Datasets:

evidence_infer_treatment

like 6

TITLE: The Effect of Education on Quality of Life in Patients under Interferon Therapy ABSTRACT.BACKGROUND AND AIMS: The main purpose of treating and caring for patients with chronic viral hepatitis is to promote life satisfaction and a feeling of well-being in patients suffering from this disease. The aim of this study was to evaluate the effect of education on quality of life in patients with chronic hepatitis who were treated with Interferon alpha. ABSTRACT.METHODS: This quasi-experimental study was conducted on 60 patients with viral hepatitis. The intervention included teaching them the method of self injection of Interferon alpha 2 b, giving them educational pamphlets and then following their continuing treatment with interferon. Patients were randomly assigned to two 30-patient groups. The data- gathering tool was a demographic characteristics questionnaire and the Quality of Life Questionnaire for Patients with Chronic Liver Disease (CLDQ). The educational program was done in four 45- minute sessions for the case group and their relatives. The follow-up period was 12 weeks. Quality of life in patients with chronic hepatitis was measured before initiating interferon therapy, and after the educational period. Quality of life in the two groups was compared. ABSTRACT.RESULTS: The total quality of life score in the two groups before therapy did not show any significant difference (P = 0.351); while 12 weeks after education there was a significant difference between the two groups (P < 0.001) in three items including abdominal symptoms (P = 0.01), worry (P < 0.001) and emotional factors (P < 0.001). The other three items did not show a significant difference between the two groups. The total quality of life score in the case group was significantly different before and after education (P < 0.001), and improved after education. The total quality of life score in the control group did not differ significantly after 12 weeks (P = 0.143). ABSTRACT.CONCLUSIONS: Planning short and simple educational programs has a significant effect on the patient's control of his/her disease and its side effects; and can improve quality of life, life satisfaction, and mechanisms of coping with treatment in patients with viral hepatitis. BODY.INTRODUCTION: The World Health Organization (WHO) has reported chronic liver disease to be responsible for 1.4 million deaths worldwide in 2002. Hepatitis C virus (HCV) stands as one of the most important etiologies of chronic liver disease and is an emerging infection in the world and in Iran [1]. It seems that less than 1% of Iranians are infected with HCV infection [2]. The control of HCV is possible and it needs to be eradicated with the best approved drugs [3]. Hepatitis B virus (HBV) infection is also an important health problem worldwide and about 1,400,000-2,000,000 patients suffer from it in Iran [4]. The main effective drugs in the treatment of HCV infection is alpha interferon plus ribavirin and alpha interferon is also one of the approved therapies in chronic hepatitis B [5][6]. Several studies have documented that impaired health-related quality of life (HRQoL) is associated with chronic hepatitis B and C [7][8]. Studies have shown that the progression of liver disease and ineffective antiviral therapies increasingly affect the quality of life, and the mental and physical well-being of patients [9]. The side effects of interferon therapy, including an influenza-like syndrome, affect the quality of life of patients as well [10]. The quality of life effects of treatment regimens also affect adherence to treatment regimens [11]. During therapy with alpha-2b interferon, patients should be closely monitored for side effects [10], so appropriate and timely supervision during treatment is necessary to limit these effects [11]. Frequently treatment causes fatigue, muscular pain, influenza-like symptoms, changes in the mental status and sexual desires of the patient, which will negatively affect the patient's life, social communication and abilities [12]. The importance of these side effects forms the basis of the physician's and the patient's decision-making regarding the continuation of the therapy, or of the cessation of the course of therapy before its completion. Termination of therapy before its completion shows the patient's intolerance [12]. Side effects of Interferon alpha begin a few hours after its administration and the patient develops tolerance in a few weeks with continuation of therapy [13]. Patient education and effective treatment are the cornerstones for enabling the patient to adhere to a therapeutic regimen. Monitoring the patient and dose adjustment during the treatment period is necessary [14]. At times lack of awareness about the route of application results in early termination of the treatment [12]; as a result, a study of the education of the patient in the proper method of the self- injection of interferon and the method of familiarizing him or her with the side effects and strategies of coping is essential and will lead to an improved quality of life. This study had been conducted for these reasons. Our primary goal was to study the effect of education on the quality of life of the patient suffering from chronic hepatitis B and C under treatment with Interferon alpha. BODY.MATERIALS AND METHODS: This is a quasi-experimental study in a pretest-posttest method conducted at Tehran Hepatitis Center- Baqiyatallah Research Center for Gastroenterology and Liver Diseases. Sampling was nonrandomized and based on sample characteristics (age 18-60 yrs, absence of other infections and chronic diseases, first time treatment for Interferon alpha therapy and absence of cirrhosis). Sixty patients were randomly assigned to the two 30-patient groups of cases and controls. Following referral to Tehran Hepatitis Center, patients fulfilling our selection criteria and willing to participate in the study were assigned to the case and control groups one after the other. The Quality of Life Questionnaire for Patients with Chronic Liver Disease (CLDQ) and the demographic information of the patients were filled out anonymously and codes were used with the help of the researcher. The CLDQ is the first tool to assess quality of life in chronic liver disease patients reasonably adjusted to include fatigue, activity, emotional symptoms, abdominal symptoms, systemic symptoms and worry. The scores are graded from 1 to 7 for each category making the minimum possible scores 29 and the maximum 203. The validity and reproducibility of this questionnaire had been previously studied in Iran [15][16]. The eliability of the CLDQ was measured by internal consistency using Cronbach's alpha test with a reported consistency of over 95%. Cases were asked to write down their free time on the back of the questionnaire to set up times for their education classes. These classes were held once a week and in each class educational pamphlets were distributed among the cases. Follow-up of the patients was done as self-reporting with in-person attendance every month. Each educational session had a maximum of 6 patients and 6 accompanying persons. These accompanying persons had a supportive care role. The sequence of the classes was as follows: In the first session, the goals of our study, the nature of their disease, transmission routes, the diagnosis and treatment of their disease were explained and pamphlets were distributed to the patients. In the second session, the effect of interferon therapy on their disease, the frequent side effects after injection, methods of protecting themselves and controlling these side effects were explained and pamphlets were distributed. In the third session, the method of the self-injection of interferon was explained and the patients' questions were answered. A pamphlet was also given out. In the fourth session, the injection of interferon by the patient was observed and their problems, if any, were corrected. Educational sessions were held for a month and patients were followed for 12 weeks. At the time of entering the study and 12 months after initiation of therapy, patients were asked to fill the quality of life questionnaire in both groups (case and control). The results were analyzed by SPSS (Version 13) using chi-square, Fisher's exact,Mann-Whitney and Wilcoxon tests. For ethical issues, after the study, the educational pamphlets were also distributed to the control group and the correct method of injection of interferon was also taught to them. BODY.RESULTS: The demographics data of the patients is shown and compared in Table 1. As is shown, no significant difference was observed between the two groups in this regard. Table 1 Demographic information of our studied population Control Group Case Group P-value Statistical Test Age 37.2 ± 9.5 40.3 ± 14.9 0.33 t- test Sex (Percent) 0.381 chi-square Male 24 (80%) 22 (73.3%) Female 6 (20%) 8 (26.7%) Level of Education fisher's exact Illiterate 0 3 (10%) 0.19 Primary and Guidance School 15 (50%) 16 (53.3%) Diploma and Higher 15 (15%) 11 (36.7%) Marital Status chi-square Single 15 (50%) 13 (43.3%) 0.398 Married 15 (50%) 17 (56.6%) Number of Children chi-square 3 or less 28 (93.3%) 23 (76.7%) 0.145 More tdan 3 2 (6.7%) 7 (23.3%) Occupation fisher's exact Worker 7 (23.3%) 4 (13.3%) 0.076 Employee 4 (13.3%) 6 (20%) Housekeeper 4 (13.3%) 4 (13.3%) Student 0 6 (20%) Retired 15 (50%) 10 (33.3%) Duration of Disease chi-square 1-3 yr 22 (73.3%) 21 (70%) 1 3-6 yr 4 (13.3%) 5 (16.7%) More tdan 6 yr 4 (13.3%) 4 (13.3%) Hospitalization fisher's exact None 28 (93.3%) 30 (100%) 0.492 Once 2 (6.72%) 0 Hepatitis Type chi-square Hepatitis C 20 (66.7%) 24 (80%) 0.243 Hepatitis B 10 (33.3%) 6 (20%) The Quality of Life Questionnaire for Chronic Liver Disease included 6 items: fatigue, activity, emotional symptoms, abdominal symptoms, systemic symptoms and worry, which were separately analyzed in the two groups before and after our intervention.Quality of life scores before and after intervention within groups has been shown in Table 2. Quality of life scores before and after intervention between the two groups has been shown in Table 3. Table 2 Quality of Life scores before and after 12 weeks within groups   Control Wilcoxon Test Case Wilcoxon Test     Before After Before After Scores Min-Max Mean SD Mean SD P Mean SD Mean SD P Abdominal Symptoms 3-21 15.9 5.3 15.9 5.6 0.48 17.7 3.1 19.5 3.2 0.00 Activity 3-21 19.8 1.9 18.7 2.7 0.01 20 1.9 18 3.6 <0.001 Fatigue 5-35 23.4 8 23 7.2 0.68 26.3 6.3 26 6.9 0.08 Systemic Symptoms 5-35 28.5 5.2 26.4 6.6 0.03 29.9 4.1 29.1 5.1 0.29 Emotional 8-56 33.3 9.9 33 9.2 0.03 40.1 9.2 46.5 10.6 <0.001 Worry 5-35 22.3 6.8 21.9 7.4 0.21 24.1 5.3 30.2 6.3 <0.001 Total Score 29-203 154.5 28.5 136.9 30.6   158.6 21.4 170 23.6   Table 3 Quality of Life scores before and after 12 weeks between two groups     Before Intervention Mann- Whitney Test After Intervention Mann- Whitney Test     Control Case Control Case Scores Min-Max Mean SD Mean SD P Mean SD Mean SD P Abdominal Symptoms 3-21 15.9 5.3 17.7 3.1 0.43 15.9 5.6 19.5 3.2 0.94 Activity 3-21 19.8 1.9 20 1.9 0.8 18.7 2.7 18 3.6 0.08 Fatigue 5-35 23.4 8 26.3 6.3 0.26 23 7.2 26 6.9 0.84 Systemic Symptoms 5-35 28.5 5.2 29.9 4.1 0.35 26.4 6.6 29.1 5.1 0.04 Emotional 8-56 33.3 9.9 40.1 9.2 0.006 33 9.2 46.5 10.6 0.8 Worry 5-35 22.3 6.8 24.1 5.3 0.06 21.9 7.4 30.2 6.3 0.64 Total Score 29-203 154.5 28.5 158.6 21.4   136.9 30.6 170 23.6   The systemic symptoms of the control group were significantly reduced after 12 weeks (P = 0.04) but other aspects including abdominal symptoms (P = 0.94), fatigue (P = 0.84), activity (P = 0.08), worry (P = 0.64) and emotional symptoms (P = 0.8) did not show a significant change after 12 weeks, in the control group. In the case group there was a significant decrease in abdominal symptoms (P < 0.001), activity (P < 0.001), worry (P < 0.001) and emotional symptoms (P < 0.001) after our intervention but no significant change was observed in systemic symptoms and fatigue in this group. Using the Mann-Whitney test, we found a difference in three aspects between the cases and the controls after our intervention including abdominal symptoms (P = 0.01), worry (P < 0.001) and emotional symptoms(P < 0.001). The other aspects did not show any significant difference between the two groups. The minimum quality of life score was 29 in this study and the maximum was 203. The mean quality of life scores in our controls was 154.5 before the study and 136.9 after 12 weeks but the Wilcoxon test did not show significant change between the two (P = 0.143). In our cases, a quality of life score of 158.6 before intervention had increased to 170 after 12 weeks, which was found to be significant using the Wilcoxon test (P < 0.001). Our data show that before treatment there had not been a significant difference between the two groups in quality of life scores (P = 0.351) but after intervention this difference becomes significant (P < 0.001). BODY.DISCUSSION: In this study the mean quality of life score in our controls was decreased after 3 months from 154 to 137 which had been shown in other studies. In 2005, a study of different antiviral treatments on patients with hepatitis C by Kang and his colleagues showed that all treatment regimens had reduced the quality of life of patients in the primary stages of treatment and side effects had reduced their compliance and adherence to treatment; whereas providing information to the patients about their treatment and its side effects will increase their tolerance, compliance and adherence to antiviral therapy [17]. In our cases, the mean quality of life score increased to 170 from its original 158 after three months. This increase is in accordance with previous studies on patients with liver disease in Tehran and Shiraz [16][18]. Certain aspects in our control group did not show an increase after 12 months while the systemic symptoms showed a decrease during follow up. Previous studies show that the quality of life of the patient under antiviral treatment decreases in 12-24 weeks after initiation of therapy and will eventually return to its baseline measurement after 24 weeks [12]. Fatigue is a frequent side effect of hepatitis treatment and may result in early termination of antiviral therapy [12]. In our cases, there was an increase in the scores of abdominal symptoms, worry and emotional symptoms after 12 weeks. In our study, the quality of life score in our cases showed a significant increase after 12 weeks compared to the controls. It seems that using simple measures against side effects like adequate hydration, light-to- moderate physical activity, scheduling the treatments for times when patients have less work or on weekends, using sedatives, antipyretics and similar measures will greatly help the control of side effects which will consequently increase the satisfaction and quality of life of patients and ultimately result in tolerance of the treatment [19]. One of the drawbacks of this study is the limited number of the population studied, which should be kept in mind in drawing a final conclusion. Another point to be considered is the different treatment regimens in hepatitis B and C (Interferon alpha and Ribavirin in hepatitis C and Interferon alpha in hepatitis B) which was a factor not taken into account in this study. The effect of different treatment regimens on hepatitis B and C could be the subject of a separate study. Emotional symptoms were different before intervention in the case and control groups, but a significant increase in the quality of life score could justify a faster and greater increase in the emotional aspect. BODY.CONCLUSIONS: This study showed that continuous education and follow up in chronic hepatitis B and C patients under Interferon alpha treatment could greatly increase their adherence to interferon treatment and decrease the side effects, ultimately resulting in a better quality of life.

TITLE: Aloe Vera Gel and Cesarean Wound Healing; A Randomized Controlled Clinical Trial ABSTRACT.BACKGROUND:: Failure in complete healing of the wound is one of the probable complications of cesarean. The present study aimed to determine the effectiveness of dressing with aloe vera gel in healing of cesarean wound. ABSTRACT.METHODS:: This prospective randomized double-blind clinical trial was conducted on 90 women who had undergone cesarean operation in Amir-al-Momenin hospital (Gerash, Iran). The participants were randomly divided into two groups each containing 45 patients. In one group, the wound was dressed with aloe vera gel, while simple dressing was used in the control group. Wound healing was assessed 24 hours and 8 days after the cesarean operation using REEDA scale. The data were analyzed through Chi-square and t-test. ABSTRACT.RESULTS:: The participants' mean age was 27.56±4.20 in the aloe vera group and 26.62±4.88 in the control group, but the difference was not statistically significant. However, a significant difference was found between the two groups concerning body mass index, heart rate, and systolic blood pressure (P<0.05). Also, a significant difference was observed between the two groups with respect to the wound healing score 24 hours after the operation (P=0.003). After 8 days, however, the difference in the wound healing score was not significant (P=0.283). Overall, 45 participants in the aloe vera group and 35 ones in the control group had obtained a zero score 24 hours after the operation. These measures were respectively obtained as 42 and 41eight days after the operation. ABSTRACT.CONCLUSION:: According to the findings of this study, the women are recommended to be informed regarding the positive effects of dressing with aloe vera gel. BODY.1. INTRODUCTION: The rate of cesarean section has increased in Iran and many other countries in the recent years (Ghaffari et al., 2011). This, in turn, has resulted in a rise in the complications and difficulties caused by the operation (Pallasmaa et al., 2010). Infection of the wound, hematoma, serosa, and wound opening are among the most common complications of cesarean section, resulting in hospitalization of the mother, her repeated referral to doctor for wound drainage and debridement, treatment of the wound for the second time, and a great economic burden imposed on the family (Pallasmaa et al., 2010; Samadi et al., 2010). Hence, wound healing is the main objective after surgical operations or traumatic injuries. Healing of the wound consists of coordinated mending responses that begin after the surgical operations or traumas and leads to reconstruction of the tissue. These responses are closely related to treatments before and after the operations and traumas. Healing process takes place in all wounds gradually. This process includes three phases, namely inflammatory phase, proliferative phase, and maturation phase (Campos, Groth, & Branco, 2008). However, several factors postpone the healing of the wound, including twin delivery, fever, prolonged rupture of the fetal membrane, history of chronic systemic diseases, preeclampsia, obesity, consumption of immunosuppressive drugs, failure in observing sterile precautions before and during the operation, not using prophylactic antibiotics, surgical operation beyond 90 minutes, operation technique, poor homeostasis, type of thread used in subcutaneous repair, and malnutrition (De Vivo et al., 2010; Schneid-Kofman, Sheiner, Levy, & Holcberg, 2005). Sufficient treatment after the operation is effective in healing of the wound. Due to the high costs of chemical treatments and insufficient effects of medications, a tendency to use traditional medicine in healing and prevention of infections has been on the rise. One of the methods used for treatment of wounds is using aloe vera gel. Aloe vera (Note 1) is a medical plant from the lily family which has attracted the attention of medical scholars in the recent years. This plant is known as a therapeutic plant and has been used for medical purposes for a long time (Sahu et al., 2013). Different parts of this plant have different applications. The thick and transparent gel of the plant, which is stored inside the leaves, is used for treatment of different kinds of wounds. In addition, the yellowish bitter sap on the surface of the leaves has laxative properties and contains antrakoin compounds. Up to now, several studies have been conducted on the healing effects of aloe vera plant (Sahu et al., 2013). In one study which was conducted on the wound and inflammation of the mucous membrane of the mouth, aloe vera mouthwash was effective in healing of the wound and reducing the inflammation compared to the control group (Mansour, Ouda, Shaker, & Abdallah, 2013). Moreover, this plant's gel has been reported to be effective in healing of the first and second degree burning wounds without any side effects (Maenthaisong, Chaiyakunapruk, Niruntraporn, & Kongkaew, 2007). Besides, its topical application has been recommended for accelerating the healing process of dermic injuries, such as burns, wounds, frostbites, inflammations, and cutaneous infections (Joseph & Raj, 2010). Overall, it can be concluded that aloe vera gel is an appropriate and economical dressing for a variety of wounds. Nonetheless, contradictory results have been obtained regardingthe effectiveness of this plant. For instance, one study reported delay in healing of the wounds after application of this plant (Schmidt & Greenspoon, 1991). Up to now, no clinical trials have been performed on the effects of aloe vera gel on cesarean wound healing in Iran. Moreover, considering the high rate of cesarean section in Iran and its resultant complications, there is an evident need to study the effects of aloe vera gel on healing of cesarean wound. BODY.2. MATERIALS AND METHODS.2.1 STUDY DESIGN AND POPULATION: This prospective randomized double-blind clinical trial aimed to assess the effect of aloe vera gel on cesarean wound healing between 23 July and 22 November 2013. The study mothers were18-36 years old with term pregnancy duration of 37–42 weeks. Considering α=0.05 and power=80%, a 90-subject sample size was determined for the study (45 subjects in each group). The participants were divided into an aloe vera and a control group through block randomization. They underwent cesarean section by the same gynecology surgeon in Amir-al-Momenin Hospital in Gerash, Fars province, Iran. The inclusion criteria of the study were term pregnancy (37–42 weeks), Body Mass Index (BMI)>29, not having the history of more than two cesarean sections, and being willing to participate in the study. On the other hand, the exclusion criteria of the study were suffering from placenta previa, placental abruption, chorioamnit, meconium discharge, and polyhydramnios, having a history of any disease that could affect wound healing, having abnormal fetus, hospitalization of the fetus in Neonatal Intensive Care Unit (NICU), severe bleeding and need for transfusion, having undergone hysterectomy or myomectomy during the operation, having the history of smoking cigarettes or drug abuse, having membranes rupture before the operation, prolongation of the operation for more than 90 minutes, and not referring to the hospital 8 days after the operation. BODY.2. MATERIALS AND METHODS.2.2 ETHICS: At first, the participants were provided with enough information about the study procedure and objectives, benefits, nature, and duration of the study. They also signed written informed consents after being ascertained about the confidentiality of their information. They were also ensured that they could withdraw from the study whenever they desired. A demographic information form was used to acquire the mothers' information, including their age, occupation, gestational age, number of pregnancies, neonate's sex, duration of operation, duration of Nil Per Os (NPO) before the operation, height, weight, BMI, blood pressure, heart rate, temperature, and the method of anesthesia. Additionally, the wound healing condition was assessed by the REEDA scale whose reliability and validity have been confirmed previously (Hill, 1990). REEDA scale is an instrument containing five factors, namely redness, edema, ecchymosis, discharge, and approximation of the two edges of the wound. Each of these factors is given a score between 0 and 3 representing no sign and presence of the sign to the highest degree, respectively. Thus, the total score of the scale ranges from 0 to 15, with higher scores showing weaker wound healing. In order to assess the reliability of the scale, wound healing was checked two times, first by the researcher and then by agynecologist, using the REEDA scale. Afterwards, the findings were compared and their consistency was verified (r=0.79). The participants were visited by the researcher in the hospital before the operation. After obtaining the written informed consents and collecting the demographic data, the participating patients were introduced to the gynecologist. Then, the gynecologist was provided with the table of random numbers (obtained through block randomization) to divide the patients in an aloe vera gel and a control group. It should be noted that the researcher and the patients were unaware of the type of intervention. Cesarean section was performed successfully on all the participants, with a pfannenstiel skin incision and low transverse cesarean incision in the uterus. In all the cases, a plastic suture with nylon thread No. 3.0 was used for skin repair. BODY.2. MATERIALS AND METHODS.2.3 INTERVENTION: Aloe vera gel was used for the intervention group. In doing so, after washing the aloe vera leaves with antiseptic solution, the leaves were cut and their epidermis was removed using gloves and a sterile knife. Then, the mucilage gel inside the leaves was taken out by the surgeon using sterile gloves, was directly applied to the sutured cesarean wound, and was then dressed with dry gauze. In the control group, on the other hand, dressing of the sutured wounds was done using dry gauze alone. Twenty four hours after the operation, the dressing was removed by the nurses and wound healing was assessed by the researcher using the REEDA scale. The participants were asked to refer to the hospital 8 days later for another examination. On the 8th day, wound healing was assessed and recorded once again using the REEDA scale. Then, the stiches were removed. A diclofenac suppository was prescribed for all the mothers after their transfer from the operation room. They received 1 gr intravenous cefazolin every 6 hours on the first day after the operation and they were discharged from the hospital 24 hours after the operation. In addition, 500 mg cephalexin capsules were prescribed for every 6 hours in the first 7 days, and 250 mg mefenamic acid capsules were prescribed for every 8 hours in the first 3 days. All the mothers breastfed their neonates immediately after birth and transference to the surgery ward. Bleeding from the surgical site was not detected in any of the participants. Also, none of the subjects had abnormal vaginal bleeding. All the participants were instructed how to take care of themselves after the operation, including protection of the abdominal wall and the stitches during coughing, taking a bath, prevention of stretching of the stiches during movement, avoiding flatulent food, consumption of liquids and laxative food to prevent constipation, daily consumption of dairy products, fruits, vegetables, and meat, and timely intake of the prescribed medicine. BODY.2. MATERIALS AND METHODS.2.4 STATISTICAL ANALYSIS: All the study data were analyzed using the SPSS statistical software (version 19). Chi-square test and independent T-test were used in order to compare the distribution of the qualitative and quantitative demographic variables, respectively. Independent T-test was also used to compare the REEDA scores. BODY.3. RESULTS: After the screening phase, 146 women were assessed for eligibility. Out of these women, 97 met the inclusion criteria and were randomly divided into an aloe vera and a control group. However, 7 women were lost to follow up. After all, 90 participants were enrolled into the study (45 in the aloe vera group and 45 in the control group). The two groups' demographic characteristics have been presented in Tables 1 and 2. Accordingly, the two groups were homogeneous with respect to age, education level, gestational age, parity, history of abortion, neonate's sex, method of anesthesia, duration of NPO, operation time, height, weight, diastolic blood pressure, and temperature before and after the operation (P>0.05). However, a significant difference was observed between the two groups regarding BMI, heart rate, and systolic blood pressure (P<0.05). Table 1 Comparison of the means of demographic variables in aloe vera and control groups Characteristics Aloe vera mean (SD) Control mean (SD) P-value Age 27.56±4.20 26.62±4.88 0.333 Gestational age 38.69±1.10 38.73±1.12 0.850 NPO time 8.04±1.36 7.96±1.92 0.801 Operation time 39.16±4.36 39.44±4.47 0.757 BMI 30.24±1.25 30.80±1.35 0.043* Systolic blood pressure immediately after the operation (mmhg) 112±10.71 117±11.45 0.025* Diastolic blood pressure immediately after the operation (mmhg) 75.57±6.65 77.69±6.22 0.123 HR 81.91±11.44 76.78±11.51 0.037* Temperature before the operation (Celsius) 37.06±0.28 37.05±0.25 0.905 Temperature immediately after the operation (Celsius) 37.08±0.26 37.08±0.38 0.961 Note: Significant at α=0.05. Table 2 Comparison of distribution of qualitative demographic variables in aloe vera and control groups Aloe vera N (%) Control N (%) P-value Education (Diploma and higher degrees) 31(68.9) 29(64.4) 0.404 Primary gravid 19(42.2) 24(55.8) 0.112 Abortion history 4(7.9) 6(13.3) 0.506 General anesthesia 39(86.7) 35(77.8) 0.270 Neonate’s sex (male) 22(48.9) 27(60) 0.290 Note: Significant at α=0.05. The score of cesarean wound healing based on the REEDA scale was 0.00±0.00 in the aloe vera group and 0.6±1.3 in the control group 24 hours after the operation, and the difference was statistically significant (P=0.003). After 8 days, the REEDA score was 0.11±0.49 in the aloe vera group and 0.29±0.99 in the control group, but the difference was not statistically significant (P=0.283). Twenty four hours after the operation, 45 participants in the aloe vera group and 35 ones in the control group had a zero REEDA score (P=0.001). These measures were respectively obtained as 42 and 41 eight days after the operation (P=0.694) (Tables 3 and 4). It should be noted that none of the intervention group participants presented any specific complications. Table 3 Comparison of the mean scores of cesarean wound healing in aloe vera and control groups Aloe vera Mean (SD) Control Mean (SD) P-value REEDA scale 24h post caesarean 0.00±0.00 0.60±1.30 0.003* REEDA scale 8 days post caesarean 0.11±0.49 0.29±0.99 0.283 Note: Significant at α=0.05. Table 4 Comparison of the number (%) of participants with zero cesarean wound healing scores in aloe vera and control groups Aloe vera N (%) Control N (%) P-value 0 REEDA score 24h post caesarean 45(100) 35(77.80) 0.001* 0 REEDA score 8 days post caesarean 42(93.33) 41(91.11) 0.694 Note: Significant at α=0.05. BODY.4. DISCUSSION: The findings of this study indicated that aloe vera gel was effective in cesarean wound healing 24 hours post cesarean. The results revealed a significant difference between aloe vera and control groups regarding REEDA score after 24 hours; however, no such difference was observed after 8 days. Of course, the intervention group's REEDA score was lower compared to the control group on the 8th day. Since the intervention was only performed for 24 hours, longer application of the gel might lead to more desirable results. Up to now, a large number of studies have been conducted on aloe vera gel as an ameliorative and wound healer, confirming the results of this study. However, none of these studies has investigated the effect of this gel on abdominal surgery wound healing using the REEDA scale (Maenthaisong et al., 2007; Mansour et al., 2013). Aloe vera gel is a mucilage in the inner part of the leaves and has attracted the attention of many researchers because of its different properties, such as anti-inflammatory, antioxidant, antiseptic, anti-microbial, anti-fungal, and anti-bacterial features, as well as its effect on improvement of the immune system (Habeeb et al., 2007; Khan, Tania, Zhang, & Chen, 2010; Sahu et al., 2013). In most of the previous studies, aloe vera gel was used in form of a processed product, such as cream or gel (Dat, Poon, Pham, & Doust, 2012; Eshghi et al., 2010). In this study, however, the fresh natural gel was used for the first time in order to preserve its effective substances. Some researchers have stated that some of the effective substances of aloe vera gel are wasted in the process of preparation and conservation (Sahu et al., 2013; Yeh, Eisenberg, Kaptchuk, & Phillips, 2003). In a study with a small sample size (19 patients), application of aloe vera gel was recommended due to its low cost and lack of any specific side-effects (Boroujeni et al., 2009). However, in the study Schmidt and Greenspoon (1991) conducted on the infected and unhealed wounds of cesarean section and gynecological abdominal surgery, aloe vera caused a delay in healing of the wounds (Schmidt & Greenspoon, 1991). This can be due to difference in the study design or the patients' wounds. They also used a different scale for assessment of wound healing. Furthermore, Oliveira, Soares, and Rocha (2010) applied aloe vera on ischemic wounds, and Shahzad and Ahmed (2013) used it on burn wounds (Oliveira, Soares, & Rocha, 2010; Shahzad & Ahmed, 2013). In both cases, the gel was effective in wound healing, which is consistent with the results of the present study. In this study, the researchers did their best to eliminate the factors that might affect wound healing. They also employed a large sample size in order to come to reliable results. Moreover, wound healing was assessed by a different individual from the interventionist (intervention was done by a gynecologist, while assessment was performed by the researcher), so that the study was blinded. Cleanness of the wounds and quick absorption of the gel via skin made it possible for the aloe vera gel to have the highest efficiency in wound healing. However, it was not possible to take a biopsy of the wound and make a closer examination of the condition of wound healing. Also, it was not possible to fully control the patients' nutrition at home, their sanitation, and their amount of movement which could affect wound healing. Yet, the researchers made their attempt to compensate for these limitations by random selection of the samples as well as by identically training the patients. BODY.5. CONCLUSION: The present study showed that aloe vera gel was effective in cesarean wound healing. According to the findings of this study, dermal application of aloe vera gel did not have any side effects and it could consequently be used as an adjunctive treatment to the standard treatments of cesarean wound. Nonetheless, longer duration of the intervention might lead to a significant difference in the process of wound healing. Therefore, further studies with longer intervention periods are recommended to be conducted on the issue.

TITLE: Comparative evaluation of single application of 2% whole turmeric gel versus 1% chlorhexidine gel in chronic periodontitis patients: A pilot study ABSTRACT.AIM:: To evaluate and compare the clinical effects of topical subgingival application of 2% whole turmeric gel and 1% chlorhexidine gel as an adjunct to scaling and root planing (SRP) in patients suffering from chronic periodontitis. ABSTRACT.MATERIALS AND METHODS:: Fifteen patients with localized or generalized chronic periodontitis with a pocket depth of 5-7 mm were selected. In each patient, on completion of SRP, three non-adjacent sites in three different quadrants were randomly divided into three different groups, that is, Group I: Those receiving 2% turmeric gel, Group II: Those receiving 1% chlorhexidine gel (Hexigel), and Group III: SRP alone (control site). Plaque index, gingival index, probing depth, and clinical attachment levels were determined at baseline, 30 days, and 45 days. ABSTRACT.RESULTS:: Group II as a local drug system was better than Group III. Group I showed comparable improvement in all the clinical parameters as Group II. ABSTRACT.CONCLUSIONS:: The experimental local drug delivery system containing 2% whole turmeric gel helped in reduction of probing depth and gain of clinical attachment levels. BODY.INTRODUCTION: Periodontitis is one of the most prevalent chronic diseases in the world, with the primary etiological agent being pathogenic bacteria that reside in the subgingival area.[1] Conventional periodontal therapy consists of mechanical debridement to disrupt the subgingival microbiota. However, comprehensive mechanical debridement of sites with deep periodontal pockets is difficult to accomplish. This has led to the adjunctive use of antimicrobial agents delivered either systemically or locally. As the systemic use of antimicrobial agents may cause several side effects like hypersensitivity, resistant strains, and superinfections, their local administration has received considerable attention.[2] Local drug delivery systems allow the therapeutic agents to be targeted to the disease site. Thus, the dose can be minimized, reducing the systemic absorption and subsequent risk of adverse side effects. Higher concentration of a therapeutic agent can be attained in subgingival sites by local drug delivery compared with a systemic drug regimen. For subgingival application, various antimicrobial agents have been tried, including tetracycline, metronidazole, and chlorhexidine, either on their own or in combination with scaling and root planing (SRP). Chlorhexidine is a highly effective antimicrobial agent that is extensively studied and shown to be effective as a mouthrinse[3] and also as a subgingival irrigant. It shows broad spectrum of topical antimicrobial activity, substantivity, effectiveness, safety, and lack of toxicity.[4] Chlorhexidine is one of the most effective topical agents, which has long been used as an effective antimicrobial agent.[5] The first sustained release dosage form of chlorhexidine diacetate for topical use was developed by Friedman and Golomb,[6] which had shown effectiveness in reducing the periodontal probing depth, clinical attachment loss, and bleeding on probing. India has a rich history of using plants for medicinal purposes. Turmeric (haldi), a rhizome of Curcuma longa, is a common antiseptic used in traditional system of Indian medicine. Curcumin (diferuloylmethane), the main yellow bioactive component of turmeric, has been shown to have a wide spectrum of biological actions.[7] Literature reports have shown that curcumin has anti-inflammatory and antibacterial activities, suggesting its potential to be used as a subgingival agent.[27] Safety evaluation studies have indicated that both turmeric and curcumin are well tolerated at a very high dose without any toxic effects.[7] Also, it is more acceptable, inexpensive, and a viable option for common man. Thus, the present investigations evaluated and compared the efficacy of two local drug delivery systems containing 2% whole turmeric gel and 1% chlorhexidine (Hexigel) in patients with chronic periodontitis. BODY.INTRODUCTION.AIM AND OBJECTIVE: To evaluate and compare the clinical effects of topical subgingival application of 2% whole turmeric gel and 1% chlorhexidine gel as an adjunct to SRP in patients suffering from chronic periodontitis. BODY.MATERIALS AND METHODS: Fifteen patients (12 males and 3 females, aged 21-55 years) suffering from localized or generalized chronic periodontitis[8] were selected from amongst those visiting the outpatient Department of Periodontology and Oral Implantology, National Dental College and Hospital, Derabassi (Punjab). BODY.MATERIALS AND METHODS.SUBJECT SELECTION.INCLUSION CRITERIA: Patients with a pocket depth of 5-7 mm in at least three non-adjacent sites in different quadrants of the mouthSystemically healthy patientsCooperative patients who could be motivated for further oral hygiene instructionsPatients with more than or equal to 20 teethPatients who consented to participate in the study. BODY.MATERIALS AND METHODS.SUBJECT SELECTION.EXCLUSION CRITERIA: Patients on antibiotic therapy from the past 1 monthPregnant or lactating womenPatients smoking tobaccoPatients giving a history of allergy to chlorhexidine. BODY.MATERIALS AND METHODS.MATERIALS: 2% Whole turmeric gelPreparationThe gel was prepared in the Department of Pharmacology, National Dental College, Derabassi. The composition of the gel was 2% turmeric extract, 20% (approx.) pluronic polymer, and water q.s. Pluronic polymer was triturated till an emulsion-like consistency was obtained. To this, turmeric extract was added gradually and triturated well. The mixture was then heated and the gel was thereafter procured. The preparation was then refrigerated and delivered into the selected sites.Gel containing 1% chlorhexidine (Hexigel). BODY.MATERIALS AND METHODS.CLINICAL PARAMETERS: The following clinical parameters were recorded: Plaque scores using Plaque Index (PI; Silness and Loe, 1964)Gingivitis using Gingival Index (GI; Loe and Silness, 1963)Probing depth: Measured by UNC-15 probeClinical attachment level: Determined by measuring the distance between base of the pocket and the cemento-enamel junction. BODY.MATERIALS AND METHODS.METHODS: History was recorded for the selected patients. All the clinical parameters were recorded at the baseline which was followed by SRP. In each patient, on the completion of SRP, selected sites with probing depths between 5 and 7 mm were randomly divided into three groups, each in different quadrant: Group I: Those receiving 2% turmeric gelGroup II: Those receiving 1% chlorhexidine gel (Hexigel)Group III: SRP alone (control site). Both the turmeric gel and chlorhexidine gel were delivered into the selected sites in Group I and Group II, respectively, using a syringe with a needle attached to it. Then these sites including the control site (Group III) were covered with periodontal pack (COE Pack). The patients were instructed to continue with the regular oral hygiene measures and were also informed about symptoms like feeling of pressure, pain, or irritation in the area. They were asked to report to the department if any of the above symptoms developed. All the subjects were recalled after 7 days for pack removal and evaluation for any clinical sign of inflammatory response. They were then recalled after 30 days and 45 days of placement of the local drug to record the clinical parameters. Data so collected were put to statistical analysis to draw conclusions. BODY.MATERIALS AND METHODS.STATISTICAL ANALYSIS: The statistical analysis was carried out using Statistical Package for Social Sciences version 15.0 (SPSS Inc., Chicago, IL, USA). Intragroup comparisons between different time intervals in various clinical parameters were analyzed by paired t-test. Intergroup comparisons between the three groups were analyzed by Mann–Whitney test. BODY.RESULTS: A total of 45 sites in 15 patients were treated. In each patient, on completion of SRP, three selected sites with probing depths between 5 and 7 mm were randomly divided into three groups, each in different quadrant, as follows: Group I- Those receiving 2% turmeric gel, Group II- Those receiving Hexigel, and Group III: SRP alone (control site). BODY.RESULTS.PLAQUE INDEX: The mean PI scores at baseline, 30 days, and 45 days were observed to be 1.716 ± 0.351, 1.066 ± 0.175, and 0.683 ± 0.274, respectively, for Group I, 1.700 ± 0.380, 1.00 ± 0.00, and 0.683 ± 0.274, respectively, for Group II, and 1.866 ± 0.159, 0.478 ± 1.00, and 1.233 ± 0.416, respectively, for Group III [Table 1]. Table 1 Comparative analysis of clinical parameters at different time intervals In Group I, the mean PI scores at 30 days and 45 days from baseline were found to be statistically nonsignificant (P = 0.234 and P = 0.686, respectively). In Group II, a statistically nonsignificant difference was observed in the mean PI scores at 45 days from baseline (P = 0.201). However, this difference from baseline was statistically significant at 30 days (P = 0.050) and nonsignificant at 45 days (P = 0.180) in Group III Table 1. At 45 days from baseline, the mean reduction in PI score was statistically nonsignificant when Groups I and II were compared (P = 1.00). However, this reduction was observed to be statistically significant when Groups I and III (P = 0.026) and Groups II and III were compared (P = 0.035) [Table 2]. Table 2 Intergroup analysis of clinical parameters at different time intervals BODY.RESULTS.GINGIVAL INDEX: The mean GI scores at baseline, 30 days, and 45 days were observed to be 2.450 ± 0.536, 1.566 ± 0.495, and 1.016 ± 0.467, respectively, for Group I, 2.233 ± 0.486, 1.266 ± 0.457, and 0.800 ± 0.253, respectively, for Group II, and 2.400 ± 0.507, 1.866 ± 0.596, and 1.550 ± 0.613, respectively, for Group III [Table 1]. In Group I, a statistically highly significant difference was found in the mean GI score at 30 days from baseline (P = 0.00) and statistically significant difference was observed from baseline to 45 days (P = 0.039). Similarly, in Group II, the mean GI score at 30 days from baseline was found to be highly significant (P = 0.00) and at 45 days was statistically significant (P = 0.033). However, this difference from baseline was statistically highly significant at 30 days (P = 0.002) and 45 days (P = 0.010) in Group III [Table 1]. At 45 days from baseline, the mean reduction in GI score was statistically nonsignificant when Groups I and II were compared (P = 1.00). However, this reduction was observed to be statistically highly significant when Groups I and II were compared with Group III (P = 0.004) [Table 2]. BODY.RESULTS.PROBING DEPTH: The mean probing depths at baseline, 30 days, and 45 days were 5.333 ± 0.617, 4.266 ± 0.703, and 3.733 ± 0.798, respectively, for Group I, 5.333 ± 0.723, 3.933 ± 0.961, and 3.466 ± 0.743, respectively, for Group II, and 5.133 ± 0.351, 4.666 ± 0.487, and 4.40 ± 0.507, respectively, for Group III [Table 1]. In Groups I and II, a statistically highly significant difference in the mean probing depth was recorded at 30 days (P = 0.001 and 0.00, respectively) and 45 days (P = 0.012 and 0.001, respectively) from baseline. However, in Group III, a nonsignificant difference at 30 days (P = 0.317) and 45 days (P = 0.070) from baseline was observed [Table 1]. At 45 days from baseline, the mean reduction in probing depth was statistically nonsignificant when Groups I and II were compared (P = 0.055). However, this reduction was observed to be statistically highly significant when Groups I and II were compared with Group III (P = 0.000) [Table 2]. BODY.RESULTS.CLINICAL ATTACHMENT LEVEL: The mean clinical attachment levels at baseline, 30 days, and 45 days were 5.533 ± 0.833, 4.466 ± 0.915, and 3.666 ± 0.816, respectively, for Group I, 5.533 ± 0.990, 4.20 ± 1.082, and 3.60 ± 0.910, respectively, for Group II, and 5.266 ± 0.457, 4.733 ± 0.593, and 4.533 ± 0.516, respectively, for Group III [Table 1]. In Groups I and II, a statistically highly significant difference in the mean clinical attachment level was found at 30 days (P = 0.00 and 0.00, respectively) and 45 days (P = 0.004 and 0.002, respectively) from baseline. However, in Group III, a significant difference at 30 days (P = 0.036) and 45 days (P = 0.029) from baseline was observed [Table 1]. At 45 days, statistically nonsignificant difference in clinical attachment level was observed between Groups I and II (P < 1.00). Statistically highly significant difference was observed when Groups I and II were compared to Group III (P = 0.00) [Table 2]. BODY.DISCUSSION: The primary role of bacteria in the etiology of periodontal diseases is unequivocal. Various treatments have been used for it, yet traditional mechanical debridement to disrupt the subgingival flora and provide clean, smooth, and biologically compatible root surfaces is still the mainstay. Even though the outcome of mechanical debridement usually satisfies in terms of reduction in probing depth and bleeding on probing, difficulties reaching the bottom of the pocket can lead to its failure.[9] As a consequence, supplementary treatment becomes inevitable. Moreover, it has also been demonstrated that the time spent on therapy, the number of sites that require instrumentation,[10] and the experience of the clinician may influence the success of SRP.[11] These findings indicate that SRP is a technique-sensitive method for treating periodontitis. Furthermore, some microbiota simply cannot be mechanically eradicated. Indeed, bacterial invasion in cementum, radicular dentin,[1213] and the surrounding periodontal tissues[14151617] has been reported. The idea of subgingivally applying a highly concentrated antimicrobial agent as an adjunct to SRP was to compensate for the shortcomings of the former, thereby improving the treatment outcome. Chlorhexidine has long been the gold standard for subgingival chemical plaque control regimens.[4] Its efficacy as a topical rinse to inhibit dental plaque and gingivitis has been well established without evidence of development of any bacterial resistance.[18] It has been found to be effective against subgingival bacteria when delivered through a sustained release device. Chlorhexidine has been shown to be an effective agent in plaque inhibition[19] as it is well retained (substantivity) in the oral cavity. It is safe and is acceptable in terms of cost and ease of use. However, it has various side effects like brown discoloration of teeth, dulling of taste sensation, and oral mucosal erosion. Therefore, a need was felt for an alternative antimicrobial agent that could provide a product already enmeshed within the traditional Indian setup and is also safe and economical. Turmeric, more commonly known as "haldi," possesses anti-inflammatory, antioxidant, and antimicrobial properties along with antimutagenic and anticoagulant activities.[27] It also accelerates wound healing.[2] Due to these reasons, it was felt that promotion of turmeric in dental terrain may prove beneficial. In terms of taste and acceptance of turmeric gel, there was good biological acceptability without any side effects. It was simple and easy to use; also, its bioadhesive property allowed its better retention. Hence, the aim of the present investigation was to evaluate and compare the clinical effects of topical subgingival application of 2% whole turmeric gel and chlorhexidine gel as an adjunct to SRP in patients suffering from chronic periodontitis. Patients with a pocket depth of 5-7 mm in at least three non-adjacent sites in different quadrants of the mouth were selected. This was in accordance with Goodson[20] who pointed out that successful control of periodontal microflora in pockets ≥5 mm requires locally delivered antimicrobials reaching the site of action, that is, the periodontal pocket and its surrounding tissues, thus maintaining minimum effective concentrations for sufficient duration to produce a therapeutic effect. Clinical parameters (PI, GI, probing depth, and relative attachment level) were recorded at baseline, 30 days, and 45 days in all three groups (Group I: 2% turmeric gel, Group II: 1% chlorhexidine gel, and Group III: SRP). The results of the present investigation show that chlorhexidine gel as the local drug system in Group II was better than SRP alone in Group III. This could be attributed to the substantivity and antimicrobial property imparted by chlorhexidine. This finding is in accordance with the findings of the studies conducted by Unsal et al.[21] and Vinholis et al.[22] who used 1% chlorhexidine gel in the treatment of periodontal pockets. However, Group I (turmeric gel) showed comparable improvement in all the clinical parameters as Group II (chlorhexidine gel). These results suggest effective usage of turmeric gel as a potential local drug delivery system which could aid in the treatment of periodontal disease. It proved to be a more effective treatment modality than SRP alone, as demonstrated by the clinical parameters. These results are consistent with those reported by Behal et al.[2] Thus, results of the present study brighten the futuristic aspect of using turmeric gel as a local drug delivery system in subgingival sites. The limitation of the present clinical trial was the small sample size and the short duration for determining the efficacy of the experimental drug. Thus, further longitudinal studies are recommended with larger sample size for the evaluation of the efficacy of this herbal agent in the treatment of chronic periodontitis. The concomitant biochemical and microbial analysis could also help in better interpretation of findings. BODY.CONCLUSION: Within the limitations of the present study, 2% whole turmeric gel as an adjunct to SRP proved to be effective in the treatment of periodontitis. The bioadhesive property of this local drug delivery system allowed better retention and was biologically accepted without any side effects. Moreover, it was simple to use and required less chairside time. So, it appears as a viable and an inexpensive option for common man and can be incorporated as a treatment modality in day-to-day life.

TITLE: Comparison of Knifelight Surgery versus Conventional Open Surgery in the Treatment of Carpal Tunnel Syndrome ABSTRACT.BACKGROUND: A variety of surgical treatment methods for carpal tunnel syndrome are introduced recently, including open surgery, endoscopic and the Knifelight. It is hypothesized that Knifelight method could decrease scar tenderness and time before return to daily activities for patients and is accompanied with less disturbance to fine sensory nerves. ABSTRACT.OBJECTIVES: To compare the Knifelight instrument and open carpal tunnel release with respect to scar length, operation duration, recovery time needed before return to work and amount of pain three weeks after surgery in patients with neurophysiologically confirmed carpal tunnel syndrome. ABSTRACT.PATIENTS AND METHODS: Fifty nine patients with indication for carpal tunnel release randomly assigned into two groups: open (n=30) or Knifelight (n=29). The patients compared regarding scar length, operation duration, time to return to daily activities and amount of pain at three weeks after operation based on Visual Analog Scale. ABSTRACT.RESULTS: There was no significant differences regarding age and sex in the two groups. The scar length, operation duration and time before return to daily activities were significantly lower in the Knifelight group. Although the mean visual analogue scale of Knifelight group found to be lower than the other, it was not statistically significant. ABSTRACT.CONCLUSIONS: The Knifelight technique is accompanied with advantages over the open surgery regarding operation time, scar length and time to return to daily activities. The pain relieve based on Visual Analog Scale was not statistically different from conventional open surgery. BODY.1. BACKGROUND: Carpal Tunnel Syndrome (CTS) which is first described by Sir James Paget in 1854 is the most common compression neuropathy of upper extremity, with an estimated prevalence of 3.7% in United States (1, 2). Medical treatments of CTS are limited and are not satisfactory in many cases (3, 4). Non-surgical treatment is mainly the splinting and corticosteroid injection which has been effective just in fraction of mild cases (5-7). The surgical treatment has shown better results and more cost effectiveness compared with non-surgical method (8, 9). Traditionally open release of median nerve was used which seems that it is accompanied by unsatisfactory results due to scar tenderness and pillar pain (10). Cosmetic problems because of large incision in open release method are also important especially in women which are more affected with this problem. Less invasive methods are recently introduced to decrease these unsatisfactory results (10, 11): endoscopic release and Knifelight Carpal tunnel release are among these novel techniques. Results of endoscopic release were not satisfactory. Endoscopic release is expensive and it seems that it is accompanied by a higher prevalence of numbness and paraesthesia (10-13). Results of Knifelight technique which is first reported by Avci et al. were satisfactory (11). Theoretically and with respect to the results of published studies, it seems that this technique decreases scar tenderness due to smaller incision and less disturbance to fine sensory nerves. It is also hypothesized that it could decrease time to take to work for patients (13). BODY.2. OBJECTIVES: A randomized controlled study was conducted in order to compare Knifelight and open carpal tunnel release results and outcomes. The duration of the procedure, length of the scar at incision site, pain after three weeks and needed time to return to daily activities were compared between groups. BODY.3. MATERIALS AND METHODS: Fifty-nine consecutive patients with CTS who were referred to a tertiary hospital during 2007, enrolled in a randomized controlled trial. All patients had clinical signs or symptoms as well as electro-diagnostic findings consistent with carpal tunnel syndrome and had not responded to nonsurgical management. Patients were randomly divided into 2 groups: thirty subjects were undergone open surgery and 29 patients undergone knifelight procedure. In addition to the type of surgery, the demographic and specific characteristics of all patients recorded by questionnaires at discharge and three weeks after surgery. All fifty-nine subjects were followed up for the specific evaluated parameters consisting scar length (millimeters), procedure duration (minutes), time to return to daily activities as what the patient declares (days), the magnitude of pain at the third week interval after surgery measured by Visual Analog Scale (the score out of 10 declared by patient as the remaining pain compared with the preoperative one). BODY.3. MATERIALS AND METHODS.3.1. SURGICAL TECHNIQUES: Open Carpal Tunnel Release and Knifelight Surgery: Knifelight ® (Stryker, Kalamazoo, MI) is a surgical instrument including a blade which is covered by a forked plastic piece and a light source supplied by a battery which illuminates the plastic forks. After making a small incision on the skin, the site of surgery on flexor retinaculum will be designated by the light (10-12, 14-16). Following prep and drape and the local or general anesthesia, the arm was compressed by the tourniquet and a towel was placed under the wrist in order to make a 30 to 45 degrees extension. To locate the incision site, a transverse line was drawn at the proximal wrist crease. Second line was drawn between the midpoint of the wrist line (between the scaphoid and hamate bones) and the radial side of the ring finger. Finally the third line was designated transversally along the ulnar side of fully abducted thumb. A 1 to 1.5 cm incision was made along the second line proximal to the intersection with the third line. The incision site has less subcutaneous fat tissue compared with the open surgery. Using the Freer elevator to approach proximally under the fat and along with the ulnar edge of palmaris longus tendon, it reaches space between interthenar fascia and flexor retinaculum. A 3 to 4 mm incision was made at the distal edge of flexor retinaculum close to the ulnar side and then the Knifelight was turned on and operation room was darkened as much as possible. The Knifelight was inserted through the incision as the longer tip was under flexor retinaculum and short tip placed over it in the space between interthenar fascia and flexor retinaculum. At this time, only the light spot of the short tip was visible clearly through the skin. The desired site was determined with the light source and median nerve was released from the carpal tunnel compression. The device was pushed gently to the proximal until the blade was cut the flexor retinaculum. Then it was pulled back slightly to overview the cutting. This process was repeated until the retinaculum was released completely. In this stage, light spots at both tips of the device were visible through the skin. The Knifelight was taken out and the tourniquet was unfastened to evaluate hemostasis. The palmar fascia was stitched with absorbable suture and skin was closed with 2.0 or 3.0 nylon suture. Finally a pressure dressing was applied in place. The patients were encouraged to start daily activities after a week and sutures were removed after 10 to 14 days (10-12). BODY.3. MATERIALS AND METHODS.3.2. STATISTICAL ANALYSIS: All analyses were done utilizing SPSS version 10 (SPSS Inc. Chicago, IL, USA). Sex distribution was tested via Chi-squared test. Age, Operation duration, scar length, time until return to daily activity and visual analog scale were compared between two groups using t-test. Statistical significance for all tests was set at 5 percent level. BODY.3. MATERIALS AND METHODS.3.3. ETHICAL ASPECTS: The risks and objectives of the study were explained to all the participants and written informed consent was obtained. The study protocol was reviewed and approved by ethics committee of Hamadan University of Medical Sciences. BODY.4. RESULTS: Mean age of the patients with CTS in groups of open and Knifelight surgery was 45.5 and 49.6 years respectively. There was no significant difference in the age of two groups (P value = 0.86). The subjects were also well distributed randomly in the two groups regarding sex. Women were 93.3% and 86.2% of patients in open and Knifelight groups respectively (Table 1). Table 1. Basic Demographic Data of two Different Groups of Carpal Tunnel Release Surgery DemographicInformation Open Surgery Knifelight P value Mean Age (years) 45.5±10.2 (41.7-49.3) a 49.7± 7.9 (46.7-52.7) 0.86 Female Population (%) 93.3 86.2 0.6 a Mean ± SD (95% lower-upper Confidence Interval) Table 2 shows the summary of main results. Mean duration of surgery was 12.5 minutes longer for open surgery than that of Knifelight (P value < 0.001). We also compared the length of scar in both techniques in millimeters, which significantly showed more than 60 percent shorter scar length for incisions made in Knifelight technique. Table 2. The Main Results of Open Surgery Compared With theKnifelight Open Surgery Knifelight P value Mean Operation Duration (minutes) 21 ± 8.9 (17.7-24.4) a 8.5 ± 4.2 (6.9-10.1) 0.000 Mean Scar Length (millimeters) 40.7 ± 5.6 (38.6-42.8) 14.8 ± 3.7 (13.4-16.2) 0.000 Mean time until return to daily activity (days) 51.9 ± 31.0 (40.3-63.5) 34.4 ± 21.8 (26.1-42.7) 0.015 Pain at 3w interval (Visual Analog Scale) 1.80 ± 1.58 (1.2-2.4) 1.38 ± 1.08 (1-1.8) 0.24 a Mean ± SD (95% lower-upper Confidence Interval) Compared to the conventional open surgery, Knifelight significantly decreased the time needed before return to daily activities (P value = 0.015). The patients who were underwent open surgery became active after 51.8 days which was 50% longer than the time needed for the counterparts of Knifelight group. The open surgery resulted in return to daily activities after mean recovery period of 51.8 days which was 50% longer than the time needed for the patients who were underwent Knifelight surgery (Table 2). Although the mean visual analogue scale of Knifelight group found to be lower than the other, it was not statistically significant (P value = 0.24). BODY.5. DISCUSSION: According to the results of our study, compared to the conventional open surgery, Knifelight technique significantly decreased the time to return to work. This is in accordance with Helm et al study results (12). Results of Bhattacharya et al. study showed no significant decrease in return to work. Although these authors used "Weeks" for the return to work period, using days may result in significant results. This phenomenon called "significance by chance" in statistics. It is better to define a definite clinical and practical scaling method for time to return to work period in order to avoid such statistical difference in results and interpretation of different studies. Knifelight scars were significantly shorter than open surgery scars in our study. A smaller incision, which is not beyond the weight bearing part of the hand, could decrease complications and is very important for cosmetic aspects of surgery (10). The mean duration of surgery was significantly lower in Knifelight method in our study. While the mean visual analogue scale of Knifelight group found to be lower than the other, it was not statistically significant. Although Yeo et al reported no difference between two methods of open and Knifelight in regard of pain improvement, numbness and patient satisfaction, results of most of other studies showed significant deference in scar tenderness after Knifelight method compared to open release (10-12, 16). Small sample size; impossibility of blinding patients and care providers which may have caused bias in our study results were among our main study limitations. However the latter bias is inevitable. Covariate adaptive randomization was the method of choice for randomization process of this study, however it was not applied and simple randomization method was used for randomization. In conclusion according to the results of this study, compared to the open release method, Knifelight technique could significantly decrease the mean duration of surgery, incision length and time to return to work.

TITLE: Dose-sparing and safety-enhancing effects of an IGF-I-based dosing regimen in short children treated with growth hormone in a 2-year randomized controlled trial: therapeutic and pharmacoeconomic considerations ABSTRACT.CONTEXT AND OBJECTIVE: Titrating the dosage of growth hormone (GH) to serum levels of insulin-like growth factor-I (IGF-I) is a feasible treatment strategy in children with GH deficiency (GHD) and idiopathic short stature (ISS). The objective was to assess the dose-sparing effect and theoretical safety of IGF-I-based GH therapy. ABSTRACT.DESIGN, SETTING AND PATIENTS: This was a post hoc analysis of a previously described 2-year, multicenter, open-label, randomized, outpatient, controlled clinical trial in 172 prepubertal short children [age 7·5 ± 2·4 years; height standard deviation score (HSDS) −2·64 ± 0·61] classified by baseline peak GH levels as GHD (<7 ng/ml) or ISS (≥7 ng/ml). ABSTRACT.INTERVENTION: Conventional weight-based dosing of GH (0·04 mg/kg/day) (n = 34) or GH dosing titrated to an IGF-I target of 0 SDS (IGF0T; n = 70) or an IGF-I target of +2 SDS (IGF2T; n = 68). ABSTRACT.MAIN OUTCOME MEASURES: Change in HSDS per GH mg/kg/day dose (ΔHSDS/GH dose ratio) and proportion of IGF-I levels above +2 SDS at the end of 2 years. ABSTRACT.RESULTS: GH dosing titrated to an IGF-I target of 0 SDS was the most dose-sparing treatment regimen for GHD or ISS children (mean±SE ΔHSDS/GH dose ratios 48·1 ± 4·4 and 32·5 ± 2·8, respectively) compared with conventional dosing (30·3 ± 6·6 and 21·3 ± 3·5, respectively; P = 0·02, P = 0·005) and IGF2T (32·7 ± 4·8 and 16·3 ± 2·8, respectively; P = 0·02, P < 0·0001). IGF0T also resulted in the fewest IGF-I excursions above +2 SDS (6·8% vs 30·0% for conventional dosing; P < 0·01). ABSTRACT.CONCLUSIONS: IGF-I-based GH dosing, targeted to age- and gender-adjusted means, may offer a more dose-sparing and potentially safer mode of therapy than traditional weight-based dosing. BODY.INTRODUCTION: The dosage of GH for the treatment of children with short stature or growth failure has been based historically on body weight, usually in the range of 25–100 mcg/kg/day in pediatric patients with growth disorders, depending on age and pubertal status. Although effective and widely used, the high cost of GH therapy and variability in treatment response has led to ongoing efforts to optimize dosing strategies to improve not only the efficacy and cost-effectiveness of treatment, but also its long-term safety.1–4 GH continues to have a favourable overall safety profile;5 however, concerns over long-term safety have been revisited5–9 and elevated serum concentrations of insulin-like growth factor-I (IGF-I), the presumed mediator of GH-induced somatic growth, are associated with certain cancers.10,11 Variability in response to a given dose of GH likely reflects differences in the severity of GH deficiency (GHD) and the patient's sensitivity to treatment. Several approaches have been explored to optimize the safety and efficacy of GH therapy in children with short stature. For example, prediction-based models have been developed to optimize GH therapy;12–15 however, the exact contribution of prediction-derived indices to adult height remains unclear. Titrating the dosage of GH to serum levels of IGF-I is a feasible treatment strategy in children with GHD or idiopathic short stature (ISS).1,2,16 Nevertheless, the potential benefits pertaining to safety and the advantages of dose-sparing on cost for this method have yet to be determined. Therefore, we undertook a post hoc analysis of a previously conducted study1,2 in which GH dose was titrated based on serum IGF-I levels to determine the potential dose-sparing effect of this method compared with conventional weight-based dosing, as well as the theoretical effects on safety. BODY.METHODS.STUDY DESIGN AND PARTICIPANTS: The original study was a 2-year, multicenter, open-label, randomized, controlled clinical trial.1,2 Briefly, 172 prepubertal short children [age 7·5 ± 2·4 years, height standard deviation score (HSDS) −2·64 ± 0·61] with low IGF-I levels were randomized in a 1:2:2 manner to 1 of 3 groups: conventional weight-based dosing of GH (0·04 mg/kg/day) (n = 34); GH dosing titrated to an IGF-I target of 0 SDS (IGF0T group; n = 70); and GH dosing titrated to an IGF-I target of +2 SDS (IGF2T group; n = 68). The dose of GH was adjusted every 3 months based on weight (conventional group) or, in the IGF0T and IGF2T groups, by 20% per SDS unit difference between the target and current IGF-I SDS. Children were classified as GHD (peak GH <7 ng/ml, n = 63) or ISS (≥7 ng/ml, n = 102) based on GH stimulation testing at baseline. The original study was conducted after approval by the institutional review board in all centers and in accordance with the Declaration of Helsinki. Written informed consent was obtained by the parent/legal guardian before any study procedure. BODY.METHODS.STATISTICAL ANALYSIS: For this post hoc analysis, the 2-year change in HSDS (ΔHSDS) per mg/kg/day dose of GH used at the end of 2 years (ΔHSDS/GH dose ratio) was calculated and expressed in arbitrary units. Theoretical safety was assessed by the proportion of IGF-I measurements above +2 SDS at the end of 2-year treatment period. For the ΔHSDS/GH dose ratio, between-group (i.e., IGF0T, IGF2T, conventional dosing) comparisons were performed using analysis of covariance with treatment effect, sex and baseline HSDS values included in the model. For comparison of the proportion of IGF-I SDS levels above +2 at the end of 2 years, Fisher's exact test was used. BODY.RESULTS.STUDY POPULATION: The study population has previously been described.1,2 Briefly, mean ± SD bone age for the study population (5·51 ± 1·93years) was approximately 2 years behind their chronological age (7·53 ± 2·40 years).1 More males (n = 132; 77%) than females (n = 40; 23%) were enrolled in the study.1 At baseline, the mean HSDS for all patients was −2·64 ± 0·61 and the mean IGF-I SDS was −3·56 ± 1·74.1 By design, the peak stimulated GH values were significantly lower in children classified as GHD compared to those classified as ISS (3·96 ± 1·94 vs 12·87 ± 4·77 ng/ml; P < 0·001) and children classified as GHD had significantly lower mean IGF-I SDS values (−4·10 ± 1·95 vs −3·27 ± 1·53; P < 0·05).2 Otherwise, the demographics and baseline information for the patient population were similar between treatment groups and between GHD and ISS subgroups within each treatment group.2 BODY.RESULTS.CHANGE IN HSDS AFTER 2 YEARS: The change in HSDS (ΔHSDS) after 2 years of treatment was previously reported.2 Briefly, the mean±SE values for ΔHSDS in GHD children for the IGF0T, IGF2T and conventional dosing groups were 1·41 (0·13), 2·04 (0·17) and 1·23 (0·12), respectively. The mean±SE values for ΔHSDS in ISS children for the IGF0T, IGF2T and conventional dosing groups were 0·84 (0·07), 1·33 (0·09) and 0·87 (0·09), respectively. The respective mean ± SE values for ΔHSDS in GHD and ISS children were significantly greater for the IGF2T group than for the IGF0T (P < 0·001) and conventional dosing groups (P = 0·001 and P < 0·001, respectively). There were no significant differences between the IGF0T and conventional dosing groups for ΔHSDS. The ΔHSDS was significantly greater among GHD than ISS children in all treatment groups (P < 0·05).2 BODY.RESULTS.MEAN DAILY DOSE OF GH: Mean daily doses of GH, calculated as the dose in mg/kg/day at the end of 2 years of treatment, were also previously reported.2 The respective mean ± SE daily dose of GH in GHD and ISS children at the end of 2 years was significantly higher for the IGF2T group (0·091 ± 0·017 and 0·114 ± 0·009 mg/kg/day, respectively) than for the IGF0T (0·037 ± 0·004 and 0·032 ± 0·003 mg/kg per day, respectively; P < 0·001) and conventional dosing groups (0·041 ± 0 mg/kg/day for both GHD and ISS; P = 0·002, P < 0·001, respectively). There were no significant differences between the IGF0T and conventional dosing groups for GH daily dose. BODY.RESULTS.POST HOC ANALYSIS OF ΔHSDS/GH DOSE RATIOS: Among the three different treatment groups, the respective mean ± SE values for the ΔHSDS/GH dose ratios in GHD and ISS children were highest in the IGF0T group (48·1 ± 4·4 and 32·5 ± 2·8, respectively), with significant differences compared to both the conventional dosing group (30·3 ± 6·6 and 21·3 ± 3·5, respectively; P = 0·02 and P = 0·005, respectively) and the IGF2T group (32·7 ± 4·8 and 16·3 ± 2·8, respectively; P = 0·02 and P < 0·0001, respectively) (Fig.1). Thus, while ΔHSDS was greater in the IGF2T group than in either of the other groups, the GH dose was also significantly higher. The resultant ΔHSDS/GH dose ratios were not only significantly lower than those for the IGF0T group, but were also not significantly different from those for the conventional dosing group (Fig.1). Figure 1ΔHSDS/GH Dose Ratio After 2 Years of GH Treatment in Children with GHD and ISS. Conv, conventional weight-based dosing (GH 0·04 mg/kg/day); ΔHSDS/GH dose ratio, change in height standard deviation score per mg/kg/day GH dose; GHD, growth hormone deficiency; ISS, idiopathic short stature; IGF0T, dose titration to IGF-I target of 0 standard deviation score; IGF2T, dose titration to IGF-I target of +2 standard deviation score; SE, standard error. BODY.RESULTS.THEORETICAL SAFETY BASED ON IGF-I EXCURSIONS ABOVE +2 SDS: Target IGF-I levels were attained at 6 months in the IGF0T group and at 9 months in the IGF2T group and remained stable thereafter. Mean±SE IGF-I SDS values for GHD children in each treatment group at the end of 2 years were 0·46 ± 0·24 for IGF0T, 2·83 ± 0·39 for IGF2T and 0·66 ± 0·87 for the conventional dosing group. For ISS children, the mean ± SE IGF-I SDS values were 0·05 ± 0·24 for IGF0T, 1·93 ± 0·38 for IGF2T and 0·97 ± 0·52 for the conventional dosing group. At the end of 2 years, IGF-I SDS was significantly higher for the IGF2T group than the IGF0T group (GHD, P < 0·001; ISS, P = 0·001). Nevertheless, for the combined population of GHD and ISS children, while the mean IGF-I SDS was comparable between the IGF0T and conventional dosing groups, the percentage of IGF-I levels above +2 SDS at the end of 2 years was significantly lower in the IGF0T group than in the conventional dosing group (7% for IGF0T, 30% for conventional dosing; P = 0·0083) (Fig.2). Figure 2Proportion of IGF-I Measurements Above +2 SDS by Dosing Strategy in Children with GHD and ISS. Conv, conventional weight-based dosing; IGF0T, dose titration to IGF-I target of 0 standard deviation score, SDS, standard deviation score. aP<0·01 compared with conventional dosing for proportion of IGF-I levels above +2 SDS, Fischer's exact test. BODY.DISCUSSION: Previous analyses demonstrated the feasibility of two IGF-I-based treatment regimens.1,2 Increases in growth (ΔHSDS) at 2 years were comparable between the IGF-I target of the mean (0 SDS) and conventional weight-based dosing groups for both GHD and ISS patients; the IGF-I target of upper normal (+2 SDS) resulted in significantly greater ΔHSDS compared to the other two treatment groups in these patients.1,2 As the dose required to achieve an IGF-I level of +2 SDS was also significantly higher than the other treatment groups, the current analysis was undertaken to compare the three treatment regimens in terms of increment in height SDS per dose as it may relate to dose-sparing potential. Furthermore, as both weight-based dosing and GH dosing targeted to the mean IGF-I SDS resulted in comparable IGF-I levels on average, a comparison between these dosing regimens was made to assess the proportion of IGF-I SDS values that exceeded the upper range of normal (+2 SDS) as a theoretical measure of safety. An effective dose-sparing strategy can save substantial healthcare costs for managed care organizations and patients receiving GH therapy.17 Previous pharmacoeconomic studies with GH relying on the use of decision-modelling have produced variable findings17–19 and the applicability of such methodology to real-world situations may be limited.20,21 Results from this analysis found that the most dose-sparing treatment regimen, based on analyses of ΔHSDS/GH dose ratios, for children with GHD or ISS was a GH dose titrated to an IGF-I target of 0 SDS. To our knowledge, this is the first demonstration that a feasible dosing strategy based on IGF-I target can potentially be more cost beneficial (based on ΔHSDS/GH dose ratio) than conventional weight-based dosing while having comparable efficacy (as measured by ΔHSDS). Not only was targeting the IGF-I SDS to the mean the most dose-sparing treatment regimen, it also resulted in a significantly lower proportion of IGF-I levels above +2 SDS than did conventional dosing, which could have important implications for long-term safety. IGF-I can produce alterations in cell proliferation and apoptosis, and elevated levels of IGF-I have been linked to some cancers in adult populations including colon, prostate and certain types of breast cancer.10,22–24 Long-term observational studies have reported on safety outcomes for children receiving GH treatment, including malignancies.5,8,25 For the most part, recent results have been reassuring. Findings from the National Cooperative Growth Study reported no appreciable increase in de novo cancer [standardized incidence ratios (SIR) 1·12, 95% CI 0·75–1·61] and a lower than expected incidence of new-onset leukaemia (SIR 0·54; 95% CI 0·11–1·58).5 However, a risk for second neoplasms among children treated with GH has been reported. A large retrospective cohort of childhood cancer survivors treated with GH reported an approximate threefold higher rate of second neoplasms than expected (SIR 3·2, 95% CI 1·9–5·5) at 15 years of follow-up.25 This rate decreased somewhat after 32 years of follow-up, but still remained elevated (SIR 2·1, 95% CI 1·3–3·5).8 Although a definitive link between elevated IGF-I levels associated with GH treatment and biological end-points has not been shown, it has been recommended that IGF-I levels in individual patients should be maintained within age- and gender-based reference ranges.26–28 We found that in patients dosed conventionally with 0·04 mg/kg/day, the proportion of IGF-I levels above +2 SDS was 30%. Others have reported similar excursions. For example, 28% of pubertal patients treated with 0·7 mg/kg/week had high IGF-I concentrations,29 as did 45% of SGA patients treated with 0·057 mg/kg/day for 2 years.30 In another report, 17% of GHD patients had IGF-I excursions above +2 SDS after 2 years even when the GH dose was based on body surface area at an average dose of 1 mg/m2/day (equivalent to 0·035/mg/day).31 A GH dose-sparing effect of IGF-I-based dosing was also noted in a study of adult Japanese patients with GHD who were switched from a conventional weight-based dose regimen, with a concomitant increase in the number of patients who were maintained within the reference range for IGF-I SDS.32 The present analysis demonstrated that targeting IGF-I to the mean (i.e., 0 SDS) significantly decreased the proportion of IGF-I measurements >+2 SDS at the end of year 2 compared to conventional weight-based dosing. Decreasing the risk of exposure to high IGF-I levels potentially reduces the theoretical risk of cancer and other adverse events related to high IGF-I levels. There are limitations to the present analysis. It was not prospectively designed for the purpose of dose-sparing and was not intended to provide any specific dosing target or recommendations. With that said, based on our analysis, an IGF-I level around the mean for the population rather than at the upper limit of normal would seem to be a reasonable approach in terms of cost-effectiveness and more prudent in terms of safety, without incurring any compromise of efficacy, especially for patients with GHD. Although IGF-I targets were met equally in patients with GHD and ISS, gains in height were significantly less for ISS patients.2 This may indicate a degree of IGF-I insensitivity, as well as GH insensitivity, in the ISS patients, who may require a more aggressive IGF-I target.2 Also, the 2-year duration of the study may not have been long enough for all patients to achieve optimal catch-up growth.3 As other IGF-I targets have yet to be fully examined, the optimal IGF-I target, particularly for non-GHD conditions, remains to be identified, and long-term clinical benefits of dosing based on IGF-I targets still need to be demonstrated. One proposed model suggests using higher IGF-I targets (+2 to +3 SDS) to maximize height during the catch-up phase followed by lower targets for maintenance.33 Furthermore, a general IGF-based dosing strategy would not preclude also individualizing treatment based upon responsiveness in growth. The lack of IGF-I assay standardization and accepted normative reference ranges are additional factors that may impact the generalizability of the reported results. A consensus statement put forth by the Growth Hormone Research Society has outlined the obstacles and steps needed to move towards a standardized process.34 Until an accepted standardized assay is available, clinicians should utilize an assay with demonstrated reliability, collect and process samples appropriately and adjust to appropriate age and gender-matched reference norms,28 which should be requested from each laboratory whenever possible. When feasible, clinicians should attempt to utilize the same assay and technique for a patient over time, although patient factors, such as health insurance, may be a barrier.28 In addition to interassay variability, clinicians should also be aware of intrapatient variability when interpreting IGF-I assay results, especially with regard to borderline values.34 In conclusion, IGF-based GH dosing targeted to the age- and gender-adjusted mean (0 SDS) in GHD and ISS children resulted in a higher ΔHSDS/GH dose ratio than conventional weight-based dosing, despite comparable levels of IGF-I and ΔHSDS achieved, and may offer a more dose-sparing mode of GH therapy than traditional weight-based GH dosing. IGF-I-based dosing targeted to the mean SDS also decreased exposure to IGF-I levels above +2 SDS and may therefore address some of the theoretical safety concerns related to GH treatment.

TITLE: Roy’s Adaptation Model-Guided Education and Promoting the Adaptation of Veterans With Lower Extremities Amputation ABSTRACT.BACKGROUND:: Any defect in extremities of the body can affect different life aspects. ABSTRACT.OBJECTIVES:: The purpose of this study was to investigate the effect of Roy's adaptation model-guided education on promoting the adaptation of veterans with lower extremities amputation. ABSTRACT.PATIENTS AND METHODS:: In a randomized clinical trial, 60 veterans with lower extremities amputation referring to Kowsar Orthotics and Prosthetics Center of veterans clinic in Tehran, Iran, were recruited with convenience method and were randomly assigned to intervention and control groups during 2013 - 2014. For data collection, Roy's adaptation model questionnaire was used. After completing the questionnaires in both groups, maladaptive behaviors were determined in the intervention group and an education program based on Roy's adaptation model was implemented. After two months, both groups completed the questionnaires again. Data was analyzed with SPSS software. ABSTRACT.RESULTS:: Independent t-test showed statistically significant differences between the two groups in the post-test stage in terms of the total score of adaptation (P = 0.001) as well as physiologic (P = 0.0001) and role function modes (P = 0.004). The total score of adaptation (139.43 ± 5.45 to 127.54 ± 14.55, P = 0.006) as well as the scores of physiologic (60.26 ± 5.45 to 53.73 ± 7.79, P = 0.001) and role function (20.30 ± 2.42 to 18.13 ± 3.18, P = 0.01) modes in the intervention group significantly increased, whereas the scores of self-concept (42.10 ± 4.71 to 39.40 ± 5.67, P = 0.21) and interdependence (16.76 ± 2.22 to 16.30 ± 2.57, P = 0.44) modes in the two stages did not have a significant difference. ABSTRACT.CONCLUSIONS:: Findings of this research indicated that the Roy's adaptation model-guided education promoted the adaptation level of physiologic and role function modes in veterans with lower extremities amputation. However, this intervention could not promote adaptation in self-concept and interdependence modes. More intervention is advised based on Roy's adaptation model for improving the adaptation of veterans with lower extremities. BODY.1. BACKGROUND: Amputation is one of the disruptive and injurious events that a person may experience in his/her life (1). About 200 to 500 million amputations occur in the world every year due to some factors such as disease, trauma and congenital defects and approximately 80% of it relates to lower extremities (2). In countries that have recently experienced war, about 80% of amputations is due to war (2, 3). During Iraq-Iran war between 1980 and 1988, about 15,000 individuals got severely amputated in upper extremity or lower extremity (4). There are about 11517 veterans with lower extremities amputation in Iran and this number includes different levels of amputation including ankle, upper the knee, knee, lower the knee, and pelvis (3). Any defect in extremities of the body is not only regarded as a physical injury, but also leads to social and mental-emotional injuries and can affect different life aspects. This considerably reduces the physical activity and mobility of person, limits the performance of normal roles of the person, and leads to economic, social, personal, family and environmental problems, making life difficult for the person (3, 5, 6). Many of these people suffer from chronic complications which can limit the performance of their physical activities. These limitations clearly reduce self-confidence of these people, change their body images negatively, reinforce their vulnerability, and increase tendency to abuse drugs and increase clinical depression and suicide thoughts (5). Studies have shown that there is a broad scope of chronic and acute complications such as post-traumatic stress disorder, anxiety disorder, aggression, depression, cognitive disorder, interpersonal relations problems, isolation, feeling of guilt, isolation from society, economic problems, unemployment, sleep disorders and many other problems in veterans, the survivors of war and their close relatives (5, 7). Studies showed that only 2% - 7% of war victims returned to their active performance before amputation (1). Some studies showed that only 62% of patients with major lower-limb amputations used their prosthesis daily or occasionally and adaptation to the prosthesis occurred in 40% of them (8). This is important that after amputation, the person should return to his/her normal life as soon as possible (3). In all chronic diseases, the adaptation of patients to long-term complications of disease plays an important and effective role in promotion of their quality of life (9). In this regard, rehabilitation of the injured person in war and increase of their independence are important goals. Nurses as healthcare professional staffs play important roles for finding patient, care, rehabilitation and adaptation to new situation and reduction of mental stresses of patients (10). One of the applied and effective models in nursing that has paid attention to this subject is Roy's adaptation model (RAM). Roy believes that when the human system is sick or can be sickened or when there are unusual stressors and the adaptive mechanisms are weakened and usual efforts of the person to adapt are ineffective, it is necessary for the person to receive care and nursing services (10). She believed that the goal of nursing is to promote adaptation in the four adaptive modes (physical, self-concept, role function and interdependence mode) (11). Three types of stimuli ie, focal, contextual and residual stimuli are effective on the adaptation and alteration of these stimuli with caring plans increases adaptation and better controls the disease (12). Focal stimuli are the ones that are directly and currently effective on person and are the most important stimuli that the person faces at present. Contextual stimuli are less important than the focal stimuli and residual stimuli are unclear stimuli which are related to personal beliefs, attitude and properties (13, 14). Contextual and residual stimuli involve education and experiences of person (12). This model is a conceptual model with a special design which is widely used for guiding, research and training in many countries (10, 12). The results of most studies that have used this model in practice have been indicative of improvement of nursing activities, focus, organization and direction of thoughts and actions of nurses in taking care of chronic patients and increasing adaptive responses in patients in the four modes of RAM (9). For example, studies have shown that training based on RAM had positive effects on adaptation of patients with chronic obstructive pulmonary disorder (COPD) (15) and hemodialysis (16). Studies have shown that the use of nursing models and theories can be effective as an organized framework for evaluating the effectiveness of nursing actions and care programs in some patients. However, it is unknown whether these models are effective on the adaptation of veterans. As, in our search, we did not find any study that investigated the effects of nursing models and theories on these patients. Considering the remarkable number of veterans with amputation in Iran and deep effects of this disorder on their life as well as the few studies on adaptation of these patients, our researchers decided to design a RAM-guided education. BODY.2. OBJECTIVES: The aim of this study was to investigate the effects of RAM-guided education on promoting the adaptation of veterans with lower extremities amputation. BODY.3. PATIENTS AND METHODS: This study was a randomized clinical trial conducted during 2013 - 2014. Veterans with lower extremities amputation referring to Kowsar Orthotics and Prosthetics Center of Veterans Clinic in Tehran, Iran, were recruited with convenience method. This clinic is a referral center and patients refer to it from all parts of Iran. The mean differences and standard deviation in previous studies (2, 2.21) (17), alpha (0.05) and power level (90%), and the following formula were considered: (1)N=2(Z1-α2+Z1-β)2(μ1-μ2δ)2=2 (1.98 +1.28)2(22.21)2=26 Accordingly, the number of subjects in each group was estimated to be 26 persons and considering a drop-out rate of 20%, 62 subjects were included in the study. Then, successfully recruited, the recruiter randomly assigned the subjects into one of the two groups of intervention and control by the use of a simple random-numbers table. The table had been prepared by one of the researchers who was independent of data collection. The subjects were not notified of the group assignment until after the baseline data were collected. In addition, the randomization was kept concealed from the analyzer of data until the end of study. The inclusion criteria were ability to read and write in Farsi, age below 65 years, no affliction with known mental diseases, lack of spinal cord injury, and not being a chemical victim; the exclusion criteria included lack of tendency to continue participating in the study. After selection of the subjects, the goal of the research was explained to the subjects in addition to getting their informed consents. The subjects were explained the stages at the beginning. The researcher tried to coordinate the date of the next referral with the study prosthesis session for those who had transportation problem, as far as possible. The researcher also entertained them briefly while behaving politely and awarded a small gift (account book and felt-tip pen) to them. Lunch was prepared for the subjects when the educational class was organized and served in a quiet and suitable place. In this way, the researchers tried to attract participation and cooperation of the veterans. Data collection instruments included demographic characteristics and RAM questionnaires. A demographic characteristics form consisting of 16 questions was used to list the subjects' demographic properties. The researcher-made questionnaire contained 35 questions in four modes of physiologic, self-concept, role function and interdependence, which examined the adaptation level of the subjects. The physiologic mode included 15 questions relating to activity, rest, nutrition, excretion, blood circulation and oxygenation, liquids and electrolytes, and endogenous glands. The self-concept mode included 11 questions relating to physical self, mental self and personal self. The role function mode included five questions relating to family, family roles and family expectations and the interdependence mode included four questions about personal and social communication of the patient. The number of items was equal in all the questions. The questions were ranked based on Likert five-choice scale (never, seldom, sometimes, often and always) and the score of each question varied from 1 to 5. The questions had negative and positive aspects. The total range of the questionnaire was between 35 and 175 points. The upper scores showed better adaptation. The quantitative and qualitative validities of the questionnaire were examined. Content validity ratio (CVR) and content validity index (CVI) of the instrument were examined; the total CVI of the instrument was calculated 0.95 and CVI and CVR for each item of the questionnaire were larger than 0.79 and 0.51, respectively (18). To determine the reliability, test-retest method was used. In this way, the questionnaires were completed by 30 veterans with lower extremities amputation in two stages, each lasting two weeks; Pearson correlation coefficients (r) were 0.75, 0.83, 0.80 and 0.70 in physiologic, self-concept, role function and interdependence modes, respectively. Cronbach's alpha coefficients were acceptable for all the dimensions of the questionnaire (18). All the data were collected by one of the researchers (MSc student of military nursing with six years of experience). The subjects completed the questionnaires before as well as two months after the intervention. After filling the questionnaire in the first stage, data of the intervention group was examined and analyzed. After determining maladaptive behaviors in the intervention group, the RAM-guided education was implemented. The educational content was determined based on the responses of the subjects in the intervention group to the adaptation questionnaire and the identification of maladaptive behaviors as well as the stimuli of these behaviors in each of them. Education was presented with two collective and individual methods. In this regard, collective educational methods were used to modify the stimuli of maladaptive behaviors common among the subjects and face-to-face individual education was used to modify the stimuli of the special maladaptive behaviors for each one of the subjects. The collective education included organization of two sessions, each lasting two hours, with lecture education method within two weeks along with a 30-minute question and answer at the end of each session. For collective education, educational aid tools such as computer and projector were used for showing the slides prepared in Power Point software. An educational booklet was given to the subjects. This booklet contained information about the main problems of veterans with lower extremities amputation and related to the desired behaviors designed in the questionnaire. The subjects were followed within two months for following the performance of recommendations and elimination of problems by phone. The telephone number of the researcher was given to them to answer the potential questions of the subjects. After two months, both intervention and control groups completed the questionnaire again. During the research, one subject was excluded from the intervention group and one was excluded from the control group (3.22% drop-out) due to lack of tendency to continue participating in the research and travelling to another city, and finally, 60 persons were studied. The stages of the research are shown in Figure 1. Figure 1.The Study Process This research was confirmed by the Ethical Committee of AJA University of Medical Sciences and was registered in database of Iranian registry of clinical trials under code IRCT2014081118763N1. The ethical principles mentioned in Declaration of Helsinki were observed (19). The observed ethical considerations included receiving informed consent, justification the subjects about the research and its goals, observance of information confidentiality principle, and freedom of the subjects to give up study at any time of the research. The data was analyzed by SPSS software. Since the results of Kolmogorov-Smirnov test indicate normality of data (P > 0.05), descriptive statistics (mean, standard deviation, frequency and percentage) and analytical statistics (independent t-test, paired t-test, chi-squared test and Fisher's exact test) were used for analysis of data. A significance level of P > 0.05 was considered. BODY.4. RESULTS: The mean age of the studied subjects was 47.83 ± 8.29 years (range: 17 - 64 years). It is necessary to note that the youngest subject was a 17-year-old teenager from one of the border cities of Iran who had amputated lower extremities due to explosion of mine left from the wartime. Of the subjects, 98.3% were male, 51.7% had high school degree and lower degrees, 61.7% had lower extremities amputation lower the knee, and 83.3% were covered by the foundation of martyrs and veterans affairs (FMVA). All the subjects used prosthesis. The two groups had no significant differences in terms of individual characteristics (P > 0.05) (Table 1). Table 1. Individuals’ Properties in the Intervention and Control Groups a Characteristics Intervention Group Control Group P Value Age, mean ± SD, y 48.37 ± 4.48 47.30 ± 10.92 0.62 b Gender 0.50 c Male 30 (50.8) 29 (49.2) - Female 0 (0) 1 (100.0) - Weight, kg 80.33 ± 13.08 75.13 ± 9.97 0.08 b Education level 0.15 c < High school diploma 15 (48.4) 16 (51.6) - Academic degree 15 (51.7) 14 (48.3) - Employment 0.08 d Employed 9 (50.0) 9 (50.0) - Service retirement 10 (50.0) 10 (50.0) - Medical retirement 9 (75.0) 3 (25.0) Disabled 2 (20.0) 8 (80.0) - Marital status before amputation 0.66 c Married 10 (45.5) 12 (54.5) Single 19 (51.4) 18 (48.6) Marital status after amputation 0.55 c Married 29 (50.9) 28 (49.1) - Single 1 (33.3) 2 (66.7) Number of children 2.00 ± 0.96 2.63 ± 1.60 0.07 b Living with people at present 1.00 c Wife 2 (50.0) 2 (50.0) Wife and children 26 (50.0) 26 (50.0) Parents 2 (50.0) 2 (50.0) History of captivity 0.33 c Yes 0 (0) 1 (100.0) No 28 (49.1) 29 (50.9) Amputation level 0.59 c One lower extremity Above knee 2 (50.0) 2 (50.0) Through knee 0 (0) 1 (100.0) Below knee 18 (48.6) 19 (51.4) Two lower extremity Below knee 1 (25.0) 3 (75.0) One below and one above knee 1 (100.0) 0 (0) Concurrent amputation of the lower extremities and other handicaps 8 (61.5) 5 (38.5) Percentage of sacrifice 0.15 c 0% - 25% 2 (100.0) 0 (0) 26% - 49% 11 (57.9) 8 (42.1) 50% - 75% 14 (41.2) 20 (58.8) 75% < 4 (80.0) 1 (20.0) Time living with prosthesis, y 23.35 ± 7.14 21.35 ±8.90 0.34 b Known physical disease 0.79 c Yes 16 (51.6) 15 (48.4) No 14 (48.3) 15 (51.7) Daily physical activity, h 6.60 ± 2.55 6.77 ± 2.70 0.80 b Supported by Foundation of Martyrs and Veterans Affairs 0.48 c Yes 24 (48.0) 26 (52.0) No 6 (60.0) 4 (40.0) Total No. 30 30 a Data are presented as No. (%) or mean ± SD. b Independent t-test. c Fisher’s exact test. d Chi-squared test. According to the results of the independent samples t-test, no significant differences were found in the mean total score of adaptation as well as in the four modes in the intervention and control groups before the education (P < 0.05). However, this test revealed a statistical difference for the mean scores of physiologic (P = 0.0001) and role function modes (P = 0.004) as well as the total score of adaptation (P = 0.001) between the two groups after the education (Table 2). The results of paired t-test showed that the total score of adaptation (P = 0.006) as well as the scores of the physiologic (P = 0.001) and role function (P = 0.01) modes in the intervention group in the pre-test and post-test were significantly different, whereas the scores of self-concept (P = 0.21) and interdependence (P = 0.44) modes in the two stages did not have significant differences. This test did not show statistically significant differences in total score of adaptation (P = 0.64) and modes of physiologic (P = 0.63), self-concept (P = 0.79), role function (P = 1.00), and interdependence (P = 0.32) in control group in the stages of pre-test and post-test (P < 0.05). Table 2. The Mean and Standard Deviation of Adaptation and the Four Modes in the Two Groups a Modes of Adaptation Group Independent Sample t-test (P Value) Intervention Control Pre-test Physiologic 56.33 ± 7.60 54.23 ± 8.37 0.31 Self-concept 41.23 ± 4.98 39.23 ± 6.21 0.17 Role function 19.03 ± 2.57 18.13 ± 3.80 0.28 Interdependence 17.03 ± 2.25 16.73 ± 2.61 0.63 Total adaptation score 133.63 ± 12.49 128.33 ± 17.34 0.18 Post-test Physiologic 60.26 ± 5.45 53.73 ± 7.79 0.0001 b Self-concept 42.10 ± 4.71 39.40 ± 5.67 0.05 Role function 20.30 ± 2.42 18.13 ± 3.18 0.004 b Interdependence 16.76 ± 2.22 16.30 ± 2.57 0.45 Total adaptation score 139.43 ± 10.87 127.56 ± 14.55 0.001 b a Data are presented as mean ± SD. b Significant at the P < 0.05. BODY.5. DISCUSSION: The present research was conducted to determine the effects of RAM-guided education on promoting the adaptation of veterans with lower extremities amputation. The results indicated that intervention and control groups did not have statistically significant differences in terms of adaptation score and modes of RAM (P < 0.05) before the intervention, which indicated the homogeneity of the two groups. After the intervention, the two groups had a statistically significant difference in terms of physiologic mode. Therefore, the scores in the intervention group were higher than the control group. In addition, the results of paired t-test showed a statistically significant difference between the scores of physiologic mode in the intervention group before and after the intervention and led to an increase in the score of this mode. This case indicated the effectiveness of RAM-guided education in the intervention group and in increasing their adaptation level in the physiologic mode. Similar results have also been reported in other studies which are in line with the results of this research (10, 15, 16, 20-22). The present study showed that RAM-guided intervention had a significant effect on the patients' role function. RAM-guided education increases patients' knowledge, better controls the situation, and consequently promotes the role function. Similar findings regarding the impact of nursing education on role function (10, 15, 16, 20-22) confirm our finding. In the current study, after the intervention, the two groups did not have any statistically significant difference in terms of self-concept mode. Unlike this finding, a significant improvement was reported in self-concept of patients with hemodialysis and (chronic obstructive pulmonary disease) COPD after conducting RAM-guided patient education (15, 16). Naeim Hassani et al. in a study on effect of educational program based on RAM on mental adaptation of patients with heart failure also showed significant decrease in the number of maladaptive behaviors in the self-concept of the intervention group (22). Our intervention could not increase the score of dependence/interdependence mode. There are controversy findings in this regard. Our finding is similar to some studies (15, 16) and is different from some others (22). Likely, the reasons for lack of significant effect of the educational plan in these modes are short-term educational course and follow-up period. It seems that if the educational plan is executed in a longer term and experiences of other healthcare personnel such as psychologists and social workers are used, there may be more evident changes in adaptation of patients in these modes. In fact, there is need for more specialized interventions to achieve more changes in modes, particularly self-concept and interdependence modes. These patients need more social, family and emotional supports and execution of many interventions was beyond the capacity of the researcher considering the term of study. It is necessary to note that the score obtained in all the modes and the total score of adaptation in the intervention group were higher than those of the control group. Generally, the results of this research indicated that RAM-guided education increased adaptation in veterans with lower extremities amputation. The obtained results emphasized on the successive educational courses in a proper manner after amputation. This plan can increase the feeling of usefulness and the activity level in this group of patients, after which, adaptation will increase. Considering that imposed war victims are covered under the insurance of the Armed Forces and are supported by the FMVA, their occupational and economic problems have been adjusted to some extent. However, the increase and continuity of mental and physical supporting actions such as education, timely treatment, and counseling services can considerably help them. The recognition of the adaptation sources in the veterans and their reinforcement for more adaptation to disease can promote health and finally improve their quality of life. One of the limitations of this research was the nonrandom sampling, which introduced a potential for sampling bias. One of the other limitations was the short term of the course and follow up and small sample size. It is recommended that similar studies replicate with larger sample sizes and long-term follow-ups. An additional limitation was using self-report questionnaire, which could lead to response bias. Considering that Iran-Iraq war was ended many years ago and there might be adaptation over time, attempt was made in this study to use the people who had amputated extremities recently during elimination of minefields, through which this limitation can be controlled to some extent. Unfortunately, such persons did not refer to the research place during the study. The findings of the present study showed that RAM-guided education given to the veterans with lower extremities amputation had a positive effect on their physiologic and role-function modes as well as on the total score of adaptation. However, as to self-concept and interdependence modes, it did not confirm to be completely effective. The present research can be regarded as a basis of future studies. Considering the results of this research, it is recommended to study the effects of RAM-guided education on quality of life and adaptation of other veterans and their families.

TITLE: Vitamin B12 Supplementation in Treating Major Depressive Disorder: A Randomized Controlled Trial ABSTRACT.BACKGROUND/OBJECTIVE: : Recent literature has identified links between vitamin B12 deficiency and depression.We compared the clinical response of SSRI-monotherapy with that of B12-augmentation in a sample of depressed patients with low normal B12 levels who responded inadequately to the first trial with the SSRIs. ABSTRACT.METHODS: : Patients with depression and low normal B12 levels were randomized to a control arm (antidepressant only) or treatment arm (antidepressants and injectable vitamin B12 supplementation). ABSTRACT.RESULTS: : A total of 199 depressed patients were screened. Out of 73 patients with low normal B12 levels 34 (47%) were randomized to the treatment group while 39 (53%) were randomized to the control arm. At three months follow up 100% of the treatment group showed at least a 20% reduction in HAM-D score, while only 69% in the control arm showed at least a 20% reduction in HAM-D score (p<0.001). The findings remained significant after adjusting for baseline HAM-D score (p=0.001). ABSTRACT.CONCLUSION: : Vitamin B12 supplementation with antidepressants significantly improved depressive symptoms in our cohort. BODY.INTRODUCTION: Major Depressive Disorder is an important global public health problem associated with the significant burden and is projected to be the second leading cause of disability by 2020 [1]. Prevalence figures worldwide range between 4.2 – 17% and a systematic review of studies from Pakistan gave the estimates as high as 34% for anxiety and depressive disorders [2]. Clinical guidelines recommend the use of SSRIs as first-line treatment [3]. Remission rates in the acute phase of treatment are 30-40% and an overall 30% show poor response to anti-depressant monotherapy [4-6]. In such cases, addressing other co-morbid conditions is suggested in addition to upgrading or augmenting anti-depressant doses [3]. Pakistan, a developing country of 17 million people, is fraught with poverty, inadequate nutrition and underprivileged health systems. Several small-case studies from Pakistan show vitamin deficiencies to be common [7,8]. A small study from Islamabad on a clinical population of patients with megaloblastic anemia reported figures of 76% with vitamin B12 deficiency [9]. Although no large scale studies on general population are available here, studies from neighboring countries that share the culture and climate show vitamin deficiencies to be common [10-12]. A study on a healthy Indian population showed the prevalence of B12 deficiency to be 47% [13]. Vitamin B12 plays an important role in DNA synthesis and neurological function. Its deficiency is associated with hematological, neurological and psychiatric manifestations of which the latter includes irritability, personality change, depression, dementia and rarely, psychosis [14]. Recent literature has identified the links between this vitamin deficiency and depression. High B12 levels in serum are associated with good treatment response, high homocysteine levels which are common in folate / B12 deficiency and in those suffering from depression are associated with poor response to anti depressant treatment [15-17]. Hyperhomocysteinemia may have direct effects on neurotransmitters implicated in depression [18]. Randomized trials have shown that folate and other nutritional supplementations have a significant effect in treating the treatment-resistant depression [19,20]. Folate deficiency has also been linked with the delay in treatment response as well as relapse [21,22]. To date no adequately designed trial compares anti-depressant monotherapy with B12 augmentation. We aimed to compare the clinical response of antidepressants monotherapy with that of B12-augmentation in a sample of depressed patients with low normalB12 levels (190 pg/ml to 300 pg/ml). BODY.METHODS: The study was designed as an open label randomized controlled trial (clinical trials registration number (Clinical Trials.gov ID NCT00939718). Patients were enrolled from outpatient clinics of the department of Psychiatry at Aga Khan University Hospital, Karachi Pakistan from December 2009 - June 2010. Depression was defined as Patients scoring ≥ 16 on the 20-item Hamilton Rating Scale for Depression-Urdu version (HAM-D) [23,24]. Low normal B12 level was defined as B12 level ranging between 190 and 300 pg/ml. Patients with B12 deficiency (level below190 pg/ml) were not enrolled due to ethical reasons (patients with established B12 deficiency must be treated and not subjected to randomization). BODY.METHODS.ETHICS STATEMENT: A study protocol was approved by the Ethics Review Committee of Aga Khan University hospital. All patients signed an informed consent form. BODY.METHODS.RANDOMIZATION AND MASKING: Patients with depression and low normal B12 levels were randomized by a computer program into the control arm (antidepressants only) or treatment arm (antidepressants and injectable vitamin B12 supplementation). The randomization was carried out using a Microsoft Excel spreadsheet using the function "RAND" to generate uniform random numbers. The randomized assignment was determined by partitioning the range of the random number. Randomization was not concealed for investigators. Antidepressants that were prescribed included either a tricyclic antidepressant (TCA) with a dose equivalent of imipramine 100 mg to 250 mg/ day and the SSRIs dose equivalent of Fluoxetine 20 – 40 mg/day. Patients with concurrent unstable medical illness, history of manic episodes or psychotic illness, psychotic symptoms in a depressive episode, concurrent substance misuse and patients with suicidal ideation were excluded. Participants in the control arm only received the antidepressants. Those in the treatment arm received B12 intramuscular injectable as 1000 mcg every week during the 6 weeks in addition to the antidepressants. Any adverse effects of oral medications and injections (B12) were monitored and documented on an adverse effects sheet in the patient folder. A decline in HAM-D score of 20% or more from the baseline, indicating an improvement in depression, was defined as the primary outcome. The total change in HAM-D score from baseline to follow up was defined as a secondary outcome. Additional secondary outcomes included the follow up HAM-D score and a reduction in HAM-D score of 50% or more from the baseline. Follow up of the HAM-D score was recorded during 12 weeks by a research officer who was unaware of the patient's randomization. BODY.METHODS.STATISTICAL CONSIDERATIONS: A total of 248 patients equally allocated to the two groups provides at least 90 percent power, with a 5 percent type I error rate, using a two-sided hypothesis test. This calculation assumes an anticipated difference in the response rate of 20 percent between the two groups with a 30 percent response rate in the SSRI group and at least a 50 percent response rate in the combination treatment group. Considering a 15 percent dropout rate in each group, an additional sample of 44 patients equally divided into the two groups would be needed to yield a total required sample size of 292 patients. Therefore, the target sample size for each arm was 146. Descriptive statistics were prepared for all characteristics including means and standard deviations for continuous measures and frequencies and percentages for categorical measures. Chi-square or Fisher's exact tests were used to compare categorical baseline characteristics. Two-sample t tests were used to compare continuous baseline characteristics. Chi-square tests were used to examine the association between treatment and the 20% and 50% reductions in HAM-D outcomes. These analyses were extended to logistic regression to adjust for the baseline HAM-D score. Two-sample t tests were used to examine the association between treatment and the follow up HAM-D score or change in HAM-D score from baseline to follow up. These analyses were extended to analysis of covariance to adjust for the baseline HAM-D score. All hypotheses tests were two-sided and p-values less than 0.05 were considered statistically significant. Analyses were conducted using SAS Version 9.2 (SAS Institute, Inc., Cary, NC, USA). BODY.METHODS.RESULTS: A total of 199 depressed patients were screened for the B12 levels. Vitamin B12 deficiency was present in 44 (22%) patients; 73 (36%) had low normal B12 levels and 82 (42%) had normal B12 levels. Patients with low B12 levels were given the prescriptions for B12 replacement therapy in addition to the antidepressants. These patients were not randomized. Out of 73 patients with low normal B12 levels 34 (47%) were randomized to the treatment group while 39 (53%) were randomized to the control arm. There were no significant differences between the two groups at baseline except for the higher depression scores in the treatment group (Table 1). No adverse effects or complications were noted in either group. For the primary outcome of 20% reduction in HAM-D score, significantly more subjects from the treatment group showed a 20% reduction unadjusted for baseline HAM-D score (100% vs. 69%; p < 0.001). Examining a50% reduction from baseline, this effect remained significant (44% vs. 5%; p < 0.001). We also adjusted the analyses of reduction for the baseline HAM-D score and our findings remained significant (Table 2). Additionally, the change in HAM-D score was significantly greater for the treatment group, unadjusted and adjusted for the baseline HAM-D score (Table 2). BODY.DISCUSSION: Coexistence of depression and vitamin B12 deficiency are not uncommon. These patients are routinely treated with SSRI and B12 supplementation, however it is not well established whether the people with low normal B12 and co-occurring depression should also receive B12 supplementation. Our study tried to address this issue. Despite not attaining the targeted sample size, the findings appear significant. Vitamin B12 deficiency was present in 22% of our depressed population. This frequency is high in a non-vegetarian, relatively young, middle to upper income population of our patients. A recent study of healthy adults from Karachi showed a population based prevalence of vitamin B12 deficiency (less than 200 pg/ml) in 9.74% people [25]. These findings indicate a substantial co-morbidity of B12 deficiency (22%) in our depressed patient population. To our knowledge, this is the first randomized control trial in Pakistani population which has looked at clinically depressed patients with low B12 levels. We did not randomize B12 deficient patients due to ethical reasons. Low normal B12 levels were present in 36% of patients. These patients are often not treated with B12 supplementation. The findings of our study clearly indicate that these patients demonstrated significant improvement with B12 supplementation in addition to SSRI as compared to the control group even after adjustment for baseline HAM-D score. We think that these patients represent sub group within the clinically depressed population and a supplementation with B12 along with the conventional antidepressants may be a useful strategy in the treatment of depression in such cases. We did not give sham injections to the control group. A placebo response due to injections may be responsible for the significant improvement in the treatment group. We also did not look at differences in response at specific doses of antidepressants nor did we stratify our groups on the basis of type of antidepressants prescribed. We also could not reach our sample size because we were not able to get another extension in our grant. Due to financial constraints we were not able to obtain final B12 levels. These are some of the limitations of our study. However, these findings have important clinical implications. B12 deficiency and low normal B12 levels are common and may be associated with depression and the inadequate response to antidepressant treatment in patients with depression. Vitamin B12 supplementation with antidepressants has significantly improved depressive symptoms in our group. Larger, multi-center studies are required to extend and replicate our findings. BODY.CONFLICT OF INTEREST: Authors have no conflicts of interests to declare

TITLE: Oxybutynin and Tolterodine in a Trial for Treatment of Overactive Bladder in Iranian Women ABSTRACT.OBJECTIVE: To evaluate the efficacy and side effects of Oxybutinin in comparison to tolterodine in treatment of overactive bladder (OAB) with detrussor overactivity (DOA) in Iranian women. ABSTRACT.MATERIALS AND METHODS: One hundred Iranian old women with clinical symptoms of OAB who show IDO in the filling cystometry participated in this randomized double-blinded parallel-group by using two kinds of the drugs for 4- week course (2 mg tolterodine twice-daily, or oxybutinin 5 mg, three times a day) in alike packages. We collected data from 3-day FVC before and after the treatment course. The effectiveness of each drug was studied using the paired t-test and improvement after treatment between two groups was compared by independent T-test. ABSTRACT.RESULTS: Positive changes in urinary urgency, Frequency and Urge incontinence after treatment in both groups were seen but mean improvements in the all were larger in the patients who treated by oxybutinin especially in terms of urgency and Urge incontinence. Dry mouth was the most common side-effect in two groups. Unlike other studies it was higher in the tolterodine group but the difference was not significant. ABSTRACT.CONCLUSION: Four week treatment with oxybutinin was better than tolterodine in improving urgency and urge incontinence but there were not statistically significance between them. BODY.INTRODUCTION: Oxybutynin and Tolterodin are two highly effective anticholinergic drugs suitable for treatment of overactive bladder (OAB) syndrome. Each drug has a different specificity to bladder muscarinic receptors, thus different adverse effect profiles should be considered. Additionally different individuals experience the symptoms of OAB and the adverse effect to different extents, therefore quality of life is affected differently in the patients with OAB. Previous findings supported similar efficacy of both drugs in different types and doses in improvement of symptoms of OAB, but in order to reduce the adverse side effects tolterodin was recommended and oxybutinine may minimize treatment costs (1–8). Determining the lowest therapeutic dose of the drugs helps in selecting different preparations regarding to the prominent symptom, cost and adverse effects. This study was designed to determine the effectiveness of oxybutinin (5 mg IR tablet t.d.s.) vs. Tolterodin (2 mg IR table b.i.d.) in treatment of the OAB. BODY.MATERIALS AND METHODS: In this randomized, double-blind, parallel-group trial conducted in a hospital related to Tehran University of Medical Sciences, Tehran, Iran, female outpatients with documented over active bladder syndrome [urinary frequency (>or=8 micturations /24 hours) plus urge incontinence (>or=5 episodes/week)] who show idiopathic detrussor overactivity (IDO) in the filling cystometry were randomized to receive oral treatment with oxybutynin hydrochloride tablet (5 mg, Iran Daru Co., Iran) every 8 hours or tolterodin tablet ( 2mg, Loghman Co., Iran) twice daily for 4 weeks. The study included all eligible patients from February 2011 till February 2012. A 3-day frequency volume chart (FVC) was obtained before and after the treatment course. Subjective and objective symptoms were assessed before, and one month after treatment. The effectiveness of each drug was compared using the paired samples t-test. BODY.RESULTS: Totally 100 women with the age of 53 ± 12 years (mean ± SD) were included. Mean subjective daytime and night-time frequency, urgency and incontinency significantly decreased after treatment in both groups. On a 3-day frequency-volume chart, after treatment with oxybutinin the daytime and the night-time frequency of patients decreased 22% (p= 0.000) and 17.6% (p= 0.035) respectively. In tolterodin group, the daytime and the night-time frequency of patients decreased 16.4% (P=.000) and 24.3% (P=.006). The evaluation of urinary urgency showed significant decrease in both groups. The urinary urgency and nocturnal urinary urgency were decreased by 58.8% (p= 0.008) and 39.7% (p= 0.001) respectively in Oxybutinin group and 41.8% (p= 0.000) and 39.1% (p= 0.001) respectively in Tolterodine group. There was a statistically significant decrease in episodes of incontinence with oxybutinin (46.7%; P=0.001) also a significant decrease in patients treated with tolterodine (39.7%; p= 0.002). In this study the discontinuation of treatment due to adverse events had no significant difference in two groups (6% and 8% in oxybutinin and tolterodine group respectively, p= 0.082) dry mouth was the most common side-effect in both groups (30% in oxybutinin group and 26% in tolterodine group). BODY.DISCUSSION: Anticholinergics are the mainstay of pharmacotherapy for OAB. Evidence for their efficacy is mostly derived from short-term phase III randomized drug trials (9). Different patients experience the symptoms of OAB (frequency, urgency, urge incontinency) to different extents. These findings remind the importance of selecting the drug which most effectively improves the prominent complaints impressing the quality of life in people with OAB especially in elderly (1, 2). Therefore researches are being conducted on different types and the lowest therapeutic dose of anticholinergic drugs. Although it acts on all types tolterodine is more commonly known to act on M2 and M3 subtypes of muscarinic receptors (10). In comparison to oxybutynin (M3 and M1 selective, but more so in the parotid than in the bladder) tolterodine is claimed to have fewer side effects as it targets the bladder more than other areas of the body (10). Treatment with oxybutynin and tolterodin as different anticholinergic types (immediate-release or extended-release tablets) have shown a similar efficacy in improving urination diary variables in patients with overactive bladder (7, 8, 11, 12). Previous studies said the discontinuation rates caused by adverse events were similar between the two formulations. But extended release (ER) preparations are more expensive than the others (12). In addition to similar efficacy and adverse effects, cost and the effect on the most prominent symptom have essential roles in choosing the appropriate treatment. There is a trend for detecting the lowest therapeutic dose of anticholinergic drugs in the treatment of OAB in elderly because of 32% reported rate of using other drugs with anticholinergic effects in elderly which leads to cumulative adverse effects (13). There were not statistically significant differences between the different doses of oxybutinin and tolterodin [(5 vs. 10 mg ER tablet of oxybutinin) (4, 12), (5 mg IR tablet of oxybutinin three times a day vs. 2mg IR tablet of tolterodin two times a day) (7, 8, 12) and (2 x 2 mg IR tablet vs. 4mg ER of tolterodin) (11, 12)]. Although differences were found in the length of the studies but regarding to achieve an appropriate improvement in OAB symptoms, the 4-week treatment course was recommended (11, 12). More severe and frequent dry mouth episodes was seen in whom took oxybutynin immediate-release (IR) compared to other preparations (11). In this study 2.5mg IR tablet of oxybutinin three times a day was used and statistically significant differences for improvement in frequency, urgency and urge incontinence episodes were seen. This recommended dose of oxybutinin (5mg IR tablet three times a day) is associated with therapeutic effect and fewer adverse effects especially dry mouth, and may thus be preferable. Thus determining the lowest therapeutic dose of the drugs is mandatory in treatment designation with different preparations regarding to cost effectiveness and decreased adverse effects. In this study the adverse events resulted in discontinuation of treatment were similar in two groups. This result is in contrast to some other studies concerning tolterodine to have fewer adverse effects in comparison to oxybutinin (7, 12). Different age groups under study and ethnic disparities may interpret the distinction. OAB is presented with various symptoms. Urgency in 54% and urge incontinence in 36% of patients with OAB were seen (13). In present study improvements in urinary urgency, frequency and urge incontinence after treatment were seen in both groups. Improvement score in patients treated by oxybutinin was larger especially in terms of urgency and urge incontinence. Therefore in patients with OAB with the chief complain of urgency or urge incontinence oxybutinin regimen should be recommended. Night-time frequency was shown to be improved by a significantly larger score by tolterodin. Respectively for elderly patients in whom the most troublesome complaint is mentioned to be nocturnal frequency and disturbed sleep pattern prescription of tolterodin is suggested. Mostly the studies have implemented that applying FVCs of ≥3 days can be used to monitor therapeutic outcomes of drugs in OAB (14). Our data collected from micturation diaries of 3 days were recorded by the patients being educated by a selected gynecology resident. If this method is used, it is recommended to train the patients and monitor for chart fulfilling method in a continuous manner. In conclusion, difference in the symptoms of patients which reduce their quality of life in planning a course of treatment should be considered. Physicians should consider the patients' prominent symptom in selecting a kind of antimuscarinic drug for treatment of overactive bladder syndrome.

TITLE: Local Administration of Tranexamic Acid During Prostatectomy Surgery: Effects on Reducing the Amount of Bleeding ABSTRACT.BACKGROUND: One of the issues in prostatectomy surgery is bleeding. Although tranexamic acid (TRA) is an antifibrinolytic agent for reducing bleeding, controversies surround its use. ABSTRACT.OBJECTIVES: In this study, the effect of local administration of TRA on reducing bleeding during prostatectomy surgery was evaluated. ABSTRACT.METHODS: A total of 186 patients who underwent prostatectomy surgery were assessed in this clinical trial study. Patients were divided randomly into two groups. After prostate removal, TRA (500 mg TRA with 5 mL total volume) to the intervention group and normal saline to the control group were sprayed with the same volume. At the end of surgery, the prescribed blood bags were measured and recorded. Hemoglobin and platelet levels were recorded 6 hours after the test. Moreover, the amounts of blood inside the blood bags in the first 24 hours, the second 24 hours, and the total length of hospital stay were recorded and compared in each group. ABSTRACT.RESULTS: By comparing the measured values before and after surgery, we found that the amounts of hemoglobin, hematocrit, and platelet decreased. The mean blood loss in the intervention group was recorded at 340 mL and that in the control group was 515 mL. The maximum bleeding in the control group was almost twice as much as that in the intervention group. Blood loss in the intervention group with the administration of TRA was significantly lesser than that in the control group (P = 0.01). The decrease in platelet level in the intervention group was significantly lower than that in the control group (P = 0.03). ABSTRACT.CONCLUSIONS: The present study showed that local administration of TRA significantly reduces bleeding after prostatectomy surgery and is effective in preventing postoperative hemoglobin decrease. BODY.1. BACKGROUND: Benign prostatic hyperplasia (BPH) is a major public health problem affecting men older than 50 years of age (1, 2). In 2008, BPH was the second most frequently diagnosed cancer in men worldwide with an estimated 899,000 new cases (13% of all new cancer cases) (3-7). These tumors can be managed in different ways. Despite the introduction of laparoscopy (including robotic-assisted approaches), open radical retropubic prostatectomy is still the standard surgical treatment for localized prostate cancer (4, 7-11). The historical gold standard of transurethral resection of prostate (TURP), which is an effective procedure, is still associated with the risk of intraoperative and postoperative bleeding (2, 12-14). Factors that influence perioperative and postoperative blood loss include prostate weight, weight of the resected tissue, operating time, preoperative urine culture, preoperative finasteride treatment, use of acetylsalicylic acid, type of anesthesia, patient age, and blood pressure although some of these associations remain controversial (2). Consequently, patients undergoing open radical prostatectomy usually require blood transfusion to restore tissue oxygenation (4, 15, 16). Nonetheless, blood transfusions have rare but potentially serious adverse effects, including hemolytic reactions (acute and delayed), acute lung injury, coagulopathic complications from massive transfusion, mistransfusion, and non-immune hemolysis and transfusion-associated infections (4, 17-19). Additionally, as blood is a scarce resource, substantial economic costs are associated with allogeneic transfusions (4, 20). Recently, a growing body of evidence has indicated that tranexamic acid (TRA) is an effective agent for reducing blood loss in different surgeries (2, 21, 22). In the literature, 16 studies evaluating the use of TRA in cardiac surgery, 6 trials in upper gastrointestinal bleeding, 3 trials in oral surgery, 2 trials in orthopedic surgery, X trials in gynecological surgery, and several other trials evaluating the use of TRA in other indications were included (23). TRA, a synthetic derivative of the amino acid lysine that exerts an antifibrinolytic action, is the standard treatment used to reduce the rate of perioperative and intraoperative transfusion by preventing the breakdown of fibrin and stabilizing blood clots (2, 4, 23-26). Treatment with TRA does not seem to adversely affect mortality and morbidity (4, 27). Moreover, TRA is less expensive than other hemostatic drugs (4, 28). BODY.2. OBJECTIVES: We conducted a randomized controlled trial to assess the efficacy of TRA in reducing the amount of bleeding and the rate of blood transfusion in patients undergoing prostatectomy and the long-term safety of this treatment. BODY.3. METHODS: Approval was obtained from the ethics committee of Tehran University of Medical Sciences. After conducting preliminary studies and applying the inclusion and exclusion criteria, patients who were scheduled for elective prostatectomy were enrolled in the clinical trial. The following patients were excluded from the study: using anticoagulant drugs such as aspirin and dipyridamole, with high PT (prothrombin time) and PTT (partial thromboplastin time) for any reason, with any history of thrombotic events, with a history of bleeding disorders, with chronic kidney disease (serum creatinine > 180 μmol/L), with cardiovascular disease treated with drug eluting stent, with atrial fibrillation, with congenital or acquired thrombophilia, with known or suspected allergy to TRA, and undergoing general or epidural anesthesia with the acknowledgment of the supervising physician. The patients were divided randomly into two groups. After prostate removal, TRA to the intervention group (500 mg TRA with 5 mL total volume) and normal saline to the control group were sprayed with the same volume and speed. In all patients, hemoglobin, platelet, and hematocrit were measured and recorded the day before surgery and 24 hours after surgery. All patients underwent spinal anesthesia and were operated by the same surgical team. Surgeon and patient were unaware of the study and intervention. At the end of surgery, another colleague counted the prescribed blood bags, and the hemoglobin and platelet levels were measured and recorded 6 hours after the test. In addition, the amount of blood inside the blood bags was recorded and compared in the two groups in the first 24 hours, the second 24 hours, and the total length of hospital stay. The number of transfused blood bags in 24 hours after surgery was recorded for each patient. After the completion of forms for all patients, information was entered and analyzed using SPSS software. Qualitative variables were analyzed by the chi-square test and quantitative variables by the t-test. P value was considered statistically significant at P < 0.05. The level of significant in all testing was 95%. BODY.4. RESULTS: A total of 186 patients were finally assessed. Patients in the intervention group were aged 49 - 86 years (9.9 ± 67.7), and those in the control group were aged 51 - 88 years (8.9 ± 64.9). Patients in both groups were in class I and II ASA (American statistical association) on average. Duration of the surgery was reported at 1 h and 15 min in the intervention group and 1 hour and 20 minutes in the control group. Weight of patients in both groups was in the range of 60 - 80 kg with no significant difference. Prostate weight in all patients was 70 - 90 g. No statistically significant differences were found between the two groups in age, prostate size, and duration of surgery. Hemoglobin, hematocrit, platelets, and bleeding were measured in two innings before and after surgery and then recorded. Comparison of the measured values before and after surgery indicated that the amount of hemoglobin, hematocrit, and platelets all declined. According to the results of the statistical analysis, the intervention group had a mean blood loss of 340 mL and the control group had a mean blood loss of 515 mL. Despite the equality of the minimum amount of bleeding in both groups, the maximum amount of bleeding in the control group was found to be almost twice as much as that in the intervention group. The low blood loss in the intervention group with the administration of TRA after prostatectomy was statistically significant (P = 0.01). The decrease in hemoglobin and hematocrit levels after surgery were lesser in the intervention group than in the control group, and this difference was statistically significant (P = 0.04, respectively, and P = 0.05). In addition, the decrease in platelets level in the intervention group was also significantly lower than that in the control group (P = 0.03). These considerable reasons can account for the lower rate of bleeding in the intervention group with the TRA prescription than in the control group. After surgery, none of the patients who received TRA suffered from vascular events, such as thromboembolism, pulmonary embolism, CVA (cerebrovascular accident), MI (myocardial infarction), DVT (Deep vein thrombosis), etc. Only one patient suffered from severe bleeding during surgery which leaded to increased heart rate and reduced blood pressure. As previously mentioned, the amount of hemoglobin reduction, the amount of bleeding after surgery, and the subsequent need for pack cell transfusion were lower in the intervention group than in the control group. In the control group, five patients had to undergo pack cell transfusion, whereas none of the patients in the case group received pack cell transfusion. Table 1. Variable of Intervention Group Variable Minimum Maximum Mean ± Pre-operation Hb, g/dL 11.9 16.8 14.24 ± 1.54 HCT 36.3 53 42.53 ± 3.89 PLT 153 340 217.69 ± 44.11 Post-operation Hb, g/dL 9.9 15.6 12.31 ± 1.62 HCT 31 59 38.14 ± 6.46 PLT 131 308 197.96 ± 40.24 Bleeding 100 750 340 ± 152.1 Table 2. Variables of the Control Group Variable Minimum Maximum Mean ± SD Pre-operaiotn HbHb, g/dL 11.8 17.2 14.39 ± 1.6 HCT 34.8 54 42.88 ± 5.09 PLT 120 370 206.4 ± 54.31 Post-operation HbHb, g/dL 10.1 16.6 12.43 ± 1.73 HCT 22.9 58 37.38 ± 7.34 PLT 107 363 187.53 ± 57.54 Table 3. Variable Difference Between the Two Groups Variable Mean ± SD ΔHb Case 1.9267 ± 1.02877 Control 1.9533 ± 1.25817 ΔHCT Case 4.5867 ± 4.12312 Control 5.1089 ± 5.28638 ΔPLT Case 19.73 ± 26.042 Control 15.87 ± 17.449 BODY.5. DISCUSSION: To the best of our knowledge, only one study has ever used intraoperative IV TRA to reduce the amount of bleeding in prostatectomy. Crescenti (4) evaluated the effect of TRA on blood loss after prostatectomy in 200 patients and found that 34% of those in the TRA group and 55% of those in the control group received blood. According to the results, a 232 mL bleeding reduction was observed in the TRA group. These results are close to findings obtained from the current study. In other studies, topical TRA was used to control local bleeding. For example, the topical use of TRA was found to control bleeding in patients with bleeding disorders undergoing gynecologic surgery (29). The effects of topical application of this drug was positively considered in reducing bleeding after tooth extraction in children with hemophilia and after orthopedic surgery (25, 30). Fawzy found that the topical use of TRA in patients undergoing coronary artery bypass significantly led to low blood loss with no additional adverse effects (31). Krohn et al. (32) evaluated the effects of topical use of TRA on the amount of bleeding after lumbar vertebra fixation surgery and fibrinolysis of drainage blood in 30 patients. According to the results, the mean blood loss was reduced by half from 525 mL to 252 mL (P = 0.02) in the TRA group. Abrishami et al. (33) found that the topical application of anti-fibrinolytic agents, particularly aprotinin or TRA, reduced the amount of bleeding in the first 24 hours after surgery and led to transfusion saving of one unit of isogroup blood for each patient. De Bonis showed that topical use of TRA (1 g of TRA diluted in 100 ml normal saline topically) in the pericardium after CABG (coronary artery bypass graft) in patients undergoing primary coronary artery bypass caused a significant reduction of postoperative bleeding compared with the placebo (34). Similar results were obtained in the present and other studies. Postoperative anemia is also a major problem that contributes to increased morbidity and mortality (35) and prolonged hospitalization (36). Previous studies showed that topical application of TRA decreased the post-operative blood hemoglobin reduction. Seo et al. (36) reported that intravenous administration of TRA was more effective than its topical application in the prevention of blood hemoglobin reduction. However, some studies produced opposite conclusions. Yasim et al. (37) showed that applying topical aprotinin and TRA reduced postoperative bleeding during heart surgery, but this difference was not statistically significant Moreover, the difference between aprotinin and TRA in decreasing blood transfusion demand was not statistically significant. The current study chose to evaluate TRA as recent studies have demonstrated that the local use of either TRA or aprotinin could practically decrease the rate of post-cardiac surgery bleeding. Although the strength of local administration of TRA has been observed to be the same as that of local administration of aprotinin in decreasing bleeding, the former is potentially more safer and inexpensive than the latter (38). However, not all researchers agree on this finding (37). Nevertheless, note that aprotinin may be more preferable to TRA in surgeries such as cardiac surgery, which has a high risk of bleeding (27). TRA comprises small molecules (molecular weight 157 Daltons) that interfere with the connection point of lysine to plasminogen and their product of transforming to plasmin. It exclusively prevents plasmin from accessing fibrin and has no other direct effect on hemostasis. Conversely, aprotinin, which is a non-exclusive serine inhibitor, directly inhibits plasmin in low density and makes the contact phase of the inner route of hemostasis easy in high density, thus resulting to minimal anti-coagulation effects (38). In the mechanism of the local administration of TRA, a 150% increase was observed in the density of plasmin/alpha 2-antiplasmin and D-dimer in the drainage blood of the TRA group 1 hour after surgery. The increase was 320% and 260% in the observed group, respectively. No side effects were reported in the local use of this type of medicine. Eventually, the local use of antifibrinolytic was concluded to reduce post-surgery bleeding and the necessity for blood transfusion in patients undergoing on-pump cardiac surgery (31). A new meta-analysis on the use of transamin for decreasing bleeding volume was published (39). In this study, platelet and coagulation disorders simultaneously affect the whole bleeding volume. For instance, hypotensive anesthesia, correct position of the patient and patient volume correction greatly affect the decreasing waste bleeding, which needs to be evaluated in future studies. BODY.5. DISCUSSION.5.1. CONCLUSION: Taking the effects of TRA in preventing postoperative hemoglobin into account, the intravenous administration of this drug is more effective than topical treatments used in surgery. The most common surgical side effect of prostatectomy is bleeding, but any attempt to use hemostatic agents to control it has not been successful. TRA is a safe and effective drug for reducing bleeding during and after surgery in prostatectomy and is recommended for routine use. Future studies can perform ROTEM (rotational thromboelastometry) and measure the intraoperative hemoglobin level.

TITLE: Short-term SSRI treatment normalises amygdala hyperactivity in depressed patients ABSTRACT.BACKGROUND: Antidepressant drugs such as selective serotonin re-uptake inhibitors (SSRIs) remediate negative biases in emotional processing in depressed patients in both behavioural and neural outcome measures. However, it is not clear if these effects occur before, or as a consequence of, changes in clinical state. ABSTRACT.METHOD: In the present study, we investigated the effects of short-term SSRI treatment in depressed patients on the neural response to fearful faces prior to clinical improvement in mood. Altogether, 42 unmedicated depressed patients received SSRI treatment (10 mg escitalopram daily) or placebo in a randomised, parallel-group design. The neural response to fearful and happy faces was measured on day 7 of treatment using functional magnetic resonance imaging. A group of healthy controls was imaged in the same way. ABSTRACT.RESULTS: Amygdala responses to fearful facial expressions were significantly greater in depressed patients compared to healthy controls. However, this response was normalised in patients receiving 7 days treatment with escitalopram. There was no significant difference in clinical depression ratings at 7 days between the escitalopram and placebo-treated patients. ABSTRACT.CONCLUSIONS: Our results suggest that short-term SSRI treatment in depressed patients remediates amygdala hyperactivity in response to negative emotional stimuli prior to clinical improvement in depressed mood. This supports the hypothesis that the clinical effects of antidepressant treatment may be mediated in part through early changes in emotional processing. Further studies will be needed to show if these early effects of antidepressant medication predict eventual clinical outcome. BODY.INTRODUCTION: Patients with acute depression manifest a range of negative biases in the processing of emotional information, which are believed to contribute to the aetiology and maintenance of the depressed state (Beck, 2008). For example, compared to healthy controls, depressed patients selectively recall more negative, self-related emotional information in memory tasks (Bradley & Matthews, 1983; Bradley et al. 1995) and demonstrate negatively biased perception of key social signals such as emotional facial expressions (Gur et al. 1992; Bouhuys et al. 1999). Such biases have been associated with aberrant responses across a network of neural areas involved in emotional processing, including an increased response of the amygdala to negative facial expressions in depressed patients compared to matched controls (Sheline et al. 2001; Surguladze et al. 2004; Suslow et al. 2010; Victor et al. 2010). We recently proposed that the therapeutic effect of antidepressant drugs could be mediated by early reversal of these negative emotional biases (Harmer et al. 2009a). For example, in healthy volunteers, 7 days treatment with the selective serotonin re-uptake inhibitor (SSRI), citalopram, and the selective noradrenaline re-uptake inhibitor, reboxetine, diminished the recognition of negative emotional faces, increased recall of positive self-referential words and attenuated the amygdala response to fearful faces as measured by functional magnetic resonance imaging (fMRI; Harmer et al. 2004, 2006; Norbury et al. 2007). Similarly, studies in depressed patients have shown attenuation of the amygdala response to sad and fearful facial expressions during SSRI treatment (Sheline et al. 2001; Fu et al. 2004; Victor et al. 2010). However, in these latter studies amygdala responses were measured at baseline and then again after 8 weeks of SSRI treatment, by which time the therapeutic response had become established and subjective mood improved. Therefore, it is possible that remediation of negative biases in depressed patients during antidepressant treatment could be a consequence of resolution of depression rather than an early effect of drug treatment. In addition, the absence of a placebo control makes it difficult to exclude changes due to order effects during repeated scanning or non-specific effects of treatment. Accordingly, the aim of the present study was to assess whether in depressed patients, SSRI treatment would remediate neural changes in emotional bias prior to the onset of clinical antidepressant effect. We used a single scan, between-subjects, placebo-controlled design to exclude order and non-specific effects. We predicted that, compared to placebo, short-term SSRI treatment would attenuate amygdala responses to fearful faces in the absence of clinically important changes in mood ratings. BODY.MATERIALS AND METHOD.PARTICIPANTS: Altogether, 45 participants with major depression and 18 healthy controls completed the fMRI protocol. Controls were recruited through university volunteer lists and advertising in local newspapers. Depressed patients were recruited from a number of sources including newspaper advertisements (n = 35) as well as referral from other clinicians or researchers (n = 7). All participants were assessed for the presence of current and past psychiatric disorder with the Structured Clinical Interview for DSM-IV (Spitzer et al. 1995). The depressed patients met criteria for a primary diagnosis of major depressive disorder. Exclusion criteria for the study were the following. For depressed patients: suffering from psychosis or substance dependence as defined by DSM-IV; being at clinically significant risk of suicidal behaviour; having contraindications to escitalopram treatment or being treated with psychotropic medication <3 weeks before the study (5 weeks in the case of fluoxetine). For healthy volunteers: current or past history of Axis I disorder as defined by DSM-IV. For both groups: major somatic or neurological disorders; pregnancy or breast-feeding; contraindications to magnetic resonance imaging or concurrent medication, which could alter emotional processing. All participants were right-handed as assessed by the Edinburgh Handedness Inventory (Oldfield, 1971). The study was approved by Oxford Research Ethics Committee and all participants gave written informed consent. Participants were reimbursed for their time and any other expenses. BODY.MATERIALS AND METHOD.STUDY DESIGN AND DRUG TREATMENT: This was a double-blind, placebo-controlled, parallel group study where patients with depression were randomly assigned to receive 10 mg escitalopram or placebo each morning for 7 days. Both groups were then scanned on the seventh day of treatment. Mood and anxiety were assessed using the Beck Depression Inventory (BDI; Beck et al. 1961), the Hamilton Depression Ratings Scale (HAMD; Hamilton, 1960) and the Spielberger's State-Trait Anxiety Inventory (Spielberger et al. 1983) immediately before starting treatment and on the seventh day of placebo/escitalopram. After the scan all patients were offered treatment openly with escitalopram according to usual clinical practice. The healthy controls were scanned without any pre-treatment. Their mood ratings were carried out just before the scan. BODY.MATERIALS AND METHOD.STUDY DESIGN AND DRUG TREATMENT.FUNCTIONAL MRI DATA ACQUISITION: Functional MRI data were acquired in a total of 63 participants on a 3T Siemens TIM TRIO (Siemens AG, Erlangen, Germany), fitted with a body transmit coil and 12-channel head receive coil, located at the University of Oxford, Centre for Clinical Magnetic Resonance Research. Data were excluded from four participants due to technical difficulties (n = 2) and rapid head motion. The remaining 59 subjects [escitalopram-treated (Esc) = 21, placebo-treated (Pla) = 21 and controls (Con) = 17] were included in the final analyses. Functional MRI data were acquired with a voxel resolution of 3 × 3 × 3.5 mm, TR/TE/FA = 2000 ms/28 ms/87o. A total of 255 volumes were acquired in an experiment lasting 8.5 min. Field maps were acquired using a dual echo 2D gradient echo sequence with echos at 5.19 and 7.65 ms and a repetition time of 444 ms. Data were acquired on a 64 × 64 × 40 grid, with a voxel resolution of 3 mm isotropic. T1-weighted structural images were acquired for subject alignment using a magnetisation prepared rapid acquisition by gradient echo sequence with the following parameters: voxel resolution 0.78 × 0.8 × 0.78 mm on a 208 × 256 × 200 grid, TE/TI/TR = 4.8/1100/2040 ms. BODY.MATERIALS AND METHOD.STUDY DESIGN AND DRUG TREATMENT.FUNCTIONAL MRI EXPERIMENTAL TASK: During fMRI scanning, participants completed a simple gender discrimination task involving the rapid presentation of fearful and happy facial expressions. In this task, nine 30-s blocks of a baseline fixation cross (condition A) were interleaved with eight 30-s blocks of the emotional task [four blocks of fear (condition B) and four blocks of happy (condition C)]. During each emotional block, participants viewed 10 emotional faces (five female) all derived from a standard set of pictures of facial affect (Matsumoto & Ekman, 1988). Each face was presented for 100 ms and subjects were asked to report the gender of the face via a MRI compatible key pad. To ensure participants remained focused during the task within block inter-stimulus intervals (ISI) ranged between 2500 and 2900 ms (mean ISI = 2900 ms). To reduce potential carry-over effects, cycles of alternation between conditions were counterbalanced across subjects. Thus, during the course of the 8.5-min experiment, half of the subjects completed the following order: ABACABACABACABACA, the remaining subjects ACABACABACABACABA. Stimuli were presented on a personal computer using E-Prime (version 1.0; Psychology Software Tools Inc., USA) and a cloned projection displayed to participants on an opaque screen located at the head of the scanner bore, which subjects viewed using angled mirrors. Subject responses were made via an MRI-compatible keypad. Stimulus presentation/subject button presses were registered and time-locked to fMRI data using E-Prime. Both accuracy (correct gender discrimination) and reaction times were recorded. Immediately before scanning, all subjects received training with another set of stimuli to ensure they fully understood the requirements of the task. Behavioural data were analysed using a repeated measures analysis of variance (ANOVA) model with group as the between-subjects factor and valence as the within-subjects factor implemented in SPSS v. 15 (SPSS Inc., USA). BODY.MATERIALS AND METHOD.STUDY DESIGN AND DRUG TREATMENT.FUNCTIONAL MRI PRE-PROCESSING AND STATISTICAL ANALYSIS: Functional MRI data were pre-processed and analysed using FSL, version 4.1.4 (Smith et al. 2004) Briefly, motion correction was applied using a rigid body registration to the central volume (Jenkinson et al. 2002). Brain matter was segmented from non-brain using a mesh deformation approach (Smith, 2002); Gaussian spatial smoothing was applied with a full-width half-maximum of 5 mm; high pass temporal filtering was applied using a Gaussian-weighted running lines filter, with a 3 dB cut-off of 120 s; susceptibility-related distortions were corrected as far as possible using field-map correction routines (Jenkinson et al. 2002). A general linear model was fitted in pre-whitened data space (to account for autocorrelation in the fMRI residuals; Woolrich et al. 2001). Two explanatory variables (plus their temporal derivatives) were modelled: 'fear faces' and 'happy faces'. All explanatory variables were convolved with a default haemodynamic response function (γ function, delay = 6 s, s.d. = 3 s), and filtered by the same high pass filter as the data. Finally, each subject's estimated motion parameters (derived from the motion correction pre-processing step described above) were also included in the model as regressors of no interest. The full model was simultaneously regressed to the data, giving the best-fitting amplitudes for each explanatory variable. Individual subject data were then combined at the group level using a full mixed-effects analysis (Woolrich et al. 2004), including gender as covariate of no interest. This mixed-effects approach enables generalisation of the results beyond the sample of subjects tested. At the group level, individual participant 's first-level difference maps were compared within an amygdala region of interest [clusters determined by Z >2.3 and a (corrected) cluster significance threshold of p = 0.05], derived from the Harvard–Oxford anatomical atlas. When a statistically significant interaction was observed in the overall 3 × 2 analysis, this was decomposed by comparing each group to one another for the contrast fearful versus happy facial expressions within the amygdala region of interest. If these group (2) × emotion (2) interactions were significant, mean percentage signal change was extracted from the significant functional clusters and compared across groups using independent samples t tests (performed using SPSS version 16.0). This small volume correction was also used to identify amygdala responses to face presentations in the healthy controls to compare effects of fearful versus happy facial expressions (main effect of emotion condition, see Supplementary material, S1). Outside our amygdala a priori areas of interest, significant activations were identified using cluster-based thresholding of statistical images with a height threshold of Z >2.3 and a (whole-brain corrected) spatial extent threshold of p = 0.05. The results from this analysis are presented in the Supplementary material (S2). BODY.MATERIALS AND METHOD.PULSED ARTERIAL SPIN LABELLING: Pulsed arterial spin labelling (PASL) data were also acquired on a subset of participants (Esc = 20, Pla = 16 and Con = 16). Using a flow-sensitive alternating inversion recovery labelling scheme, whole-brain volumes were acquired with a 3D gradient and spin echo imaging readout (MacIntosh et al. 2010). The imaging volume was 200 mm × 200 mm × 120 mm (half kz-space coverage; 64 × 64 × 24 matrix size; voxel dimensions: 3.1 mm × 3.1 mm × 5.0 mm). The pulse repetition time and echo time were 3150 ms and 40.6 ms, respectively. Background suppression of static tissue was achieved using two non-selective inversion pulses, prescribed at times that will null the signal from background grey and white matter and that have been shown to improve the temporal stability of the arterial spin labelling measurement. Optimal inversion null times were calculated for signals with T1 values of 700 and 1400 ms, which is approximately consistent for white and grey matter, respectively, at 3T (Macintosh et al. 2010). A 5 mm full-width half-maximum spatial smoothing kernel filter was applied to the PASL images prior to sinc-interpolated subtraction between tag and control volumes. The top and bottom two slices in each PASL imaging volume were discarded due to wraparound in the z direction. The resulting perfusion maps were smoothed and demeaned prior to inclusion in the between-groups analysis (described above) as voxelwise covariates to minimise the potential impact of these variables on group comparisons. We also performed a voxelwise between-group whole-brain analysis on resting perfusion images through repeated permutation (5000) of the observed data. Significant activations across the whole brain were identified using cluster-based thresholding of statistical images with a height threshold of Z = 2.3 and a (whole-brain corrected) spatial extent threshold of p < 0.05. Finally, amygdala regions of interest (ROIs) were registered to perfusion space to extract mean resting perfusion values (ml/100 g/min) for comparison between-groups. BODY.RESULTS.DEMOGRAPHIC DATA AND CLINICAL RATINGS: The patients randomized to receive escitalopram or placebo were well matched for age and gender. The Con group had a higher proportion of female participants, but not significantly so (χ2 = 2.5, p = 0.3; Table 1). HAMD scores indicated that the patients were moderately depressed at baseline and a similar decline in scores was seen in both Esc and Pla groups over the 7 days of treatment (Table 1). Mean (± s.e.m.) scores in the Esc group fell by 4.4 ± 0.8 v. 3.2 ± 1.0 in the placebo group (t = 0.86, p = 0.4). Similarly, there were no significant difference in decline in scores on the BDI (t = 0.64, p = 0.5) or state anxiety ratings (t = –0.34, p = 0.74) between the two groups. Table 1.Demographic and clinical characteristics of participantsVariablePlacebo-treatedEscitalopram-treatedHealthy controls(mean ± s.d.)(n = 21)(n = 21)(n = 17)Age (years)31.1 ± 12.132.0 ± 10.733.7 ± 12.3Male/Female10/119/124/13Male/Female age31.4 ± 10.4/30.8 ± 4.233.5 ± 11.3/30.8 ± 10.634.4 ± 17.4/33.5 ± 11.2HAMD before treatment (mean ± s.d.)23.3 ± 4.524.2 ± 5.70.5 ± 0.7HAMD after treatment (mean ± s.d.)20.0 ± 4.319.8 ± 7.8BDI before treatment (mean ± s.d.)30.9 ± 9.630.9 ± 9.41.1 ± 1.3BDI after treatment (mean ± s.d.)23.8 ± 9.5125.4 ± 11.8STAI-S before treatment (mean ± s.d.)52.4 ± 12.4555.6 ± 11.727.5 ± 5.2STAI-S after treatment (mean ± s.d.)46.7 ± 10.2350.7 ± 11.2Mean age at onset of depression (range)24 (12–45)23.5 (12–47)Mean number of episodes (range)2.5 (1–10)3 (1–10)Mean months duration of current episode (range)9.5 (1–36)13.4 (1–36)Medication naive (n)1110Co-morbidities (number of patients, condition)1 – somatisation disorder1 – trichillomania2 – GAD1 – social anxiety disorderGender discrimination accuracy % (fear)96.58 ± 5.5496.37 ± 3.8497.35 ± 3.24RT, ms (fear)756.48 ± 130.91725.45 ± 165.81680.44 ± 146.48Gender discrimination accuracy % (happy)97.92 ± 3.3596.62 ± 3.7498.38 ± 1.75RT, ms (happy)760.38 ± 141.17720.96 ± 170.92680.99 ± 164.30HAMD, Hamilton Rating Scale for Depression; BDI, Beck Depression Inventory; STAI-S, State-Trait Anxiety Inventory State; GAD, generalised anxiety disorder; RT, reaction time. BODY.RESULTS.DEMOGRAPHIC DATA AND CLINICAL RATINGS.FUNCTIONAL MRI BEHAVIOURAL PERFORMANCE: Due to technical difficulties response accuracy and latency were not acquired for three patients (n = 2, Esc). Subsequent analysis, therefore, included 19 Esc, 20 Pla and 17 Con participants. Subjects were highly accurate in their behavioural performance (>77.5% accuracy). Repeated measures ANOVA revealed no main effect of group or emotion and no group × emotion interaction for either response accuracy or latency (all F's <1, see Table 1). BODY.RESULTS.DEMOGRAPHIC DATA AND CLINICAL RATINGS.FUNCTIONAL MRI RESULTS: A two-way repeated-measures ANOVA model in FSL comparing haemodynamic differences across groups [Esc, Pla and Con and conditions (fear and happy) revealed a significant group × condition interaction in right amygdala (Fig. 1)]. To decompose this significant interaction, we compared, separately, Pla depressed patients and controls (Fig. 2 a), drug treated patients with Pla patients (Fig. 2 b) and drug-treated patients with controls within this amygdala region using FSL. These simple main effect analyses revealed greater BOLD response to fear in Pla vs. Esc (t40 = 2.729, p = 0.009; Fig. 2 a) and Pla vs. Con (t28.39 = 3.51, p = 0.001; Fig. 2 b). By contrast, the BOLD response to happy faces was similar across groups (all p's >0.5). Between-group differences in right amygdala BOLD response were not affected by adding resting perfusion maps as a voxelwise covariate. Similarly, no significant differences were observed in resting brain perfusion either at the whole-brain level or using a ROI-based analysis of the right amygdala (all p's >0.2). Fig. 1.Coronal image depicting the group × emotion interaction in right amygdala. The image is thresholded at Z = 2.3, p < 0.05 (small volume correction). Lower numeral refers to the coordinate in Montreal Neurological Institute space. Fig. 2.Plot depicting BOLD activation (expressed as % signal change) to fearful and happy facial expressions in right amygdala for (a) escitalopram- (Esc) and placebo-treated (Pla) participants, * p = 0.009 and (b) for healthy controls (Con) and Pla participants, ** p = 0.001. Bars show mean, error bars standard error. Consistent with the prediction that these changes in neural response do not relate to immediate changes in mood or anxiety with antidepressant treatment, there were no significant associations between change in HAMD, BDI and State Anxiety with the response in the amygdala to fear in the Esc group (all p values >0.24). BODY.DISCUSSION: The principal finding of our study is that amygdala response to fearful faces was significantly lower in depressed patients treated with 7 days escitalopram than in those receiving placebo. Ratings of depression or anxiety did not distinguish placebo and drug-treated groups at this point, suggesting that the attenuation in amygdala responsivity was caused by SSRI administration rather than change in clinical state. Consistent with this, there was no association between the change in ratings during treatment and the magnitude of the amygdala response to fearful facial expressions. Further, this effect of SSRI treatment cannot be explained by differences in basal perfusion of the amygdala measured with arterial spin labelling. Finally, the between-subjects placebo controlled design indicates that the differences in amygdala reactivity during SSRI treatment were not due to an effect of repeated fMRI examination or because of non-specific placebo effects. These findings in SSRI-treated depressed patients are similar to those we noted in a similarly designed, placebo-controlled study of healthy volunteers, where 7 days treatment with the SSRI, citalopram, diminished amygdala responses to fearful facial expressions (Harmer et al. 2006). The latter study used backward masking of emotional faces, which were presented below the threshold of conscious awareness. While the emotional stimulus presentations used in the present investigation were not masked, the nature of the task could still be considered 'implicit' and therefore likely to activate limbic regions implicated in rapid automatic appraisal of emotional stimuli (Killgore & Yurgelen-Todd, 2004). Our findings are also consistent with other studies of antidepressant treatment in depressed patients, which have used fMRI to examine neural responses to fearful and sad faces during more extended periods of SSRI administration. For example, Sheline et al. (2001) found that the amygdala response to masked fearful faces was reduced bilaterally relative to baseline in patients treated with sertraline in doses of approximately 100 mg daily for 8 weeks. Victor et al. (2010), employing a similar treatment regimen, found that sertraline treatment lowered responses to masked sad faces in the right amygdala and Fu et al. (2004) found that 8 weeks fluoxetine treatment (20 mg daily) decreased responses in left amygdala to implicitly presented sad faces of increasing emotional intensity. In these studies, however, most patients had shown clinically significant symptomatic improvement by the time of the second fMRI scan. The neurochemical mechanisms by which SSRIs might lower amygdala responses to fear are not presently clear. The amygdala receives a substantial serotonergic input from the dorsal raphe and, in animals, application of serotonin to amygdala interneurones increases release of γ-aminobutyuric acid, which, in turn, modifies the activity of glutamatergic projection neurones (Rainnie, 1999). Thus, changes in serotonin neurotransmission are well placed to alter the excitability of internal amygdala networks. However, the serotonin receptor subtypes involved and their location with regard to different neuronal types are not fully elucidated. Taken in conjunction with the above studies, our findings indicate that the attenuating effects of SSRIs on amygdala responses to negative facial expressions in depressed patients can occur early in treatment, prior to meaningful symptomatic improvement. Indeed, in healthy subjects we found that both citalopram (Murphy et al. 2009) and the atypical antidepressant, mirtazapine (Rawlings et al. 2010), reduced amygdala responses to fear a few hours after administration of single therapeutic dose. The translation of these findings from healthy volunteers to an acutely ill patient group suggests that neuropsychologically relevant, remediating effects of antidepressant treatment on emotional processing may be present very shortly after initiation of treatment in depressed patients. Furthermore, in a behavioural study, we have recently found that a single dose of reboxetine in depressed patients reversed negative emotional biases in both facial expression recognition and emotional memory in the absence of any change in subjective mood (Harmer et al. 2009b). In the present study, the effect of escitalopram to lower fear responses relative to placebo was apparent in the right amygdala rather than bilaterally and in our antidepressant studies in healthy volunteers, using the same or similar paradigms, changes in fear processing have been most apparent in the right amygdala (Harmer et al. 2006; Murphy et al. 2009; Rawlings et al. 2010). However, the investigations of antidepressants in depressed patients outlined above do not apparently reveal a consistent pattern in this respect and it is possible that the detection of laterality is influenced by a number of additional factors, such as the nature of the task and the number of trials presented. We also saw here a specific effect of SSRI treatment on response to negative facial expressions, which is the best replicated effect seen early and late in treatment (see Harmer et al. 2011). However, some studies have also revealed increased amygdala responses to happy facial expressions after antidepressant treatment (Norbury et al. 2009; Rawlings et al. 2010; Victor et al. 2010), which were not detected here. The reason for this discrepancy is unclear but could involve differences between drug treatments, patient or volunteer characteristics and explicit versus implicit emotional paradigms. Nonetheless, these findings are all in line with a decrease in the relative processing of negative versus positive stimuli at the level of the amygdala. We also studied a group of age-matched healthy controls with the same facial expression task, but it must be noted that control participants did not receive drug or placebo treatment prior to scanning. In addition, there were proportionately more women than men in the Con group than in the patient groups, leading us to enter gender as a covariate in the fMRI analysis (see Method). These differences limit the conclusions that can be drawn from the comparison between the Pla depressed group and healthy volunteer group, although our findings are consistent with a number of other imaging studies that have found increased amygdala responses to negative facial expressions in depressed patients relative to healthy controls (Sheline et al. 2001; Surguladze et al. 2004; Suslow et al. 2010; Victor et al. 2010). A major aim of our study was to exclude an effect of repeated scanning and placebo effects in changes in amygdala response in drug-treated patients and we therefore used a single scan, between-subjects placebo-controlled design. However, this approach is open to the objection that the two patient groups may have differed in baseline amygdala reactivity to fearful faces. In as far as we could ascertain, the patients randomised to placebo and escitalopram were similar in terms of personality, clinical and demographic factors, which could have altered the response. However, future studies using a within-subjects design are warranted to explore this question further and to explore whether this early amygdala response is predictive, as hypothesised, of later clinical response. BOLD magnitude is determined by the interaction between increases in cerebral blood flow, cerebral blood volume and rate of oxygen consumption (Brown et al. 2003; Buxton et al. 2004) and is affected by differences in resting cerebral blood flow (Brown et al. 2003). Characterising the effects of escitalopram (or any drug) upon task-specific brain activity may, therefore, be confounded by drug-related effects on baseline activity. Arguing against this interpretation of our data, we found no significant between-groups differences in resting perfusion using either whole-brain or ROI-based approaches, indicating a degree of region and task specificity unlikely to be related to global effects of escitalopram on baseline blood flow. An unexpected finding was that the current sample of healthy volunteers did not show increased amygdala response to fearful versus happy facial expressions in the statistically significant cluster of interest. However, examination of this within-subjects difference may not be justified in studies where the data derived from the amygdala have been identified through the statistical comparison of depressed and healthy controls. In these circumstances, a difference between response to emotions in the healthy volunteer group may be an artefact of the comparison used to identify the difference between the groups rather than a pattern that will be seen consistently across the whole, or other parts of, the amygdala. Consistent with this, analysis of the amygdala region of interest in healthy volunteers alone revealed a trend for the pattern expected by results in meta-analyses of amygdala responsivity in healthy people [increased responses to fearful compared to happy facial expressions at p = 0.1, see Supplementary material S1 (e.g. Phan et al. 2002)]. The apparent rapid resolution of negative emotional processing biases by antidepressant administration in depressed patients supports the notion that such an effect precedes the overt clinical effects of antidepressant treatment and may be a relevant therapeutic mechanism. According to this view, remediation of negative emotional bias is translated into improved subjective mood over time as individuals re-experience and relearn personal and social contingencies in an implicitly transformed emotional world (Harmer et al. 2009a). If this hypothesis is correct, one might expect that the early changes in emotional bias produced by antidepressant treatment would predict eventual therapeutic outcome. Although, as yet, there are no data exploring this question with functional neuroimaging outcomes measures, behavioural changes in emotional processing with antidepressant drug treatment have been associated with clinical response 4 weeks later (Tranter et al. 2009). It is also of great interest that certain negative biases in emotional processing may persist in recovered unmedicated patients who demonstrate abnormalities in behavioural and neural responses similar to those apparent in acute depression (Bhagwagar et al. 2004; Victor et al. 2010). It would be predicted that such biases should be attenuated by continued antidepressant treatment (Sheline et al. 2001; Fu et al. 2004; Victor et al. 2010). This may provide a mechanism for the established efficacy of antidepressant treatment in longer-term maintenance therapy and a possible means of identifying patients who require it. BODY.SUPPLEMENTARY MATERIAL: Supplementary MaterialSupplementary information supplied by authors. Supplementary MaterialSupplementary information supplied by authors.

TITLE: Efficacy and safety of lixisenatide in patients with type 2 diabetes and renal impairment ABSTRACT.AIMS: This post hoc assessment evaluated the efficacy and safety of once‐daily, prandial glucagon‐like peptide‐1 receptor agonist lixisenatide in patients with type 2 diabetes (T2D) and normal renal function (estimated glomerular filtration rate ≥90 mL/min), or mild (60‐89 mL/min) or moderate (30‐59 mL/min) renal impairment. ABSTRACT.METHODS: Patients from 9 lixisenatide trials in the GetGoal clinical trial programme were categorized by baseline creatinine clearance: normal renal function (lixisenatide n = 2094, placebo n = 1150); renal impairment (mild: lixisenatide n = 637, placebo n = 414; moderate: lixisenatide n = 122, placebo n = 68). Meta‐analyses of placebo‐adjusted mean differences between baseline renal categories were performed for efficacy and safety outcomes. ABSTRACT.RESULTS: HbA1c, 2‐hour postprandial plasma glucose and fasting plasma glucose were comparably reduced in lixisenatide‐treated patients with normal renal function, and mild and moderate renal impairment. The most common adverse events (AEs) in all renal function categories were gastrointestinal (GI), predominantly nausea and vomiting. A 14% higher incidence of GI AEs and a 10% higher incidence of nausea and vomiting were seen with mild impairment vs normal function (P = .003 for both), but no significant differences were observed between the mild and moderate impairment categories (P = .99 and P = .57, respectively), or between the moderate impairment and normal categories (P = .16 and P = .65, respectively). Additionally, the incidence of hypoglycaemia was similar in all categories. ABSTRACT.CONCLUSIONS: This study demonstrates that baseline renal status does not affect efficacy outcomes in lixisenatide‐ vs placebo‐treated patients, and that no lixisenatide dose adjustment is required for patients with T2D with mild or moderate renal impairment. BODY.INTRODUCTION: 1 Type 2 diabetes (T2D) is a progressive life‐threatening disease associated with altered glucose homoeostasis.1 The negative effects of the associated chronic hyperglycaemia may compromise organ and tissue function, including the cardiovascular system, eyes, nerves and kidneys.2 Owing to the systemic nature of the disease, clinical management of T2D is often complex and may be suboptimal, with associated co‐morbidities often confounding the issue.3 Of these co‐morbid conditions, chronic kidney disease is particularly common in T2D, with about one‐quarter of patients aged ≥60 years exhibiting moderate or severe impairment of renal function.4 A precise definition of the advantages and disadvantages of available therapeutic options in relation to the disease characteristics and co‐morbidities of the individual patient is needed to select the most appropriate treatment in this setting. In particular, it is essential to understand the pharmacokinetic profile, and specifically the mechanism of excretion, of any drug administered, and to adjust dosing accordingly.5 The most recent recommendations from the American Diabetes Association/European Association for the Study of Diabetes (ADA/EASD) suggest that first‐line therapy for T2D should be lifestyle modifications and metformin monotherapy.6 However, further guidance from the ADA states that the use of metformin is contraindicated in individuals with severe renal disease,7 with recent Food and Drug Administration (FDA) guidance advising that metformin may be used in patients with mild impairment and only in some with moderate impairment.8 In patients with T2D where first‐line metformin monotherapy does not provide sufficient glycaemic control or is not indicated, guidelines recommend the introduction of one of a number of different therapeutic options, including sulphonylureas, sodium–glucose co‐transporter‐2 (SGLT2) inhibitors, thiazolidinediones, dipeptidyl peptidase‐4 (DPP‐4) inhibitors, basal insulin or glucagon‐like peptide‐1 receptor agonists (GLP‐1 RAs).6 The extent of clinical experience with these drug classes in patients with renal disease varies, with many of these treatment options contraindicated or not recommended in patients with moderate or severe impairment9; specific concerns have been raised regarding the use of certain sulphonylureas and SGLT2 inhibitors in this population. With regard to GLP‐1 RAs, there is a relative lack of data investigating their use in patients with impaired renal function.10 The evidence to date indicates that exenatide is eliminated by renal mechanisms and should not be given to patients with severe impairment.10 Further data indicate that the glycaemic efficacy of liraglutide does not appear to be affected by moderate impairment.11 Elimination of lixisenatide, a once‐daily, injectable, prandial GLP‐1 RA, is presumed to occur via renal filtration, tubular reabsorption and metabolic catabolism; the resulting metabolites do not appear to stimulate the GLP‐1 receptor.12 Furthermore, clinical evidence suggests that the pharmacokinetic profile of lixisenatide is largely unaffected by mild or moderate renal impairment; however, only limited pharmacokinetic data are available.10 The efficacy and safety of lixisenatide have been investigated extensively across the GetGoal clinical trial programme, which included patients with T2D with or without renal impairment.13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 Overall, these studies have demonstrated that lixisenatide is significantly more effective than placebo at reducing levels of glycated haemoglobin (HbA1c). Moreover, treatment with lixisenatide was associated with significant reductions in postprandial plasma glucose (PPG) and fasting plasma glucose (FPG) compared with placebo. In order to investigate the potential effects of renal impairment on the efficacy and safety of lixisenatide in patients with T2D, we conducted a post hoc meta‐analysis based on trials reported previously from the comprehensive GetGoal clinical trial programme.13, 14, 15, 16, 18, 19, 20, 21, 22 BODY.MATERIALS AND METHODS: 2 This meta‐analysis included data from nine GetGoal trials that had been published at the time of the analysis (October 2014). An overview of the designs of these trials, along with their primary results, is presented in Table 1. Five of the trials included assessed lixisenatide as an add‐on to oral antidiabetic drugs in patients with T2D over 24 weeks. Three of the trials compared lixisenatide with placebo when added to basal insulin over 24 weeks. One trial assessed lixisenatide as monotherapy over a period of 12 weeks. Furthermore, 2 of the aforementioned trials included in this analysis were conducted in a predominantly Asian population. All trials were approved by the Institutional Review Boards or ethics committees of the participating centres, and were conducted in accordance with the principles of the Declaration of Helsinki and International Conference on Harmonization Good Clinical Practice guidelines. All participants provided written informed consent. Table 1 Summary of clinical trials included in the analysis Trial Drug treatments Trial duration Primary endpoint as published previously ΔHbA1c from baseline to study end a GetGoal‐M 13 ( n  = 680) Lixisenatide morning or evening vs placebo asadd‐on to metformin 24 weeks −0.87 (morning) vs −0.75 (evening) vs −0.38% (placebo; P  < .0001 for both arms vs placebo) GetGoal‐F1 14 ( n  = 482) Lixisenatide 1‐ or 2‐step dose increase vs placebo as add‐on to metformin 24 weeks −0.92 (1‐step) vs −0.83 (2‐step) vs −0.42% (placebo; P  < .0001 for both arms vs placebo) GetGoal‐Mono 15 ( n  = 361) Lixisenatide monotherapy 1‐ or 2‐step dose increase vs placebo 12 weeks −0.85 (1‐step) vs −0.73 (2‐step) vs −0.19% (placebo; P  < .0001 for both arms vs placebo) GetGoal‐P 16 ( n  = 484) Lixisenatide vs placebo as add‐on to pioglitazone ± metformin 24 weeks −0.90 (lixisenatide) vs −0.34% (placebo; P  = .0001) GetGoal‐L‐Asia 18 ( n  = 311) Lixisenatide vs placebo as add‐on to basal insulin ± sulphonylureas 24 weeks −0.77 (lixisenatide) vs +0.11% (placebo; P  < .0001) GetGoal‐M‐Asia 19 ( n  = 390) Lixisenatide vs placebo as add‐on to metformin ± sulphonylureas 24 weeks −0.83 (lixisenatide) vs −0.47% (placebo; P  = .0004) GetGoal‐L 20 ( n  = 495) Lixisenatide vs placebo as add‐on to basal insulin ± metformin 24 weeks −0.74 (lixisenatide) vs −0.38% (placebo; P  = .0002) GetGoal‐Duo1 21 ( n  = 446) Lixisenatide vs placebo as add‐on to newly initiated basal insulin glargine + metformin ± thiazolidinediones 24 weeks −0.71 (lixisenatide) vs −0.40% (placebo; P  < .0001) GetGoal‐S 22 ( n  = 859) Lixisenatide vs placebo as add‐on to sulphonylureas ± metformin 24 weeks −0.85 (lixisenatide) vs −0.10% (placebo; P  < .0001) Abbreviation: HbA1c , glycated haemoglobin. a P ‐values are for the treatment group difference. Safety and efficacy data from patients in the selected trials were pooled and stratified by each patient's baseline renal function. This was assessed by estimated glomerular filtration rates (eGFR) using baseline creatinine clearance levels based on the Cockcroft–Gault formula.24 For the purposes of the present analysis, renal function was categorized as: "normal" (eGFR ≥90 mL/min); "mild renal impairment" (60‐89 mL/min); "moderate renal impairment" (30‐59 mL/min); or "severe renal impairment" (<30 mL/min), as defined by the ADA.25 As the included trials had exclusion criteria based on renal function, there was a lack of patients with severe renal impairment in the present analysis. BODY.MATERIALS AND METHODS.STUDY ENDPOINTS: 2.1 Efficacy endpoints were calculated as placebo‐adjusted mean change from baseline to week 24 with lixisenatide (week 12 for GetGoal‐Mono15) for: HbA1c, 2‐hour PPG, FPG, basal insulin dose (when appropriate) and body weight. Not all trials included in the present analysis reported every endpoint; the number of studies and sample sizes for each endpoint are shown in Table S1, and the endpoints evaluated in each study are shown in Table S2. In the GetGoal trials that assessed 2‐hour PPG, measurements were recorded at baseline and week 24 by administration of a standardized 600‐kcal liquid breakfast meal challenge test [400 mL of Ensure Plus (Abbott Nutrition, Columbus, OH) 30 minutes after drug administration, with PPG measured 2 hours after the breakfast was administered]. Analyses of safety endpoints included the placebo‐adjusted rate of treatment‐emergent adverse events (AEs) by system and organ class (SOC) for SOCs identified across all of the renal function subgroups and by higher level term (HLT) for AEs by SOC that were significantly more frequent with lixisenatide. BODY.MATERIALS AND METHODS.STATISTICAL ANALYSES: 2.2 Analyses of efficacy endpoints were performed using the pooled modified intent‐to‐treat (mITT) populations from the nine trials, which comprised all randomized participants who received at least one dose of study treatment and had both a baseline and at least one post‐baseline assessment for any of the primary or secondary efficacy variables. All of the studies included in the meta‐analysis employed the last observation carried forward method. If the end‐of‐study value was missing for any endpoint, the last available post‐baseline value was used. Differences in mean changes from baseline to study end between lixisenatide‐ and placebo‐treated patients (placebo‐adjusted changes) were compared for each of the five efficacy endpoints within each renal function category and between categories. Analyses of safety outcomes were performed using the safety population, which comprised all patients who received at least one dose of study drug. AEs grouped by SOC were analysed using risk differences (placebo‐adjusted rates). Comparisons between renal function categories were based on differences in placebo‐adjusted rates. Where there were significant differences in the number of AEs between categories, further analyses using all available HLTs or preferred terms were carried out. To evaluate the differences in assessed efficacy endpoints and safety outcomes across studies, study‐level meta‐analyses (random effects) were performed using placebo‐adjusted changes from baseline or placebo‐adjusted rates, respectively. Comparisons between renal categories were carried out using effect estimates calculated by study as the difference in placebo‐adjusted changes or placebo‐adjusted rates between categories. Effect estimates and their standard errors were entered as generic inverse variances in the Cochrane algorithm RevMan 5.2. Cochran's Q‐test and I 2 statistic were used to assess homogeneity between studies. BODY.RESULTS: 3 BODY.RESULTS.PATIENT DEMOGRAPHICS AND CLINICAL CHARACTERISTICS AT BASELINE: 3.1 The distribution of patients in the combined safety population by renal function category and a summary of patient characteristics at baseline is given in Table 2. Table 2 Baseline demographics by treatment (safety population) Characteristic Placebo Lixisenatide ( N  = 1639) ( N  = 2869) n (%) n (%) Sex Male 811 (49.5) 1362 (47.5) Female 828 (50.5) 1507 (52.5) Age <65 years 1286 (78.5) 2352 (82.0) ≥65 years 353 (21.5) 517 (18.0) <75 years 1600 (97.6) 2805 (97.8) ≥75 years 39 (2.4) 64 (2.2) Race White 973 (59.4) 1898 (66.2) Black 43 (2.6) 73 (2.5) Asian/Oriental 601 (36.7) 843 (29.4) Other 22 (1.3) 55 (1.9) HbA1c a <8% 744 (45.4) 1277 (44.5) ≥8% 895 (54.6) 1592 (55.5) Body mass index b <30 kg/m 2 832 (50.8) 1376 (48.0) ≥30 kg/m 2 807 (49.2) 1493 (52.0) Renal function category Total 1636 2853 NormalCC ≥90 mL/min 1150 (70.3) 2094 (73.4) Mild impairmentCC 60 to 89 mL/min 414 (25.3) 637 (22.3) Moderate impairmentCC 30 to 59 mL/min 68 (4.2) 122 (4.3) Severe impairmentCC <30 mL/min 4 (0.2) 0 (0.0) Abbreviations: CC , creatinine clearance; HbA1c , glycated haemoglobin. Only patients with assessment were included for any particular variable. a Screening. b Baseline. The combined safety population from the nine GetGoal trials included in this analysis comprised 2869 patients who received lixisenatide and 1639 patients who received placebo; the mITT population comprised 2720 patients and 1577 patients who received lixisenatide and placebo, respectively. Within the safety population, 3244 patients were classified as having normal renal function, 1051 patients had a mild renal impairment and 190 patients a moderate renal impairment. No patient had severe renal impairment at baseline in the lixisenatide group. The majority of patients were white and <65 years old, with approximately half of the patients having HbA1c ≥8% (64 mmol/mol) at baseline (Table 2). Baseline rates of microalbuminuria, an indicator of diabetic nephropathy, were generally low and similar across all studies and both treatment arms included in the analysis (P = .80 for heterogeneity). BODY.RESULTS.COMPARISONS OF CHANGES IN EFFICACY VARIABLES FROM BASELINE TO STUDY END WITHIN BASELINE RENAL FUNCTION CATEGORIES: 3.2 Of the five efficacy variables evaluated in this analysis, placebo‐adjusted mean differences in HbA1c, 2‐hour PPG and FPG were significantly lower at study end in lixisenatide‐ than in placebo‐treated patients in all three renal function categories (Table 3). Table 3 Efficacy of lixisenatide compared with placebo by renal function category ( mITT population) Endpoint placebo‐adjusted mean difference Normal Mild impairment Moderate impairment CC ≥90 mL/min CC 60‐89 mL/min CC 30‐59 mL/min HbA1c (%) −0.52 (−0.65, −0.39) −0.50 (−0.68, −0.31) −0.85 (−1.09, −0.61) P  < .00001 P  < .00001 P  < .00001 2‐hour PPG (mmol/L) −4.78 (−5.90, −3.66) −5.08 (−6.58, −3.58) −6.81 (−10.81, −2.82) P  < .00001 P  < .00001 P  < .001 FPG (mmol/L) −0.70 (−0.91, −0.50) −0.48 (−0.74, −0.22) −0.78 (−1.36, −0.20) P  < .00001 P  < .001 P  < .01 Basal insulin dose (U) −2.53 (−3.84, −1.21) −1.79 (−2.76, −0.83) −0.70 (−2.22, 0.81) P  < .001 P  < .001 NS Weight (kg) −0.64 (−0.93, −0.34) −0.59 (−0.90, −0.28) −0.47 (−1.37, 0.42) P  < .0001 P  < .001 NS Abbreviations: CC , creatinine clearance; FPG , fasting plasma glucose; HbA1c , glycated haemoglobin; NS , not significant; PPG , postprandial plasma glucose. All data are presented as mean (95% CI ). Basal insulin dose data were retrieved from three GetGoal trials (Table S2). In both the normal renal function and the mild impairment categories, end‐of‐treatment basal insulin dose was significantly lower with lixisenatide than with placebo. However, in the moderate renal impairment category there was no significant difference between lixisenatide and placebo in basal insulin dose. End‐of‐treatment body weight was significantly lower compared with baseline in both the normal renal function and the mild impairment categories. Body weight loss was also observed in the moderate renal impairment category, but this did not reach statistical significance. BODY.RESULTS.META‐ANALYSIS OF CHANGES IN EFFICACY VARIABLES BETWEEN RENAL FUNCTION CATEGORIES: 3.3 Comparisons of normal vs mild renal function and mild vs moderate renal function were performed to examine the incremental effect of increasing renal impairment on efficacy measures, while the direct comparison of normal vs moderate renal function demonstrates the cumulative effect. When between‐category changes for normal vs mild renal impairment and mild vs moderate renal impairment were assessed across the studies, there was no significant difference in HbA1c reductions at study end for patients with normal renal function vs those with mild renal impairment (P = .58), between patients with mild and moderate renal impairment (P = .36), or between patients with normal and moderate renal impairment (P = .20; Figure 1a). Figure 1Placebo‐adjusted meta‐analysis of change in A, HbA1c; B, 2‐hour PPG and C, FPG from baseline to week 24 (week 12 for GetGoal‐Mono) between renal function categories in patients receiving lixisenatide. Normal renal function: eGFR ≥90 mL/min; mild impairment: eGFR 60‐89 mL/min; moderate impairment: eGFR 30‐59 mL/min. CI, confidence interval; eGFR, estimated glomerular filtration rate; FPG, fasting plasma glucose; HbA1c, glycated haemoglobin; PPG, postprandial plasma glucose No difference was observed in placebo‐adjusted change in 2‐hour PPG at week 24 between patients with normal function compared with those with mild renal impairment (P = .72), between patients with mild and moderate renal impairment (P = .59), or between patients with normal function and those with moderate renal impairment (P = .70; Figure 1b). Similarly, the difference in placebo‐adjusted FPG reductions from baseline was not significant for patients with normal renal function vs those with mild renal impairment (P = .12), between patients with mild and moderate renal impairment (P = .37), or between patients with normal function and those with moderate renal impairment (P = .55; Figure 1c). Data for these three subgroup analyses, demonstrating the cumulative effect of increasing renal impairment (i.e. the normal vs moderate renal function comparisons) in each original study population can be seen in Figure S1. There was no significant placebo‐adjusted difference in insulin dose change from baseline between the normal renal function and the mild impairment categories [−0.82 U; 95% confidence interval (CI) −2.65, 1.03; P = .39], or between the mild and moderate renal impairment categories (−3.20 U; 95% CI −8.31, 1.92; P = .22). Finally, no significant difference was seen in placebo‐adjusted body weight change from baseline between the normal renal function and the mild impairment categories (−0.05 kg; 95% CI −0.47, 0.38; P = .82), or between the mild and moderate renal impairment categories (−0.19 kg; 95% CI −1.11, 0.73; P = .69). BODY.RESULTS.META‐ANALYSIS OF SAFETY OUTCOMES: 3.4 Adverse events were analysed using SOCs that were identified across all of the renal function categories. There were 14 SOCs that met this criterion: gastrointestinal (GI) disorders; nervous system disorders; general disorders and administration‐site conditions; musculoskeletal and connective tissue disorders; skin and subcutaneous tissues disorders; metabolism and nutrition disorders; psychiatric disorders; cardiac disorders; injury, poisoning and procedural disorders; renal and urinary disorders; eye disorder investigations; respiratory, thoracic and mediastinal disorders; and infections and infestations. There were no significant differences between the normal and mild impairment or between the normal and moderate impairment renal function categories, with the exception of the GI disorders and metabolism and nutrition disorders (Table 4). The most common AEs in all renal function categories were GI‐related, predominantly nausea and vomiting. Table 4 Placebo‐adjusted meta‐analysis (fixed effect) of selected AE s a between renal function categories (safety population) Parameter Normal vs mild Mild vs moderate Normal vs moderate Estimate P ‐value Estimate P ‐value Estimate P ‐value GI disorders (SOC) −0.14 .003 0.00 .99 −0.10 .16 Nausea/vomiting (HLT) −0.1 .003 0.04 .57 −0.03 .65 Metabolism and nutrition disorders (SOC) −0.08 .005 0.15 .03 0.11 .09 Hypoglycaemia (HLT) −0.02 .26 0.04 .53 0.03 .63 Appetite disorders (HLT) −0.03 .009 0.01 .79 −0.03 .47 Decreased appetite (PT) −0.03 .004 0.03 .47 −0.02 .63 Abbreviations: GI , gastrointestinal; HLT , higher level term; PT , preferred term; SOC , system and organ class ( MedDRA ). a Fourteen SOC s were identified as common for all three renal impairment categories. Those showing significant placebo‐adjusted risk differences are shown here. There was a lower incidence of any GI disorder AE (SOC), and a lower incidence of nausea and vomiting (HLT), in the normal renal function vs mild renal impairment category (P = .003 for both), but no difference was found for either of these endpoints between the mild and moderate impairment categories (P = .99 and P = .57, respectively), or between the moderate impairment and normal categories (P = .16 and P = .65, respectively). The incidences of any metabolism/nutrition disorder AE (SOC) and of decreased appetite (HLT) were significantly lower in the normal function vs the mild impairment category (P = .005 and P = .004, respectively). The difference in the incidence of any metabolism/nutrition disorder AE between the mild and moderate renal impairment categories was also significant (P = .03), but no other significant difference between renal function groups was found for either of these safety endpoints (Table 4). Importantly, with respect to hypoglycaemia, there was no significant placebo‐adjusted difference in the incidence rate between the normal renal function and the mild impairment categories (−0.02; 95% CI −0.06, 0.02; P = .26), between the mild and the moderate renal impairment categories (0.04; 95% CI −0.08, 0.15; P = .53), or between the normal renal function and the moderate impairment categories (−0.03; 95% CI −0.08, 0.14). No significant difference was reported for placebo‐adjusted change from baseline in heart rate between the normal renal function and the mild impairment categories [−1.13 beats per min (bpm); 95% CI −2.54, 0.28; P = .12], or between the mild and moderate renal impairment categories (1.73 bpm; 95% CI −2.72, 6.17; P = .45). Similarly, there was no significant placebo‐adjusted difference between the change from baseline in systolic blood pressure (SBP) in the normal renal function and mild impairment categories (−0.99 mm Hg; 95% CI −3.82, 1.84; P = .49), or between the mild and moderate renal impairment categories (−7.41 mm Hg; 95% CI −16.30, 1.47; P = .10). Although there was no significant placebo‐adjusted difference between the change from baseline in diastolic blood pressure (DBP) in the normal renal function and mild impairment categories (−0.18 mm Hg; 95% CI −1.56, 1.20; P = .80), a significant difference was seen between the mild and moderate renal impairment categories (−5.11 mm Hg; 95% CI −8.93, −1.29; P < .01). BODY.DISCUSSION: 4 In patients with T2D, good glycaemic control is necessary to prevent the micro‐ and macrovascular complications associated with the disease. Establishing this control in patients with co‐morbid renal impairment is complex for a number of reasons, including restrictions in the use of certain treatment options based on their pharmacokinetic profiles. In this clinical setting it is of critical importance to understand whether the efficacy or safety of a potential treatment is affected by impaired renal function so that an appropriate decision can be made regarding drug treatment and dosing regimen. The most recent combined ADA/EASD 2015 position statement continues to recommend metformin as first‐line therapy in T2D6; however, subsequent ADA guidance includes severe renal impairment as a contraindication for use,7 with additional guidance from the FDA stating that metformin may be used in patients with mild impairment and only some with moderate impairment.8 Concerns regarding the use of metformin in patients with renal insufficiency are due to lactic acid accumulation, and although recent evidence suggests that cautious use of the treatment in mild‐to‐moderate renal impairment may be appropriate, dosage reductions and careful monitoring of kidney function are recommended.26 In cases where the use of metformin is not appropriate, current treatment guidelines recommend a number of alternative therapeutic options, including sulphonylureas, SGLT2 inhibitors, thiazolidinediones, DPP‐4 inhibitors and GLP‐1 RAs; however, many of these commonly used options are also contraindicated or require dose adjustments. For example, the risk of hypoglycaemia is increased due to the accumulation of sulphonylureas and/or their active metabolites, and their long duration of action27; dose reductions are required for glipizide despite evidence that the kidneys only have minimal involvement in the metabolism of the drug.28 The DPP‐4 inhibitors sitagliptin, vildagliptin and saxagliptin all require dose reductions in patients with renal impairment, with only linagliptin not requiring dose adjustment due to minimal renal excretion of the drug.28 Furthermore, although the SGLT2 inhibitors dapagliflozin, canagliflozin and empagliflozin do not increase the risk of hypoglycaemia, there is evidence that they increase the risk of hypovolemic side‐effects and that their glycaemic efficacy is diminished in moderate‐to‐severe renal impairment.28 In addition, alpha glucosidase inhibitors are not generally recommended for people with renal impairment due to potential accumulation and lack of safety information.28, 29 The ADA/EASD treatment guidelines have designated GLP‐1 RAs as a therapeutic option in T2D owing to their proven efficacy in improving glycaemic control.6 Interestingly, preclinical evidence indicates that GLP‐1 may play a role in the regulation of renal function, and thus it has been hypothesized that treatment with certain GLP‐1 RAs may even aid in improving diabetic nephropathy.30, 31 As clearance of exenatide is via the renal route, it is not recommended in patients with severe impairment.10 In contrast, despite minor increases in the plasma concentrations of albiglutide and dulaglutide, and increased rates of hypoglycaemia and GI side‐effects,32 the FDA has approved both treatments for use in patients with renal impairment without dose reduction. In Europe, however, their use in patients with severe impairment is not recommended until further data are available.28 Further data relating to the use of GLP‐1 RAs in patients with renal disease are provided by a recent study of liraglutide in patients with moderate impairment.11 In this population, liraglutide did not appear to impact renal function and demonstrated improved glycaemic control compared with placebo. In addition, there was no increase in hypoglycaemia incidence with liraglutide; however, a greater number of withdrawals due to GI events was observed.11 This meta‐analysis of nine lixisenatide trials demonstrates that mild or moderate renal impairment does not have a statistically significant effect on efficacy outcomes in patients with T2D treated with lixisenatide. Across the trials included, clinical outcomes were generally consistent between the normal renal function and the mild and moderate renal impairment categories. Basal insulin dose reduction and body weight loss did not reach statistical significance in the moderate renal impairment category; this could be attributable to a change in exposure to lixisenatide in this group. There was a trend toward a significant reduction in body weight in the moderate renal impairment group, but it should be noted that the sample size in this category was relatively small and that post hoc analyses may not always be powered sufficiently for the assessment of all outcomes. None of the five placebo‐adjusted efficacy parameters tested (HbA1c, 2‐hour PPG, FPG, basal insulin dose, weight) was found to be significantly different between renal function categories. In the current analysis of lixisenatide trials, there was no significant difference in the incidence of GI AEs between patients with mild or moderate renal impairment; however, in patients with mild renal impairment, there was an increased risk (P = .003) of experiencing any GI AE compared with patients with normal renal function. It is important to note that the incidence of hypoglycaemia was similar in all categories. These findings indicate that lixisenatide dose adjustment is not required in patients with T2D with mild or moderate renal impairment. This is in contrast to other anti‐hyperglycaemic agents, such as SGLT2s and DPP‐4 inhibitors, where in cases of moderate renal disease, efficacy tends to be diminished and safety concerns are a possibility.28, 33 Furthermore, no significant changes were seen in placebo‐adjusted difference in heart rate change from baseline or SBP between the normal renal function and the mild impairment categories. In contrast, a significant difference was seen between the change from baseline in DBP between the mild and moderate renal impairment categories. This difference was driven primarily by a change in a single trial (GetGoal‐M‐Asia: −23.4 mm Hg; 95% CI −37.6, −9.1). A further consideration regarding the choice of treatment in this patient population is the potential for anti‐hyperglycaemic drugs to negatively affect renal function. There are conflicting data available for liraglutide depending on duration of treatment. Evidence from a 26‐week study suggests that liraglutide has no effect on renal function11; however, findings from a 1‐year study with a small sample size indicate that the drug may elicit a significant reversible decline in GFR, suggestive of a reversible metabolic or haemodynamic effect, without accompanying structural changes in renal physiology.34 These conflicting results may indicate that there is considerable variation in pharmacodynamic and pharmacokinetic profiles in patients with renal impairment, and that these factors need to be carefully considered prior to initiation of any anti‐hyperglycaemic treatment. This analysis was a post hoc evaluation of multiple trials. One limitation of this approach is that the nine trials included were of varying design, specifically with regard to duration and treatment regimen (i.e. monotherapy or add‐on); however, this may also be viewed as a strength of this analysis as it permitted evaluation of a broad range of patients. It should be noted that patient numbers in the moderate category were relatively low, prohibiting some specific statistical comparisons. In addition, effects of treatment on diabetic nephropathy were not investigated in these trials; these clinical data are needed for all of the GLP‐1 RAs. It should also be noted that considering the lifelong nature of T2D, the duration of follow‐up in the trials included in this analysis was relatively short. While rates of AEs with lixisenatide in this analysis were placebo‐adjusted, rates of AEs in patients who received placebo in the different renal function groups were not analysed. The lower incidence of GI‐disorder AEs seen in patients in the normal renal function vs mild impairment categories may also have been observed in patients who received placebo because of the symptoms of reduced kidney function; the absence of these placebo data creates an inherent bias against lixisenatide in the AE analysis. In summary, the clinical management of patients with T2D and impaired renal function can be challenging; however, the results of this analysis support that no lixisenatide dose adjustment is required for patients with T2D with mild or moderate renal impairment. BODY.ORCID: Markolf Hanefeld http://orcid.org/0000-0001-7323-1203 Lawrence A. Leiter http://orcid.org/0000-0002-1040-6229 BODY.SUPPORTING INFORMATION: Table S1. Patient distribution (sample sizes) by renal impairment stage and endpoint (mITT population). Table S2. Endpoints evaluated in each of the included trials.Click here for additional data file. Figure S1. Placebo‐adjusted analysis by original study population of change in A, HbA1c; B, FPG and C, PPG from baseline to week 24 (week 12 for GetGoal‐Mono) between renal function categories (normal function versus moderate impairment).Click here for additional data file.

TITLE: Posterior lamellar versus bilamellar tarsal rotation surgery for trachomatous trichiasis in Ethiopia: a randomised controlled trial ABSTRACT.SUMMARY.BACKGROUND: Eyelid surgery is done to correct trachomatous trichiasis to prevent blindness. However, recurrent trichiasis is frequent. Two procedures are recommended by WHO and are in routine practice: bilamellar tarsal rotation (BLTR) and posterior lamellar tarsal rotation (PLTR). This study was done to identify which procedure gives the better results. ABSTRACT.SUMMARY.METHODS: A randomised, controlled, single masked clinical trial was done in Ethiopia. Participants had upper lid trachomatous trichiasis with one or more eyelashes touching the eye or evidence of epilation, in association with tarsal conjunctival scarring. Exclusion criteria were age less than 18 years, recurrent trichiasis after previous surgery, hypertension, and pregnancy. Participants were randomly assigned (1:1) to either BLTR or PLTR surgery, stratified by surgeon. The sequences were computer-generated by an independent statistician. Surgery was done in a community setting following WHO guidelines. Participants were examined at 6 months and 12 months by assessors masked to allocation. The primary outcome was the cumulative proportion of individuals who developed recurrent trichiasis by 12 months. Primary analyses were by modified intention to treat. The intervention effect was estimated by logistic regression, controlled for surgeon as a fixed effect in the model. The trial is registered with the Pan African Clinical Trials Registry (number PACTR201401000743135). ABSTRACT.SUMMARY.FINDINGS: 1000 participants with trichiasis were recruited, randomly assigned, and treated (501 in the BLTR group and 499 in the PLTR group) between Feb 13, 2014, and May 31, 2014. Eight participants were not seen at either 6 month or 12 month follow-up visits and were excluded from the analysis: three from the PLTR group and five from the BLTR group. The follow-up rate at 12 months was 98%. Cumulative recurrent trichiasis by 12 months was more frequent in the BLTR group than in the PLTR group (110/496 [22%] vs 63/496 [13%]; adjusted odds ratio [OR] 1·96 [95% CI 1·40–2·75]; p=0·0001), with a risk difference of 9·50% (95% CI 4·79–14·16). ABSTRACT.SUMMARY.INTERPRETATION: PLTR surgery was superior to BLTR surgery for management of trachomatous trichiasis, and could be the preferred procedure for the programmatic management of trachomatous trichiasis. ABSTRACT.SUMMARY.FUNDING: The Wellcome Trust. BODY.INTRODUCTION: Trachoma, a neglected tropical disease caused by Chlamydia trachomatis, is the leading infectious cause of blindness.1 Recurrent infection drives progressive conjunctival scarring, which turns the lid and eyelashes in towards the eye (trichiasis) resulting in pain and eventually blinding corneal opacification. About 1·2 million people are irreversibly blind from this disease and about 7·2 million have trichiasis.1, 2 WHO recommends the SAFE strategy for trachoma control: Surgery for trichiasis, Antibiotics, Facial cleanliness, and Environmental improvement.3 Trichiasis surgery reduces the risk of sight loss by correcting the in-turned eyelid, thus stopping the corneal damage. Surgery involves an incision through the scarred upper eyelid, parallel to the lid margin, outward rotation, and suturing in the corrected position.4 Due to the limited number of ophthalmologists in most trachoma-endemic countries, surgery is usually done by non-physicians with limited training, equipment, and time.3 Given these constraints, the technique needs to be simple, safe, and quick to do, whereas at the same time giving consistently good results. Unfortunately, trichiasis frequently recurs after surgery. This outcome represents a substantial limitation in preventing sight loss from trachoma. Studies have reported trichiasis recurrence rates between 10% at 3 months and up to 60% at 3 years, with an average of around 20% at 1 year.5, 6, 7, 8, 9, 10, 11, 12, 13, 14 Several factors contribute to recurrent trichiasis, including preoperative disease severity, surgeon skill, and surgical procedure.15 Among these, operation type is a major determinant of outcome and subtle variations in procedure performance probably affect results.10, 11, 16 Many different surgical procedures have been used to correct trichiasis, with some evidence that bilamellar tarsal rotation (BLTR) is better than others to which it has been formally compared.10, 11, 15, 17 However, it is important to determine which is the best of these options. Research in contextEvidence before this studyMembers of our study group recently published a systematic review of the management of trachomatous trichiasis (Burton and colleagues, 2015). When preparing this systematic review, we searched CENTRAL, Ovid MEDLINE, Embase, ISRCTN registry, ClinicalTrials.gov, and WHO ICTRP. We searched until May 7, 2015, using the search terms "trachoma" and "trichiasis". See the review's appendix for full search methods for each database. We identified one previous randomised trial (Adamu and Alemayehu, 2002), which compared variants of the BLTR and PLTR procedure done by ophthalmologists in a teaching hospital environment in Ethiopia; 153 patients were randomly assigned and followed for 3 months. No evidence of a difference in outcome was found. However, this earlier study was constrained by a small sample size and short duration. The surgery was performed in a teaching hospital setting by ophthalmologists, in contrast to the health centre provision by non-physicians typical of trachoma control programmes, limiting the conclusions that can been drawn.Added value of this studyOur trial was designed to compare the two most common operations used to treat trachomatous trichiasis to determine which gives the best results in terms of disease recurrence and complications in a programmatic setting. The results show that the PLTR was superior to BLTR because it had a substantially lower trichiasis recurrence rate by 1 year and fewer intraoperative and immediate postoperative complications.Implications of all the available evidenceThis study provides evidence of superiority of PLTR, suggesting that it could be the best procedure for the programmatic management of trachomatous trichiasis. We suggest that new surgical trainees in both established and new programmes be trained in the PLTR procedure. Another trial examining the outcomes of PLTR surgery done by surgeons previously trained in BLTR surgery should be considered. About 20 years ago several procedures were compared with the BLTR operation in randomised controlled trials.10, 11 The findings from these trials showed that the BLTR procedure had the lowest trichiasis recurrence rate of the procedures compared (about 20% at 1 year), leading WHO to recommend it as the preferred operation.3 However, the most commonly used alternative procedure, the posterior lamellar tarsal rotation (PLTR) or Trabut operation, was not included in these earlier trials. One earlier randomised trial from Ethiopia compared variants of the BLTR and PLTR, and found no difference. However, that trial was relatively small, with only 3 months' follow-up and was done by ophthalmologists in a teaching hospital, precluding conclusions for control programmes that do the vast majority of trichiasis surgery.13 There is an unprecedented effort to scale up global trichiasis surgery output and improve outcomes, to clear the huge trichiasis backlog. This effort requires training many trichiasis surgeons on the easiest, safest, and most successful operation with the least recurrence and complications. There is an urgent need to examine rigorously which of these two most frequently performed operations has the best outcomes in a programmatic setting, with an adequate sample size and follow-up period. This question was identified as a research priority several years ago by the WHO Alliance for the Global Elimination of Trachoma by 2020 (GET2020).18 The aim of our trial was to determine whether BLTR or PLTR surgery gives superior results under programmatic conditions. BODY.METHODS.STUDY DESIGN AND PARTICIPANTS: This was a single-masked, individual-randomised, controlled trial done in Ethiopia. Adults with trachomatous trichiasis were randomly allocated to either BLTR or PLTR surgery, stratified by surgeon, and followed up for 1 year. The study was approved by the Ethiopian National Health Research Ethics Review Committee, the London School of Hygiene & Tropical Medicine Ethics Committee, Emory University Institutional Review Board, and the Ethiopia Food, Medicine and Healthcare Administration and Controls Authority. The trial was done in compliance with the Declaration of Helsinki and International Conference on Harmonisation–Good Clinical Practice. An independent data and safety monitoring committee oversaw the trial. Participants had upper lid trachomatous trichiasis with one or more eyelashes touching the eye or evidence of epilation, in association with tarsal conjunctival scarring. We excluded people with trichiasis due to other causes, recurrent trichiasis after previous surgery, hypertension, pregnancy, and those under 18 years. Patients were recruited mainly through community-based screening in three districts of West Gojam Zone, Amhara Region, Ethiopia. Recruitment and surgery were performed in community level health centres. Written informed consent in Amharic was obtained before enrolment from participants. If a participant was unable to read and write, the information sheet and consent form were read to them and their consent recorded by thumbprint. BODY.METHODS.RANDOMISATION AND MASKING: Participants were randomly assigned (1:1) to either PLTR or BLTR surgery for each surgeon, with random block sizes of 4 or 6. Randomisation was stratified by surgeon because of potential intersurgeon variability. The sequences were computer-generated by an independent statistician. Separate allocation sequences for each surgeon were concealed in sequentially numbered, sealed, opaque envelopes. A person independent of all other aspects of the trial prepared these envelopes. On most recruitment days, two surgeons operated simultaneously. Following baseline examination, participants were allocated to the next available surgeon. A fieldworker was responsible for implementing the intervention assignment in a dedicated area. The fieldworker and surgeon jointly confirmed the allocation and recorded this in the surgical logbook. The different surgical equipment sets for the two procedures were kept separately. The randomisation fieldworker and surgeon jointly collected the appropriate surgical set for the allocated procedure. Surgeons and patients were aware of the allocation. The two examiners (EH, SA) who were responsible for clinical observations at baseline, 6 months, and 12 months were masked to the allocation. They were not involved in the allocation process, surgery, postoperative care, or the 10 day follow-up. The intraoperative and 10 day observations were made by separate fieldworkers who could not be masked to the allocation. BODY.METHODS.PROCEDURES: At the preoperative assessment before randomisation, demographic characteristics were recorded. Presenting logMAR (logarithm of the minimum angle of resolution) visual acuity at 2 m was measured using PeekAcuity software on a smartphone in a dark room.19 For visual acuities of counting fingers or less, logMAR values were attributed as follows: counting fingers, 2·0; hand movements, 2·5; perception of light, 3·0; and no perception of light, 3·5.8 We assessed contrast sensitivity with a prototype smartphone-based test that presents calibrated grey scale spots against a white background, which are identified by touch. Eyes were examined by a single examiner (EH) using 2·5× binocular loupes and torch, and graded using the Detailed WHO FPC Grading System.20 Lashes touching the eye were counted and subdivided by the part of the eye contacted: cornea, lateral, or medial conjunctiva. Trichiasis subtypes were recorded: metaplastic, misdirected, and entropic.21 Clinical evidence of epilation was identified by broken or newly growing lashes, or areas of absent lashes. Upper lid entropion was graded by assessing the degree of eyelid margin inward rotation.21 Corneal scarring was graded using a previously described detailed system.20 Three standardised high-resolution digital photographs of trichiasis, cornea, and tarsal conjunctiva were taken, using a Nikon D90 digital SLR camera with 105 mm macro lens and R1C1 flash units.22 Before recruitment, nine experienced trichiasis nurse-surgeons, already trained, certified, and regularly performing PLTR surgery were trained in BLTR surgery. We followed the procedures described in the WHO Trichiasis Surgery for Trachoma manual.4 After training, surgeons were carefully observed throughout five operations and certified as correctly doing the procedure following the standardisation checklist.4 Surgeons then returned to their usual workplace, and regularly performed BLTR for 6 months. They then returned for repeat standardisation, assessment, and certification on both PLTR and BLTR procedures by two assessors. Before commencing the trial, each surgeon had done about 100 BLTR procedures (median 117, range 94–137). The best six surgeons did the surgery in this trial: they were all certified as consistently performing all component steps of both operations correctly, using the WHO certification procedures. The procedures are described in detail in the WHO manual.4 Briefly, in the PLTR the eyelid is everted, an incision is made through the tarsal conjunctiva and tarsal plate (posterior lamella), parallel to and 3 mm above the lid margin. The posterior lamella is separated from the anterior lamella (orbicularis muscle and skin). Three sutures are placed to externally rotate and fix the eyelid. In the BLTR the eyelid is fixed with a clamp (Waddell type), of an appropriate size.23 A full-thickness incision is made through the anterior and posterior lamellae, parallel to and 3 mm above the lid margin. Three sutures are placed to externally rotate and fix the eyelid. Surgery was done under subcutaneous local anaesthesia (2–3 mL of lidocaine 2%, with adrenaline). In both surgical procedures, 4/0 silk sutures with 3/8th circle, 19 mm cutting needles were used. Surgery duration was measured and complications documented. Postoperatively, operated eyes were padded for 1 day and tetracycline eye ointment 1% was self-administered twice daily for 2 weeks. Participants were not given perioperative oral azithromycin because it is not the operational practice to use it in this region. Participants were examined at 10 days, 6 months, and 12 months after operation. At 10 days, data were collected on patient-reported outcomes (improvement in preoperative symptoms, postoperative pain, and functioning). Participants were examined for recurrence, degree of lid eversion, infection, granulomata, and eyelid contour abnormality (ECA) before suture removal. At 6 months and 12 months participants were re-examined following the same procedures as for baseline (SA at 6 months and EH at 12 months). The examiners were standardised and had very strong agreement for the primary outcome in grading validation studies (κ=0·95). Based on severity, trichiasis cases were categorised into minor trichiasis with less than six lashes or evidence of epilation in less than one third of the lid margin, and major trichiasis with six or more lashes or evidence of epilation in one third or more of the lid margin. The degree of entropion correction was graded as follows: (grade 1) extra eversion: main lashes point superiorly, whole lid margin visible, and tarsal plate surface visible; (grade 2) lid margin eversion: lashes point superiorly, whole lid margin visible, and tarsal surface not visible; (grade 3) partial lid margin entropion: some parts of the lashes might point anteriorly and some part of the lid margin not visible; (grade 4) total lid margin entropion: lashes might point inferiorly or towards the globe and lid margin is not visible. We considered grade 1 over-correction, grade 2 normal correction, and grades 3 and 4 under-correction. Granulomata were defined as fleshy tissue growth of at least 2 mm on the tarsal conjunctiva or at the edge of the eyelid.12 Grading of ECAs was based on the PRET trial method: mild, vertical deviation from the natural contour less than 1 mm in height and affecting more than one third of horizontal eyelid length; moderate, vertical deviation from the natural contour 1–2 mm in height or affecting one third to two thirds of horizontal eyelid length; severe, vertical deviation from the natural contour more than 2 mm in height or a defect more than two thirds the horizontal eyelid length.24 These were regrouped as: clinically non-significant ECA, which included mild ECA; and clinically significant ECA, which included moderate-to-severe ECA. The clinically significant ECAs also included other ECAs such as divot, which is a scarred depression or tissue loss including lashes at the eyelid margin. Visual acuity and contrast sensitivity were measured at 12 months. Data on patient-reported outcomes were collected at 12 months. Individuals with recurrent trichiasis during follow-up were offered repeat surgery. Participants with other ophthalmic pathology (eg, cataract) were referred. High-resolution digital photographs of upper eyelid, cornea, and tarsal conjunctiva were taken at 6 months and 12 months.22 To address potential concerns of bias which might arise from identifying procedure type from surgical scars, the upper eyelid photograph was taken after covering the incision area with a shaped occluder to prevent any unmasking of the independent photograph grader (an ophthalmologist with 15 years' experience of examining for trachomatous trichiasis). Images were viewed on a 15 inch high-resolution "retina" screen (Apple). Trachomatous trichiasis was considered to be present if there was one or more lashes touching the eye, identified by the lashes deviating over the globe and appearing to touch the eye. BODY.METHODS.OUTCOMES: The primary outcome was the cumulative proportion of individuals who developed recurrent trichiasis by 12 months. Recurrent trichiasis was defined as one or more lashes touching the eye or clinical evidence of epilation, or a history of repeat trichiasis surgery by 12 months. A-priori defined secondary outcome measures were: recurrent trichiasis at 6 months and 12 months; trichiasis recurrence difference by surgeon; trichiasis recurrence difference by baseline disease severity; number, type, and location of recurrent lashes at 12 months; corneal opacity, vision, and contrast sensitivity changes at 12 months; intraoperative, immediate, and late postoperative surgical complications (bleeding, infection, and granulomas); ECA at 12 months; and patient-reported outcomes. BODY.METHODS.STATISTICAL ANALYSIS: In the STAR trial, the 1 year trichiasis recurrence rate using BLTR surgery was about 10% (tetracycline group).5 In our recent trials in Ethiopia involving patients with a similar severity of disease to the STAR trial, we found PLTR surgery had a 1 year recurrence rate of 18%.8 A sample of 836 participants was estimated to have 90% power and 95% confidence to detect a similar difference in recurrent trichiasis (18% vs 10%). Therefore, we aimed to recruit 1000 cases (500 in each group), to allow for about 15% loss to follow-up. Data were double-entered into Access 13 (Microsoft) and transferred to Stata 11 (StataCorp) for analysis. For participants who had bilateral surgery, we randomly designated one eye to be the study eye for the analysis. A modified intention-to-treat analysis was done, with primary outcome data analysed on all participants seen at either the 6 month or 12 month follow-up or both. Those not seen at either of these follow-up visits were excluded from the analysis. The primary outcome and binary secondary outcomes were compared between the two surgical groups with logistic regression analyses to estimate the odds ratio (OR) and 95% CI. All comparisons between the two surgical procedures were controlled for surgeon as a fixed effect in the model to account for the stratified randomisation. The risk difference in the primary outcome (recurrent trichiasis by 12 months) between BLTR and PLTR procedures was estimated. The possibility of effect modification between group and a-priori defined factors such as surgeon, preoperative trichiasis severity, papillary inflammation, age, and sex was investigated by including interaction terms in the model and using a likelihood ratio test to assess statistical significance of the interaction term. Ordered categorical secondary outcomes (changes in visual acuity and corneal opacity, bleeding, and patient-reported outcomes) were compared between the two surgical interventions using ordinal logistic regression. Categorical secondary outcomes (type and location of recurrent lashes, ECAs, and entropion correction) were analysed using multinomial logistic regression to estimate relative risk ratio (RRR) and 95% CI. Negative binomial regression was used to analyse the difference in the number of recurrent lashes touching the eye between the two intervention groups. The signed-rank test was used to analyse visual acuity and contrast sensitivity changes between baseline and the 12 month follow-up. The risk of trichiasis recurrence difference by surgeon between the two surgical interventions was analysed using logistic regression adjusted for baseline disease severity such as entropion and trichiasis. To investigate the possibility of a learning curve effect during recruitment, the trichiasis recurrence rates for the first 50% of cases to be recruited versus the second 50% of cases recruited for each surgeon were compared using logistic regression adjusted for baseline disease severity such as entropion and trichiasis. The trial is registered at the Pan African Clinical Trials Registry (PACTR201401000743135). BODY.METHODS.ROLE OF THE FUNDING SOURCE: The funder of the study had no role in study design, data collection, data analysis, data interpretation, or writing of the report. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication. BODY.RESULTS: Between Feb 13, 2014, and May 31, 2014, 5168 people were examined for eligibility, of whom 1314 (25%) had trachomatous trichiasis (figure). The remaining 3854 had other ocular conditions. Of the 1314 trichiasis cases, 312 did not meet inclusion criteria, largely because they had previously received surgery for trichiasis. Of the 1002 eligible participants, two (<1%) declined surgery. Thus, 1000 trichiasis cases consented, were enrolled, and randomly assigned (501 in the BLTR group and 499 in the PLTR group). Participants were reassessed at 10 days (range 7–14) for suture removal, 6 months, and 12 months after enrolment. Almost all (98%) participants were examined at each follow-up. At 10 days, two people had travelled to another region, and had sutures removed in their new locality. Eight (1%) participants were not seen at either 6 month or 12 month follow-up visits and were therefore excluded from the analysis: three from the PLTR group and five from the BLTR group. Hence, primary outcome data were available and analysed for 992 (99%): 496 in each group. Baseline demographic and clinical characteristics were balanced between the trial groups (table 1). The majority of the participants were female (77%) and their mean age was 47·3 years. The two groups were comparable for visual acuity and prevalence of corneal opacity, conjunctival inflammation, scarring, entropion, and trichiasis. There was evidence of epilation in 588 (59%) participants: 281 (56%) in the PLTR group and 307 (61%) in the BLTR group; among these 82 (8%) in both groups had successfully epilated, with no lashes touching. Major trichiasis was present in 145 (29%) of the PLTR group and 144 (29%) of the BLTR group. About 90% of the participants in both groups had corneal lashes (table 1). PLTR surgery took slightly less time than BLTR surgery (15 min 33 s vs 16 min 39 s; p<0·0001). By 12 months, the primary outcome, cumulative recurrent trichiasis, had developed in 173 (17%) of 992 study eyes. Cumulative recurrence was significantly more frequent in the BLTR group (110/496 [22%]) than in the PLTR group (63/496 [13%]); after adjusting for surgeon, the OR was 1·96 (95% CI 1·40–2·75; p=0·0001). The risk difference for recurrent trichiasis between BLTR and PLTR procedures was 9·50% (95% CI 4·79–14·16). There was no evidence of effect modification between group and a-priori defined other factors on the primary outcome, including surgeon. The primary outcome analysis using the photograph grading results was similar to the field grading. By 12 months, cumulative recurrent trichiasis was recorded for 250 (25%) of 992 study eyes. Recurrence was significantly more frequent in the BLTR group than in the PLTR group (32% vs 19%; OR 1·97 [95% CI 1·47–2·65]; p<0·0001). The risk difference for recurrent trichiasis between BLTR and PLTR procedures was 12·5% (95% CI 7·2–17·8). At 10 days, recurrent trichiasis was present in three study eyes, one in the PLTR group and two in the BLTR group. At 6 months, recurrent trichiasis was present in 114 (12%) of 983 study eyes, and was significantly more frequent in the BLTR group than the PLTR group (71 [14%] vs 43 [9%]; OR 1·77 [95% CI 1·19–2·65]; p=0·0001). At 12 months, recurrent trichiasis was present in 131 (13%) of 981 study eyes and again remained significantly more frequent in the BLTR group than the PLTR group (85 [17%] vs 46 [9%]; OR 2·04 [95% CI 1·39–2·99]; p=0·0003). There was no evidence of a difference in the risk of trichiasis recurrence between surgeons by 12 months for either PLTR (p=0·80) or BLTR (p=0·44), or for a learning curve during the course of the trial for either procedure. For PLTR, recurrence risks during the first and second half of recruitment were 32 (13%) of 248 and 31 (12%) of 248, respectively (p=0·68). For BLTR, recurrence risks during the first and second half of recruitment were 55 (22%) of 247 and 55 (22%) of 249, respectively (p=0·93). The number, type, and location of recurrent lashes were comparable between the two groups (Table 1, Table 2). BLTR surgery had more frequent recurrence than PLTR surgery for major trichiasis cases and across all baseline entropion grades. There was no evidence of a difference in visual acuity, contrast sensitivity, corneal opacity, and entropion changes at 12 months between the two groups (table 2). However, compared with the baseline, at 12 months there was a statistically significant overall improvement in visual acuity (baseline median logMAR, 0·6 [IQR 0·3–0·8] vs 12 month median logMAR, 0·5 [0·2–0·7]; signed-rank test, p<0·0001) and contrast sensitivity (baseline median contrast sensitivity, 3% [2–5] vs 12 month contrast sensitivity, 2% [1–3]; signed-rank test, p<0·0001) in the entire combined study sample. After adjusting for surgeon, there was evidence of a difference in odds of intraoperative, immediate, or late postoperative complications between the two surgical interventions (table 3). There was more intraoperative and immediate postoperative bleeding in the BLTR surgery group than the PLTR surgery group (OR 2·76 [95% CI 1·27–6·00]; p=0·01), and also more postoperative infection in the BLTR surgery group than the PLTR surgery group (OR 4·44 [95% CI 2·11–9·33]; p=0·0001; table 3). Granulomata were less frequent in the BLTR group compared with the PLTR group (OR 0·41 [95% CI 0·20–0·83]; p=0·01; table 3). The frequency of clinically non-significant (mild) ECA at 12 months was lower in the BLTR surgery group than the PLTR surgery group (RRR 0·50 [95% CI 0·34–0·73]; p<0·0001; table 3). However, there was no evidence of a difference in the frequency of clinically significant (moderate-to-severe) ECA between the two groups (RRR 1·10 [95% CI 0·66–1·81]; p=0·72; table 3). A similar pattern in ECA was found by independent photograph grading. Clinically mild ECA at 12 months was less frequent in the BLTR group (27/484 [5%]) than in the PLTR group (58/489 [12%]; RRR 0·43 [95% CI 0·27–0·70]; p=0·001). However, again we found no evidence of a difference in moderate-to-severe ECA between the two groups (BLTR, 4% vs PLTR, 5%; RRR 0·76 [95% CI 0·41–1·44]; p=0·40). There was evidence of more under-correction at 12 months with BLTR surgery than PLTR surgery (table 3). There was no evidence of a difference between groups in the patient-reported pain experienced during surgery (p=0·84; table 4). However, participants in the BLTR group reported more pain and discomfort during the days between surgery and suture removal than the PLTR group (OR 1·46 [95% CI 1·12–1·89]; p=0·004; table 4). There was no evidence of a difference in patient satisfaction between the two groups for treatment of trichiasis (p=0·20) or the cosmetic appearance of the operated eyelid (p=0·64; table 4). BODY.DISCUSSION: Around 7 million people have trachomatous trichiasis and require high-quality surgical intervention.2 A major global effort exists to scale up surgical programmes. However, high postoperative trichiasis recurrence rates are undermining trachoma control.25 Identifying the surgical intervention with the lowest recurrence rate has been a research priority for many years.18 In this trial, we compared the relative effectiveness of the two most commonly used operations and found that PLTR surgery has a significantly lower trichiasis recurrence rate at 12 months than BLTR surgery, particularly for more severe cases. Considerable care was taken to ensure that the surgeons did both procedures using the WHO-described method with equal precision.4 We trained surgeons who had been previously taught PLTR to do the BLTR procedure. This approach was chosen, rather than training novice surgeons simultaneously in both procedures, to reduce the learning curve to achieve proficiency in the new procedure.26 During training and standardisation, before the commencement of the trial, each surgeon did about 100 BLTR operations and was confirmed by two assessors to be performing the procedure per protocol, using the WHO Certification process.4 There is clear evidence that during the trial the surgeons continued to do both operations consistently well and that the recorded difference in the primary outcome was not attributable to having learnt the BLTR procedure more recently. First, there were only three recurrent cases by 10 days, indicating that primary surgical failure was rare. If the recorded differences in recurrence were due to poor surgical technique, we would anticipate this to be more apparent by 10 days. This finding suggests that the subsequent difference in the primary outcome is attributable to fundamental differences in the surgical method that achieves a more stable and long-lasting correction in the case of PLTR surgery. Second, trichiasis recurrence rates between the first and second half of recruitment were very similar. If surgeons were still on a BLTR learning curve, a lower recurrence rate in the second half of recruitment would have been anticipated. Third, there was no significant difference in recurrence for either surgical procedure between surgeons. Finally, the recurrence rates for both procedures were generally similar to or lower than those reported in other trials, with the exception of the STAR trial which reported a lower BLTR recurrence rate.5, 6, 7, 8, 9, 10, 11, 12, 13, 14 The only other trial to compare BLTR and PLTR procedures was done in Ethiopia.13 This trial reported comparable outcomes for the two procedures: BLTR, 10·4%, and PLTR, 12·3%, recurrence at 3 months. However, this earlier study had a number of constraints. First, it was under-powered to detect a difference (153 patients, 256 eyes operated). Second, it was done at a tertiary teaching hospital by ophthalmologists. By contrast, most programmatic trichiasis surgery is done by non-physicians with limited training in remote, low-level, health facilities. Alternative techniques might give different results in more programmatic settings. Third, the 3 month follow-up period was too short to assess the relative performance because differences might take longer to become apparent.6, 7, 11, 27, 28 The PLTR surgical procedure did better than BLTR for several secondary outcomes. A higher rate of postoperative infection occurred following BLTR, probably because of the skin incision. All infections were treated successfully with oral antibiotics. The skin and orbicularis incision probably also explains the greater intraoperative and postoperative bleeding and postoperative pain that occurred with the BLTR procedure because these structures have an extensive vascular and sensory supply. These are important considerations for improving surgical uptake, which might be reduced by patient reports of pain and bleeding. Participants reported very high levels of satisfaction with the cosmetic outcome and effect of surgery in alleviating the trichiasis in both groups at 12 months. There was no difference by group. However, some caution needs to be taken in drawing firm conclusions from such data; the questions were asked by members of the study team, and there could be some reticence in expressing dissatisfaction in this context. Of note, the Kenyan National Trachoma Control Programme recently switched from the BLTR to PLTR surgery because of reports of widespread patient dissatisfaction with the appearance of the full-thickness incision in BLTR surgery. Under-correction was more frequent with BLTR surgery at 12 months, suggesting it is less effective at correcting underlying entropion. We found that BLTR had a lower rate of mild ECAs. We consider this degree of ECA to be clinically and cosmetically non-significant because the vertical deviation from the lid contour is less than 1 mm. It is possible that this difference reflects consistently greater degrees of evertion with PLTR. There was no difference in moderate-to-severe ECA by group. Conjunctival granulomata developed more frequently after PLTR surgery.8 Granulomata are probably a vigorous healing response that occurs in a tissue defect.12 The additional rotation effected by the PLTR might create a larger posterior lamella defect and thereby a higher likelihood of granuloma formation. However, they are usually a minor complication that either self-resolve or need only a simple shave under topical anaesthesia. In the earlier comparison of BLTR and PLTR in Ethiopia, both eyelid notching and granulomata were significantly more common in the BLTR group than in the PLTR group (p=0·002).13 We think that it is biologically plausible that the PLTR achieves a more effective and stable correction of the entropion and trichiasis due to a key difference in technique from the BLTR. In the PLTR procedure, the lower edge of the dissected upper portion of the tarsal plate is drawn down and tucked into the dissected space between the anterior lamella and the lower portion of the tarsal plate behind.4 Once healed, this provides a wedge of tissue that continues to rotate the distal end of the eyelid outwards, and stabilise the correction. This study has several strengths. It had a large sample size and very high follow-up rates. Demographic and clinical characteristics were balanced between groups. The surgeons were rigorously trained and standardised to ensure the procedures were done correctly. A potential design limitation in a trial of these two procedures is the risk of unmasking at the time of follow-up observations because some BLTR cases might very occasionally have a faint skin scar. The baseline, 6 month, and 12 month observers were masked to the randomisation. However, to independently assess the primary outcome for observer bias, photographs in which the upper lid skin was covered by a mask were graded. We found that the analysis of primary outcome using field and photograph grading were comparable, showing no systematic bias in the field grading. The observations of some of the secondary outcomes made during the operative procedure and at 10 days were impossible to mask. The use of surgeons who had previously been trained in PLTR and then provided with a second round of training in BLTR could be viewed as a potential limitation. However, we think that there was ample pre-trial training, practice, and assessment to bring the surgeons to a proficient standard, and that there is clear evidence that during the trial high standards were maintained, as discussed above. In this trial we used silk sutures, which were removed at 10 days. Although absorbable sutures such as polyglactan-910 (vicryl) offer the operational advantage of not needing to be removed, we have previously found in a randomised trial that silk and absorbable sutures have comparable outcomes, and therefore it is unlikely that the outcome of this present study would be modified by their use.8 Overall, the PLTR procedure was superior to the BLTR in terms of lower trichiasis recurrence and fewer intraoperative and immediate postoperative complications. All other factors being equal, PLTR could be the preferred procedure for the programmatic management of trachomatous trichiasis. We suggest new surgical trainees in both established and new programmes should be trained in the PLTR procedure. Additionally, consideration could be given to further research to investigate whether individuals previously trained to do BLTR surgery need to be re-trained in PLTR surgery.

TITLE: A PET-CT study on the specificity of acupoints through acupuncture treatment in migraine patients ABSTRACT.BACKGROUND: In the field of acupuncture research, the topic of acupoint specificity has received increasing attention, but no unified conclusion has been reached on whether or not acupoint specificity exists. Furthermore, the majority of previous acupuncture neuroimaging studies have been performed using healthy subjects. In this study, patients with migraine were used to investigate acupoint specificity. ABSTRACT.METHODS: Thirty patients with migraine were enrolled and randomized into three groups: Traditional Acupuncture Group (TAG), Control Acupuncture Group (CAG), and Migraine Group (MG). The TAG was treated by acupuncture stimulation at Waiguan (TE5), Yang Lingquan (GB34), and Fengchi (GB20). The CAG was treated at Touwei (ST8), Pianli (LI6), and Zusanli (ST36). The MG received no treatment. Positron emission tomography with computed tomography (PET-CT) was used to test for differences in brain activation between the TAG and CAG versus MG, respectively. ABSTRACT.RESULTS: Traditional acupuncture treatment was more effective for pain reduction than control acupuncture treatment. The TAG showed higher brain metabolism than the MG in the middle temporal cortex (MTC), orbital frontal cortex (OFC), insula, middle frontal gyrus, angular gyrus, post-cingulate cortex (PCC), the precuneus, and the middle cingulate cortex (MCC). Metabolism decreased in the parahippocampus, hippocampus, fusiform gyrus, postcentral gyrus, and cerebellum in the TAG compared with the MG. In the CAG, metabolism increased compared with the MG in the MTC, supratemporal gyrus, supramarginal gyrus, and MCC, whereas metabolism decreased in the cerebellum. ABSTRACT.CONCLUSIONS: Acupuncture stimulation of different points on similar body regions in migraine patients reduced pain and induced different levels of cerebral glucose metabolism in pain-related brain regions. These findings may support the functional specificity of migraine- treatment-related acupoint. ABSTRACT.TRIAL REGISTRATION: The number of our clinical trial registration is: ChiCTR-TRC-11001813, and the protocol and inclusion criteria have already been registered as ChiCTR-TRC-11001813. BODY.BACKGROUND: Acupuncture, an important part of Traditional Chinese Medicine (TCM), has been accepted as an ancient therapeutic modality in Eastern medicine. However, little is known about the neural mechanisms of acupuncture. In the past decade, positron emission tomography (PET) and functional magnetic resonance imaging (fMRI) techniques have provided a means to study effects of acupuncture on the brain, and to elucidate the mechanisms of action in acupuncture treatment of diseases [1-4]. In acupuncture research, the topic of acupoint specificity has received increasing attention. Significant neuroimaging evidence of acupoint specificity of the vision-related acupoints was provided by Cho et al[5]. Other studies have also focused on the specificity of acupoints, including visual and auditory acupoints [6-9], but no consensus has yet been reached on the existence of acupoint specificity. The majority of previous acupuncture neuroimaging studies have used healthy subjects. To our knowledge, only a few neuroimaging studies have reported on the response to acupuncture in patients with disorders [10-12]. Migraine is one of the indications for acupuncture therapy. Randomized controlled trials (RCTs) have shown that acupuncture, compared with conventional treatment, is beneficial to migraine by reducing consumption of medication [13,14]. Li et al. discovered that stimulation of genuine acupoints was superior to stimulation of non-acupoints in relieving pain and preventing migraine relapse or aggravation [15]. Moreover, a review of clinical trials revealed that acupuncture is an effective treatment option for migraine prophylaxis [16]. In this study, patients with migraine were used as subjects to investigate acupoint specificity. We used fluorodeoxyglucose positron emission tomography combined with computed tomography (FDG-PET/CT). FDG-PET is used to visualize glucose metabolism and is frequently applied for diagnosis of various diseases. In recent years, FDG-PET has also been used to assess brain function related to the efficacy of acupuncture [17]. Patients received stimulation at specific acupoints of the Shaoyang meridians, which are traditionally employed in the treatment of migraine. In the control group, acupoints on the Yangming meridians were stimulated. These points are less often used than points on Shaoyang meiridians for migraine treatment according to clinical data and theories of traditional acupuncture. We hypothesized that the specific and non-specific stimulation would elicit distinct patterns of brain activity. This could provide information on the specificity of acupoints in the treatment of migraine. BODY.METHODS.SUBJECTS AND EXPERIMENTAL PARADIGM: Thirty right-handed patients with acute migraine without aura, selected from a total of 278 patients recruited from July 2008 to September 2009, were studied. The migraine patients (12 males and 18 females; mean age 32.87 ± 8.71 years) were randomized into three groups: 1) Traditional Acupuncture Group (TAG), 2) Control Acupuncture Group (CAG), and 3) Migraine Group (MG). The TAG received specific stimulation of traditional acupoints, the CAG received non-specific stimulation, and the MG received no treatment. Moreover, after PET-CT scan, MG group were given a fee for their contribution, and also we would give them acupuncture treatment for free if they want. Subjects were matched by gender, age, handedness, and education. Each subject gave informed consent and all study protocols were approved by the ethics committee of the Affiliated Hospital of Chengdu University of Traditional Chinese Medicine. The inclusion criteria were: (1) meeting the classification criteria of the International Headache Society for the diagnosis of migraine without aura; (2) left-sided headache; (3) one or more migraine attacks per month during the last three months; (4) a Visual Analogue Scale (VAS) score of 2–8 at recruitment and before scanning; (5) less than 24 hours from the previous migraine attack to the beginning of the scan; (6) age 20–45 years; (7) negative neurological examination and normal skull CT or MRI; (8) no medication for migraine within 24 hours since the onset of the acute attack; and (9) being capable of giving written informed consent. The exclusion criteria were: (1) headaches caused by organic disorders, such as subarachnoid hemorrhage, cerebral hemorrhage, cerebral embolism, cerebral thrombosis, vascular malformation, hypertension, or arteriosclerosis; (2) presence of psychosis, bleeding disorders, or allergies that may preclude the safe use of acupuncture; (3) presence of concurrent autoimmune or inflammatory disease resulting in pain; (4) concurrent participation in other studies; (5) pregnancy or nursing; (6) medication with vasoactive agent in the last two weeks; (7) current major anxiety disorder and/or depression; and (8) presence of any contraindications to PET-CT or electroacupuncture. Acupuncture treatment was applied to the TAG and CAG by electroacupuncture treatment (EAT), while the MG was not treated in any way. Acupuncture stimulation (AS) in the TAG was performed at Waiguan (TE5), Yang Lingquan (GB34), and Fengchi (GB20) on the Shaoyang meridians. In the CAG, AS was performed at Touwei (ST8), Pianli (LI6), and Zusanli (ST36) on the Yangming meridians (Figure 1a). Sterile single-use acupuncture needles (25–40 mm in length and 0.30 mm in diameter; manufactured by Suzhou Medical Supplies Co., Ltd., Suzhou, China) were used for stimulation. The treated subjects achieved DeQi sensation (soreness, numbness, distention, and heaviness) by the manipulations of lifting and thrusting or twirling and rotating. Once all the acupoints had been needled, auxiliary needles were perpendicularly punctured 2 mm lateral to the acupoints, to 2 mm in depth, without manual manipulation. Electro-acupuncture (HANS: Han's acupoint nerve stimulator, HANS-200, Nanjing, China) was performed on the acupoints by one experienced acupuncturist. Each acupuncture needle and its auxiliary needle were connected with the electricity by HANS for 30 minutes. The stimulation frequency was 2/100 Hz, and the stimulation intensity varied from 0.1 to 1.0 mA as long as the patients felt comfortable, as determined by the previous studies [15,18]. Figure 1 a: Location of acupoints. b: Experimental Paradigm. PET-CT scans were performed on the subjects at the PET-CT center of the Sichuan Provincial People's Hospital. When the migraine attack began, each subject went through the following procedure: (1) examinations of blood sugar and Visual Analogue Scale (VAS) scores (range from 0 to 10) before the PET-CT scan; (2) a 20 min rest in a quiet room; (3) a tracer injection at the back of the right hand (18F-FDG; synthesized with Mini Tracer accelerator; 0.11 mCi/kg dosage); (4) a 40 min rest, which included the 30 min acupuncture treatment in the TAG and CAG; (5) a PET-CT scan; and (6) examination of VAS scores after the PET-CT scan (Figure 1b). Subjects were instructed to remain relaxed during the whole study, with eyes blindfolded and ears plugged. BODY.METHODS.PET-CT IMAGING: It has been found that curative effects of acupuncture treatment emerge after about 30 to 40 minutes of acupuncture stimulation [15,18], and 18F-FDG is known to be stable in the brain for 30 to 45 minutes after injection (half-life ~109 min). We therefore acquired image data sets at 40 minutes after the 18F-FDG injection, with the aim of capturing the processes underlying the effect of acupuncture. PET-CT scans were performed using a Biograph Duo BGO scanner (Siemens, Germany). The images covered the whole brain and were parallel to the AC-PC line. Image acquisition was started after a 40 min uptake period (bed: 1; collection mode: 3D; slice thickness: 3 mm; slice interval: 1.5 mm; matrix size: 256 × 256; total counts: 3 × 109). On completion of data acquisition, the images were reconstructed using ordered-subset expectation maximization (OSEM) with 6 iterations and 16 subsets. BODY.METHODS.IMAGE PROCESSING: PET-CT images were processed using SPM2 software (Wellcome Department of Cognitive Neurology, University College London, UK). After realignment, the images were normalized using the Montreal Neurological Institute (MNI) template and then smoothed using a Gaussian kernel with 6 mm full width at half maximum (FWHM). On the second level of statistical analysis, the differences between the TAG and MG and between the CAG and MG were tested using separate two-sample t-tests. The statistical threshold was set at P <0.05 with correction for false-discovery rate (FDR) and the cluster size threshold was >5 voxels. BODY.RESULTS.EFFECT OF ACUPUNCTURE ON PAIN: The VAS of pain intensity was significantly reduced in the TAG (P = 0.0005) and CAG (P = 0.008) groups after AS compared with before (paired two-tailed t-test with threshold at P <0.01). The reduction of pain intensity appeared greater in the TAG than in the CAG. There was no significant reduction in pain intensity in the MG (P = 0.047) (Figure 2a). Figure 2 a: Behavior data analysis. b and c: Imaging data analysis. BODY.PET RESULTS: In the TAG, metabolism increased compared with the MG in the middle temporal cortex (MTC), orbital frontal cortex (OFC), insula, middle frontal gyrus, angular gyrus, posterior cingulate cortex (PCC), precuneus, and middle cingulate cortex (MCC). Metabolism decreased in the parahippocampus, hippocampus, fusiform gyrus, postcentral gyrus, and cerebellum (Figure 2b and Table 1). In the CAG, metabolism increased compared with the MG in the MTC, supratemporal gyrus, supramarginal gyrus, and MCC, whereas metabolism decreased in the cerebellum (Figure 2c and Table 1). Table 1 Main localization of activated/deactivated brain regions, comparing SG or MSG versus MG, using two-sample t -test TAG-MG CAG-MG Regions Hem BA Talairach T-score Vol BA Talairach T-score Vol       x y z       x y z     Medial Frontal L 9/10 −10 −50 −4 3.97 16               R                         Middle L 6/9 −30 36 28 3.48 17             Frontal R                         Middle L 17 −59 −29 7 3.89 17 21 −57 −26 −9 4.43 23 Temporal R                         Postcentral L 2 −61 −22 32 −2.98 6             Gyrus R                         Fusiform L 18/19 −28 −86 −18 −3.36 6               R 18/19 22 −82 −14 −3.06 6   33 −48 −35 −3.58 27 Precuneus L 31/39 −40 −68 37 3.73 11               R 31/39 12 −51 32 4.82 14             ACC L 32 −12 48 −4 3.72 6               R                         MCC L 31 −2 −36 26 2.99 65 31 −10 31 28 3.56 18   R 31 8 −55 29 3.02 20             PCC L 23/31 −2 −38 24 3.05 6               R 23/31 6 −38 24 3.07 24             Insula L 13 −44 −9 13 3.61 21               R                         Hippocampus L   −28 −28 −7 −4.75 5               R                         Parahippocampus L 19 −30 −49 −4 −3.50 5               R                         Cerebellum L   −28 −84 −18 −3.30 10   −30 −82 −16 −3.19 23   R   6 −68 −8 −4.31 200   4 −68 −7 −3.43 94 Abbreviations: BA-Brodmann area; Hem-hemisphere; L-Left; R-Right; ACC-anterior cingulate cortex; MCC-middle cingulate cortex ; PCC-poster cingulate cortex. BODY.DISCUSSION: According to the theories of acupuncture and TCM, acupoints are reactive sites of diseases on the body surface, with close relationships to specific visceral organs and meridians. In this study, we applied PET neuroimaging technology to investigate the concept of acupoint specificity in migraine patients. The results showed that analgesia was more effective in the TAG than in the CAG, and that the two groups showed cerebral patterns of metabolism that were distinct from the MG. In both groups receiving AS, there was an increase in metabolism in the MTC and MCC, and a decrease in metabolism in the cerebellum, compared with the MG. The MTC is located in the temporal lobe, but its exact function is still unknown. Functional neuroimaging studies have indicated that the MTC is concerned with cognitive processes such as language and semantic memory processing, and multimodal sensory integration [19,20]. We suggest that MTC may be related to the reaction of the body to the external AS. The MCC is a part of the limbic system, which is an important region in acute pain and anxiety [21,22]. Brown et al. found that the MCC could play a role in interrupting attention during the anticipation of pain [1]. Moreover, MCC is implicated in pain, emotion and cognition. Some investigator reported that MCC might be an important site for the interaction between negative emotion and motor signals [23]. We hypothesize that acupuncture—specific or non-specific—might modulate certain components of the pain matrix. However, the question of whether the change in brain activity induced by acupuncture is related to self-regulation and/or emotional factor requires further investigation. The human cerebellum is a complicated region. It is well-known to play an important role in motor control, but it also has a crucial role in affective behaviors such as responses to fear and pleasure [1]. Previous animal study indicated that the cerebellum contributes more to pain processing than just motor control [24]. Our results indicate that the cerebellum may be affected by acupuncture. We speculated that cerebellar metabolism might be related to nociceptive processing or motor preparation. The increase in metabolism in the MTC and MCC was greater in the CAG than in that TAG, indicating that the non-specific AS might require more sensory integration or attention. Metabolism changes were observed in the MFC, OFC, insula, PCC, precuneus, parahippocampus, and hippocampus in the TAG but not in the CAG. Recently, an [11C]-PET study suggested that the OFC may be involved in endogenous opioid modulation during acupuncture analgesia [4]. The insula receives input from the spinothalamically activated posterior thalamic nuclei, and has been shown to be involved in the processing of visceral sensory input, attention, pain, emotion, and visual input [25]. The insula has been consistently been found to be activated in experimental pain studies. It has links with the limbic and autonomic systems and is thought to be involved in the representation of the emotional aspect of pain. A PET study of patients with spontaneous migraine reported activation of the insula [26]. This was confirmed in our study. The hippocampus is a major component of the human brain that links affective states with memory processing, and that has a role in pain processing [27]. The greater changes seen in the TAG compared with the CAG in the regions discussed above—in particular the OFC, insula, parahippocampus, and hippocampus—are consistent with their close relationship to pain processing. Our findings indicate that the limbic system is central to the effect of acupuncture in migraine patients. We speculate that stimulation of the traditional acupoints, which are used clinically for migraine treatment, may deactivate brain regions associated with migraine or pain. The different patterns of metabolism observed could reflect acupoint specificity under pathogenic conditions. BODY.CONCLUSIONS: We have reported that acupuncture stimulation of different points on similar body regions in migraine patients reduced pain and induced different patterns of cerebral glucose metabolism in the brain. Our findings demonstrated that acupoints did have some specificity in migraine treatment. Further studies using patients with different pathological conditions should be performed to study the specificity of acupoints. BODY.COMPETING INTERESTS: No competing interests exist. BODY.AUTHORS’ CONTRIBUTIONS: Study protocol and design: FL, FZ, JY. Acquisition of data: JY, FZ, YF, LF, WQ, XL, WS, HX. Analysis and interpretation of data: WQ, WS, HX. Drafting of the manuscript: JY, FZ, YF, WQ, JC. Revision of the manuscript: FL, JY, FZ, YF. All authors read and approved the final manuscript. BODY.PRE-PUBLICATION HISTORY: The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1472-6882/12/123/prepub

TITLE: Lateral approach is advantageous in total knee arthroplasty for valgus deformed knee ABSTRACT.INTRODUCTION: For the total knee arthroplasty in valgus deformed knee, superiority of the medial or lateral approach is still controversial. We compared the short-term result of two approach groups. ABSTRACT.MATERIALS AND METHODS: Forty-seven knees in rheumatoid arthritis with valgus deformity from 6° to 24° were randomly divided into two group; medial approach (24 knees) and lateral approach (24 knees). We used Scorpio NRG PS for all knees. Median postoperative periods were 43 months in both groups. We compared the surgical time, and alignment on standing radiograph, range of motion (ROM) pre/postoperatively, and degrees of soft-tissue release procedure, and lateral laxity measured by stress radiograph immediately after operation and at final follow-up. ABSTRACT.RESULT: Pre/postoperative alignment, surgical time, lateral laxity, and preoperative ROM had no significant in two groups; however, postoperative flexion was superior in lateral approach group 123.8°, 109° in medial approach group. All cases required iliotibial band (ITB) release at Gerdy's tubercle, 83 % ITB at joint level, 21 % lateral collateral ligament (LCL), 17 % popliteus tendon (PT) in medial approach group, and 88 % ITB at Gerdy's tubercle, 46 % ITB at joint level, 13 % LCL, 4 % PT in lateral approach group. ABSTRACT.DISCUSSION: In the valgus knee, lateral structures are tight. Lateral approach can directly adjust the tight structure, and also less vascular compromise to the patella than medial approach with lateral patellar release. Less invasiveness to the quadriceps muscle in lateral approach could result into better range of motion after the surgery. BODY.INTRODUCTION: Nowadays, total knee arthroplasty (TKA) is a well-established procedure and has proven to be durable and effective for the treatment of advanced arthritis of the knee joints; however, the long-term results in valgus deformed knee were relatively inferior to those of varus deformed knee. One of the reasons of poor prognosis might be the difficulty to acquire good soft-tissue balance during the surgery. In treating valgus deformity of the knee by TKA, sequential releases of soft tissue on the lateral side of the knee are usually necessary, including the iliotibial band (ITB), lateral patellar retinaculum, lateral collateral ligament (LCL), and at times the popliteus tendon (POP), lateral gastrocnemius tendon, and biceps femoris tendon [1]. Some authors [2–4] have stated that releases of these structures are best addressed by direct access using a lateral approach. Good results had been reported using this approach [3]. Some authors have reported poor result for TKA in valgus deformed knee using a conventional medial approach [3, 5, 6]. In addition, vascular compromise after TKA by a medial approach with lateral retinacular release had been reported [2, 7, 8]. But for most orthopedic surgeon, the lateral approach was not familiar technique to perform. Osteotomy of the tibial tubercle was usually necessary, and many complications were also reported with the procedure. Ranawat et al. [9] reported good results using a medial approach with lateral retinacular release. There were several reports which compared the clinical results between medial and lateral approach with the osteotomy of tibial tubercle [10, 11]; however, superiority of the medial or lateral approach still remains controversial. To solve this problem, we prospectively compared short-term results of two approach groups. BODY.MATERIALS AND METHODS: Inclusion criteria of the study as follows: primary unilateral TKA, female, rheumatoid arthritis, valgus deformity from 6° to 24°, preoperative flexion contracture <31°, and preoperative flexion angle >89°. Forty-eight cases were included in this study. Each case was randomly divided into two groups: group of medial approach (n = 24); and group of lateral approach (n = 24). Mean age of the all cases was 65 years (range, 50–77 years) at the time of surgery. Details of the groups are shown in Table 1. No difference was found in age, height, weight, preoperative mechanical axis, preoperative range of motion (ROM), and preoperative knee society score (KSS) between two groups. A medial parapatellar approach was used for the medial approach, and a lateral parapatellar incision without osteotomy of the tibial tubercle was applied for the lateral approach. There were several surgical tips for successful lateral approach without osteotomy. One was the incision to the quadriceps tendon from superficial lateral to deep medial, allowing for natural expansion of the laminated quadriceps tendon at closure described by Keblish et al. [4]. This coronally elongated quadriceps tendon was beneficial for better patellar tracking. Next, ITB was released at Gerdy's tubercle in the early stage if the tibia was externally rotated. This release eliminates the difficulty shifting or everting the patella medially. We also inserted two Kirschner wires of 2 mm in diameter into the tibial tubercle to prevent avulsion fracture at patellar eversion.Table 1Comparisons of preoperative variables in medial approach group and lateral approach groupLateral approachMedial approachAge (years)63 ± 6.666 ± 6.7nsHeight (cm)154 ± 5.1154 ± 6.4nsWeight (kg)54.5 ± 8.953 ± 9.8nsPreoperative mechanical axis (°)13.3 ± 5.914 ± 6.5nsPreoperative flexion contracture (°)12.7 ± 11.513 ± 11.3nsPreoperative flexion angle (°)112.5 ± 14.8113 ± 17.1nsPreoperative KSS (points)35.3 ± 12.636 ± 11.1nsAll data were exhibited as mean ± SD (range) ns no significant difference A Scorpio NRG® posterior-stabilized prosthesis (Stryker Howmedica Osteonics, Allendale, NJ, USA) was used for all knees. All surgeries were conducted by a senior surgeon (HS). After bone cuts were completed with an independent cut method, a tensor was used in extension and 90° of flexion to apply a 40-lb distraction force, and release of lateral-side soft tissues was conducted in stages until satisfactory balance was acquired. The patella was replaced in all cases, and all components were fixed with bone cement. Postoperative evaluation was performed at a mean of 43 ± 12 months (18–63 months) after surgery. We compared the following measures between medial approach group and lateral approach group; complications among perioperative time; and surgical time, number of soft-tissue release procedures for balancing during the surgeries, alignment on standing radiography, ROM, KSS at preoperatively and postoperatively, and varus/valgus laxity at immediately after the surgery, and at final follow-up. Measurements of ROM and KSS were taken by one of the authors who did not know which surgical approach had been applied for the patients. Postoperative coronal laxity was assessed by stress radiographs of the knees using Telos SE arthrometer® (Fa Telos; Medizinisch–Technische, Greisheim, Germany) following a previously reported method [13]. Anteroposterior radiographs were taken while the device was used. Valgus or varus forces of 7 kg to the knees were applied just above the joint on the lateral or medial femoral condyle, whereas the proximal thigh and middle leg were held by the counter supports at 15 flexion. On the stress radiographs, the angle between a line in contact with the bottom of the femoral prosthesis and a line in contact with the upper surface of the tibial prosthesis was measured. We defined this as the valgus angle or varus angle according to the description by Yagishita et al. [12]. These angles indicated the values of medial ligamentous laxity or lateral ligamentous laxity, respectively. The study was approved by the Ethics Committee of Jichi Medical University Hospital, and all patients provided written informed consent. Statistical assessment included unpaired t test to clarify the difference of variables between medial approach group and lateral approach group. Differences in p values less than 0.05 were considered statistically significant. A sample size power analysis was performed based on our pilot study and showed that 18 patients in each group would be required to show a difference in a mean of 10 degrees in postoperative flexion with the effect size = 1, test of significance level = 0.05, SD = 10, and a power of test = 80 %. BODY.RESULTS: All results are summarized in Table 2. There was one case of skin necrosis in the group of lateral approach and one case of superficial infection in the group of medial approach for complication. Both cases were treated successfully. No serious complication such as deep infection or fracture was encountered in either group. No difference was found in all values except for number of soft-tissue release procedures for balancing during the surgeries, and postoperative ROM.Table 2Comparisons of postoperative variables in medial approach group and lateral approachLateral approachMedial approachFollow-up periods (months)43.3 ± 14.243.2 ± 8.4nsComplicationsSkin necrosis 1Superficial infection 1Surgical time (min)133 ± 24131 ± 18nsNumber of soft-tissue release procedures1.5 ± .092 ± 0.9nsPostoperative mechanical axis (°)1.6 ± 11 ± 1.8nsPostoperative flexion contracture (°)2.9 ± 4.12 ± 5.2nsPostoperative flexion angle (°)123.8 ± 11109 ± 14.3 p < 0.001Postoperative KSS (points)89.3 ± 4.287 ± 4nsVarus laxity immediately after surgery (°)5.5 ± 3.15 ± 3nsVarus laxity immediately after surgery (°)4.8 ± 1.84.4 ± 1.7nsVarus laxity at follow-up (°)3.7 ± 1.74 ± 2nsValgus laxity at follow-up (°)4 ± 1.94 ± 1.9nsAll data were exhibited as mean ± SD (range) KSS Knee society score; ns no significant difference Averagely, two release procedures were necessary in the groups of medial approach and 1.5 procedures in the group of lateral approach (p = 0.14). In the medial approach group, 100 % of cases required ITB release at Gerdy's tubercle, 83 % required ITB release at the joint level, 21 % required LCL release, and 17 % required POP release. In the lateral approach group, 88 % required ITB release at Gerdy's tubercle, 46 % required ITB release at the joint level, 13 % required LCL release, and 4 % required PT release. Postoperative ROM at the follow-up was superior in the lateral approach group. Although there was no difference at flexion contracture angle in two groups, marked difference was found at flexion angle 123.8° in the group of lateral approach versus 109° in the group of medial approach (p < 0.001). BODY.DISCUSSION: Although the rationality of the lateral approach for the valgus deformed knee has been recognized, differences in clinical results between medial and lateral approaches have been uncertain. Hay et al. [10] had randomly divided 32 patients into two groups, in one of which the lateral subvastus approach combined with a tibial tubercle osteotomy and in the other the medial parapatellar approach. And they compared the ROM, a visual analog satisfaction score, the Western Ontario McMasters University Osteoarthritis index, and the KSS at 2 years after the surgery. No significant differences were found between the groups in any of the parameters for clinical outcome. They found significant better patellar tracking in the group of lateral subvastus approach combined with a tibial tubercle osteotomy. Due to complications related with tibial tubercle osteotomy and longer surgical time (10–15 min) in the lateral approach with osteotomy, they did not support its routine use of the except for the patients in whom problems with patellar tracking were anticipated. Hirschman et al. [11] also compared the two groups, the group of lateral parapatellar approach with tibial tubercle osteotomy and medial parapatellar approach group in clinical outcomes. They found better flexion of the knee, better VAS, higher patient's satisfaction, and longer pain free walking distance in the group of lateral parapatellar approach with tibial tubercle osteotomy at 2 years follow-up. But the revision rate in the group of lateral parapatellar approach with tibial tubercle osteotomy (4 %) was higher than in the group of medial approach (1.5 %), which was mainly due to two cases of traumatic secondary displacement of the tibial tubercle and need for refixation. Our findings indicate that postoperative knee flexion after TKA in valgus knee was better with a lateral approach than with a medial approach as shown by Hirschman et al. [11]. Thus, lateral approach had some advantages in postoperative clinical outcomes; however, tibial tubercle osteotomy could be problematic procedure. In the valgus knee, lateral structures are shortened [14]. Due to contracture of the lateral patellar retinaculum, lateral subluxation of the patella is a common problem [14]. Conversely, medial structures are lax or stretched in many instances. Stern et al. [15] reported the difficulty to acquire good coronal balance of TKA by medial approach in 134 valgus deformed knees. He reported only 71 % of valgus deformed knee rated as excellent compared with the 88 % excellent results achieved in an earlier study from the same institution [15]. A lateral approach can directly adjust the tight structure, guarantee good patellar tracking, and reduce vascular compromise to the patella compared with a medial approach with lateral patellar release [16]. Keblish et al. [16] reported good/excellent result in 79 valgus deformed knee treated with lateral approach. And he recommended the lateral approach as the "approach of choice" for fixed valgus deformity in TKA. However, problems with the lateral approach include difficulty in eversion of the patella [3], and less familiarity for many surgeons [3]. The patellar tendon must not be avulsed, since this is potentially disastrous [17]. To avoid this eventuality, Keblish et al. [16] and Buechel [2] recommended deliberate osteotomy of the tibial tubercle. However, some complications had been reported at the osteotomy of the tibial tubercle [10, 11], and postoperative rehabilitation might have to be delayed to some extent after osteotomy. Fiddian et al. [3] could evert the patella without the osteotomy of the tibial tubercle in lateral approach. Following their methods, we successfully performed TKA using a lateral approach without osteotomy in all cases. To facilitate the eversion of the patella in lateral approach, Boyer et al. [18] completely released the iliotibial band from the Gerdy's tubercle. In fixed valgus deformity, contracture of ITB is one of the most important factors of excessive external rotation of the tibia. In the condition with the external rotation of the tibia, to evert the patella medially is extremely difficult and dangerous for avulsion of tibial tubercle or rupture of patellar tendon at forceful eversion. Release of ITB in early stage was a crucial key for success in lateral approach. The other details of the surgical tips those we used were mentioned in the part of surgical procedure. Due to the direct approach for diseased lateral soft tissue, numbers of the release procedure might logically be reduced with a lateral approach compared with a medial approach. Although we could not find the significant difference, our data regarding the relatively less number of release procedures in the group of lateral approach compared with the group of medial approach indicated the rationality of lateral approach to adjust the soft-tissue balance in valgus deformed knee. We could confirm by the stress radiograph that the similar coronal balance could be achieved with reduced number of release procedures in lateral approach group. To explain the reason underlying the better ROM with a lateral approach than with a medial approach, we paid attention to differences in attachments of the vastus lateralis and vastus medialis. The vastus medialis attaches at the midpoint of the patella or more distally, whereas the vastus lateralis attaches at the proximal patella [19]. Even with the same length of parapatellar dissection, invasiveness to the muscle would differ between medial and lateral approaches. Reduced invasiveness to the quadriceps muscle and reduced release procedures for lateral structures with a lateral approach could result into better postoperative ROM. Niki et al. [20] compared the clinical outcomes and perioperative data, including total blood loss, operative time, myoglobin/creatinine phosphokinase (CPK) index, and VAS score for pain between 26 patients with valgus knee who underwent MIS–TKA using a lateral subvastus approach and 26 patients treated with MIS–TKA by medial approach. Although they did not mention about the detail of postoperative ROM, they found the comparable clinical scores, radiographic accuracy, and postoperative complication rate. From reduced serum myoglobin index on postoperative day 1 in the group of lateral subvastus approach, they showed the muscle-sparing effect in the lateral approach. And from lower VAS score at 7 days after surgery in the group, they made explanation as follows: The subcutaneous nerve plexus on the lateral side of the skin is less developed than on the anterior or medial sides. These subjective and objective findings shown by Niki et al. [20] could be a key to explain the reason for better flexion angle found in lateral approach group. There were some limitations that need to be addressed regarding the present study. The first limitation concerned about the relatively small number of the patients in both groups. To achieve the firm conclusion, we will continue the study. The second limitation was the shortage of the subjective and objective finding to explain the reason for better flexion angle found in lateral approach group. Measurement of the myoglobin/CPKindex, and VAS score for pain shown by Niki et al. [20], and inflammatory markers (IL-6, IL-10, IL-8 and tumor necrosis factor—α) would be beneficial for the study in the future. The third limitation was the duration of the follow-up. In accordance with the improvement of the implants and surgical technique, good clinical result had become common in TKA. Long-term observation over 10 years is necessary to state the real value of the technique. From such point of view, the follow-up period of 43 ± 12 months in present study was short. However, ROM and laxity of the knee joint over 1 year after TKA were relatively constant in many studies, 43 months would be sufficient to compare the ROM and laxity. In conclusion, TKA using a lateral approach without tibial osteotomy could provide better postoperative ROM compared with knees treated using a medial approach.

TITLE: Effect of tongue strength training using the Iowa Oral Performance Instrument in stroke patients with dysphagia ABSTRACT: [Purpose] The aim of this study was to evaluate the effectiveness of a structured program of resistance training for the tongue in order to improve swallowing function in stroke patients with dysphagia. [Subjects and Methods] Twenty-seven stroke patients with dysphagia were randomly divided into two groups. The experimental group participated in a resistance-training program involving a 1-repetition maximum, with an intensity of 80%, along with 50 repetitions per day each for the anterior and posterior regions of the tongue. Both groups received conventional therapy for dysphagia for 30 min per day, 5 times per week, for 6 weeks. [Results] The experimental group showed statistically significant improvements in both, the anterior and posterior regions of the tongue. In contrast, the control group showed significant improvements only in the anterior region of the tongue. In the videofluoroscopic dysphagia scale evaluation, improvement was noted at both, the oral and pharyngeal stages in the experimental group, whereas significant improvements were only noted in the oral stage and total score in the control group. [Conclusion] Our study confirmed that tongue resistance training is an effective intervention for stroke patients with dysphagia, offering improved tongue muscle strength and overall improvement in swallowing. BODY.INTRODUCTION: The tongue plays a major role in swallowing and is essential to ensure normal swallowing function. The primary functions of the tongue include food mastication, bolus formation, manipulation, and propulsion into the pharynx1). Moreover, it also contributes to respiration and speech functions2). During the oral stage of swallowing, the tongue squeezes food against the hard palate of the mouth, and moves the bolus from the anterior to the posterior region of the tongue for propulsion into the pharynx3). Neurogenic disorders, such as a stroke or Parkinson's disease, can lead to deficits in the sensory and motor functions of the tongue. This can further lead to dysphagia in both the oral and pharyngeal stages of swallowing, such as difficulties with the mastication and manipulation of food, vallecular and pharyngeal residues, and aspiration4, 5). Therefore, sufficient tongue muscle strength is a determining factor for safe swallowing. Pushing the tongue against the hard palate or against an external resistance, such as a tongue depressor, has been described as a basic strengthening exercise for the tongue6). However, in this basic approach for strength training of the tongue, the level of resistance and the volume of training stimulus—parameters necessary to optimize strength outcomes—are not systematically controlled. The Iowa Oral Performance Instrument (IOPI Medical LLC, Redmond, WA) is a standardized portable device that can be used to quantify tongue muscle strength, thus allowing the clinician to set the level of resistance necessary to achieve optimal gains in strength, and also providing visual feedback of performance to the patients to guide training7). In the present study, we aimed to evaluate the effectiveness of a resistance training program for the tongue in order to improve swallowing function in stroke patients with dysphagia. BODY.SUBJECTS AND METHODS: Fifty stroke patients with dysphagia were eligible for this study, which was conducted from April 2015 to July 2015. The inclusion criteria for participation were as follows: 1) dysphagia from a stroke that was confirmed by a videofluoroscopic swallowing study (VFSS), 2) onset duration > 6 months, 3) Mini-Mental State Examination (MMSE) score ≥ 24. The exclusion criteria were as follows: 1) previous stroke; 2) severe orofacial pain including trigeminal neuropathy; 3) significant malocclusion or facial asymmetry; 4) severe communication disorder, such as severe aphasia. All participants provided written informed consent, and the study protocol was approved by the Institution Review Board. This study was designed as a 6-week, single-blind, randomized controlled study. Each eligible participant was randomly allocated to the experimental training or control group using opaque envelopes that contained codes specifying his or her group membership. Both groups received traditional dysphagia therapy for 30 min per day, and the experimental group additionally received strength training for the tongue using the IOPI. Tongue muscle strength training was classified into the anterior and posterior regions. When we measured the pressure of the anterior tongue region, the bulb was positioned on the hard palate immediately behind the upper gingiva and touched the anterior 10 mm of the tongue dorsum. The subjects were instructed to press the bulb toward the hard palate with the tongue as hard as possible for 2 s. For the posterior tongue region, the bulb was placed on the anterior aspect of the posterior hard palate and the subjects were instructed to press the bulb in the same manner as described above. The instructions were as follows, "I will place the bulb in your mouth. Please press the bulb as hard as possible for 2 s. Next, I will move it backwards a little further. Now, press it in the same manner. Please do not frown too much or use your teeth." The intensity of training was based on previous research by Robbins et al.4). The 1-repeated maximum contraction (i.e., 1 RM) for anterior and posterior elevation of the tongue was measured using the IOPI. The training protocol of the experimental group was similar to that for the measurement of tongue strength, and resistance was set at the 80% level of maximal isometric tongue pressure. Training was performed for 6 weeks at a frequency of 5 times per week and an intensity of 5 sets of 10 trials per day, amounting to a total daily volume of 50 repetitions each for the anterior and posterior regions of the tongue. A minimum rest period of 30 s was provided between sets, with longer durations considered to accommodate patients' fatigue. Trials in which the target training level was not reached were repeated to standardize the volume of resistance training. The training was directed by two experienced occupational therapists. The effectiveness of the training was evaluated by comparing pre- and post-training measures. The IOPI was used to determine baseline 1 RMs of the anterior and posterior regions of the tongue for patients in both the experimental and control groups. The 1 RMs were re-evaluated at the end of the 6-week training program. Swallowing function was also evaluated at baseline and following the 6-week training intervention using the videofluoroscopic dysphagia scale (VDS) based on videofluoroscopic swallowing study (VFSS). VFSSs were conduct based on a previous study8). The VDS consists of 14 items, which can largely be categorized into an oral phase (7 items: lip closure, bolus formation, mastication, apraxia, tongue to palate contact premature bolus loss, and oral transit time) and a pharyngeal phase (7 items: pharyngeal triggering, vallecular residues, pyriform sinus resides, laryngeal elevation, pharyngeal wall coating, pharyngeal transit time, and aspiration). The score ranges from 0 to 100, and a higher score indicates a higher severity of dysphasia9). Participant characteristics were analyzed using a statistical software program (SPSS Statistics 20, IBM, Armonk, NY), and descriptive statistics are presented as mean ± standard deviation. The Shapiro-Wilk test was used to check the normality of the outcome variables. To evaluate the effects of training, paired t-test was used to compare measures before and after the intervention in each group. Independent t-test was used to compare the changes in outcome measures between the two groups. The significance level was set at p < 0.05. BODY.RESULTS: There were no significant differences between the baseline characteristics in the two groups (Table 1Table 1.Characteristics of participantsCharacteristicsExperimental Group (n=15)Control group (n=14)Age (years) mean±SD (range)67.3±10.6 (51–82)65.8±11.5 (52–80)Gender, male/female6/97/7EtiologyHemorrhage86Infarction78Time since onset of stroke, weeks, mean ± SD (range)25.37±7.43 (19–45)26.38±6.81 (17–43)SD: standard deviation). The experimental group showed significant improvements from 18.93 ± 6.75 to 20.73 ± 6.61 for the anterior region, and from 16.2 ± 4.69 to 18.47 ± 4.09 for the posterior region. On the other hand, the control group showed improvements from 22 ± 5.74 to 22.86 ± 5.36 for the anterior region, and from 17.29 ± 4.3 to 17.71 ± 4.36 for the posterior region. However, the change in the control group was only statistically significant for the anterior region. No statistically significant difference in either the anterior or the posterior region scores was observed between the two groups after the intervention (Table 2Table 2.Comparison of results between experimental group and control groupRegionExperimental groupControl groupBefore treatmentAfter 4-week treatmentBefore treatmentAfter 4-week treatmentAnterior region18.93 ± 6.7520.73 ± 6.61**22 ± 5.7422.86 ± 5.36*Posterior region16.2 ± 4.6918.47 ± 4.09**17.29 ± 4.317.71 ± 4.36The values are mean ± standard deviation. Unit: pressure*p<0.05, **p<0.01 by paired t test between initial and final scores in the group). Regarding the VDS evaluation based on VFSS, the experimental group showed statistically significant differences in both the oral and pharyngeal stages, as well as in the total score. On the other hand, the control group showed significant improvements in the VDS score for the oral stage of swallowing and in the total score. No statistically significant difference in VDS scores was observed between the two groups after the intervention (Table 3Table 3.Comparison of results between experimental group and control groupItemsExperimental groupControl groupBefore treatmentAfter 4-week treatmentBefore treatmentAfter 4-week treatmentOral phase16.27±4.7214.67±4.45**16.82±4.1116.64±4.13*Pharyngeal phase42.87±6.8540.77±6.12*41.75±6.841.5±6.84Total score59.13±10.7455.43±9.35**58.57±9.7558.14±9.83*The values are mean ± standard deviation.*p<0.05, **p<0.01 by paired t test between initial and final scores in the group). BODY.DISCUSSION: Tongue resistance training can improve tongue muscle strength in stroke patients with dysphagia. Consequently, it has been considered as a remedial approach for improving swallowing functions. In this study, we aimed to confirm the effects of tongue resistance training on tongue muscle strength and overall swallowing function. Our 6-week protocol involved a training resistance of 80% 1 RM and a volume of 50 repetitions each for the anterior and posterior regions of the tongue. The protocol yielded significant gains in strength in the anterior and posterior regions of the tongue, and improved function in both the oral and pharyngeal stages of swallowing. In general, the functional recovery of skeletal muscle increases rapidly within the first 6 months after a stroke10). A training intensity of 60–80% 1 RM has been shown to be effective in improving the strength of skeletal muscles11). A very low resistance intensity will not provide sufficient loading of the muscle to stimulate increases in strength, whereas a very high resistance intensity will lead to fatigue and an inability to complete the volume of repetitions that is necessary to optimize strength gains. Robbins et al.4) reported increases in tongue strength and volume/area in stroke patients following an 8-week resistance training program for the tongue, involving a training resistance between 60% and 80% 1 RM. Based on these results, we assumed that a training stimulus of 80% 1 RM would be adequate when designing the present study. The effectiveness of the resistance-training program in improving the oral and pharyngeal stages of swallowing is an important and novel finding of our study. In the oral stage of swallowing, tongue strength and function play essential roles in mastication and bolus formation. Further, tongue strength and function are essential to squeeze food against the hard palate, both for movement of the bolus from the anterior to the posterior regions of the tongue and for propulsion into the pharynx. Tongue strength is also important for creating a sufficiently high pressure within the oral cavity, to reduce the oral and pharyngeal transit time, vallecular residues, and risk of aspiration as a result of improved airway protection. Steele et al.12) also suggested that tongue resistance training is an effective method for reducing aspiration and penetration. Thus, increased tongue strength has a positive effect on the swallowing-related quality of life of stroke survivors. The effectiveness of resistance training for the tongue results from both a central (neural) and peripheral (muscle mass) effect13). In the present study, we confirmed that a structured resistance-training program was effective for producing gains in strength (1 RM) in the tongue. However, we did not specifically evaluate the central effects of resistance training. Robbins et al.4) proposed that improvements in swallowing function with resistance training are the result of both the direct effects of training on strength and the effects of resistance training on the neuroplasticity of the neural circuits for swallowing, including collateral sprouting to areas affected by the stroke. This study has several limitations. First, the sample size was small; future studies with larger sample sizes are therefore needed to generalize the results. Second, the recruited participants included patients with relatively mild dysphagia who actively cooperated during training. Finally, a follow-up was not performed after the intervention. In conclusion, our study provides evidence supporting the inclusion of resistance training of the tongue muscle in rehabilitation programs for stroke patients with dysphagia. The administration of this resistance training can improve tongue strength and general swallowing function.

TITLE: Effect of selenium on markers of risk of pre-eclampsia in UK pregnant women: a randomised, controlled pilot trial ABSTRACT: Pre-eclampsia is a serious hypertensive condition of pregnancy associated with high maternal and fetal morbidity and mortality. Se intake or status has been linked to the occurrence of pre-eclampsia by our own work and that of others. We hypothesised that a small increase in the Se intake of UK pregnant women of inadequate Se status would protect against the risk of pre-eclampsia, as assessed by biomarkers of pre-eclampsia. In a double-blind, placebo-controlled, pilot trial, we randomised 230 primiparous pregnant women to Se (60 μg/d, as Se-enriched yeast) or placebo treatment from 12 to 14 weeks of gestation until delivery. Whole-blood Se concentration was measured at baseline and 35 weeks, and plasma selenoprotein P (SEPP1) concentration at 35 weeks. The primary outcome measure of the present study was serum soluble vascular endothelial growth factor receptor-1 (sFlt-1), an anti-angiogenic factor linked with the risk of pre-eclampsia. Other serum/plasma components related to the risk of pre-eclampsia were also measured. Between 12 and 35 weeks, whole-blood Se concentration increased significantly in the Se-treated group but decreased significantly in the placebo group. At 35 weeks, significantly higher concentrations of whole-blood Se and plasma SEPP1 were observed in the Se-treated group than in the placebo group. In line with our hypothesis, the concentration of sFlt-1 was significantly lower at 35 weeks in the Se-treated group than in the placebo group in participants in the lowest quartile of Se status at baseline (P= 0·039). None of the secondary outcome measures was significantly affected by treatment. The present finding that Se supplementation has the potential to reduce the risk of pre-eclampsia in pregnant women of low Se status needs to be validated in an adequately powered trial. BODY: Overall, 10 % of women have high blood pressure during pregnancy and 2–5 % will develop pre-eclampsia, a serious hypertensive condition associated with high maternal and fetal morbidity and mortality( 1 ). Furthermore, women who have had pre-eclampsia have a greater risk of developing hypertension, stroke and IHD in later life( 2 – 4 ). Numerous strategies to prevent pre-eclampsia have been investigated, but, so far, all have failed to reach effectiveness. Deficient placentation occurring during the first half of pregnancy is a frequent forerunner of the development of pre-eclampsia( 5 ). Shallow trophoblast invasion and inadequate spiral arteriole remodelling result in a placenta that is not adequately perfused( 5 , 6 ). Thus, localised areas of ischaemia/reperfusion associated with placental oxidative and endoplasmic reticulum stress are established( 6 – 9 ). This results in increased apoptosis and necrosis of the syncytiotrophoblast layer lining the intervillous space( 10 ). The oxidatively stressed syncytiotrophoblast responds by the increased release of two anti-angiogenic factors – soluble vascular endothelial growth factor receptor-1 (sVEGFR-1, also called sFlt-1) and soluble endoglin – into the maternal circulation that oppose the actions of vascular endothelial growth factor and placental growth factor (PlGF)( 11 – 13 ), leading to endothelial dysfunction, hypertension and proteinuria. Other characteristics of the condition include higher circulating levels of soluble adhesion molecules produced by the activated endothelium( 14 , 15 ), and of the potent inflammatory mediator peroxynitrite that causes vasoconstriction, platelet aggregation and thrombus formation( 16 – 18 ). In addition, placental microvesicles are released into the maternal circulation where they stimulate a maternal systemic inflammatory response and endothelial activation, the hallmark of pre-eclampsia( 5 , 19 – 22 ). The essential trace mineral Se acting through selenoproteins/selenoenzymes has the capacity to reduce the risk of pre-eclampsia( 23 – 29 ). A positive correlation between Se status and the incidence of pre-eclampsia has been shown in an epidemiological study of forty-five countries( 30 ). Supplementation of Chinese women deemed to be at risk of pregnancy-induced hypertension (PIH) with Se has been shown to prevent PIH and gestational oedema, two of the signs of pre-eclampsia( 31 ). Serum/plasma Se and plasma glutathione peroxidase (GPx) concentrations have been found to be significantly lower in pre-eclamptic than in normal pregnancies( 32 – 36 ), while significantly lower levels of the selenoenzymes, GPx and thioredoxin reductase have been found in placentae from pre-eclamptic women than from matched healthy controls( 8 , 32 , 34 , 37 ). In a retrospective study in a large Norwegian case–control cohort, women with pre-eclampsia were significantly more likely to carry the A allele of the G105A promoter polymorphism in the anti-inflammatory selenoprotein S (SEPS1)( 38 ). In an interesting animal study, a Se-free diet caused a pre-eclampsia-like syndrome in pregnant rats with significantly increased blood pressure, proteinuria and placental oxidative stress and significantly lower pup weight compared with Se-adequate controls( 39 ). In a previous study, we showed that Se status was low in Oxford women with normal (non-pre-eclamptic) pregnancy (median serum Se concentration 48·5 μg/l at 33 weeks)( 40 ). In a subsequent case–control study in the same location, we found that the concentration of Se in the toenails (laid down from 3 to 12 months previously) of women with pre-eclampsia was significantly lower than that of matched controls (P= 0·001)( 41 ). Women in the bottom tertile of toenail Se were 4·4 (95 % CI 1·6, 14·9) times more likely to have pre-eclampsia. Within the pre-eclamptic group, lower Se status was significantly associated (P= 0·029) with more severe expression of disease, as measured by delivery before 32 weeks( 41 ). Following on from that study, we decided to set up a randomised, placebo-controlled trial, SPRINT (Se in PRegnancy INTervention), to measure the effect of supplementation with dietary levels of Se (i.e. 60 μg/d, the UK-recommended intake for women)( 42 ), on the markers of pre-eclamptic risk, inflammation, endothelial and placental function. Our hypothesis was that a small increase in the intake of Se in pregnant women of inadequate Se status would protect against the risk of pre-eclampsia, as assessed by biomarkers of pre-eclampsia, by increasing Se status and selenoprotein concentration. The biomarkers that we chose to measure were serum or plasma markers known to be significantly associated with the development of pre-eclampsia. The primary outcome measure of the present study was sFlt-1, a marker of placental dysfunction that blocks the actions of vascular endothelial growth factor and PlGF and impedes the maintenance of endothelial integrity( 11 , 12 ). Secondary outcome measures were as follows: PlGF, an angiogenic factor the levels of which are significantly lower in pregnancies where pre-eclampsia subsequently develops( 43 ); soluble endoglin, an anti-angiogenic protein that inhibits the formation of capillary tubes and induces vascular permeability and hypertension( 44 ); activin A and inhibin A, placental endocrine factors that, when increased, give early warning of pre-eclampsia( 45 ); vascular cell adhesion molecule-1 and E-selectin, cell adhesion molecules that are indices of endothelial activation( 14 , 15 , 46 ); plasma nitrotyrosine, an indicator of peroxynitrite exposure observed in placental vascular endothelium in pre-eclampsia( 17 , 18 ); C-reactive protein (CRP), a measure of inflammation raised in early gestation in advance of pre-eclampsia( 47 ); pentraxin-3, an inflammatory marker thought to be more specific to vascular inflammation than CRP( 48 ). BODY.METHODS.DESIGN: The present double-blind, placebo-controlled, two-group study was registered at the International Standard Randomised Controlled Trial Number Registry (registration no. ISRCTN37927591; http://controlled-trials.com/ISRCTN37927591). BODY.METHODS.ETHICS STATEMENT: The present study was conducted according to the guidelines laid down in the Declaration of Helsinki, and all procedures involving human subjects were approved by the Milton Keynes Research Ethics Committee (REC reference no. 08/H0603/46). Written informed consent was obtained from all subjects. BODY.METHODS.PARTICIPANTS: We chose to study primiparous women because they have a higher risk of pre-eclampsia. Between 14 July 2009 and 6 June 2011, primiparous women attending the antenatal clinic at the John Radcliffe Hospital, Oxford, UK, for an ultrasound scan at 12 weeks of gestation were invited to join the trial. BODY.METHODS.ELIGIBILITY CRITERIA: We initially planned to recruit women only in the bottom half of Se status in line with our hypothesis that a treatment effect would only be seen in women of low Se status. However, reviewers of our proposal recommended that we should recruit all women, regardless of Se status, and specify that the primary data analysis would be on women of low Se status. We accepted that modification to our protocol which had the added advantage of avoiding a time lag due to the screening process which would have resulted in our randomising women in pregnancy than we wanted. The inclusion criteria were first pregnancy and 12–14 weeks of gestation at randomisation. The exclusion criteria were as follows: under 18 years old; current smokers (who have a lower risk of pre-eclampsia); taking any supplement containing Se; taking thyroid medication; multiple pregnancy; abnormal fetal anomaly scan; chronic proteinuria; heparin treatment; HIV, Hep-B or Hep-C positive; yeast intolerance (supplement contains yeast); inability or refusal to give informed consent (the genetic component of the trial was omitted in those who did not give explicit consent to this aspect of the trial). BODY.METHODS.INTERVENTION: Women were randomly allocated to one of two treatment groups: 60 μg/d of Se, as Se-enriched yeast (SelenoPreciseTM), or placebo yeast, both supplied by Pharma Nord (60 μg/d is the recommended intake for UK women)( 42 ). The treatment period was from randomisation (12 up to a maximum of 14 weeks) until delivery. A blood sample (10 ml) was taken from all recruits at trial entry. Whole blood was used to measure Se concentration, while the remainder was separated into plasma and serum and banked. If separate, explicit, consent had been given, an additional 5 ml of blood were taken as part of the same procedure for potential genetic analysis. A urine sample was taken for possible future use. The following information was recorded by the trial midwife: blood pressure; date of the last menstrual period/gestational age; weight; height; haematocrit; ethnicity; family history of pre-eclampsia; chronic illness, e.g. chronic hypertension, diabetes, thyroid disease; current medication; presence of severe morning sickness; alcohol use; vegetarian or not. Women were given a simple FFQ to complete and a further questionnaire about dietary supplements taken. Women were asked to allow their toenails to grow for 4–6 weeks (for possible later analysis), cut them, place the clippings in the plastic envelope provided to return to the research midwife. At 20 weeks (when attending for a scan) and 35 weeks, women were again seen at the John Radcliffe Hospital by the research midwife. Blood and urine samples were taken again, separated as appropriate into serum and plasma, and banked for the measurement of different components related to the risk of pre-eclampsia. Data from the analysis of urine, toenails and FFQ will be the subject of subsequent publications. BODY.METHODS.OUTCOMES: The specified primary outcome measure of the present study was serum concentration of sFlt-1( 11 , 12 ). Specified secondary outcome measures were as follows: serum PlGF, soluble endoglin, activin A and inhibin A; plasma VCAM-1, E-selectin, 3-nitrotyrosine and CRP. An additional outcome introduced because of a concurrent funded study being carried out at the John Radcliffe Hospital was plasma pentraxin-3( 48 ). Se status was measured by whole-blood Se concentration and plasma concentration of selenoprotein P (SEPP1), the carrier of Se in the plasma. Whole-blood concentration of Se, a longer-term measure of Se status than plasma Se, was determined at baseline and 35 weeks. Plasma concentration of SEPP1, a major component of plasma Se and an important parameter of functional Se status, was measured at 35 weeks( 49 ). BODY.METHODS.MEASUREMENT OF OUTCOMES.WHOLE-BLOOD SELENIUM: The analysis was carried out at the SAS Trace Element Unit, Southampton General Hospital by dynamic reaction cell-inductively coupled plasma MS on an Elan 6100 DRC plus (SCIEX Perkin-Elmer). Se concentration was measured using methane as the dynamic reaction cell gas to remove the argon dimer background( 50 ). Samples were run against a bovine blood calibration curve spiked with Se (Se standard solution 1000 ppm; Fisher Chemical). To increase signal sensitivity, a sample diluent containing 0·5 % butanol( 51 ) was used for calibration, testing and quality control. Rhodium was used as the internal standard. A certified reference material (Trace Elements Whole Blood: Seronorm; Sero) assured accuracy: observed values 1·44 (sd 0·25) μmol/l (n 42) for lot number 1103129 (target value 1·42 μmol/l) and 3·02 (sd 0·19) μmol/l (n 32) for lot number 1003193 (target value 3·29 μmol/l). BODY.METHODS.MEASUREMENT OF OUTCOMES.SELENOPROTEIN P: Frozen plasma samples were shipped to the laboratory of Raymond Burk. Immediately before the analysis, samples were thawed and SEPP1 concentrations were measured using an ELISA as described previously( 52 ). BODY.METHODS.MEASUREMENT OF OUTCOMES.SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1, PLACENTAL GROWTH FACTOR AND SOLUBLE ENDOGLIN: Concentrations of sFlt-1, PlGF and soluble endoglin were measured using commercially available Duoset kits for the development of a sandwich ELISA kit (R&D systems), according to the manufacturer's instructions. The intra- and inter-assay CV were 5·2 and 10·5 % for sFlt-1, 5·2 and 8·3 % for PlGF, and 4·9 and 11·6 % for soluble endoglin, respectively. BODY.METHODS.MEASUREMENT OF OUTCOMES.INHIBIN A AND ACTIVIN A: The levels of inhibin A and activin A were measured using a two-site ELISA as described previously( 53 ). Affinity-purified human activin A was used as the assay standard for the measurement of total activin A. The intra- and inter-assay CV for inhibin A were 5·6 and 12·2 % and for activin A were 6·8 and 10·5 %, respectively. BODY.METHODS.MEASUREMENT OF OUTCOMES.E-SELECTIN AND VASCULAR CELL ADHESION MOLECULE-1: The circulating levels of soluble E-selectin and vascular cell adhesion molecule-1 were measured using Quantikine ELISA Kits (R&D Systems, Inc.), according to the manufacturer's instructions. The intra- and inter-assay CV were 5·8 and 7·9 % for E-selectin and 3·1 and 7·0 % for vascular cell adhesion molecule-1, respectively. BODY.METHODS.MEASUREMENT OF OUTCOMES.3-NITROTYROSINE: Circulating plasma levels of 3-nitrotyrosine were measured using a Hycult-Biotech ELISA kit (Hycult-Biotech), according to the manufacturer's instructions. The inter- and intra-assay CV were < 15 %. BODY.METHODS.MEASUREMENT OF OUTCOMES.C-REACTIVE PROTEIN: Circulating levels of CRP in plasma samples were detected using an in-house, high-sensitivity ELISA adapted from a previously described competition ELISA( 54 ) by comparing the direct detection of bound CRP by horseradish-peroxidase-conjugated rabbit anti-human CRP (DakoCytomation) and visualisation using Tetra Methyl Benzidine (Sigma-Aldrich). The intra- and inter-assay CV were 5 and 8 %, respectively. BODY.METHODS.MEASUREMENT OF OUTCOMES.PENTRAXIN-3: Plasma samples were analysed using a pentraxin 3 ELISA kit (DIESSE Diagnostica Senese SpA), according to the manufacturer's instructions. The between-batch CV was 6·55 % at a pentraxin-3 concentration of 1·92 ng/ml, 7·58 % at 8·48 ng/ml and 8·45 % at 13·34 ng/ml. BODY.METHODS.SAMPLE SIZE: We knew that our trial was not powered to look at pre-eclampsia risk per se, but believed that we had adequate power to observe a significant difference in our chosen primary end-point of sFlt-1, a recognised marker of pre-eclampsia risk. We calculated sample size using graphical data on sFlt-1 in normal pregnant women( 11 ). Taking the standard deviation as 0·2 ng/ml, twenty-nine subjects per group gave us 80 % power to detect a difference of 1·5 ng/ml in the mean sFlt-1 values between the placebo- and Se-treated groups at a two-sided 5 % significance level. As our hypothesis was that an effect of Se supplementation would only be seen in women of inadequate Se status (e.g. in the bottom tertile)( 41 ), we increased the sample size to 100 per group to include a sufficient number of such women. To allow for a 15 % dropout, we planned to recruit 115 subjects per group, making a total of 230 subjects. It subsequently came to light that an error had been made, in that the standard deviation of 0·2 ng/ml was actually the standard error, resulting in the present trial being underpowered to detect a difference in the sFlt-1 end-point. Using the observed difference in means between the Se-treated and placebo groups and the measured standard deviation in both groups, we have now calculated the true power of the present study to achieve two-sided significance at the 5 % level when comparing the means of sFlt-1 in the two arms of the study to be 10 % overall and 36·8 and 54·5 % for women in the bottom tertile and quartile of Se status, respectively. As neither power level is adequate to achieve a significant effect of treatment, we have redefined the present study as a pilot trial. BODY.METHODS.RANDOMISATION: Centralised randomisation was performed by the National Perinatal Epidemiology Unit Clinical Trials Unit, University of Oxford. The randomisation schema was created using the subroutine ralloc.ado (version 3.5.2) in Stata software (version 10.1). Treatments were allocated in the ratio of 1:1 using permuted block randomisation with variable block sizes of 2, 4 and 6 (seed used: 221010). Block sizes were allocated proportional to the elements of Pascal's triangle. A third party, Pharma Nord, who were not involved in any way in the recruitment of participants for the trial, provided the treatment tablets. Pharma Nord was notified of the allocation sequence by an independent statistician at the National Perinatal Epidemiology Unit, and packed eight blister strips of twenty-eight tablets into plain white boxes. The pharmacist at the John Radcliffe Hospital held and dispensed the boxes, each of which bore a label with a unique pack identification number. Each blister pack within each box also bore the randomisation number. The packs were collected by the research midwife from pharmacy as required. A log was kept which, on dispensing the packs, was signed by two people, the research midwife and pharmacist or nurse prescriber. The pack label was also signed before giving the trial box to each participant. BODY.METHODS.RANDOMISATION.BLINDING: Apart from the independent statistician at the National Perinatal Epidemiology Unit who generated the sequence, all study personnel and the participants were blinded to allocation. BODY.METHODS.ASSESSMENT OF COMPLIANCE: Compliance was assessed by tablet count. Stamped, addressed envelopes were provided to participants who were instructed to return empty/partially used/unused blister packs by post to the research midwife who recorded the number of tablets taken. The midwife contacted those who failed to return the packs from the previous 4 weeks within 10 d of the expected return date by telephone. To assess compliance, the total number of study tablets reported as having been taken was expressed as a percentage of the number of days between the study consent date and the date of giving birth. Participants were deemed to be compliant if they took 80 % of their study tablets. BODY.METHODS.RATIONALE FOR AN APPROACH TO DATA ANALYSIS: We observed a large and significant reduction (12 %) in whole-blood Se concentration from 12 to 35 weeks in the placebo group in the present study, resulting, at least in part, from the increase in plasma volume that occurs over the course of normal pregnancy( 55 ). We found that we could mitigate this dilution effect by correcting Se concentration by haematocrit, which reduced the decline in the concentration of Se in the placebo group to 7 %. Therefore, this adjustment was made in some of the analyses as explained below. As the earlier study on which the present pilot trial was based( 41 ) showed a significantly higher incidence of pre-eclampsia in women in the bottom tertile of toenail Se than in the rest, analyses in subgroups with low baseline Se status were the pre-specified primary analyses. As the earlier study and this trial used different matrices (toenail Se and whole-blood Se, respectively) and toenail cuttings reflect Se status before pregnancy, we endeavoured to determine the equivalent baseline whole-blood Se cut-off point in pregnant women to that used for toenail Se (bottom tertile cut-off point 0·547 mg/kg) in the previous study. Using the data from Behne et al. ( 56 ) and taking the density of whole blood to be 1·06 kg/l, we calculated the equivalent whole-blood Se cut-off point to be 106·5 μg/l. As pregnancy causes an expansion of blood volume from the non-pregnant state, the equivalent whole-blood Se cut-off value would be 95·1 μg/l, assuming that the increase was the same as that observed in plasma volume at 12 weeks of gestation, i.e. 12 %( 57 ). This value represents a cut-off between the bottom third and the bottom quarter of baseline whole-blood Se. Therefore, we examined the treatment effect in both the bottom quartile and the bottom tertile of Se status by blood Se concentration at baseline. BODY.METHODS.STATISTICAL ANALYSIS.INTENTION-TO-TREAT ANALYSIS: None of the dependent variables was normally distributed, nor was baseline Se; therefore, they were log-transformed to facilitate parametric testing. Thus, medians (ranges) or geometric means and their 95 % CI, computed by back transformation of log values, are reported. All analyses of continuous data used one observation per subject in a general linear model (SAS PROC MIXED), with treatment (Se or placebo) as the independent variable. Additional covariates were included as appropriate. These covariates were log baseline blood Se (adjusted or unadjusted for baseline haematocrit) and log baseline haematocrit. The treatment effect was assessed using the LSMEANS and PDIFF options of this SAS statistical procedure. The pre-specified primary data analysis of this study was carried out on the subgroup of women with low Se levels at recruitment (the lowest third or the lowest quarter). Subgroups with low Se status (quartiles and tertiles) were defined as blood Se concentration at baseline divided by haematocrit concentration at baseline. BODY.METHODS.STATISTICAL ANALYSIS.SENSITIVITY ANALYSIS.SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1 BY COMPLIANCE: The analysis was repeated including only those women who had taken 80 % or more of their trial tablets. BODY.METHODS.STATISTICAL ANALYSIS.EXPLORATORY SUBGROUP ANALYSES.SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1 BY SE QUARTILE AT BASELINE: Quartiles of baseline blood Se and treatment were simultaneously contrasted to determine whether a trend could be observed across quartiles. The quartile was an additional categorical independent variable in the model and the contrast was assessed using the ESTIMATE option of the PROC MIXED procedure. BODY.METHODS.STATISTICAL ANALYSIS.EXPLORATORY SUBGROUP ANALYSES.PRE-ECLAMPSIA AND PREGNANCY-INDUCED HYPERTENSION: Pre-eclampsia and PIH were not pre-specified outcomes. PIH is defined as new hypertension appearing for the first time after 20 weeks of pregnancy. Hypertension is defined as diastolic blood pressure ≥ 90 mmHg on two occasions ( ≥ 4 h apart). Pre-eclampsia is defined as PIH and new-onset proteinuria after 20 weeks of pregnancy ( ≥ 300 mg/24 h or ≥ 2+ dipstick midstream specimen of urine/catheter specimen of urine). A protein:creatinine ratio of >30 mg/mmol of creatinine was accepted as confirmation of proteinuria. These criteria are an extension of those adopted by the International Society for the Study of Hypertension in Pregnancy( 58 ). Women were dichotomised according to whether they had either pre-eclampsia/PIH, or neither. The relationship with study treatment (Se or placebo) was then analysed by logistic regression. BODY.METHODS.STATISTICAL ANALYSIS.ASSOCIATIONS WITH BASELINE SELENIUM STATUS: The correlation of whole-blood Se (log-transformed and haematocrit-corrected) at baseline with other parameters was investigated using appropriate statistical tests. BODY.RESULTS.PARTICIPANTS: A total of 230 participants were recruited between July 2009 and June 2011. The mean gestational age at recruitment was 12·3 weeks. One participant was recruited at 16 weeks; she was included in the data analysis. In each treatment group, eleven participants discontinued the treatment. Figure 1 shows the participant flow through the study.Fig. 1Participant flow through the study. The baseline characteristics of the participants are shown in Table 1 from which it can be seen that there were no significant differences between the groups at baseline.Table 1Baseline characteristics of the 229 participants, overall and by treatment group (Mean values and standard deviations; numbers and percentages; medians and ranges) Overall (n 229)Se-treated group (n 115)Placebo group (n 114) Mean sd Mean sd Mean sd P * Age (years)30·734·1830·354·5531·113·750·166Gestational age at recruitment (weeks)12·300·8812·260·8512·340·910·500Age of mother at the time of leaving education (years)20·792·9720·592·8721·003·070·296Ethnicity (Caucasian) 0·124 n 213104109 %93·090·495·6 BMI (kg/m2)24·593·9924·774·1124·413·880·499Underweight, BMI < 18·5 kg/m2 0·361† n 202 %0·901·8 Normal body weight, BMI 18·5–24·9 kg/m2 n 1366571 %59·456·562·3 Overweight, BMI 25–29·9 kg/m2 n 703832 %30·633·028·1 Obese, BMI ≥ 30 kg/m2 n 21129 %9·210·47·9 Non-smoker 0·098 n 1568373 %68·172·264·0 Stopped smoking before conception n 59236 %25·820·031·6 Stopped smoking when pregnant n 1495 %6·17·84·4 Consumes alcohol 0·669 n 1346668 %58·857·460·2 Se status: whole-blood Se concentration (μmol/l) 0·352Median1·311·311·32 Range0·84–3·330·84–3·330·84–2·19 Pentraxin 31·090·421·090·401·100·440·858* P value for a comparison between the Se-treated and placebo groups.† P value for the distribution of BMI categories between the Se-treated and placebo groups. The mean gestational age at delivery was 39·65 (95 % CI 39·45, 39·86) weeks overall, 39·75 (95 % CI 39·50, 40·00) weeks in the Se-treated group and 39·56 (95 % CI 39·24, 39·88) weeks in the placebo group, with no significant difference being observed between the Se-treated and placebo groups. BODY.RESULTS.SELENIUM STATUS: Blood was successfully obtained from the 230 participants at baseline, though one was subsequently found to be ineligible for the trial, and from 215 participants at the 35-week visit. The overall median whole-blood Se concentration at baseline was 1·31 (range 0·84–3·33) μmol/l (Table 1). By 35 weeks, whole-blood Se concentration had increased significantly in the Se-treated group (see Table 2), whereas there was a significant reduction (12 %) in the placebo group. Whole-blood Se concentration and plasma SEPP1 concentration were significantly higher at 35 weeks in the Se-treated group than in the placebo group (Table 2). Figure 2 shows the difference in the effect of Se v. placebo treatment on plasma SEPP1 concentration and whole-blood Se concentration at 35 weeks.Table 2Effect of selenium supplementation on the parameters of selenium status (Median values and ranges) PlaceboSe Parameter of Se statusMedianRangeMedianRange P * Whole-blood Se concentration (μmol/l) Baseline (n 230)1·320·84–2·191·310·95–3·330·352435 weeks (n 215)1·160·69–2·151·871·05–3·73< 0·0001 P (baseline v. 35 weeks)< 0·0001 < 0·0001 Plasma SEPP1 concentration (μg/ml) 35 weeks (n 215)3·000·90–5·805·302·40–7·40< 0·0001SEPP1, selenoprotein P.* P value for a comparison between the placebo and Se-treated groups at 35 weeks. Fig. 2Selenoprotein P (SEPP1) v. whole-blood selenium concentration at 35 weeks. , Placebo; , selenium. (A colour version of this figure can be found online at http://www.journals.cambridge.org/bjn) BODY.RESULTS.COMPLIANCE WITH TREATMENT: Of the participants, 22 % in the Se-treated group and 23 % in the placebo group were non-compliant, i.e. took less than 80 % of the trial tablets. However, 28 % of the participants failed to return some or all of the empty packets, though many claimed to have taken the tablets; compliance may therefore have been somewhat better than the estimates suggest. In the placebo group, one participant took a pregnancy supplement containing 30 μg Se sporadically from 16 to 20 weeks of pregnancy along with the trial tablets. She was included in the data analysis. BODY.RESULTS.EFFECT OF TREATMENT: PRIMARY OUTCOME MEASURE (SERUM SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1): The intention-to-treat analysis included all participants (apart from one clear outlier) for whom we had an sFlt-1 measurement, regardless of compliance, i.e. 105 participants in the Se-treated group and 109 in the placebo group (see Fig. 1). Table 3 shows the effect of Se v. placebo supplementation on sFlt-1 concentration at 35 weeks in participants in the bottom quartile and tertile of whole-blood Se at baseline (primary data analysis of the present study) and in the whole dataset. Because the ratio of sFlt-1:PlGF is often taken to be a more sensitive indicator of the risk of pre-eclampsia as the fall in the concentration of PlGF amplifies the concurrent rise in the concentration of sFlt-1( 12 , 59 ), the data for PlGF and the ratio of sFlt-1:PlGF are also presented. In participants in the lowest quartile of Se status at baseline, treatment with Se significantly lowered the concentration of sFlt-1 (P= 0·039) and halved the ratio of sFlt-1:PlGF, though the latter effect did not quite reach significance (P= 0·066); however, in all participants taken together, Se treatment had no effect on sFlt-1 concentration, PlGF concentration or sFlt-1:PlGF ratio.Table 3Effect of selenium supplementation v. placebo on soluble vascular endothelial growth factor receptor-1 (sFlt-1) concentration, placental growth factor (PlGF) concentration and the ratio of sFlt-1:PlGF at 35 weeks in participants in the bottom quartile* (n 50) and tertile* (n 67) of selenium status at baseline and in all participants† ‡ (n 214) (Mean values and 95 % confidence intervals)Outcome measureSe status group at baselineSe treatment (geometric mean)Placebo(geometric mean)Se:placebo ratio P (Se treatment v. placebo)Mean95 % CIsFlt-1 (ng/ml)Bottom quartile5·227·490·700·49, 0·980·039 Bottom tertile5·797·550·770·56, 1·060·104 All participants6·797·180·950·80, 1·120·511PlGF (ng/ml)Bottom quartile2611930·970·78, 1·210·185 Bottom tertile2412101·150·77, 1·710·494 All participants2332400·970·78, 1·210·801sFlt-1:PlGFBottom quartile0·0200·0390·510·25, 1·050·066 Bottom tertile0·0240·0360·670·35, 1·270·215 All participants0·0290·0300·970·70, 1·360·875*For division into quartiles/tertiles, baseline Se concentration was adjusted for baseline haematocrit.†In all participants, adjustment for blood Se and haematocrit covariates at baseline and for haematocrit at 35 weeks made no substantial difference to the results.‡Analysis on all participants was not part of the primary analysis. BODY.RESULTS.EFFECT OF TREATMENT: SECONDARY OUTCOME MEASURES: The effect of Se and placebo treatments on secondary outcome measures is shown in Table 4. None of the parameters was significantly affected by Se treatment either in the participants in the bottom tertile or quartile of Se status or in the whole group.Table 4Effect of selenium supplementation v. placebo on secondary outcome measures at 35 weeks in participants in the bottom quartile* and tertile* of selenium status at baseline and in all participants† ‡ (Mean values and 95 % confidence intervals)Outcome measureSe status group at baseline n Se treatment (geometric mean)Placebo (geometric mean)Se:placebo ratio P (Se treatment v. placebo)Mean95 % CISoluble endoglin (ng/ml)Bottom quartile5062·3271·890·870·69, 1·100·227 Bottom tertile6769·0868·711·010·78, 1·300·967 All participants21364·8864·721·000·87, 1·160·973Activin (ng/ml)Bottom quartile5015·3616·730·920·66, 1·280·606 Bottom tertile6716·7117·290·970·72, 1·310·821 All participants21417·0818·380·930·80, 1·080·347Inhibin (ng/ml)Bottom quartile50118512470·950·69, 1·310·749 Bottom tertile67130413230·990·74, 1·300·916 All participants214125212011·040·90, 1·210·578VCAM-1 (ng/ml)Bottom quartile506006490·920·80, 1·060·256 Bottom tertile676116410·950·84, 1·080·427 All participants2146026180·970·91, 1·040·407E-selectin (ng/ml)Bottom quartile5031·9330·491·050·79, 1·010·741 Bottom tertile6732·3330·931·050·82, 1·330·715 All participants21427·3730·710·890·79, 1·390·070CRP (ng/ml)Bottom quartile50373528281·320·87, 1·840·448 Bottom tertile67304422691·340·67, 2·690·402 All participants214320425381·260·64, 2·750·222Pentraxin 3 (ng/ml)Bottom quartile501·411·490·940·92, 1·180·592 Bottom tertile671·481·630·900·71, 1·150·411 All participants2141·621·551·040·76, 1·180·501Nitrotyrosine (μmol/l)Bottom quartile112·460·813·050·04, 218·80·453 Bottom tertile152·560·853·020·14, 66·290·570 All participants490·960·821·180·31, 4·520·805VCAM-1, vascular cell adhesion molecule-1; CRP, C-reactive protein.*For division into quartiles/tertiles, baseline Se concentration was adjusted for baseline haematocrit.†In all participants, adjustment for blood Se and haematocrit covariates at baseline and for haematocrit at 35 weeks made no substantial difference to the results.‡Analysis on all participants was not part of the primary analysis. BODY.RESULTS.SUBGROUP ANALYSES (EXPLORATORY).SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1 BY COMPLIANCE: Reanalysis of the effect of treatment on sFlt-1 concentration when only participants who reported taking 80 % of the trial tablets were included made no difference to the result (data not shown). BODY.RESULTS.SUBGROUP ANALYSES (EXPLORATORY).SOLUBLE VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-1 BY QUARTILE OF BASELINE SELENIUM STATUS: Given the significant effect of Se treatment on sFlt-1 concentration in women in the lowest quartile of Se status at baseline, we decided to determine whether the effect showed a trend by quartile. The ratio of sFlt-1 means shown in Table 5 illustrates that, rather than a trend, treatment with Se appears to reduce sFlt-1 concentration only in participants in the bottom quartile of Se status at baseline, with no effect being observed in those in the other quartiles. There is a near-significant difference between the effect in the bottom quartile and the rest (ratio for the lowest quartile compared with the other quartiles: 0·67, 95 % CI 0·45, 1·00; P= 0·051).Table 5Results for soluble vascular endothelial growth factor receptor-1 by quartile of whole-blood selenium concentration at baseline (Mean values and 95 % confidence intervals)Data subset by quartile of Se at baseline* n Se treatment, geometric mean (ng/ml)Placebo geometric mean (ng/ml)Se:placebo ratio P (Se treatment v. placebo)Mean95 % CI1st (bottom) quartile505·227·490·700·49, 0·980·0392nd quartile517·537·461·010·70, 1·450·9623rd quartile517·356·451·140·80, 1·620·4574th quartile517·327·520·970·69, 1·380·880*Division into quartiles by baseline Se status corrected for haematocrit. BODY.RESULTS.SUBGROUP ANALYSES (EXPLORATORY).PRE-ECLAMPSIA AND PREGNANCY-INDUCED HYPERTENSION: Neither pre-eclampsia nor PIH was a designated outcome because of the known lack of power; there were eleven cases of pre-eclampsia (eight in the placebo group and three in the Se-treated group), and nine cases of PIH (six in the placebo group and three in the Se-treated group). As expected, the effect of Se treatment on the incidence of either outcome failed to reach significance (data not shown). However, when the two outcomes were combined on the basis that there may be some continuity between the conditions( 60 – 63 ), and when the analyses were adjusted for baseline Se concentration and haematocrit, Se treatment significantly reduced the odds of having either pre-eclampsia or PIH in all participants (OR 0·350, 95 % CI 0·126, 0·974; P= 0·044) and with near significance in those in the bottom third of Se status at baseline (Table 6), with large treatment effects.Table 6Effect of selenium treatment v. placebo on the risk of pre-eclampsia (PE) and pregnancy-induced hypertension (PIH) combined, by treatment group, in all participants and in those in the bottom tertile* and quartile* (Odds ratios and 95 % confidence intervals) Subjects with PE/PIH (n)PE/PIH combinedData subset n Se-treated groupPlacebo groupOR95 % CI P † All participants2286140·420·16, 1·090·075All participants‡ 2155140·35‡ 0·13, 0·970·044Bottom Se tertile71180·170·03, 1·070·059Bottom Se quartile53040·120·01, 2·400·163*Division into tertiles/quartiles by baseline Se concentration corrected for haematocrit.†χ2 test.‡Adjusted for baseline Se concentration and baseline haematocrit. BODY.RESULTS.ASSOCIATIONS WITH SELENIUM AT BASELINE: At baseline (12 weeks), with adjustment for haematocrit, whole-blood Se was negatively correlated with BMI (Pearson's correlation (r) − 0·222; P= 0·001); there were no other significant correlations. BODY.RESULTS.ADVERSE EVENTS: Overall two adverse events were reported: one participant had a rash on her legs below the knees, deemed to be mild, and possibly related to the study treatment. Another participant had spontaneous torsion of her right ovary that required right oophorectomy, a rare complication of pregnancy, not connected with the study supplement. BODY.DISCUSSION.EFFECT ON SELENIUM STATUS: We used whole blood to measure Se concentration as it gives a longer-term measure than does plasma Se. Se supplementation from 12 to 35 weeks increased whole-blood Se concentration by 43 % in the Se-treated group, while there was a significant fall of 12 % in the placebo group (Table 2). Other studies that measured whole-blood Se in pregnancy have also found a substantial fall in its concentration with increasing gestational age( 64 , 65 ). Apart from plasma volume expansion, an additional cause of a fall in blood Se concentration throughout pregnancy may be the transfer of Se to the fetus by SEPP1, a major component of plasma Se that transports Se to other tissues( 49 ). This has been suggested by a recent study by Burk et al. ( 66 ) in pregnant mice that identified two mechanisms of Se transfer; from early to mid-gestation, plasma GPx and SEPP1 were transported via the uterine fluid, probably by pinocytosis, whereas in the latter half of gestation, placental transfer of maternal SEPP1 occurred through apoE receptor 2. Even in mice with normal Se status, maternal plasma SEPP1 concentration fell rather dramatically in late pregnancy with a sharp rebound the day after delivery. Therefore, pregnancy may be putting similar pressure on the Se stores of UK pregnant women with marginal Se status. Women supplemented with Se had at least partial correction of their Se deficiency, raising the SEPP1 concentration, though most participants did not reach the maximum value (see Fig. 2). BODY.DISCUSSION.PER-PROTOCOL ANALYSES: sFlt-1 was the primary outcome measure of the present study, and our hypothesis was that there would only be an effect of Se supplementation in pregnant women of inadequate Se status. Owing to an initial statistical error, the trial was powered only at 36·8 and 54·5 % to observe a significant difference between sFlt-1 means in the two arms of the study in women in the lowest third and lowest quarter of Se status, respectively. Therefore, it is important that we found a significant difference in participants in the lowest quartile of Se status at baseline, in whom Se treatment lowered the concentration of sFlt-1 by 30 % (ratio of means 0·70, 95 % CI 0·49, 0·98; P= 0·039; Table 3). When we examined the effect of Se supplementation on the ratio of sFlt-1:PlGF, a more sensitive indicator of risk of pre-eclampsia( 12 , 59 ), we found that it had decreased by 49 % in the bottom quartile, though the effect did not quite reach significance (P= 0·066). We observed no significant effect of treatment on any of the secondary outcome measures of the present study, perhaps because of the lack of power, so these will not be discussed further. What are the mechanisms by which treatment with Se could cause a fall in sFlt-1 concentration, a primary marker of pre-eclampsia risk? Selenoproteins are able to reduce oxidative stress, endoplasmic reticulum stress and inflammation, characteristics of pre-eclampsia, while protecting endothelial cells and up-regulating the expression of the protective haem oxygenase 1 (HO-1)( 23 – 26 , 28 , 29 , 67 , 68 ). Se supplementation was found to decrease NF-κB activation and down-regulate the expression of inflammatory genes( 67 , 68 ). Both GPx and thioredoxin reductase have been shown to protect endothelial cells from oxidants including oxidised LDL( 25 , 26 ). Thioredoxin reductase has been shown to up-regulate the expression of HO-1 by a number of pathways during a pro-oxidant challenge, resulting in the reduced expression of pro-inflammatory genes( 28 , 29 ); HO-1 has antioxidant effects and is linked to successful placentation, inhibition of sFlt-1 release, uterine quiescence, placental haemodynamic control and the regulation of apoptotic and inflammatory cascades in trophoblast cells( 69 – 72 ). SEPP1, which is recruited to the endothelium in the areas of inflammation, scavenges the powerful inflammatory agent peroxynitrite, thereby reducing oxidative stress and inflammation and shielding endothelial membranes from its attack( 16 , 73 ). Gene expression of SEPS1 is activated by endoplasmic reticulum stress, and binding sites exist for NF-κB in the human SEPS1 promoter; thus, SEPS1 plays a key role in the control of the inflammatory response( 27 ). The effects of Se outlined above can mostly be attributed to selenoproteins; therefore, it is entirely understandable that we only observed an effect in the bottom quartile of Se status in the present study and in the bottom tertile in our earlier study( 41 ). Above a whole-blood Se concentration of 1·3 μmol/l, plasma GPx activity is maximised( 74 ). The mean whole-blood Se concentration in trial participants at baseline was 1·31 μmol/l, suggesting that approximately 50 % would not have had maximal plasma GPx activity. If the effects that we observed are attributable to GPx, then only a subgroup of women in the present study could have benefited from Se supplementation, as observed by our group. In contrast to plasma GPx, the concentration of SEPP1 does not plateau until a plasma Se concentration of 1·6 μmol/l is reached( 75 ). The results suggest that in whole blood, SEPP1 concentration may plateau at about 1·8 μmol/l (Fig. 2), which accords with the findings in plasma. Supplementation with Se from 12 to 35 weeks was insufficient to raise the concentration of SEPP1 to that plateau level in the majority of women in the Se-treatment group (Fig. 2). Therefore, if beneficial effects are related to the effect of SEPP1, a higher dose or an intervention earlier than 12 weeks of gestation would have been required to observe it. BODY.DISCUSSION.EXPLORATORY ANALYSES: In addition to the pre-specified analyses described above, we carried out hypothesis-generating exploratory analyses in order to have some further insight into the effect of Se supplementation. When we analysed sFlt-1 concentration by quartiles to determine whether a trend could be detected, we observed a reduction in the concentration of sFlt-1 only in participants in the bottom quartile of Se status at baseline, with those in the other quartiles showing no effect (Table 5). Thus, there was a near-significant difference between the effect in the bottom quartile and the rest (P= 0·051), suggesting a threshold effect that affected only participants in the bottom quartile of Se status. We had very small numbers of participants affected by pre-eclampsia( 11 ) and PIH( 9 ), so we combined the two outcomes on the basis that there may be some continuity between the conditions( 62 , 63 ). Se treatment significantly reduced the odds of the combination (pre-eclampsia/PIH) in all participants (OR 0·35, 95 % CI 0·13, 0·97; P= 0·044) and with near significance (P= 0·059) in those in the bottom third of Se status at baseline, with large treatment effects (eight women developed pre-eclampsia/PIH in the placebo group compared with one in the Se-treated group) (Table 6). Although pre-eclampsia and PIH are not synonymous, the distinction between the two is not always completely clear; 15–45 % of women with PIH will eventually develop pre-eclampsia( 62 , 63 ). The earlier the time of presentation, the more likely is PIH to be a harbinger of pre-eclampsia( 60 ). If PIH is associated with some other feature of pre-eclampsia than proteinuria, such as hyperuricaemia or intra-uterine growth retardation, it will be now recognised as a possible atypical variant of pre-eclampsia( 61 ). BODY.DISCUSSION.BASELINE ASSOCIATIONS: The negative correlation (r − 0·222; P= 0·001) between baseline whole-blood Se and BMI is in line with other findings in the literature on the relationship between serum/plasma Se and BMI in non-pregnant groups( 76 – 78 ). BODY.DISCUSSION.TRIAL LIMITATIONS: The major limitation of the present study was in having very limited power (only 54·5 % in the bottom quartile and 36·8 % in the bottom tertile of participants) to observe a difference in our primary endpoint of sFlt-1. Intervention at 12 weeks of gestation may have been later than ideal. Our earlier study( 41 ) that found a significant difference in Se status between pre-eclamptic and matched control pregnant women used toenail clippings that probably reflected Se status before conception, as toenails are laid down up to 12 months before clipping. We were always aware that if the effect of Se supplementation was primarily in the early stages of gestation, we would not be able to observe it with the present protocol. A number of processes that occur during the periconceptual period might benefit from protection by selenoproteins. Indeed, periconception 'multivitamin' (often including Se) use has been shown to reduce the risk of pre-eclampsia( 79 ). We have observed an effect in the bottom quartile (upper cut-off value 1·18 μmol/l in whole blood) of Se status in UK pregnant women. This might roughly equate to 1·07 μmol/l (84·5 μg/l) in serum/plasma. These results may therefore only be generalisable to other population groups of similar Se status such as that likely to be found in other countries of Europe. Vanderlelie & Perkins( 30 ) found a significant reduction (P= 0·0007) in the incidence of pre-eclampsia in countries with a reported serum/plasma Se concentration ≥ 95 μg/l (1·2 μmol/l). Our trial population falls within that range. BODY.DISCUSSION.SUGGESTIONS FOR FUTURE WORK: To date, this is the only study to have investigated the effect of Se supplementation in a population with low Se status that examined an outcome related to the risk of pre-eclampsia. Given the present findings of significantly lower concentrations of sFlt-1 in women in the bottom quartile of Se status supplemented with Se, and the suggestion that Se supplementation may lower the incidence of PIH+pre-eclampsia, the trial should be repeated, properly powered for the outcome of pre-eclampsia (and PIH), in a population with a Se status as low, or lower, than that of the present study. Ideally, recruitment would start earlier than 12 weeks. On the basis of our inability to optimise SEPP1 during the course of the trial, we would recommend a higher, though safe, dose of Se-enriched yeast, i.e. 100 μg/d( 80 ). A major difficulty in conducting such a trial in a Western country is recruiting sufficient women who are not taking a pregnancy supplement; such supplements are increasingly available at relatively low cost in supermarket chains. Despite these difficulties, the potential benefits to be gained by conducting a properly powered trial would make such a demanding exercise worthwhile.

TITLE: Systematic depression screening in high-risk patients attending primary care: a pragmatic cluster-randomized trial ABSTRACT.BACKGROUND: Systematic screening for depression in high-risk patients is recommended but remains controversial. The aim of this study was to assess the effectiveness of such screening in everyday clinical practice on depression recognition. ABSTRACT.METHODS: A pragmatic, cluster randomized, controlled study that randomized primary care physicians (PCPs) in Spain either to an intervention or control group. The intervention group (35-PCPs) received training in depression screening and used depression screening routinely for at least 6 months. The control group (34-PCPs) managed depression in their usual manner. Adherence to (1–6; never-very frequently), feasibility (1–4; unfeasible-very feasible), and acceptance (1–5; very poor-very good) of the screening were evaluated. Underrecognition (primary outcome) and undertreatment rates of major depressive disorder (MDD) in the two groups were compared 6 months after randomization in a random sample of 3737 patients assigned to these PCPs using logistic regression adjusting for the clustering effect. ABSTRACT.RESULTS: No significant differences were found for recognition rates (58.0% vs. 48.1% intervention vs. control; OR [95%CI] 1.40 [0.73-2.68], p = 0.309). The undertreatment rate did not differ significantly either (p = 0.390). The mean adherence to depression screening was 4.4 ± 1.0 ('occasionally'), the mean feasibility was 3.1 ± 0.5 ('moderately feasible'), and the mean acceptance was 4.2 ± 0.6 ('good'). ABSTRACT.CONCLUSIONS: This research was not able to show effectiveness of the systematic screening for MDD in high-risk patients on depression recognition in primary care. The poor adherence to screening implementation could partially explain the results. These reflect the difficulties of putting into practice the clinical guidelines usually based on interventional research. ABSTRACT.TRIAL REGISTRATION: Clinicaltrials.gov NCT01662817 BODY.BACKGROUND: Major depressive disorder (MDD) is a common disease associated with significant disability and high healthcare costs, but it is still underdiagnosed in a large percentage of primary health care (PC) patients [1-3]. Not recognizing depression may prolong episodes, increasing the duration of patient suffering and decreasing the likelihood of recovery [4]. Systematic screening for depression has therefore been recommended in order to reduce the large rate of depression underrecognition and its deleterious consequences [5-8]. Evidence from explanatory clinical trials, indicates that screening ensures proper identification of depressed patients in the primary health care setting, and several health agencies have published guidelines recommending systematic screening for depression in high-risk patients [5-8]; however, when incorporated into routine primary care practice, their effectiveness is controversial [9-12]. The guidelines on systematic screening for depression recommend, as one possible screening strategy, asking the patient two questions about their mood and anhedonia, followed by a diagnostic interview if screening is positive [5-8]. More specifically, it has been proposed by the US preventive Services Task Force, that depression screening in primary care should be aimed at patients at high risk of depression, such as patients with a history of depression, psychological comorbidities, unexplained somatic symptoms, or disability due to physical illnesses [13]. It has been claimed that screening in PC ensures that depressed patients are identified [5-8], but evidence is based on explanatory trials performed under the inherent "ideal" conditions of clinical trials [7,14,15]. In fact, there is a lack of randomized data supporting their effectiveness when integrated into the everyday clinical practice. The authors have identified only one non-randomized study that aimed to assess the effectiveness of depression screening under such conditions [16]. In this study, Bass et al., evaluated the effectiveness of screening on treatment initiation in three high-risk groups in primary care (patients with mental health problems, unexplained somatic complaints and patients who frequently consult their general practitioner). Negative results were reported [16]. Two further studies have been published assessing the extent of implementation of screening in the PC setting [17,18], showing very low [17] and very high [18] use of depression screening. This lack of effectiveness data could partly explain the controversy of systematic screening for depression in PC. The present paper presents the results of a pragmatic research that tested the hypothesis whether implementing the guidelines on screening for depression in high-risk patients in everyday clinical practice reduces the underrecognition of MDD in PC. The authors also addressed MDD undertreatment and outcomes as secondary endpoints and sought to evaluate the degree of adherence and acceptance of depression screening by primary care physicians (PCPs). BODY.METHODS.STUDY DESIGN: This was a pragmatic, cluster-randomized, controlled study performed in PC practices with the PCP as the unit of randomization (cluster). One hundred five PCPs from the public healthcare system throughout Spain were invited by telephone between July and September of 2009. Sixty-nine (66%) PCPs, who fulfilled the inclusion criteria, were randomized. Randomization of PCPs to either an intervention group (n = 35) or a control group (n = 34) was stratified by the number of patients attending their practices daily (<50, ≥50) and by PCP shift (morning or afternoon). Participating PC practices belong to the Spanish primary health system that offers almost universal coverage, provides free access and partial reimbursement for the majority of antidepressant treatments [19]. The organization of the system is regionally controlled by 17 autonomous communities. The pay of PCPs is not linked to integrated care or management of disease [19]. In a second stage, at least six months after randomization, the effectiveness of the intervention was cross-sectionally evaluated at patient level between April and July 2010 (Figure 1) by the same PCPs. Following the next procedure, a sample of patients with MDD episode (n = 525) was systematically recruited (Figure 1). Every 10th attending patient was evaluated (n = 3737) by the PCP with the Depression subscale of the Hospital Anxiety and Depression Scale (HADS-D) [20]. The Hospital Anxiety and Depression Scale was designed to screen for the presence of a mood disorder in medically ill patients. The HADS-D is a self-report scale and contains 7 items rated on 4-point Likert-type scales [20]. The sensitivity and specificity for the HADS-D is approximately 0.80 [21]. Patients with a HADS-D score of 8 or higher were then interviewed by the PCP with the Mini-International Neuropsychiatric Interview (MINI) [22] to confirm a MDD episode (n = 525) (Figure 1). The MINI is an abbreviated psychiatric structured interview used to diagnose major Axis I psychiatric disorders in DSM-IV and ICD-10. The MINI is a relatively brief instrument that is divided into modules corresponding to diagnostic categories such as major depressive episode, dysthymia, mania/hypomania, panic disorder, etc. The module administrated was that corresponding to the diagnostic category for MDD [22]. Figure 1Study flow chart. PCP: primary care physician. MDD: major depressive disorder. First stage: PCP randomization (September 2009) and implementation of the intervention (October 2009 to March 2010). Second stage: collection of patient data (April to July 2010). Selection of patients for screening in the second stage: Every 10th attending patient was evaluated (n = 3737) by the PCP with the Depression subscale of the Hospital Anxiety and Depression Scale. Confirmation of MDD in the study sample was done with the Mini-International Neuropsychiatric Interview. The study was carried out between September 2009 and July 2010 (PCP randomization – September 2009; implementation of the intervention – from October 2009 to March 2010; and collection of patient data, second stage – April to July 2010). It was approved by the ethical review board of Hospital Clínico Universitario San Carlos, Madrid and carried out according to the principles of the Declaration of Helsinki [23] and the Spanish regulations (circular 15/2002/AEM). BODY.METHODS.SELECTION CRITERIA: PCPs were fully informed of the study design and agreed to be randomized to the intervention or control group. PCPs were excluded if they already followed the recommendations on screening or were planning to do so, if they would be absent from their practice for a significant period during the study, or if they could not ensure effective management of depression (diagnosis, treatment and follow-up is not ensured). In the second stage, patients were included if they were aged 18 years or older, and provided written consent for the collection and use of their clinical data collected by the PCP. High-risk patient and non-high-risk patients were suitable for this second stage. Patients not able to understand the aims of the study based on PCP clinical criteria were excluded. The study population was formed by the patients with a MDD episode according to the MINI. BODY.METHODS.INTERVENTION: PCPs randomized to the intervention arm received a 1-day face-to-face training, done by one psychiatrist and four PCPs, on the recommendations on screening for depression in adults, according to the U.S. Preventive Services Task Force (USPSTF) 2002 guidelines [7,13], and were asked to implement them in their routine clinical practice for at least 6 months. Monthly reminders were sent by e-mail. They were also required to complete a form each month indicating adherence to and acceptance and feasibility of such recommendations. The 2002 USPSTF guidelines recommended, as a way of conducting the screening, to ask the patient the following two questions: "Over the past two weeks, have you felt down, depressed, or hopeless?" and "Over the past two weeks, have you felt little interest or pleasure in doing things?". "High risk" was defined as fulfilling at least one of the following: history of depression, somatic symptoms without any cause, psychological comorbidities or drug abuse, or chronic pain. Positive screening should be followed by a diagnostic interview. The training included several workshops with clinical cases to discuss the barriers of implementation. BODY.METHODS.OUTCOME MEASURES: The primary outcome measure was the rate of underrecognized depression, measured in the second stage, six months after the PCPs were randomized. Underrecognition was assessed by a systematic review of the patients' medical records carried out by the participating physicians. Patients with a confirmed MDD episode were considered as underrecognized if there was not any diagnosis of such episode in the patient's medical record, regardless the patient was receiving or not any treatment. There was not any specific time-frame (for example, last 6 months) for the revision of the medical record. For the secondary outcome measure of undertreatment, patients with a confirmed MDD episode were considered "treated " if at the time of the assessment, they were receiving any antidepressant medication, any non-pharmacological treatment for depression according to the NICE guidelines [5], or if they had been referred to specialized psychiatric care for the current episode. NICE guideline was chosen since it is a complete and well-known guide by physicians in Spain. The feasibility of implementing the depression screening by the PCPs randomized to the intervention group as well as its acceptance and degree of adherence were measured monthly using Likert-type scales developed specifically for this study. Feasibility was scored from 1 (unfeasible) to 4 (very feasible), acceptance from 1 (very poor) to 5 (very good), and adherence from 1 (never) to 6 (very frequently). In addition, the average number of patients in whom the screening was applied was collected monthly by the PCPs. To assess depression outcomes, data on severity of depression was collected using the Clinical Global Impression-Severity scale (CGI-S), which ranges from 1 (normal, no disease) to 7 (severely diseased) [24]. Functioning was evaluated by the Sheehan Disability Scale (SDS), a self-administered questionnaire which evaluates changes in the subjects' working, social, and family life [25]. Each area is scored between 0 (no perturbation) and 10 (maximum perturbation), up to a total score of 30 for the whole scale [25]. In addition, work absenteeism due to depression, median duration of the current MDD episode and reason for consultation (multiple choice between emotional/affective symptoms, somatic/physical symptoms, social reasons, requires medication/prescription or other) for the study visit were also collected. These depression outcomes were measured in the second stage, at least six months after PCPs randomization, and were collected by the PCPs. BODY.METHODS.SAMPLE SIZE CALCULATION: Sample size was calculated assuming that the rate of depression underrecognition in the PC setting is about 50% [26] and that intervention reduces it by 15% [7]. Considering that randomization was done at PCP level and each practice was expected to recruit 5 patients with a 0.05 intra-cluster correlation [27], 432 patients with a MDD episode were needed. With a prevalence of MDD of 14% in PC [26] and an 80% sensitivity of the HADS-D scale [27], about 4000 patients were to be screened. BODY.METHODS.STATISTICAL METHODS: Underrecognition rates were compared between groups by logistic regression modelling adjusted for the effect of cluster aggregation by using generalized estimating equations. For each patient, the dependent variable was the presence or absence of MDD diagnosis in the medical records. Independent variables on the PCP level were the number of patients attending the practice daily (50 or more vs. less than 50 patients) and the PCP's shift (morning vs. afternoon), self-reported by the PCP. PCP's shift was included since could has an effect on the primary outcome (patients in the afternoon shift are usually younger and have less co-morbidities than patients in the morning shift) as well as the number of patients attending the practice daily (more patients could be linked with more under-recognition of depression). On the patient level, the independent variables were gender, age (continuous variable), education (no formal education vs. primary education; vs. vocational training; vs. secondary education; vs. university education), work status (unable to work vs. unemployed; vs. house-keeping; vs. retired; vs. working for pay), medical comorbidities (yes vs. no), psychiatric comorbidities (yes vs. no), non-psychiatric treatment (yes vs. no), and time since previous visit (continuous variable). A similar model including the same covariates was used to analyze the differences between groups in the undertreatment of depression. The duration and severity of depression, the patient's functioning, and the number of days absent from work due to depression, were analyzed using an extension of covariance analysis. The model was adjusted for the grouping effect caused by the clustering, with the practice considered as a random effect. The analysis was also adjusted by the same covariates described in the models above and both, pharmacological treatment for depression (yes vs. no) and non-pharmacological treatment for depression (yes vs. no). The reason for consultation (emotional/affective symptoms yes vs. no; somatic/physical symptoms yes vs. no) was included in a post hoc analysis as an independent variable in the logistic regression model for underrecognition of depression. All variables were described using descriptive statistics. All statistical tests were two-tailed with a level of significance of p = 0.05, unless otherwise specified. SAS (Statistical Analysis System) version 9.2 was used for analysis. BODY.RESULTS.PHYSICIANS, PRIMARY CARE PRACTICES AND PATIENTS: The characteristics of the PC practices and PCPs are shown in Table 1. Demographic and clinical characteristic of the patients are shown in Table 2. Before study visit, most patients (436/525; 83%) had visited their PCP (84.8% and 81.3%; intervention and control groups respectively), with a mean of 3.4 ± 2.70 visits in the previous 3 months. Table 1 Characteristics of the primary care practices and physicians participating in the study   Intervention group N = 35 Control group N = 34 Primary care practices     City population (thousands), mean (range) 287.6 (1.4-3213.3) 887.9 (1.6-3213.3) Patients attending practice daily (<50), n (%) 24 (68.6) 24 (70.6) Geographical area, n (%)      Central Spain 11 (31.4) 14 (41.2)  Mediterranean coast 13 (37.1) 7 (20.6)  North of Spain 3 (8.6) 6 (17.6)  South of Spain 8 (22.9) 7 (20.6) Primary care physicians     Gender (male), n (%) 23 (65.7) 28 (82.4) Shift (morning), n (%) 31 (88.6) 30 (88.2) Table 2 Characteristics of the primary care patients participating in the study   Intervention group N = 257 Control group N = 268 Female, n (%) 191 (74.3) 197 (73.5) Mean age (SD) 54.8 (16.1) 56.2 (16.3) Marital status, n (%)      Married/Partnered 149 (57.9) 160 (59.7)  Divorced/separated 21 (8.2) 17 (6.3)  Widowed 30 (11.7) 41 (15.3)  Other 57 (22.2) 50 (18.7) Educational status, n (%)      Primary education 107 (41.6) 111 (41.4)  Secondary education 46 (17.9) 40 (14.9)  University 21 (8.2) 37 (13.8)  Other 83 (32.3) 80 (29.8) Any medical co-morbidity*, n (%) 167 (65.0) 185 (69.0) Any psychiatric co-morbidity**, n (%) 142 (55.3) 160 (59.7) * Hypertension, Osteoarthritis, Hyperlipidemia, Obesity, Hypercholesterolemia, Diabetes Mellitus, Migraine, Fibromyalgia Syndrome, Carcinoma, Cardiovascular Disease, Pulmonary Disease, Cardiac Arrest, Myocardial Infarction, Cerebrovascular Disease, Parkinson’s Disease. ** Dysthymia, adjustment disorder, anxiety, anorexia, phobic disorder, panic disorder, alcohol abuse, bulimia nervosa, post traumatic stress disorder, drug dependence, bipolar disorder, psychotic disorder, obsessive-compulsive disorder. BODY.RESULTS.UNDERRECOGNITION OF DEPRESSION: No significant differences were found in the rate of underrecognition of depression between intervention and control groups (underrecognition rates were 33.9% vs. 41.4% intervention vs. control; recognition rates were 58.0% vs. 48.1% intervention vs. control; OR [95% CI] for depression recognition intervention vs. control: 1.40 [0.73-2.68], p = 0.309) (Table 3). The factors related to the PCP did not yield significant differences either. Two patient-related factors significantly improved recognition rate: psychiatric comorbidities (OR [95% CI]: 2.43[1.44-4.08], p < 0.001 vs. absence of psychiatric comorbidities) and inability to work (OR [95% CI]: 2.91[1.22-6.95], p = 0.016 vs. working for pay). Table 3 Recognition and treatment rates of depression   Intervention group N = 257 Control group N = 268 OR 95% CI for OR p -value Recognized patients, n (%) 149 (58.0) 129 (48.1) 1.40 0.73-2.68 0.309 Underrecognized patients, n (%) 87 (33.9) 111 (41.4)       Missing data, n (%) 21 (8.2) 28 (10.4%)       Treated patients, n (%) 153 (59.5) 139 (51.9%) 1.35 0.68-2.63 0.390 Undertreated patients, n (%) 104 (40.5) 129 (48.1)       OR: odds ratio. CI: confidence interval. BODY.RESULTS.UNDERTREATMENT OF DEPRESSION: No significant differences were found between study groups (Table 3). Factors associated with less undertreatment were the presence of psychiatric comorbidities (OR [95% CI]: 0.25 [0.15-0.40], p < 0.001 vs. absence of psychiatric comorbidities) and inability to work (OR [95% CI]: 0.29 [0.12-0.71], p = 0.007 vs. working for pay). Significantly more patients without formal education were undertreated than those with education (OR [95% CI]: 2.26 [1.18-4.33]), p = 0.014 vs. primary education; OR [95% CI]: 3.80 [1.48-9.77], p = 0.006 vs. secondary education; OR [95% CI]: 2.92 [1.10-7.75] p = 0.031, vs. university education). BODY.RESULTS.IMPLEMENTATION OF THE SCREENING: Five out of 35 PCPs randomized to the intervention group dropped out from the study (Figure 1). In the 30 PCPs that continued in the study, the mean (± standard deviation) adherence score for the whole study period was 4.4 ± 1.0 ("occasionally"). Between 40% (Month 1) and 60% (Month 3) of PCPs followed the recommendations "frequently" or "very frequently". Overall, PCPs used the screening in an average of 67 patients (95% CI: 38.1-96.5) per month. The mean score for feasibility of implementation was 3.1 ± 0.5 ("moderately feasible"). Nearly 90% of PCPs found the implementation "moderately feasible" or "very feasible" at all monthly assessments. The mean score for acceptance of the screening among PCPs was 4.2 ± 0.6 ("good"). Most PCPs (90%) assessed acceptability as "good" or "very good" (Table 4). Table 4 Implementation degree of the recommendations among the primary care physicians randomized to the intervention group   Month 1 N = 30 Month 2 N = 30 Month 3 N = 30 Month 4 N = 30 Month 5 N = 30 Month 6 N = 29 Adherence, n (%)              Very frequently/ Frequently 12 (40.0) 13 (43.3) 18 (60.0) 16 (53.3) 15 (50.0) 15 (51.7)  Occasionally 11 (36.7) 9 (30.0) 5 (16.7) 10 (33.3) 10 (33.3) 9 (31.0)  Rarely/very rarely/Never 7 (23.3) 8 (26.7) 7 (23.3) 4 (13.3) 5 (16.7) 5 (17.2) Feasibility, n (%)              Very feasible 4 (13.3) 6 (20.0) 9 (30.0) 9 (30.0) 9 (30.0) 8 (27.6)  Moderately feasible 23 (76.7) 19 (63.3) 17 (56.7) 18 (60.0) 17 (56.7) 18 (62.1)  Of little feasibility/ Unfeasible 3 (10.0) 5 (16.7) 4 (13.3) 3 (10.0) 4 (13.3) 3 (10.3) Acceptance, n (%)              Very good/Good 27 (90.0) 26 (86.7) 27 (90.0) 27 (90.0) 27 (90.0) 26 (89.7)  Barely acceptable 2 (6.7) 3 (10.0) 2 (6.7) 3 (10.0) 3 (10.0) 3 (10.3)  Poor/Very poor 1 (3.3) 1 (3.3) 1 (3.3) 0 0 0 BODY.RESULTS.DEPRESSION OUTCOMES: No significant differences were found between patients in the intervention and control groups for severity of depression (CGI-S), functional impairment (SDS), mean duration of the episode, or mean days on sick leave. Overall, patients had a mean (SD) CGI-S score of 4.1 ± 0.81 and a mean (SD) SDS score of 18.3 ± 6.0, corresponding to a moderate degree of depression and functional impairment. The mean (SD) duration of the current MDD episode was 408 ± 1288 days; 12% of patients were on sick leave due to depression, with a mean (SD) of 159 ± 477 days. BODY.RESULTS.REASONS FOR CONSULTATION: The most frequent reason for consultation in patients with a non-recognized MDD episode was somatic-physical symptoms (107/198 patients, 54%). In contrast, it was emotional-affective symptoms (136/278 patients, 49%) in patients with a recognized MDD episode. Consultation for somatic symptoms was associated with lower recognition rates (OR [95% CI]: 0.58 [0.37-0.90], p < 0.016 vs. no somatic symptoms), while consultation for emotional symptoms was associated with a higher recognition rate (OR [95% CI]: 2.74 [1.59-4.72], p < 0.001 vs. no emotional symptoms). BODY.DISCUSSION.SUMMARY OF MAIN FINDINGS: Contrary to our hypothesis, we did not find significant differences for the underrecognition rate of MDD between patients treated by PCPs who followed guidelines for screening and those treated by PCPs who did not. Although the guidelines found high acceptance among PCPs in the intervention group, adherence to them was suboptimal. Our results also failed to show a significant difference between the study groups regarding depression undertreatment. BODY.DISCUSSION.COMPARISON WITH EXISTING LITERATURE: We did not find a statistically significant difference of MDD underrecognition rates between study groups. This negative result contrasts somewhat with the efficacy of screening guidelines reported in controlled clinical trials [7,8,15]. The failure to detect differences in the secondary outcome of depression undertreatment is, nevertheless, consistent with prior reports that point to the ineffectiveness of screening alone to resolve this issue in PC [14,16]. With regard to underrecognition of depression, a study done by Caballero et al. [26] carried out in PC setting in Spain, that used a similar design to our study, reported that 54% of PC patients with MDD in Spain remain unrecognized. However, in our study we found that only 41% of control group patients remained unrecognized. This may have contributed to reduce between-group differences in this study. Adherence to the screening among the PCPs in the intervention group was suboptimal: only about half of them used the screening in their practice frequently or very frequently during the study. In contrast, 90% of PCPs considered that its acceptance was good or very good. Our adherence data are better than the results reported by Harrinson et al. [17], however, worse than Kirkaldy et al. [18]. A study conducted by Harrison et al. [17] in primary care centers through the United States showed that, despite the recommendations raised by the USPSTF, only the 2.3% of the physicians performed the screening for depression. Kirkaldy et al. evaluated the screening program implemented in a medical center for one month and found that the 97% of PCPs performed the screening [18]. Our results on acceptance and adherence suggest that many PCPs were willing to implement the screening recommendations but were unable to do that frequently. PCPs in our study setting have a very short consultation time with each patient, they have no support staff for depression care and are not audited and paid for screening [19]. Besides, PCPs have other conflicting clinical priorities [19,28]. These factors may prevent physicians from establishing new systems, even if acceptable and feasible [29]. The suboptimal adherence found in our study is in accordance with a previous study where PCPs had a positive view of the NICE guideline for depression, but its impact was compromised by resource and practitioner barriers to implementation [30]. The degree of implementation of new interventions into routine clinical practice is markedly influenced by contextual factors in the setting where they have to be applied [31].In order to improve the quality care for depression, organizational barriers to the implementation of a depression guideline, in the complex realities of PC, is a significant factor to take into account. In that sense, it should be mentioned that collaborative care in primary care has shown effectiveness in the management of depression [32,33]. However, this is a multi-component approach which requires the involvement of additional staff like nurses. Currently, it is not a usual practice for the management of depression in Spain [33]. The aim of this study was to test the implementation of a specific recommendation regarding depression screening in the current everyday reality of the primary care setting in Spain. The present study was based on the 2002 USPSTF recommendations [7,13]. These recommendations are in accordance with EU guidelines that are known and used in Spain [5], and with Canadian guidelines [5,6]. However, we chose the USPSTF guidelines because they were more detailed and had more information regarding their implementation. The version issued in 2002 recommended screening only in those cases where the patient could have adequate follow-up and treatment in case depression was recognized. The 2009 recommendations are more restrictive and specify that the screening should not be applied unless there is support from additional staff to provide depression care [8]. PCPs in our study lack additional staff, and as previously discussed, this could in part explain the suboptimal implementation of the recommendations by some PCPs randomized to the intervention group, and therefore the study results. Consistent with early research, somatic symptoms were a frequent reason for consultation and were associated with underdiagnosis of depression [34]. This finding supports the additional vigilance in patients with somatic symptoms. Also, PCPs should be aware that, in patients with medical illnesses, an interview focussed on the affective and cognitive symptoms of depression could be helpful and easier to apply [35]. Finally, psychiatric comorbidities and inability to work were associated with recognition. Maybe these conditions can sound an alarm to the PCP, so he/she is more driven to look for other diagnosis. BODY.DISCUSSION.STRENGTHS AND LIMITATIONS OF THE STUDY: Because of the pragmatic, cluster-randomized design, this study allowed to assess the effectiveness rather than the efficacy (under controlled conditions) of depression screening. This may be construed as a strength because the evidence obtained under everyday practice conditions serves as a basis for decisions about healthcare policies [36]. To evaluate the recognition of the depression episode, the participating PCPs reviewed the patients' medical records themselves, so this may have introduced a collection bias, so a possible deflation of underrecognition rates cannot be ruled out. However, this procedure was done in both study groups. The use of an independent evaluator would have been optimal. However, this option was ruled out after the evaluation of the pros and cons, taking into account the difficulties of its implementation in the 69 participating centres. There was not any specific time-frame for the revision of the medical record. This adds complexity to the collection of information and could be considered a limitation. However, it allows the capture of current episodes of long duration. Feasibility, acceptance and adherence to the screening of depression were reported by PCPs themselves which adds a recall bias and a social desirability bias into the results, so an overestimation cannot be ruled out. It should be mentioned, that for a small percentage of patients, the study visit was the first contact with the participating PCP, so this may have contributed to the reported underrecognition rates of depression. However, the percentage was balanced between both groups and the inclusion of these patients reflects more precisely the clinical reality of PC. The study was powered to find a difference between groups of 15% or greater; smaller differences, that could be considered clinically relevant by some clinicians, were therefore undetectable. This aspect should be taken into account for future research, especially in pragmatic trials were differences may be smaller than in controlled trials. The focus on high-risk patients, based on USPSTF 2002 recommendations, would have contributed to undermine the chances of showing an effect of the intervention, since the recognition of depression in this group could be higher than among all adults. The intervention was provider-dependent, that is, the PCPs had to do the screening. Support from nursing staff might have had a greater chance of yielding positive results. It could be suggested that screening may hardly be effective in depression because of its episodic nature. Nevertheless, we do not consider this as an explanation for our results, because most patients had been suffering from depression for several months and had consulted their PCP several times. BODY.CONCLUSIONS: This pragmatic randomized trial was not able to show that depression screening under everyday clinical practice in the primary health care setting was effective. The negative results in reducing the underrecognition of MDD in PC may be explained by the poor adherence of the PCPs to the guidelines. Our results reflect the difficulties of putting into practice the clinical guidelines based on controlled clinical studies, into everyday clinical practice. To improve the detection, treatment, and outcomes of MDD, we need to develop and evaluate strategies adapted to the settings where they have to be implemented. BODY.COMPETING INTERESTS: Irene Romera MD, Sireesha Pamulapati, Belen Yruretagoyena PhD and Inmaculada Gilaberte MD PhD are Eli Lilly employees. BODY.AUTHORS’ CONTRIBUTIONS: All authors have collaborated on the design of this study and on the interpretation of the data. Dr. Irene Romera has written the first draft of this article and all authors have contributed to its critical review and approved the final version of the manuscript. BODY.PRIOR PRESENTATIONS: This study has not been presented previously. BODY.PRE-PUBLICATION HISTORY: The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-244X/13/83/prepub

TITLE: Drug-Coated Balloon vs Standard Percutaneous Transluminal Angioplasty for the Treatment of Atherosclerotic Lesions in the Superficial Femoral and Proximal Popliteal Arteries: One-Year Results of the MDT-2113 SFA Japan Randomized Trial ABSTRACT: Purpose: To assess the safety and effectiveness of the MDT-2113 (IN.PACT Admiral) drug-coated balloon (DCB) for the treatment of de novo and native artery restenotic lesions in the superficial femoral and proximal popliteal arteries vs percutaneous transluminal angioplasty (PTA) with an uncoated balloon in a Japanese cohort. Methods: MDT-2113 SFA Japan (ClinicalTrials.gov identifier NCT01947478) is an independently adjudicated, prospective, randomized, single-blinded trial that randomized (2:1) 100 patients (mean age 73.6±7.0 years; 76 men) from 11 Japanese centers to treatment with DCB (n=68) or PTA (n=32). Baseline characteristics were similar between the groups, including mean lesion length (9.15±5.85 and 8.89±6.01 cm for the DCB and PTA groups, respectively). The primary effectiveness outcome was primary patency at 12 months, defined as freedom from clinically-driven target lesion revascularization (CD-TLR) and freedom from restenosis as determined by duplex ultrasonography. The safety endpoint was a composite of 30-day device- and procedure-related death and target limb major amputation and clinically-driven target vessel revascularization within 12 months. Results: Patients treated with DCBs exhibited superior 12-month primary patency (89%) compared to patients treated with PTA (48%, p<0.001). The 12-month CD-TLR rate was 3% for DCB vs 19% for PTA (p=0.012). There were no device- or procedure-related deaths, major amputations, or thromboses in either group. Quality-of-life measures showed sustained improvement from baseline to 12 months in both groups. Conclusion: Results from the MDT-2113 SFA Japan trial showed superior treatment effect for DCB vs PTA, with excellent patency and low CD-TLR rates. These results are consistent with other IN.PACT SFA DCB trials and demonstrate the safety and effectiveness of this DCB for the treatment of femoropopliteal lesions in this Japanese cohort. BODY.INTRODUCTION: Treatment guidelines for femoropopliteal lesions have been updated significantly in the past decade because of improved outcomes associated with the use of novel endovascular devices, particularly nitinol stents. Self-expanding nitinol stents have shown superior efficacy over standard percutaneous transluminal angioplasty (PTA) in the superficial femoral artery (SFA) and/or proximal popliteal artery (PPA).1–4 Randomized trials have demonstrated superiority of primary stenting with bare nitinol stents over PTA, with 1-year patency rates ranging from 63% to 81%.1–3 Similarly, advances in drug elution technology have proven that drug-eluting stents (DES) are better than PTA in this challenging vessel segment.4 Positive results have been reported with DES in a large cohort of Japanese patients.5 Despite the sustained benefits of stents, therapeutic success has been shown to correlate with underlying disease and lesion complexity, including lesion length, chronic total occlusions, and calcification.6,7 Moreover, even with newer stent designs concerns still remain regarding how best to treat in-stent restenosis and late stent-related adverse events, including stent fracture.8–10 Given these challenges, an effective "leave nothing behind" treatment strategy that circumvents the use of metallic implants while preserving future therapeutic options is attractive. In recent years, the use of drug-coated balloons (DCB) in femoropopliteal lesions has become widespread. To date, randomized clinical trials have demonstrated superior patency with DCBs compared to PTA11–16; however, these studies were limited to patients with short and intermediate lesions defined as TransAtlantic Inter-Society Consensus (TASC) A or B lesions, for which guidelines recommend an endovascular approach as first-line therapy.17 Initial results from single-center experiences and small randomized trials demonstrating a reduction in restenosis rates and the need for reinterventions with DCBs compared with standard PTA12,18–20 have paved the way for larger randomized studies. The IN.PACT SFA trial reported superior primary patency and a reduction in CD-TLR with DCB vs PTA at 12 months11 and more recently demonstrated sustained benefit with the DCB at 24 months.21 The evidence base showing positive treatment outcomes with DCB is founded almost exclusively on Caucasian patients in European and American populations. Pathophysiological differences in the presentation of PAD have been reported between ethnic groups,22,23 which may adversely impact response to treatment. A recent subanalysis of the Zilver PTX registry reported no ethnic differences in the performance of DES in Japanese patients.24 In the present trial, the efficacy and safety of the MDT-2113 DCB vs conventional PTA in patients with TASC A, B, and C lesions was evaluated in a Japanese population. BODY.METHODS.STUDY DESIGN: MDT-2113 SFA Japan is a prospective, multicenter, randomized, single-blinded, phase III trial aimed at evaluating the safety and efficacy of the MDT-2113 device (IN.PACT Admiral; Medtronic, Santa Rosa, CA, USA) compared with standard PTA in Japanese patients with symptomatic de novo or native vessel restenotic lesions in the SFA/PPA. The trial was designed to be part of a series including IN.PACT SFA I (conducted in Europe) and IN.PACT SFA II (conducted in the United States), collectively known as the IN.PACT SFA trial. Although not independently powered, the MDT-2113 SFA Japan trial, with a planned enrollment of 100 subjects and a design identical to the IN.PACT SFA trial,11,21 was intended to demonstrate consistent effectiveness and safety outcomes for a Japanese cohort compared to other measured geographies in the IN.PACT SFA trial. The MDT-2113 SFA Japan trial was registered on the National Institutes of Health website (ClinicalTrials.gov identifier NCT01947478). The trial included independent oversight by a Data Safety Monitoring Board and Clinical Events Committee (CEC), which reviewed and adjudicated all major adverse events through 12 months postintervention. Independent ultrasound (VasCore; Massachusetts General Hospital, Boston, MA, USA) and angiography (SynvaCor, Springfield, IL, USA) core laboratories analyzed procedure and follow-up images. The independent core laboratories and CEC were blinded and remain blinded to the treatment assignments through the 36-month follow-up duration. The trial was conducted in accordance with the Declaration of Helsinki, good clinical practice guidelines, and applicable laws as specified by all relevant government authorities. Prior to enrollment, written informed consent was obtained from all patients according to the protocols approved by the institutional review boards at each of the 11 investigational sites. BODY.METHODS.INCLUSION/EXCLUSION CRITERIA: Patients between the ages of 20 and 85 years with symptoms of claudication and/or ischemic rest pain (Rutherford category 2–4) were eligible for inclusion in the trial if they had a 70% to 99% stenosis measuring between 4 and 20 cm or occlusions ≤10 cm long in the SFA and/or PPA. The lesions ranged in complexity from TASC A to C. BODY.METHODS.PATIENT ENROLLMENT AND RANDOMIZATION: One hundred patients (mean age 73.6±7.0; 76 men) were enrolled at 11 centers in Japan. Patient flow through the 12-month follow-up is described in Figure 1. Patients were randomly assigned in a 2:1 ratio to treatment with DCB (n=68) or PTA (n=32) during the procedure providing all eligibility criteria were met, including successful predilation. Figure 1.One hundred patients enrolled in the MDT-2113 SFA Japan trial were randomized in a 2:1 ratio to treatment with DCB or standard PTA. Deaths, lost to follow-up, visits not completed, and withdrawals through 1 year are shown. DCB, drug-coated balloon; PTA, percutaneous transluminal angioplasty. BODY.METHODS.STUDY DEVICE: Patients randomized to the test arm were treated with the single-inflation MDT-2113 DCB (IN.PACT Admiral), which is coated with paclitaxel, an antiproliferative agent, at a dose of 3.5 μg/mm2 in a urea excipient. Multiple balloon diameters (4, 5, 6, and 7 mm) and lengths (20, 40, 60, 80, and 120 mm) were available in the study (the 7-mm diameter device was not available in the 120-mm length). To avoid geographic miss, DCB length was chosen to exceed the target lesion length by 10 mm at the proximal and distal edges. If treatment required multiple balloons, a 10-mm overlap was applied for contiguous balloon inflations. BODY.METHODS.TREATMENT AND MEDICAL THERAPY: Premedication included aspirin (minimum of 81 mg daily for at least 5 consecutive days prior to the procedure) and clopidogrel (according to the manufacturer's instructions for use). Heparin was administered at the time of the procedure to maintain an activated clotting time of 250 seconds. A minimum balloon inflation time of 180 seconds was required for both the test and control (uncoated balloon) groups. Postdilation with a standard PTA balloon was allowed at the discretion of the operator. In both treatment groups, provisional stenting was allowed only in case of residual stenosis ≥50% or major (≥grade D) flow-limiting dissection confirmed by a peak translesion gradient >10 mm Hg despite repeated and prolonged PTA inflations. In both arms, postprocedure medical therapy included aspirin (minimum 81 mg/d for a minimum of 6 months) and clopidogrel daily for a minimum of 1 month for nonstented patients and 3 months for patients who received stents. BODY.METHODS.FOLLOW-UP: For primary endpoint reporting, patients were followed by the treating physician at 30 days, 6 months, and 12 months, including office visits with duplex ultrasound, functional testing, and adverse event assessment. Reinterventions, if required within 12 months of the procedure, were performed according to standard practice using PTA balloons and provisional stenting. BODY.METHODS.STUDY OUTCOME MEASURES: The primary efficacy outcome was primary patency at 12 months following the index procedure, defined as freedom from clinically-driven target lesion revascularization (CD-TLR) and freedom from restenosis as determined by duplex-derived peak systolic velocity ratio (PSVR) ≤2.4.25 Each component of the endpoint was independently adjudicated by the blinded CEC (for CD-TLR) or by the core laboratories (for restenosis). CD-TLR was defined as reintervention at the target lesion due to symptoms or decrease in ankle-brachial index (ABI) ≥20% or >0.15 compared with the postprocedure ABI. The primary safety outcome was a composite of freedom from 30-day device- and procedure-related death and freedom from target limb major amputation and clinically-driven target vessel revascularization (CD-TVR) through 12 months. The secondary endpoints included major adverse events (MAEs) defined as death from any cause, CD-TVR, major target limb amputation, and thrombosis at the target lesion site at 12 months. Thrombosis was defined as a rapidly evolving total thrombotic occlusion with sudden onset of symptoms and documented by duplex and/or angiography. Additional assessments at 12 months included individual components of the MAE composite endpoint; binary restenosis (PSVR >2.4) of the target lesion; sustained primary clinical improvement (defined as no target limb amputation or TVR and an improvement shift of 1 Rutherford category at 12 months); device success; procedure success; and clinical success. Functional assessments included general appraisal through administration of the EuroQOL (EQ-5D), a 5-dimension generic health status questionnaire,26 a 6-minute walking test,27 and specific evaluation of walking capacity using the Walking Impairment Questionnaire (WIQ).28 Additionally, data on intravascular ultrasound (IVUS) usage were analyzed. BODY.METHODS.STATISTICAL ANALYSIS: All analyses were based on the intent-to-treat principle. For baseline characteristics, continuous variables were described as mean ± standard deviation and were compared using t tests; dichotomous and categorical variables were described as counts and proportions and were compared with the Fisher exact test or Cochran-Mantel-Haenszel test, respectively. A 2-sample Z-test was used to compare 12-month primary patency between the 2 groups. In addition, the Kaplan-Meier method was used to evaluate time-to-event data for primary patency and CD-TLR over the 12-month follow-up period. The difference in the survival curves between groups was assessed using the log-rank test. For all endpoints, the level of statistical significance was set at p<0.05 with no correction for multiple comparisons. Statistical analyses were performed using SAS software (version 9.4; SAS Institute, Cary, NC, USA). BODY.RESULTS.BASELINE AND PROCEDURE CHARACTERISTICS: The treatment groups were well matched at baseline with similar demographics, comorbidities, and lesion characteristics (Tables 1 and 2). The mean lesion length was 9.15±5.85 cm in the DCB group vs 8.89±6.01 cm in the PTA group (p=0.838); 11 (16%) of 68 DCB-treated lesions and 5 (16%) of 32 PTA-treated lesions were occlusions. Percent diameter stenosis was 80.2%±14.1% and 80.7%±12.5% (p=0.861) for DCB and PTA, respectively. The provisional stent rate was low and similar between groups (4% DCB vs 3% PTA, p=0.759). During the index procedure, IVUS was used in 27 (40%) DCB cases and 28 (5%) PTA patients to optimize vessel size (Table 2). Table 1. Baseline Patient and Lesion Characteristics. a Characteristics DCB (n=68) PTA (n=32) p Age, y 73.3±7.4 74.2±6.1 0.539 Men 50/68 (74) 26/32 (81) 0.461 Obesity (BMI ≥30 kg/m²) 3/68 (4) 0/32 (0) 0.549 Diabetes mellitus 40/68 (59) 18/32 (56) 0.831  Insulin dependent 10/68 (15) 6/32 (19) 0.771 Current smoker 18/68 (26) 10/32 (31) 0.639 Carotid artery disease 12/65 (18) 5/31 (16) >0.999 Coronary heart disease 34/68 (50) 16/32 (50) >0.999 Renal Insufficiency 6/68 (9) 4/32 (13) 0.722 Previous peripheral revascularization 39/68 (57) 19/32 (59) >0.999 BTK involvement 23/68 (34) 11/32 (34) >0.999 Previous limb amputation 1/68 (1) 0/32 (0) >0.999 ABI/TBI 0.76±0.15 0.74±0.17 0.384 Rutherford category  2 37/68 (54) 19/32 (59) 0.623  3 28/68 (41) 12/32 (38)  4 3/68 (4) 1/32 (3) Angiographic characteristics  De novo b 62/68 (91) 32/32 (100) 0.085  Restenotic (nonstented) b 6/68 (9) 0/32 (0) Proximal popliteal involvement c 1/68 (1) 1/32 (3) 0.540 Severe calcification c 5/68 (7) 3/32 (9) 0.708 Lesion length, cm c , d 9.15±5.85 8.89±6.01 0.838 Total occlusions c 11/68 (16) 5/32 (16) >0.999 TASC II classification c 0.852  A 39/68 (57) 18/32 (56)  B 16/68 (23) 7/32 (22)  C 13/68 (19) 7/32 (22) RVD, mm c 4.84±0.75 4.68±0.66 0.280 MLD, mm c 0.97±0.73 0.90±0.59 0.610 Diameter stenosis, % c 80.2±14.1 80.7±12.5 0.861 Abbreviations: ABI, ankle-brachial index; BMI, body mass index; DCB, drug-coated balloon; MLD: mean lesion diameter; PTA, percutaneous transluminal angioplasty; RVD, reference vessel diameter; TASC, TransAtlantic Inter-Society Consensus II; TBI, toe-brachial index. a Continuous data are presented as the means ± standard deviation; categorical data are given as the count/sample (percentage). b Site-reported. c Per lesion assessment reported by the core laboratory. d Normal-to-normal by core laboratory quantitative vascular analysis. Table 2. Procedure Characteristics. a Characteristics DCB (n=68) PTA (n=32) p Predilation b 68/68 (100) 32/32 (100) >0.999 Postdilation b 16/68 (24) 6/32 (19) 0.796 Provisional stenting b 3/68 (4) 1/32 (3) 0.759 Index procedure IVUS use 27/68 (40) 8/32 (25) 0.181 DCBs per subject b 1.4±0.5 1.1±0.2 <0.001 Dissection  None 18/68 (26) 9/32 (28) 0.235  A-C 50/68 (74) 23/32 (72)  D-F 0/68 (0) 0/32 (0) Hospitalization, d b 2.0±1.0 2.1±1.2 0.778 Lesion length treated, cm c 13.4±5.1 13.7±5.6 0.800 Device success 97/97 (100) 33/34 (97) 0.260 Procedure success 66/68 (97) 32/32 (100) >0.999 Clinical success 66/68 (97) 32/32 (100) >0.999 Abbreviations: DCB, drug-coated balloon; IVUS, intravascular ultrasound; PTA, percutaneous transluminal angioplasty. a Continuous data are presented as the means ± standard deviation; categorical data are given as the count/sample (percentage). b Site-reported. c Per lesion assessment reported by the core laboratory. BODY.RESULTS.EFFICACY OUTCOMES: Procedure success, defined as residual diameter stenosis ≤50% for nonstented patients or ≤30% for stented patients, was achieved in 97% of subjects in the DCB group and 100% of patients in the PTA group (p>0.99). The primary patency rate at 12 months was significantly higher with DCB than PTA (89% vs 48%, p<0.001; Table 3). The Kaplan-Meier estimate of primary patency was 93.9% for DCB compared to 46.9% for PTA (p<0.001; Figure 2A). An ad hoc evaluation of patency by IVUS use during the index procedure showed that in patients whose vessels were viewed by IVUS outperformed non-IVUS studied counterparts. In the DCB group, patency was 96% for IVUS use vs 85% for no-IVUS use, while in the PTA group, patency was 71% vs 42% for IVUS vs no-IVUS use, respectively. Table 3. Key Efficacy and Safety Outcomes at 12 Months. Outcome DCB a PTA a Difference, % b p Primary patency c 58/65 (89) 15/31 (48) 38 [19, 57] <0.001  By IVUS use during index procedure — —   Yes 25/26 (96) 5/7 (71) — —   No 33/39 (85) 10/24 (42) — — 12-Month efficacy outcomes  Binary restenosis d 6/64 (9) 10/25 (40) — 0.002  All TLR e 2/68 (3) 6/32 (19) −16 [−32, −4] 0.012  CD-TLR f 2/68 (3) 6/32 (19) — 0.012  By IVUS use during index procedure    Yes 1/27 (4) 1/8 (13)    No 1/41 (2) 5/24 (21)  CD-TVR 3/68 (4) 6/32 (19) — 0.028   By IVUS use during index procedure    Yes 1/27 (4) 1/8 (13)    No 2/41 (5) 5/24 (21)  Sustained primary clinical improvement g 61/65 (94) 22/31 (71) — 0.004   By IVUS use during index procedure    Yes 25/26 (96) 6/7 (86)    No 36/39 (92) 16/24 (67)  ABI/TBI 0.93±0.12 (68) 0.92±0.14 (32) — 0.722 12-month safety outcomes  Primary safety composite h 65/68 (96) 26/32 (81) 14 [2, 31] 0.028  30-day device- and procedure-related death 0/68 (0) 0/32 (0) —  Target limb major amputation 0/68 (0) 0/32 (0) —  All-cause death 0/68 (0) 0/32 (0) —  Thrombosis 0/68 (0) 0/32 (0) — Abbreviations: ABI, ankle-brachial index; CD-TLR, clinically-driven target lesion revascularization; CD-TVR, clinically-driven target vessel revascularization; DCB, drug-coated balloon; IVUS, intravascular ultrasound; PTA, percutaneous transluminal angioplasty; TBI, toe-brachial index; TLR, target lesion revascularization; TVR, target vessel revascularization. a Continuous data are presented as the means ± standard deviation (sample); categorical data are given as the count/sample (percentage). b Difference is presented with the 95% confidence interval in brackets. c Defined as freedom from CD-TLR and freedom from restenosis as determined by duplex ultrasound peak systolic velocity ratio (PSVR) ≤2.4. d Defined as duplex restenosis (PSVR >2.4) of the target lesion at 12 months or at the time of reintervention. e Includes clinically-driven and incidental or duplex-driven TLR. f Defined as any reintervention within the target vessel due to symptoms or drop in ABI/TBI ≥20% or >0.15 compared with postprocedure ABI/TBI. g Defined as no target limb amputation or TVR and an increase in Rutherford class at 12 months postprocedure. h Defined as no 30-day device- and procedure-related death, target limb major amputation, or CD-TVR through 12 months. Figure 2.Kaplan-Meier estimates of (A) primary patency and (B) clinically-driven target lesion revascularization (TLR) at 12 months. Bars represent the 95% confidence intervals. DCB, drug-coated balloon; PTA, percutaneous transluminal angioplasty Number at risk represents the number of evaluable subjects at the beginning of the 30-day window prior to each follow-up interval. DCB-treated patients demonstrated significantly lower CD-TLR rates at 12 months (3% vs 19%, p=0.012) compared with patients treated with PTA (Figure 2B, Table 3). Significantly higher sustained primary clinical improvement was observed in the DCB group compared with PTA (94% vs 71%, p=0.004). BODY.RESULTS.SAFETY OUTCOMES: Safety outcomes through 12 months are reported in Table 3. The primary safety composite endpoint of freedom from 30-day device- and procedure-related death and 12-month target limb major amputation and CD-TVR was 96% in the DCB group vs 81% in the PTA group (p=0.028). There were no procedure- or device-related deaths, major amputations, thromboses, or all cause deaths through 12 months in either group. BODY.RESULTS.FUNCTIONAL OUTCOMES: At 12 months, both treatment groups showed similar improvement from baseline in all functional outcomes assessed, including the quality of life assessment by EQ-5D index, WIQ, and 6-minute walk test. The mean change in the EQ-5D index from baseline to 12 months was 0.081±0.149 for DCB vs 0.095±0.157 for PTA (p=0.705). Using the 6-minute walk test, the distance traveled at baseline was similar between groups (350.4±97 m for DCB vs 354.5±71.9 m for PTA; p=0.825). At 12 months, both groups showed similar improvement in walking distance (23.7±37.8 m DCB vs 8.8±29.8 m PTA; p=0.156). Despite improvement in functional outcomes in both groups, patients treated with DCB required 77% fewer reinterventions than their PTA-treated counterparts. BODY.DISCUSSION: Several randomized trials have shown superior benefit with DCB over PTA in patients with femoropopliteal disease.12,14–16,18–20 These reports indicate higher patency rates for DCB in comparison with uncoated balloons. Although these studies provide valuable insights into the benefits of DCB, the patients studied have been exclusively Caucasian, European, and American populations. To date, this is the first randomized trial evaluating DCB in a specific cohort of Japanese patients undergoing treatment for symptomatic femoropopliteal disease. Japanese patients in the phase III MDT-2113 SFA Japan trial had significantly greater primary patency and fewer reinterventions of the target lesion at 12 months compared to those treated with an uncoated balloon. In terms of safety outcomes, no difference was observed between the groups in the incidence of death, limb amputation, or transition to surgical treatment within 30 days or at 12 months. The MDT-2113 SFA Japan trial was modeled after the randomized IN.PACT SFA trial in terms of design, DCB device evaluated, and outcomes assessed. At 12 months, Kaplan-Meier estimates in the IN.PACT SFA trial11,21 were 87.5% for patency rate and 2.4% for CD-TLR, which were quite similar to the 89% and 3% rates, respectively, from the present study. There were important differences between the MDT-2113 SFA Japan cohort and patient groups from other similarly conducted studies. Japanese patients were on average older at the time of the procedure. The average age was 74 years in this cohort vs ~68 years in the IN.PACT SFA11 and LEVANT II13 randomized trials but identical (73.5 years) to the Japanese study population in the Zilver PTX registry.5 The proportion of patients with diabetes was also higher [59% (DCB) and 56% (PTA)] in comparison with the 40% to 49% enrolled in other studies.11,13 The present trial planned to enroll patients with lesions of up to 20 cm in length. The 9-cm mean lesion length for the DCB arm was similar to lengths in the IN.PACT SFA DCB group (9 cm) but longer than lesions in the LEVANT II (6 cm) and Zilver PTX DES (7 cm)4 trials. Despite longer lesions and a sicker patient population in this study, outcomes were still favorable for DCB, while those treated with PTA were relatively poor. In our trial, the provisional stent rate was very low despite the presence of longer lesions. Possible explanations for this low rate include optimal PTA technique, the use of IVUS, and exclusion of severe calcification per the study protocol, which likely limited the occurrence of severe dissections that may require stent use. In general, procedures for achieving optimal PTA at medical centers have changed in recent years. For one, the use of prolonged balloon inflations may have contributed to the low provisional stent rate we observed. Also, in recent years, IVUS has been incorporated in many institutions in Japan for endovascular procedures. IVUS was not mandated by the study protocol; its use was at the discretion of the implanting physician and per institutional practice. In the present study IVUS was used in 40% of DCB vs 25% of PTA patients, which allowed detailed assessment of vessel diameter and morphology, possibly leading to treatment without an excessive pressure load. Importantly, there was a trend toward improved outcomes in patients whose vessels were evaluated with IVUS before the procedure. Despite smaller numbers, there were marked differences in the PTA group with 12-month patency rates of 71% vs 42% for IVUS use vs no IVUS use, respectively. Additional studies are needed to provide insights regarding this observation. While the MDT-2113 DCB was shown to be superior to PTA in this trial, it is important to note that these results may not be generalizable to other DCBs. Each DCB is unique in terms of the paclitaxel dose (2.0–3.5 μg/mm2) on the balloon, the excipient, and the coating process employed to get the drug on the balloon. Each feature has the potential to influence the dose of paclitaxel delivered to the vessel wall and thus the effectiveness of the treatment. Each technology must be evaluated critically and stand on its own merit. BODY.DISCUSSION.LIMITATIONS: Although this randomized controlled trial was rigorously conducted with blinding and extensive oversight by core laboratories and a CEC, it enrolled only a limited number of patients. However, statistically significant superiority of DCB treatment effect was demonstrated in this small sample size, positively reinforcing the impact of DCBs. The study is restricted to Japanese patients and thus is not generalizable to other patient populations. That said, outcomes were consistent with those reported in other studies, which could demonstrate that the therapeutic effect of DCBs is not affected by racial differences. BODY.CONCLUSION: Results from the MDT-2113 SFA Japan trial showed superior treatment effect with DCB vs PTA, with remarkably high patency and low CD-TLR rates. These results are consistent with other IN.PACT SFA DCB trials and demonstrate the safety and efficacy of this DCB for the treatment of complex femoropopliteal lesions.

TITLE: Pilot randomized controlled trial to evaluate the effect of aquatic and land physical therapy on musculoskeletal dysfunction of sickle cell disease patients ABSTRACT.OBJECTIVE: To compare the effect of aquatic and land-based physiotherapy in reducing musculoskeletal hip and lower back pain and increasing overall physical capabilities of sickle cell disease patients. ABSTRACT.METHODS: Informed written consent was obtained from all volunteers who were submitted to evaluations using different functional scales: Lequesne's Algofunctional Questionnaire and Oswestry Disability Index, trunk and hip range of motion, goniometry, trunk and hip muscle strength assessment using load cell, and surface electromyography of the iliocostalis, long dorsal (longissimus), gluteus maximus, gluteus medius and tensor fasciae latae muscles. Ten patients were randomized into two groups: aquatic physiotherapy with a mean age of 42 years (range: 25–67) and conventional physiotherapy with a mean age of 49 years (range: 43–59). Both groups were submitted to a twelve-week program of two sessions weekly. ABSTRACT.RESULTS: After the intervention, significant improvements were observed regarding the Lequesne index (p-value = 0.0217), Oswestry Disability Index (p-value = 0.0112), range of motion of trunk extension (p-value = 0.0320), trunk flexion muscle strength (p-value = 0.0459), hip extension and abduction muscle strength (p-value = 0.0062 and p-value = 0.0257, respectively). Range of motion of trunk and hip flexion, extension, adduction and abduction, trunk extensor muscle strength and all surface electromyography variables showed no significant statistical difference. ABSTRACT.CONCLUSION: Physical therapy is efficient to treat musculoskeletal dysfunctions in sickle cell disease patients, irrespective of the technique; however, aquatic therapy showed a trend toward improvement in muscle strength. Further studies with a larger patient sample and longer periods of therapy are necessary to confirm these results. BODY.INTRODUCTION: Sickle cell disease (SCD) is a genetic disorder that results in the sickling of red blood cells, triggering vaso-occlusion episodes which lead to pain and organ damage. This inherited disorder is caused by a point mutation in the beta-globin gene. The mutant form of hemoglobin in SCD (Hb S) is capable of polymerization and complex molecular and structural changes within the red cell. Occurring in homozygotes (Hb SS) and in compound heterozygotes, such as those carrying Hb S and beta-thalassemia (Hb SB+ or Hb SB0) and Hb S and hemoglobin C (Hb SC), hemolytic anemia and vaso-occlusion crises are the main complications of SCD. The illness tends to gradually develop toward multisystem organ failure.1 Bone involvement, frequently causing painful vaso-occlusive crises, is the most common clinical manifestation. Furthermore, bone involvement is a source of chronic, progressive disability, with long-term effects upon bone mass density, growth, and bone damage such as avascular necrosis and osteomyelitis. Osteopenia and osteoporosis are often asymptomatic; however, pain, fractures, deformities, and vertebral collapse may occur and require chronic analgesia, mechanical support, and surgical interventions.2,3 Chronic and progressive damage such as, for example, avascular necrosis of the femoral head, the leading cause of hip deformity in these patients, commonly results in gait disturbances, pain, and activity and functional limitations in adult patients. Lower back pain is one of the main complaints among SCD patients and occurs due to the flattening and widening of the vertebral bodies with biconcave depressions of the endplates, probably caused by infarction of the central portion of the vertebral body.4,5 There are few studies in the literature on the role of physiotherapy as a resource to prevent and treat locomotor system disorders in SCD individuals. According to recent studies, the life expectancy of SCD patients' has improved dramatically over the last century.6 However this longer life span has, as an unfortunate consequence, the development of progressive organ damage which includes osteoarticular lesions.7 Chronic pain is considered a serious public health problem which negatively affects the quality of life of individuals. Therefore, a multi-action therapeutic plan, specifically physiotherapy, could help decrease pain, and improve mobility and the rehabilitation of osteoarticular disorders, positively impacting on the quality of life.8 Despite this fact, there are few studies in the literature on the role of physiotherapy as a resource to prevent and treat locomotor system disorders in SCD patients. One study9 compared the efficacy of physiotherapy alone with physiotherapy associated with surgical femur decompression in SCD patients with osteonecrosis of the femoral head. The results showed no significant difference between these two approaches, suggesting that physical therapy alone appeared to be as effective as surgical decompression to improve hip function, thus deferring the need for surgery. Within the existing physiotherapy resources, aquatic physiotherapy used in rehabilitation has demonstrated positive effects against pain, in regaining physical function and in improving quality of life in adults with musculoskeletal conditions.10 Movements performed in the water are facilitated by the elimination of the effects of gravity, resulting in increased muscle strength (MS) and flexibility. The benefits of water are mainly explained by the physiological effects of immersion and by the hydrodynamic principles of exercise, such as buoyancy, in this environment thereby enabling functional exercises with a reduced gravitational load. Furthermore, the immersion in thermo-neutral water (34 °C) in combination with the effects of hydrostatic pressure reduces the perception of pain. The physical properties and heated water play an important role in improving and maintaining the range of joint motions, reducing muscular tension and promoting relaxation, as well as preparing the muscle for stretching. The buoyancy induces muscle relaxation and the decrease in impact enables increased mobility and flexibility.11,12 This study aimed to evaluate the efficacy of aquatic and land-based physical therapy in decreasing hip and lower back musculoskeletal pain and increasing overall physical wellbeing in SCD patients. BODY.METHODS: Adult SCD patients who regularly attended (at least three times a year during the previous three years) the Outpatient Clinic of the Hemocentro of the Universidade Estadual de Campinas (UNICAMP) with chronic hip and lumbar spine pain, and who had not participated in a physical therapy program during the previous 12 months, were invited to participate in this study. Patients with acute episodes, absence of over three physical therapy sessions without justification, or any dermatological issue which would prevent them from entering a therapeutic pool, were excluded from the study. The National Ethics Board approved this study, and all patients provided written informed consent. BODY.METHODS.STUDY DESIGN: Initially, the volunteers were evaluated according to functional scales, including the Lequesne's Algofunctional Questionnaire and Oswestry Disability Index (ODI), range of motion (RoM) measurements of trunk flexion and extension, hip adduction and abduction, assessment of MS of the trunk flexors and extensors, and the flexors, extensors, adductors and abductors of the hip through load cell and surface electromyography (SEMG) of the iliocostalis, long dorsal (longissimus), gluteus maximus, gluteus medius and tensor fasciae latae muscles. Volunteers were then randomized by an investigator not involved in data collection, using the blind allocation method of sequentially numbered, opaque sealed envelopes,13,14 into two different program groups: aquatic physiotherapy (AP) and conventional or land physiotherapy (CP). A total of 24 sessions over a twelve-week period (two sessions per week) were administered. Patients were assessed after the intervention comparing the results before and after the sessions according to data obtained for the dominant side of each patient.15,16 BODY.METHODS.QUESTIONNAIRES: The Lequesne's Algofunctional Questionnaire was developed for patients with osteoarthritis and evaluates symptoms and functional capacity of the hip and knee. This index is composed of 11 questions that evaluate pain, discomfort and function. The ODI is a self-administered questionnaire used to measure the degree of lumbar spine disability, and contains topics concerning intensity of pain and physical activity.17 The ODI has been used in scientific research to evaluate patients with nonspecific or specific low-back pain after surgical procedures, medication and rehabilitation. BODY.METHODS.RANGE OF MOTION: The RoM was evaluated by a single examiner using a conventional 360° free shaft goniometer. The following movements were assessed: trunk flexion and extension and flexion, extension, adduction and abduction of the hip joint, according to the standardization of the goniometry manual of Marques.18 BODY.METHODS.MUSCLE STRENGTH: MS was analyzed by maximal voluntary isometric contraction (MVIC) using a load cell (MIOTEC®, Porto Alegre, Brazil). The load cell was connected to a Miotool 400® apparatus (MIOTEC®) using a SDS1000® sensor connected via a USB cable to a notebook. During movements, the force generated by traction on the load cell was transmitted to the Miograph® software which produces a plot of MS in kilograms-force (kgf). Volunteers were submitted to isometric MS tests of the trunk flexors and extensors and hip flexors, extensors, adductors and abductors. BODY.METHODS.SURFACE ELECTROMYOGRAPHY: Myoelectric signals of the gluteus maximus, gluteus medius, tensor fascia lata, long dorsal (longissimus) and iliocostalis muscles were sampled at 2000 Hz in single differential mode from each muscle through a four channel electromyography system (MIOTEC®, Porto Alegre, Brazil) using disposable Ag/AgCI circular bipolar electrodes (3M®). The 10 mm diameter electrodes with adhesive conducting gel were positioned on the skin overlying the muscles at an inter-electrode distance of 20 mm. Abrasion of the skin was achieved at the fixation sites with gauze soaked in alcohol to reduce impedance and the electrodes were then fixed at the muscular belly, distant from the motor point, and fixed with transparent tape and elastic band wrapping to avoid movement artifacts. The data acquisition Miograph USB® software system with windowing 32 (RMS – Root Mean Square) and gain of 2000 for each channel was used to capture the electrical potentials of the muscles evaluated in microvolts (μV). Butterworth filters were used: order 4 and band pass 20–500 Hz. The four channels were connected to active SDS500® sensors by clamps. Signal analysis was performed using Miograph USB® system software. The sensors were calibrated before data collection. The electrical potentials of the muscles were collected in accordance to international standardization of SENIAM.19 BODY.METHODS.AQUATIC PHYSIOTHERAPY: The 9 m2 pool in a 16 m2 room was warmed to 34 °C; the patients changed their clothes in this temperature-controlled room. Each session consisted of lower limb muscle stretching, jogging in the pool (forward, backward and sideways), suspended bicycle exercises in the vertical position, stair climbing exercises, active exercises in the supine position using floats, and finally relaxation exercises. BODY.METHODS.CONVENTIONAL PHYSIOTHERAPY: Each session consisted of lower limb stretches, hip exercises to strengthen hip adductors and abductors, supine bridge, exercises using ankle-weights to strengthen the quadriceps and when necessary, transcutaneous electrical nerve stimulation was used for pain relief. BODY.METHODS.STATISTICAL ANALYSES: The statistical analysis system (SAS) computer program for Windows (version 9.2) and GraphPad Prism (version 5.00 – Trial) were used for statistical analysis. A p-value of 0.05 or less was considered statistically significant. The following tests were then performed. Fisher's exact test to compare proportions, the Mann–Whitney test to compare numerical measurements between the two groups, ANOVA to compare numerical values over time with repeated measurements with transformation stations and the Wilcoxon test for paired samples before and after the intervention. BODY.RESULTS: The final sample comprised ten volunteers randomized into two groups: AP and CP. Median age was 42 years old (range: 25–67) for the AP group and 49 years old (range: 43–59) for the CP group. The clinical and laboratory data of the participants are shown in Table 1. Comparison of numerical values over time between the two groups showed a statistically significant difference after the intervention in respect to the Lequesne index (p-value = 0.0217), ODI (p-value = 0.0112), RoM of trunk extension (p-value = 0.0320), trunk flexion MS (p-value = 0.0459), and hip extension and abduction MS (p-value = 0.0062 and p-value = 0.0257, respectively). There were no significant statistical differences in the RoM of trunk and hip flexion, extension, adduction and abduction, trunk extensor MS and hip flexion and adduction MS and all SEMG variables (Figures 1–4). BODY.DISCUSSION: The present study aimed to evaluate two types of physiotherapy intervention for hip and lumbar spine functionality of adult SCD patients. The dominant side of each patient was considered in the results.15,16 The major limitation of this study was the recruitment of volunteers, as most of the patients live far from the center and find it very difficult to attend the clinic twice every week. Therefore, only ten patients, six compound heterozygous for Hb S and Hb C and four Hb S homozygotes, completed the physiotherapeutic program. In view of the high frequency of avascular necrosis of the femoral head in SCD patients, the intervention was focused on the hip joint. The Lequesne questionnaire was used to evaluate the functionality of this joint. This scale assesses pain and hip function for daily activities. The results of the Lequesne Algofunctional questionnaire showed a statistically significant improvement after the intervention for both the groups. The AP group had very severe impairment (13.5 points) in the first assessment and moderate impairment (5.5 points) in the second. The CP group also had very severe impairment (11.5 points) in the first assessment and severe impairment (8 points) in the second. These results suggest that aquatic physiotherapy may lead to a greater improvement in hip functionality and are in agreement with Wang et al.20 and Hinman et al.21 who observed improvement in physical function after a program of aquatic physical therapy for patients with hip and knee osteoarthritis. Other studies carried out in individuals with hip and/or knee disorders however, showed no significant differences between the two rehabilitation strategies, suggesting that both techniques are equally effective.22–24 Lower back pain is one of the main complaints of SCD patients. The ODI was herein used to assess lower back pain and function during daily activities. This index also showed statistically significant improvements in both study groups after the intervention. The CP group improved from moderate disability (26.5%) to minimal disability (18%); the AP group, however, despite some significant improvement in the scores of the second assessment (from 35% to 22%) showed no change in the severity of the disability caused by back pain. Longer or more frequent sessions may render better results, as has been described by others.24,25 These studies showed that patients who performed AP two or more times weekly had greater improvement in physical assessment scores than those who exercised only once a week.24,25 Nevertheless, Ariyoshi et al.25 extended the program for six months and concluded that water therapy exercises were useful for patients with back pain as they provide pain relief. In this study, a significant improvement in RoM of the trunk extension and a trend toward an improvement in trunk flexion goniometry were observed in both groups, especially in the AP group. However, no significant change was detected in either group regarding motion amplitude, probably due to the inflammatory phenomena and bone infarctions which may have caused permanent limitations. Furthermore, late interventions may not be sufficient to improve joint RoM in this age group in which chronic degenerative hip injuries may have reached a level of severity that precludes greater joint flexibility. Moreover, the fact that there was no significant improvement in goniometry may be a consequence of the techniques used in both groups which may favor strength gain. Thus, perhaps the program should increase the time devoted to stretching certain target muscles during therapy, thereby promoting improved muscle flexibility. Regarding trunk MS, a significant improvement in flexion was observed in both groups after the interventions. Despite the trend toward improvement in trunk extensor MS in the AP group, there were no significant differences between the two groups. These results are in agreement with other studies that showed improved MS after specific land-based and water-based trunk exercises.24,26,27 There was a statistically significant increase in hip extension and abduction MS in both groups after the interventions. Although, hip flexion MS was unchanged in the CP group, there was a trend toward improvement in the AP group, and hip adduction MS showed a slight trend toward improvement in both groups. Thus, albeit slight, the results of this study showed improvement of all MS variables in the AP group, in accordance with Wang et al.20 who also observed improved flexibility and lower limb strength after 12 weeks of aquatic therapy, and Cochrane et al.28 who observed significant improvement in pain and physical function after aquatic exercises in adults with hip and knee osteoarthritis. In another study, Rahmann29 demonstrated a positive effect of a specific program of aquatic physical therapy on early recovery of strength after hip and knee surgeries. Furthermore, Hinman et al.21 observed a slight improvement in pain, physical function, quality of life and MS after aquatic therapy for patients with hip and knee osteoarthritis in a protocol of two sessions per week for six weeks. However, Jigami23 concluded that both programs, land-based and water-based, even when the exercises were performed only once a week, improved overall physical activity and MS in the lower limbs of osteoarthritis patients. Surface electromyography did not show any significant difference after the interventions of both groups. However, there seemed to be an improvement in the electromyography signal of all muscles evaluated in the AP group. The better result obtained in this group may be related to the greater amount of muscle fibers recruited in aquatic therapy added to the physical properties of water such as buoyancy and multidirectional strength. These findings are in agreement with the results reported by Kaneda et al.30 who observed greater electromyography activity of all muscle movements performed in the water with floating devices. The results of this study should be analyzed with caution as the sample size may have been a limiting factor and therefore, further studies are needed to confirm these results. BODY.CONCLUSION: The results obtained here suggest that physical therapy is a resource capable of treating musculoskeletal dysfunction in SCD patients regardless of the technique used. However, exercises designed to stretch tone and strengthen the core and limb muscles carried out in the water require greater stabilization of the muscles and may justify the trend toward the better results obtained. BODY.FUNDING: This work was supported by the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Fundação de Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). The Hemocentro, UNICAMP, is a part of Instituto Nacional de Ciência e Tecnologia do Sangue, Brazil (INCT do Sangue – CNPq/MCT/FAPESP). BODY.CONFLICTS OF INTEREST: The authors declare no conflicts of interest.

TITLE: Combination of Comfrey Root Extract Plus Methyl Nicotinate in Patients with Conditions of Acute Upper or Low Back Pain: A Multicentre Randomised Controlled Trial ABSTRACT: This randomised, multicentre, double-blind, three-arm, placebo-controlled trial compared a topical combination of 35% comfrey root extract plus 1.2% methyl nicotinate versus a single preparation of methyl nicotinate or placebo cream for relief of acute upper or low back pain. 379 patients were randomly assigned to three groups (combination, n = 163; methyl nicotinate, n = 164; placebo, n = 52). They applied a 12 cm layer of cream three times daily for 5 days. The primary efficacy variable was the area under the curve (AUC) of the visual analogue scale (VAS) on active standardised movement values at visits 1 to 4. Secondary measures included back pain at rest, pressure algometry, consumption of analgesic medication, functional impairment measured with Oswestry Disability Index, and global assessment of response. The AUC of the VAS on active standardised movement was markedly smaller in the combination treatment group than in the methyl nicotinate and in the placebo group (ANOVA: p < 0.0001). The combination demonstrated superiority to the two other treatment arms, while methyl nicotinate displayed a considerable effect as well. Copyright © 2012 John Wiley & Sons, Ltd. BODY: Acute back pain of the upper or low back is a widespread condition that impairs quality of life and functional movement in a large number of people (McCarberg, 2010; Balagué et al., 2012). However, patients seek for pain relief and treat their pain symptoms often in self-medication. There are many potential causes for acute back pain, and precise causation is difficult to determine. As a consequence, the treatment of acute back pain is a complex issue. Recommended topical and systemic pharmacologic treatments for acute low back pain include application of superficial heat, acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs), skeletal muscle relaxants/benzodiazepines, and opioids including tramadol (McCarberg, 2010). The topical pharmacotherapeutic approach has generally included hyperaemising topical drugs such as nicotinates with the intention to soften and relax the contracted muscle area, thereby indirectly alleviating the pain caused by this contraction. In addition to heat or hyperaemia, the treatment strategy has recently been augmented by a direct anti-inflammatory topical approach – for instance with diclofenac. Topical treatments with anti-inflammatory and analgesic properties provide an interesting alternative, taking into account the potential adverse effects of oral therapies (e.g. gastrointestinal and renal side effects of NSAIDs and analgesics). Extracts of comfrey in mono preparations and in combination with methyl nicotinate have a long tradition of use as topical treatment (Englert et al., 2005; Staiger, 2005; Staiger, 2007; European Scientific Cooperative on Phytotherapy (ESCOP), 2009; Staiger, 2012) In clinical studies, the antiphlogistic properties of comfrey extract could be demonstrated in various indications (Petersen et al., 1993; Koll et al., 2004; Predel et al., 2005; D'Anchise et al., 2007; Grube et al., 2007; Giannetti et al., 2010). The efficacy of comfrey root extract ointment was evaluated in a randomised, double-blind, placebo-controlled multicentre study involving 142 patients with a unilateral ankle sprain. Compared to placebo, the superiority of the verum treatment was significant (Koll et al., 2004). The same ointment was compared with a gel preparation containing 1% of diclofenac in a randomised, single-blind multicentre study involving patients with the same condition. The results showed that the comfrey ointment was not inferior to diclofenac gel (Predel et al., 2005). In some variables there was even evidence of superiority of the comfrey ointment (D'Anchise et al., 2007). Another randomised, double-blind, placebo-controlled clinical trial investigated the effect of the same ointment over a 3-week period in 220 patients with painful osteoarthritis of the knee. The superiority (p < 0.001) of the verum group over the placebo group was confirmed. Pain was reduced, mobility of the knee improved, and quality of life increased (Grube et al., 2007). The effect of two concentrations of topical, comfrey-based botanical creams containing a blend of tannic acid and eucalyptus was compared to a eucalyptus reference cream in patients with primary osteoarthritis of the knee. Both active topical comfrey formulations were effective in relieving pain and stiffness and in improving physical functioning and were superior to placebo (Smith and Jacobson, 2011). In the treatment of acute upper or low back pain, a study was conducted as a double-blind, multicentre, randomised clinical trial with parallel group design over a period of 5 days (Giannetti et al., 2010). One-hundred and twenty patients with acute upper or lower back pain were treated three times a day, 4 g per application. They used either a verum cream containing comfrey root fluid extract (1:2, 35.0 g, extraction solvent ethanol 60% (v/v), less than 0.35 ppm of pyrrolizidine alkaloids, Kytta-Salbe® f) or a corresponding placebo. The trial included four visits and was performed at the German Sport University in Cologne (Deutsche Sporthochschule) and three additional ambulatory centres for orthopaedics and sports medicine. The primary efficacy variable was the area under the curve (AUC) of the visual analogue scale (VAS) on active standardised movement values at visits 1 to 4. The pain intensity on VAS was assessed at performance of standardised, muscle group specific tests. The secondary objectives were back pain at rest using assessment by patient on VAS, pressure algometry (pain–time curve; AUC over 5 days), global assessment of efficacy by the patient and the investigator, intake of analgesic medication, and functional impairment measured with the Oswestry Disability Index. The results were clear-cut and consistent across all primary and secondary efficacy variables. Comfrey root extract showed a remarkably potent, fast-acting, and clinically relevant effect in reducing acute back pain. The pain intensity on active standardised movement decreased on average (median) approximately 95.2% in the comfrey extract group (104.8–12.7 mm; mean VAS sum) and 37.8% in the placebo group (100.0–56.5 mm; mean VAS sum) (p < 0,001). Compared with placebo, superiority of the verum treatment was significant with regard to secondary efficacy variables (each p < 0.001). Both the AUC of the reported back pain at rest, the AUC of the pressure algometry in the trigger point, as well as the global assessment of the efficacy by the patients and the investigators showed a clinically relevant effect in reducing acute back pain. For the first time, a fast-acting effect of the ointment (1 h) was also observed. After 1 h, the pain intensity had already decreased about 33.0% in the comfrey group (104.8 to 60.4 mm; mean VAS sum) and 12.0% in the placebo group (100.00 to 86.5; mean VAS sum) indicating an early onset of the treatment effect. Besides creams with the single comfrey root extract, a combination with methyl nicotinate has been used for decades. A non-published pilot study showed a favourable effect of the combination in patients with lumbar spine syndrome. Furthermore, the antiphlogistic and analgetic properties of the drug were evaluated in a post-marketing surveillance study. A total of 167 patients who used the preparation externally for contusions and distortions, muscle and joint pain were documented. The key symptoms were clearly reduced (Klingenburg, 2004). It is therefore justified and reasonable to assume a beneficial effect of the combination of comfrey root extract and methyl nicotinate also in patients suffering from acute back pain such as upper or low back pain and to conduct a GCP-compliant clinical trial to document this assumed efficacy. For acute back pain, the Note for Guidance on Clinical Investigation of Medicinal Products for Treatment of Nociceptive Pain requires a study period of less than 1 week (Committee for Proprietary Medicinal Products, 2002). BODY.METHODS: The study was conducted at six active study centres in Germany. The Ethics Committee of the Ärztekammer Nordrhein, Düsseldorf, Germany, approved the protocol on 14 July 2009. We did not fully comply with the guideline available for the treatment of low back pain, as we included also patients with acute upper back pain into the trial (Devogelaer et al., 2003). However, this trial met most of the criteria mentioned for patients with types 1–2 low back pain. BODY.METHODS.PARTICIPANTS: Main criteria for inclusion were: (i) Age range 18–45 years; (ii) Good general condition; (iii) Written informed consent; (iv) Acute back pain (either upper or low back pain), not in combination; (v) Sensitivity to algometric pressure on the site contralateral to the painful trigger point at least 2.5 N/cm2; (vi) Back pain on active standardised movement of at least 50 mm on a 100 mm VAS; (vii) Basic value of the pressure algometry on the trigger point should not exceed 50% of the respective value of the site contralateral to the painful trigger point. Among the exclusion criteria were: (i) Upper or low back pain that was attributable to any identifiable cause (e.g. disc prolapse, spondylolisthesis, osteomalacia, or inflammatory arthritis); (ii) Any recent trauma; (iii) Any recent strains of the back muscles documented by the clinical evaluation and anamnesis; (iv) Chronic back pain; (v) Likelihood of prolapsed spinal disc documented by clinical symptoms (pain irradiation to peripheral areas, paraesthesia, clinically detectable impairment of muscle strength of related areas); (vi) Back pain caused by metabolic or neurological diseases documented by anamnesis (i.e. toxic neuropathy); (vii) Diabetes mellitus; (viii) Risk factors for spinal infection; (ix) Recent onset of bladder dysfunction or severe or progressive neurological deficit in the low extremity (as a possible indication of prolapsed disk); (x) Concomitant use of any anti-inflammatory drugs, heparinoids, or analgesics including herbal preparations (glucocorticosteroids, NSAIDs, etc.) for the same indication or other indications (e.g. rheumatoid arthritis); (xi) Analgesics or NSAIDs applied by any route of administration within 10 days before study entry or corticoid drugs applied by any route of administration within 60 days before study entry; (xii) Any other concomitant treatment (e.g. cosmetics, ointments on the treated area) or medication that interferes with the conduct of the trial. Patients with depression or other psychiatric disorders were not excluded. The distribution of those patients in the groups is stated in Table 1. Table 1 Demographic, baseline, and other group characteristics (FAS/ITT) Combination Methyl nicotinate Placebo Total (n = 163) (n = 164) (n = 52) (n = 379) Sex male n (%) 82 (50.3) 81 (49.4) 29 (55.8) 192 (50.7) female 81 (49.7) 83 (50.6) 23 (44.2) 187 (49.3) Age (years) Mean 31.29 29.02 28.92 29.98 SD 8.48 8.31 7.70 8.36 Height (cm) Mean 174.15 174.05 174.52 174.16 SD 9.44 9.75 9.02 9.50 Weight (kg) Mean 76.67 72.51 77.83 75.03 SD 17.32 15.21 18.74 16.75 Ethnic origin Caucasian n (%) 163 (100) 163 (99.4) 50 (96.2) 376 (99.2) African - - 1 (1.9) 1 (0.3) Asian - 1 (0.6) - 1 (0.3) Other - - 1 (1.9) 1 (0.3) Known allergies yes n (%) 43 (26.4) 34 (20.7) 9 (17.3) 86 (22.7) no 120 (73.6) 130 (79.3) 43 (82.7) 293 (77.3) Concomitant medication Antidepressants n (%) 2 (1) 2 (1) 0 4 (1) Concomitant diseases Psychiatric disorders n (%) 15 (9) 12 (7) 3 (5.8) 30 (7.9) Mean daily dose of IMP g 10.4 10.27 10.61 10.37 Localisation of back pain n (%) upper 100 (61) 88 (54) 30 (58) 218 (56) low 63 (39) 76 (46) 22 (42) 161 (44) Back pain on standardised movement at baseline, sum of VAS (mm) Mean 164.57 157.73 165.38 - SD 43.62 40.87 43.74 - BODY.METHODS.STUDY DESIGN: The Phase III trial was conducted as a double-blind, multicentre, randomised, placebo-controlled clinical trial with three independent treatment groups (parallel group design). After obtaining written informed consent and after all patient eligibility reviews had been performed, patients were randomised and subsequently treated until Day 5 (fourth day after enrolment). One group of patients received a combination cream containing 35% of comfrey root extract (1:2, extractant 60 v/v%), and 1.2% methyl nicotinate (Kytta-Balsam® f, Merck Selbstmedikation GmbH, Darmstadt, Germany), the second group a cream containing 1.2% methyl nicotinate, and the third a placebo cream. Treatment was started after trial enrolment (visit 1). Patients were seen for evaluation of treatment effects after 1 h (visit 2) and after 3 and 5 days (± 1 day) (visits 3 and 4). For scientific reasons, a parallel-group design was selected as the most suitable and generally accepted method. A double-blind treatment was chosen to avoid bias in the assessment of treatment success, and a randomisation was carried out to avoid a bias of treatment allocation. A placebo concurrent control was used because the aim of the study was to verify the combination's efficacy in patients with acute upper and low back pain. Placebo treatment was justified because the patients to be included in this clinical trial could ethically be treated with paracetamol as rescue medication. The study was to show that combination treatment is superior to single component. Therefore, a methyl nicotinate arm was included. The randomisation ratio 3:3:1 was chosen because placebo was expected to be detectable by some of the patients due to the absence of the visible effects on the skin caused by methyl nicotinate. In order not to treat more patients than absolutely necessary only with placebo, and knowing the possibly limited feasibility of blinding the placebo arm, the placebo group was limited to the minimum number required to form a baseline. This trial design was discussed and agreed in a scientific advisory procedure with the relevant German national authority, Bundesinstitut für Arzneimittel und Medizinprodukte (BfArM). Parties agreed to conduct this trial as a sibling study of the above mentioned back pain trial with comfrey root extract (Giannetti et al., 2010) and to use the most similar design possible. The full concept and the results that can be taken from both trials in combination will be subject to a seperate publication under preparation. With respect to a homogeneous trial population, age range and a lack of clear diagnosis of acute upper or low back pain seemed to be the most important factors causing bias in baseline values. Therefore, only young patients (age 18–45 years) were included as postulated in the inclusion criteria. Moreover, only acute back pain cases were enrolled in order to exclude upper or low back pain that is attributable to any identifiable cause or trauma. BODY.METHODS.INTERVENTIONS: A 12 cm long cream layer (corresponding to about 4 g) was spread onto the area of treatment and distributed by soft massage. A glove must be worn. The cream had to be administered three times a day in intervals of about 8 h and applied for 5 days. To ensure the patients applied the cream every time to the same area of the skin, the investigator marked the treatment area at the edges by means of a water-resistant pen. In order to be able to control the applied amount of cream, patients were supplied with packs of gloves which were equipped with a printed measuring scale. The investigators as well as the patient information instructed the patients to squeeze out a continuous strand of cream to the hand wearing the glove and to compare it to the scale. Moreover, at each visit, the tube weight was measured with standardised weighing machines at the study centres. The tube weight was recorded in the CRF. Values for mean daily cream doses used by the patients are shown in Table 1. Paracetamol tablets were allowed as rescue medication for breakthrough pain (maximum dose 4000 mg per 24 h; single dose: not more than 10–15 mg/kg at minimum intervals of 4–8 h) and had to be documented. BODY.METHODS.OUTCOME MEASURES.EFFICACY VARIABLES: The primary efficacy variable was the AUC of the VAS on active standardised movement values at visits 1 to 4 (at actual measurement times). For the calculation of the primary variable, the sum of the VAS for low back pain and for upper back pain was calculated using the actual measurement times, respectively. The AUC was determined using the cumulative trapezoidal rule. Higher values of the AUC of VAS sum on active standardised movement indicate higher pain. The tests on active standardised movement were performed in a specific manner for each muscle (Lenhart and Seibert, 2001). For M. trapezius (upper part): The patient was sitting on a chair with the investigator standing behind him/her and fixing his/her shoulders. The patient pulled her/his head sideways towards the left of the right shoulder without lifting up the shoulder at the same time and reported the pain sensation. For M. latissimus dorsi, M. teres major: The patient was lying with the front on a table. The arm was adducted and rotated inwards. Palm was showing upward and prevents a rotation outwards. The patient tried to lift the arms upwards away from the table and reported the pain sensation. For M. deltoideus pars spinalis: The patient was lying with the front on a table, and the tested arm is abducted in a right angle with the forearm hanging over the edge of the table. The investigator fixed both the shoulder and the arm to the table surface with a gentle pressure. The patient tried to lift the arm upwards away from the table surface against the gentle resistance of the investigator's arms and reported the pain sensation. For M. erector spinae: The patient was lying with his/her front on a small table. The hips did not lie on the table. With her/his hands, the patient held on to the right and left edges of the table. The patient bended her/his legs to reach a square angle, lifted her/his bottom up towards the horizontal line, and reported the pain sensation. For M. rectus abdominis: The patient was lying on the back, legs extended, arms crossed behind his/her head. Both legs are stretched and lifted up to reach a right angle to the surface the patient is lying on. The spine did have full contact to the surface. The patient slowly lifted down to the surface the stretched legs and reported the pain sensation. Secondary objectives of the study were the investigation of the following variables: Back pain at rest, assessment by patient on VAS, pressure algometry (pain–time curve; AUC over 5 days), Global assessment of efficacy by patient, Global assessment of efficacy by investigator, Functional impairment measured with the Oswestry Disability Index, consumption of analgesic medication. Moreover, the safety was assessed by means of general physical examinations, vital signs, and the occurrence of adverse events (AEs) and serious adverse events (SAEs), respectively. BODY.METHODS.SAMPLE SIZE: The sample size for this study was calculated based on the results of previous trials in particular involving patients with acute back pain. The sample size estimation was carried out by means of the software program Nquery and based on the assumption on a level of significance α = 5%, power 1-β = 80%, two-sided t-test situation, standardised difference (mean difference divided by standard deviation) δ = Δ/SD = 0.40 between the combination comfrey plus methyl nicotinate and single methyl nicotinate. At least 100 evaluable patients per treatment group had to be enrolled in the two active treatment groups. As the BfArM recommended to observe at least 300 patients under methyl nicotinate for safety reasons, it was decided to enrol a total of 350 patients (combination: n = 150, methyl nicotinate: n = 150, placebo: n = 50 using a 3:3:1 allocation ratio). However, a total of 378 patients had to be enrolled, because an approximate drop-out rate of 7% was expected. Each centre had to enrol at least 20 and at most 115 patients. BODY.METHODS.CRITERIA FOR EVALUATION: All randomised patients were assessed in the Full Analysis Set/intention-to-treat (FAS/ITT) population. Moreover, a per protocol analysis (PP) was performed. The PP population included all patients who met the inclusion and exclusion criteria and showed no major protocol violations. The FAS/ITT-evaluation was the primary analysis set in this superiority trial. All patients treated at least one time with one of the study drugs were assessed for safety. BODY.RESULTS: Between January 2010 and May 2011, a total of 379 patients with conditions of acute upper or low back pain were randomly assigned to the double-blind treatment (combination: n = 163, methyl nicotinate: n = 164, placebo: n = 52). For efficacy, all enrolled patients were evaluated as the FAS/ITT population. After exclusion of 17 patients due to major protocol violations, a total of 362 patients (combination: n = 156, methyl nicotinate: n = 156, placebo: n = 50) were evaluated as PP population (Fig. 1). The treatment groups were well balanced with regard to the baseline characteristics (Table 1). Figure 1Patient's analysed flowchart. BODY.RESULTS.EFFICACY.PRIMARY RESPONSE CRITERION: The AUC of the VAS on active standardised movement values at visits 1 to 4 (at actual measurement times) was markedly smaller in the combination treatment group than in the methyl nicotinate and in the placebo group (ANOVA: p < 0.0001) (Table 2). Table 2 AUC of VAS sum on active standardised movement at actual measurement times (FAS/ITT) Combination Methyl nicotinate Placebo (n = 163) (n = 164) (n = 52) AUC – sum of VAS values at actual measurement times Mean 6548.65 8975.32 13052.40 (mm x h) SD 4021.33 3635.20 4567.87 Median 6013.56 8769.48 13223.31 p (ANOVA) <.0001 The pairwise comparisons of the mean AUCs of VAS sums on active standardised movement showed values 27% lower in favour of the combination compared to methyl nicotinate (6548.65 mm × h versus 8975.32 mm × h, i.e. a mean treatment effect of −2426.7 mm × h), and values 50% lower in favour of the combination compared to placebo (6548.65 mm × h versus 13052.40 mm × h, mean treatment effect −6503.8 mm × h). Methyl nicotinate alone reached a reduction in this variable of 31% compared to placebo (8975.32 mm × h versus 13052.40 mm × h, mean treatment effect 4077.1 mm × h). All pairwise comparisons were statistically significant (t-test: p < 0.0001). The combination proved superiority to the two other treatment arms (Fig. 2). Figure 2AUC of VAS sum on active standardised movement at actual measurement times (FAS/ITT). BODY.RESULTS.EFFICACY.SECONDARY RESPONSE CRITERIA: The pairwise comparisons of the AUC of VAS values on pain at rest at actual measurement times were 27% lower, comparing the combination with methyl nicotinate (1782.60 mm × h versus 2457.32 mm × h, mean treatment effect −674.7 mm × h), and 54% lower comparing the combination to placebo (1782.60 mm × h versus 3910.66 mm × h, mean treatment effect −2128.1 mm × h); all pairwise comparisons were again statistically significant (t-test: p = 0.0005, p < 0.0001). The AUC of the pressure algometry values in the trigger point was much higher in the combination group, which means significantly less inducible pressure pain than in both comparator groups (64% more compared to placebo and 19% more compared to methyl nicotinate, respectively, t-test: p < 0.0001). Similar to the mean reduction of pain on movement values, the mean pain-at-rest values – assessed also by using VAS – decreased statistically significant (ANOVA: p < 0.0001) in the actively treated groups compared to placebo (Fig. 3). The pairwise comparisons of the AUC of VAS pain at rest at actual times were −674.7 mm × h in favour of the active combination compared to methyl nicotinate and nearly the triple in comparison to placebo (−2128.1 mm × h). Figure 3VAS pain at rest – means and SD (FAS/ITT). The VAS sum of pain on active standardised movement diminished after 1 h (visit 2) by 25.2% in the combination group, by 15% in the methyl nicotinate group, and by 4,1% in the placebo group. The VAS sum of pain at rest reduced at the same visit 2 by 29% in the combination group, by 18.1% in the methyl nicotinate group, but only by 1% in the placebo group. The global assessments of efficacy by investigators and patients showed that the difference between the treatment groups was statistically significant at visit 4 (CMH: p < 0.0001). The percentage of patients who were assessed as 'good' or 'excellent' in terms of global efficacy was markedly higher in the combination group (93.3%) compared to methyl nicotinate (51.2%) and placebo (7.6%). Moreover, 'no' or 'poor' global efficacy was rarely documented in actively treated patients, in contrast to placebo. The assessment of global efficacy coming from the patients was very similar. In the comfrey group, the rating of 'good' or "excellent" was 93.9%, compared to methyl nicotinate (49.4%) and placebo (7.7%). Moreover, 17.3% of patients in the placebo group needed to take paracetamol at least once as rescue medication, which was markedly more than in the treatment groups (combination group: 9.2%, methyl nicotinate group: 5.5%). The average total dose of rescue medication was higher in the placebo group (9929 mg) than in the active treatment groups (combination: 7400 mg, methyl nicotinate: 8889 mg) in the subgroup of patients who took rescue medications at least once. The Oswestry Disability Index between visit 1 and visit 4 (FAS/ITT) improved by 80% in the combination group (V1 24.85, V4 4.96) compared to 54% in the methyl nicotinate group (V1 24.38, V4 11.3) and 22% in the placebo group (V1 25.63, V4 20.06). The combination ointment was thus consistently more effective in the treatment of acute upper or low back pain than both comparators, while methyl nicotinate displayed a non-negligible effect as well. The results are consistent across the primary and all secondary variables in this clinical trial. Patients treated with the combination had significant reductions in pain scores and were more satisfied with the treatment effect than those receiving only methyl nicotinate. A clear benefit of the combination product compared to the mono substance methyl nicotinate could thus be proven. Methyl nicotinate alone, however, proved to have a noticeable effect on the disease under investigation as well. BODY.RESULTS.SAFETY: All 379 patients enrolled, who received at least one dose of study medication, were included in the safety population (SAF). A total of 327 patients received at least one dose of one of the nicotinate-containing preparations (combination: n = 163, methyl nicotinate: n = 164). Fifty-two patients received placebo. AEs reports, which included multiple descriptions, were split into single AEs for analysis purposes and counted separately. Four drug-related AEs were recurrent, meaning they were recorded more than once in the same patient. A total of 19 patients (5%) (combination: n = 10 (6.1%), methyl nicotinate: n = 9 (5.5%), placebo: n = 0) showed at least one AE during the course of the clinical trial (33 AEs in total). 9 patients (2.4%) showed at least one AE, which was classified as drug-related (combination: n = 3 (1.8%), methyl nicotinate: n = 6 (3.7%), placebo: n = 0). In total, 22 drug-related AEs were recorded. The System Organ Class which was affected most frequently was 'General disorders and administration site conditions'. All drug-related events were application site reactions (application site erythema, hypersensitivity, pruritus, and reaction); they represent typical reactions caused by the topical application form of the treatments. It is remarkable that the majority of AEs out of these drug-related cutaneous side effects (88%) occurred in the methyl nicotinate group (15 application site reactions), not in the combination group (two application site reactions). The 22 drug-related AEs (certain or probable) also included recurrent events, and all occurred in the two treatment groups, none in the placebo-group (combination: n = 7, methyl nicotinate: n = 15). The causality of the seven drug-related AEs in the combination group was assessed as 'probably' drug related. The 15 drug-related AEs in the methyl nicotinate group were classified as 'certainly' drug-related. All above drug-related AEs were assessed as mild or moderate by the investigators. Two unrelated AEs were classified as serious: recurrent depressive disorder and pancreatic insufficiency. Both of these cases occurred in the combination treatment group. BODY.DISCUSSION: The results demonstrate that the topical combination of comfrey root extract and methyl nicotinate has a clinically relevant, favourable impact on the outcomes of patients suffering from acute upper or low back pain. Patients treated with the combination had statistically significant and clinically relevant reductions in pain scores and increases in tenderness. Significantly more patients in the combination group reached a virtually pain-free status at visit 4 compared to the placebo group as well as compared to the methyl nicotinate group, as documented by the results of the global assessment of efficacy by the patients and by the investigators. They reached a pain-free condition significantly earlier than patients in the methyl nicotinate and those in the placebo group. Further, the clinical trial showed that methyl nicotinate contributes substantially to the efficacy of the combination product, reducing the primary parameter by 31% compared to placebo. Patients using topical drugs for self-medication do not usually know the precise cause of their pain; however they do seek pain relief. This trial might have limitations as we did not include, for example, a pain diary, which may have allowed further, relevant, detailed data analysis. However, the efficacy demonstrated reflects the pharmaceutical treatment routine of this patient group to quite an extent. BODY.CONCLUSION: The combination of comfrey root extract plus methyl nicotinate was consistently more effective in the treatment of acute upper or low back pain than both comparators, while methyl nicotinate displayed an effect as well. The clinical trial at hand confirms the topical combination is an effective and well-tolerated treatment option for acute back pain. BODY.CONTRIBUTORSHIP STATEMENT: Helmut Pabst and Axel Schaefer were investigators, Hans-Georg Predel was principal investigator of this RCT, Marc Junker-Samek was project manager, Christiane Staiger was project manager and wrote most of the article. BODY.FUNDING: Merck Selbstmedikation GmbH sponsored the study. The study was conducted by the CRO CRM clinical trials GmbH, Rheinbach, Germany.

TITLE: Metabolic Effects of Replacing Sucrose by Isomaltulose in Subjects With Type 2 Diabetes ABSTRACT.OBJECTIVE: To test the hypothesis that replacement of sucrose with isomaltulose in sweet foods and beverages improves metabolic control in patients with type 2 diabetes. ABSTRACT.RESEARCH DESIGN AND METHODS: One hundred ten patients with type 2 diabetes were randomized to receive sweet foods containing either 50 g/day isomaltulose or sucrose for 12 weeks as part of their habitual diet under free-living conditions. HbA1c at 12 weeks was the primary outcome parameter. ABSTRACT.RESULTS: In the final analysis comprising 101 patients, isomaltulose did not significantly affect HbA1c at 12 weeks (sucrose: 7.39 ± 0.78%; isomaltulose: 7.24 ± 0.76%; regression coefficient [b]: 0.02 [95% CI: −0.21 to 0.25], P = 0.844). Triglycerides at 12 weeks were significantly lower in the isomaltulose versus the sucrose group (b: 34.01 [6.59–61.44], P = 0.016). Other secondary parameters did not significantly differ between groups. ABSTRACT.CONCLUSIONS: Isomaltulose did not influence glycemic control assessed as HbA1c in type 2 diabetes under free-living conditions but was associated with lower triglyceride levels. BODY: In patients with type 2 diabetes, a low glycemic diet is recommended to reduce postprandial hyperglycemia and, thereby, improve glycemic control (1). Isomaltulose (Palatinose), a disaccharide composed of α-1,6–linked glucose and fructose, was recently introduced as an alternative sugar with delayed digestion and absorption (2) resulting in a low glycemic index (GI) of 32 (3). The aim of this study was to examine whether replacing a daily intake of 50 g sucrose by isomaltulose in sweet foods and beverages over a period of 12 weeks would result in improved glycemic control assessed as HbA1c and metabolic parameters in individuals with type 2 diabetes. BODY.RESEARCH DESIGN AND METHODS: The study followed a randomized, controlled, double-blind design with two parallel groups. One hundred ten patients with type 2 diabetes (age > 18 years, BMI 25–40 kg/m2, HbA1c 6.5–9.0) treated by diet alone or with oral antidiabetic agents were recruited through advertisements between March 2007 and December 2008 in two study centers (Munich and Wuerzburg, Germany) and randomly assigned to either isomaltulose (n = 57) or sucrose (n = 53) intervention. The study protocol was approved by the ethical committees of the Technical University of Munich and the University of Wuerzburg, Germany. The participants received sweet foods and beverages (biscuits, toffees, milk drinks, soft drinks) containing either 50 g of isomaltulose or sucrose per day in a double-blinded fashion for a period of 12 weeks and were asked to maintain their habitual diet but to refrain from additional sweetened foods other than the test products. At study entry, after 6 and 12 weeks, venous blood was taken in the morning after a 12-h overnight fast to determine clinical routine and metabolic parameters. HbA1c, fasting glucose, serum fructosamine, insulin, C-peptide, proinsulin, nonesterified fatty acids (NEFA), total cholesterol, triglycerides, LDL-cholesterol, HDL-cholesterol, and standard clinical parameters were analyzed by a certified laboratory. Homeostasis model assessment–insulin resistance (HOMA-IR) was calculated as previously described (4). Commercial ELISA kits were used to analyze oxidized (ox)LDL (Mercodia, Uppsala, Sweden), leptin, and adiponectin (R&D Systems, Abingdon, U.K.). The primary end point of the study was HbA1c at week 12. With a sample size of 55 patients per group, the study had a power of 80% to show a statistically significant difference of at least 0.3% in HbA1c at week 12 between the groups with a type I error level of 0.05 assuming a common standard deviation of 0.5. BODY.RESULTS: One hundred patients completed the study (isomaltulose, n = 52; sucrose, n = 48). Ten patients dropped out for various reasons but not because of side effects (Supplementary Fig. 1). One patient who dropped out after the week 6 visit was included in the analysis by use of a last-observation-carried-forward analysis. Baseline patient characteristics were comparable (Supplementary Table 1), with the exception of higher BMI at baseline in the patients receiving sucrose (32.3 ± 4.5 vs. 29.9 ± 4.2 kg/m2, P = 0.007). Over the course of the study, there was no significant change in HbA1c within both groups (Table 1). Mean HbA1c at 12 weeks was 7.39 ± 0.78% in the sucrose group and 7.24 ± 0.76% in the isomaltulose group, respectively, with no significant difference between the groups (regression coefficient [b]: 0.02 [95% CI −0.21 to 0.25], P = 0.844) in the final analysis controlling for BMI and baseline levels. There were no significant differences between the groups for insulin, fasting glucose, fructosamine, proinsulin, C-peptide, and HOMA-IR (Table 1). Within the sucrose group, a significant linear increase in triglycerides was observed over the course of the study (P = 0.023), whereas in the isomaltulose group, there was a tendency toward reduced levels, resulting in a significant difference between the groups at week 12 (b: 34.01 [6.59–61.44], P = 0.016). Table 1 HbA 1c and secondary target parameters over the course of the 12-week intervention period in the sucrose vs. isomaltulose group In addition, there were significant changes over time within the sucrose group for fructosamine (P = 0.019) and within the isomaltulose group for proinsulin (P = 0.039), C-peptide (P = 0.038), and oxLDL (P = 0.013). All other parameters remained unchanged. BODY.CONCLUSIONS: Short-term studies have consistently shown a reduced glycemic and insulin response after isomaltulose compared with sucrose/glucose ingestion in healthy patients as well as in individuals with type 2 diabetes (5–8). Our study is the first to investigate the effects of a 12-week dietary intervention with 50 g/day isomaltulose compared with sucrose in sweet foods and beverages in patients with type 2 diabetes under free-living conditions. Both dietary interventions were well-tolerated by the participants, independent of the antidiabetic medication. HbA1c, the primary outcome parameter, remained virtually unchanged in both groups after 12 weeks of intervention. Likewise, no profound effects on most other secondary metabolic parameters and cardiovascular risk factors were observed. However, triglyceride levels were significantly lower in the isomaltulose group, which is in accordance with findings from an animal study (9) and might indicate a potential metabolic benefit if sustained over the longer term. Thus, the results of our study suggest that replacement of 50 g/day sucrose with isomaltulose is not enough to induce a pronounced and clinically relevant effect on HbA1c in individuals with type 2 diabetes in addition to their standard antidiabetic treatment and under free-living conditions. This may be explained by the fact that isomaltulose and sucrose, respectively, constituted only approximately 10% of total caloric intake resulting in an approximate reduction of the overall GI by ∼6 units according to a simple calculation (3), and it is obvious that this proportion within a mixed diet is too small to evoke distinct effects on metabolic control. This finding is in line with a recent 1-year trial in type 2 diabetic patients that shows that an only modest reduction of the dietary GI does not affect HbA1c as a long-term marker for glycemic control (10), although meta-analyses have provided evidence for low GI diets as a useful strategy in the management of diabetes (11–13). In conclusion, substitution of 50 g/day sucrose by isomaltulose in sweet food and beverages over 12 weeks did not significantly affect HbA1c and most other metabolic and cardiovascular risk parameters, despite significantly lower triglyceride levels in the isomaltulose versus the sucrose group. Although the principle of isomaltulose action is unquestionable, a more marked modification of the dietary GI may be required to achieve a clinically significant improvement in glycemic control in type 2 diabetic patients.

TITLE: Early Post Operative Enteral Versus Parenteral Feeding after Esophageal Cancer Surgery ABSTRACT.INTRODUCTION:: The incidence of malnutrition in hospitalized patients is reported to be high. In particular, patients with esophageal cancer are prone to malnutrition, due to preoperative digestive system dysfunctions and short-term non-oral feeding postoperatively. Selection of an appropriate method for feeding in the postoperative period is important in these patients. ABSTRACT.MATERIALS AND METHODS:: In this randomized clinical trial, 40 patients with esophageal cancer who had undergone esophagectomy between September 2008 and October 2009 were randomly assigned into either enteral feeding or parenteral feeding groups, with the same calorie intake in each group. The level of serum total protein, albumin, prealbumin, transferrin, C3, C4 and hs-C-reactive protein (hs-CRP), as well as the rate of surgical complications, restoration of bowel movements and cost was assessed in each group. ABSTRACT.RESULTS:: Our results showed that there was no significant difference between the groups in terms of serum albumin, prealbumin or transferrin. However, C3 and C4 levels were significantly higher in the enteral feeding group compared with the parenteral group, while hs-CRP level was significantly lower in the enteral feeding group. Bowel movements were restored sooner and costs of treatment were lower in the enteral group. Postoperative complications did not differ significantly between the groups. There was one death in the parenteral group 10 days after surgery due to myocardial infarction. ABSTRACT.CONCLUSION: : The results of our study showed that enteral feeding can be used effectively in the first days after surgery, with few early complications and similar nutritional outcomes compared with the parenteral method. Enteral feeding was associated with reduced inflammation and was associated with an improvement in immunological responses, quicker return of bowel movements, and reduced costs in comparison with parenteral feeding. BODY.INTRODUCTION: Malnutrition is defined as a state in which a deficiency of nutrients such as energy, protein, vitamins and minerals causes measurable adverse effects on body composition, function or clinical outcome (National Institute of Clinical Excellence (NICE) guideline (2006). The incidence of malnutrition in hospitalized patients has been reported to be over 50%, and exists even in the best treatment centers. Patients with esophageal cancer often have malnutrition caused by dysphagia and malignant cachexia, and short-term (7–10 days), non-oral feeding after surgery accentuates this problem (1). Identifying an appropriate nutritional method that is cost effective, physiological and that preserves the immune response in the postoperative period is clearly important. There are currently controversies concerning the optimal method of feeding in the postoperative period among patients with esophageal cancer (2,3). Cancer cachexia is a multi-factorial condition and results in weight loss and muscle atrophy, disturbance of the immunologic system and metabolic changes. Patients with cancer and malnutrition do not respond well to common methods of treatment(surgery-chemotherapy or radiation therapy) (4). Malnutrition also increases the rate of complications including infection, hospitalization, and mortality rate as well as treatment costs. In fact, a serum albumin level less than 29 g/L is considered to be severe malnutrition and a cause of increased postoperative complications (2). These problems, and the fact that patients with esophageal cancer are unable to swallow during the early postoperative period, have always been challenging for surgeons. Gastrocolic malfunction after surgery, especially in the digestive system, impairs oral or gastric feeding for 2–5 days. Iran has a high frequency of esophageal cancer. Therefore, we decided to compare the effects of early enteral feeding with parenteral feeding in the postoperative period among patients with esophageal cancer in terms of biochemical nutritional factors (total protein, albumin, transferrin, prealbumin) as well as immunological status (C3 and C4 complement levels) and inflammatory response (C-reactive protein [CRP] level) as well as postoperative complications during the time of hospitalization. The aim of the present study is to compare the efficacy of enteral and parenteral feeding methods in the postoperative period among patients with esophageal cancer. BODY.MATERIALS AND METHODS: In this randomized clinical trial conducted between September 2008 and October 2009 at the Ghaem Hospital (Mashad, Iran), 40 patients with esophageal cancer were studied. Inclusion criteria were patients with middle or lower esophageal cancer (squamous cell carcinoma or adenocarc- inoma); operated using a transhiatal or transthoracic approach with a feeding jejunostomy. Exclusion criteria were cervical esophageal cancer; severe malnutrition before surgery (albumin <30 g/L; history of diseases affecting immunological function, such as diabetes or renal failure or chronic liver disease; history of using immunosuppressive drugs or corticosteroids; thoracic duct injury during surgery; history of preoperative radio- or chemo-radiotherapy (1-6). Patients were randomly allocated into two groups (enteral and parenteral groups) using a computer-generated code. The average requirements in terms of energy, protein, carbohydrate and fat were calculated according to each patient, and the enteral and parenteral regimes were then designed based on the amount of macronutrients in the respective brand: Energy: 25–30 kcal/kg; protein: ~1.5 g/kg; fat:~30% of the energy intake; carbohydrate: the remaining energy requirement. For parenteral nutrition, Intralipid (10%, Dextrose (10%) and aminoven (5%)) was used. Age, gender, clinical signs and symptoms, serum nutritional proteins (total protein, albumin, transferrin, prealbumin), C3 and C4 complement levels (immunologic parameter) and high sensitivity (hs)-CRP (inflammatory parameter) were assessed. One day before surgery, blood tests were taken for routine preoperative measures as well as serum nutritional proteins, C3, C4 and hs-CRP levels. The patients then underwent surgery. From the first day after surgery, feeding was begun via jejunostomy or partial parenteral nutrition (PPN), according to the patient's allocated group. The calorie intake was equal in both groups and on similar days. To prevent re-feeding syndrome (4), feeding was started with 500 kcal on the first day and gradually increased to 1,500 kcal by Day 5–7 after the surgery. Measuring of nutritional serum proteins and C3, C4 and CRP levels was repeated on Days 3 and 7 after surgery. Daily monitoring of patients was performed and data were collected regarding general condition, postoperative complications such as atelectasia, pneumonia, wound infections, fistula formation, return of bowel motion, defecation, gavage intolerance and the amount of chest tube drainage. To obtain the precise calorie intake, a standard gavage solution with 1 kcal/cc energy was used (this solution comprised Nutric EN nutritional powder produced by Pooyan Co. Ltd). The calorie intake in the parenteral feeding group was calculated using standard solutions under the supervision of a nutritionist. Seven days after surgery, and after radiologic evaluation, oral feeding was started in both groups. Statistical analysis Statistical analyses were performed using the SPSS statistical software package. Data analysis and statistical evaluation of quantitative variables was performed using a T-test for normal distribution of data and a Mann Whitney U-test in the case of non-normal distribution. A Chi-square or Fisher's exact test was used for evaluation of categorical variables. A p-value <0.05 was considered as statistically significant. In the case that an independent variant was found to have interactive variants, a general linear model (likelihood test) was used in the subsequent process. BODY.RESULTS: Table 1 shows the patient characteristics. There was no significant difference between the two groups regarding age (mean), gender or body mass index. There was no significant difference between the two groups regarding the tumor location, surgical technique (P=0.65) or pathological staging (P=0.76). Blood loss in the two groups during surgery was not significantly different (P=0.85). Table 2 shows the results of total protein, albumin, transferrin and prealbumin levels in the two groups at different times before and after surgery. The results showed that there was no significant difference between the two groups. Table 3 shows the results of C3, C4 and CRP levels in the two groups at different time points after surgery. There was a significant difference between the two groups in C3, C4 and CRP levels before and after surgery. Concentrations of C3 and C4 in the enteral feeding groups were significantly higher than those in the parenteral group, while CRP level was significantly higher in the parenteral group.The restoration of bowel movements (defecation and gas passing after surgery) in the enteral group occurred significantly sooner (4.5 days) than in the parenteral group (6 days), and the cost of treatment was significantly lower in the enteral group (gavage cost for each patient was 30,0000 Rls; almost $30) compared with the parenteral group (PPN cost was about 80,0000 Rls; almost $80) in one week. There was no significant difference between groups regarding complications or length of hospitalization (Table. 4). Table 1 Comparison of the baseline characteristics between groups Enteral feeding group Parenteral feeding group P-value Gender (male/female) 9/11 12/8 0.21 Age (y) 64 57 0.25 Body mass index (k/m 2 ) 17.6±9.7 18.1±4.9 0.75 Tumor location & technique of surgery      Middle (Transthoracic esophagectomy) 12 11 0.65      Lower (Transhiatal esophagectomy) 8 9 Pathologic staging      - I 1 1 0.76      - IIA 8 9      - IIB 2 2      - III 9 8 Table 2 Comparison the nutritional proteins levels between the two groups Day 0 P-value Day 3 after surgery P-value Day 7 after surgery P-value Total protein Enteral F † 6.43±0.83 0.36 4.86±0.81 0.18 4.79±0.69 0.17 Parenteral Fǂ 6.67±0.86 5.73±1.04 5.36±0.80 Albumin Enteral F 4.25±0.60 0.67 3.15±0.56 0.079 2.66±0.46 0.10 Parenteral F 4.33±0.52 3.27±0.65 3.08±0.52 Transferrin Enteral F 193±74 0.167 104±28 0.057 95±51 0.720 Parenteral F 224±65 130±36 120±33 Prealbumin Enteral F 15.0±8 0.915 10.6±85 0.065 14.5±12 0.216 Parenteral F 15.3±9 13.2±6.7 19±10 † Enternal feeding Table 3 Complement C3, Complement C 4 , CRP levels in study groups Preoperative day P-value Day 3 after surgery P-value Day 7 after surgery P-value Complement C3 Enteral F 122±40 0.756 88±33 0.091 107±10 0.039 Parenteral F 127±54 82±35 92±12 Complement C 4 Enteral F 27±10.5 0.748 24±6.8 0.037 25±7 0.046 Parenteral F 28±9 20±8.7 21±8 CRP Enteral F 10±6 0.648 22±1.9 0.029 17±6.5 0.031 Parenteral F 9±5 27±1.1 20±7.3 Table 4 Comparison of complications of the patients underwent esophagectomy in the two groups Enteral feeding Parenteral feeding P-value Leakage from anastomosis 0 0 - Pneumonia 1 1 - Wound infection 0 0 - In the group of patients who were fed by jejunostomy, gavage was well tolerated. In our study there was only one patient with abdominal distension and one case of diarrhea, occurring on Days 4 and 5 after surgery and due to excessive gavage volume. These complications were resolved by decreasing the volume and increasing the times of gavage. There was one death in the parenteral group, at Day 10 after surgery due to myocardial infarction. One patient was excluded from the study due to thoracic duct injury. BODY.DISCUSSION: A previous study by Lassen et al. showed that earlier feeding from the first days after surgery on the upper digestive system did not increase the morbidity rate (5). Our results support these findings and suggest the potential of using gavage solutions immediately after major surgeries, including esophagectomy. In our study only one case of abdominal distension and one case of diarrhea (on Days 4 and 5 due to excessive gavage volume) were observed. Several studies have previously been conducted into the role of early enteral feeding versus parenteral feeding. Carr et al. confirmed that early feeding could increase intestinal mucosal permeability protein metabolism and the earlier restoration of bowel movement, and prevent postoperative infections (6). Gianotti et al. showed that early enteral feeding played no role in preventing complications and even caused complications such as abdominal distension, diarrhea and intolerance (7). Heyland et al. showed that early enteral feeding could cause earlier withdrawal of ventilators from very ill patients (8). Several studies have also been conducted assessing the volume of gavage solutions. In two large studies, Heyland et al. and Beier-Holgerson et al. recommended that the volume of gavage feeding at the first day after surgery should fall within the range of 480–1200cc and then be gradually increased (8,9). Our study began with a feeding volume of 500cc on the first day and was gradually increased up to 1,500cc on the fifth day to prevent the re-feeding syndrome. For evaluation of the sufficiency and comparison of enteral and parenteral feeding Aiko et al. used several parameters, such as nutritional factors (total protein, albumin, transferrin, prealbumin) and effective immunological and inflammatory factors (C3, C4 and CRP levels) (2). Serum levels of total protein, albumin, transferrin and prealbumin were used to evaluate nutritional status. Due to its shorter half-life, prealbumin is more responsive to nutrient absorption, and this is thought to be more useful in evaluating nutritional status (1,10). In Japan, Aiko et al. (2000) (2) found no significant difference between groups fed using enteral or parenteral methods in terms of nutritional, immunologic or inflammatory indexes. In contrast, in our study there was no meaningful difference between the two groups regarding the serum protein levels, but C3 and C4 levels were significantly higher in the enterally-fed group. There was also a significant difference in hs-CRP levels between the two groups. Aiko et al., Baigrie et al. and Sand et al. showed that there were no significant differences between enteral and parenteral feeding in important complications such as pneumonia, fistula formation or wound infection.In all of these studies, the cost of parenteral feeding had been reported to be more than enteral feeding (11,12). In our study, the incidence of complications after surgery (pneumonia, fistula and wound infection) showed no meaningful difference between the two groups studied. In addition, we found that the cost of enteral feeding was significantly lower than that of parenteral feeding. BODY.CONCLUSION: The results of our study show that enteral feeding can be effectively used in the first days after surgery, with few early complications and similar nutritional outcomes compared with the parenteral method. Furthermore, early enteral feeding can reduce the inflammatory response to the stress of surgery, improve immune response, lead to an earlier return of bowel movements, and involve a lower cost.

TITLE: Effects of Clonidine Premedication Upon Postoperative Shivering and Recovery Time in Patients With and Without Opium Addiction After Elective Leg Fracture Surgeries ABSTRACT.BACKGROUND: Opium is a highly addictive agent and the most common narcotic often misused in Iran. The pharmacokinetic of anesthetic drugs in patients with opium addiction is one of the great challenges for anesthesiologists. Hemodynamic instability and postoperative side effects are of these challenges which should be managed correctly. ABSTRACT.OBJECTIVES: In this study we aimed to assess the effects of clonidine upon post anesthesia shivering and recovery time in patients with and without opium addiction after general anesthesia to decrease the subsequent complications related to the shivering and elongation of recovery time. ABSTRACT.PATIENTS AND METHODS: In a randomized clinical trial, 160 patients candidates for elective leg fracture operations under general anesthesia were studied in four groups of 40 patients: Group 1 (placebo 1) were patients without addiction who got placebo 90 minutes before the operation. Group 2 (placebo 2) were patients with opium addiction which received placebo as group 1. Group 3 (Clonidine 1) patients without addiction who got clonidine 90 minutes before the operation and group 4 (Clonidine 2) who were opium addicted ones which received clonidine as premedication. ABSTRACT.RESULTS: None of the patients with and without addiction in clonidine groups had shivering after the operation but in placebo groups shivering was observed and the difference between clonidine and placebo groups was statistically significant (P < 0.01). Recovery time in clonidine groups of patients with and without addiction was less than placebo ones (both P < 0.01) which the magnitude of difference was higher in opium addicted than non-addicted patients (P = 0.04). ABSTRACT.CONCLUSIONS: Premedication with clonidine in patients with and without opium addiction can be effective to decrease the incidence of shivering and recovery time after operation. BODY.1. BACKGROUND: Opium addiction is one of the most common addictions in Iran (1). Patients with opium addiction are more prone to hemodynamic instability which leads to increased risk of general anesthesia in this group of patients. Management of anesthesia in patients with opium addiction is one of the great challenges for anesthesiologists (2). Clonidine as an alpha2 adrenergic agonist has been reviewed in different articles to be able to decrease the hemodynamic responses during surgeries (3-6). It has been shown that clonidine owns anesthetic, sympatholytic, sedative and analgesic properties (7, 8). Newly discovered mechanisms of this drug have been remained as active fields of research (9), moreover it has been shown to be a safe and effective adjuvant drug in patients with addiction (10). Tolerance is a common phenomenon in patients with opium addiction who are candidates for surgeries that require sedation or anesthesia. They would require greater amounts of anesthetics per weight than patients without addiction (11) and they may have some side effects related to their addiction after anesthesia (12). Post anesthesia shivering occurs in 40% of patients (13) and is often preceded by core hypothermia and vasoconstriction (14) but not necessarily so (15). It may cause some complications such as an increase in oxygen consumption, carbon dioxide production, lactic acidosis and release of catecholamines (16). Clonidine acts on central thermoregulatory system and prevents post op shivering (17). BODY.2. OBJECTIVES: In this study, we assessed the effects of premedication with oral clonidine on postoperative shivering and recovery time after general anesthesia in patients with and without opium addiction who had undergone elective fractured leg surgeries to compare the effects of clonidine upon shivering and recovery time in those two groups of patient. BODY.3. PATIENTS AND METHODS.3.1. PATIENT SELECTION: After obtaining written informed consent from each patient and approval of Institutional review board, 160 patients who were candidates for elective leg fracture surgeries were selected and entered into our randomized clinical trial. To do this we enrolled all the patients with including criteria for non-addicted group. The opium addicted group was selected with the same sex frequency distribution as non-addicted group: as in each group we had 32 males and eight females. The power as 90% and type I error of α = 0.05. 80 patients were opium addicted and the other 80 were non-addicted ones according to their assertions before the surgery. If any patient used at least 4 grams per day of opium (natural or semisynthetic Alkaloids) as oral or inhalational route for more than six months, we put him or her in opium addicted group. After that we divided each 80 patients into two different groups of 40 patients who either received oral clonidine (about 5 μg/kg) or placebo (vitamin C tablet) by the nurse of anesthesia 90 minutes before the operation. We used Stratified Permuted-block randomization (with the length of 4) to assign our samples to the treatment groups. We had four stratified randomization lists to each combination of Sex-Addiction (Addicted Male, Addicted Female, Non-addicted Male and Non-addicted female). The inclusion criteria of our study were as follow; patients age between 18 to 65 years, American Society of Anesthesiologists (ASA) score one or two, systolic blood pressure during 24 hours before surgery between 90 to 140 mmHg, duration time of operation less than three hours, no history of cardiac diseases or any arrhythmia before surgery, any other fractures or multiple trauma and saturation of Oxygen more than 90% in room air. BODY.3. PATIENTS AND METHODS.3.2. METHODS: All patients received fentanyl 2 μg/kg intravenously (IV) and midazolam 0.02 mg/kg IV as premedication and induction of anesthesia performed by thiopental 5 mg/kg and Atracurium 0.5 mg/kg IV. For the maintenance of anesthesia we used O2/N2O as 1/1 liter and propofol by the infusion dosage of 100 μg/kg/min to preserve the value of Cerebral State Index (CSI) between 40 to 60. Systolic and diastolic blood pressure, heart rate, saturation of oxygen and cardiac rhythm monitored and recorded. After the end of the operation and by acquiring the criteria for reversal of neuromuscular blockade, the patients' endotracheal tubes were extracted and by precise monitoring of hemodynamic and ventilation, they transferred to post anesthesia care unit. In the recovery room the incidence of muscular activity in one or more muscle groups was considered as shivering and treated by Meperidine 20 mg IV. When patients acquired post anesthesia recovery score (modified Aldrete score) > 9, the nurse of anesthesia recorded the time and let them leave the recovery room and transfer to orthopedic ward. The nurse who recorded the incidence of shivering and recovery time of patients did not have any information about opium addiction and premedication of patients. All data were analyzed using SPSS (version 17.0; SPSS Inc, Chicago, IL). For statistical data analysis, student t test, Chi-square test and analysis of variance (ANOVA) with interaction were used. P values less than 0.05 were considered significant. BODY.4. RESULTS: In this survey there were no significant differences between all four groups regarding age, weight and duration of operation (Table 1). Post anesthesia shivering was not seen in patients with and without opium addiction who received clonidine as premedication, but 15 patients with opium addiction (37.5%) and 13 patients without opium addiction who received placebo (32.5%) showed post anesthesia shivering (Figure 1). As a result there was a statistical significant difference between clonidine and placebo groups of both patients with and without opium addiction (P < 0.01, based on chi-square test) but the difference between opium addicted and non-addicted groups was not statistically different (P = 1, based on interaction analysis in logistic regression). Recovery time in clonidine groups of both patients with and without opium addiction was less than placebo ones which showed statistically significant difference (both P < 0.01, based on t-test). However the magnitude of the difference was higher in opium addicted than non-addicted patients (P = 0.04, based on interaction analysis in two way analysis of variance) as it is shown in the Figure 2 and Table 1 the recovery time difference between clonidine and placebo groups was around two minutes (108 vs. 110 min) in non-addicted patients where the difference was around five minutes (114 vs. 109 min) in opium addicted group. Table 1. Baseline Characteristics of Patients Total Control P value a Addict P value a Placebo Clonidine Placebo Clonidine No. 160 40 40   40 40   Age, y             0.89 Mean ± SD 36.2 ± 12.8 32.9 ± 14.2 34.1 ± 12.2 0.68 38.8 ± 12.4 39.1 ± 11.3   Median (Range) 34 (18 to 64) 27 (18 to 64) 33.5 (18 to 64)   38 (22 to 64) 37 (22 to 64)   Sex, M/F, Frequency (%) 128/32 (80) 32/8 (80) 32/8 (80) - 32/8 (80) 32/8 (80) - Weight, kg             0.06 Mean ± SD 71.6 ± 11 71.1 ± 13.1 73.9 ± 10.2 0.28 68.4 ± 9.9 72.8 ± 10.2   Median (Range) 72 (48 to 110) 70 (48 to 110) 75.5 (52 to 100)   68 (51 to 90) 73 (55 to 100)   Duration of Operation, min             0.51 Mean ± SD 110 ± 28 110 ± 27 108 ± 23 0.69 114 ± 30 109 ± 33   Median (Range) 110 (40 to 180) 110 (50 to 170) 100 (60 to 170)   120 (40 to 180) 110 (40 to 180)   a Based on t-test. Figure 1.Post Anesthesia Shivering Figure 2.Recovery Time After Operation BODY.5. DISCUSSION: The results from our study showed that clonidine as premedication can be an effective drug to decrease the incidence of shivering and recovery time after anesthesia for leg fracture operations not only in patients without addiction but also in opium addicted ones which their postoperative complications make a great challenge for anesthesiologists. Clonidine effectiveness upon preventing post anesthesia shivering has been reviewed before (17, 18). In one study, oral administration of clonidine 30 minutes before operation was assessed, their results showed that incidence of post anesthesia shivering was decreased but there was an increase in emergence time after operation (19). In another survey oral clonidine administration had better preventive effects on post anesthesia shivering than oral midazolam (20). We could not find any study related to the effect of clonidine on postoperative shivering in patients with opium addiction and we suggest that our study is a unique survey about this matter which showed that oral clonidine in patients with opium addiction can control the incidence of post op shivering. Clonidine premedication was found to decrease the recovery time after operation in both patients with and without opium addiction and even the magnitude of the difference between clonidine and placebo was higher in opium addicted than non-addicted patients. So, from our results we deducted that premedication effect of clonidine on post anesthesia recovery time in patients with opium addiction is better than patients without addiction and by considering the effectiveness of clonidine premedication on recovery time after anesthesia, recommendation about oral administration of clonidine as premedication in patients with opium addiction is reasonable. Some studies have shown that clonidine premedication does not delay recovery time after anesthesia (21, 22) but in other ones clonidine as premedication drug can delay arousal from anesthesia and extend the time of discharge from operating room (23, 24). Through our investigation we could not find any related article about clonidine effects on recovery time after anesthesia in opium abuser patients so, we suppose that our study upon the effectiveness of clonidine on recovery time after anesthesia in patients with opium addiction is a unique study on this matter. We could not have equal sexes of patients and the male ones were dominant in the study. So, it seems that we cannot generalize our results to both sexes. The other limitation was that we did not have any lab data about the level of opium in patients' serum or urine and we relied on the history of patients about their addiction. It was due to an attempt to preserve patients' rights and we did not intend to create any discomfort for patients to have any test about their addiction. In summary, the premedication of oral clonidine can be effective to decrease the incidence of shivering after operation in both patients with and without opium addiction and to decrease recovery time after anesthesia especially in patients with opium addiction.

TITLE: Effect of Septoplasty on Voice Quality: A Prospective-Controlled Trial ABSTRACT.OBJECTIVES.: The purpose is to investigate effect of septoplasty and widened nasal patency on voice quality. ABSTRACT.METHODS.: Fifty patients who undergone septoplasty were included in the study. Thirty-three people who had similar age and distribution were enrolled as control group. Before and 1 and 3 months after surgery, anterior rhinomanometry, voice analysis by Multi-Dimensional Voice Program, and spectrographic analysis were performed to patients. The recordings of /a/ vowel were used to evaluate average fundamental frequency (F0), jitter percent, and shimmer percent. In spectrographic analyses, F3–F4 values for the vowels /i, e, a, o, and u/, nasal formant frequencies of the consonants /m/ and /n/ in the word /mini/, and 4 formant frequencies (F1, F2, F3, and F4) for nasalized /i/ vowel following a nasal consonant /n/ in the word /mini/ were compared. The differences in nasal resonance were evaluated. All patients were asked whether change in their voices after the surgery. Preoperative and postoperative voice parameters and anterior rhinomanometry results were compared separately with the control group as well as in the patient group itself. ABSTRACT.RESULTS.: Preoperative total nasal resistance (TNR) values of patients were higher than the control group (P=0.001). TNR values of patients measured one day before surgery and after surgery in the 1st and 3rd months were different and these differences were significant statistically (P=0.001). There was no significant difference between the voice analysis parameters in preoperative, postoperative 1st, and 3rd months. As a result of their subjective reviews, 12 patients (36%) noted their voices were better than before surgery and 20 patients (61%) noted no change before and after surgery. ABSTRACT.CONCLUSION.: Providing widened nasal cavity has no effect on voice quality. BODY.INTRODUCTION: Nasal obstruction is one of the common complaints of patients visiting otorhinolaryngology clinics and the one of main reasons of nasal obstruction is nasal septal deviation [1]. Septoplasty is a well-known surgical procedure for management of nasal septal deviation [2]. This minor surgical procedure is performed to widen the nasal passage, which in turn alters the resonance characteristics of the vocal tract [3]. Voice disorders can affect patient's quality of life. According to a study reported by Behlau et al. [4], patients with unnatural speech are evaluated as less attractive and less intelligent than people with normal speech and this apprehension can affect social life and life quality of these patients. Nasal obstruction may play an important role in the feature of voice [5]. There are not many reports about acoustic features of the voice after septoplasty procedure. Normality of voice, grade and cause of voice disorders, and effect of treatment especially in clinical trials can be evaluated by voice analysis methods [6]. We aim to evaluate the relationship between widened nasal cavity and voice quality by voice analysis method, spectrography and subjective questions in patients undergone successful septoplasty procedure. BODY.MATERIALS AND METHODS: A prospective-controlled trial was performed between January 2014 and December 2014 in a 3rd stage hospital. It was approved by local ethical committee (2012/313). Written informed consent was obtained from all patients. BODY.MATERIALS AND METHODS.DESIGN: Fifty patients who have septal deviation were included in the study. None of them was a voice professional. Septal deviation was diagnosed by anterior rhinoscopy and nasal endoscopy. Patients and 30 voluntary people who had similar age and sex distribution and no nasal obstruction, septal deviation, laryngeal disease, and voice disorder were also included as control group. People who have nasal operation history before, allergic rhinitis, cranio-facial anomaly, neurological disease, laryngeal pathology, nasal pathology except septal deviation, and those younger than 18 age excluded. After the operation, patients who did not come to their postoperative controls, had septal perforation and higher total nasal resistance (TNR) value than avarage value of control group were also excluded. When postoperative TNR value of a patient was less than avarage TNR of control group, this operation was accepted as successful septoplasty. The study was continued with successful operations. Because we aimed to evaluate the effects of increased nasal patency on voice quality. BODY.MATERIALS AND METHODS.ANTERIOR RHINOMANOMETRY: It was used to measure grade of nasal obstruction. Before it, agents that may affect the results like smoking, decongestant, and antihistamines were excluded. Measurements were performed by Homoth Rhino 4000 device (Homoth, Hamberg, Germany) under 150 Pascal pressure defined by International Organization for Standardization. Both resistance of nasal airways were seperately calculated with the inspiration values using the formula R=∆P/V. Then, TNRs were calculated using the formula 1/R (total)=1/r (left)+1/r (right) [2]. Results were recorded. BODY.MATERIALS AND METHODS.VOICE RECORD AND ACOUSTIC ANALYSIS: Multi-dimensional Voice Program (MDVP) (Kay Elemetrics Co., Lincoln Park, NJ, USA) and a microphone (Shure SM-48; Shure Inc., Niles, IL, USA), with a standard soundboard (Sound Blaster Live Value, Creative Technology Ltd., Jurong East, Singapore) were used for recording. The recordings were made in an isolated room using a microphone at a constant mouth-to microphone distance (15 cm). For the standardization and comparability of the voice samples, the patients and volunteers were instructed to sustain the vowels at a comfortable pitch and level of loudness three times before recording to obtain maximum steady phonation during recording. Before and 1 and 3 months after operation, phonetically balanced sentences and the vowel /a/, followed by vowels /i/, /e/, /a/, /o/, and /u/, then a word /mini/, which contains nasal consonants /m/ and /n/ and nasalized vowel /i/ articulated with a comfortable speech voice were for 5 seconds recorded and digitalized in all patients for an evaluation. Linear predictive coding analysis was used to obtain formant frequencies. All patients were performed septoplasty by the same surgical team. Radiofrequency ablation was applied the inferior turbinate on the opposite site of septal deviation if necessary. One and 3 months after surgery, physical examinations and anterior rhinomanometry (ARM) were again done. All patients were asked whether changes in their voice with open questions as no change, better than preoperative and worse than preoperative. These procedures were also performed to control group. Preoperative and postoperative voice parameters and ARM results were compared separately with the control group as well as in the patient group itself. BODY.MATERIALS AND METHODS.STATISTICAL ANALYSIS: Preoperative and postoperative voice analysis results of patients were evaluated with the control group and in the patient group itself: basic frequency (F0), jitter %, shimmer % and noise to harmonic ratio (NHR) values for /a/ vowel; F3-F4 formant frequency values for /n/ nasal consonant; and F1-F2-F3-F4 formant frequency values for nazalized /i/ in /mini/ word in preoperative, postoperative 1st and 3rd months were compared with the control group and in the patient group itself. All data were evaluated in IBM SPSS ver. 21.0 (IBM Co., Armonk, NY, USA) statistical pocket program. Categorical data were evaluated by Fisher exact chi-square test. Distributions of normality were tested by Shapiro-Wilk test. Independent samples t-test, one-way analysis of variance, repeated measures analysis of variance, and parametric Student-Newman-Keuls multiple comparisons tests were used in normal distributed data. Mann-Whitney U-test, Kruskal–Wallis H-test, Friedman test, and nonparametric Student-Newman-Keuls tests were used in abnormal distrubuted data. P<0.05 value was considered significant statistically. BODY.RESULTS: There were 29 men and 21 women in the study group. None of them was applied sinus surgery. Seven patients who did not come to their postoperative controls, 3 patients who were observed septal perforation after septoplasty and could not be done ARM due to perforation, and 7 patients who had higher TNR value than avarage TNR value of control group were excluded. There were 9 patients applied radiofrequency ablation and all of them was in excluded group. Except absent patients, successful septoplasty rate was 77%. The study was conducted with 33 patients who have an increased nasal patency. Nineteen men (58%) and 14 women (42%) were enrolled as patient group and the mean age of patients was 25 years (range, 18 to 53 years). The mean age of control group was 27 years (range, 18 to 51 years) and there was no significant difference in terms of age and sex between patients and the control group (P<0.05) (Table 1). Preoperative mean TNR value of patients was higher than the control group's and this difference was significant statistically (P=0.001). Preoperative TNR values of patients decreased post-operatively and these differences were again significant statistically (P=0.001) (Table 2). When asked patients whether changes in their voices after surgery, 20 patients (61%) noted no change, 12 patients (36%) said there was a change in a good way, and one (3%) noted a change in a bad way. Compared analysis results of /a/ vowel, there was no significant difference between the values before and 1 and 3 months after surgery (Table 3). Compared these results with the control group, there was no significant difference except NHR value (P=0.017). This difference was not reviewed, because it was not related to change of TNR. Compared analysis results of /n/ nasal consonant; there was no significant difference between the values before and 1 and 3 months after surgery. Compared these results with the control group, there were significant differences statistically about F3 formant freqency in postoperative 1st and 3rd months (P=0.022, P=0.024) and F4 formant frequency in postoperative 1st month (P=0.017) (Table 4). These differences were not significant clinically because these frequencies had not significant change in patient group. Compared analysis results of /mini/ word, there was no significant difference postoperative and with the control group (Table 5). BODY.DISCUSSION: ARM is most frequently used to evaluate preoperative nasal obstruction level and postoperative operation success in people performed septoplasty [7-9]. The most important value obtained from ARM is TNR [10]. TNR value and sensation of nasal obstruction are significantly related [8]. In this study, preoperative mean TNR value was 0.42 Pa/mL/sec and it was 0.25 postoperative. This difference was significant statistically (P<0.05). Postoperative mean TNR value of patients was even better than the control group (P<0.05). Operations about vocal folds can change voice quality to effect acoustic parameters formed by vocal folds movement and defined MDVP (F0 and F0 related parameters jitter–shimmer). There is an opinion surgical procedures about pharynx, oral, and nasal cavity can affect voice quality and resonance changing shape and size of acoustic area [3,11,12]. For this reason, voice changes must be considered in larynx and upper airway surgical procedures. Evaluating of human voice is very difficult because of multidimensional nature of sound signals and variety of physical aspects. Objective assessment of voice is essential to expose voice disorders and to comment therapeutic results about voice. Subjective opinions of patients especially postoperative are not satisfying, because they can not realize minor changes. For this reason, acoustic analysis is used to evaluate voice changes objetively [13]. There are a lot of program doing acoustic analysis but the most used program is Computerized Speech Lab (CSL) and MDVP working on CSL [14]. Plenty of parameters can be calculated on MDVP but the most used parameters are F0, NHR, jitter, and shimmer [15]. A study reported by Petrovic-Lazic et al. [16] including 46 patients have vocal polyp and treated by cold technique and another study reported by Geyer et al. [17] including 235 patients have benign glottic lesions and treated by CO2 laser defined significant difference between preoperative and postoperative values of Fo, jitter, shimmer, and NHR. A study reported by Brosch et al. [18] in 2000 defined no significant difference about acoustic parameters except F0 after uvulopalatopharyngoplasty. MDVP can expose voice changes in laryngeal disorders and surgical procedures performed on larynx. MDVP is the first used method to evaluate effect of upper airway surgeries on voice in the literature. There was not significant difference about voice quality in these studies. There are very few studies assessing nasal resonance and laryngeal functions together in the literature. Both of them were evaluated together in this study. In a study reported by Mora et al. [19] in 2009, they evaluated objectively patients' voice by MDVP one month after septoplasty. There were significant differences in F0, jitter, shimmer, and NHR values. Compared with their control group, there was no significant difference. Changes in nasal resonance after upper airway surgical procedures were defined in a lot of study. Andreassen et al. [20] found significant differences about nasality after adenoidectomy; Chen and Metson [21] defined significant promotion in formant amplitude of nasal consonants (/m, n/) after functional endoscopic sinus surgery; Behrman et al. [3] determined statistically significant increase in formant amplitude of nasal consonants after upper airway surgeries. We expected change in F3-F4 formant frequencies, because they are related to nasal cavity and paranasal sinuses. But there was no significant diffence both F3-F4 formant frequencies of /n/ nasal consonant and F1-F2-F3-F4 formant frequencies of /mini/ word including nasalized /i/ after septoplasty. There are different results in the literature about effect of upper airway surgical procedures on nasality and nasal resonance. Using different voice analysis method, differencies in voice analysis methods and postoperative time of evaluating effect of operation could be reasons for this. Depending on wound healing and edema, nasal patency can not be enough postoperative. For this reason, voice analysis must be performed in a late period like 3rd or 6th months postoperative. Ozbal et al. [5] have reported a new study investigating effect of septoplasty on voice and speech in a 20-patient group. They did voice analysis preoperative and postoperative 1st and 3rd months and determined septoplasty has no effect on voice and speech [5]. But this study has no control group. In addition, success of septoplasty was not evaluated. Our presented study has compared values of patients and control group and evaluated success of septoplasty by ARM objectively. In conclusion, a widened nasal cavity has no effect on voice quality and procedures about nasal obstruction like septolasty could be performed safely. But more comprehensive studies are needed about this issue. BODY.HIGHLIGHTS: ▪ Voice quality before and after septoplasty was prospectively measured in patients with septal deviation.▪ Postoperative total nasal resistance (TNR) did not significantly differ between 33 study patients and 30 healthy volunteers.▪ Preoperative but no postoperative objective voice parameters differ between study and control groups.

TITLE: Effects of interventions on trajectories of health-related quality of life among older patients with hip fracture: a prospective randomized controlled trial ABSTRACT.BACKGROUND: Health-related quality of life (HRQoL) has been used to assess subjects' prognosis and recovery following hip fracture. However, evidence is mixed regarding the effectiveness of interventions to improve HRQoL of elders with hip fracture. The purposes of this study were to identify distinct HRQoL trajectories and to evaluate the effects of two care models on these trajectories over 12 months following hip-fracture surgery. ABSTRACT.METHODS: For this secondary analysis, data came from a randomized controlled trial of subjects with hip fracture receiving three treatment care models: interdisciplinary care (n = 97), comprehensive care (n = 91), and usual care (n = 93). Interdisciplinary care consisted of geriatric consultation, discharge planning, and 4 months of in-home rehabilitation. Comprehensive care consisted of interdisciplinary care plus management of malnutrition and depressive symptoms, fall prevention, and 12 months of in-home rehabilitation. Usual care included only in-hospital rehabilitation and occasional discharge planning, without geriatric consultation and in-home rehabilitation. Mental and physical HRQoL were measured at 1, 3, 6, and 12 months after discharge by the physical component summary scale (PCS) and mental component summary scale (MCS), respectively, of the Medical Outcomes Study Short Form 36, Taiwan version. Latent class growth modeling was used to identify PCS and MCS trajectories and to evaluate how they were affected by the interdisciplinary and comprehensive care models. ABSTRACT.RESULTS: We identified three quadratic PCS trajectories: poor PCS (n = 103, 36.6 %), moderate PCS (n = 96, 34.2 %), and good PCS (n = 82, 29.2 %). In contrast, we found three linear MCS trajectories: poor MCS (n = 39, 13.9 %), moderate MCS (n = 84, 29.9 %), and good MCS (n = 158, 56.2 %). Subjects in the comprehensive care and interdisciplinary care groups were more likely to experience a good PCS trajectory (b = 0.99, odds ratio [OR] = 2.69, confidence interval [CI] = 7.24–1.00, p = 0.049, and b = 1.32, OR = 3.75, CI = 10.53–1.33, p = 0.012, respectively) than those who received usual care. However, neither care model improved MCS. ABSTRACT.CONCLUSIONS: The interdisciplinary and comprehensive care models improved recovery from hip fracture by increasing subjects' odds for following a trajectory of good physical functioning after hospitalization. ABSTRACT.TRIAL REGISTRATION: ClinicalTrials.gov (NCT01350557) BODY.BACKGROUND: Health-related quality of life (HRQoL) has been recommended for assessing the prognosis and recovery of patients following a hip fracture as a supplement to objective clinical indicators [1]. However, evidence is mixed regarding the effectiveness of interventions to improve the HRQoL of elders with hip fracture [2–4]; some studies found beneficial effects [2, 4] and some did not [3]. This inconsistency in intervention benefits on HRQoL might have been due to the course of changes in HRQoL after hip fracture being averaged over patients. However, temporal changes in HRQoL for community-dwelling older persons and hospitalized older patients have been shown to be heterogeneous [5–7]. For example, older community-dwelling women were found to have four distinct trajectories of HRQoL, high (19 %), high decline (22 %), intermediate (42 %) and low decline (16 %), over a period of 7 years [5]. In another study, hospitalized, frail older persons waiting for entry to residential care had extremely poor HRQoL (worse than death-equivalent) and poor (death equivalent) at both baseline and 4-month follow-up, but with some improvement over the follow-up period [6]. Also, patients who had undergone coronary artery bypass surgery were found to have "improver" and "non-improver" HRQoL trajectories for both the physical component summary scale (PCS) and the mental component summary scale (MCS) of the Medical Outcomes Study (MOS) Short Form 36 (SF-36) during the first year following surgery [7]. Because patients may have several distinct HRQoL trajectories following hip fracture, intervention effects could vary across these trajectories. In an earlier study of elderly patients with hip fracture, we developed an interdisciplinary care model consisting of geriatric consultation, discharge planning, and 4 months of in-home rehabilitation in addition to usual care and found this model effective in improving HRQoL of older persons with hip fracture [8]. Later in a different trial, we refined the interdisciplinary care model by adding management of malnutrition and depressive symptoms as well as fall prevention and 12 months of in-home rehabilitation, thus developing a comprehensive care model [9]. Comparison of the intervention effects of the comprehensive and interdisciplinary care models to usual care showed that both models improved HRQoL of older persons with hip fracture, especially physical health-related outcomes (effect size = 0.3, 95 % CI =0.02–0.58 at 12 months after discharge) [9]. Analysis of that data was limited by focusing on the average course of changes in HRQoL without exploring whether HRQoL may change along distinct trajectories and whether the intervention effects varied for distinct trajectories. Hence, two research questions remain unanswered: Do patients with hip fracture experience multiple distinct trajectories of HRQoL? If so, what are their levels and rates of change over time? What are the effects of the interdisciplinary care and comprehensive care models compared to usual care on these distinct HRQoL trajectories? To address these questions, we conducted this secondary analysis to identify the distinct courses of change in HRQoL over 1 year after hip-fracture surgery and to analyze the intervention effects on HRQoL trajectories after comprehensive and interdisciplinary care compared to usual care. In particular, we evaluated the following two hypotheses.Hypothesis 1 (H1): HRQoL, including physical and mental health-related health outcomes, during the first year after hospital discharge following hip fracture has multiple distinct trajectories that can be characterized as poor, moderate, and good [5].Hypothesis 2 (H2): Receiving the comprehensive and interdisciplinary care models increases patients' odds of being in a good physical and good mental health trajectories over time compared with the usual care model. BODY.METHODS.DESIGN AND SETTING: Data for this research came from a randomized control trial conducted from September 2005 to July 2010 at a medical center in northern Taiwan [9, 10]. BODY.METHODS.SUBJECTS: Patients were included in the original study by these criteria: (a) at least 60 years old, (b) hospitalized for an accidental first time, single-side simple hip fracture and receiving hip arthroplasty or internal fixation, (c) with a pre-fracture Chinese Barthel Index (CBI) score >70 at admission and able to perform full range of motion against gravity and against some or full resistance with the unaffected limb, and (d) living in northern Taiwan. Exclusion criteria were (a) severely cognitively impaired and completely unable to follow orders (determined by a score <10 [11] on the Chinese Mini-Mental State Examination [12]), or (b) terminally ill. Of 1246 patients with hip fracture screened, 470 met the study criteria. Among the 776 patients who did not meet our criteria, 409 (52.7 %) had poor pre-fracture physical functioning, 158 (20.4 %) did not live in northern Taiwan, 95 (12.3 %) had severe cognitive impairment, 85 (10.9 %) were unable to communicate, and 29 (3.7 %) lived in a nursing home. Among the 470 patients who met our criteria, 299 agreed to participate. Of these, only 281 had at least one HRQoL assessment. Subjects who had at least one HRQoL assessment and those without any HRQoL data did not differ significantly in gender, age, type of fracture and surgery, and pre-fracture performance of activities of daily living (ADLs). All subjects were assessed for pre-fracture ADL performance before surgery and for HRQoL outcome variables at 1, 3, 6, and 12 months after discharge. The present analysis included 281 subjects (91 comprehensive, 97 interdisciplinary, and 93 usual care) for whom HRQoL data were available during the first year following discharge. The three treatment protocols are briefly described below. Details have been published [9, 10]. Based on our prior study on intervention effects of the interdisciplinary care model, a sample size of at least 90 was found sufficient to measure changes in physical function-related indicators to achieve a power of 0.80, with a significance level of 0.05, from pre-discharge to 3 months after discharge [8]. Based on a case loss of 10 % [13], we recruited 100 in each group. BODY.METHODS.USUAL CARE: After receiving internal fixation or arthroplasty, subjects were cared for on trauma wards. During postoperative hospitalization (around 7 days), no geriatric consultation was provided, although internal medicine consultations were occasionally made according to the subject's condition. Physical therapy usually started on the second or third day following surgery without any home rehabilitation. Clinical follow-ups were recommended at 1, 3, 6 and 12 months following discharge. BODY.METHODS.INTERDISCIPLINARY CARE MODEL: The interdisciplinary care model included three key components: Geriatric consultation, rehabilitation, and discharge planning. BODY.METHODS.INTERDISCIPLINARY CARE MODEL.GERIATRIC CONSULTATION: Geriatric assessment was first delivered by a geriatric nurse to assess and detect potential problems. After the nursing assessment, high-risk patients, including those >80 years old, at high operative risk, with poor nutritional status, cognitive impairment or disorientation, or with unstable co-morbid conditions were further evaluated by a geriatrician who then made recommendations to the primary surgeon. BODY.METHODS.INTERDISCIPLINARY CARE MODEL.REHABILITATION PROGRAM: Rehabilitation included in-hospital rehabilitation starting on the first day following surgery and 4 months of in-home rehabilitation, both delivered by a geriatric nurse. Based on their recovery progress, subjects receiving interdisciplinary care were advised on a six-stage progressive muscle-strength training program, which started from ankle pumping exercise, knee extension, gently bouncing jump with knee semiflexed and both feet on the floor, and gently bouncing jump with knee semiflexed and single foot on the floor. During rehabilitation, the geriatric nurse emphasized pain relief; enhancing range of motion, muscle strength and endurance; proprioception; balance challenges, as well as improving aerobic and anaerobic capacity. BODY.METHODS.INTERDISCIPLINARY CARE MODEL.DISCHARGE PLANNING: The geriatric nurse provided a structured discharge assessment of caregiver competence, resources, family function, elderly subject's self-care ability, elderly subjects' and their family caregivers' need for community or long-term care services, assessment of the home environment, and referrals to community resources referrals. If needed, the nurse also suggested environmental modifications for identified barriers at home. Reminder phone calls were also made for follow-ups. BODY.METHODS.COMPREHENSIVE CARE MODEL: The comprehensive model integrated all components of the interdisciplinary care model with an enhanced rehabilitative program, fall prevention, nutrition consultation, and management of depression. BODY.METHODS.COMPREHENSIVE CARE MODEL.REHABILITATION PROGRAM: Subjects in the comprehensive group received an expanded, 1-year in-home rehabilitation program. Hence, these subjects could recover sufficiently to perform exercises related to balance challenges and aerobic capacity under instruction, whereas subjects receiving interdisciplinary care were not recovered enough to perform these activities during the 4 months in-home rehabilitation. BODY.METHODS.COMPREHENSIVE CARE MODEL.FALL PREVENTION: The geriatric nurse assessed fall risks and provided corresponding interventions at each home visit. Assessed fall-risk factors included postural hypotension, multi-medications, impaired transfer ability, poor gait or weak leg/arm muscles, environmental hazards, and knowledge deficits. BODY.METHODS.COMPREHENSIVE CARE MODEL.NUTRITIONAL CONSULTATION/EDUCATION: Subjects' nutritional status was assessed at discharge using the Mini Nutritional Assessment (MNA) scale [14, 15]. Those who scored < 17 were categorized as malnourished and were referred to a dietitian. Those who scored ≥ 17 but ≤ 23.5 were categorized as at risk of malnutrition and were referred to a geriatrician. These high-risk patients were followed up by a geriatric nurse who provided consultation according to suggestions of the geriatrician and dietician. The nurse also assessed nutrition outcomes using the MNA at each home visit. BODY.METHODS.COMPREHENSIVE CARE MODEL.DEPRESSION SCREENING AND MANAGEMENT: Geriatric nurses assessed subjects' depressive symptoms using the Geriatric Depression Scale short form [16, 17] before hospital discharge and at each home visit. Subjects identified as at risk were referred to a psychiatrist or psychiatric clinic for further assessment and management under agreement of the subjects. At the same time, the geriatric nurse provided individualized consultation and emotional support for these at-risk subjects. BODY.METHODS.MEASUREMENTS.HRQOL: Mental and physical HRQoL were measured by the PCS and MCS, respectively of the MOS SF-36, Taiwan version [18]. The SF-36 has 36 items representing eight generic health concepts: physical functioning (PF), role disability due to physical health problems (RP); bodily pain (BP); vitality (energy/fatigue) (VT); general health perceptions (GH); social functioning (SF); role disability due to emotional problems (RE); and general mental health (MH). PCS and mental MCS using norm-based (50, 10) scoring methods were calculated based on the norm of a previous study [19]. BODY.METHODS.MEASUREMENTS.PRE-FRACTURE PERFORMANCE OF ADLS: Pre-fracture ADL performance was retrospectively assessed using the Chinese Barthel Index (CBI) before randomization and before hip-fracture surgery. The CBI, with scores ranging from 0 to 100, measures dependencies in eating, transferring, grooming, toileting, bathing, walking, climbing stairs, dressing, as well as bowel and bladder control [20]. The CBI has been shown to have satisfactory reliability and validity for assessing Taiwanese elders with hip fracture [20, 21]. BODY.METHODS.ETHICAL CONSIDERATIONS: The study was approved for human subject research by the study hospital (Chang Gung Medical Foundation, Institutional Review Board; approval number: 94-422C) and was in compliance with the Helsinki Declaration and local legislation. Informed consent was obtained from subjects before data collection. BODY.METHODS.PROCEDURES: Potential subjects meeting the research criteria were contacted by a research nurse in the emergency room. Those who agreed to participate were randomly assigned to the comprehensive care, interdisciplinary care, or usual care group. Subjects were randomized by a throw of the dice by a research assistant not involved in the clinical intervention. Subjects were blinded to which intervention they received, but assessors were not blinded. BODY.METHODS.DATA ANALYSIS: Distinct trajectories of PCS and MCS were identified using group-based trajectory models [22–24]. This approach includes two components. First a basic model classifies individuals into groups based on similarities of their trajectories over time. In particular, latent class analysis was used to derive trajectory parameters through maximum likelihood estimation with the following specifications:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \mathrm{L}\mathrm{n}{Y}_{iT}^{*g} = {\upbeta_0}^{\mathrm{g}} + {\upbeta_1}^{\mathrm{g}}{\mathrm{Time}}_{\mathrm{iT}} + {\upvarepsilon}_{iT}^{*}\ \mathrm{with}\ \mathrm{i} = 1, \dots \mathrm{n} $$\end{document}LnYiT*g=β0g+β1gTimeiT+εiT*withi=1,...n Ln YiT* g is a latent variable with a zero-inflated Poisson distribution representing the health status (i.e., either PCS or MCS) of individual i at time T (e.g., 1 month) given membership in group g. Time refers to assessment time from 1 month after discharge. The coefficients β0g and β1g are associated with the intercept and rate of change in PCS and MCS scores, respectively. εiT* is a disturbance term that is normally distributed with 0 mean and constant variance. A series of models with two to six groups was examined with the optimal number of groups determined by the Bayesian information criterion (BIC). Within each group, PCS and MCS scores were analyzed as an intercept only, linear or nonlinear model of time, although a linear function is shown in Equation 1 as an illustration. In the second component, trajectory group membership was treated as a dependent variable, which was a function of demographic covariates and treatment interventions, in a fashion similar to that of multinomial logistic regression analysis. In particular, we evaluated the following specifications:2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {e}^{z_i{\uptheta}_g}\ {\uppi}_{\mathrm{g}}\left({\mathrm{Z}}_{\mathrm{i}}\right) = {e}^{z_i{\uptheta}_g}/{\varSigma}_{\mathrm{g}} $$\end{document}eziθgπgZi=eziθg/Σg where θg represents the parameters of a multinomial logistic model that captures the effects of predictors zi (e.g., intervention group, attrition, and pre-fracture performance of ADLs) on πg, and the probability of membership in group g [24]. Equations 1 and 2 were estimated by an SAS software package, with accompanying Proc Traj [23]. BODY.RESULTS.SUBJECT CHARACTERISTICS: As indicated in Table 1, the 281 subjects had an average age of 76.36 years (SD = 7.28), with 64.4 % (n = 181) being female, 52.7 % (n = 148) being married, and 44.1 % (n = 124) being illiterate. Before admission, they had on average 2.39 (SD = 1.48) chronic diseases and 67.6 % (n = 190) were independent in pre-fracture ADLs. The majority had femoral neck fracture (57.3 %, n = 161), 42.7 % (n = 120) had trochanteric fracture, 63 % (n = 177) received internal fixation of the fracture, and 37 % (n = 104) received arthroplasty. Subjects in the experimental and control groups did not differ significantly in any characteristics.Table 1Demographic characteristics and health-related quality of life of elderly Taiwanese patients with hip fracture (N = 281)CharacteristicMean (SD) n (%)Age, years76.36 (7.28)Gender Female181 (64.4)Marital status Married148 (52.7) Widowed/divorced133 (47.3)Educational background Illiterate124 (44.1) ≥ Primary school157 (55.9)Number of comorbidities a 2.39 (1.48)Type of fracture Femoral neck161 (57.3) Trochanteric120 (42.7)Type of surgery Arthroplasty104 (37.0) Internal fixation177 (63.0)Pre-fracture independence in ADL Yes190 (67.6) No91 (32.4)PCS score Baseline (1 month post discharge)45.53 (5.92) 3 months53.14 (9.40) 6 months59.27 (10.42) 12 months63.67 (10.88)MCS score Baseline (1 month post discharge)55.31 (9.72) 3 months55.54 (8.51) 6 months53.54 (8.93) 12 months51.97 (9.53)Attrition Baseline (1 month post discharge)7 (2.49) 3 months20 (7.11) 6 months33 (11.74) 12 months46 (16.37) ADL activities of daily living, PCS physical component summary score, MCS mental component summary score a Comorbidities include heart disease, hypertension, stroke, dementia, Parkinson's disease, diabetes, lung disease, renal disease, liver disease, and cancer Subjects' average PCS score was 45.53 (SD = 5.92) at 1 month following discharge and improved to 63.67 (SD = 10.88) at 12 months following discharge. The average MCS score was 55.31 (SD = 9.72) at 1 month following discharge and remained relatively stable during the first 3 months following discharge, but slightly decreased to 51.97 (SD = 9.53) at 12 months following discharge (Table 1). BODY.RESULTS.TRAJECTORIES OF PCS AND MCS.PCS: Our analyses identified three PCS trajectories among subjects with hip fracture (Table 2 and Fig. 1). The first trajectory was characterized as poor PCS (n = 103, 36.65 %). Subjects in this group experienced a significant, but small improvement in PCS from 43 points to 49 points during the first 6 months after hospitalization, and remained stable at 49 to 52 points from 6 to 12 months following discharge. Similarly, the second trajectory was characterized as moderate PCS (n = 96, 34.16 %). Subjects in this group started with a PCS score at 44 points, which improved to 60 during the next 6 months, and remained relatively stable at 67 thereafter (Fig. 1). The third trajectory was described as good PCS (n = 82, 29.18 %). Subjects in this group improved substantially from a PCS score of 50 points to 70 points during the first 6 months after discharge and remained relatively stable at 72 points during the following 6 months (Fig. 1).Table 2Estimated trajectory classes and group-specific growth parameters of health-related quality of life (N = 281)Growth parameterPCS classesMCS classesPoorModerateGoodPoorModerateGoodIntercept3.72*** 3.71*** 3.83*** 3.75*** 3.95*** 4.11*** Linear slope0.04*** 0.08*** 0.11*** -0.010 * -0.007** -0.005*** Quadratic slope-0.002** -0.004*** -0.006*** Group proportion36.6534.1629.1813.8729.8956.23Alpha0-21.28-21.14Alpha10.26-0.23Alpha2-0.05Model fit statistics BIC (N =1018)-3545.68-3578.91 BIC (N =281)-3536.67-3572.48 AIC fit index-3511.21-3554.29 Log likelihood-3497.21-3544.29 BIC Bayesian information criterion, AIC Akaike's information criterion, PCS physical component summary score, MCS mental component summary scoreLevel 1, N = 1018, and Level 2, N = 281 * p < 0.05, ** p < 0.01, *** p < 0.001Fig. 1Trajectories of physical component summary scale (PCS) over 12 months after hip fracture-surgery in elderly Taiwanese patients. Solid lines represent observed trajectories; dashed lines indicate predicted trajectories. Red line indicates poor PCS; green line indicates moderate PCS; blue line indicates good PCS BODY.RESULTS.TRAJECTORIES OF PCS AND MCS.MCS: Our analyses identified three linear decreasing MCS trajectories among subjects with hip fracture (Table 2 and Fig. 2). For the first trajectory, poor MCS (n = 39, 13.87 %), subjects had a low MCS of 42 points in the 1st month that declined to 38 at the end of 12 months. The second trajectory could be characterized as moderate MCS (n = 84, 29.89 %), with the MCS score beginning at 51 in the 1st month and declining to 48 at the end of 12 months following discharge. The third trajectory could be characterized as good MCS (n = 158, 56.23 %). Subjects in this group had an average MCS score of 61 at baseline and declined to 57 at the end of 12 months following discharge (Fig. 2).Fig. 2Trajectories of mental component summary scales (MCS) over 12 months after hip-fracture surgery in elderly Taiwanese patients. Solid lines represent observed trajectories; dashed lines indicate predicted trajectories. Red line indicate poor MCS; green line indicates moderate MCS; blue line indicates good MCS BODY.RESULTS.INTERVENTION EFFECTS ON DISTINCT TRAJECTORIES OF PCS AND MCS: The interdisciplinary care and comprehensive care models made a significant difference in the PCS trajectories of older Taiwanese subjects with hip fracture. Those who received comprehensive care were 2.69 times more likely to experience good PCS than those who received usual care (b = 0.99, odds ratio [OR] = 2.69, CI = 7.24–1.00, p = 0.049) (Table 3). Similarly, those who received interdisciplinary care were 3.75 times more likely to experience good PCS than those who received usual care (b = 1.32, OR = 3.75, CI = 10.53–1.33, p = 0.012) (Table 3). These intervention effects remained robust even after adjusting for pre-fracture ADL performance (b = -2.27, OR = 0.10, CI = 0.68–0.02, p = 0.018) and attrition (b = -0.94, OR = 0.39, CI = 1.49–0.10, p = 0.168). In contrast with the effects on PCS trajectories, the interdisciplinary and comprehensive models did not show statistically significant effects on MCS (Table 4).Table 3Factors associated with health-related quality of life for PCS trajectory group membershipTrajectoryParameterβa SEa Odds ratio (95%CI)Poor PCSReference groupModerate PCSConstant-0.040.430.96 (2.23–0.42)Comprehensive group0.340.471.40 (3.54–0.56)Interdisciplinary group0.730.492.08 (5.46–0.80)Attrition-1.271.240.28 (3.18–0.02)Pre-fracture ADL dependent-0.490.430.61 (1.42–0.26)Good PCSConstant-0.630.490.53 (1.39–0.20)Comprehensive group0.990.502.69 (7.24–1.00) * Interdisciplinary group1.320.533.75 (10.53–1.33) * Attrition-0.940.680.39 (1.49–0.10)Pre-fracture ADL dependent-2.270.960.10 (0.68–0.02) * Model fit statistics BIC (N = 1018)-3558.53 BIC (N = 281)-3544.37 AIC fit index-3504.35 Log likelihood-3482.35 BIC Bayesian information criterion, AIC Akaike's information criterion. Level 1, N = 1018, and Level 2, N = 281 a Non-standardized * p < 0.05Table 4Factors associated with health-related quality of life for MCS trajectory group membershipTrajectoryParameterβa SEa Odds ratio (95%CI)Poor MCSReference groupModerate MCSConstant0.940.712.55 (10.37–0.63)Comprehensive group0.320.661.38 (5.10–0.38)Interdisciplinary group1.240.723.46 (14.37–0.83)Attrition-1.831.360.16 (2.32–0.01)Pre-fracture ADL dependent-1.140.670.32 (1.19–0.09)Good MCSConstant1.740.665.70 (20.77–1.57)** Comprehensive group0.250.481.28 (3.28–0.50)Interdisciplinary group0.860.612.37 (7.88–0.71)Attrition-1.100.550.33 (0.97–0.11)* Pre-fracture ADL dependent-1.170.490.31 (0.81–0.12)* Model fit statistics BIC (N = 1018)-3598.60 BIC (N = 281)-3587.02 AIC fit index-3554.27 Log likelihood-3536.27 BIC Bayesian information criterion, AIC Akaike's information criterion. Level 1, N = 1018, and Level 2, N = 281 a Non-standardized * p < 0.05, ** p < 0.01 BODY.DISCUSSION: This study contributes to current knowledge by depicting distinctive prototypical trajectories for both physical and mental HRQoL following a hip fracture and by showing intervention effects for different trajectory groups. These trajectories are more informative than measures at one or two times and average trajectories derived by hierarchical linear modeling because a significant health difference at one time may diminish or even reverse at a later time, and an average trajectory cannot represent differences in changes over time between subjects. Understanding distinct trajectories in physical and mental HRQoL and exploring intervention effects of different care models on specific trajectories may facilitate improvements in managing subjects following hip fracture. BODY.DISCUSSION.DISTINCT TRAJECTORIES OF PHYSICAL AND MENTAL HRQOL FOLLOWING HIP FRACTURE: Consistent with our H1, both physical and mental HRQoL during the first year after hospitalization for hip fracture followed multiple distinct courses or trajectories that could be characterized as poor, moderate and good trajectories [5]. These trajectories were clinically different, based on the suggested minimal clinically important difference (MCID) for PCS and MCS of 2.5 to 7.8 points [25, 26], and that their confidence intervals were not overlapping and the differences among trajectories were > 10 points. These criteria indicate that the postoperative PCS and MCS trajectories (poor, moderate and good) for older persons with hip fracture differed clinically and represented different patient groups. Distinct trajectories may reflect differences in etiology and thus call for targeted treatments. BODY.DISCUSSION.NATURAL COURSES OF PHYSICAL AND MENTAL HRQOL FOLLOWING HIP FRACTURE: This study provides significant findings on the natural history of changes in physical and mental HRQoL after hip fracture by quantifying the levels and rates of change in PCS and MCS over 1 year. For PCS, all three trajectories improved over time, whereas for MCS, all three trajectories declined slightly over time during the first year following discharge. Physical HRQoL of older patients with hip fracture has been shown to improve during the first year following discharge, with improvement most rapid during the first 6 months [27–29]. On the other hand, the slight decline in mental HRQoL is consistent with the high prevalence of depressive symptoms during the first year following hip fracture [30, 31]. BODY.DISCUSSION.INTERVENTION EFFECTS: Our study extends the findings of previous randomized controlled trials on older adults with hip fracture [9, 32] by showing that the intervention effects specifically targeted patients originally in the "poor" PCS trajectory by increasing their likelihood of being in the "good" PCS group. The first trial documented the average beneficial effects of interdisciplinary (referred to as "subacute") and comprehensive care models on older Taiwanese patients with hip fracture [9]. The second trial showed that older Norwegian patients with hip fracture had significantly better overall improvements in mobility, ADL performance, and QoL for at least 1 year after surgery after receiving comprehensive orthogeriatric care, including comprehensive geriatric assessment and treatment, early discharge planning, early mobilization, and individualized rehabilitation than their counterparts who received usual care on an orthopedic trauma ward [32]. Our analysis showed minimal intervention effects on specific MCS trajectories, similar to the averaged intervention effects [9]. Our study findings indicate that both the interdisciplinary and comprehensive care models can be implemented specifically for subjects with hip fracture and poor physical HRQoL. Subjects with hip fracture and SF-36 PCS scores ≤ 40 might benefit most from interdisciplinary subacute care and comprehensive care including geriatric assessment, 1 year of in-home rehabilitation, supported discharge planning, and management of depressive symptoms, malnutrition management, and fall prevention in improving their physical health-related outcomes. BODY.DISCUSSION.STUDY LIMITATIONS: The generalizability of the findings are limited to older patients with hip fracture, but without severe cognitive impairment and relatively independent in pre-fracture performance of ADLs due to our sample inclusion criteria. Another limitation is that our study was single blinded; only subjects and families were blinded to the interventions. A third study limitation is that HRQoL was not assessed at baseline, making it difficult to explore the intervention effects more completely. Lastly, the sample size estimated might not support our current hypotheses, because the sample size estimated primarily based on prior intervention effects on physical HRQoL of the interdisciplinary care. The sample estimation did not consider the intervention effects of a comprehensive care mental health related outcomes. Based on the current results, to make the MCS trajectories significant over 1 year following hospital discharge for comprehensive care model, the sample size calculations for latent class analysis is estimated to be 1424 in the future study [33]. BODY.CONCLUSION: Changes in postoperative HRQoL for people with hip fracture during the first year following hip fracture can be categorized as poor, moderate and good for both physical and mental HRQoL, with physical HRQoL improving and mental HRQoL declining over time. An interdisciplinary care model that included geriatric assessment, supported discharge planning and 4 months of in-home rehabilitation, and a comprehensive care model including management of malnutrition and depressive symptoms as well as fall prevention in addition to interdisciplinary care effectively improved physical health-related outcomes. In particular, these two care models are especially beneficial for people who originally had poor physical HRQoL (for example, PCS ≤ 40) in that these models enhanced their chances of having good physical HRQoL. In other words, these models can be used to target people with hip fracture and initially poor physical HRQoL, thus obtaining optimal effects from the intervention. Finally, even though the interdisciplinary care model provided only 4 months of in-home rehabilitation, compared to the 1 year in-home program provided in the comprehensive care model, it was as beneficial as comprehensive care in improving PCS of people with hip fracture. BODY.CONCLUSION.AVAILABILITY OF SUPPORTING DATA: The datasets supporting the conclusions of this article are not available in an open access repository because the authors have not finished the data analysis yet. If anyone is interested in exploring specific issue, please contact Prof. Yea-Ing L Shyu.

TITLE: Plantar-flexor Static Stretch Training Effect on Eccentric and Concentric Peak Torque – A comparative Study of Trained versus Untrained Subjects ABSTRACT: The aim of this study was to examine the long-term effects of static stretching of the plantar-flexor muscles on eccentric and concentric torque and ankle dorsiflexion range of motion in healthy subjects. Seventy five healthy male volunteers, with no previous history of trauma to the calf that required surgery, absence of knee flexion contracture and no history of neurologic dysfunction or disease, systemic disease affecting the lower extremities were selected for this study. The participants were divided into three equal groups. The control group did not stretch the plantar-flexor muscles. Two Experimental groups (trained and untrained) were instructed to perform static stretching exercise of 30 second duration and 5 repetitions twice daily. The stretching sessions were carried out 5 days a week for 6 weeks. The dorsiflexion range of motion was measured in all subjects. Also measured was the eccentric and concentric torque of plantar-flexors at angular velocities of 30 and 120°/s pre and post stretching. Analysis of variance showed a significant increase in plantar-flexor eccentric and concentric torque (p < 0.05) of trained and untrained groups, and an increase in dorsiflexion range of motion (p < 0.05) at both angular velocities for the untrained group only. The static stretching program of plantar-flexors was effective in increasing the concentric and eccentric plantarflexion torque at angular velocities of 30 and 120°/s. Increases in plantar-flexors flexibility were observed in untrained subjects. BODY.INTRODUCTION: Strength and flexibility are common components of exercise programs; however, it is not clear how best include both of these elements in a single training program. Training for flexibility and strength is widely recommended for those who wish to attain good fitness levels and a better quality of life that is gained by preventing muscle injury and soreness or even enhancing performance. Many activities rely on strength, but strength performance may be diminished by stretching. Therefore, it is important to understand this phenomenon when prescribing physical exercise programs (Rubini et al., 2007). Many authors have studied the acute effect of a stretching routines on strength performance, but the results are often controversial. Various studies found that stretching exercises preceding the main strength activity significantly decreased performance (Avela et al., 2004; Behm et al., 2006; Brandenburg, 2006; Cramer et al., 2005; Derek et al., 2005; Marek et al., 2005; Nelson et al., 2001; Nelson et al., 2005; Power et al., 2004; Rubini et al., 2005; Yamaguchi et al., 2006). These studies used stretching exercise of lower extremities and found decreases in strength ranging from 4.5 to 28%, irrespective to the testing mode (i.e. isometric, isotonic or isokinetic) (Rubini et al., 2007). Very few studies have looked into the chronic effects of stretching on strength performance. Worrell et al. (1994) used static stretching and proprioceptive neuromuscular facilitation (PNF) 'contract-relax' methods to train the flexibility of the hamstrings. Exercises were performed five times a week, for 3 consecutive weeks, with 20 minute sessions. The study showed there was no significant gains in flexibility, but a 8.5 and 13.5% increases in eccentric peak torque measured at 60 and 120°/s, respectively, and a 11.2% increase in concentric peak torque at 120°/sec. Handel et al. (1997) used the PNF 'contract-relax' method to train the knee extensor and flexor muscles. Exercises were performed three times a week for 8 consecutive weeks, with a total of 86 minutes 40 seconds in each session. The study indicated that there was a significant increase in flexibility (up to 6.3%). In the knee flexor and extensor muscles eccentric peak torque increased by 18.2 and 23.0%, respectively, while the knee flexor concentric peak torque and knee flexor isometric peak torque results improved by 9.4 and 11.3%. During an eccentric contraction, mechanical work is absorbed by the series elastic component of the muscle as potential energy, which is used during the immediate concentric contraction (Cavagna, 1970; Cavagna et al., 1968). This condition of eccentric contraction followed by concentric contraction occurs during gait and running. For example, the quadriceps femoris undergoes an eccentric contraction during heel strike and concentric contraction at push-off. The same is true for the gastrocnemius and soleus (plantar-flexors) muscles during midstance and push-off. The speed of the eccentric contraction and muscle length are the factors that determine the amount of energy absorbed by muscles (Cavagna, 1970). Thus, if the length of the muscle can be increased, more forces will be absorbed during the eccentric contraction and increased force will be generated during the concentric contraction. Worrell et al. (1994) stated that patients with lower extremity overuse injuries would benefit by muscle stretching because greater force will be absorbed, lessening the overload on weakened and inflamed tissues. In addition, theoretically, muscle performance will be increased for activities of daily living or sports by increasing the potential energy available for concentric contractions. There is contradictory data on the effect of stretching exercises on flexibility of plantar-flexors. Therefore, the purpose of this study was 1) to examine the effect of static stretching on plantar-flexor flexibility and 2) to determine the long-term effect of static stretching on concentric and eccentric peak torque of plantar-flexors of trained and untrained subjects. BODY.MATERIAL AND METHODS.SUBJECTS: Seventy five volunteers from physical therapy students and staff participated in this study. Inclusion criteria for this study were as follows: (1) no block at the talocrural joint that would limit ankle dorsiflexion or plantar flexion, and no limitation of subtalar joint mobility that would limit foot inversion or eversion motion; (2) no previous history of trauma to the calf that required surgery; (3) absence of knee flexion contracture; and (4) no history of neurologic dysfunction or disease, systemic disease affecting the lower extremities or ambulation, (5) no macrotrauma involving bone or nerve injury to the lower extremity. The subjects were divided into three equal groups; the first group (untrained group; age = 22.3 ± 2.3 years, body height 171 ± 4.7 cm, body mass = 68.2 ± 6.4 kg). The second group (trained group; age = 22.7 ± 2.7 years, body height 170 ± 6.3 cm, body mass = 68.5 ± 5.6 kg). Both groups performed static stretching exercises. The third group (untrained group; age = 21.9 ± 4.1 years, body height 169 ± 5.9 cm, body mass = 66.2 ± 7.4 kg) served as a control group and did not stretch. A subject was considered trained if they engaged in an aerobic activity at least three times weekly for more than 20 minutes a session (Seymour and Bacharach, 1990). Informed consent was obtained from all subjects participating in this study before any measurements were taken. The research was approved by the ethics committee of the Faculty of Physical Therapy, Cairo University. BODY.MATERIAL AND METHODS.INSTRUMENTATION: A universal goniometer (UG) with a double-armed full-circle protractor made of transparent plastic (Bench-mark Medical, Inc) was used to measure ankle dorsiflexion range of motion (ROM). The length of the arms was 20.3 cm (8 in) and the scale of the protractor was marked in 1° increments. The UG was selected because it is commonly used by physical therapists when making measurements of joint mobility. Isokinetic dynamometer (Biodex Multi-joint System 3) was used to measure the eccentric and concentric torque of calf muscles before (Pre) and after six weeks of static stretching (Post) of plantar-flexors. The test protocol was supplied by the manufacturer and was strictly followed. Prior to data collection, the Biodex device was calibrated, the testing procedures were explained, and each subject was positioned. BODY.MATERIAL AND METHODS.FLEXIBILITY ASSESSMENT: Each volunteer lay prone on a standard treatment table. Maximum active ankle dorsiflexion ROM of the right ankle was measured with the knee straight. This position was selected because lying prone is a functional position for assessment of active ankle dorsiflexion ROM. Both hip and knee joints are extended simultaneously, simulating the stance phase (of the gait cycle) just before heel-off, where the greatest demand for active ankle dorsiflexion ROM, and gastrocnemius is maximally stretched by a combination of knee extension and ankle dorsiflexion (Stauffer et al., 1977). The right hip was placed in neutral rotation with the knee in terminal extension and the foot hanging over the table's edge to permit full active ankle dorsiflexion ROM. The examiner sat in a standard chair at the level of the subject's right leg-ankle-foot complex. Each subject was requested to actively dorsiflex and plantar flex the right ankle joint through the available ROM 4 times for the purpose of preconditioning the soft tissues of the calf muscle-tenden unit (MTU). This maneuver was recommended by Zito et al. (1997) because repeated stretch cycles before the testing procedure improves the reproducibility of a measurement, controlling for temporary lengthening mechanisms associated with stretching of connective tissues. The examiner observed the subject's ankle motion closely to prevent foot eversion during maximum active ankle dorsiflexion ROM, because this extraneous movement would involve dorsiflexion of midtarsal and talocrural joints. The active ankle dorsiflexion ROM was used because the volitional movement of the dorsiflexor muscles would be expected to inhibit the calf MTU via reciprocal inhibition (Kandel et al., 2000). Once the terminal position of active ankle dorsiflexion ROM was achieved after the 4 repetitions, the examiner measured the amount of ankle dorsiflexion using a technique described by Valmassy (1996). A right angle formed by the intersection of the leg's long axis with the foot's long axis was assumed to be the starting position of ankle joint sagittal plane motion. The universal goniometer's stationary arm was aligned parallel with the fibular head, whereas the moveable arm followed the foot's plantar surface just inferior to the fifth metatarsal. The examiner read the measurement scale and reported the results. After the baseline measurement was obtained, the subjects were instructed to hold the stretch for 30 seconds and repeat it 4 times (total of 5 repetitions) with 10-second rest intervals between repetitions. The participants were instructed to perform the stretching exercise twice daily, with at least 4 hours between sessions, for a total ten 30-second stretches per day. The stretching sessions were carried out 5 days a week for 6 weeks because this frequency exceeded that reported by most of the previous investigators (Bohannon et al., 1994; Grady and Saxena, 1991; Muir et al., 1999) who did not find lasting gains in active ankle dorsiflexion ROM, also exceeded the stretching technique conducted by Johanson et al. (2008) who proved that dorsiflexion ROM increased after a gastrocnemius stretching program. BODY.MATERIAL AND METHODS.STRETCHING PROTOCOL: To stretch the plantar-flexor muscles, subjects stood barefoot about 2 to 3 feet from a solid wall. While facing the wall with their right foot perpendicular to it (Kisner and Colby, 1966), they were instructed to move the right foot backward while keeping the left foot forward, placing their hands against the wall and maintaining their right hip and knee in extension with the foot kept flat on the floor. This posture simulates the position of the ankle joint of the posterior leg during the stance phase of gait just before heel rise (Stauffer et al., 1977). No attempt to keep the subject's subtalar joint in a neutral position as Worrell et al. (1994) reported no difference in active ankle dorsiflexion ROM between the supinated and pronated stretching positions. Subjects in our study were instructed to move their right foot back from the wall until they felt a substantial pull in the posterior calf that was just short of being painful. They were asked to maintain this sensation throughout the session either by leaning further into the wall or by moving the right foot even farther back from the wall. The stretching sessions were to be performed between 10 a.m. and 5 p.m. The posttest was conducted on a minimum of 60 and a maximum of 72 hours between the last bout of stretching. BODY.MATERIAL AND METHODS.ISOKINETIC TESTING: Each subject performed a warm-up for 5 min, on a stationary bicycle, pedaling at a comfortable pace of 60 – 70 revolutions per minute and 5 min of stretching exercises for plantarflexors and dorsiflexors. The participants were tested in plantar-flexion-dorsiflexion movements using the Biodex multi joint system 3-isokinetic dynamometer (Biodex Medical Systems, Inc, Shirley, NY). The angular velocities were 30 and 120°/s for plantarflexion and dorsiflexion movements. Each subject was seated on the Biodex chair and stabilized by straps, with the axis of Biodex dynamometer aligned with the lateral malleolus and the angle of hip joint at 80° flexion (0° neutral position). In the ankle plantarflexion-dorsiflexion test a knee pad was placed under distal femur and secured with a strap allowing for approximately 20° to 30° of knee flexion. Also, the examiner ensured that the subject's lower leg was parallel to the floor to diminish the potential for dynamic hamstring activity contributing to the generated torque (Lentell et al., 1988). The foot and ankle were positioned into plantarflexion/dorsiflexion attachment with straps to secure the foot (Figure 1). Once positioned, the participant's active range of motion was used to determine the start and stop angles. The subjects were also allowed to perform 10 submaximal contractions (familiarization trials) through the predetermined ROM at eccentric/concentric mode of testing with speeds of 30 and 120°/s to familiarize them with the dynamometer before the actual test. A rest period of 30 s was allowed between warm up and the actual test, and 1 min was allowed between testing speeds of 30 and 120°/s. The testing protocol consisted of an eccentric loading of the plantar-flexors muscle group, followed by an immediate concentric plantar-flexors muscle contraction. In order to accomplish this, eccentric muscle contraction occurred during passive ankle dorsiflexion mode, and the concentric phase occurred during the ankle plantarflexion mode. Subjects received standardized verbal cues of "hold" during the eccentric phase and "pull" during the concentric phase, with instruction "not to relax between the two stages and maintain plantar-flexors contraction throughout the arc of procedures". This procedure was repeated 5 times at the two angular velocities, the single highest value for each test was used for data analysis. BODY.MATERIAL AND METHODS.DATA ANALYSIS: Data was analysed using a Statistical Package for Social Sciences (SPSS) version 15.0. A multiple measures analysis of variance (MANOVA/mode of contraction and angular velocity) was used to compare plantar-flexor isokinetic values among control, trained and untrained (pre and post) stretching groups. Finally, one-way analysis of variance (ANOVA) was conducted to compare among the control (pre, post), trained and untrained (posttest and pretest) scores of the dorsiflexion ROM. The level of significance was set at 0,05 for all statistical tests with the least significant difference (LSD) used to locate the source of differences. BODY.RESULTS: The peak torque values for the calf muscles during concentric and eccentric contraction at pre and post stretching for the three groups at 30 and 120°/s angular velocities are shown in Table 1. The peak torque values for the plantar-flexor muscles during concentric contraction was always lower than that during the eccentric mode at both angular velocities 30 and 120°/s. Regarding, the angular velocity, the peak torque values for the plantar-flexor muscles at 120°/s was always higher than that at 30°/s during eccentric mode of contraction. However, at 30°/s the peak torque value was higher after stretching of the calf muscles either during concentric or eccentric contractions. During concentric contractions at angular velocities of 30 and 120°/s, there was no significant difference between pre and post peak torque values in the control group (p > 0.05). However, there was a significant difference between pre and post peak torque values in untrained groups at angular velocities of 30 and 120°/s (p < 0.05). Moreover, there was a significant difference between pre and post peak torque values of trained groups at angular velocities 30°/s and 120°/s (p < 0.05). During eccentric contractions, there was no significant difference between pre and post peak torque values in the control group (p > 0.05). However, there was a significant difference between pre and post peak torque values in the untrained group at angular velocities of 30 and 120°/s (p < 0.05). Moreover, there was a significant difference between pre and post peak torque values in the trained groups at angular velocities of 30 and 120°/s (p < 0.05). There was no significant increase in the dorsiflexion ROM in the control and trained groups. However, there was a significant increase in the dorsiflexion ROM in the untrained group (p < 0.05). The dorsiflexion ROM values of the three groups are shown in Table 2. BODY.DISCUSSION: Static stretching is used extensively in physical therapy and rehabilitation programs. The results of this study proved that plantar-flexor muscles static stretching increased ankle dorsiflexion ROM of untrained group without consideration of the subtalar joint position. This finding concurs with the findings of Worrell et al. (1994) who reported an increase in ankle dorsiflexion ROM after gastrocnemius stretching with the subtalar joint positioned in either supination or pronation. The ROM of the trained group did not increase what may be due to regular exercise which increased ROM. The improvement in the flexibility of plantar-flexor muscles of untrained group is not coincident with the results of previous investigators (Bohannon et al., 1994; Grady and Saxena, 1991; Muir et al., 1999) where no significant gains in active ankle dorsiflexion ROM were found. However, the results of the current study supported by findings of Johanson et al. (2008) proved that dorsiflexion ROM increased after a gastrocnemius stretching program. This may be due to the stretching sessions of our study which were carried out at least 5 days a week for 6 weeks. The frequency and duration exceeded those reported by all previously mentioned researchers. The mechanism underlying the increase in joint ROM can be explained by the effect of stretching. In animal studies, the chronic effect of stretching clearly changed both the contractile (Tabary et al., 1972; Williams and Goldspink, 1973), and passive 'non contractile' (Warren et al., 1976) elements of skeletal muscle, but similar changes after static stretching in human muscle have not been demonstrated (Lieber, 2002). In contrast, researchers (Halbertsma et al., 1996; Magnusson et al., 1998; Magnusson et al., 1996) have shown that static stretching of the human hamstrings muscle increased joint ROM without a concomitant decrease in stiffness or electromyographic activity of the stretched hamstrings muscle. These findings suggested that a central, rather than a peripheral, mechanism causes the increase in joint ROM after static stretching, and increased tolerance to stretching is the proposed central mechanism (Halbertsma et al., 1996; Lieber, 2002; Magnusson et al., 1998; Magnusson et al., 1996). If increased tolerance to stretching resulted in increased ankle dorsiflexion range in the study participants, joint positioning may not have been as relevant as it would have been if mechanical changes occurred within the contractile or passive elements of the gastrocnemius muscle. The results of this study indicated that all subjects produced significantly higher eccentric torque values at 120 than at 30°/s, and lower concentric torque values at 120 than at 30o/s. These results are consistent with previous studies (Duncan et al., 1989; Walmsley et al., 1986). The eccentric force-velocity relationship indicates that peak torque increases with velocity, unlike the concentric force-velocity relationship in which peak torque decreases as velocity increases, which may explain our results. Moreover, the results revealed a significant increase in plantar-flexor peak torque concentrically and eccentrically at angular velocities of 30 and 120°/s for experimental groups (trained and untrained). The greater improvement of the peak torque experimental groups proved that changes are caused by static stretching and could not be attributed to other factors such as learning, or repeated testing. The improvement in concentric peak torque production at angular velocities of 30 and 120°/s resulted from the increased storage of potential energy during eccentric loading, which is used in the immediate concentric contraction (Asmussen and Bonde-Petersen, 1974; Cavagna, 1970; Cavagna et al., 1986; Wilson et al., 1991). This added potential energy must be used instantaneously following the eccentric contraction (Pousson et al., 1990). During the evaluation procedure of the current study the eccentric testing was followed immediately by concentric testing. Svantesson et al. (1994) found that, if the eccentric contraction of the plantarflexor was followed by a concentric contraction, it will increase the values of the concentric contraction. Wilson et al. (1992) demonstrated that, by increasing pectoralis and deltoid flexibility, series elastic component stiffness was significantly reduced during a 70% maximal bench press repetition. Moreover, they reported that the initial concentric work of the bench press was significantly increased after stretching. In addition, the bench load increased by 5.4%, which was not significant. Increases in eccentric torque production at angular velocities of 30 and 120°/s can be attributed to the increase in plantar-flexor muscle flexibility and increasing the compliance of the series elastic component that results in a greater ability to store potential energy (Asmussen and Bonde-Petersen, 1974; Cavagna, 1970; Cavagna et al., 1986; Wilson et al., 1992; Wilson et al., 1991). This result is supported by the findings of Worrell et al. (1994) who found that there was significant increase in eccentric torque of hamstrings atangular velocities of 60 and 120°/s post static stretch training. Yamashita et al. (1993) reported that stretching of a musculotendinous unit may also affect neuromuscular transmission. They conducted a study on rats and proved that stretching a rat soleus muscle by 10 and 20% increased posttetanic potentiation of the miniature end-plate potential, which indicates increased Ca2+ conductance in the nerve terminal. This increase in intracellular free Ca2+ facilitates neurotransmitter release. Theoretically, muscle force generation should increase as a result of increased transmitter release. Therefore, the increase in the plantar-flexor concentric and eccentric torque of trained and untrained groups may be due in part to factors other than changes in series elastic component stiffness and flexibility. Finally, chronic static stretching leads to increased muscle force concentrically and eccentrically which differs from its acute effect when applied just before athletic activities, which produce a reduction of muscle strength and power. So, it is advisable to apply static stretching as a part of regular training rather than performing it just before the physical activities which will produce an adverse impact on subjects performance. BODY.DISCUSSION.LIMITATIONS: A limitation of our study was the inclusion of only healthy individuals without limitation in ankle dorsiflexion ROM. In future research, scientists must investigate the effect of static stretching on concentric and eccentric plantar-flexor torque for subjects suffering from ankle dorsiflexion ROM limitations. During stretching, the position of subtalar joint either supinated or pronated was not observed or checked. Future researchers may compare the effect of ankle stretching in supination versus pronation on the plantar-flexor peak torque. Gender in this study was limited to males only. So, the appropriateness of generalizing the results is confined to this specific population. Finally, the plantar-flexors peak torque was measured in the open kinetic chain only in this study, so caution must be taken when generalizing these results to closed kinetic chain activities. Additional studies are needed to determine the effect of increasing plantar-flexors flexibility on closed kinetic chain activities. BODY.CONCLUSIONS: The results of this study revealed that using static stretching techniques 5 repetitions of 30 s/twice daily, five times per week for six weeks, produced a significant increase in plantar-flexors flexibility for untrained individuals regardless of the subtalar joint position. Moreover, static stretching increased the isokinetic eccentric and concentric plantar-flexor peak torque at angular velocities of 30 and 120°/sec for trained and untrained individuals, which is different than the acute effects of stretching, which reduces muscle strength and power.

TITLE: Efficacy of radiotherapy for the treatment of cystic echinococcosis in naturally infected sheep ABSTRACT.BACKGROUND: Radiotherapy is commonly used to treat cancers. To date, there has been no study focusing on the effects of radiotherapy on hydatid disease in large animals. In this study, we aim to investigate the efficiency and safety of radiotherapy for treating hydatid disease caused by Echinococcus granulosus in naturally infected sheep. ABSTRACT.METHODS: Ultrasound was used to screen naturally infected sheep in an echinococcosis endemic area in Xinjiang, China. A computer tomography (CT) scan confirmed the presence of hydatid cysts. Twenty sheep naturally infected with E. granulosus in the liver and/or lungs were randomly assigned into four groups receiving no irradiation, or X-ray irradiation of low (30 Gy), medium (45 Gy), and high dose (60 Gy), respectively. After three months of radiotherapy, a CT scan was performed to measure the changes in the cysts. The hepatic parasite cysts and host tissues were collected for histology and gene expression analysis. ABSTRACT.RESULTS: In the animals subject to irradiation, no significant differences were observed in their appetite, daily activities, and weight before and after radiotherapy. Severe calcification was noticed in the cysts subject to a high dose of radiation compared with the groups subject to low and medium doses. Hematoxylin and eosin staining showed that irradiation contributed to the damage of the cyst structure and nucleus in the germinal layers. Quantitative PCR demonstrated that expression of TPX and HSP70 significantly decreased in a dose-dependent manner (P < 0.05). The expression of the EPC1 decreased in the medium- and high-dose groups compared with the low-dose group (P < 0.05). Meanwhile, the expression of radiation-related apoptosis genes caspase-3 and Gadd45 decreased with an increase in the irradiation dose. ABSTRACT.CONCLUSIONS: Radiotherapy is an option with satisfactory efficiency and safety for treating cystic echinococcosis in sheep with partial response or stable disease at month 3. In future, inhibition of cystic activity using radiotherapy may serve as a new regimen for treating hydatid disease. ABSTRACT.ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1186/s40249-017-0301-7) contains supplementary material, which is available to authorized users. BODY.MULTILINGUAL ABSTRACTS: Please see Additional file 1 for translations of the abstract into the five official working languages of the United Nations. BODY.BACKGROUND: Cystic echinococcosis (CE), a zoonotic disease caused by Echinococcus granulosus [1–3], has become a major public health and economic problem worldwide. An epidemiology survey conducted in 2011 showed that more than 380 000 people were diagnosed with CE in China [4], but treatment remains a challenge. Currently, surgery is the preferred treatment for CE, however, a higher incidence of relapse has been reported. Albendazole has been widely considered as the first-line drug for treating CE, however, the efficiency of chemotherapy is not satisfactory as the agent concentration in the hydatid cysts was low [5]. Therefore, it is urgent to develop a new regimen for treating CE. Radiotherapy may represent an alternative treatment modality, but there is no adequate evidence for it as yet. Up until now, very few studies have been carried out to evaluate the efficiency of radiotherapy for treating such diseases [6–8]. In 2013, Ulger et al. [6] reported that one patient with hydatid cysts in the chest wall, who showed no response to surgery and drugs, achieved local control and pain relief after radiotherapy. Previous studies conducted by us showed that X-ray is lethal for alveolar hydatid disease as it can increase its mortality rate and inhibit cyst growth in vivo (gerbil) or in vitro [7, 8]. To date, there has been no study that has investigated the effects of radiotherapy on hydatid disease in large animals worldwide. In this study, we aim to determine the efficiency and safety of radiotherapy to treat CE in naturally infected sheep. BODY.METHODS.STUDY SUBJECTS: Twenty naturally infected female sheep (aged 3 – 5 years) with liver cystic hydatid disease obtained from the Bayanbulak Grassland (Xinjiang, China) were used in this study. CE was confirmed using the ultrasound technique. The anesthesia procedures were as follows: sheep were initially subject to subcutaneous injection of atropine sulfate (0.1 mg/kg), followed by intramuscular injection of Zoletil (5 mg/10 kg, VIRBAC laboratories, 06516 Carros, France) 15 min later. Subsequently, the following agents were given via intravenous injection (1 ml/10 kg): xylazine hydrochloride (batch No.: 130412, Huamu Animal Health-Care Co., Ltd. Changchun), diazepam (batch No. 14060, Jinyao Amino Acids Ltd. Co., Tianjin, China), atropine (Xixiang Changjiang Animal Pharmacy Ltd. Co., Shaanxi, China, production batch: 140201), and normal saline in a total volume of 10 mL (xylazine hydrochloride: diazepam: atropine: normal saline = 2:2:1:5). The study protocols were approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University. After anesthesia, thoracic and abdominal CT was performed (slice thickness: 5 mm) to determine the lesion number, size, and location as the baseline characteristics. BODY.METHODS.STUDY DESIGN: The sheep were randomly assigned into four groups (with five in each group), including a control group subject to no irradiation; a low-dose irradiation group subject to 30 Gy irradiation; a medium-dose irradiation group subject to 45 Gy irradiation; and a high-dose group subject to 60 Gy irradiation. After anesthesia, each sheep was fixed on an operative table by using a thermoplastic membrane. Subsequently, a computer tomography (CT) scan was performed using a 16-slice Brilliance CT Big Bore scanner (Philips, USA). The proposed irradiation shape was outlined by professional radiologists and radiotherapy was performed by experienced radiotherapists. The radiotherapy was performed in three fractions with an interval of 2 days between each fraction within 7 days to reach the predefined irradiation volume (see Fig. 1).Fig. 1Process of radiotherapy. a sheep were fixed on an operative table by thermoplastic membrane; b radiotherapy was performed by radiotherapist with precise image-guided radiation therapy; c radiotherapy was performed using a linear accelerator A routine blood test was conducted and liver function was determined before radiotherapy, as well as 3 days, 1 month, and 3 months after radiotherapy. Meanwhile, a CT scan was performed 3 months after radiotherapy to determine the changes in lesions. After radiotherapy, all sheep were followed up for 3 months to record any changes in their appetite, activity, and fur. BODY.METHODS.LIGHT AND ELECTRON MICROSCOPY: Three months after radiotherapy, the liver was removed from each sheep to determine the changes of hydatid cyst(s) in the target lesions. The paraffin-embedded tissues were fixed with 4% paraformaldehyde. After hematoxylin and eosin staining, a light microscope was used to detect protoscolices of E. granulosus in the germinal layer and stratum corneum, pathological changes, and the development of cysts. Hydatid cysts were cut into 1 mm × 1 mm × 1 mm blocks, and were immediately fixed with 3% glutaraldehyde potassium oxalate (90 mmol/L) solution at 0 – 4 °C. The tissues were sliced, dehydrated by gradient ethanol and acetone, and double stained by uranyl acetate and lead citrate. Finally, the sections were observed by electron microscopy to detect ultrastructural changes. BODY.METHODS.REAL-TIME POLYMERASE CHAIN REACTION (PCR): Total RNA was extracted from the endocyst using TRIzol (batch No.: 15596026, Life, USA), followed by reverse transcription into cDNA. Real-time PCR was performed on a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, CA, USA) using the primers described in Table 1. The mRNA level was normalized by GAPDH. The amplification results for real-time PCR were calculated according to the 2 (-ΔΔCt) method [9].Table 1Primer sequences of EgTPX, EgEPC1 and Eg HSP70GenesPrimers (5'-3')Product sizeEgTPXForward: TTTCTTAGATAAGCTCGACTCCAAReverse: AGTATATAGACCGGTGAATTAAGGG196bpEgHSP70Forward: GAGGAGTTGTGTTCGGACCTReverse: GTCCGGGTTTATCGACTTGT145bpEgEPC1Forward: TTTCTTAGATAAGCTCGACTCCAAReverse: AGTATATAGACCGGTGAATTAAGGG151bpCaspase-3Forward: CTTTGCTTGCGTCATCCTTAReverse: GGCAGGCCTGAATAAAGAAC152bpGadd45Forward: TGGAATGCGCTCTACTATCGReverse: GCCATGGCCTTGATAAAGAT165bpactinForward: TCAATCCTAAAGCCAATCReverse: CGTACAACGACAGCAC163bp BODY.METHODS.IMMUNOHISTOCHEMISTRY: Immunohistochemistry was performed using rabbit anti-transforming growth factor β (TGF-β) antibody (1:500, batch No. BS-0086R, Biosynthesis Biotechnology Co. Ltd, Beijing, China) and secondary donkey anti-rabbit antibody (1:300, batch No. ab6802, Aibokang Co. Ltd, Shanghai, China). All procedures were conducted using a commercial TGF-β kit (Yansheng Co., Ltd. Shanghai, China) according to the manufacturer's instructions (Bioss, Beijing, China). Cytoplasm stained in a brown colour was considered as positive for TGF-β. BODY.METHODS.IMMUNOFLUORESCENCE: The hydrated paraffin sections were deparaffinised, endogenous peroxidase blocked, antigen retrieved, and blocked by 10% goat serum. Then, the sections were incubated with self-prepared 1% goat serum primary antibody (EPC1, 1:50) at 4 °C overnight. Afterwards, the secondary antibody (1:1 000, batch: A31571, donkey anti-mouse IgG, Alexa Fluor® 647, USA) was added and incubated at room temperature for 1 hour. After washing with PBS, DAPI solution (Solarbio, Beijing, China) (DAPI: methanol = 1:1 000) was used for staining. Finally, the images were observed under an inverted fluorescence microscope (DMI4000B, Leica, Germany). BODY.METHODS.STATISTICAL ANALYSIS: Data analysis was performed using SPSS 17.0 software (IBM SPSS, CA, USA). All measurement data were presented mean ± standard deviation. Analysis of variance was used to compare the groups. All P values of < 0.05 were considered to be statistically significant. BODY.RESULTS.RADIOTHERAPY DID NOT COMPROMISE THE SAFETY OF THE SHEEP: All the sheep were confirmed with E. granulosus infection in the liver with a CT scan (see Fig. 2). No significant differences were noticed in the appetite, daily activities, and weight of the animals before and after radiotherapy (P > 0.05). Compared with the baseline levels, no significant differences were observed in the blood test and liver function before radiotherapy, and 3 days, 1 month, and 3 months after radiotherapy (see Tables 2 and 3). This indicates that radiotherapy did not compromise the safety of the animals.Fig. 2CT-diagnosed hydatid disease in sheep Table 2Routine blood tests before radiotherapy, 3 days, 1 month and 3 months after radiotherapy0 Gy30 Gy45 Gy60 GyPBefore radiotherapyWBC59 ± 3770 ± 4080 ± 3384 ± 560.163HB107 ± 13120 ± 13104 ± 20116 ± 90.331PLT173 ± 56186 ± 69133 ± 30238 ± 480.4183 days after radiotherapyWBC47 ± 3258 ± 5835 ± 2374 ± 570.327HB106 ± 10117 ± 12106 ± 20129 ± 130.079PLT182 ± 42319 ± 322332 ± 214477 ± 2310.2531 month after radiotherapyWBC52 ± 1935 ± 2354 ± 4986 ± 460.267HB116 ± 18104 ± 15104 ± 25129 ± 100.149PLT216 ± 50142 ± 27158 ± 41308 ± 2090.1833 months afterWBC60 ± 4174 ± 5752 ± 4781 ± 450.802HB111 ± 17111 ± 8114 ± 3116 ± 140.899PLT254 ± 77130 ± 87137 ± 54187 ± 1560.296 WBC white blood cell, HB hemoglobin, PLT platelet. There were no significant differences in WBC, HB, PLT within each group and between groups before radiotherapy, 3 days, 1 month and 3 months after radiotherapy Table 3Liver function before radiotherapy, 3 days, 1 month and 3 months after radiotherapy0Gy30Gy45Gy60GyPBefore radiotherapyALT207 ± 54174 ± 33186 ± 52137 ± 110.516AST64 ± 1852 ± 1463 ± 554 ± 150.098r-GT111 ± 6987 ± 3276 ± 2479 ± 250.381TP69 ± 571 ± 272 ± 372 ± 50.8323 days after radiotherapyALT171 ± 57134 ± 53152 ± 57138 ± 700.695AST25 ± 718 ± 623 ± 1221 ± 80.778r-GT87 ± 3279 ± 23130 ± 93117 ± 400.575TP68 ± 766 ± 570 ± 664 ± 90.6111 month after radiotherapyALT203 ± 40160 ± 61145 ± 31214 ± 710.019AST42 ± 918 ± 322 ± 1021 ± 100.227r-GT76 ± 24117 ± 40137 ± 107226 ± 1790.227TP68 ± 777 ± 671 ± 463 ± 80.3653 month after radiotherapyALT260 ± 113190 ± 57199 ± 51136 ± 420.057AST46 ± 2027 ± 822 ± 1223 ± 50.114r-GT79 ± 24195 ± 145160 ± 98142 ± 980.373TP66 ± 668 ± 267 ± 368 ± 50.854 ALT alanine aminotransferase, AST aspartate aminotransferase, r-GT gamma-glutamyltransferase, TP total protein. There were no significant differences in ALT, AST, r-GT and TP within each group and between groups before radiotherapy, 3 days, 1 month and 3 months after radiotherapy BODY.RESULTS.IRRADIATION INDUCED CALCIFICATION IN CYSTS IN A DOSE-DEPENDENT MANNER: In the control group, no significant changes were observed in the size of the lesion at month 3 compared with the baseline level. In the low-dose group, calcification was noticed in the cysts of only one sheep, while the cysts in the other sheep showed no changes. In the medium-dose group, the irradiated cysts in four sheep remained unchanged and the size of cysts decreased in one sheep. In the high-dose group, calcification was noticed in the cysts subject to irradiation in four sheep (see Fig. 3).Fig. 3CT scan before and after radiotherapy in the high-dose group (60 Gy). a cyst in the right lobe of the liver before radiotherapy; b radiotherapy; c visible calcification in the cyst 3 months after radiotherapy BODY.RESULTS.IRRADIATION INDUCED CYSTIC DAMAGES IN VIVO: In this part, pathological analysis was performed to further determine treatment efficacy. As shown in Fig. 4, in the medium-dose group, the tension of irradiated cysts was no longer present, together with the collapse of the cystic wall. However, in the non-irradiated cysts, the cystic tension was high and the cyst was filled with fluid. After irradiation, the edge of liver tissues was darkened in colour and showed signs of liver congestion. Under a light microscope, interruption was observed in the structure of the germinal layer and stratum corneum of irradiated cysts, together with universal swelling, degeneration or thinning, partial separation or breaking, karyolysis, or vanishing of germinal layer (see Fig. 5). However, cysts and protoscolex were rarely seen after irradiation. This indicates that irradiation can cause different degrees of damage to cysts.Fig. 4The cystic tension disappeared with the collapse in the cyst wall in the medium-dose group (45 Gy). The rear part of the irradiated liver was dark in colour with signs of congestion Fig. 5Pathology changes in the irradiated lesions (x200, under microscopy). a normal structure of the germinal layer in the control group; b atrophy in the germinal layer after irradiation in the low-dose group (30Gy); c separated stratum corneum and germinal layer of the irradiated cyst in the medium-dose group (45 Gy); d normal structure stratum corneum disappeared and the germinal layer shed off in the high-dose group (60 Gy) BODY.RESULTS.IRRADIATION INDUCED APOPTOSIS AND NECROSIS IN CYSTIC CELLS: To investigate the molecular mechanism on the treatment efficacy of irradiation on cysts, the expressions of five key genes — namely thioredoxin peroxidase (TPX), heat shock protein 70 (HSP70), EPC1, caspase-3, and growth arrest and DNA damage-inducible protein 45 (Gadd45) — involved in cyst development were determined. The expressions of TPX and HSP70 showed a significant decrease in a dose-dependent manner (P < 0.05, see Fig. 6). The expression of EPC1 decreased in the medium- and high- dose groups compared with the low-dose group (P < 0.05). On this basis, we speculated that elevation of irradiation density inhibited the activity of cysts. Meanwhile, the expression of radiation-related apoptosis genes caspase-3 and Gadd45 decreased as the irradiation dose increased, indicating apoptosis and necrosis occurs in cystic cells after irradiation.Fig. 6Gene expression detected by qRT-PCR. *P < 0.05, compared with the low-dose group BODY.RESULTS.IRRADIATION INDUCED DAMAGES OF GERMINAL LAYER AND CYSTIC WALL: Murine EPC1 polyclonal antibody and Alexa Fluor® 647-labeled donkey anti-mouse IgG secondary antibody were used for indirect immunofluorescence staining. Expression of EPC1 was identified in non-irradiated tissue mainly distributed linearly along the germinal layer, while no expression was noticed in the stratum corneum (see Fig. 7). The expression of EPC1 in the irradiated cyst wall decreased and was intermittently expressed in the part near the damaged germinal layer. No expression of EPC1 was observed in the stratum corneum. In the negative control groups, no or very small non-specific scattered fluorescence reactions were observed. Taken together, we conclude that the cystic germinal layer and cystic wall were severely damaged by radiation.Fig. 7Process of indirect immunofluorescence staining. Column I: phase-contrast images; Column II: nuclear staining images (4', 6-diamidino-2-phenylindole dihydrochloride, DAPI); Column III: anti-EPC1 fluorescence images; Column IV: nuclear staining (blue) image merged with anti-EPC1 fluorescence (red) BODY.RESULTS.IRRADIATION ATTENUATED HYDATID INFLAMMATION AND INFECTION IN SHEEP: To determine the immunological effects of radiation, immunohistochemistry was performed. The expressions of TGF-β and IL-10 were significantly upregulated in the liver tissues adjacent to the irradiated cysts. In contrast, the expressions of TGF-β and IL-10 were weak in the liver tissues adjacent to the non-irradiated cysts, or absent in the liver tissues without cysts. The germinal layer structure was incomplete in the irradiated cysts with no TGF-β and IL-10 expressions, while it was continuous with high TGF-β and IL-10 expressions in the non-irradiated cysts (see Fig. 8). This indicated that hydatid inflammation and host infection was attenuated after radiotherapy.Fig. 8Analysis of TGF-β and IL-10 expressions (×400, under microscopy). TGF-β and IL-10 expression levels in liver tissues (a) and cysts (b) were detected by immunohistochemistry. Representative images were shown BODY.DISCUSSION: Hydatid disease can infect many mammals including sheep and humans [10, 11]. In human cystic hydatid disease, liver is the most commonly affected organ [12, 13]. In this study, sheep naturally infected with E. granulosus were used to mimic human infection to investigate the efficacy and safety of radiotherapy in vivo. Radiotherapy is commonly used to treat cancers [14]. To date, radiotherapy has been used to treat the majority of malignant tumors and more than half of cancer patients would depend on or involve radiotherapy [15]. In addition, radiotherapy can also be used in benign disease treatment, such as scars, hemangioma, genital warts, tinea capitis, or abscess around the hair follicles on the head [16]. To our best knowledge, only a few clinical studies have been conducted focusing on the efficacy of radiotherapy for treating hydatid disease, mainly carried out in vitro or on rat models [7, 17]. For example, in 1998, Schmid reported a decrease of cysts after treatment using Gamma knife radiosurgery in a case with cerebral alveolar hydatid disease [18]. Zhou et al. [19] were the first to report that heavy-ion radiotherapy was more superior to X-ray in terms of inhibiting the growth of hydatid cysts. The maximum dose of radiotherapy should be within the tolerance of normal tissue. As previously described, a dose of 30 – 60 Gy/3f is effective with safety [20, 21]. In this study, the irradiation dose ranged from 0 to 60 Gy. In the three-month follow-up, no significant differences were noticed in the appetite, daily activity, fur, and body weight of the sheep. In addition, no significant differences were observed in the routine blood and liver function tests within each group and among all groups before radiotherapy, as well as three days, one month, and three months after radiotherapy. This indicates that a dose of 30 – 60 Gy/3f induced no bone marrow suppression and liver damage in the sheep. Although the rear part of the irradiated liver showed signs of congestion, liver function remained normal due to the high decompensation capacity of the liver. Therefore, the doses adopted in this study are safe for radiotherapy to treat hepatic hydatid disease. A CT scan is considered to be an effective way to determine the lesion size of cysts after radiotherapy. In this study, the wall calcification was classified as CE5 according to the World Health Organization ultrasound grading after irradiation, indicating that cystic activity was rather low and did not require surgical intervention. Four sheep (80%) showed significant calcification in the high-dose group (60 Gy) compared with the low-dose group, indicating the damage of the cyst was affected by the radiation in a dose-dependent manner. In presence of an intact germinal layer in the cyst, the cyst was filled with hydatid fluid and the cystic tension was high. Upon the destruction of the germinal layer, the tension in the cyst declined. In this study, the tension in the cyst showed obvious decrease in irradiated cysts, together with the collapse of the cystic wall, while the tension in the non-irradiated cysts was still high. Under a microscope, irradiation induced interruption of the stratum corneum and the cyst's germinal layer. As previously described, cyst destruction is a predictor for decreased hydatid activity and vitality [22]. On this basis, the pathological changes confirmed irradiation contributed to the decline of cyst growth and reproduction, which was consistent with our previous findings [7]. To investigate the potential molecular mechanism in the radiation effects on hydatid disease, we determined the expression of related genes using real-time PCR. TPX is expressed in all developmental stages of E. granulosus, which is of great importance in repairing the injury induced by reactive oxygen and antagonizing the host immune cells [23]. EPC1 is polypeptide screened from the cDNA library of protoscolex of E. granulosus with a sensitivity of 92.2% and a specificity of 95.6% [24]. The protein is present on the surface of the germinal layer and can be used as an indicator for hydatid growth. HSP70 is highly expressed and involved in protein translation, transport, and degradation [25, 26]. In our study, the expression of these genes, together with the decrease of the oxidation resistance, growth activity, and oxygen free radicals clearance, was noticed after irradiation in a dose-dependent manner, indicating radiation can kill cysts. Meanwhile, the expression of caspase-3 and Gadd45 related to apoptosis and necrosis [27] decreased after radiation. This implied that large doses of radiation would directly cause cell apoptosis and necrosis. To further detect EPC1's expression before and after radiotherapy, immunofluorescence detection was carried out. Our results indicate that EPC1 was mainly continuously and linearly distributed along the germinal layer of the non-irradiated normal cyst wall, and intermittently expressed along the germinal layer of the irradiated cyst wall. No expression of EPC1 was noticed in the stratum corneum after irradiation. This indicates that EPC1 expressed in the part near the germinal layer surface and was sensitive to cyst activity. The protein expression decreased after radiotherapy, suggesting that radiotherapy contributed to the decrease of cyst activity. It has been reported that liver hydatid disease contributes to the upregulation of TGF-β and IL-10 expressions in the host [28]. The expressions of TGF-β and IL-10 in the liver were also shown to increase after irradiation [29]. In this study, the TGF-β and IL-10 expressions were significantly higher in the liver tissue adjacent to the irradiated cysts compared with the non-irradiated liver tissue, indicating cystic infection and radiotherapy promoted the liver injury pathway mediated by TGF-β and IL-10. Meanwhile, slight expressions of TGF-β and IL-10 were identified in the liver without cysts nearby, demonstrating a tendency for the host affected by E. granulosus to develop liver fibrosis. Furthermore, the expressions of TGF-β and IL-10 in the cystic wall obviously decreased after irradiation, indicating that irradiation contributes to the attenuation of the inflammatory reaction and infection in the host. Our study had some limitations. Currently, surgery and chemotherapy are commonly used for the management of hydatid disease. In the present study, we could not compare the efficiency of radiotherapy and that of chemotherapy in this study. In the future, we will focus on conducting a comparison between these treatments in order to further investigate the efficiency of radiotherapy. BODY.CONCLUSIONS: This study was the first to investigate the efficacy and safety of radiotherapy on sheep naturally infected by E. granulosus, taking into account CT scans, pathology, and molecular biology. Our results indicate that radiotherapy can be a safe option for treating hydatid disease, especially for patients who do not have opportunities for surgery or are irresponsive to chemotherapy.

TITLE: The effectiveness of a group psycho-educational program on family caregiver burden of patients with mental disorders ABSTRACT.BACKGROUND: Brief family intervention may have a positive impact on family caregivers for patients with mental disorders. We assessed the effectiveness of a group psycho-educational program on family caregivers for patients with schizophrenia and mood disorders. ABSTRACT.METHODS: This randomized controlled trial was performed on 100 caregivers for patients with mental disorders attending the Isfahan Behavioral Sciences Research Center (IBSRC), in Isfahan, Iran. One hundred family caregivers of patients with schizophrenia (n = 50) and mood disorders (n = 50) were selected and assigned randomly to either a psycho-educational group intervention or routine care in each diagnosis category. The caregivers were followed for 3 months. Caregiver burden was assessed using the Zarit Burden Interview ABSTRACT.RESULTS: The mean scores of the Zarit caregiver burden decreased significantly for the group that participated in the psycho-educational program, while scores in the control group did not change significantly. ABSTRACT.CONCLUSIONS: This group intervention program was effective to reduce the caregiver burden for both categories of mental disorders in the Iranian population. This group intervention program may improve the quality of life of patients and caregivers by improving the standards of care giving. ABSTRACT.TRIAL REGISTRATION: RCT registration number: IRCT138804272200N BODY.BACKGROUND: The importance of caregiver burden was pointed out as early as the 1950s [1]. Over the past two decades, the focus of the deinstitutionalization movement has shifted from psychiatric hospitals to community mental health centers. However, enough money has not been allocated towards such resources. Family members of patients with seriously mental illnesses were encouraged to participate in this study to gain an understanding of practical help and emotional support for these patients [2,3]. They often provide significant services at home to their relatives who need their help; however, lack of sufficient information and resources has always been an obstacle. As a result, they are not well-prepared to play their roles as efficiently as possible [3-5]. Although care giving may have multiple rewards [6], extensive studies indicate that the intensity and diversity of care giving leads to caregiver strain and burden [7-9]. Family caregivers experience relationship strains, and feelings of grief, loss, sadness, anger, frustration, shame, and guilt as a consequence of caring for a relative at home [10]. Such strains and burden, if left untreated, can result in poor physical and mental health in the family caregivers [11,12]. As a consequence, this burden may reduce the quality of care giving and endanger the mental and physical health of the caregivers themselves [13]. Therefore, interventions such as education, support, psychotherapy, and respite, can be effective in reducing caregiver burden. These interventions enhance the quality of care giving, as well as the physical and mental health of caregivers [14,15]. Thus, reducing caregiver burdens provides better professional mental health outcomes for patients with mental disorders and their caregivers. Although numerous studies have been performed over the past three decades, more studies need to enhance the development and evaluation of effective family intervention strategies. Psychiatric services for patients with severe mental illnesses and their families also need to be improved [16,17]. Group education programs have been widely recommended as a valuable strategy to deliver support and information to family caregivers [5]. Several other studies have also demonstrated the efficacy of family psycho-educational interventions in reducing of relapses, re-hospitalization [18-20] and family burden [21-23]. The psycho-educational intervention is a set of systematic interventions based on supportive and cognitive behavior therapy approaches with emphases on patients and family needs. The intervention is focused on increasing patient and family knowledge about mental disorders, adjusting to mental illness, and communicating and facilitating problem solving skills [24]. Iranian families are characterized by their intimate interpersonal relationships and many interactions among family members. Therefore, illness in one family member results in a substantial burden for the whole family. In addition, Iranian families report a low level of formal support services as compared with their Western peers [25]. Currently, there are no community mental health centers which specifically follow up on patients in Iran. The patients mainly are referred to psychiatrists, psychiatric centers, or primary healthcare centers that do not clearly address the specific needs of each family. Moreover, since mental illness is considered as a taboo in Iranian cultural settings, and many families are not aware of the needs and illness of their family members, they experience a great amount of burden. Also, neither the patients nor their families receive routine non pharmaceutical treatments such as family interventions. Finally, there are not trained professionals to perform such interventions in Iran. Considering the lack of routine long term psychoeducational programs for patients and their families based on their specific needs, we investigated the efficacy of family psycho-education in reducing family caregiver burden. BODY.METHODS.DESIGN: In a randomized controlled trial (RCT), we evaluated the effectiveness of a weekly, 4-session psycho-educational group intervention for caregivers of patients with mental disorders over a period of three months compared with routine care (control group) in the Isfahan Behavioral Sciences Research Center, in Isfahan, Iran. This study was done on a sample of family caregivers of patients with schizophrenia (n = 50) and mood disorders (n = 50). In each group, 25 caregivers were assigned randomly to either a psycho-educational group intervention or routine care. In our study, a caregiver is defined as a member of the family who has the most frequent contact with the patient, financially supports the patient, has participated in the patient's treatment, is older than 15 years, and has good communicational skills. Family caregiver burden was assessed using the Zarit Burden Interview (ZBI) at baseline, at the end of the intervention period, and three months after the intervention. The results were compared between each group. BODY.METHODS.ETHICAL CONSIDERATIONS: Ethical approval was given by the study hospital's ethics committee and the hospital's research governance recommendations were followed. Written informed consent for participation in the study was obtained from family caregivers. An information leaflet about the study was distributed to family caregivers of patients with mental disorders. This research was approved by the Ethics Committee of Isfahan Medical Sciences and was registered in the Iranian Registry of Clinical Trials (IRCT) with a reference number of IRCT138804272200N1. BODY.METHODS.INSTRUMENTS: Data were collected using the ZBI questionnaire. The ZBI is a widely used 22-item assessment tool for measuring the caregiver's perceived burden in providing family care. The questionnaire was translated, and modified according to Iranian cultural standards. Its reliability was calculated using the test-retest method (r =0.94). The psychometric properties of the ZBI include an acceptable inter-item reliability and convergent validity, indicated by a Cronbach's alpha of 0.79 and a correlation coefficient of 0.71 between the caregiver's global evaluation and ZBI scores (Scott, Roberto, Hutton, & Slack, 1985). A test-retest reliability of 0.71 and internal consistency (Cronbach's alpha = 0.91) have also been reported (26–28). This questionnaire asks family caregivers questions about physical, psychological, economic, and communication problems that cause stress and strain for caregivers. The items are answered on a five-point scale ranging from 0 (never) to 4 (always). Scores were calculated by summing up the total chosen statement which ranges from 0 to 88, that higher scores implying greater perceived caregiver burden. BODY.METHODS.INTERVENTION: We developed our intervention based on the families' needs in schizophrenia and mood disorder groups and the existing literature (29, 30). The psycho-educational program consisted of four 120-min sessions held during four consecutive weeks with one session each week. Six psycho-educational groups of eight or nine caregivers (three groups for schizophrenia and three groups for mood disorders) were arranged with the same content, and the program was conducted by a mental health nurse or psychiatrist. The goals and content of each of the four sessions are summarized in Table 1. At the beginning of the first session, a needs assessment was performed in which we asked the caregivers about the types of issues and problems they have with their patients, and what they would like to know about their patient's condition so that we could organize the interventions appropriately. After evaluating the subjects' needs assessments, each psycho-educational session included a variety of educational techniques designed to enhance the participant's learning and maintain their attention (for example; visual aids such as charts, film presentations and Microsoft PowerPoint slideshows). Table 1 The contents of the psycho-educational program Session Session goal Content Pre Session To orient caregivers to the program, to create a trusting relationship between the caregivers and instructors · Overview of the program and introduction of the instructors and members to each other.     · Discussion of the importance of orientation to patient behaviors and symptoms     · Completion of Zarit Burden Interview (ZBI) questionnaire by participants.     · Assessment of family needs. 1 To understand the disorder, its symptoms and treatments, and its effects on patients and families · Case presentation. The instructor offers explanations of the symptoms and behaviors, and their effects on the family.     · Discussion of the etiology and treatments     · Question-answer and group discussion. 2 To recognize the effect of medications and compliance, and to orient caregivers to the warning signs of relapse and relapse prevention · A review of the previous session.     · Discussion of positive and negative effects of drugs and problems related to side effects.     · Emphasis on the importance of drug compliance.     · Discussion about the warning signs of relapse.     · Explanation of the family role in relapse prevention.     · Question-answer and group discussion. 3 To manage the patient’s symptoms, to gain skills in coping with the patient’s symptoms, and to understand effective ways to express emotion and improve communication skills. · A review of the previous session.     · Discussion of the importance of effective communication skills in the family and with the patients when they have symptoms.     · Explanation of skills for coping with some of the patients’ symptoms, and cognitive and behavioral techniques for managing patients’ symptoms     · Exploring intense emotions towards the patient.     · Discussion of expressing emotion and the emotional environment in the family.     · Discussion of how to cope with the patient’s negative emotions (for example, suicide behavior in mood disorder patients).     · Question-answer and group discussion. 4 To orient caregivers to stress management and relaxation for the family · A review of the previous session.     · Introduction of the importance of stress management in the family.     · Discussion of ways to reduce stress.     · Practicing relaxation methods during the session.     · Question-answer and group discussion.     · Conclusion The first part of each session consisted of a lecture given by a psychiatrist or mental health nurse, and the last part of each session (50 min) consisted of a question-and-answer and group discussion period. During this period, the caregivers described situations and incidents related to their family members and discussed alternative ways of coping with and resolving their difficulties with care giving. During these sessions, the caregivers were informed about the patients' disorder patterns, and psychosocial issues were discussed. Moreover, the caregivers were taught how to care for themselves, monitor their own feelings, and how to manage symptoms efficiently. Coping skills and problem solving strategies were also taught in a group format to be the most effective. BODY.METHODS.STATISTICAL ANALYSIS: The SPSS v. 15 was used for statistical analyses. At baseline, socio-demographic characteristics of the two groups were compared using the chi-square test. Between-group comparisons of the variables were performed with Student's t-tests, and repeated measurement analyses of variance were used to determine whether the improvements in these variables changed over time. BODY.RESULTS: The mean age of the caregivers was 43.03 ± 11.90 years. Of these caregivers, 47% were the patients' parents, 22% were the spouses, 20% were the siblings, and 11% were the children. The majority of the participants (92%) were married, and 56% were housewives. The patients' mean age was 34 ± 13.14 years, and most of them (58%) were male. Table 2 summarizes the patients' and their caregivers' additional socio-demographic and clinical data. Table 2 Clinical and socio-demographic data of the patients and their caregivers Demographic and clinical features Percentage of patients Percentage of caregivers Sex Male 58 30   Female 42 70 Age < 20 years 13 2   21-35 years 48 28   36 years 39 70 Marital status Married 65 92   Single 35 8 Educational background No studies/illiterate 3 0   Primary education 48 58   Higher education or more 49 42 Occupational status Housekeeper 30 56   Employee 11 13   Unemployed 30 6   Business & similar jobs 24 19   Other 5 6 Diagnosis Schizophrenia 50 -   Mood disorders 50 - Comparisons of the baseline scores of the variables (FCB Score for Schizophrenia and FCB Score for Mood disorders) did not detect any significant differences between the two groups. The findings after completion of the psycho-educational program and the three month post-intervention scores indicated statistically significant reductions in the family burden scores as compared with the baseline scores (Table 3). Table 3 Family caregiver burden at Time 0 (baseline), time 1 (post-intervention) and time 3 (three months post-intervention) Variables Experimental group (n=25) Mean ± SD Control group (n=25) Mean ± SD   P value FCB Score for Schizophrenia Time 0 57.28 ± 10.60 57.40 ± 11.59   > 0.05 Time 1 32.12 ± 8.52 47.08 ± 10.33   0.001* Time 2 35.80 ± 7.48 44.52 ± 8.28   0.003* Effect of time     14.10 0.01* Effect of treatment     11.32 0.002* Interaction of time and treatment     20.68 0.001* FCB Score for Mood disorders Time 0 52.48 ± 9.02 49.04 ± 11.07   > 0.05 Time 1 25.44 ± 6.81 55.76 ± 11.77   0.0001* Time 2 29.44 ± 7.29 52.88± 10.50   0.0001* Effect of time     48.07 0.001* Effect of treatment     71.99 0.001* Interaction of time and treatment     61.23 0.001* These results regarding the family caregivers to patients with mood disorders showed that the mean scores of burden in the control group was 49.04, 55.76, and 52.88 at baseline, after intervention, and 3 months after intervention, respectively. The mean scores in the experimental group were 52.48, 25.44, and 29.44, respectively. These results are statistically significantly different for the mean burden scores of caregivers for patients with mental disorders between the experimental and control groups (P = 0.001, F = 71.99). Moreover, the interaction between group members and the level of burden for the three stages measured was also significant (P = 0.001, F = 61.23), or, in other words, the decrease of burden in the experimental group is significant compared with the control group. These data demonstrate that group interaction reduced caregiver burden in the experimental group, with the mean burden score being reduced considerably from 52.48 before the intervention to 25.44 after the intervention. This decrease remained low three months after intervention. The mean scores at time 0 (baseline) and time 2 (three month post-intervention) indicated that the experimental group had improved steadily in the family caregivers' burden of schizophrenia (P < 0.001). For family caregivers of schizophrenic patients, the mean burden score in the control group was 57.40, 47.08, and 44.52 at baseline, after intervention, and three months after the intervention, respectively (Table 3), compared with the mean burden scores of 57.28, 32.12, and 35.80, respectively, in the experimental group. Variance analysis with repeated measures demonstrated a significant difference in the mean burden score between the two groups (P = 0.002, F = 11.32), with the mean burden score in the experimental group being lower than the control group. Also, there is a significant correlation between group interaction and the level of burden for the three stages of measurement (P = 0.001, F = 20.68). In other words, the burden in the experimental group decreased significantly as compared with the control group. Intervention had a positive effect on reducing caregiver burden in such a way that the mean burden score decreased considerably from 57.28 at baseline to 32.12 after intervention and still remained low three months after intervention. The mean scores at time 0 (baseline) and time 2 (three month post-intervention) indicated that the experimental group improved steadily in the family caregivers' burden of mood disorders (P < 0.001). BODY.DISCUSSION: Most caregivers in our study were women who also were housewives. In Iranian households, girls or women are responsible for taking care of children, patients, elderly, and disabled people in the family as a part of their daily household chores [13]. Studies in western countries also have shown that women and girls were usually the main caregivers at home with most women being under 60 years of age. The primary caregivers for the elderly are usually their daughters or wives [27,28]. Burden is one of the most commonly used measures to evaluate the effect of intervention. The results of our study confirmed the hypothesis that psycho-educational family intervention has a significant effect on reducing the family caregiver burden when provided in a routine manner [32] for caregivers of family members with schizophrenia and mood disorders. A prospective study on the relationship between burden and coping in caregivers for patients with schizophrenia and mood disorders [33] showed that these caregivers face similar levels of burden and use similar types of coping methods to deal with it. Another psycho-educational group intervention for relatives of patients with bipolar disorders showed that the relative's insight about the disease improved and their burden reduced after one year of follow-up [34]. Magliano and colleagues (2006) reported that 40% of their patients and 45% of their relatives had a significant improvement in their social interactions during the intervention period. Other RCTs that were performed on Chinese [35] and Indian [36] family caregivers for patients with mental disorders confirmed that scores significantly improved after structured psycho-educational interventions compared with routine out-patient care. We have demonstrated that intervention specifically developed for caregivers for patients with schizophrenia and mood disorder in Iran positively can influence burden. Compared with previous studies in which intervention was designed and performed for only a specific group of family caregivers [14,34-36], the intervention used in our study was designed to be effective for care givers for patients with schizophrenia and mood disorders, who comprise considerable numbers of the hospital inpatients in Iranian psychiatric wards. BODY.DISCUSSION.LIMITATIONS OF THIS STUDY: The current study has some limitations. Each family caregiver's personal experience and perception of care could have differed considerably in the experimental and control groups because of personal, familial, and economical differences. The sample size was relatively small, so larger studies are needed to confirm these results. The improvements in the family caregivers' burden were confirmed for a relatively short follow-up period of three months, compared to other studies with a follow-up duration of one year [37]. Therefore, further studies are needed to confirm the long-term effects of this family psycho-educational intervention. Also more studies are recommended to apply different psycho-educational models, and family to family interventions, etc. BODY.CONCLUSIONS: Our group psycho-educational intervention improves the family caregiver burden. Our findings provide evidence that psycho-educational group intervention can be an effective family intervention for Iranian caregivers for family members with mood disorders and schizophrenia. Based on our findings, psycho-educational services for patients and their caregivers are helpful, beneficial and effective. The psycho-educational intervention used in our study is simple, feasible, and cheap, and could prevent the recurrence of severe mental disorders and long hospital admissions, without increasing mental burden or reducing the satisfaction of family care givers. As intervention was effective in decreasing the burden of family caregivers for patients with schizophrenia and mood disorders, it is also likely that this program will be applicable to other psychiatric disorders. Future investigations should focus on obtaining more precise estimates of the contributions of the specific components of this program in reducing burden. The knowledge of how to support family caregivers for persons with mental disorders should be included in the education of healthcare professionals in general, and for the psychiatric team, in particular. BODY.ABBREVIATIONS: FCB: Family Caregiver Burden; IBSRC: Isfahan Behavioral Sciences Research Center; RCT: Randomized Controlled Trial; SD: Standard Deviation; ZBI: Zarit Burden Interview. BODY.COMPETING INTEREST: The authors declare that they have no competing interests. BODY.AUTHOR CONTRIBUTIONS: AN: Main investigator, creating the research question and research design, supervising the study, drafting the article and the guarantor.FK: Data analysis and critical revision of the article. SNR: managing group sessions. All authors read and approved the final manuscript.

TITLE: Randomized trial of the efficacy and safety of a new oral spray for drug‐induced xerostomia ABSTRACT.ABSTRACT: The aim of this study was to evaluate the efficacy, safety, and tolerability of three formulations of DC161 oral spray, a saliva substitute, and a comparator in relieving drug‐induced xerostomia. This was an open‐label, randomized, 4‐period, cross‐over study in adult subjects with drug‐induced xerostomia and documented hyposalivation. During each of the four 1‐day periods, one product (one of three DC161 formulations or the comparator) was applied at T0 and then at T4h (before a meal). Mouth dryness and related symptoms were evaluated by the subject on a 100‐mm visual analog scale. The primary efficacy criterion was the area under the curve of the dry mouth evaluation (baseline to T4h) after the first application. The oral mucosa was examined by a dental specialist; tolerability and product acceptability were assessed by the subject. Twenty‐four subjects were randomized and completed the study. Despite large variability in data among the products, the selected aqueous formulation – DC161‐DP0292 – reduced the intensity of dryness of mouth at least as well as the comparator; DC161‐DP0292 provided a fast relief and a long‐lasting effect on mouth dryness. Both products improved other symptoms such as swallowing and speaking, even when applied just prior to a meal. DC161‐DP0292 was well tolerated and rated by subjects as providing a slightly higher acceptability of taste/aftertaste, texture, and lubricating effect than the comparator. No clinically relevant signs were reported for any product following the oral examination. DC161‐DP0292 provides fast and long‐acting symptomatic relief and is a relevant new treatment for drug‐induced xerostomia. BODY.INTRODUCTION: Dry mouth or xerostomia, a symptom of salivary hypofunction, is a common side effect of many medications and is also associated with various medical conditions. As the number of prescribed drugs increases with age, drug‐induced salivary hypofunction and dry mouth complaints become an increasing health problem. More than 500 commonly used medications can cause xerostomia; these include antidepressants, antihypertensives, opiates, bronchodilators, proton‐pump inhibitors, antipsychotics, antihistamines, diuretics, antineoplastics, and others (Gupta et al., 2006; Mouly et al., 2007). Estimates of the prevalence of persistent dry mouth vary between 10% and 50%. Prevalence is conservatively estimated as approximately 20% in the general population, with increased prevalence in women (up to 30%) and in the elderly (up to 50%) (Orellana et al., 2006; Hopcraft and Tan, 2010; Villa and Abati, 2011). Dry mouth is often attributed to increased prevalence of chronic illnesses that require pharmacological treatments with dry mouth as a side effect (Porter et al., 2004; Thelin et al., 2008). Although salivary flow does not necessarily decrease with age, the synergistic effects of combining medications also contribute to xerostomia, and therefore, the elderly are more likely to suffer from dry mouth. Thus, while drug‐induced xerostomia is generally reversible, the disorders for which these medications are prescribed are frequently chronic. A wide range of therapies are available for the management of xerostomia, including sialagogues and saliva substitutes, as well as general measures like sipping water or chewing gum. However, the effectiveness of many available agents is controversial, and few have been tested in controlled clinical trials. To address this concern, Pierre Fabre Medical Devices has developed three formulations (two aqueous and one oily) of a new oral spray, DC161, which acts as a saliva substitute for the treatment of xerostomia in adults. The aim of these formulations is to act as temporary substitutes for saliva by recreating its physical action without disturbing the oral environment. Their mechanisms of action vary according to the different physical and chemical properties of their components. The purpose of the current study was to evaluate the clinical efficacy of these three DC161 formulations and an active comparator – Aequasyal® oral spray (Carilène Laboratory, Montesson, France), a marketed oily saliva substitute – allowing comparison of outcomes based on the product formulation. Relief of drug‐induced xerostomia and other associated symptoms and the effects on the oral mucosa were assessed, as well as local tolerability and product acceptability. BODY.SUBJECTS AND METHODS.SUBJECTS AND STUDY DESIGN: This was an exploratory, randomized, open‐label, active‐controlled, 4‐period, cross‐over study conducted at a single center in Germany between 7 January 2014 and 21 February 2014. The study was approved by the Landesärztekammer Thüringen Ethics Committee on 28 November 2013, and performed in compliance with the Declaration of Helsinki, Good Clinical Practice Guidelines (CPMP/ICH/135/95), and the EN ISO 14155 (2011) standard for medical devices. All subjects provided written informed consent prior to study participation. The study (EUDAMED no. CIV‐13‐10‐011648) was registered at www.clinicaltrials.gov (NCT02005328). Male and female subjects (18 years and older) were eligible if they had taken drug(s) causing salivary hypofunction/ xerostomia for at least 1 week prior to study initiation and were expected to continue without any change during the study. Most of these subjects were taking chronic medications like beta blockers, antacids, anticholinergics, and psychotropic drugs. Subjects were also required to have a score of ≥40 mm on a 100 mm visual analog scale (VAS) rating dryness of mouth and documented hyposalivation (resting saliva weight ≤0.5 g absorbed over 5 min using a swab method) (Navazesh and Christensen, 1982). Exclusion criteria included bucco‐dental disease, which may have interfered with study conduct; history of head and neck irradiation and cancer chemotherapy; Sjögren syndrome and related autoimmune diseases or other medical causes of xerostomia (oral candidiasis); or a history of major medical/psychiatric illness or surgery. Eligible subjects were equally randomized to one of four treatment sequence groups (ADBC, BACD, CBDA, or DCAB; where A = Aequasyal®, B = DC161‐DP0291, C = DC161‐DP0292, and D = DC161‐DP0293) according to a computer‐generated randomization list provided by the Institut de Recherche Pierre Fabre. Subjects were enrolled by Dr Frank Donath at SocraTec R&D GmbH (Germany). The compositions of the four products evaluated in this study as well as a presentation of the differences in their mechanism of action according to the formulation are provided in Table 1. Table 1 Composition of study products and mechanism of action. Study product DC161‐DP0291 DC161‐DP0292 DC161‐DP0293 Aequasyal® a Formulation Aqueous solution Aqueous solution Oily solution Oily solution Mode of administration Spray Spray Spray Spray Composition Glycerol, polysorbate 80 , soja lecithin , sodium hyaluronate , xanthan gum, potassium chloride, xylitol, anhydrous disodium hydrogen phosphate, potassium dihydrogen phosphate, sucralose , soft mint flavor , macrogolglycerol 40 hydroxystearate, benzylic alcohol, sodium benzoate , cetylpyridinium chloride , alpha tocopheryle acetate , and pure water. Glycerol, povidone K30 , copovidone , xanthan Gum, potassium chloride, xylitol, marshmallow concentrated hydroglycerined extract , anhydrous disodium hydrogen phosphate, potassium dihydrogen phosphate, macrogolglycerol 40 hydroxystearate, potassium sorbate , benzylic alcohol, and pure water. Paraffin liquid, cotton refined oil, orange flavor, and alpha tocopheryle acetate. 94.4% triesters of glycerol oxidized fatty acids of vegetal origin (corn oil); silicium dioxide; food aromas: orange, grapefruit, and mint; and aspartame. Mechanism of action Moisturizing effect as an aqueous solution, which spreads over and is retained on the mucosal surface by its surfactant and humectant properties. Moisturizing effect as an aqueous solution, which spreads over and is retained on the mucosal surface by its coating and thickening agents and its humectant effects. Formation of a protective barrier against dryness by reducing moisture loss from tissue and provide a lubricating effect. Properties provide adherence to the oral mucosa, thus retaining the product in the oral cavity. The effects are 3‐fold: lubrication; provision of adherence properties due to the formation of a lipid film, which reduces the loss of water and restores viscoelasticity of the oral mucosa; and protection against local infections. Differences between the compositions of the two DC161 aqueous solutions are displayed in italics. a Leaflet, July 2010 (translation from French) During each of the four 1‐day study periods (P1, P2, P3, and P4), one of the four test products was applied twice a day, at T0 and at T4h, such that each subject received a total of eight applications of product during the study. The four periods were separated by a washout of 3 days maximum. All applications were performed by the subject at the study center under the investigator's supervision. The two applications of each product were separated by 4 h; the first application was performed after breakfast (the subject had fasted for at least 1 h before the first application), and the second application was performed 15 min before a standard meal. Fluid intake was standardized: for each period, no fluid was permitted from 30 min before until 2 h after the first application; from 2–6 h after the first product application, fluid intake was limited to two glasses of water (2×150 mL). The three DC161 formulations were applied via three sprays in the mouth – one spray inside each cheek and one spray on the tongue. Application of the comparator was performed according to the instructions for use, that is, two sprays in the mouth, one spray inside each cheek, and distribution of the solution in the mouth with the tongue. As the application scheme differed between the comparator spray and the three DC161 sprays, the study was not blinded. BODY.SUBJECTS AND METHODS.CLINICAL ASSESSMENTS.SUBJECT‐REPORTED ASSESSMENTS: Dryness of mouth and other associated symptoms were evaluated using a 100 mm VAS (where 0 mm = "no symptoms" and 100 mm = "the worst imaginable symptoms") for the following 8 items: 1 = difficulty in speaking; 2 = difficulty in swallowing; 3 = saliva in mouth; 4 = dryness of your mouth; 5 = dryness of throat; 6 = dryness of lips; 7 = dryness of tongue; and 8 = level of thirst. During each period, the assessment was self‐performed by the subject 5 min before the first product application (T0) and at 5, 10, 20, 30, and 40 min and 1, 1.5, 2, 3, and 4 h after the first product application; then at 30 min, 1, 1.5, and 2 h after the second application (i.e. T4.5 h, T5h, T5.5 h, and T6h). Local tolerability was self‐assessed by the subject using a 4‐point ordinal scale (0 = none, 1 = mild, 2 = moderate, and 3 = severe) evaluating painful tongue, burning sensation, and tickling after the first and second applications, at T4h (before the second application) and at T6h. Product acceptability was evaluated by the subject under investigator guidance using a 100 mm VAS for assessment of taste, ease of spread, lubrication, ease of use, and sensations in mouth (burning, tickling, and irritation), after the first and second applications (at T4h [before the second application] and at T6h). BODY.SUBJECTS AND METHODS.CLINICAL ASSESSMENTS.INVESTIGATOR‐REPORTED ASSESSMENTS: Safety was assessed via evaluation of the mouth mucosa by the same dental specialist for all subjects. This assessment was carried out using a 4‐point ordinal scale (0 = none, 1 = mild, 2 = moderate, and 3 = severe) measuring redness, dryness of the tissues, and degree of inflammation before the first and second applications (T0 and T4h) and after the second application (at T6h). A global physical examination was carried out by the investigator and was evaluated as normal or abnormal, with further investigation for any abnormal findings. All subject‐assessed local reactions with a score >0 were reported by the investigator as adverse events, as were all other adverse events related to safety. BODY.SUBJECTS AND METHODS.CLINICAL ASSESSMENTS.OUTCOMES: The primary efficacy outcome was the dry mouth evaluation (item 4 of VAS assessment) over 4 h after the first product application (T0–T4h). Secondary efficacy outcomes included the dry mouth evaluation (VAS item 4) over 2 h after the second application (T4h–T6h) and improvement of other dryness‐related symptoms (i.e. VAS items 1, 2, 3, 5, 6, 7, and 8) after the first and second applications (T0–T6h). Other secondary evaluation outcomes included the following: time to onset of action (defined as a reduction of at least 20% from baseline); time to maximum effect; and duration of action after the first and second applications, defined as the time interval between first and last time point where a 20% reduction in VAS from baseline was observed. BODY.SUBJECTS AND METHODS.CLINICAL ASSESSMENTS.STATISTICAL ANALYSIS: A sample size of 24 subjects was arbitrarily chosen. Results are regarded as exploratory in nature, and only descriptive statistics were performed. Two analysis sets were defined. The full analysis set (FAS) included all randomized subjects who received each product of their sequence group and had data available for the primary efficacy criterion for each product. The safety set comprised all randomized subjects who received at least one product application of their sequence group. The primary efficacy endpoint was the area under the curve (AUC) of the dry mouth evaluation (VAS item 4) from baseline to 4 h after the first product application. The primary analysis was performed on the FAS and was descriptive only. The adjusted AUC difference between groups and the associated 95% confidence interval (CI) were calculated using an analysis of variance, including product and period as fixed effects and subjects as random effect on the FAS. All secondary efficacy criteria were analyzed using the analysis of variance model described for the primary analysis, by product group on the FAS. Time to onset of action and time to maximum effect were described according to the Kaplan–Meier method. The duration of action after the first and second applications was described by product using number of subjects, number of missing data, mean, 95% CI of the mean, standard deviation (SD), minimum, and maximum. The safety set was used for all safety analyses. Any reported adverse event starting during a period X until the first application of the next period (X + 1) was attributed to the product applied in period X. BODY.RESULTS.SUBJECTS AND DEMOGRAPHICS: A total of 40 subjects were screened; of these, 16 did not meet the study eligibility criteria, and 24 subjects (17 women [70.8%] and 7 men [29.2%]) were randomized. All 24 subjects completed the study, and therefore, the FAS and safety set were equivalent. Subject demographics and baseline characteristics are shown in Table 2. Overall, mean subject age was 66.8 years (SD: 9.1), and mean body mass index was 30.8 kg/m2 (SD: 4.8). At baseline, the mean VAS score for dryness of mouth (item 4) for all subjects was 73.8 mm (SD: 11.9). Mean saliva weight (collected over 5 min) was 0.31 g (SD: 0.13) overall, and values were similar for the four sequence groups. The most frequently reported concomitant diseases were hypertension (reported by 20 subjects [83.3%]) and Type 2 diabetes mellitus (6 subjects [25.0%]). Table 2 Subject demographics and baseline characteristics. Treatment sequence ADBC n  = 6 BACD n  = 6 CBDA n  = 6 DCAB n  = 6 Total n  = 24 Age (years) Mean (SD) 63.2 (9.5) 68.8 (5.8) 62.8 (12.3) 72.5 (5.2) 66.8 (9.1) Median (range) 66.5 (44–70) 69.0 (59–76) 66.5 (41–73) 72.5 (64–80) 69.0 (41–80) Gender Female 4 (66.7%) 3 (50.0%) 5 (83.3%) 5 (83.3%) 17 (70.8%) Male 2 (33.3%) 3 (50.0%) 1 (16.7%) 1 (16.7%) 7 (29.2%) BMI (kg/m 2 ) Mean (SD) 29.010 (3.329) 31.789 (6.513) 32.914 (5.889) 29.296 (2.360) 30.752 (4.819) Median (range) 28.405 (25.08–34.45) 30.736 (25.78–43.14) 34.150 (25.86–40.98) 28.787 (27.17–33.78) 28.902 (25.08–43.14) Salivation test at baseline Mean (SD) 0.32 (0.15) 0.32 (0.12) 0.30 (0.17) 0.32 (0.13) 0.31 (0.13) Median (range) 0.25 (0.2–0.5) 0.30 (0.2–0.5) 0.25 (0.1–0.5) 0.30 (0.2–0.5) 0.30 (0.1–0.5) Dry mouth evaluation at baseline (VAS item 4) Mean (SD) 77.3 (9.4) 76.2 (7.8) 71.3 (11.5) 70.5 (18.0) 73.8 (11.9) Median (range) 81.5 (59–84) 79.0 (62–84) 75.5 (57–83) 66.5 (45–97) 77.5 (45–97) A = Aequasyal®, B = DC161‐DP0291, C = DC161‐DP0292, D = DC161‐DP0293. BMI, body mass index; SD, standard deviation; VAS, visual analog scale. BODY.RESULTS.EFFICACY.FIRST PRODUCT APPLICATION: T0–T4H: Results for the primary efficacy criterion are shown in Table 3 for the oral spray formulations DC161‐DP0291, DC161‐DP0292, DC161‐DP0293, and the comparator. Data were highly variable, as reflected by the SDs of the mean AUC for dryness of mouth (VAS item 4) as well as the standard errors (SEs) and 95% CIs of the differences between products: all CIs cross zero indicating a lack of statistical significance for all comparisons. However, of the three DC161 formulations tested, only DC161‐DP0292 showed a reduction in mouth dryness versus the comparator: The adjusted mean difference in AUC (T0–T4h) versus the comparator was −935.00 (SE: 577.70; 95% CI: −2088.42, 218.42) for DC161‐DP0292, compared with 350.27 (SE: 577.70; 95% CI: −803.15, 1503.69) for DC161‐DP0291, and 146.02 (SE: 577.70; 95% CI: −1007.40, 1299.44) for DC161‐DP0293. Table 3 Primary efficacy analysis: AUC (T0–T4h) for dryness of mouth (item 4 of VAS) – ANOVA values (FAS). Dryness of mouth DC161‐DP0291 n  = 24 DC161‐DP0292 n  = 24 DC161‐DP0293 n  = 24 Aequasyal® n  = 24 AUC (T0–T4h) of VAS item 4 Mean (SD) 11326.52 (5407.47) 10041.25 (4525.68) 11122.27 (4648.37) 10976.25 (5140.21) Adjusted AUC (T0–T4h) difference between product and comparator LSM (SE) 350.27 (577.70) −935.00 (577.70) 146.02 (577.70) — [LSM 95% CI] [−803.15; 1503.69] [−2088.42; 218.42] [−1007.40; 1299.44] — AUC, area under the curve; VAS, visual analog scale; ANOVA, analysis of variance; FAS, full analysis set; SD, standard deviation; LSM, least square mean; SE, standard error; CI, confidence interval. Based on these results, DC161‐DP0292 (Elgydium Clinic Dry Mouth, Pierre Fabre Oral Care, France) was selected, and therefore, further results will focus on this formulation compared with the comparator. Figure 1 shows the mean VAS scores (mm) for dryness of mouth (item 4) for DC161‐DP0292 and the comparator after the first product application from T0 to T4h (240 min). Mean VAS scores at baseline (before T0) were comparable between products: 53.9 mm (SD: 22.3) for DC161‐DP0292 and 56.1 mm (SD: 21.1) for the comparator. For DC161‐DP0292, the mean change in VAS score for dryness of mouth was −20.2 mm (SD: 20.8) after 5 min, with a further decrease after 10 min (−23.8 mm [SD: 21.5]). For the comparator, the maximum effect was observed after 5 min (−19.1 mm [SD: 16.5]). By the end of the first dosing interval, the residual mean change from baseline was −4.2 mm (SD: 17.8) with DC161‐DP0292 and −3.2 mm (SD: 20.0) with the comparator. Figure 1Values for visual analog scale item 4 (dryness of mouth) from T0 to T4h (expressed as geometric mean). BODY.RESULTS.EFFICACY.SECOND PRODUCT APPLICATION: T4–T6H: Following the second product application (administered at T4h), the adjusted mean difference in AUC (T4‐T6h) between DC161‐DP0292 and comparator for dryness of mouth was −382.69 (SD: 390.86; 95% CI: −1163.06, 397.69). The first postdose time point of assessment was scheduled 30 min after the second product application and 15 min after a meal. The mean change in VAS score for dryness of mouth was −20.5 mm (SD: 17.8) for DC161‐DP0292 and −18.4 mm (SD: 24.8) for the comparator. Despite the different administration conditions for the first and second product applications, the magnitude of the effect observed 30 min after each application was similar. BODY.RESULTS.EFFICACY.TIME TO ONSET AND DURATION OF ACTION: The overall cumulative incidence of clinically significant action (defined as a reduction from baseline of at least 20% of dryness of mouth) was comparable for DC161‐DP0292 and the comparator (Fig. 2). However, time to onset of effect appeared to be shorter for DC161‐DP0292: 18 subjects (75%) had at least a 20% reduction from baseline at 5 min and 20 subjects (83.3%) at 10 min after the first application of DC161‐DP0292 versus 15 subjects (62.5%) and 18 subjects (75%) at 5 and 10 min, respectively, after application of the comparator (Fig. 2). The mean duration of action was 1 h 29 min (SD: 1 h 18 min) for DC161‐DP0292 and 1 h 08 min (SD: 1 h 29 min) for the comparator. Figure 2Cumulative incidence of time to onset of action (reduction of at least 20%): rate of dryness of mouth (visual analog scale item 4) (full analysis set). BODY.RESULTS.EFFICACY.OTHER SECONDARY EFFICACY RESULTS: Regarding the secondary criteria related to the other seven dry mouth symptoms, although these data were also highly variable, both formulations showed similar efficacy profiles to the primary analysis and supported the primary results. From T0 to T4h, DC161‐DP0292 seemed to reduce the intensity of the associated symptoms of xerostomia; although all CIs cross zero, a consistently greater mean improvement versus the comparator was observed, especially over the 4 h after the first product application (Table 4) and particularly during the first 90 min (data not shown). From T4h toT6h, after the second application, these items showed a similar time course of effect for DC161‐DP0292 and the comparator and were generally in accordance with the overall trend observed with item 4 (dryness of mouth). This suggested an improvement in all investigated dry mouth symptoms when the products were used prior to meal intake. Table 4 Secondary efficacy analysis: VAS items 1, 2, 3, 5, 6, 7, and 8 of VAS – adjusted AUC difference for DC161‐DP0292 versus comparator (FAS). VAS item Adjusted AUC difference between DC161‐DP0292 and comparator (Aequasyal®) T0–T4h T4h–T6h 1 = difficulty in speaking LSM (SE) −791.94 (525.11) −124.83 (352.88) [LSM 95%CI] [−1840.36; 256.48] [−829.38; 579.71] 2 = difficulty in swallowing LSM (SE) −579.02 (620.40) 0.58 (385.49) [LSM 95%CI] [−1817.70; 659.65] [−769.07; 770.24] 3 = saliva in mouth LSM (SE) −683.17 (594.59) −128.25 (365.16) [LSM 95%CI] [−1870.30; 503.97] [−857.31; 600.81] 5 = dryness of throat LSM (SE) −733.62 (587.84) −368.02 (364.85) [LSM 95%CI] [−1907.28; 440.03] [−1096.47; 360.43] 6 = dryness of lips LSM (SE) −629.71 (759.60) −23.79 (457.15) [LSM 95%CI] [−2146.30; 886.88] [−936.53; 888.94] 7 = dryness of tongue LSM (SE) −525.87 (548.39) −165.60 (380.42) [LSM 95%CI] [−1620.77; 569.02] [−925.13; 593.92] 8 = level of thirst LSM (SE) −437.50 (704.91) −49.60 (437.90) [LSM 95%CI] [−1844.90; 969.90] [−923.90; 824.69] VAS, visual analog scale; AUC, area under the curve; FAS, full analysis set; LSM, least square mean; SE, standard error; CI, confidence interval. BODY.RESULTS.SAFETY AND TOLERABILITY: All 24 subjects received the four products and were included in the safety set. No clinically relevant abnormalities were detected with any product following systemic or local examinations. No serious adverse events or events leading to study product discontinuation or premature withdrawal were reported during the study. Related treatment‐emergent adverse events were mainly reported in the gastrointestinal disorders system organ class (one event each after application of the DC161‐DP0292 formulation and comparator). There were no relevant differences between products in terms of incidence and type of related treatment‐emergent adverse event. Objective assessment of the oral mucosa showed no relevant safety signals, with mainly mild or moderate dryness of mouth tissue reported for most subjects (as would be expected in this subject population), with only one case of mild redness with DC161‐DP0292 but no signs of inflammation. In all groups, local tolerability was assessed as very good (score of 0 for painful tongue, burning sensation, and tickling) by over 90% of subjects throughout the study following both product applications. Product acceptability for the DC161‐DP0292 formulation and the comparator, as rated by subjects after the first and second product applications, is shown in Figures 3 and 4, respectively. Subjects' overall evaluation of the product was higher for DC161‐DP0292 than comparator following both applications. After the first application, acceptability of product taste, aftertaste, texture, and lubricating effect was higher for DC161‐DP0292. Sensations of burning, irritation, and tingling as well as ease of use of the spray were rated similarly for the two products following the first application, and only ease of spread was rated higher for the comparator (Fig. 3). After the second application, product acceptability for DC161‐DP0292 was higher or similar to the comparator for all rated items (Fig. 4). Figure 3Product acceptability after the first application (full analysis set). Figure 4Product acceptability after the second application (full analysis set). BODY.DISCUSSION: Drug‐induced xerostomia is a common side effect associated with many pharmacological drug classes (Gupta et al., 2006). If the dry mouth condition becomes chronic, it may lead to important oral pathological changes, with increased risk of infections and caries (Porter et al., 2004). In addition, dry mouth can have a marked negative impact on the patient's quality of life as a result of the impairment of oral functions. Age and polypharmacy play a very important role in patients with xerostomia (Porter et al., 2004; Thelin et al., 2008). Consequently, in elderly patients, particularly those over 65 years of age, saliva substitutes represent the best palliative management option, although no ideal artificial saliva has been developed to date. Existing products replace the components and functions inherent to natural saliva, which are impaired as a result of dry mouth. Because of their lack of undesirable effects, saliva substitutes can be used for prolonged time periods as palliative or coadjuvant treatment, depending on the severity of hyposialia. Likewise, these products can be used as often as required and are adaptable to the needs of the individual patient and degree of oral dryness (Silvestre et al., 2009). In the current study, three formulations (two aqueous and one oily) of DC161 oral spray, a new saliva substitute, and an active comparator, Aequasyal® oral spray (oily), were assessed for clinical efficacy in terms of their relief on drug‐induced xerostomia and other associated symptoms. The subjective intensity of various symptoms was self‐assessed by the subject using a 100 mm VAS, a validated and well‐described assessment tool. Taking into account the overall variability of the data, as well as the sample size, only slight differences between the products could be deduced from the primary criterion, VAS item No. 04 "Dryness of your mouth". None of the three DC161 formulations showed a statistically significant difference in effect versus the comparator. However, only the DC161‐DP0292 aqueous formulation (Elgydium Clinic Dry Mouth) showed a reduction in intensity of dryness of mouth versus the comparator (−935.00 [SE: 577.70; 95% CI: −2088.42, 218.42]) and was therefore selected for overall comparison. Although there were no statistically significant differences between the two products, the maximum effect on dryness of mouth following the first product application was marginally higher for DC161‐DP0292 than the comparator and occurred 5 min earlier. The onset of action, defined as a clinically relevant mean reduction of 20% from baseline, was observed within the first 5 min in 75% of subjects for DC161‐DP0292 (62.5% for the comparator). Dry mouth is a sign as well as a symptom and is usually accompanied by generalized discomfort, eating and speaking disturbance (Eveson, 2008). As expected, the secondary criteria evaluated in this study showed an improvement in other symptoms, including swallowing and speaking, consistent with a reduction in mouth dryness. These effects were also observed when the spray was applied just before a meal (second product application). Optimal topical treatment in xerostomia should provide fast relief and a long‐lasting effect, although published evidence in the literature is quite variable. For example, in one study (Silvestre et al., 2009), around 50% of patients showed immediate improvement with a new artificial saliva spray, and the average duration of effect was 15.3 min. For Mouly et al. (2007), improvement with saliva spray was only achieved from the second day for most patients, and average duration of effect was over 4 h. In our study, DC161‐DP0292 had a long duration of clinically relevant action (1 h 29 min ± 1 h 18 min), similar to that of the comparator (1 h 08 min ± 1 h 29 min). The main study limitation was use of a subjective evaluation of dry mouth symptoms, which likely contributed to the large variability in responses observed between formulations. In addition, evaluations were performed after only two applications of each product and in a limited number of subjects, and these factors should therefore be taken into consideration. As the study was not blinded, both the investigator and subjects were aware of the formulations being investigated and could bias the subjective assessments. Also as the scheme of application differed between the test products and comparator, it was not blinded; however, subjects were randomized in four different sequence groups to test all four products, allowing comparison of all three DC161 formulations with the comparator. This study was designed as an exploratory study, and the analysis was not planned to be demonstrative (no rationale for sample size). Topical treatment response in general depends directly on patient compliance, which can be jeopardized by poor local tolerability and acceptability. Discomfort sensations, as well as ease of use and flavor, are important factors to evaluate for the treatment of dry mouth with artificial saliva. In the study by Silvestre et al. (2009), flavor was rated as favorable by almost 50% of the test subjects. In the present study, besides very good local tolerability, the subject self‐rated assessment indicated that DC161‐DP0292 provided a slightly higher acceptability of taste/aftertaste, texture, and lubricating effect versus the comparator. In patients with xerostomia, because the properties of saliva are usually impaired, a saliva substitute not only maintains mouth humidity but also promotes a lubricating effect and therefore prevents the disorders related to impaired saliva secretion (Humphrey and Williamson, 2001). BODY.CONCLUSION: This study in 24 subjects with drug‐induced xerostomia was conducted to assess the efficacy, safety, and tolerability of three different new oral spray formulations of DC161 (two aqueous and one oily) and an active comparator Aequasyal® (oily). In general, analysis of the primary criterion showed that despite large variability among the products, the selected aqueous formulation – DC161‐DP0292 – could reduce the intensity of dryness of mouth at least as well as the comparator: DC161‐DP0292 provided fast relief and a long‐lasting effect on mouth dryness. Both DC161‐DP0292 and the comparator improved other symptoms associated with dry mouth such as swallowing and speaking, even when applied just before a meal. The DC161‐DP0292 formulation was well tolerated and rated by subjects as providing a slightly higher acceptability of taste/aftertaste, texture, and lubricating effect than the comparator. This new oral spray, presented as an aqueous formulation, DC1661‐DP0292, is therefore considered to be a relevant treatment for drug‐induced xerostomia, providing fast and long‐acting symptomatic relief while potentially improving patient compliance. BODY.CONFLICT OF INTEREST: F. D. is an employee of SocraTec R&D, a company that received payment for study monitoring and medical writing. F. T., R. C., JPh. G., and J. B. are employees of Pierre Fabre Laboratories. BODY.FUNDING INFORMATION: Pierre Fabre Medical Devices provided funding for the study.

TITLE: The impact of including corticosteroid in a periarticular injection for pain control after total knee arthroplasty ABSTRACT: There is conflicting evidence about the benefit of using corticosteroid in periarticular injections for pain relief after total knee arthroplasty (TKA). We carried out a double-blinded, randomised controlled trial to assess the efficacy of using corticosteroid in a periarticular injection to control pain after TKA. A total of 77 patients, 67 women and ten men, with a mean age of 74 years (47 to 88) who were about to undergo unilateral TKA were randomly assigned to have a periarticular injection with or without corticosteroid. The primary outcome was post-operative pain at rest during the first 24 hours after surgery, measured every two hours using a visual analogue pain scale score. The cumulative pain score was quantified using the area under the curve. The corticosteroid group had a significantly lower cumulative pain score than the no-corticosteroid group during the first 24 hours after surgery (mean area under the curve 139, 0 to 560, and 264, 0 to 1460; p = 0.024). The rate of complications, including surgical site infection, was not significantly different between the two groups up to one year post-operatively. The addition of corticosteroid to the periarticular injection significantly decreased early post-operative pain. Further studies are needed to confirm the safety of corticosteroid in periarticular injection. Take home message: The use of corticosteroid in periarticular injection offered better pain relief during the initial 24 hours after TKA. Cite this article: Bone Joint J 2016;98-B:194–200. BODY: Pain after total knee arthroplasty (TKA) may be severe.1 The use of periarticular injection to control the pain of TKA has gained wide acceptance.2-5 The agents used in modern periarticular injections typically include corticosteroid, local anaesthetic, opioid and a non-steroidal anti-inflammatory drug (NSAID).1,4 Corticosteroid is believed to be a key component because of its local anti-inflammatory effects and its ability to reduce the local stress response to surgery.1 However, there is conflicting evidence about its benefits.6-11 Some studies have shown that post-operative pain is improved with corticosteroid,6-9 whereas others have shown no benefit.10,11 Christensen et al10 conducted a randomised controlled trial (RCT) which compared patients who had a periarticular injection with or without corticosteroid, and concluded that the corticosteroid had no impact on post-operative pain. Chia et al11 compared patients who had a periarticular injection containing high- or low-dose corticosteroid and found no improvement in the level of post-operative pain. We conducted a double-blinded RCT to investigate the clinical effectiveness of corticosteroid in a periarticular injection for pain control after TKA. Our hypothesis was that the post-operative pain score would be lower in patients who had a periarticular injection which included corticosteroid. BODY.PATIENTS AND METHODS.STUDY DESIGN: This prospective, two-arm, parallel-group, double-blinded, RCT was conducted at Nekoyama Miyao Hospital which specialises in knee and hip surgery. The study was approved by the institutional review board. All patients provided written informed consent. The study was registered with the University Hospital Medical Information Network (registration number UMIN000012257) as a RCT with the title "Impact of corticosteroid on periarticular injection for pain control following total knee arthroplasty: a double-blind randomised trial" before the onset of participant enrolment. The study focused on post-operative pain during the first 24 hours after TKA. BODY.PATIENTS AND METHODS.PARTICIPANTS: Participants were recruited between November 2013 and April 2014. Eligible patients were at least 18 years of age and scheduled for unilateral TKA. Exclusion criteria were poorly controlled diabetic mellitus, defined as haemoglobin A1c level was over 7.0%;12 spinal anaesthesia contraindicated; allergy or intolerance to one of the study drugs; regular opioid use; renal insufficiency, and a prolonged QT interval on electrocardiography. Participants were informed that we were testing the efficacy of corticosteroid for pain control after TKA and that they would be randomly assigned to receive a periarticular injection of a mixture with or without corticosteroid. BODY.PATIENTS AND METHODS.RANDOMISATION AND BLINDING: Randomised numbers from zero to 99 were generated using computer software (Excel 2010, Microsoft, Redmond, Washington). These randomised numbers were then put into an opaque envelope. Just before surgery, a sealed envelope was selected in the pharmacy department by one of two unblinded allocating staff who did not take part in surgery or the assessment of outcome. The selected number was confirmed by the two allocating staff. They were instructed not to discuss the products used with the patient. Patients with even numbers were allocated to the group who were to have the periarticular injection which included corticosteroid, and those with odd numbers were allocated to the group without corticosteroid. A member of the pharmacy department prepared and delivered the periarticular injection solution to the operating theatre. We ensured that the patients, care providers, and outcome assessors were blinded to the group assignment during the study period. They were all unaware of the randomisation given by the allocating staff. BODY.PATIENTS AND METHODS.INTERVENTIONS: We used a control solution for periarticular injection which contained ropivacaine, morphine, epinephrine, and ketoprofen without corticosteroid, and compared its effect with that of a periarticular injection solution which contained the same agents but with corticosteroid. The corticosteroid solution consisted of methylprednisolone 40 mg (Sol Mercort, Fuji, Toyama, Japan) (1 mL), 7.5 mg/mL ropivacaine (Anapeine, AstraZeneca, Osaka, Japan) (40 mL), 10 mg/mL morphine hydrochloride hydrate (Takeda, Osaka, Japan) (0.8 mL), 1.0 mg/mL epinephrine (Bosmin, Daiichi-Sankyo, Tokyo, Japan) (0.3 mL), 50 mg of ketoprofen (Capisten, Kissei, Matsumoto, Japan) (2.5 mL), and normal saline (15.4 mL). Just before implantation of the prosthesis, 20 mL of the mixture was injected into the posterior capsule and the posteromedial and posterolateral structures.2 Small volumes of the solution were injected into multiple sites with the knee in flexion.13 After implantation, the remaining 40 mL of mixture was injected into the extensor mechanism, synovium, anterior capsule, pes anserius, retinaculum, periosteum, iliotibial band, and collateral ligaments.2 The procedure for periarticular injection without corticosteroid was identical to that for periarticular injection with corticosteroid except that the injectable solution contained an equivalent volume of normal saline. BODY.PATIENTS AND METHODS.PRE- AND POST-OPERATIVE MEDICATION: These were identical in both treatment groups except for the use of corticosteroid. For all patients included in the study, NSAID (50 mg of flurbiprofen axetil, Ropion, Kaken, Tokyo, Japan) was given intravenously four hours after spinal anaesthesia had complete resolution. From the day after surgery, an NSAID (60 mg of loxoprofen, Surinofen, Aska, Tokyo, Japan) was given orally three times a day. No parenteral narcotics were used. For rescue analgesia, a 25 mg or 50 mg diclofenac sodium suppository (Adefuronic zupo, Teva, Nagoya, Japan) was used. An intravenous first-generation cephalosporin (cefamezin, Cefazolin, Astellas, Tokyo, Japan) was given peri-operatively and every eight hours for the first 48 hours after surgery. We gave 1 g of tranexamic acid intravenously (Transamin, Daiichi-Sankyo, Tokyo, Japan) just before skin incision and again six hours after the first dose. For thromboprophylaxis we injected 1.5 mg or 2.5 mg of fondaparinux (Arixtra, GlaxoSmithKline, Tokyo, Japan) subcutaneously once every evening for ten days, starting from the first post-operative day. BODY.PATIENTS AND METHODS.SURGERY AND REHABILITATION: All patients had a spinal anaesthetic using 2.0 mL to 2.8 mL of 0.5% bupivacaine (Marcaine, AstraZeneca, Osaka, Japan). All operations were carried out by one of two surgeons (ST and MW). Neither pneumatic tourniquet nor drain was used during the study period. A subvastus approach was used in every case. All patients had a cemented, posterior stabilised prosthesis (Scorpio NRG, Stryker Orthopaedics, Mahwah, New Jersey) implanted. The post-operative rehabilitation regimen was the same for both groups, and started the day after surgery. BODY.OUTCOME MEASUREMENTS.PRIMARY OUTCOME: Staff who were unaware of the treatment group to which each patient had been assigned conducted all assessments. The primary outcome was pain at rest during the first 24 hours after surgery. Intensity of pain was rated using a 100 mm horizontal visual analogue scale (VAS) in 10 mm increments, in which 0 mm represented no pain and 100 mm represented extreme pain. Before surgery, all patients were instructed in use of the VAS. Time zero was defined as the time at which spinal anaesthesia had complete resolution.14 The VAS score at rest was recorded every two hours from four to 24 hours from time zero, when the patients were awake. After this 24-hour time period, the VAS score was recorded every eight hours for a further 48 hours, that is until 72 hours had elapsed from time zero. BODY.OUTCOME MEASUREMENTS.SECONDARY OUTCOMES: The post-operative level of pain during activity was estimated on a VAS score once a day until the third post-operative day. The strongest pain experienced during physiotherapy on a particular day was recorded as the VAS score during activity. Range of movement was measured by the physiotherapist. The data were collected during the hospital stay (from days one to 14 after surgery) and during regularly scheduled post-operative visits (at one, two, three, six, and 12 months after surgery). The number of diclofenac sodium suppositories used as rescue analgesia was recorded. Any complications that occurred during the course of the trial were recorded: particular emphasis was placed on wound complications, surgical site infections, and opioid-related side effects. Diagnosis of surgical site infections was performed using the Centres for Diseases Control standardised criteria.15 BODY.OUTCOME MEASUREMENTS.SAMPLE SIZE: Based on previous studies, we considered a 20-point decrease in the VAS score as clinically meaningful when comparing different regimens of pain control after TKA.4,16-18 We calculated that with a sample of 74 patients (37 patients per treatment group), the study would have 80% power to detect a 20-point mean decrease in the VAS score, with a type I error of 5%. For power analysis, we used a standard deviation of 30 in the VAS score for the data of a previous study in post-operative unilateral TKA patients managed under spinal anaesthesia and periarticular injection.16 BODY.OUTCOME MEASUREMENTS.STATISTICAL ANALYSES: We used the area under the curve of the VAS scores at rest to assess primary outcome. The area under the curve represents the cumulative VAS score over the period of observation.19 A line graph for each patient was made with VAS score on the vertical (y) axis and time after surgery on the horizontal (x) axis. The area under the curve in the line graph was divided into a series of trapezoids, and determined by calculating the sum of the areas of each of the individual trapezoids. A lower area under the curve represents better pain relief during the period of observation. The area under the curve for the first 24-hour post-operative period was compared between groups with Student's t-test after confirming normality with the Kolmogorov-Smirnov test. The area under the curve for the first 24-hour post-operative period was also compared using the Mann–Whitney U test. For missing primary outcome data, we replaced VAS scores either by linear interpolation in cases in which the missing scores fell between two valid scores or by the median scores for the other patients at the same time point in the same treatment group. Comparisons between the study groups were undertaken using the chi-squared test for categorical variables and Student's t-test for continuous variables. All tests were two-sided, and p < 0.05 was considered statistically significant. BODY.RESULTS.PATIENTS: Figure 1 is a flow chart which outlines the progress of the trial. Of 87 applicants screened for eligibility, 77 were randomly assigned to receive a periarticular injection with or without corticosteroid (n = 40 and n = 37, respectively). After randomisation, we excluded two patients in the corticosteroid group: one patient cancelled the operation and one patient had to have a general anaesthetic because spinal anaesthesia failed. Fig. 1Flow chart showing patient recruitment and progression of trial. Table I summarises the demographics of the patients in the two groups. The baseline characteristics were similar in both groups. Table I Patient demographics and baseline clinical characteristics (data are presented as means with ranges) Steroid (n = 40) No steroid (n = 37) p-value Age (yrs) 75 (58 to 88) 72 (47 to 88) 0.14 * Sex (female/male) 35/5 32/5 0.89 † Side (right/left) 16/24 22/15 0.088 † Height (cm) 149 (134 to 166) 150 (131 to 167) 0.50 * Weight (kg) 59 (39 to 80) 62 (40 to 108) 0.29 * Body mass index (kg/m 2 ) 26.7 (20.5 to 38.6) 27.3 (18.4 to 40.6) 0.51 * Pre-operative diagnosis (OA/RA/AVN) 37/2/1 34/1/2 0.71 † History of Diabetes Mellitus (yes/no) 2/38 6/31 0.11 † Pre-operative VAS at rest (mm) 26 (0 to 90) 18 (0 to 60) 0.16 * Pre-operative VAS during activity (mm) 56 (0 to 100) 55 (0 to 100) 0.91 * Pre-operative flexion angle (°) 127 (60 to 160) 129 (95 to 160) 0.62 * Pre-operative extension angle (°) -8 (-25 to 0) -11 (-30 to 0) 0.13 * Intra-operative blood loss (mL) 181 (43 to 490) 219 (37 to 628) 0.17 * Duration of operation (min) 84 (70 to 101) 88 (69 to 116) 0.079 * * p-values were determined with Student’s t -test † p-values were determined with the chi-squared test VAS, visual analogue scale; OA, osteoarthritis; RA, rheumatoid arthritis; AVN, avascular necrosis BODY.RESULTS.OUTCOMES: The VAS scores at rest are shown in Figure 2 and Table II. In both groups, the hypotheses of normality were not rejected according to Kolmogorov-Smirnov test (p = 0.092 in the corticosteroid group, and p = 0.17 in the no-corticosteroid group). The corticosteroid group had a significantly lower area under the curve post-operatively at four to 24 hours compared with the no-corticosteroid group (mean 139 mm × day (0 to 560) vs 264 mm × day (0 to 1460), p = 0.024, Student's t-test). The significance of difference was also confirmed with non-parametric statistics (median 75 mm × day vs 240 mm × day, p = 0.033, Mann–Whitney U test). Fig. 2Graph showing visual analogue scale scores for pain at rest after total knee arthroplasty. The area under the curve was significantly lower in the corticosteroid group at four hours to 24 hours post-operatively (p = 0.024). Table II Visual analogue scale score for post-operative pain at rest (data are presented as means with ranges) Duration after surgery (hrs) Steroid (n = 38) No steroid (n = 37) p - value 4 2 (0 to 40) (n = 35) 2 (0 to 80) (n = 35) 0.83 6 2 (0 to 20) (n = 35) 3 (0 to 50) (n = 36) 0.80 8 6 (0 to 60) (n = 35) 5 (0 to 60) (n = 36) 0.76 10 8 (0 to 50) (n = 33) 10 (0 to 60) (n = 32) 0.67 12 8 (0 to 50) (n = 25) 10 (0 to 70) (n = 31) 0.69 14 12 (0 to 50) (n = 24) 14 (0 to 60) (n = 18) 0.63 16 7 (0 to 40) (n = 17) 14 (0 to 80) (n =23) 0.22 18 6 (0 to 40) (n = 33) 21 (0 to 70) (n = 26) 0.0019 20 8 (0 to 40) (n = 29) 24 (0 to 80) (n = 35) 0.0033 22 12 (0 to 50) (n = 21) 25 (0 to 90) (n = 22) 0.046 24 17 (0 to 70) (n = 38) 26 (0 to 80) (n = 36) 0.057 32 22 (0 to 80) (n = 37) 32 (0 to 100) (n = 37) 0.070 40 28 (0 to 90) (n = 37) 39 (0 to 100) (n = 36) 0.081 48 34 (0 to 90) (n = 38) 29 (0 to 70) (n = 37) 0.17 56 30 (0 to 70) (n = 35) 32 (0 to 80) (n = 35) 0.62 64 31 (0 to 70) (n = 36) 30 (0 to 80) (n = 36) 0.73 72 29 (0 to 60) (n = 35) 30 (0 to 80) (n = 35) 0.81 Visual analogue scale score was rated using a 100 mm horizontal scale in 10 mm increments All p-values were determined with Student’s t -test In the point-by-point evaluation, the corticosteroid group had significantly lower mean VAS scores at 18, 20, and 22 hours than the no-corticosteroid group (6 mm (0 to 40) vs 21 mm (0 to 70), p = 0.0019, 8 mm (0 to 40) vs 24 mm (0 to 80), p = 0.0033, and 12 mm (0 to 50) vs 25 mm (0 to 90), p = 0.046, respectively). There was no difference in VAS score at rest between the two groups 24 hours after surgery. The mean VAS score during activity was significantly lower in the corticosteroid group than in the no-corticosteroid group one day after surgery (34 mm (0 to 80) vs 49 mm (0 to 80), p = 0.013) (Table III). Table III Visual analogue scale for post-operative pain during activity (data presented as means with ranges) Duration after surgery (days) Steroid (n = 38) No steroid (n = 37) p - value 1 34 (0 to 80) 49 (0 to 80) 0.013 2 46 (20 to 80) 51 (0 to 100) 0.27 3 40 (0 to 70) 42 (10 to 80) 0.82 Visual analogue scale score was rated using a 100 mm horizontal scale in 10 mm increments All p-values were determined with Student’s t -test In terms of flexion angle, the corticosteroid group had a significantly better mean range of movement at one, two, and six days after surgery (mean 67° (40° to 95°) vs 57° (30° to 95°), p = 0.014, 73° (40° to 100°) vs 65° (35° to 100°), p = 0.017, and 91° (65° to 115°) vs 84° (60° to 100°), p = 0.021, respectively) (Fig. 3, Table IV). The corticosteroid group had a significantly better mean extension angle at one, two, three, and ten days after surgery (-6° (-10° to 0°) vs -9° (-20° to 0°), p = 0.0046, -7°(-15° to 0°) vs -10° (-25° to 0°), p = 0.0060 and -4° (-10° to 0°) vs -7° (-20° to 0°) p = 0.022, respectively) (Table IV). Fig. 3Graph showing the mean flexion angle of the knee (with standard deviation) after total knee arthroplasty. The corticosteroid group had a significantly better mean flexion angle on post-operative days one and two (p = 0.014 and p = 0.017, respectively). Table IV Range of movement after total knee arthroplasty (data are presented as means with ranges) Post-operative day Steroid (n = 38) No steroid (n = 37) p - value Flexion angle (°) Flexion angle (°) 1 67 (40 to 95) 57 (30 to 95) 0.014 2 73 (40 to 100) 65 (35 to 100) 0.017 3 78 (40 to 105) 76 (60 to 105) 0.47 4 86 (50 to 110) 84 (65 to 115) 0.54 5 87 (50 to 115) 84 (55 to 110) 0.50 6 91 (65 to 115) 84 (60 to 100) 0.021 7 91 (65 to 110) 88 (70 to 110) 0.19 8 92 (60 to 115) 89 (60 to 110) 0.23 9 93 (60 to 115) 89 (70 to 110) 0.76 10 95 (65 to 115) 90 (70 to 110) 0.14 11 93 (65 to 115) 94 (70 to 120) 0.80 12 95 (65 to 115) 94 (65 to 120) 0.77 13 97 (75 to 112) 95 (80 to 120) 0.59 14 95 (65 to 120) 95 (70 to 130) 0.90 1 mth 104 (80 to 125) 108 (75 to 135) 0.19 2 mths 111 (85 to 135) 109 (90 to 145) 0.58 3 mths 115 (85 to 140) 120 (95 to 135) 0.13 6 mths 121 (70 to 150) 120 (75 to 150) 0.83 12 mths 126 (80 to 155) 122 (90 to 145) 0.39 Post-operative day Extension angle (°) Extension angle (°) p-value 1 -6 (-10 to 0) -9 (-20 to 0) 0.0046 2 -7 (-15 to 0) -10 (-25 to 0) 0.0060 3 -6 (-10 to 0) -9 (-25 to 0) 0.0080 4 -7 (-15 to 0) -8 (-20 to 0) 0.13 5 -6 (-10 to 0) -8 (-20 to 0) 0.056 6 -6 (-10 to 0) -7 (-15 to 0) 0.20 7 -6 (-10 to 0) -7 (-20 to 0) 0.15 8 -5 (-10 to 0) -7 (-20 to 0) 0.056 9 -5 (-15 to 0) -7 (-20 to 0) 0.069 10 -4 (-10 to 0) -7 (-20 to 0) 0.022 11 -4 (-15 to 0) -6 (-15 to 0) 0.36 12 -5 (-20 to 0) -7 (-15 to 0) 0.14 13 -4 (-15 to 0) -5 (-10 to 0) 0.23 14 -4 (-15 to 0) -6 (-15 to 0) 0.091 1 mth -5 (-25 to 0) -6 (-20 to 0) 0.41 2 mths -5 (-25 to 0) -6 (-20 to 0) 0.51 3 mths -5 (-15 to 0) -4 (-20 to 0) 0.85 6 mths -3 (-20 to 0) -4 (-20 to 0) 0.64 12 mths -1 (-10 to 0) -3 (-15 to 0) 0.18 All p-values were determined with Student’s t -test Table V shows the number of diclofenac sodium suppositories used as rescue analgesia: this was significantly lower in the corticosteroid group than in the no-corticosteroid group at one day after surgery (0, 0 to 2 vs 1, 0 to 2; p = 0.021). Table V The mean number of suppositories used as rescue analgesia Steroid (n = 38) No steroid (n = 37) p - value On the night of surgery 0 (0 to 2) 0 (0 to 1) 0.77 Post-operative day 1 0 (0 to 2) 1 (0 to 2) 0.021 Post-operative day 2 0 (0 to 2) 0 (0 to 2) 0.62 Post-operative day 3 0 (0 to 2) 0 (0 to 1) 0.57 All p-values were determined with Student’s t -test There were no significant differences in the rate of complications, including wound complications and surgical site infections, between the two groups (Table VI). Five patients developed a peroneal nerve palsy as a result of the injection of local anaesthetic into the area: these all recovered completely within 24 hours. Table VI Complications Steroid (n = 38, %) No steroid (n = 37, %) p-value Nausea on the night of surgery 2 (5.3) 1 ( 2.7) 0.57 Nausea on post-operative day 1 1 ( 2.6) 2 ( 5.4) 0.54 Pruritus 1 ( 2.6) 0 ( 0) 0.31 Respiratory depression 0 ( 0) 0 (0) N/A Wound complication 1 ( 2.6) 1 ( 2.6 ) 0.98 Surgical site infection 0 ( 0) 0 (0) N/A Transient peroneal nerve palsy 3 ( 7.9) 2 ( 5.4) 0.67 All p-values were determined with chi squared test N/A, not applicable BODY.DISCUSSION: We found that the level of post-operative pain in the first 24 hours was less in the corticosteroid group than in the no-corticosteroid group. The corticosteroid group also had better results in terms of post-operative pain during activity, range of movement, and the use of rescue analgesia in the early post-operative period. The rate of complications did not differ between groups. There have been two RCTs which do not support the efficacy of corticosteroid in periarticular injection10,11 and four RCTs which do.6-9 These conflicting results may be owing to differences in the periarticular injection solutions used in the various studies. Long-acting6,8 or intermediate-acting7,9-11 corticosteroids were used in these studies. In our study, we chose to use methylprednisolone, an intermediate-acting corticosteroid which is five-times more potent than hydrocortisone,20 one of the most frequently used corticosteroids for periarticular injection.1,4,5,10,15 Although several RCTs have compared the efficacy of different corticosteroids in intra-articular injection of the knee joint,21,22 there have been no studies which directly compare the efficacy of periarticular injection for pain control after TKA. Surgical technique, including the surgical approach and the use of a pneumatic tourniquet could have an effect on early post-operative pain.23,24 Differences in surgical technique may also have been responsible for the conflicting results of previous studies.6-11 The usefulness of a multimodal approach to pain control after TKA has been reported.1,3,25 Although the periarticular injection of a combination of agents is the most important component of the multimodal approach,1 peripheral nerve blockade is also a key component.26,27 We deliberately did not use peripheral nerve blockade so that we would be able to study the impact of corticosteroid on the periarticular injection. There is controversy about whether the analgesic solution should be injected into the extensor mechanism. Although we did so in the same way as other studies,1,4,16 Chia et al11 has advised against injecting the extensor mechanism because of the risk of delayed tendon rupture. A transient peroneal nerve palsy occurred in five patients, because of infiltration into the area of the common peroneal nerve.16 Surgeons should avoid excessive infiltration in this area when injecting the posterior aspect of the capsule.2 The strengths of our study include its double-blinded, randomised, controlled design, the use of the area under the curve for the primary outcome and more meticulous measurement than in previous studies. In contrast with measurement only at a specific time point, the area under the curve represents total pain relief during the observation period.19 This study had several limitations. First, the allocation using randomised numbered, opaque, sealed envelopes could be considered suboptimal compared with other remote methods of randomisation, such as a dedicated telephone randomisation service. When a trial has the potential to subvert randomisation, the results may differ from trials in which there is no such possibility.28 Second, as this study was conducted in a single centre and only two surgeons were involved, care should be taken when generalising the findings to community settings. Third, although spinal anaesthesia is recommended for TKA owing to the low risk of complications,29 it could mask the pain scale in the early post-operative period. Fourth, we did not evaluate post-operative swelling: that was expected to be better in the corticosteroid group. Finally, although this study showed a significant difference between groups in terms of primary outcome, the sample size was underpowered to make definitive conclusions about the ratio of complications, including surgical site infection and wound complication, owing to their low frequency. Although no previous studies have shown that including corticosteroid in a periarticular injection significantly influences the rate of surgical site infection,6-11,30 several studies have reported patients developing a surgical site infection after periarticular injection which contained corticosteroid.10,16 To analyse the impact of corticosteroid on surgical site infection, a larger sample size is needed. As even a recently conducted meta-analysis was underpowered to determine the safety of corticosteroid in periarticular injection,30 further studies are needed to answer this question unequivocally.

TITLE: Randomized Crossover Study Showing Nurse-Led Same Day Review Replacing Next Day Review in Uneventful Phacoemulsification to Be Safe and Efficacious ABSTRACT: Purpose. To study whether nurse led same-day review (SDR) after uneventful phacoemulsification can replace next-day review (NDR) in terms of safety and efficacy. Setting. Patients are recruited from an ophthalmology outpatient clinic in Hong Kong. Design. A prospective, randomized crossover study conducted from November 2012 to 2014. Methods. Inclusion criteria include cataract surgery naïve patients undergoing phacoemulsification under local anaesthesia. All patients were seen by our ophthalmic nurse 2 hours after surgery. Before undergoing phacoemulsification of the first eye, patients were randomized to be reviewed on day 1 or 7 after surgery. Surgeons and reviewing doctors were blinded to patient allocation. For the patients' second eye surgery, group allocation will cross over. Primary outcome measures include visual improvement and patient satisfaction questionnaire. Other measures include cataract characteristics, surgical details, and complications. Statistical tests include paired t-test, Wilcoxon signed rank test, and Chi-square test. Results. 164 eyes from 82 patients were available. Visual improvement, satisfaction, and complications were comparable between both groups. Conclusions. A nurse led SDR can replace NDR in uneventful phacoemulsification in terms of safety and efficacy. Patient satisfaction is also comparable in the setting of Asian culture and when transportation is not a major concern. BODY.1. BACKGROUND: Next day review (NDR) following phacoemulsification is actually more of a convention and tradition rather than being evidence based. The Cataract Surgery Guidelines published by the Royal College of Ophthalmologists (RCOph) in 1995 had recommended postoperative review within 48 hours after surgery. This recommendation was based on data from surveying postoperative complications at a time when the extracapsular cataract extraction (ECCE) technique was mainstream and wound integrity or prolapsed irises were major concerns. The National Cataract Survey conducted in 1993 showed the 3 most frequently occurring complications: corneal edema, raised intraocular pressure (IOP), and wound leak [1]. The most recent National Cataract Survey in 1997 collected data from surgeries, which comprised 80% of phacoemulsification and 20% of ECCE, showing a shift of the 3 most frequently occurring complications to corneal edema, raised IOP, and uveitis, [2] shifting the emphasis from wound-related complications to IOP spikes. The most recent Cataract Surgery Guidelines published by RCOph in 2010 states that NDR is no longer in widespread use, with many departments having replaced patient visit with a telephone call by a trained nurse [3]. The intervention rate in routine clinical review following uneventful phacoemulsification has also found to be low (2.8%), with the majority of these are avoidable or trivial [4]. As evidenced above, NDR following uneventful cataract surgery may not be an efficacious practice. It causes inconvenience and leads to additional cost to patients, most of which are elderly. It also casts a burden on health care cost and consumes clinic time, as one uncomplicated case of cataract generates approximately 5–8 outpatient appointments from surgery listing to closing case. However, the practice of NDR is still very common across Asia [5, 6]. The purpose of postoperative follow-up is multifold and includes the following: screen for complications, allow for intervention where necessary, allow the surgeon to review his surgical outcome which encourages surgical development, and assess and assure the patient. We propose that same day review (SDR) can replace traditional NDR in meeting the above goals, with other additional advantages. SDR is more effective in detecting postoperative IOP spike, as it has been found that IOP peaks at 3 to 7 hours postoperatively [7]. This is all the more important in glaucoma patients, as 19% of glaucoma patients were found to have peak IOP above 40 mmHg, as compared to 4% of patients without glaucoma. SDR is also more convenient for patients: it saves travel time and trouble, it allows immediate eye pad removal and immediate usage of postoperative eye drops, and it also allows earlier reassurance. In this study, we will compare the visual outcome in patients undergoing SDR versus NDR and also patient satisfaction level in an urban and metropolitan setting, where travel time is less of an issue. BODY.2. METHODS: This is a prospective, randomized crossover study conducted from November 2012 to November 2014. Patients are recruited from the outpatient clinic at a tertiary eye centre in the eastern part of the Kowloon Peninsula of Hong Kong serving a population of around 1 million. The study was approved by the Institutional Review Board of the Kowloon East Cluster Research Ethics Committee in Hong Kong (reference number KC/KE-12-0101/ER-2) and adhered to the tenets of the Declaration of Helsinki. Written informed consent was obtained. Indications for cataract surgery include visual acuity less than 0.5 together with a patient's wish for surgery. Inclusion criteria include patients with bilateral cataract that required surgery, willingness to undergo sequential phacoemulsification under local anaesthesia within 3 months, and age of at least 18. Exclusion criteria include only eye patients, end-stage glaucoma patients, minors, any intraoperative complications, conversion into ECCE and surgery done under general anaesthesia, illiteracy, and inability to complete a questionnaire. Before undergoing phacoemulsification of the first eye, randomized allocation was done via sealed envelope method. An outline of our study design is shown in Figure 1. Surgeons performing the surgery were blinded to group allocation. Doctors reviewing the patients' postoperation on either day 1 or day 7 were also blinded to group allocation, as they would examine the patient first before reviewing the patients' clinical records. All patients were reviewed 2 hours postsurgery at our Day Surgery Center by an ophthalmic specialist nurse (ML) who had undergone accredited training in slit lamp examination. The timing of review at 2 hours after surgery was chosen as it helps identify those with a rising IOP and it gives consideration to patient convenience [7, 8]. The ophthalmology nurse specialist would perform the following: remove eye dressing, slit lamp examination to inspect for a round pupil configuration and intraocular lens centricity, check wound integrity via Seidel test, and IOP measurement via noncontact tonometry. Noncontact tonometry was chosen as the method for IOP measurement as it is less invasive, quick, convenient, and shown to agree well with Goldmann applanation [9]. The nurse specialist would then pad the patient's eye with maxitrol ointment (Alcon) and instruct the patient on postoperative care. The importance of symptoms such as severe ocular pain and reduced vision were explained, and contact numbers in case of emergency were given. If no complications were seen and the IOP was lower than 30 mmHg, the patient would be told to start postoperative eye drops and followed up according to the next day review (NDR) or no next day review (NNDR) group schedule as allocated. NDR patients would be seen on 1 day, 7 days, and 1 month postsurgery. NNDR patients would be told to take off their eye dressing 4 hours after surgery and start postoperation eye drops, and they would be seen on 7 days and 1 month postsurgery. For these reviews, the patients would be seen at our outpatient clinic. The fellow eye of all patients will automatically crossover to the alternative group, with cataract surgery done within 3 months. If the ophthalmic specialist nurse detects any complications or the IOP was equal or above 30 mmHg, then the patient would be seen at 1 day, 7 days, and 1 month postsurgery for both eyes. A single dose of 500 mg oral acetazolamide would be administered for those with IOP above 30 mmHg. 30 mmHg was chosen as a cutoff as previous studies have showed that at this level, there is a significant increase in optic disc cupping [10]. Complications include wound leak, IOP higher or equal to 30 mmHg, peaked pupil, IOL dislocation, and severe inflammation. All surgeries were performed at a day surgical centre (Wu Ho Loo Ning Cataract Centre, Tseung Kwan O Hospital). Cases were performed under either topical anaesthesia or retrobulbar anaesthesia, depending on the patient's cooperation and/or surgeon's preference. Standard phacoemulsification with clear corneal incision was performed (Infiniti vision system, Alcon Inc., Fort Worth, USA). Intracameral injection of cefuroxime (1 mg in 0.1 mL) was performed routinely unless there was any known related allergy. Standard postoperative regimen of 0.5% chloramphenicol with 0.1% dexamethasone eye drops was prescribed. No routine prophylactic medications were prescribed for IOP lowering. Primary outcome measures include visual improvement postsurgery and patient satisfaction via a questionnaire. The questionnaire consists of 3 sections. The first and second section is completed 1 month after the first and second cataract surgery, respectively. Subjects are asked to rate their overall experience, level of reassurance, and explanation received during follow-up, and confidence level towards the follow-up health care professional on a scale of 1–5, with 1 representing very satisfied and 5 representing very dissatisfied. In the third section, subjects are asked to state their preference towards NDR versus NNDR and also the venue of follow-up. Other outcome measures include preoperative visual acuity, cataract characteristics, surgical details, surgeon ranking, phacoemulsification energy, and complications. Visual acuity was measured with the use of pinhole and Snellen chart. A small pupil was defined as less than 5 mm after pupil dilatation. High myope was defined as myopia of 6 diopters or above. Dense cataract was defined as nuclear sclerosis of grade 3 or above. All questionnaires were completed on day 7 after surgery for both eyes, evaluating the patient satisfaction level for the NDR group and NNDR group, at a scale from 1 to 13, with 1 presenting very satisfied and 13 presenting very unsatisfied. At day 7 after surgery for the second eye, the patient will be asked to state his preference in the following areas: (1) location—review at the Day Surgery Center versus the outpatient clinic, and (2) schedule—the NDR versus NNDR schedule. Paired t-test was used for parametric data analysis, Wilcoxon signed rank test for nonparametric data, and Chi-square test for categorical data. Means were expressed as mean ± standard deviation (SD). For comparison of visual acuity between NDR and NNDR, Snellen visual acuity was converted into logMAR visual acuity to obtain geometric progression. Statistical significance was defined as p < 0.05. Analysis was conducted with SPSS version 20. BODY.3. RESULTS: A total of 102 patients were recruited with the recruitment outline shown in Figure 2. Among them, there were 12 dropouts: 7 patients cancelled their second eye surgery, 3 patients failed to follow the study schedule, 1 patient had his second eye surgery postponed beyond 3 months, and 1 patient passed away after the first eye surgery. Eight patients had their NNDR changed to NDR group for various reasons. This includes 4 cases that encountered minor intraoperative complications: 2 had wound burn, 1 had repeated intraoperative iris prolapse, and 1 required monitored anaesthetic care due to poor cooperation. The remaining 4 were found to have minor complications at 2 hours postsurgery review by a nurse specialist (ML): 3 had high IOP (range 35–41 mmHg) and were given a single dose of oral acetazolamide (500 mg) and 1 had a corneal epithelial defect. Data from the remaining 82 patients were available for analysis; the mean age was 74.9 ± 7.8. Forty-eight were female and thirty-four were male. The operative details are shown in Table 1. For the surgery, the case mix of surgeries and surgeons were representative of our norm. The mean preoperative visual acuity of the NDR group and NNDR group were similar (paired t-test, p = 0.84). Difficulty and density of the cataract in the NDR and NNDR group were noted preoperatively by noting down characteristics including shallow anterior chamber, small pupil, sunken globe, high myope, dense cataract, and posterior subcapsular cataract. These parameters were comparable among the two groups. Density of the cataract was also reflected by recording the total dissipated phacoemulsification energy postoperatively. The cumulated dissipated energy (%-s) required in the NDR group was 16.11 ± 10.24 and that in the NNDR group was 14.86 ± 9.02, with no statistically significant difference (paired t-test, p = 0.38). The surgical details and rank of surgeons were also comparable between both groups. There was no statistically significant difference in the visual acuity between NDR and NNDR at baseline and at 7 days or 1 month after phacoemulsification (see Table 2). The preoperative visual acuity for the NDR and NNDR groups was 0.3 +/− 0.1 and 0.3 +/− 0.2, respectively (p = 0.6). The visual acuity at day 7 postoperation for the NDR and NNDR groups was 0.5 +/− 0.2 and 0.5 +/− 0.2, respectively (p = 0.2). The visual acuity at 1 month postoperation for the NDR and NNDR groups was 0.5 +/− 0.2 and 0.5 +/− 0.2, respectively (p = 0.7). No complications such as wound leaks, peaked pupil, IOL dislocation, or severe inflammation were noted in either group at D0, D1, or D7. Three patients had IOP higher than 30 mmHg noted at D0 as mentioned above and were given one dose of 500 mg oral acetazolamide and reviewed the next day as per study protocol. No subjects were noted to have IOP higher than 30 mmHg at other study time points. For the NDR group, IOP at D0 and D7 were 22.2 +/− 5.4 and 11.2 +/− 3.9 mmHg, respectively. For the NNDR group, IOP at D0 and D7 were 22.2 +/− 5.6 and 11.9 +/− 3.4 mmHg, respectively. There was no statistical significance of D7 IOP between the NDR and NNDR groups (paired t-test, p = 0.3). There was no significant difference in patient satisfaction level between the NDR group and NNDR group (5.33 ± 1.1 versus 5.09 ± 1.29, p = 0.06, Wilcoxon signed rank test). For patient preference comparing NDR schedule versus NNDR schedule, the vast majority showed no preference (65%). 22% preferred the NNDR schedule while 13% preferred the NDR schedule. For patient preference comparing review at the Day Surgery Center versus the outpatient clinic, the vast majority were neutral (82%), while 13% preferred the Day Surgery Center. BODY.4. DISCUSSION: A number of studies with various designs have been conducted to study the necessity, indications, and optimal timing of the first postphacoemulsification review. A summary of studies focusing on NDR is shown in Table 3 [11–14]. The majority of the NDR were conducted by doctors. In studies where NDR were deemed necessary, the main purpose is to provide management for high IOP. As a high incidence of complications were found on NDR in complicated phacoemulsifications, NDR were deemed necessary in this group of patients as well. A summary of prospective studies looking into the optimal timing of the first postphacoemulsification review and their outcome is shown in Table 4 [5, 15–19]. The majority of the NDR were conducted by doctors, while in one study, SDR was conducted by a nurse with a pen torch. Although the patients were reviewed at different time points in different studies, a few common results can be observed as follows: (1) An early SDR is more effective in picking up postoperative IOP spikes, and (2) in the long run, the visual outcome is comparable irrespective of whether the review was conducted on the same day, next day, or even later. However, although many of these studies conclude that SDR is safe and efficacious when compared to NDR, their follow-up protocol and logistics fail to ensure patient safety, as complications such as painless iris prolapse and corneal abrasions have been missed in the SDR group. The results of the present study is consistent with the above conclusion in that SDR is comparable to NDR in both efficacy and safety. SDR is advantageous in that its timeframe allows more efficacious detection in IOP spikes. This is of even greater significance to glaucoma patients, who have a higher tendency to develop deleterious IOP spikes. Ahmed et al. found that at 3–7 hours postoperation, 18% of nonglaucoma patients and 46% of glaucoma patients were found to have IOP > 28 mmHg, while 4% of nonglaucoma patients and 19% of glaucoma patients had IOP > 40 mmHg [7]. We took extra precautions to enhance safety for SDR patients; only uneventful phacoemulsification was included in the present study, and all cases with IOP spikes were reviewed the next day. Our SDR was conducted by an ophthalmic nurse who had undergone accredited slit lamp training. As such, we had no complications that had gone undetected in either group. SDR is a more convenient and economical arrangement, especially for patients with mobility issues or who live far away from the hospital. One concern for implementing SDR would be the issue of detecting postcataract endophthalmitis. The incidence of postcataract endophthalmitis has dropped since the introduction of intracameral cefuroxime prophylaxis. Prior to its introduction, the incidence ranges from 0.3% to 1.2% [20–23]. With the introduction of intracameral cefuroxime, the risk is further reduced by fivefold, ranging from 0.014% to 0.08% [24]. The above range refers to all cataract surgeries and encompasses both the uneventful and complicated. As the ESCRS study group found a fivefold increased endophthalmitis risk in the presence of surgical complications, the incidence of endophthalmitis following uneventful phacoemulsification is even lower [25]. The mean time between cataract surgery and diagnosis of endophthalmitis has been quoted to range from 6 to 13 days [15, 17]. The efficacy of NDR in detecting endophthalmitis is, therefore, extremely low. Although there has been a case report of endophthalmitis detected at day 1 postsurgery, the patient had underlying risk factors including an anaesthetic cornea from history of herpes zoster ophthalmicus and history of infective keratitis [26]. In this new era, we believe that the main role for the first postphacoemulsification review lies in detecting IOP spikes. We therefore advocate replacing NDR with SDR, rather than delaying the first review till late. The second review, which can be scheduled at 5 to 7 days postsurgery, would be much more effective in detecting endophthalmitis. Implementation of SDR, shared care with a nonophthalmologist, and patient review at the Day Surgery Center has allowed us to streamline our review protocol, allocate our resources more effectively, and facilitate the development of high volume cataract surgery in all aspects, while maintaining health care standard and patient safety at the same time. Although our study included surgical cases conducted under local anaesthesia only, we believe that surgery under general anaesthesia can also be safely included. Shared care with nonophthalmologists is feasible provided that appropriate training has been undertaken and appropriate equipment are used. Lastly, the importance of perioperative patient education in postoperative care and warning symptoms cannot be overemphasized. Our study is unique in several aspects. The study is conducted among an Asian population and background. A randomized crossover design has been adopted to allow better comparison. We also take patient satisfaction into consideration. To the best of our knowledge, this is the first postphacoemulsification review study of such nature conducted among Asian subjects. Like many metropolitan cities worldwide, Hong Kong's public transport and travel are known to be particularly convenient. In general, our patients prefer SDR to NDR, even when transportation is already less of an issue. Limitations of our study include a relatively small sample size and not adopting validated patient satisfaction questionnaires. Also, examiners may be able to distinguish NDR patients despite NDR and NNDR blinding. In conclusion, the present study showed that NNDR combined with SDR by a nurse specialist is efficacious and safe in uneventful phacoemulsification in the era of intracameral cefuroxime. Patient satisfaction did not show any preference between NDR and NNDR and further supports NNDR with the use of SDR. These findings bear significance and may influence the current practice of NDR common in Asian countries.