms even in busy vascular units are infrequent and difficult to manage. Ruptured popliteal aneurysms are extremely rare and are said to have varied presentations and can cause diagnostic dilemma. We present a 78 year old man who presented with a ruptured popliteal aneurysm associated with deep vein thrombosis and pulmonary embolism. A through literature search identified only one previously reported case of ruptured popliteal artery aneurysm with large psuedoaneurysm formation with deep vein thrombosis .A 78 year old Caucasian male presented to our casualty 6 weeks following admission elsewhere with a history of swelling of the right leg and a pulmonary embolus. He had undergone VQ scanning with a proven diagnosis of pulmonary embolus and was therefore anticoagulated with heparin and warfarin.On admission he had swelling of the right knee and lower thigh with loss of sensation on the dorsolateral aspect of the right foot. Clinical examination revealed a large mass in the right popliteal fossa. The initial diagnosis was that of deep venous thrombosis and imaging was undertaken and the patient referred for a vascular opinion.On vascular review, the patient had a pulsatile mass comparable with a popliteal artery aneurysm of 12 cms diameter on the right and 6 cms on the left. His foot was warm and well perfused and his INR was 2.6. He underwent a duplex scan of the lower limb arteries which revealed ectatic iliacs and an abdominal aorta of 3.4 cms in diameter. A further CT arteriogram . Deep veUltrasound examination is of limited value in a case of suspected rupture; however it does help in confirming the presence of an aneurysm. CT scan with or without angiography is the investigation of choice to confirm popliteal artery rupture . It can It is stated that ruptured popliteal artery aneurysms are best treated by ligation and continuity established preferably by autologous saphenous vein graft or by synthetic grafts when the patients have unsuitable veins. More recently this condition has been managed by percutaneous endovascular treatment in medically unfit patients .Since there is no evidence to show that routine screening of popliteal arteries will detect asymptomatic aneurysms and in a1. Popliteal artery aneurysms very rarely rupture (a reported incidence of 0.1–2.8 %).2. Ruptured popliteal aneurysms have varied presentations and can cause diagnostic dilemma.3. A high index of suspicion is needed in a patient presenting with signs and symptoms of deep vein thrombosis or a massively swollen leg with impending compartment syndrome or anaemia with out any clear diagnosis4. Inappropriate management of patients with deep venous thrombosis from unrecognised arterial aneurysms is associated with unacceptable morbidity and mortality.

Candidate gene and genome-wide association studies have both reproducibly identified several common Single Nucleotide Polymorphisms (SNPs) that confer type 2 diabetes (T2D) risk in European populations. Our aim was to evaluate the contribution to T2D of five of these established T2D-associated loci in the Arabic population from Tunisia.KCNJ11/Kir6.2, K121Q in ENPP1, the -30G/A variant in the pancreatic β-cell specific promoter of Glucokinase, rs7903146 in TCF7L2 encoding transcription factor 7-like2, and rs7923837 in HHEX encoding the homeobox, hematopoietically expressed transcription factor.A case-control design comprising 884 type 2 diabetic patients and 513 control subjects living in the East-Center of Tunisia was used to analyze the contribution to T2D of the following SNPs: E23K in TCF7L2-rs7903146 T allele increased susceptibility to T2D in our study population. This risk was 56% higher among subjects carrying the TT genotype in comparison to those carrying the CC genotype . No allelic or genotypic association with T2D was detected for the other studied polymorphisms.TCF7L2-rs7903146 T allele confers an increased risk of developing T2D as previously reported in the European population and many other ethnic groups. In contrast, none of the other tested SNPs that influence T2D risk in the European population was associated with T2D in the Tunisian Arabic population. An insufficient power to detect minor allelic contributions or genetic heterogeneity of T2D between different ethnic groups can explain these findings.In the Tunisian population, T2D is a complex metabolic disorder which is caused by both decreased insulin sensitivity, and impaired insulin secretion due to pancreatic β-cell defects . T2D is T2D is a global major health problem showing worldwide increasing prevalence . The AraKCNJ11, encoding the Kir6.2 subunit of the K+-ATP channel [PPARG [(GCK) [ENPP1 encoding ectonucleotide pyrophosphatase phosphodiesterase, the inhibitor of insulin receptor [From the previous familial linkage and candidate-gene studies, T2D-associated single nucleotide polymorphisms (SNPs) have been confirmed and widely replicated, but with modest effects on disease risk ,8. These channel , the Prol [PPARG , the -30receptor .TCF7L2 locus [The SNP with the largest risk effect is the intronic variant, rs7903146, in the L2 locus ,14. ThisL2 locus .HHEX locus [Recently, genome-wide association (GWA) studies revealed novel SNPs that increased T2D risk in different European populations ,16-18. Tpressed) , which wpressed) and othepressed) populatiTCF7L2, rs7923837 of HHEX, rs1788994 of GCK, rs5219 of KCNJ11/Kir6.2 and rs1044498 of ENPP1 using a case-control design in 1,397 individuals (884 unrelated T2D patients and 513 normoglycemic controls) to assess their association with T2D risk in the Tunisian population. To our knowledge, four of them have not been previously tested in this Arabic population, and we aim to evaluate whether these common variants reported to be at-risk for T2D in European populations may also contribute to T2D risk and aetiology in the Tunisian population living in the East-Center part of the country.In this study, we analyzed five polymorphisms in the following genes, rs7903146 of The T2D group includes 884 unrelated Tunisian diabetic subjects . The affected individuals were recruited in 2003–2006 in collaboration with the Endocrinology-Diabetology departments of Farhat Hached Hospital and Fattouma Bourguiba University Hospital . T2D was defined according to 1997 American Diabetes Association. Inclusion criteria: fasting plasma glucose ≥ 7.0 mmol/l and/or treatment for diabetes included diet and/or oral antidiabetic drugs and/or insulin to achieve glycemic control. All subjects who required insulin had been treated with oral drugs for at least 2 years.The diabetic cases included in the study are representative of the diabetic population examined in two hospital clinics in the center of Tunisia within a time period of 4 years; no clinical criteria of exclusion have been held .Individual and clinical characteristics were recorded for all subjects, including age at examination, gender, age at diagnosis, duration of diabetes, first-degree family history of diabetes, treatment for diabetes including date of initiation and/or discontinuation of oral agents or insulin. When available, the following details were obtained from the clinic records: dyslipidaemia, history of chronic complications of diabetes, history of hypertension, ischaemic heart disease and other medical illness.2) from blood donors recruited in the transfusion centres of Monastir and Sousse (Center of Tunisia). None was first degree relative of other subjects in the case or control groups; they were not known to have diabetes although occult disease was not excluded.All T2D patients were compared to a group of 513 normoglycaemic subjects .TCF7L2, rs7923837 in HHEX and rs1799884 in GCK promoter were performed using allelic discrimination TaqMan SNP Genotyping Assays . The PCR primers and TaqMan probes were designed by Primer Express and optimized according to the manufacturer's protocol. We obtained a 95% genotyping success rate (except for HHEX rs7923837 which gave a 90% genotyping rate). A random of 10% sample set was re-tested with the same method to confirm genotype accuracy. No difference of genotypes was found between the duplicate samples.SNP genotyping of rs7903146 in KCNJ11/Kir6.2 and K121Q (rs1044498) in ENPP1, we used the FRET technology using the Light Cycler TM assay . For both SNPs, the genotyping success rate was 91%. In order to assess genotyping accuracy for these two SNPs, 20 random samples were tested by direct sequencing, which provided a 100% concordance rate.For genotyping of E23K (rs5219) in Allele frequencies were calculated by the genotype-counting method, and each polymorphism was tested for Hardy-Weinberg equilibrium using Chi square goodness-of-fit test using HPlus 2.5 software , odds ratio (OR) and 95% confidence intervals (CI). The minimum detectable effect size with a statistical power of 80% was assessed [.Genotypic associations for additive, dominant and recessive models were tested by calculating a logistic regression (adjustments) statistic and corresponding assessed using QuP-value < 0.05.Student's t-test, used to determine differences in means of continuous variables in the normoglycemic control subjects, was performed using the SPSS statistical analysis software v.16.0 . Statistical significance was set at a 2) versus 69.91% (n = 618) non-obese (BMI < 30 kg/m2). No significant differences in clinical features were noted when all T2D patients were compared to the non-obese T2D group (data not shown).The clinical characteristics of the T2D patients and control subjects are given in Table The distribution of allelic and genotypic frequencies of the five SNPs was compared between the two study groups (884 T2D cases and 513 normoglycemic controls) [The T-allele of to date , even if to date . Our datulations ,15,24. T7903146) .HHEX, GCK, KCNJ11 and ENPP1 variants, whereas previous independent studies reported such associations with T2D risk in several European white populations [HHEX locus and T2D was also reported in a Moroccan population [With regard to the remaining four loci, no association with T2D was detected for ulations ,14,26,27Minor allele frequencies of the SNPs examined in this study compared to those reported from several other populations with different ethnic backgrounds appeared to be variable depending on ethnicity. For example, the frequency of the Q121 allele in our study population is higher (31%) than the one reported in Caucasians which ranged from 10 to 17% , but relENPP1 did not reveal evidence for association with T2D in our study from the Tunisian population. The contribution of this variant to T2D risk in the European white populations has been established in several [The extensively studied K121Q variant (rs1044498) in several but not several ,28 studiENPP1-K121Q variant may predispose to T2D [ENPP1-K121Q variant to the risk of T2D in Tunisians at the population level, and also in interaction with BMI and environmental factors in modulating T2D risk, as previously reported [A recent study in another Tunisian population reported that the t model) , but thereported .HHEX, GCK, KCNJ11 or ENPP1 variants similar to those previously reported from the European diabetic cohorts [We have to note that the present study was underpowered to demonstrate an effect in T2D risk for cohorts ,30,34. IGCK, KCNJ11 or TCF7L2) or insulin action may be modulated by the obesity status or adiposity [It was previously demonstrated that the genetic effects of variants associated with either insulin secretion (like for diposity ,28,32,34diposity ,26,28,34PPARG [eNOS [MTHFR [IL-10 [PPARG which were found to be associated only to a lower BMI among T2D patients, the other variants showed a contribution to T2D and in part to diabetic vascular complications.Previous genetic studies undertaken in this case-control study from the Tunisian population have assessed the impact of a number of gene variants on T2D risk and vascular complications, such as PPARG , eNOS [3RG [eNOS , MTHFR [S [MTHFR , IL-10 [R [IL-10 . Except TCF7L2 variant on T2D risk in the Arabic population from Tunisia, whereas the other variants tested were not found to play a major role in T2D. In comparison to the European and non-European populations, these findings can be explained by several factors, such as a minor contribution of the studied variants that is not detectable in this middle-sized cohort, the presence of Arabic-specific SNPs in some loci, or a genetic heterogeneity of T2D between different ethnic groups, which we already highlighted in a recent study of novel T2D-associated SNPs in several populations of different ethnic origins [In conclusion, our data support an effect of the widely replicated origins . In this+-ATP channel: ATP-sensitive potassium channel; MAF: Minor Allele Frequency; OR: Odds ratio; PCR: Polymerase Chain Reaction; SNP: Single Nucleotide Polymorphism; T2D: Type 2 Diabetes.BMI: Body Mass Index; CI: Confidence interval; KThe authors declare that they have no competing interests.IE and NM participated in the design of the study, carried out the SNP genotyping and the analyses of the genotype data, and contributed to the statistical analyses and the drafting of the manuscript. SC contributed to the statistical analyses and participated in the writing of the manuscript. EV participated in the SNP genotyping and some of the genetic analyses. AD carried out some of the genotyping experiments. MC and MK coordinated the patients' recruitment. WYA, PF and TM contributed to the manuscript editing. MV contributed to the design and coordination of the study, to the genetic analyses and drafted the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Supplemental table. Test of Hardy-Weinberg equilibrium for each SNP genotyped in the control and T2D study subjects.Click here for file

However, we provide evidence for a preservation of the corresponding genes in two animals unable to synthesize cholesterol (auxotrophs): Drosophila melanogaster and Caenorhabditis elegans.It is known that primary sequences of enzymes involved in sterol biosynthesis are well conserved in organisms that produce sterols bona fide orthologs of several ERG genes in both organisms using a series of complementary approaches. We have detected strong sequence divergence between the orthologs of the nematode and of the fruitfly; they are also very divergent with respect to the orthologs in organisms able to synthesize sterols de novo (prototrophs). Interestingly, the orthologs in both the nematode and the fruitfly are still under selective pressure. It is possible that these genes, which are not involved in cholesterol synthesis anymore, have been recruited to perform different new functions. We propose a more parsimonious way to explain their accelerated evolution and subsequent stabilization. The products of ERG genes in prototrophs might be involved in several biological roles, in addition to sterol synthesis. In the case of the nematode and the fruitfly, the relevant genes would have lost their ancestral function in cholesterogenesis but would have retained the other function(s), which keep them under pressure.We have been able to detect ERG24 and ERG25 in D. melanogaster and genes encoding factors involved in intracellular protein trafficking and folding and with Start1 involved in ecdysteroid synthesis. These potential functional connections are worth being explored not only in Drosophila, but also in Caenorhabditis as well as in sterol prototrophs.By exploiting microarray data we have noticed a strong expressional correlation between the orthologs of DrosophilaCaenorhabditis elegans possesses several genes encoding proteins with regions similar to Hh and potentially undergoing cholesterylation Cholesterol and other sterols such as ergosterol and phytosterols are universal components of eukaryotic plasma membranes and are absent from the membranes of prokaryotes. These sterols modulate membrane fluidity Saccharomyces cerevisiae, which involve ERG (i.e. from ERGosterol) genes and the respective ERG proteins.Yeast, plants and mammals synthesize sterols through a series of complex reactions that occur in the endoplasmic reticulum (ER) and, therefore, most of the involved enzymes have transmembrane domains . We outlERG25, ERG26, and ERG27, in cooperation with ERG28p. Finally, ERG6p (C-24 methylase) converts zymosterol to fecosterol, which is further transformed into ergosterol by ERG2p, ERG3p, ERG5p and ERG4p The first three steps of sterol biosynthesis are catalized by ERG9p , ERG1p and ERG7p (lanosterol synthase), respectively. These proteins are essential for aerobic viability and their absence results in an inability to synthesize ergosterol. The third enzyme, ERG7p, converts squalene epoxide into lanosterol, the first cyclic component of the cholesterol biosynthesis cascade (i.e. the first sterol). The remaining enzymes of the pathway metabolize lanosterol into ergosterol. The sequential action of ERG11p (lanosterol demethylase) and ERG24p (C-14 reductase) leads to 4,4-dimethylzymosterol. They are also essential in aerobic conditions Recent results show that, in yeast, ergosterol biosynthetic enzymes display specific protein-protein interactions and form a functional complex called ergosome. Proteins ERG11p, ERG25p, ERG27p and ERG28p, appear to form a core center of the complex and would interact with other enzymes of the pathway D. melanogaster and C. elegans cannot synthesize sterols de novoC. elegans takes sterols from animal feces or yeast and plant remnants Drosophila obtains sterols from the diet: ergosterol from yeast and phytosterols from plants Most animals synthesize cholesterol. However, some animals such as dauer larva formation and molting depend on sterols. Cholesterol, or more likely its derivatives, seem to act as hormones. Indeed, recent papers report the identification of natural steroid ligands for the DAF-12 nuclear receptor As already noted, sterols in these animals are required as hormone precursors and/or developmental effectors C. elegans, the distribution and transport of cholesterol in vivo has been studied by using dehydroergosterol (DHE), a fluorescent analog which mimics many cholesterol properties C. elegans might be involved in the structural and functional organization of the plasma membrane cell types that are richer in this lipid In D. melanogaster with Anopheles gambiae and prototrophs has suggested that these insects have lost most of the genes involved in sterol synthesis Drosophila is unable to synthesize cholesterol. However, in a previous work we have shown that Drosophila contains an ERG28 ortholog that has undergone a process of acceleration in its evolution, and is undetectable using the current techniques for ortholog detection by sequence homology C. elegans and D. melanogaster, not only for ERG28, but most of the genes/enzymes involved in the sterol synthesis pathway, in the light of new genomic and functional data.A previous comparative genome analysis of ERG gene orthologs in C. elegans and D. melanogaster following their order in the sterol synthesis cascade . This protein, which also exists in C. elegans, contains two functional domains: monooxygenase and UbiH (2-polyprenyl-6-methoxyphenol hydroxylase and FAD-dependent oxidase). This is also the case in yeast ERG1p. However, in a reverse BLAST, CBG19254 recognized with very high score yeast Coq6 and only marginally ERG1p . A similar behavior was observed for GA20231-RA from D. pseudoobscura, so we did not proceed to a further analysis of these sequences.We failed to detect the squalene synthase (ERG9p) homolog, which catalyzes the first committed step in cholesterogenesis. In the search for squalene epoxidase (ERG1p) in a BLAST using ERG1p from yeast, we detected the gene CBG19254 in For lanosterol synthase (ERG7p), which follows in the classical pathway, we could not gather any convincing evidence for the existence of orthologs in the fruitfly and the nematode.Drosophila . However, the Drosophila genes are likely to belong to other Cyp subfamilies (not Cyp51). Cyp51 is probably missing, which is in agreement with the results of Tijet, Helvig & Feyereisen P450 gene superfamily. Cyp51 is also absent in C. elegansThe following enzyme in the pathway is a sterol 14α-demethylase, ERG11p/Cyp51, involved in the biosynthesis of cholesterol, phytosterols and ergosterol. Thus, it is the only cytochrome P450 having an ortholog common to animals, plant and fungi ERG24 orthologs in D. melanogaster (CG17952) and in C. elegans (B0250.9) were easily found. The corresponding proteins contain the ERG4-24 domain. D. melanogaster produces three isoforms that are longer than the yeast ortholog, a peculiarity that they share with the human ortholog. The ortholog of ERG24 in mammals encodes the Lamin B receptor (LBR), a nuclear envelope protein first described in vertebrates. LBR bears extensive structural similarities with the members of the sterol reductase family (ERG24p and ERG4p). Human LBR (hLBR) cannot restore ergosterol biosynthesis in an ERG4 yeast mutant, whereas it is able to restore ergosterol prototrophy in an ERG24 mutant. This strongly suggests that hLBR is a sterol C14-reductase hLBR gene causes an autosomal recessive disease called hydrops-ectopic calcification-‘moth-eaten’ (HEM). This mutation leads to high levels of cholesta-8,14-dien-3-beta-ol in cultured skin fibroblasts, which is compatible with a deficiency of the cholesterol biosynthetic enzyme 3-beta-hydroxysterol delta(14)-reductase Potential LBR gene arose from an ancestral gene coding for a soluble nuclear protein and that the rest of the protein evolved from another gene, similar to yeast ERG24. Indeed, the C-terminal hydrophobic domain of LBR can be retained in the endoplasmic reticulum when expressed in transfected cells, as expected for the ortholog of ERG24 in mammals. In turn, the N-terminal domain is transported to the nucleus The hLBR contains two major domains: a ∼220-amino-acid N-terminal segment highly charged, and a hydrophobic C-terminal half with eight putative transmembrane segments Drosophila CG17952 gene is the ortholog of vertebrate LBRDrosophila LBR (dLBR) possesses a highly charged N-terminal domain of 307 amino acids followed by eight transmembrane segments. Transmembrane segments 1–6 are similar in length and position to the transmembrane domains 1–6 of hLBR. However, the putative membrane domains 7 and 8 of dLBR are shorter than those of hLBR. Thus, dLBR is expected to have a topological organization similar to that of its vertebrate orthologs Drosophila lamin B, a function residing in the N-terminal domain. Not unexpectedly, dLBR does not display sterol C14 reductase activity when expressed in the yeast ERG24 mutant. This shows that, during insect evolution, although the enzymatic activity of this protein has been lost, its capacity to bind lamin B has not. However, depletion of dLBR by RNA interference does not lead to any obvious effect on nuclear architecture, or viability, of treated cells and embryos. Thus, although dLBR might be important, it is not a limiting component of the nuclear architecture in Drosophila cells, at least during the first days of development ERG24 ortholog in C. elegans. It would be interesting to experimentally assess if it has kept LBR activity.Recent functional studies show that the D. melanogaster (CG1998/dERG25A and CG11162/dERG25B) and C. elegans (F49E12.9/ERG25A and F49E12.10/ERG25B) using the sequence of yeast ERG25p as a starting point. In both organisms the duplicated copies of ERG25 are located in the same chromosome (chromosome II for C. elegans and chromosome X for D. melanogaster). The two paralogs in D. melanogaster are separated by 0.25 Mb and contain a different number of predicted exons. Namely, CG1998 contain 6 exons, while CG11162 contains only 2. However, the last intron of both genes interrupts the coding sequence at very similar positions were also easily found in both C. elegans (ZC8.1) and D. melanogaster (CG7724) was obtained in BLAST searches taking the sequence from yeast as the starting point orthologs. However, a BLAST with C32D5.12 detected as the first hits NSDHL in man and ERG26 in yeast (ERG26p (C-3 dehydrogenase) belongs to the 3β-hydroxysteroid dehydrogenase family and convincing evidence for the presence of orthologs in in yeast . Thus, iet al.Drosophila and C. elegans, although several oxidoreductases were detected.In agreement with Breitling C. elegans (C14C10.6) was hardly detectable by BLAST starting with yeast sequences. This precludes the use of standard phylogenetics methods to show orthology. However, further evidence of sequence relatedness was gathered using Psi-BLAST with the yeast sequence against the Metazoa division of Genbank D. melanogaster, which is the ortholog of ERG28p according to our previous results −27). Reverse Psi-BLAST also suggested orthology (i.e. significant scores). The sequence of C14C10.6 is so divergent that it had no match in the conserved domain database (CDD). Moreover, we also computed the hydrophobic profiles for some of the orthologs As outlined above, ERG28p might tether many other ERG proteins to the ER. The ERG28p ortholog of C. elegans (H14E04.1) was easily detected by BLAST with protein sequences from either yeast or A. thaliana (SMT1). We used the plant sequence since no clear ERG6 homolog could be detected in human. The issue with Drosophila turned out to be more complex because, when starting the search with the yeast sequence, we detected CG8067 marginally (E>1). This was even worse when starting with the sequence of A. thaliana. However, when using the C. elegans sequence as a starting point, the first significant hit in Drosophila (E<10−6) was CG2453, which proved to be the ortholog of yeast Coq5, but not of ERG6p. Finally, considering i) the similar lengths of the previously marginally detected CG8067, of H14E04.1 and of SMT1 proteins and ii) their similar pI, we have preferred CG8067 as the most likely ortholog. Indeed, the hydrophobic profiles of SMT1 and the protein encoded by CG8067 displayed a strong correlation. Namely, we obtained an R = 0.43 with a p-value 10−16.The ortholog of ERG6p in C. elegans (W08F4.3) was marginally detected by BLAST with the yeast and the human protein . However, W08F4.3 was found to contain a sigma1-receptor domain when compared with the CDD. This strengthens the idea that this gene is the ortholog of OPRS1 and ERG2. The situation in Drosophila was more complex. When starting our BLAST with either yeast or human sequences, we detected the sequence HDC14735 (DAA04220) very marginally (E≫1) and no conserved domain was found. However, when starting with the C. elegans sequence, it came as the best hit with E = 0.002 . Although not significant, this result was taken as suggestive of similarity. The results were improved using Psi-BLAST. Again, we computed the hydrophobic profiles for the various potential orthologs and we found strong correlations . Therefore, we propose that the orthologs of ERG3 are potentially missing in both organisms.In BLAST searches with yeast ERG3p, we detected again CG1998 and CG11162 in For ERG5p, which belongs to the big Cyp protein family, no clear orthologs could be established. However, three potential candidates were found: CG4321-PA (Cyp4d8), CG3540-PA (Cyp4d14) and CG8859-PA (Cyp6g2). In the reverse BLAST, they all matched ERG5p as the best scoring hit in yeast.Finally, the search for ERG4p orthologs led to the same ERG24 orthologs in the nematode and the fruitfly. Moreover, with ERG4p the BLAST scores were worse than with ERG24p. Thus, either ERG4 orthologs are missing or they have been replaced by ERG24.ERG orthologs mentioned above undergo a selective pressure, we have examined the ratio of the number of non-synonymous substitutions per non-synonymous site (Ka) and the number of synonymous substitutions per synonymous site (Ks). The ratio Ka/Ks is indicative of the mode of evolution operating on the sequences. If selection is dominantly purifying, then we expect few non-synonymous substitutions per background synonymous changes and hence, a low ratio. If selection is absent, then a ratio of unity is expected ratios show that these genes are under selective pressure . This property is important for enzymes because protein-protein and enzyme-substrate interactions are often electrostatic in nature. Thus, we should expect the pI of an enzyme to be similar in different organisms if protein-protein and/or enzyme-substrate interactions are conserved. In order to test this idea we gathered the protein sequences of the orthologs of ERG2, 6, 24, 25, 26 and 28. Next, we asked whether the corresponding vergence . SimilarERG orthologs that we have described above for both D. melanogaster and C. elegans. Co-expression can be assessed by determining the correlation coefficient. The correlation coefficient can be artificially inflated by flat profiles (no changes in the expression of the relevant genes). To avoid this, we focused on experiments where the genes of interest display strong variation and it was not possible to proceed further with the analysis.Co-expression is indicative of i) physical interaction between proteins and ii) of membership to the same complex or molecular process tion see . Thus, wD. melanogaster ERG orthologs were correlated (dLBR (ERG24) and CG1998 (ERG25) with an associated p-value of 10−16 (after a Bonferroni correction). Such a p-value means that only one correlation coefficient out of 1016 is expected to be as high as 0.89 just by chance . Considering the maximum number of possible correlations for the 14000 transcripts in the microarrays (representing the Drosophila genome), such a high R cannot be found by chance. The behavior of dLBR and CG1998 might be reminiscent of the situation in yeast because ERG24p and ERG25p are supposed to interact, according to Epistatic MiniArray Profiling experiments First, we asked whether the expression profiles of the rrelated . The strERG orthologs in Drosophila. However, it seems that only dLBR and CG1998 still “remember” their ancestral belonging to the sterol biosynthesis pathway. Poor expressional correlation among the rest of the ERG orthologs also suggests that the corresponding proteins either have lost their ability to physically interact in order to form stable complexes, or they do so in conditions/moments not covered by the microarray experiments explored here. Then, we focused our attention on dLBR and CG1998 by determining which other genes were expressionally correlated with them. For this, we gathered 84 genes displaying R≥0.875 with respect to both genes. For a correlation involving 51 data points, this R cut-off is associated with a safe p-value of 10−13 after correction , chaperone cofactors or unfolded protein-binding factors. A similar analysis conducted using g∶profiler −5). The existence of expressional correlation does not imply any causality. In fact, from this exploration it is not possible to determine whether dLBR and CG1998 somehow interact with other partners to participate in intracellular protein trafficking or folding, or on the contrary, they undergo the action of the latter. Since dLBR has been shown to be a nuclear protein ERG orthologs. However, no unifying theme emerged from this analysis . All in all, the strong expressional correlation between dLBR and CG1998 with proteins involved in intracellular protein trafficking or folding, and the absence of such correlation with other Erg orthologs suggest that the involvement of dLBR and CG1998 in both processes is worth exploring.In the analysis using DAVID, the most overrepresented class included genes encoding membrane proteins, often targeted to the ER, where sterol biosynthesis takes place in prototrophs was found for Start1. Interestingly, Start1, which is involved in intra-mitochondrial sterol transport, is expressed ubiquitously. However, in situ hybridization demonstrates a stronger expression in the prothoracic gland, where ecdysteroids are synthesized from cholesterol. These and other observations are consistent with the idea that Start1 plays a key role in the regulation of ecdysteroid synthesis In a previous paper, given the structural similarity between cholesterol and ecdysteroids, we had proposed that divergent ERGp orthologs might somehow participate in the synthesis of the latter ERG genes in Drosophila melanogaster and Caenorhabditis elegans. In spite of their sequence divergence with respect to the corresponding orthologs in sterol prototrophs, they still are under selective pressure. Since insects are unable to synthesize cholesterol de novo, an appealing way to explain this evolutionary acceleration is that ERGp orthologs have other biological functions in addition to sterol synthesis. This is clearly the case of the LBR, which is also a reductase in sterol prototrophs. Shut-down of cholesterogenesis in insects and nematodes would have allowed these proteins to evolve as much as their other functions were not compromised ERG24 and ERG25 in D. melanogaster and genes encoding factors involved in intracellular protein trafficking and folding. This is compatible with our idea that ERGp might be involved in other biological roles in addition to sterol synthesis. The potential link between ERG proteins and intracellular protein trafficking and folding deserves experimental exploration not only in Drosophila and Caenorhabditis but also in sterol prototrophs. Moreover, the potential link between dLBR, CG1998 and Start1 is to be explored in D. melanogaster. This is compatible with our previous idea of a potential implication of these proteins in the synthesis of ecdysteroids. We hope that this genomic exploration and the hypotheses prompted here might open new avenues of experimental research.In conclusion, we detected a preservation of We used BLASTp For some distant homologues we computed the hydrophobic profiles and calculated the Pearson correlation coefficient “R” for various pairs of profiles. The values of R range between 1 (perfect match between the profiles) and −1 (profiles are mirror images). Strong positive correlation is not a proof of orthology but strengthens the idea of structural relationship at the protein level.The protein-coding nucleotide sequences were first translated into amino acid sequences and aligned. Then, this alignment was used to define the alignment of the corresponding nucleotide sequences to avoid frame-shifting indels as alignment artifacts http://www.expasy.ch/tools/pi_tool.html). Then, we asked whether the corresponding Drosophila and Caenorhabditis sequences displayed outlier pI values. In short, we performed an extreme studentized deviate test to determine whether one of the values in the pI list was a significant outlier from the rest.We have investigated whether the pI of presumably orthologous proteins were similar. In order to test this, we gathered the protein sequences of the orthologs of ERG2, 6, 24, 25, 26 and 28 listed in the HomoloGene division of the NCBI database and estimated their pI (

The [Co(bpy)3]3+ complex cation exhibits C 2 symmetry with the twofold axis through the central Co atom and bis­ecting one bpy ligand and one of the Cl− anions. The four solvent water mol­ecules and the remaining two Cl− anions lie on a mirror plane. Hydrogen-bond inter­actions define a two-dimensional layer structure parallel to (100), which consists of seven-membered [Cl2(H2O)5], eight-membered [Cl4(H2O)4] and ten-membered [Cl2(H2O)8] rings.The title compound, [Co(C DOI: 10.1107/S1600536808038154/bg2219Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Fetal alcohol spectrum disorders (FASD) are the leading cause of mental retardation in the western world and children with FASD present altered somatosensory, auditory and visual processing. There is growing evidence that some of these sensory processing problems may be related to altered cortical maps caused by impaired developmental neuronal plasticity.Here we show that the primary visual cortex of ferrets exposed to alcohol during the third trimester equivalent of human gestation have decreased CREB phosphorylation and poor orientation selectivity revealed by western blotting, optical imaging of intrinsic signals and single-unit extracellular recording techniques. Treating animals several days after the period of alcohol exposure with a phosphodiesterase type 1 inhibitor (Vinpocetine) increased CREB phosphorylation and restored orientation selectivity columns and neuronal orientation tuning.These findings suggest that CREB function is important for the maturation of orientation selectivity and that plasticity enhancement by vinpocetine may play a role in the treatment of sensory problems in FASD. Fetal Alcohol Spectrum Disorders (FASD) is an umbrella term describing a range of effects that can occur in an individual whose mother imbibed alcohol during pregnancy. This condition is considered the leading cause of mental retardation in the western world with as many as 40,000 cases per year in the United States The development of sensory cortical maps generally involves an initial phase in which the basic structure of the map is formed, followed by a refinement phase in which connections are eliminated and strengthened by activity-dependent mechanisms The cAMP response element-binding protein (CREB) is regulated by phosphorylation in response to neuronal activity patterns Here we show that early alcohol-exposure leads to a persistent impairment in CREB phosphorylation and that treatment with a PDE type 1 inhibitor, several days after the period of the alcohol insult, restores normal phosphorylation of CREB, which in turn leads to normal development of orientation selectivity maps and single cell orientation tuning, cortical features known to be disrupted by early alcohol exposure In order to mimic alcohol binge drinking during the third trimester of pregnancy in humans, ferrets were injected with ethanol every other day between postnatal day (P) 10 to P30. This period is roughly equivalent to P4–P10 in rodents and to the third trimester equivalent of human gestation Six days after the end of the alcohol treatment, animals received vinpocetine confirm that Vinpocetine treatment restores the intrinsic homogeneity in alcohol exposed animals is similar to that of the Saline and significantly different from that of the Ethanol treated animals .The cumulative distributions of the Hom animals . Saline animals , indicat2 of cortical surface area; in Ethanol animals, there were 4.25±0.64 (n = 9) pinwheels/mm2; and 3.48±0.14 (n = 9) pinwheels/mm2 cortical surface in Ethanol+Vinpocetine treated animals. A hallmark feature of the orientation selectivity cortical columnar organization is the presence of pinwheel centers: singularities in the orientation map around which all orientations are represented i) was obtained for each cell . Similar to what was observed with optical imaging of intrinsic signals, vinpocetine treatment restored orientation selectivity in Ethanol treated animals .Although vinpocetine treatment restores orientation selectivity maps in alcohol exposed animals, we cannot discard the possibility that at the cellular level, neurons still present orientation tuning deficits cell see . An indeWe also made use of extracellular single-unit recordings to verify whether alcohol and vinpocetine treatments resulted in abnormal visually driven activity. Confirming our previous data To examine whether CREB function is related to the effects of early alcohol exposure on orientation selectivity as well as to its restoration by vinpocetine treatment we performed fluorescent immunoblots to assess pCREB levels in Saline (n = 10), Ethanol (n = 10) Ethanol+Vinpocetine (n = 8), and Saline+Vinpocetine (n = 10) animals. Similar to procedures done prior to physiological experiments, animals were exposed to ethanol or saline between P10–P30, and at P36 received a single dose of either vinpocetine or vehicle. We chose this age point since it is around the time that of orientation selectivity maturation in the ferret Here we show that pCREB levels remain decreased after the period of early alcohol exposure in a ferret model of FASD. This decrease could account for poor circuit refinement 2+The development of cortical orientation selectivity is known to require visual activity ++/calmodulin-dependent kinases or cAMP-dependent protein kinase A. These kinases phosphorylate the transcription factor CREB But how could visual activity result in the plastic changes necessary for circuit refinements? Visual stimulation activates the NMDA receptor allowing calcium influx that, in turn, activates protein kinases, such as CaHere, animals were exposed to alcohol from the second to the fourth postnatal week (P10 to P30), a period when lateral geniculate neurons are forming synapses with layer IV neurons Alcohol may disrupt orientation selectivity by acutely suppressing NMDA receptor function The fact that vinpocetine treatment was able to restore orientation selectivity in animals early exposed to alcohol suggests that, although NMDA and GABA receptor functions are affected by alcohol Another important aspect of our findings is that vinpocetine treatment takes place during the period of the refinement of layer II–III cortical horizontal connections in the ferret However, one may argue that vinpocetine's restorative effects on orientation selectivity maps might be in part explained by its cerebral vasodilatory properties. While vinpocetine has vasodilatory effects Orientation selectivity is a property of visual cortex neurons that is thought to be essential for visual perception of shapes and borders In conclusion, we showed that administration of a PDE1 inhibitor several days after the period of alcohol exposure can improve cortical organization in the ferret model of FASD by restoring pCREB levels. Improving activity-dependent plasticity using PDE1 inhibitors should be seriously considered in other animal models of impaired cortical development, since orientation selectivity map formation is believed to share similarities to the development of other cortical areas It is of great importance to devise treatment approaches that can be implemented long after the period of alcohol exposure. However, the biggest challenge to this has been the non-specific nature of the alcohol insult. Early alcohol exposure affects many neuronal biochemical and physiological properties All procedures described in this paper were approved by the Institutional Animal Care and Use Committee at Virginia Commonwealth University.Ferrets were treated with 3.5 g/kg alcohol i.p. or saline as control every other day between postnatal day (P) 10 to P30. This alcohol treatment leads to a blood alcohol level of approximately 250 mg/dl for 1–5 hours after injection 2 and arterial blood oxygen saturation (SpO2) were monitored continuously and maintained at approximately 270 bpm, 4.0% and above 90%, respectively. Body temperature was maintained at 38°C using a homeostatic blanket. Supplemental doses of pentobarbital (12 mg/kg) were given every hour throughout the experiment or when heart rate or expired CO2 increased, a procedure previously shown to preserve visual responses over time Animals were premedicated by subcutaneous injection of a tranquilizer , and a muscarinic antagonist to reduce bronchial secretion, as well as dexamethasone sodium phosphate (0.5 mg/kg) to reduce inflammation. Animals were then anesthetized using sodium pentobarbital and placed in a stereotaxic frame. No procedures were started until the animal was sufficiently anesthetized, as ascertained by the loss of withdrawal and cornea-blink reflexes. A tracheal cannulation was performed, and the animal was placed on a ventilator and paralyzed using pancuronium bromide . To comply with NIH guidelines for use of paralytic agents and to certify that the animals were maintained at an appropriate level of anesthesia, use of muscle relaxants was omitted in some experiments and withdrawal reflexes were monitored in these animals. Similar procedures have been previously described and shown to be appropriate for visual physiology studies conducted in ferrets Optical imaging of intrinsic signals was performed with Imager 2001 VSD+ using imaging methods slightly modified from those described elsewhere http://rsbweb.nih.gov/ij/plugins/texture.html) to compute the contrast texture of differential maps . Three contrast values were obtained for each differential image (248×160 pixels) from 3 non-overlapping ROIs (55×55 pixels) that included V1 and V2, covering nearly the entire map surface. The contrast values were then summed to obtain a contrast value for a single differential map. A value near to 20,000 indicates a high contrast level (high degree of selectivity), and a value close to 10,000 indicates a low contrast level (poor degree of selectivity).Quantitative analysis of orientation selectivity was done by assessing the contrast level of the differential maps. To obtain a quantitative estimate of contrast texture, differential maps were mixed with the floating point files clipped at ±3SD from the median. The resulting 8 bit difference images were rescaled from 0 to 255 and the contrast was calculated based on the Grey-Level-Co-Occurrence Matrix contrast texture technique described by Haralick and colleagues i) was calculated for each condition according to the following formula:To compare the strength of visual responses across the different treatment groups we computed the signal intensity observed in single condition maps. An estimate of signal intensity was obtained by first computing the pixel distribution along a grayscale containing 128 levels of gray in 8 bit single condition images clipped at ±3SD from the median. In this scale, 0 represents lack of responses and 127 the strongest possible response to visual stimulation. For each single condition map , the pixel distribution was obtained from an ROI drawn manually to include V1 and V2. To avoid sampling biases, for each animal, ROIs were outlined on maps of total visual response (0°+45°+90°+135°/blank stimulus). Next, a signal intensity index in an ROI drawn manually to include V1 and V2. To avoid biases in the identification of the area of cortical responsiveness, ROIs were outlined on maps of total visual response (0°+45°+90°+135°/blank stimulus) and then superimposed on the respective polar map. Next, homogeneity indexes (Homi) were computed from the pixel distributions according to the following formulas:Cortical responsiveness to visual stimulation at different angles is considerably homogeneous and preferentially activated by cardinal contours rather than by contours at oblique angles , 205.84±19.68 mm2 for Ethanol , and 253.21±9.26 mm2 for Ethanol+Vinpocetine . No significant size differences were observed .Pinwheel numbers and densities were determined in a similar way as previously described elsewhere We also investigated the relationship between the number of pinwheels and the cortical representation of visual responses to gratings of different orientations. For each polar map, we divided the number of pixels in each pseudo-color (see above) by the total number of pinwheels.2 and SpO2 were monitored continuously. A craniotomy (3–4 mm in diameter) was performed to expose the binocular region of the left primary visual cortex where recordings were performed. Single-unit recordings were conducted using a glass-coated tungsten microelectrode with a 5 µm exposed tip lowered into the primary visual cortex at approximately 20° to the vertical. To minimize sampling bias, single-units used in this study were separated by at least 100 µm along the electrode track. After the isolation of a single-unit, its receptive field was mapped and the optimal stimulus orientation, direction and velocity were determined qualitatively using a moving bar of light projected onto a tangent screen. Ocular dominance, spontaneous activity and number of spikes per stimulus were then quantitatively determined for each cell by presenting a computer-controlled bar of light to each eye. Each stimulus presentation consisted of the bar of light moving across the receptive field at the optimal orientation in one direction and back across in the opposite direction. To assess orientation selectivity, the moving bar of light was presented to each eye separately at four orientations centered around the optimal . Spikes were collected during the 10 stimulus presentations by a computer using Spike 2 software and peristimulus histograms were generated. Spontaneous activity was determined by recording activity in the absence of stimulation. At the conclusion of the electrophysiology experiment, ferrets were killed with Euthasol, .Animals were premedicated, anesthetized and ventilated with similar procedures described for optical imaging. Temperature, heart rate, expired COi) was obtained for each cell by using the following formula:To quantify the orientation selectivity based on the single-unit recordings, an orientation selectivity index to different orientations . Indices of 1.0 indicate a high degree of selectivity.Where Ferret visual cortices were dissected at P36 (n = 38), frozen on dry ice and stored at −80°C then homogenized in Tissue Extraction Buffer with a Protease and a Phosphatase inhibitor cocktail . Due to the fact that western blot studies normally require large sample sizes and that ferrets are a USDA protected species, we limited our western blot analysis to a single age point. Protein concentrations were measured using Bradford protein assay with bovine serum albumin as a standard . Next, 50 µg of total protein was resolved by SDS-PAGE and transferred to nitrocellulose membranes . Blots were incubated in blocking buffer for 1 hour, then incubated in Phospho-CREB (Ser133) (87G3) rabbit mAb overnight at 4°C. This was followed by two hours of incubation in CREB (86B10) mouse mAb at room temperature, then one hour in GAPDH mouse mAb . The secondary antibodies were goat anti-mouse IRDye 800CW IgG and goat anti-rabbit IRDye 680 IgG . Blots were detected by Odyssey Image System .Results S1a)Effects of PDE type 1 inhibition on cAMP and pCREB levels. b)Alcohol exposure during the third trimester equivalent of human gestation does not affect visual acuity in the ferret.(0.04 MB DOC)Click here for additional data file.Figure S1Changes in cAMP and CREB phosphorylation after vinpocetine. cAMP levels assessed by a commercially available immunoassay kit. CREB phosphorylation assessed by western blotting. Primary antibody: pCREB . pCREB data was normalized by actin.(0.32 MB TIF)Click here for additional data file.Figure S2Number of spikes resulting from stimulation with different spatial frequencies. While the ethanol treated animal presented a severe impairment of the orientation selectivity map its response to changes in spatial frequency was similar to a control animal that exhibited a highly organized orientation selectivity map.(0.50 MB TIF)Click here for additional data file.

Prevalence and risk factors for respiratory symptoms and airway obstruction in HIV-infected subjects in the era of highly active antiretroviral therapy (HAART) are unknown. We evaluated respiratory symptoms and measured airway obstruction to identify the impact of HAART and other risk factors on respiratory symptoms and pulmonary function.1) percent predicted, and FEV1/forced vital capacity (FEV1/FVC). Thirty-one percent of subjects reported at least one respiratory symptom. Smoking status (current or former versus never) , higher log plasma HIV viral levels , and lower FEV1/FVC were independent predictors of respiratory symptoms. Age (p = 0.04), pack-year smoking history (p<0.001), previous bacterial pneumonia (p = 0.007), and HAART use (p = 0.04) were independent predictors of decreased FEV1/FVC.Two hundred thirty-four HIV-infected adults without acute respiratory symptoms were recruited from an HIV clinic. All subjects were interviewed and performed spirometry. Multivariate linear and logistic regressions were performed to determine predictors of respiratory symptoms, forced expiratory volume in one second (FEV1/FVC ratios. Interestingly, use of HAART was independently associated with a decreased FEV1/FVC, possibly secondary to an immune response to subclinical infections, increased autoimmunity, or other factors associated with HAART use.Respiratory symptoms remain common in HIV-infected subjects, especially in those with a smoking history. Subjects who were older, had a greater pack-year history of smoking, or previous bacterial pneumonia had lower FEV The development of highly active antiretroviral therapy (HAART) has led to impressive declines in morbidity and mortality from the human immunodeficiency virus (HIV) In the pre-HAART era, HIV-infected persons had a high prevalence of respiratory complaints including cough, shortness of breath, and dyspnea on exertion Pneumocystis pneumonia (PCP), and previous bacterial pneumonia Risk factors for respiratory symptoms and airway obstruction reported in the pre-HAART era might also have changed with HAART. Most previous studies documented an association between smoking, respiratory symptoms, and airway obstruction among HIV-infected individuals We conducted a cross-sectional study of HIV-infected individuals presenting to an HIV clinic for routine care. Our overall aims were to investigate the frequency of respiratory symptoms and airway obstruction during the HAART era, identify risk factors, and explore the relationship of HAART to symptoms and airway obstruction. We report the first prospective study to directly measure pulmonary function in HIV-infected individuals in the HAART era, and the first to report a relationship of HAART and airway obstruction.Our objectives were to determine frequency of respiratory symptoms and airway obstruction during the HAART era, to identify associated risk factors, and to determine the relationship of HAART to symptoms and pulmonary function.Subjects were HIV-infected adult outpatients at the University of Southern California HIV clinic, who were enrolled between September 2003 and September 2004. Subjects who had new or increasing cough, shortness of breath, or fever in the past four weeks were excluded, as were subjects with self-reported asthma.Data were collected by subject interview and standardized medical record abstraction using pre-determined definitions. Information collected from subjects included age, gender, race and ethnicity, HIV risk factor, medication use, smoking history, and history of an AIDS-defining diagnosis. History of pneumonia was obtained from both patient interview and chart review. HAART was defined as use of at least three medications from two classes of antiretroviral drugs within the previous 3 months as determined by medical record review. Current smokers were defined as those smoking at least one cigarette each day and at least a lifetime total of 100 cigarettes. Former smokers had quit for greater than one year. Subjects were asked about presence or absence of chronic respiratory symptoms including cough, shortness of breath, and dyspnea on exertion. Laboratory values for CD4 cell counts and plasma HIV viral levels were obtained within six months of spirometry testing.All subjects performed spirometry according to American Thoracic Society guidelines The University of Southern California Institutional Review Board approved the study. All subjects gave written informed consent.Data were double-entered to ensure accuracy. Stata 8 was used for analysis, and significance determined for a p-value ≤0.05. Variables were described using either t-tests and Wilcoxon rank-sum, or chi-square and Fisher's exact.Percentage of subjects reporting respiratory symptoms was determined for individual symptoms and for any symptom. Univariate analyses were performed to determine clinical variables related to reporting any respiratory symptom. Step-wise forward and backward multivariate logistic regression was performed to determine independent predictors of respiratory symptoms by including variables significant at a level of p≤0.1 in univariate analyses. If two variables were significantly correlated , the variable with the strongest univariate relationship to the outcome was included. Interactions of variables were explored. Model fit was assessed using the Hosmer-Lemeshow goodness-of-fit test 1) percent predicted, forced vital capacity (FVC) percent predicted, and FEV1/FVC were described for the entire cohort. The percentages of subjects with airway obstruction as determined both by FEV1/FVC below the 5% lower limit of normal adjusted for age and FEV1/FVC less than 0.70 were calculated 1 percent predicted and FEV1/FVC. Stepwise forward and backward multivariate linear regression was performed to determine independent predictors of FEV1/FVC by including variables at a level of p≤0.1 in univariate analyses. The strongest univariate predictor was included in the multivariate model if two variables were significantly correlated. CD4 cell counts and plasma HIV viral levels were missing for 13 subjects. We compared models with and without subjects with missing data, and there were no significant differences. Data on HAART use were missing or incomplete (i.e. subjects reported recent use of fewer than 3 medications) in 19 subjects. Models were run without subjects who lacked adequate information on HAART use. For subjects reporting use of less than three antiretrovirals, we ran models including them in the HAART group and excluding them as well. There were no significant differences between these two models and because we felt the data were less reliable in the subjects reporting non-standard ART regimens, we chose to exclude them in the final model. We explored interactions between model variables. Because we were specifically interested in the relationship of HAART to FEV1/FVC, we investigated other potential interactions and modifying effects for relationship of HAART use to FEV1/FVC. To account for confounding, we explored potential mediators and moderators, such as plasma HIV viral levels, CD4 cell counts, and smoking history, using linear regression as described Forced expiratory volume in one second (FEVTwo hundred and thirty-four subjects participated. The majority (82.5%) were men . SubjectPrevalence of any respiratory symptom was 31.5%. Cough was most frequently reported, occurring in 23.0% of subjects. Sixteen percent of subjects reported dyspnea on exertion and 3.0% complained of shortness of breath at rest. Current or former smokers were more symptomatic than never smokers .1 percent predicted of those with and without symptoms, but FEV1/FVC was significantly lower among symptomatic subjects. Multivariate analysis demonstrated that current or former smoking status , higher log serum HIV viral levels , and lower FEV1/FVC were independent predictors of respiratory symptoms.Age, intravenous drug use, smoking history, higher log plasma HIV viral levels and a history of bacterial pneumonia were associated with a higher likelihood of reporting respiratory symptoms . There w1 was 99.1 percent of predicted. Mean FVC was 94.0 percent of predicted, and mean FEV1/FVC was 0.82. The prevalence of clinical obstruction as determined by the 5% lower limit of age-adjusted normal was 8.6% and by the FEV1/FVC below 0.70 was 6.8%. Of these subjects, 62.5% were classified as GOLD stage I, and 37.5% were GOLD stage II.Most subjects (93.2%) had normal spirometry. Mean FEV1 including age, gender, race/ethnicity, HIV risk factor, smoking or pack-year history, CD4 cell count or HIV viral level, use of HAART, or history of pneumonia. In contrast, several clinical characteristics were associated with a lower FEV1/FVC . Subjects who were current or former smokers had a lower FEV1/FVC than never smokers and FEV1/FVC decreased with increasing pack-year history (p<0.001). Subjects with a history of hepatitis C had a lower ratio than those who did not , as did those who reported a history of bacterial pneumonia . There was a trend for subjects receiving HAART to have a lower FEV1/FVC . Multivariate modeling demonstrated that older age (p = 0.04), pack-year history of smoking (p<0.001), and history of bacterial pneumonia (p = 0.007) were independent predictors of lower FEV1/FVC (1/FVC (p = 0.04). There were no significant interactions among variables in the model and no significant mediators or modifiers responsible for the effect of HAART. Sixteen subjects (8.2%) receiving HAART met clinical criteria for airway obstruction (FEV1/FVC<0.70), but none of the subjects not receiving HAART had clinical obstruction (p = 0.37). There were no relationships of FEV1/FVC to particular classes of antiretroviral therapy, although we were unable to assess nucleoside reverse transcriptase inhibitors (NRTI) separately from HAART as virtually all subjects receiving HAART were using an NRTI.No characteristics were significantly associated with FEVFEV1/FVC . The ratFEV1/FVC . Use of 1/FVC, and higher HIV viral levels. We found that a lower FEV1/FVC ratio is independently related to age, pack-year smoking history, and history of bacterial pneumonia. Interestingly, we also discovered an independent relationship of HAART use with lower FEV1/FVC.This study is the first to prospectively examine respiratory symptoms and directly measure spirometry in the HIV-infected population in the era of HAART. It is also the first study to report an association between HAART use and airway obstruction. Respiratory symptoms remain common in the current era and are associated with age, smoking history, lower FEV1/FVC values than those not reporting symptoms, suggesting that symptoms might be the result of airway obstruction. Combined, these studies argue for increased efforts at smoking cessation, substance abuse intervention, and routine influenza and pneumococcal vaccinations in an effort to decrease respiratory symptoms in HIV-infected patients.Previous studies documented a high prevalence of respiratory symptoms in the pre-HAART era 1/FVC in our cohort were generally consistent with pre-HAART risk factors and included age, smoking pack-year history, and prior bacterial pneumonia Many studies from the pre-HAART era demonstrated that HIV is associated with airway obstruction, emphysema, and decreased diffusing capacity for carbon monoxide 1/FVC after controlling for other independent risk factors such as age, cigarette smoking, intravenous drug use, and previous pneumonia. Although absolute differences in FEV1/FVC were small in subjects receiving HAART, these subjects were young and face a lifetime of antiretroviral treatment. Therefore, they may be at risk of developing clinically significant disease as they age.Most notably, we found that HAART use was associated with a decreased FEVAirway obstruction may be the latest in a series of chronic conditions linked to HAART. Prolonged HIV infection and HAART have been associated with cardiovascular disease, metabolic syndrome, osteoporosis, rheumatologic disorders, and thyroid disease HAART-associated cardiovascular disease, metabolic syndrome, and osteoporosis may be directly related to particular antiretroviral agents, particularly protease inhibitors HAART might also potentiate airway obstruction through indirect mechanisms such as aberrant immune restoration. IRIS is a well-documented side-effect of HAART initiation that occurs in response to known or occult pathogens Streptococcus pneumonia and Haemophilus influenzae, and viral pathogens such as adenovirus, have been implicated in COPD pathogenesis Pneumocystis jirovecii colonization has also been linked to COPD in the non-HIV-infected population and has been found using polymerase chain reaction in as many as 70 percent of HIV-infected individuals without acute Pneumocystis pneumonia In the non-HIV-infected population, the vicious circle hypothesis has been proposed as one mechanism leading to COPD Another possible explanation of the association of HAART and airway obstruction, which does not necessarily exclude a role for infections, is that an autoimmune response develops after initiating HAART. Organ-specific autoimmunity has been demonstrated as a complication of HAART and occurs later than infection-associated IRIS Autoimmunity, either in response to infectious agents or other triggers, has been linked to COPD in the non-HIV-infected population There are several limitations of our study. First, it was a cross-sectional observational study of HIV-infected individuals; thus limiting our ability to determine causation. Use of chart review for assessing certain clinical variables is also difficult. We were unable to assess effects of HAART on progression of airway obstruction or to determine effects of length of HAART use, HAART compliance, or nadir CD4 cell count, as this information was not reliably available. Use of plasma HIV viral levels as surrogate markers of adherence is also difficult, but HAART users did have lower HIV viral levels than those not receiving HAART, suggesting that at least some subjects were compliant with HAART. It also did not appear that length of HIV infection was associated with airway obstruction, but this information is difficult to obtain accurately. In addition, pulmonary testing was limited to pre-bronchodilator spirometry. Subjects with a history of asthma were excluded, but we cannot rule out the possibility that some subjects had asthma. Airway hyperresponsiveness was previously reported in HIV-infected subjects, although not at a significantly higher prevalence than in controls and it was more common in those with a self-reported history of asthma, a group excluded from our study As this study was performed at a single center, results may not be able to be generalized to all populations of HIV-infected patients. Subjects were from an urban area, and populations in different settings or different geographic locations might not be similar to the one reported here. Inclusion of relatively healthy subjects who attended an outpatient clinic may have also biased results in finding a lower prevalence of respiratory symptoms and pulmonary function deficits than would be found in a cohort with more advanced disease or in those who do not seek primary care.This study is the first prospective examination of airway obstruction and risk factors in HIV-infected persons during the HAART era. While most risk factors for airway obstruction were similar to those seen in the pre-HAART era, we found a novel, independent association of HAART and airway obstruction. Although the effect of HAART was small, the subjects in our study were young and the mild changes identified here could become clinically important over a lifetime of antiretroviral therapy. Future studies are needed to improve understanding of the relationship of HAART and pulmonary abnormalities, to determine progression of abnormalities over time, and to discover the mechanism of this association in order to provide treatment or prevention.

The dihedral angles between the two aromatic rings are 64.0 (1) and 66.5 (1)° in the two independent mol­ecules.The asymmetric unit of the title compound, C Å b = 8.7434 (7) Å c = 20.1446 (19) Å β = 118.444 (2)°V = 3121.0 (5) Å3 Z = 8 Kα radiationMo −1 μ = 0.24 mmT = 293 K 0.25 × 0.22 × 0.18 mm Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.942, T max = 0.958Absorption correction: multi-scan (22416 measured reflections5494 independent reflectionsI > 2σ(I)4266 reflections with R int = 0.034 R[F 2 > 2σ(F 2)] = 0.045 wR(F 2) = 0.127 S = 1.07 5494 reflections361 parametersH-atom parameters constrainedmax = 0.25 e Å−3 Δρmin = −0.34 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S160053681000125X/ci2995sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053681000125X/ci2995Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The coordinated regulation of cellular protein synthesis and degradation is essential for normal cellular functioning. The ubiquitin proteasome system mediates the intracellular protein degradation that is required for normal cellular homeostasis. The 26S proteasome is a multi-enzyme protease that degrades redundant proteins; conversely, inhibition of proteasomal degradation results in intracellular aggregation of unwanted proteins and cell death. This observation led to the development of proteasome inhibitors as therapeutics for use in cancer. The clinical applicability of targeting proteasomes is exemplified by the recent FDA approval of the first proteasome inhibitor, bortezomib, for the treatment of relapsed/refractory multiple myeloma. Although bortezomib represents a major advance in the treatment of this disease, it can be associated with toxicity and the development of drug resistance. Importantly, extensive preclinical studies suggest that combination therapies can both circumvent drug resistance and reduce toxicity. In addition, promising novel proteasome inhibitors, which are distinct from bortezomib, and exhibit equipotent anti-multiple myeloma activities, are undergoing clinical evaluation in order to improve patient outcome in multiple myeloma.).Republished from Current BioData's Targeted Proteins database (TPdb; Immunohistochemical analysis of human bone sections from mice treated with various drugs, such as bortezomib, lenalidomide or NPI-0052, can be performed to detect apoptosis , growth inhibition (Ki67) and angiogenesis (PECA1 [CD31] and FA8 [Factor VIII staining]). ELISA and human cytokine bead arrays are utilized for analyzing the effect of drugs on human cytokine secretion in mouse serum triggered by human MM-BMSC interactions. This model therefore permits the evaluation of the molecular and cellular changes induced by human MM-human stroma interactions in vivo, before and after therapy. We have used this model to validate novel targeted therapies such as CD-138-DM1 antibody [Although the human plasmacytoma xenograft model allows for direct assessment of therapy of tumor growth and associated angiogenesis, it does not reflect the bone marrow milieu. For these studies, we have utilized the SCID-hu mouse model developed in our laboratory . This moantibody and BAFFantibody . Our ong3L3VS, capable of monitoring proteasome activity in living cells [3L3VS has been proven to be useful for defining the differential activity profiles of the two proteasome inhibitors bortezomib and NPI0052 in MM cell lines [3L3VS for quantitatively and qualitatively monitoring proteasomal blockade in patients receiving proteasome inhibitor therapy [Validation of the proteasome as a target for antineoplastic therapy has led to the development of assays that not only quantify the bulk of the proteasomes in cells, but also qualitatively assess their function ,28. Giveng cells . DansylAll lines . It was ll lines . These e therapy .Preclinical studies provided the basis for the evaluation of bortezomib as a therapy in MM. A Phase I clinical trial on 27 patients with refractory hematologic malignancies showed anti-MM activity and acceptable toxicity, and in a Phase II trial enrolling 202 relapsed, refractory MM patients, one third of the patients achieved durable responses (with 4% complete responses) and associated clinical benefit. This provided the basis for accelerated FDA approval of bortezomib treatment for relapsed refractory MM ,67. Therin vitro studies suggest that proteasome inhibition by bortezomib triggers both various apoptotic signaling cascades and blocks growth/survival mechanisms in MM cells [Bortezomib-triggered apoptosis in MM cells is associated with inhibition of NFκB; however, whether NFκB blockade is an obligatory event remains unclear. To address this issue, we compared the effects of PS1145, a specific inhibitor of IKKB (IKK-B), with the effects of bortezomib on NFκB and consequent biological response (cell death) in MM cells. Both PS1145 and bortezomib block TNFA (TNF-α)-induced NFκB activation by inhibiting phosphorylation and degradation of IKKB. However, in contrast to bortezomib, PS1145 only partially inhibits MM cell growth . These fMM cells .+ MM cells with bortezomib and the novel agents lenalidomide or CDDO-Imidazolide induces synergistic anti-MM activity in vitro and overcomes resistance to bortezomib by targeting both intrinsic and extrinsic apoptotic signaling. This was evidenced by the disruption of mitochondrial potential and cleavage of CASP9 (caspase-9) and CASP8 (caspase-8) [in vitro studies provide the basis for clinical protocols combining these agents [+ MM cells, as measured by decreased cell viability in colorimetric assays (MTT assay) [Oncogenomics and proteomic studies in MM cells are identifying and validating key molecules, the pharmacological inhibition of which enhances the antitumor activity of bortezomib and could abrogate drug resistance . Firstlyspase-8) ,90. These agents . Fourth,T assay) .A recent randomized Phase III trial in 646 patients showed that treatment with pegylated doxorubicin and bortezomib achieved increased overall survival and extent of responses, as well as prolonged time to progression, compared with bortezomib alone. This provided the rationale for FDA approval of this combination for the treatment of relapsed MM ,93. FinaSalinospora, a marine gram-positive actinomycete [50 of < 10 nM in all cases. Importantly, NPI0052 similarly triggered apoptosis in purified tumor cells from several MM patients relapsing after prior therapies including bortezomib and thalidomide [In vivo efficacy of NPI0052 was shown using a human plasmacytoma xenograft mouse model. Specifically, NPI0052 inhibited MM tumor growth and prolonged survival of these mice at concentrations that were well tolerated, without weight loss or neurological changes [A recent study showed that a novel proteasome inhibitor, NPI0052 , is able to overcome bortezomib resistance in MM cells. NPI0052 is a small molecule derived from the fermentation of nomycete ,99,100. nomycete . Despitenomycete ,99-101. lidomide . In vivo changes ,55. Anot changes .Examination of signal transduction pathways in MM cells showed that: NPI0052 is a more potent inhibitor of NFκB and related cytokine transcription and secretion than bortezomib; NPI0052-induced MM cell death is predominantly mediated by CASP8 and bortezomib-induced apoptosis requires both CASP8 and CASP9 activation . MoreoveFinally, PR171 or carfilzomib is another novel proteasome inhibitor. PR171 -106 is aDelineation of the molecular and cellular mechanisms of bortezomib-induced apoptosis ,109 has BMSC: bone marrow stromal cell; C-L: caspase-like; CT-L: chymotrypsin-like; MM: multiple myeloma; T-L: trypsin-like; UPS: ubiquitin proteasome system.The authors declare that they have no competing interests.).Republished from Current BioData's Targeted Proteins database (TPdb;

Å b = 10.019 (2) Å c = 16.311 (3) Å V = 1729.8 (6) Å3 Z = 8 Kα radiationMo −1 μ = 0.10 mmT = 293 K 0.26 × 0.21 × 0.19 mm Bruker SMART CCD diffractometerAbsorption correction: none15411 measured reflections1984 independent reflectionsI > 2σ(I)1794 reflections with R int = 0.028 R[F 2 > 2σ(F 2)] = 0.046 wR(F 2) = 0.128 S = 1.08 1984 reflections118 parametersH-atom parameters constrainedmax = 0.24 e Å−3 Δρmin = −0.32 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809045024/hb5196sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809045024/hb5196Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: