Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: significant calcification of coronary artery lesions has been identified as a strong predictor for decreased success and increased complication rates with balloon angioplasty . calcium imposes a rigid obstacle to optimal and symmetric stent expansion and results in smaller acute gain , and stent under - expansion is associated with an increased risk of acute stent thrombosis and re - stenosis , even with drug - eluting stents ( des ) . we report a useful technique , the \" hugging balloon technique , \" using two small balloons to treat encircling , heavily - calcified lesions . a 76 - year - old male patient presented to us with an anterior st elevation myocardial infarction ( stemi ) that developed 3 hours previously . primary pci was performed and coronary angiography showed a heavily calcified total occlusion at the proximal left anterior descending ( lad ) artery . the lesion was pre - dilated with a 2.515 mm balloon ( voyager , guidant , indianapolis , in , usa ) , but the balloon ruptured at 12 atm and a type c dissection was noted . two paclitaxeleluting stents ( 3.028 mm , and 3.020 mm , taxus ; boston scientific , boston , ma , usa ) were deployed at the midlad . a follow - up angiogram showed residual stenosis and haziness at the previous calcified total occlusion site ( fig . after dilatation of the adjuvant balloon 10 times with a 3.010 mm balloon ( 20 atm , vigor ; occam , eindhoven , netherlands ) and a 3.012 mm balloon ( quantum maverick ; boston scientific ) , severe stenosis remained . intravascular ultrasound ( ivus ) revealed an encircling heavy calcification at the previous total occlusion site ( fig . the hugging balloon technique was performed with two 2.015 mm balloons ( splinter ; medtronic , minneapolis , mn , usa ) . two balloons were located at mid - lad in parallel , and stepwise inflations were performed simultaneously at 12 , 18 , and 20 atm ( fig . repeated balloon dilatations were performed several times with a 3.012 mm balloon ( quantum maverick ) . a follow - up angiogram showed resolution of the stenosis and ivus showed an ellipsoidal rupture of the encircling calcification ( fig . a 68 - year - old male was admitted for a stemi that developed 4 hours previously . primary angioplasty was planned and the angiogram revealed total occlusion with thrombus and heavy calcification at the mid - lad artery . after manual aspiration ( thrombuster ; kaneka , osaka , japan ) , an angiogram showed that the heavily - calcified stenosis remained at the mid - lad artery ( fig . the lesion was pre - dilated with a 3.015 mm balloon ( maverick balloon at 9 atm ) and a 3.010 mm cutting balloon , but the balloons were not fully dilated at the lesion site . two balloons were located in the mid - lad artery , side - by - side ( 2.515 mm , and 1.515 mm maverick ) and were stepwise inflated simultaneously at 10 and 12 atm . three sirolimus - eluting stents ( 2.533 mm , 2.7523 mm , and 3.023 mm , cypher ; cordis , johnson & johnson , fl , usa ) were then successfully implanted in the mid - lad artery . a 76 - year - old male patient presented to us with an anterior st elevation myocardial infarction ( stemi ) that developed 3 hours previously . primary pci was performed and coronary angiography showed a heavily calcified total occlusion at the proximal left anterior descending ( lad ) artery . the lesion was pre - dilated with a 2.515 mm balloon ( voyager , guidant , indianapolis , in , usa ) , but the balloon ruptured at 12 atm and a type c dissection was noted . two paclitaxeleluting stents ( 3.028 mm , and 3.020 mm , taxus ; boston scientific , boston , ma , usa ) were deployed at the midlad . a follow - up angiogram showed residual stenosis and haziness at the previous calcified total occlusion site ( fig . after dilatation of the adjuvant balloon 10 times with a 3.010 mm balloon ( 20 atm , vigor ; occam , eindhoven , netherlands ) and a 3.012 mm balloon ( quantum maverick ; boston scientific ) , severe stenosis remained . intravascular ultrasound ( ivus ) revealed an encircling heavy calcification at the previous total occlusion site ( fig . the hugging balloon technique was performed with two 2.015 mm balloons ( splinter ; medtronic , minneapolis , mn , usa ) . two balloons were located at mid - lad in parallel , and stepwise inflations were performed simultaneously at 12 , 18 , and 20 atm ( fig . repeated balloon dilatations were performed several times with a 3.012 mm balloon ( quantum maverick ) . a follow - up angiogram showed resolution of the stenosis and ivus showed an ellipsoidal rupture of the encircling calcification ( fig . a 68 - year - old male was admitted for a stemi that developed 4 hours previously . primary angioplasty was planned and the angiogram revealed total occlusion with thrombus and heavy calcification at the mid - lad artery . after manual aspiration ( thrombuster ; kaneka , osaka , japan ) , an angiogram showed that the heavily - calcified stenosis remained at the mid - lad artery ( fig . the lesion was pre - dilated with a 3.015 mm balloon ( maverick balloon at 9 atm ) and a 3.010 mm cutting balloon , but the balloons were not fully dilated at the lesion site . two balloons were located in the mid - lad artery , side - by - side ( 2.515 mm , and 1.515 mm maverick ) and were stepwise inflated simultaneously at 10 and 12 atm . however , ivus revealed breakage of the encircling calcification ( fig . 2d ) . then , additional balloon dilation was performed with a cutting balloon . three sirolimus - eluting stents ( 2.533 mm , 2.7523 mm , and 3.023 mm , cypher ; cordis , johnson & johnson , fl , usa ) were then successfully implanted in the mid - lad artery . these cases highlight the potential efficacy of a double balloon for managing severely calcified lesions . a finding of extensive calcification may lead to the use of plaque modification strategies , such as atherectomy devices or cutting balloon inflation . rotational atherectomy ( ra ) has been shown to be efficient for selective calcium ablation .1 ) 2 ) high - speed ra preferentially cuts hard plaque , increasing plaque compliance , and thereby rendering the lesion more amenable to balloon dilatation .1 ) however , the potential exists for microcirculatory impairment due to embolization of plaque debris , platelet aggregation , or vasospasm .3 ) the cutting balloon creates small , sharp , and regular incisions in the plaque and relieves the hoop stress of the vessel , thereby lessening the continuity and rigidity imposed by calcium . the efficacy of the cutting balloon for a calcified lesion has been demonstrated in previous reports ,4 ) but the cutting balloon poses the risk of coronary rupture , microblade fracture and subsequent coronary mural hematoma because of the blades around the surface of the balloon .5 ) a small portion of lesions are refractory to coronary angioplasty , even when very high pressures are used . in double balloon mitral valvulotomy , the tension applied to the plane of the mitral commissures is twice the tension applied vertically , resulting in a more elliptical mitral valve shape , more effective splitting of the fused commissures , and less risk of rupturing or tearing of the leaflets .6 ) based on la place 's law for surface tension , higher pressures can be attained with smaller balloons as the burst pressure is higher in smaller balloons compared to larger balloons , as follows : surface tension = pressureradius . this technique successfully dilates the lesion as the geometry of two balloons inflated side - by - side is different from one balloon . two balloons consist of two outer semi - circles and a central trapezoidal square area . this altered geometric configuration may be important in successfully dilating a lesion refractory to standard dilating techniques . the determination of adequate diameters is based on the formula , \" r = d1 + d2 \" , by adjusting the balloon diameters ( d1 and d2 ) to pre - dict the theoretical mean hugging balloon diameter ( r ) .7 ) the preferred choices for management of heavy , calcified coronary lesions are ra or a cutting balloon . however , the judicious use of hugging balloons can be considered in the management of heavy calcified lesions to facilitate adequate dilatation of the lesions when other non - compliant balloons have failed .\noutput:\n" }, { "from": "agent", "value": "we report our experience in coronary angioplasty and intravascular ultrasonography ( ivus ) on a heavy , encircling , calcified lesion that was not dilated with the use of a cutting balloon and a non - compliant balloon . the angioplasty was successfully performed with a simple and inexpensive hugging balloon technique ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in 1995 , we started to implant battery - powered , programmable , and gas driven constant infusion rate pumps for long - term delivery of drugs to the intrathecal space in patients with refractory chronic pain and severe spasticity in various neurological conditions . during the first 3 years of pump implantation , we observed the common symptoms of post - dural puncture headache ( pdph ) . especially patients with spinal catheter were at highest risk for developing pdph ; in two cases with difficult anatomic conditions due to severe ossifications and obesity neurosurgical repair of dural tear was required . in a recently published study over a 20 - year time period ,23 % of the cases developed pdph symptoms after surgical implantation of an intrathecal catheter . during pump implantation , the space of csf is accessed with a 14 - gauge tuohy needle followed by the placement of a smaller diameter catheter . when the needle is removed , a csf leak is likely to occur ; and a persistent csf leak can lead to pdph . in case of catheter exchange , the dura materis penetrated at two sites , the old one after catheter removal and the second one caused by inserting a new catheter for exchange . the clinical hallmark of pdph is the presence of orthostatic headache which may be associated with neck pain , nausea , vomiting , diplopia , blurred vision , and distorted hearing . the success rate of therapeutic epidural blood patch ( ebp ) is variable and depends on the size of the dural hole , timing of the ebp , and possibly the volume of blood used . taking into account the variable therapeutic efficacy of ebp in the treatment of pdph as well as the high incidence and severity of pdph , it is reasonable to investigate the applicability of prophylactic ebp to prevent headache after dural puncture during pump catheter exchange . since pdph can be severe enough for suffering and can increase the cost of healthcare by lengthening hospital stay , it might be more justified to take a proactive approach by administering preventative measures rather than waiting to begin treatment once the symptoms appear provided that the prophylactic procedure itself is not associated with significant risksmost experienced clinicians have observed that there is a large and unpredictable variation in the volume of injected blood that elicits symptoms ; thus , the risk of a large volume injectate , which is essentially creating a temporary epidural hematoma , must be balanced with the risk of inadequate volume possibly failing to patch the leak . keeping in mind the absence of controlled studies to guide the clinical practice of this approach and based on the refractory nature of pdph to conservative treatment as well as the possibility of infection by postoperatively repeated ebp , a high - volume prophylactic ebp during the exchange of the intrathecal catheter for prevention of pdph seems reasonable to optimize the spread of the blood in the epidural space at the same puncture spot . in a retrospective observational study , we used a high - volume prophylactic ebp during exchange of intrathecal catheters for preventing pdph in patients with a history of pdph according to medical records and observed its efficacy and safety in a 1 year follow - up . after obtaining approval from our institutional review board , patients with severe chronic pain or spasticity , who had an intrathecal pump in place and experienced inadequate symptom relief between january 1998 and august 2010 were identified and included in the retrospective analysis . twenty - two patients who had already suffered from symptoms of pdph following catheter pump implantation were considered for a prophylactic ebp with a high blood volume during exchange . prior to admission to surgery , the battery - powered or gas driven pump with its catheter was checked separately for proper function in each patient . a normal functioning pump was assumed in the battery - powered pump with normal movement of the rotor by bolus injection during fluoroscopy and in the gas pump with pressure measured in the mean chamber above 2,000 mbar . beside the pump reservoir port , the side port for bypassing the pump with a self - sealing septum for percutaneous access to the catheter was used for aspiration and injection , and for evaluating its function with and without imaging . the patient under intubation anesthesia was placed in a lateral decubitus position , after which the back was flexed , prepped , and draped , in sterile fashion . a posterior midline incision approximately 6 cm long was made from the skin to the supraspinous fascia at the level of l23 or l34 . the defective catheter was first carefully removed , while a new one was prepared for placement . the 14 - gauge tuohy needle supplied by the manufacturer in the implant kit was advanced through the incision into the epidural space , usingloss of resistance technique while a 10 ml syringe filled with normal saline was attached . once the needle tip was in adequate position with its slightly curved tip directed superiorly , autologous venous blood was drawn by a second operator from the antecubital vein into a 10 ml plastic syringe attached to an extension tube under sterile technique . a total of 40 ml blood was injected slowly through the tuohy needle at a speed of 5 ml / min into the epidural space to spread both cephalad and caudal . then , the needle was advanced through the dura into the csf fluid space and the catheter was introduced 15 cm intrathecally to the t11 - level with the tip oriented cephalad while clear csf was flowing [ figure 1 ] . at this point , it is preferable to check fluoroscopically the correct catheter movement into cranial direction without any looping on itself . the insight guide wire catheter with its small metallic bead at the tip could make fluoroscopic tracking relatively easy . after removing the needle and subsequently the guide wire , the spinal catheter was anchored to the lumbar fascia using a silastic anchor provided by the manufacturer . the spinal catheter was checked for free flowing csf by aspiration with a 2 ml plastic syringe . once the tunnel needle was firmly attached , the spinal catheter was pulled by the tunnel subcutaneously from the lumbar side to the patient 's flank site using a facilitating flank incision . then , the spinal catheter was clamped with a rubber shod mosquito at the flank incision to prevent excessive csf loss . after careful review of the manufacturer 's procedural guidelines for pump exchange , a lunar incision around the pump pocket was made along the course of the proposed position in the right or left lower quadrant of the abdomen at the umbilical level . the malfunctioning pump was explanted and replaced with a new one implanted under the subcutaneous tissue of the abdomen or at the rectus fascia for secure attachment . the pump - sided catheter was measured , trimmed if needed , and connected to the pump . the connection was manually tested for leak using a saline injection in the catheter access port while occluding the catheter distally . gentle subcutaneous guidance of the pump catheter tip attached firmly to the tunnel needle ensured safe tunneling to the flank incision . prior to connecting both spinal and pump catheters at the flank incision , it is important to verify the free flow of csf from the spinal catheter . both catheter parts were attached using a metal pin connector secured with silk sutures . before implantation , the pump was filled for 14 postoperative days and the catheter was filled with predetermined drug solution by a bridge bolus to clear the dead space and deliver the prescribed medication dose . the follow - up visits for 1 year were carried out on postoperative day 1 by the attending physician , then by telephone interview on day 2 , later at weekly intervals during the 1 month , and finally at refilling requirements after surgery . pumps were refilled only by trained staff of our pain clinic , using sterile refill kits offered by the pump manufacturer . the patients were asked to quantify their pain experience on a visual analog scale ( vas ) . likewise , pain was assessed on a 03 verbal categorical rating scale ( vrs ) ( 0 = none , 1 = mild , 2 = moderate , and 3 = severe ) . oswestry activity scale which is a well - validated international outcome measure in the management of spinal disorders or modified ashworth scale for examining the efficacy of baclofen by grading muscle spasticity and clinical interview were obtained by neurology staff specialists experienced in pain and spasticity management . patient satisfaction with the effectiveness of pain relief was recorded by using a 4 - point scale which shows the verbal expressed satisfaction of assigned numerical values : 1 = worse , 2 = moderate , 3 = good , 4 = very good . results were predominantly descriptive and expressed as means and standard deviations or medians plus minimum and maximum . cerebrospinal fluid ( csf ) pdph is a common complication following implantation of intrathecal catheters with or without pump for drug delivery . from a sample of 72 patients admitted for catheter exchange with or without pump , 22 patients ( 33 % ) ( 12 male , 10 female ) had a history of pdph following initial implantation . the symptoms of pdph in these patients had been mostly self - limited and had resolved with conservative medical management . the mean age of the patients in the study group was 51.59.5 years ranging from 34 to 72 years . the mean pump refill interval before surgical intervention for exchange was 35.5 days ( range : 1445 days ) . the duration of intrathecal drug therapy before catheter - pump exchange was 6.250.55 years . twenty - two catheters were exchanged and eight pumps were replaced , six of them by gas driven pumps and two by battery - powered programmable pumps with a reservoir volume of 18 ml for baclofen infusion in muscle spasticity . baseline patient characteristics , along with the medical indication for device replacement are listed in table 1 . characteristics of patients ( n = 22 ) with underlying disease , concomitant intrathecal drug with or without adjuvants ( plus : either clonidine or bupivacaine ) substantial complications prior or during surgery for each patient , that is relevant to discuss , were recorded . based on a distinct increase of predominantly excitatory symptoms ( hyperexcitability or increased muscle spasticity ) due to reduced drug infusion suggesting pump malfunctioning and / or catheter defect , the preoperative check program was started . in six patients , the battery - powered pump had neared the manufacturer 's recommended exchange interval ; thus the device was electively scheduled for replacement which was necessary after 5.70.3 years . in two cases , the pumps were defective . one pump was battery - powered , while the other was gas driven . in both cases , withdrawal symptoms appeared within 13 days after interruption of intrathecal therapy . one patient treated with baclofen using a battery - powered pump for muscle spasticity on upper and predominantly lower extremities presented with more stiffness which completely disappeared after two boluses of 25 g ( maximum 50 g ) into the side port . the other patient treated withmorphine showed withdrawal symptoms , such as stomach cramps , diarrhea , rhinorrhea , sweating , elevated heart rate and increased blood pressure , irritability , hyperalgesia , and insomnia . the symptoms also disappeared completely after the injection of 12 mg morphine diluted in 5 ml normal saline within 15 min into the side port . while the catheters were checked with fluoroscopy , we found slight leaking at different sites in the catheter system [ figure 2a and b ] . during surgical exploration at the site of spinal entry , we observed catheter obstruction and fracture caused by fibrous sheath [ figure 3a and b ] . the catheter was fractured close to the site of spinal entry [ figure 3b ] . catheter obstruction was confirmed in four cases by lack of csf aspiration with the needle inserted into the side port bypassing the pump . leakage of csf with perforating tear was found in close proximity to the vertebral spinous process and spine catheter entry site . fluoroscopic image of contrast dye - a ) leaking at the catheter entry site into spinal space with huber needle inserted through side port for contrast dye injection and ( b ) leaking in close proximity to the pump with huber needle inserted through side port for contrast dye injection catheter ( a ) obstruction and ( b ) fracture by fibrous sheath information concerning technical difficulties encountered when performing peridural puncture could be ascertained in only three out of 22 patients . all patients received 40 ml ebp before entering the dural space . for exchange , battery - powered pumpswere preferably replaced by gas driven pumps , so that the mean pump refill interval changed to 42 days ( range , 3250 days ) . the postoperatively administered intrathecal infusion rate was kept similar to that dosage being administered preoperatively for intrathecal management of intractable pain or severe muscle spasms . additional boluses of either morphine 0.10.5 mg or baclofen 2550 g diluted in 5 ml normal saline were given on the day of surgery as required . after surgical intervention , 21 patients were successfully treated with a prophylactic ebp and had a satisfactory outcome , while one patient remained in coma and could not be properly evaluated because of intracranial bleeding as the underlying disease . results from the oswestry disability index revealed that 19 patients were able to walk longer distances and sit for longer periods of time . in both patients with muscle spasticity , the modified ashworth scale showed a decrease in muscle tone predominantly in the lower extremities . catheter defect , pump failure , or discrepancies of pump volume at the time of refill as well as adverse events were not reported . substantial complications prior or during surgery for each patient , that is relevant to discuss , were recorded . based on a distinct increase of predominantly excitatory symptoms ( hyperexcitability or increased muscle spasticity ) due to reduced drug infusion suggesting pump malfunctioning and / or catheter defect , the battery - powered pump had neared the manufacturer 's recommended exchange interval ; thus the device was electively scheduled for replacement which was necessary after 5.70.3 years . in two cases , one pump was battery - powered , while the other was gas driven . in both cases , withdrawal symptoms appeared within 13 days after interruption of intrathecal therapy . one patient treated with baclofen using a battery - powered pump for muscle spasticity on upper and predominantly lower extremities presented with more stiffness which completely disappeared after two boluses of 25 g ( maximum 50 g ) into the side port . the other patient treated withmorphine showed withdrawal symptoms , such as stomach cramps , diarrhea , rhinorrhea , sweating , elevated heart rate and increased blood pressure , irritability , hyperalgesia , and insomnia . the symptoms also disappeared completely after the injection of 12 mg morphine diluted in 5 ml normal saline within 15 min into the side port . while the catheters were checked with fluoroscopy , we found slight leaking at different sites in the catheter system [ figure 2a and b ] . during surgical exploration at the site of spinal entry , we observed catheter obstruction and fracture caused by fibrous sheath [ figure 3a and b ] . the catheter was fractured close to the site of spinal entry [ figure 3b ] . catheter obstruction was confirmed in four cases by lack of csf aspiration with the needle inserted into the side port bypassing the pump . leakage of csf with perforating tear was found in close proximity to the vertebral spinous process and spine catheter entry site . fluoroscopic image of contrast dye - a ) leaking at the catheter entry site into spinal space with huber needle inserted through side port for contrast dye injection and ( b ) leaking in close proximity to the pump with huber needle inserted through side port for contrast dye injection catheter ( a ) obstruction and ( b ) fracture by fibrous sheathinformation concerning technical difficulties encountered when performing peridural puncture could be ascertained in only three out of 22 patients . all patients received 40 ml ebp before entering the dural space . for exchange , battery - powered pumpswere preferably replaced by gas driven pumps , so that the mean pump refill interval changed to 42 days ( range , 3250 days ) . the postoperatively administered intrathecal infusion rate was kept similar to that dosage being administered preoperatively for intrathecal management of intractable pain or severe muscle spasms . additional boluses of either morphine 0.10.5 mg or baclofen 2550 g diluted in 5 ml normal saline were given on the day of surgery as required . after surgical intervention , 21 patients were successfully treated with a prophylactic ebp and had a satisfactory outcome , while one patient remained in coma and could not be properly evaluated because of intracranial bleeding as the underlying disease . results from the oswestry disability index revealed that 19 patients were able to walk longer distances and sit for longer periods of time . in both patients with muscle spasticity , the modified ashworth scale showed a decrease in muscle tone predominantly in the lower extremities . catheter defect , pump failure , or discrepancies of pump volume at the time of refill as well as adverse events were not reported . patients with back pain using morphine with / without clonidine and bupivacaine were strongly represented in our study . intrathecal baclofen was used for the treatment of patients with severe muscle spasticity associated with intracranial bleeding or intramedullary ependynoma as underlying neurological diseases who were unresponsive to conservative pharmacotherapy or developed intolerable side effects at therapeutic doses of oral baclofen . most clinicians implant battery - powered , programmable pumps when frequent dosage changes are likely to occur . at our facilitywe used to implant gas driven constant infusion rate pumps because of economic aspects and variable volume capacity ( 3550 ml ) . exchange of intrathecal catheters was required in 22 patients ; in eight of them also the pump was replaced . the explantation technique was described in detail ; the presented malfunctions were found by checking the pump and the catheter preoperatively and under surgery . we therefore intended to keep the preoperative intrathecal infusion rate during surgery , while utilizing a drug bolus for the early postoperative symptom control . the expertise of a skilled physician with good understanding of diagnostic and therapeutic challenges faced with a possible device malfunction was essential to minimize the risks during surgical exchange . the patients who had already suffered from pdph after initial implantation were found to be completely free of headache in both sitting and standing position with no apparent complications from the surgical procedure using a prophylactic ebp . the pdph has been the most common significant morbidity of dural puncture and an important source of litigation against anesthesiologists . pdph with its high incidence also in our study is not only a disabling condition but , if left untreated , can also lead to complications such as cranial nerve palsies , subdural hematoma , and cortical venous thrombosis . the mechanism of relieving pdph by a blood patch is thought to be related to a dual mode of action , namely compression of the thecal space as well as clotting and occluding the dural perforation by preventing further csf leak . the success rate for an ebp is variable and depends on the size of the dural hole , timing of the ebp , and possibly the volume of blood used . a survey of anesthesiologists in the usa regarding pdph , unintentional dural puncture , and related issues showed that 1031 % applied an ebp as a prophylactic measure . without controlled studies to guide clinical practice , we postulate that a high blood volume patch during catheter exchange is a reasonable procedure that will optimize the spread of blood in the epidural space and prevent pdph . however in the present study , the small number of reported cases who received this uncommon preventive measure for pdph after catheter exchange leaves questions still open for the optimal management approach . without prophylactic ebpthe mainstay of specific therapy for pdph is a therapeutic ebp , which may be repeated postoperatively in case pdph should occur after surgical catheter exchange . however , the safety and effectiveness of prophylactic ebp in combination with pump exchange have not been investigated so far . complete symptom relief without side effects postoperatively during the follow - up period , even among a limited number of cases may suggest that treatment of the causative pathology and application of a prophylactic ebp during surgery may be adequate for preventing pdph . our preventive approach during catheter exchange is certainly less invasive than the neurosurgical exposure with repair of the dural defect . successful treatment outcomes may give the patient the opportunity to return to activities of daily living , thus improving quality of life . the study has some limitations due to its design with a limited number of patients and the lack of a control group for pdph outcome . nevertheless , the results are valuable because complications are most commonly evaluated in observational or small sample studies . the study has some limitations due to its design with a limited number of patients and the lack of a control group for pdph outcome . nevertheless , the results are valuable because complications are most commonly evaluated in observational or small sample studies . pdph is a common complication following implantation of spinal catheter with or without pump for drug delivery . a new approach using a high - volume prophylactic ebp for preventing pdph following spinal catheter exchange with or without pump is presented . the efficacy and safety of this technique for 1 year follow - up have been evaluated and was found to be safe and potentially effective .\noutput:\n" }, { "from": "agent", "value": "background : in an observational study , complications of intrathecal catheter pumps necessitating surgical exchange were analyzed . also the use of a high - volume prophylactic epidural blood patch ( ebp ) during surgery for preventing post - dural puncture headache ( pdph ) with a follow - up for 1 year is described.materials and methods : in 22 patients with refractory chronic pain of cancer / noncancer origin or severe spasticity , who were receiving intrathecal morphine including adjuvants or baclofen for symptom relief , catheter exchange with or without pump was performed . in patients with documented symptoms of pdph following initial intrathecal catheter implantation , a prophylactic ebp with a high blood volume was used for pdph prevention during surgery . catheters were replaced using 40 ml ebp before entering dural space at a speed of 5 ml / min into the epidural space . patients were asked to quantify pain experience and functional ability.results : from a sample of 72 patients admitted for catheter exchange with or without pump , 22 patients ( 33 % ) ( 12 male , 10 female ) had a history of pdph following initial implantation . diagnostic and therapeutic measures occurring with malfunction of intrathecal catheter pump systems were described . twenty - one patients were successfully treated with prophylactic ebp , while one patient could not be properly evaluated because of intracranial bleeding as the underlying disease.conclusions : a new approach using a high - volume prophylactic ebp for preventing pdph following catheter exchange is presented . the efficacy and safety of this technique for 1 year follow - up have been evaluated and was found to be safe and potentially effective ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sepsis is characterized by a complex systemic response to an overwhelming infection that may lead to multi - organ dysfunction , including acute kidney injury ( aki ) . sepsis is the dominant cause of aki in the icu , accounting for nearly 50 % of episodes . despite several decades of extensive study , even supportive care studies , including goal directed volume therapy and albumin infusion have not shown clinical benefit . many potential pathways and multiple drug targets have been identified in animal models of sepsis ; however , the translation from animal to human studies has been quite challenging [ 5 - 7 ] . while older studies were focused on inflammation and global renal blood flow , more attention has been given recently to renal microvascular alterations ( i.e. , capillary leak , leukocytes and platelet adhesion with endothelial dysfunction , microthrombi formation ) and immunosuppression that occur during sepsis and sepsis - aki . the microvascular alterations and endothelial dysfunction that occur during sepsis resemble the endothelial dysfunction that happens in many chronic conditions with the healthy endothelium shifting to a damaged pro - coagulative and pro - inflammatory phenotype . recent epidemiologic and mechanistic studies suggest that aki and chronic kidney disease ( ckd ) are not distinct entities but are rather closely interconnected : ckd is a risk factor for aki , aki is a risk factor for the development of ckd , and both are risk factors for cardiovascular disease . the link between an acute episode of aki and a possible future chronic loss of kidney function and / or cardiovascular disease may be explained , in part , by the microvascular injury that often occur in both acute and chronic conditions . several mediators and processes take part in the microvascular dysfunction that occurs during sepsis - aki . we briefly review some aspects of this syndrome and highlight the role of microparticles , cell membrane - derived particles that may play a critical role in both the initiation and propagation of sepsis . in the vascular microcapillary bed , circulating cells interact with highly dynamic endothelial cells through a variety of receptors and elaborated mediators whose functions include vasoregulation , coagulation , barrier maintenance , immune cell recruitment and oxygen transport . microvascular dysfunction , defined as any damage to the microvascular cellular components , including endothelial cells , smooth muscle cells and circulating blood cells , is often detected by altered flow or adhesive properties . during sepsis , microvascular dysfunction can occur by several mechanisms : 1 ) blood flow stagnation from altered circulatory cell function ( loss of reticulocyte flexibility , increased leukocyte adhesion , etc ) ; 2 ) endothelial cell injury ; 3 ) parenchymal cell injury with oxygen utilization abnormalities and mitochondrial dysfunction ; and 4 ) increased coagulopathy ( clotting factors , protein c , tissue factor , etc ) [ 12 - 14 ] . also , severe capillary leakage can result in interstitial edema exacerbating low tissue oxygen perfusion , contributing to hypoxia and multi - organ dysfunction . in vivo studies in animal models using intra - vital video microscopyvisually demonstrate impaired arteriole and capillary microcirculation in several organs during sepsis [ 17 - 20 ] , including the kidneys [ 21 - 23 ] . during sepsis , a decrease in functional microcapillary density , as defined as the length of continuously perfused microvessels per observation area , is associated with increased heterogeneity of microvascular perfusion , due to the presence of intermittently or non - perfused capillaries nearby well - perfused capillaries . this is a dynamic process , as non - or poorly - perfused capillaries may become perfused a few minutes later . these alterations have been shown in several preclinical models of sepsis in several vascular beds . besides microcirculatory flow changes , endothelial cells also change their phenotype with an increased expression of adhesion molecules ( becoming more pro - inflammatory ) , and tissue factor ( becoming more pro - coagulant ) . because of tissue hypoxia caused by microvascular dysfunction during sepsis , parenchymal cells can switch from aerobic to anaerobic respiration , producing toxic byproducts such as reactive oxygen species ( ros ) . in an anaerobic state rosare aggressively produced by the mitochondria , resulting in more cell damage and endothelial cell dysfunction , perpetuating a vicious cycle [ 27 - 29 ] . oxidative stress and microvascular dysfunction together have an important role in the development of sepsis - aki . the relationships between renal microvascular changes and ros generation have been studied in preclinical models of sepsis , using live animal intra - vital video microscopy . these elegant studies have demonstrated that increased tubular generation of ros and peroxynitrite occur following a decline in peritubular capillary perfusion ( secondary to microvascular dysfunction ) . microvascular dysfunction during sepsis causes important micro - environment changes that have deleterious effects not only locally , but also systemically , and its contribution to multi - organ dysfunction including aki is significant . therefore , understanding the microvascular derangements during sepsis is essential for future development of biomarkers and therapeutics in this complex disease . sepsis - induced microvascular injury causes the release of microparticles ( mps ) into the systemic circulation . mps are cell membrane - derived particles , 0.2 to 2m in diameter that promote coagulation and inflammation ( figure 1 ) , perpetuating microvascular injury . for example , when human neutrophils were activated with a calcium ionophore to induce mps release , these mps induced loss of cell membrane integrity and caused other morphological changes in human umbilical vein endothelial cells . mps contain proteins and lipids from cell membranes and cytoplasm of their parental cells , and are generated from a wide variety of cells , including endothelial cells , red blood cells , monocytes , and platelets . the outer leaflet of the mps membrane contains two pro - coagulants : phosphatidylserine , a pro - coagulant phospholipid , and tissue factor . as their internal cargo includes proteins , mrnas , and mirnas , mps have recently been shown to participate in a novel form of cell - cell communication . the actions of mps may depend on their cellular origin and state of activation of the parental cells . given their multi - faceted roles in thrombosis , inflammation , and angiogenesis ( figure 2 ) , mps have been considered as possible culprits during the pathogenesis of sepsis and septic shock , and possibly sepsis - aki . during sepsis in mice , most of circulating mps are derived from platelets ( 85 % ) , with a minority originated from endothelial cells and monocytes . studies that address the role of each particular mp sub - population on endothelial function and immune system , and their interactions , are still lacking . exosomes are smaller ( 0.04 -0.1 m in diameter ) than microparticles . whereas microparticles bud from cell membranes , exosomes are an end - product of the endocytic recycling pathway . after inside - out endocytic vesicles form at the plasma membrane and fuse to form early endosomes , these endosomes mature and become late endosomes that constitute the multivesicular bodies . these inside - out multivesicular bodies ( mvbs ) invaginate to produce right - side out vesicles within the mvbs , then the mvbs can directly fuse with the plasma membrane and thereby release right - side out exosomes into the extracellular space . as mps are produced directly through the outward budding and fission of membrane particles from the plasma membrane , their surface markers are largely dependent on the composition of the plasma membrane at the time of release ; whereas , exosomes are rich in lipid raft constituents due to organelle maturation . microvesicles is a term that includes both exosomes and microparticles that are smaller than the detection limit of flow cytometry . the term microvesicles is sometimes ambiguous in the literature , reflecting the technical difficulty in purifying and / or validating the purity of microparticles , microvesicles , and exosomes . annexin i has been identified as one essential component to recognize mps in cultured endothelial cells . mps produced from wild - type but not from annexin i - null polymorphonuclear cells ( pmns ) inhibited il - 1beta - induced leukocyte trafficking on human umbilical vein endothelial cell ( huvec ) monolayers . cd36 , a class b scavenger receptor that binds multiple ligands , can also act as a receptor for endothelial cell - derived mps during vascular injury . blocking cd36 ( either genetically or with an inhibitor ) improves sepsis survival and acute outcomes , including aki , related to decreased inflammation and better granulocyte activity with better local ( peritoneal ) bacterial containment . however , the number of other mps receptors is unknown ; some may work in combination with annexin i , or independent of annexin i. mps can be detected in the circulation in a normal / healthy state ( figure 3a ) , but are greatly increased after sepsis ( figure 3b ) . because mps circulate systemically , they can behave as pathogenic autocrine ( distance ) disseminators and have been implicated in the multi - organ dysfunction that characterizes sepsis and septic shock . mps can directly modulate endothelial cell nitric oxide and prostacyclin production , stimulate cytokine release and tissue factor induction , and promote monocyte chemotaxis and adherence to the endothelium . systemic injection of mps from septic rats into healthy rats reproduces the hemodynamic , inflammatory , and oxidative stress patterns of sepsis , including nitrosative stress . similarly , mps extracted from whole blood of septic patients exerted pleiotropic and tissue - selective changes in expression of pro - inflammatory proteins related with nitrative and oxidative stresses ; changes not seen when mps were isolated from non - septic controls . mps derived from septic subjects also increased renal markers of inflammation and oxidative stress in healthy rats . mps can also contribute to the prothrombotic state in sepsis by initiating disseminated intravascular coagulopathy ( dic ) , a known contributor to multiple organ dysfunction ( figure 2 ) . tissue factor present on the surface of mps is a primary initiator of coagulation . the activity of tissue factor associated with peripheral blood mps is related to disease severity and bacteremia in patients with community - acquired febrile e. coli urinary tract infections ; and mps - tissue factor activity declines upon resolution of infection . have demonstrated in a cohort study involving 100 patients with septic shock , that elevations in endothelium - derived cd105 - labeled mps and reductions in cd31 - labeled mps are strongly associated with early dic , and might predict dic occurrence and early vascular injury among septic patients . cd105 , or endoglin , is a type iii auxiliary receptor for the transforming growth factor beta ( tgf - ) superfamily , and is highly expressed on the vascular endothelium in adults . cd31 , also known as platelet endothelial cell adhesion molecule ) 1 ( pecam - 1 ) , is a molecule expressed on all cells within the vascular compartment , with higher expression on endothelial cells . zafrani et al . demonstrated a direct role of mps in the pathogenesis of sepsis and sepsis - aki , on both inflammatory and coagulation pathways , using calpain signaling to modulate the number of mps . calpains are calcium - activated neutral cysteine proteases that play an important role in inflammatory processes and lymphocyte apoptosis . increasing calpain activity can cause platelet activation including shape change and the generation of mps rich in phosphatidylserine . calpastatin is a specific endogenous inhibitor of activated calpain activity . in a clp model of sepsis , transgenic mice over - expressing calpastatin had better survival and less organ dysfunction ( including lung and liver damage , and sepsis - aki ) , and less lymphocyte apoptosis compared with wild type mice . calpastatin overexpressing mice also had a decreased inflammatory response and dic , as well as a dramatic reduction in the number of circulating mps . furthermore , mps transferred from septic wild type mice worsened the survival and increased coagulopathy of septic calpastatin overexpressing mice . this study demonstrates not only a deleterious net effect of calpains , but also that among all of the potential effects of calpains , mps account for nearly all calpain - mediated injury during sepsis . the large increase in mps during sepsis again highlight that mps may be both a marker and mediator of sepsis . thus , most septic patients do not die during the overwhelming inflammatory immune response phase of sepsis , but rather , they die from an increased susceptibility to secondary infections during a latter immunosuppressive state , that can last for weeks . recent efforts have been made to better understand the pathophysiology of this late immunosuppressive phase of sepsis , with the development of possible biomarkers and therapeutic targets [ 52 - 56 ] . mps shed from platelets stored for platelet transfusions can alter the function of cultured macrophages and dendritic cells toward less reactive states . demonstrated that human stored platelet - derived mps reduced the release of tnf - and il - 10 by macrophages activated by lps or zymosan a. further , platelet - derived mps attenuated the differentiation of monocytes into immature dendritic cells by il - 4 and gm - csf : immature dendritic cells lost part of their phagocytic activity and their lps - induced maturation was down modulated when exposed to platelet - derived mps . this inhibitory effect on neutrophils is mediated by annexin i , which binds to phosphatidylserine on the surface of the mps . mps produced from wild - type but not from annexin i - null pmns inhibited il - 1beta - induced leukocyte trafficking on human umbilical vein endothelial cell ( huvec ) monolayers . mps have been found to be elevated in other conditions where both endothelial dysfunction and immune system alterations coexist , such as pre - eclampsia . syncytiotrophoblast - derived mps ( stbmps ) circulate in normal third trimester pregnancy , but are present in significantly higher concentrations during pre - eclampsia , and these mps suppress t lymphocytes in vitro . circulating endothelial - derived mps are also elevated during pre - eclampsia , and strongly correlate with proteinuria . finally , a meta - analysis of randomized trials involving 8735 patients found that a more restrictive , compared to a more liberal , strategy of red blood cell transfusion was associated with a lower risk of serious infections ( pneumonia , mediastinitis , wound infection , and sepsis ) . a possible link between storedblood cell - derived mps with immunosuppression in patients who receive blood transfusion is an association that merits further investigation . therefore , mps may act as mediators and / or perpetuators of immunosuppression during sepsis . in summary , mps released during sepsis participate in several pathological pathways that are activated during this complex disease , and their contribution to sepsis pathophysiology is summarized in figure 2 . because microvascular dysfunction is responsible for profound metabolic perturbations at the tissue level and contributes to sepsis - induced multi - organ dysfunction ( mod ) , including aki , efforts have been made in order to find possible therapeutic targets within the microvascular system . a complex interplay between microvascular dysfunction and oxidative stress in the pathogenesis of sepsis may be more effectively targeted by drugs that interfere with both mechanisms . several primarily anti - oxidant agents are effective in animal models of sepsis , as well as drugs that target primarily endothelial dysfunction . however , drugs such as resveratrol may have a dual mechanism of action ( restoration of peritubular microvasculature perfusion and reactive nitrogen species scavenging ) . erythropoietin has also been shown to improve endothelial function , kidney function , and survival in experimental sepsis , through enos activation and anti - inflammatory effects [ 66 - 70 ] . sepsis is also associated with a time - dependent increase in circulating levels of vascular endothelial growth factor ( vegf ) , which is a potent stimulator of endothelial permeability and involved in the proliferation , migration , and survival of endothelial cells , but also contributes to inflammation and coagulation . vegf levels are elevated among septic patients , and are positively correlated with mortality . anti - vegf antibody ( bevacizumab ) has been shown to attenuate inflammation and decrease mortality in an experimental model of severe sepsis , and sflt - 1 , an endogenous soluble vegf receptor that neutralizes vegf , improves survival in experimental sepsis . several groups have studied the effects of progenitor or stem cells , which is one way of going beyond the classical approach of single mediators . the number of circulating endothelial progenitor cells ( epcs ) is increased in the peripheral blood of septic patients , and is positively associated with better survival , and erythropoietin is known to be a potent stimulator for endothelial progenitor cell mobilization . interestingly , septic patients with aki ( according to akin criteria ) have a higher number of peripheral epcs than septic patients in the low creatinine group . despite increased numbers of epcs during sepsis - aki , these cells have a decreased proliferative capacity . stromal cell - derived factor - 1 ( sdf - 1 ) facilitates epcs recruitment and is elevated in murine sepsis models . recently , the effect of exogenous epcs derived from human cord blood on murine sepsis caused by cecal - ligation puncture ( clp ) was studied , as well as the role of ctce , a sdf -1-analogue . both exogenous epcs and ctce increased 7 - day survival , and their effects were synergistic . either epcs alone or sub - threshold epcs and ctce combination administered 6h after clp significantly increased plasma il - 10 , with no effect on il - 6 or tnf - ; and also decreased lung capillary leakage as shown by the evans blue dye assay . administration of epcs augments plasma expression of microrna - 126 and microrna -125-b , which can influence endothelial function [ 81 - 83 ] . while most of what is known regarding the role of mps during sepsis suggests a harmful / deleterious effect , mps may have beneficial roles ; their function vary according to their cells of origin and the state of those cells . demonstrated that mps derived from epcs protect the kidney from aki following ischemia - reperfusion injury while delivering a mirna cargo ( including mir - 126 ) that can contribute to reprogramming hypoxic resident renal cells to a regenerative program , and the mice that received epcs - derived mps were also protected from ckd following aki . dye from labeled epcs - derived mps was detected in endothelial and tubular epithelial cells 2h after intravenous injection . further , epcs - derived mps have direct effects on cultured hypoxic tubular epithelial cells . these intriguing results support further exploration of the fate of circulating microparticles , especially in more complicated models of aki , including sepsis - aki . we have demonstrated that administration of bone marrow - derived mesenchymal stem cells ( bmscs ) to mice shortly ( up to 1h ) after the induction of sepsis increases survival and improves organ dysfunction , including aki , by immunomodulatory effects : monocytes and / or macrophages from septic mice treated with bmscs release more interleukin - 10 ( il - 10 ) , and the beneficial effects of bmscs were eliminated by macrophage depletion or pretreatment with antibodies specific for il - 10 . interestingly , a study by another group demonstrated that mps derived from plasma of septic patients increases mrna expression of il - 10 in engineered vascular tissue and increases contraction of these vascular cells induced by histamine . the paracrine effects of mesenchymal stem cells ( mscs ) during aki may be driven , at least in part , by a horizontal transfer of mrna and micrornas through mps . mice subjected to unilateral ischemia - reperfusion with contralateral nephrectomy that received intravenous injection of mps derived from human adult mscs immediately after injury were protected from aki and subsequent ckd onset . pretreatment of the same mps with rnase to inactivate associated rna prevented their protective effects . a recent paper shows that mps from in vitro expanded kidney - derived mesenchymal stem cells contribute to recovery from aki following ischemia - reperfusion injury by improving proliferation of peri - tubular capillary endothelial cells and decreasing peritubular microvascular rarefaction , possibly by acting as carriers of pro - angiogenic signals . while these studies were performed in the ischemia - reperfusion model , it is possible that therapeutics with mps derived from stem cells , known to have protective effects during aki , may also have beneficial effects during sepsis - aki . targeting several mediators that participate in the microvascular microenvironment and are involved in sepsis - induced microvascular injury have been shown to be beneficial in preclinical models of sepsis . the protective effects of endothelial progenitor cells or mesenchymal stem cells during sepsis and sepsis - aki through their paracrine effects are promising . mps may be responsible , at least in part , for these protective paracrine effects of stem - cells , supporting the hypothesis that mps functions are strongly related to their sources ( cells ) of origin . further studies are needed to better understand the individual subpopulations of mps contributions to sepsis and sepsis - aki . in critically ill patients requiring mechanical ventilation , preexisting chronic kidney disease ( ckd ) dramatically impacts short and long term outcomes , including all - cause aki , and 30 - day and 1 - year mortality . we have reproduced this effect in preclinical animal models , whereby ckd amplifies the deleterious effects of sepsis , including sepsis - aki . circulating endothelial - derived mps are elevated both in adults , and in children with ckd , and are associated with vascular dysfunction ( figure 3c ) . endothelial - derived mps isolated from patients with ckd impair endothelium - dependent relaxation of rat aortic arteries , and decrease no release by endothelial cells in vitro . it is unknown whether mps participate in ckd progression , or whether they contribute to the worse outcomes seen in septic patients with underlying kidney dysfunction . conversely , severe any - cause - aki is associated with increased risk of short - term and long - term mortality , incident ckd and accelerated progression to end - stage renal disease , but it is not known if circulating mps ( released from a damaged endothelium ) could be involved in the development of these events , participating in kidney scarring and ckd . previous endothelial dysfunction associated with ckd may have an impact on therapeutic choices during sepsis . septic mice with previous ckd ( after 5/6 nephrectomy ) did not respond to sflt - 1 , demonstrated to be beneficial in previously healthy mice . acute on chronic episode , are unknown at present ; but may represent a future therapeutic target . a schematic view of what may happen during an acute - on - chronic scenario is represented in figure 3d . in the vascular microcapillary bed , circulating cells interact with highly dynamic endothelial cells through a variety of receptors and elaborated mediators whose functions include vasoregulation , coagulation , barrier maintenance , immune cell recruitment and oxygen transport . microvascular dysfunction , defined as any damage to the microvascular cellular components , including endothelial cells , smooth muscle cells and circulating blood cells , is often detected by altered flow or adhesive properties . during sepsis , microvascular dysfunction can occur by several mechanisms : 1 ) blood flow stagnation from altered circulatory cell function ( loss of reticulocyte flexibility , increased leukocyte adhesion , etc ) ; 2 ) endothelial cell injury ; 3 ) parenchymal cell injury with oxygen utilization abnormalities and mitochondrial dysfunction ; and 4 ) increased coagulopathy ( clotting factors , protein c , tissue factor , etc ) [ 12 - 14 ] . also , severe capillary leakage can result in interstitial edema exacerbating low tissue oxygen perfusion , contributing to hypoxia and multi - organ dysfunction . in vivo studies in animal models using intra - vital video microscopyvisually demonstrate impaired arteriole and capillary microcirculation in several organs during sepsis [ 17 - 20 ] , including the kidneys [ 21 - 23 ] . during sepsis , a decrease in functional microcapillary density , as defined as the length of continuously perfused microvessels per observation area , is associated with increased heterogeneity of microvascular perfusion , due to the presence of intermittently or non - perfused capillaries nearby well - perfused capillaries . this is a dynamic process , as non - or poorly - perfused capillaries may become perfused a few minutes later . these alterations have been shown in several preclinical models of sepsis in several vascular beds . besides microcirculatory flow changes , endothelial cells also change their phenotype with an increased expression of adhesion molecules ( becoming more pro - inflammatory ) , and tissue factor ( becoming more pro - coagulant ) . because of tissue hypoxia caused by microvascular dysfunction during sepsis , parenchymal cells can switch from aerobic to anaerobic respiration , producing toxic byproducts such as reactive oxygen species ( ros ) . in an anaerobic state rosare aggressively produced by the mitochondria , resulting in more cell damage and endothelial cell dysfunction , perpetuating a vicious cycle [ 27 - 29 ] . oxidative stress and microvascular dysfunction together have an important role in the development of sepsis - aki . the relationships between renal microvascular changes and ros generation have been studied in preclinical models of sepsis , using live animal intra - vital video microscopy . these elegant studies have demonstrated that increased tubular generation of ros and peroxynitrite occur following a decline in peritubular capillary perfusion ( secondary to microvascular dysfunction ) . microvascular dysfunction during sepsis causes important micro - environment changes that have deleterious effects not only locally , but also systemically , and its contribution to multi - organ dysfunction including aki is significant . therefore , understanding the microvascular derangements during sepsis is essential for future development of biomarkers and therapeutics in this complex disease . sepsis - induced microvascular injury causes the release of microparticles ( mps ) into the systemic circulation . mps are cell membrane - derived particles , 0.2 to 2m in diameter that promote coagulation and inflammation ( figure 1 ) , perpetuating microvascular injury . for example , when human neutrophils were activated with a calcium ionophore to induce mps release , these mps induced loss of cell membrane integrity and caused other morphological changes in human umbilical vein endothelial cells . mps contain proteins and lipids from cell membranes and cytoplasm of their parental cells , and are generated from a wide variety of cells , including endothelial cells , red blood cells , monocytes , and platelets . the outer leaflet of the mps membrane contains two pro - coagulants : phosphatidylserine , a pro - coagulant phospholipid , and tissue factor . as their internal cargo includes proteins , mrnas , and mirnas , mpshave recently been shown to participate in a novel form of cell - cell communication . the actions of mps may depend on their cellular origin and state of activation of the parental cells . given their multi - faceted roles in thrombosis , inflammation , and angiogenesis ( figure 2 ) , mps have been considered as possible culprits during the pathogenesis of sepsis and septic shock , and possibly sepsis - aki . during sepsis in mice , most of circulating mps are derived from platelets ( 85 % ) , with a minority originated from endothelial cells and monocytes . studies that address the role of each particular mp sub - population on endothelial function and immune system , and their interactions , are still lacking . exosomes are smaller ( 0.04 -0.1 m in diameter ) than microparticles . whereas microparticles bud from cell membranes , exosomes are an end - product of the endocytic recycling pathway . after inside - out endocytic vesicles form at the plasma membrane and fuse to form early endosomes , these endosomes mature and become late endosomes that constitute the multivesicular bodies . these inside - out multivesicular bodies ( mvbs ) invaginate to produce right - side out vesicles within the mvbs , then the mvbs can directly fuse with the plasma membrane and thereby release right - side out exosomes into the extracellular space . as mps are produced directly through the outward budding and fission of membrane particles from the plasma membrane , their surface markers are largely dependent on the composition of the plasma membrane at the time of release ; whereas , exosomes are rich in lipid raft constituents due to organelle maturation . microvesicles is a term that includes both exosomes and microparticles that are smaller than the detection limit of flow cytometry . the term microvesicles is sometimes ambiguous in the literature , reflecting the technical difficulty in purifying and / or validating the purity of microparticles , microvesicles , and exosomes . annexin i has been identified as one essential component to recognize mps in cultured endothelial cells . mps produced from wild - type but not from annexin i - null polymorphonuclear cells ( pmns ) inhibited il - 1beta - induced leukocyte trafficking on human umbilical vein endothelial cell ( huvec ) monolayers . cd36 , a class b scavenger receptor that binds multiple ligands , can also act as a receptor for endothelial cell - derived mps during vascular injury . blocking cd36 ( either genetically or with an inhibitor ) improves sepsis survival and acute outcomes , including aki , related to decreased inflammation and better granulocyte activity with better local ( peritoneal ) bacterial containment . however , the number of other mps receptors is unknown ; some may work in combination with annexin i , or independent of annexin i. mps can be detected in the circulation in a normal / healthy state ( figure 3a ) , but are greatly increased after sepsis ( figure 3b ) . because mps circulate systemically , they can behave as pathogenic autocrine ( distance ) disseminators and have been implicated in the multi - organ dysfunction that characterizes sepsis and septic shock . mps can directly modulate endothelial cell nitric oxide and prostacyclin production , stimulate cytokine release and tissue factor induction , and promote monocyte chemotaxis and adherence to the endothelium . systemic injection of mps from septic rats into healthy rats reproduces the hemodynamic , inflammatory , and oxidative stress patterns of sepsis , including nitrosative stress . similarly , mps extracted from whole blood of septic patients exerted pleiotropic and tissue - selective changes in expression of pro - inflammatory proteins related with nitrative and oxidative stresses ; changes not seen when mps were isolated from non - septic controls . mps derived from septic subjects also increased renal markers of inflammation and oxidative stress in healthy rats . mps can also contribute to the prothrombotic state in sepsis by initiating disseminated intravascular coagulopathy ( dic ) , a known contributor to multiple organ dysfunction ( figure 2 ) . tissue factor present on the surface of mps is a primary initiator of coagulation . the activity of tissue factor associated with peripheral blood mps is related to disease severity and bacteremia in patients with community - acquired febrile e. coli urinary tract infections ; and mps - tissue factor activity declines upon resolution of infection . have demonstrated in a cohort study involving 100 patients with septic shock , that elevations in endothelium - derived cd105 - labeled mps and reductions in cd31 - labeled mps are strongly associated with early dic , and might predict dic occurrence and early vascular injury among septic patients . cd105 , or endoglin , is a type iii auxiliary receptor for the transforming growth factor beta ( tgf - ) superfamily , and is highly expressed on the vascular endothelium in adults . cd31 , also known as platelet endothelial cell adhesion molecule ) 1 ( pecam - 1 ) , is a molecule expressed on all cells within the vascular compartment , with higher expression on endothelial cells . zafrani et al . demonstrated a direct role of mps in the pathogenesis of sepsis and sepsis - aki , on both inflammatory and coagulation pathways , using calpain signaling to modulate the number of mps . calpains are calcium - activated neutral cysteine proteases that play an important role in inflammatory processes and lymphocyte apoptosis . increasing calpain activity can cause platelet activation including shape change and the generation of mps rich in phosphatidylserine . calpastatin is a specific endogenous inhibitor of activated calpain activity . in a clp model of sepsis , transgenic mice over - expressing calpastatin had better survival and less organ dysfunction ( including lung and liver damage , and sepsis - aki ) , and less lymphocyte apoptosis compared with wild type mice . calpastatin overexpressing mice also had a decreased inflammatory response and dic , as well as a dramatic reduction in the number of circulating mps . furthermore , mps transferred from septic wild type mice worsened the survival and increased coagulopathy of septic calpastatin overexpressing mice . this study demonstrates not only a deleterious net effect of calpains , but also that among all of the potential effects of calpains , mps account for nearly all calpain - mediated injury during sepsis . the large increase in mps during sepsis again highlight that mps may be both a marker and mediator of sepsis . thus , most septic patients do not die during the overwhelming inflammatory immune response phase of sepsis , but rather , they die from an increased susceptibility to secondary infections during a latter immunosuppressive state , that can last for weeks . recent efforts have been made to better understand the pathophysiology of this late immunosuppressive phase of sepsis , with the development of possible biomarkers and therapeutic targets [ 52 - 56 ] . mps may also play a role in the immunosuppression associated with sepsis . mps shed from platelets stored forplatelet transfusions can alter the function of cultured macrophages and dendritic cells toward less reactive states . demonstrated that human stored platelet - derived mps reduced the release of tnf - and il - 10 by macrophages activated by lps or zymosan a. further , platelet - derived mps attenuated the differentiation of monocytes into immature dendritic cells by il - 4 and gm - csf : immature dendritic cells lost part of their phagocytic activity and their lps - induced maturation was down modulated when exposed to platelet - derived mps . this inhibitory effect on neutrophils is mediated by annexin i , which binds to phosphatidylserine on the surface of the mps . mps produced from wild - type but not from annexin i - null pmns inhibited il - 1beta - induced leukocyte trafficking on human umbilical vein endothelial cell ( huvec ) monolayers . mps have been found to be elevated in other conditions where both endothelial dysfunction and immune system alterations coexist , such as pre - eclampsia . syncytiotrophoblast - derived mps ( stbmps ) circulate in normal third trimester pregnancy , but are present in significantly higher concentrations during pre - eclampsia , and these mps suppress t lymphocytes in vitro . circulating endothelial - derived mps are also elevated during pre - eclampsia , and strongly correlate with proteinuria . finally , a meta - analysis of randomized trials involving 8735 patients found that a more restrictive , compared to a more liberal , strategy of red blood cell transfusion was associated with a lower risk of serious infections ( pneumonia , mediastinitis , wound infection , and sepsis ) . a possible link between storedblood cell - derived mps with immunosuppression in patients who receive blood transfusion is an association that merits further investigation . therefore , mps may act as mediators and / or perpetuators of immunosuppression during sepsis . in summary , mps released during sepsis participate in several pathological pathways that are activated during this complex disease , and their contribution to sepsis pathophysiology is summarized in figure 2 . because microvascular dysfunction is responsible for profound metabolic perturbations at the tissue level and contributes to sepsis - induced multi - organ dysfunction ( mod ) , including aki , efforts have been made in order to find possible therapeutic targets within the microvascular system . a complex interplay between microvascular dysfunction and oxidative stress in the pathogenesis of sepsisseveral primarily anti - oxidant agents are effective in animal models of sepsis , as well as drugs that target primarily endothelial dysfunction . however , drugs such as resveratrol may have a dual mechanism of action ( restoration of peritubular microvasculature perfusion and reactive nitrogen species scavenging ) . erythropoietin has also been shown to improve endothelial function , kidney function , and survival in experimental sepsis , through enos activation and anti - inflammatory effects [ 66 - 70 ] . sepsis is also associated with a time - dependent increase in circulating levels of vascular endothelial growth factor ( vegf ) , which is a potent stimulator of endothelial permeability and involved in the proliferation , migration , and survival of endothelial cells , but also contributes to inflammation and coagulation . vegf levels are elevated among septic patients , and are positively correlated with mortality . anti - vegf antibody ( bevacizumab ) has been shown to attenuate inflammation and decrease mortality in an experimental model of severe sepsis , and sflt - 1 , an endogenous soluble vegf receptor that neutralizes vegf , improves survival in experimental sepsis . several groups have studied the effects of progenitor or stem cells , which is one way of going beyond the classical approach of single mediators . the number of circulating endothelial progenitor cells ( epcs ) is increased in the peripheral blood of septic patients , and is positively associated with better survival , and erythropoietin is known to be a potent stimulator for endothelial progenitor cell mobilization . interestingly , septic patients with aki ( according to akin criteria ) have a higher number of peripheral epcs than septic patients in the low creatinine group . despite increased numbers of epcs during sepsis - aki , these cells have a decreased proliferative capacity . stromal cell - derived factor - 1 ( sdf - 1 ) facilitates epcs recruitment and is elevated in murine sepsis models . recently , the effect of exogenous epcs derived from human cord blood on murine sepsis caused by cecal - ligation puncture ( clp ) was studied , as well as the role of ctce , a sdf -1-analogue . both exogenous epcs and ctce increased 7 - day survival , and their effects were synergistic . either epcs alone or sub - threshold epcs and ctce combination administered 6h after clp significantly increased plasma il - 10 , with no effect on il - 6 or tnf - ; and also decreased lung capillary leakage as shown by the evans blue dye assay . administration of epcs augments plasma expression of microrna - 126 and microrna -125-b , which can influence endothelial function [ 81 - 83 ] . while most of what is known regarding the role of mps during sepsis suggests a harmful / deleterious effect , mps may have beneficial roles ; their function vary according to their cells of origin and the state of those cells . . demonstrated that mps derived from epcs protect the kidney from aki following ischemia - reperfusion injury while delivering a mirna cargo ( including mir - 126 ) that can contribute to reprogramming hypoxic resident renal cells to a regenerative program , and the mice that received epcs - derived mps were also protected from ckd following aki . dye from labeled epcs - derived mps was detected in endothelial and tubular epithelial cells 2h after intravenous injection . further , epcs - derived mps have direct effects on cultured hypoxic tubular epithelial cells . these intriguing results support further exploration of the fate of circulating microparticles , especially in more complicated models of aki , including sepsis - aki . we have demonstrated that administration of bone marrow - derived mesenchymal stem cells ( bmscs ) to mice shortly ( up to 1h ) after the induction of sepsis increases survival and improves organ dysfunction , including aki , by immunomodulatory effects : monocytes and / or macrophages from septic mice treated with bmscs release more interleukin - 10 ( il - 10 ) , and the beneficial effects of bmscs were eliminated by macrophage depletion or pretreatment with antibodies specific for il - 10 . interestingly , a study by another group demonstrated that mps derived from plasma of septic patients increases mrna expression of il - 10 in engineered vascular tissue and increases contraction of these vascular cells induced by histamine . the paracrine effects of mesenchymal stem cells ( mscs ) during aki may be driven , at least in part , by a horizontal transfer of mrna and micrornas through mps . mice subjected to unilateral ischemia - reperfusion with contralateral nephrectomy that received intravenous injection of mps derived from human adult mscs immediately after injury were protected from aki and subsequent ckd onset . pretreatment of the same mps with rnase to inactivate associated rna prevented their protective effects . a recent paper shows that mps from in vitro expanded kidney - derived mesenchymal stem cells contribute to recovery from aki following ischemia - reperfusion injury by improving proliferation of peri - tubular capillary endothelial cells and decreasing peritubular microvascular rarefaction , possibly by acting as carriers of pro - angiogenic signals . while these studies were performed in the ischemia - reperfusion model , it is possible that therapeutics with mps derived from stem cells , known to have protective effects during aki , may also have beneficial effects during sepsis - aki . targeting several mediators that participate in the microvascular microenvironment and are involved in sepsis - induced microvascular injury have been shown to be beneficial in preclinical models of sepsis . the protective effects of endothelial progenitor cells or mesenchymal stem cells during sepsis and sepsis - aki through their paracrine effects are promising . mps may be responsible , at least in part , for these protective paracrine effects of stem - cells , supporting the hypothesis that mps functions are strongly related to their sources ( cells ) of origin . further studies are needed to better understand the individual subpopulations of mps contributions to sepsis and sepsis - aki . in critically ill patients requiring mechanical ventilation , preexisting chronic kidney disease ( ckd ) dramatically impacts short and long term outcomes , including all - cause aki , and 30 - day and 1 - year mortality . we have reproduced this effect in preclinical animal models , whereby ckd amplifies the deleterious effects of sepsis , including sepsis - aki . endothelial function is severely impaired during ckd [ 93 - 97 ] . circulating endothelial - derived mps are elevated both in adults , and in children with ckd , and are associated with vascular dysfunction ( figure 3c ) . endothelial - derived mps isolated from patients with ckd impair endothelium - dependent relaxation of rat aortic arteries , and decrease no release by endothelial cells in vitro . it is unknown whether mps participate in ckd progression , or whether they contribute to the worse outcomes seen in septic patients with underlying kidney dysfunction . conversely , severe any - cause - aki is associated with increased risk of short - term and long - term mortality , incident ckd and accelerated progression to end - stage renal disease , but it is not known if circulating mps ( released from a damaged endothelium ) could be involved in the development of these events , participating in kidney scarring and ckd . previous endothelial dysfunction associated with ckd may have an impact on therapeutic choices during sepsis . septic mice with previous ckd ( after 5/6 nephrectomy ) did not respond to sflt - 1 , demonstrated to be beneficial in previously healthy mice . acute on chronic episode , are unknown at present ; but may represent a future therapeutic target . a schematic view of what may happen during an acute - on - chronic scenario is represented in figure 3d . new possible targets are emerging with the advances in our understanding of how sepsis affects the microvasculature . mps , released after endothelial dysfunction during sepsis , are possible markers and contributors / perpetuators of further endothelial dysfunction . the development of therapeutics preventing the release of mps from injured endothelium , or directly interfering with the mps themselves , or their receptors , may be reasonable targets in sepsis and other diseases associated with microvascular dysfunction . besides perpetuating endothelial dysfunction and coagulation , mps may also participate in the immunosuppression found in the late states of sepsis . whether mps are important as amplifiers of disease ( as intercellular messengers ) , or biomarkers , or both , is not completely known , and may depend on which cell types generate mps and their state of activation . so far , harmful effects of mps during sepsis - aki have been demonstrated , but as a part of a natural response to infection / injury , it is likely that there are some benefits conferred by mps during sepsis , during aki , and possibly during sepsis - aki . more studies are needed to better understand the effects of mps during sepsis - aki , especially with a deeper understanding of specific mps sub - populations . their functions may be intrinsically determined by their cells of origin , whereby some mps may be harmful and others protective . in the future , it may be possible to engineer artificial therapeutic mps that either contain or lack specific surface molecules ( thrombin , ps ) , or carry passenger or trojan horse molecules ( mrna , micro - rnas ) that may be beneficial in the treatment of sepsis and sepsis - aki . perhaps these modified mps could even be directly targeted to the kidneys , or a specific organ , or a specific vascular bed . this could be accomplished by manipulating specific surface ligands , or by causing upregulation of receptors in specific organs . mps are potential therapeutic targets to prevent or treat sepsis and sepsis - aki .\noutput:\n" }, { "from": "agent", "value": "sepsis is a severe and complex syndrome that lacks effective prevention or therapeutics . the effects of sepsis on the microvasculature have become an attractive area for possible new targets and therapeutics . microparticles ( mps ) are cell membrane - derived particles that can promote coagulation , inflammation , and angiogenesis ; and can participate in cell - to - cell communication . mps retain cell membrane and cytoplasmic constituents of their parental cells , including two pro - coagulants : phosphatidylserine and tissue factor . we highlight the role of microparticles released by endothelial and circulating cells after sepsis - induced microvascular injury , and discuss possible mechanisms by which microparticles can contribute to endothelial dysfunction , immunosuppression , and multi - organ dysfunction -- including sepsis - aki . once viewed as cellular byproducts , microparticles are emerging as a new class of markers and mediators in the pathogenesis of sepsis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: parkinson 's disease ( pd ) is a severe and progressive neurodegenerative disorder of the central nervous system ( cns ) and is the most common movement disorder . pd is characterized by the loss of dopaminergic neurons in the substantia nigra pars compacta ( snpc ) in the ventral midbrain , mostly affecting the nigroestriatal pathway . the consequence of the severe depletion of dopamine ( da ) in the striatum is the imbalance of acetylcholine , glutamate and y - aminobutyric acid ( gaba ) in the subthalamic nucleus , thalamus and cortex , underlying the clinical symptomatology of the disorder ( wichmann and de long , 2003 ) . the loss of non - dopaminergic neurons , such as norepinephrine - containing neurons in the locus coeruleus , cholinergic neurons in the nucleus basalis of meynert and serotoninergic neurons in the raphe nuclei have been observed and are also involved in the pathophysiology of pd ( jellinger , 1999 ) . the clinical features of pd are tremor at rest , rigidity and bradykinesia , often associated to postural instability , gait alterations and dysarthria . these symptoms are mainly explained by deficiency of dopamine in the striatum , whereas minor symptoms such as autonomic dysfunction , depression and cognitive impairment may be consistent with the disease whether or not associated with pathological changes in non - dopaminergic systems . the ultimate therapeutic goal , based on the understanding of the etiopathogenesis of the disease has to be restorative and protective . even knowing that the main cause of the disease is daergic cell deathgenetic , epigenetic and environmental factors , such as head trauma , toxics or drugs have been reported in pd etiopathogenesis ( revised by cardoso et al . , 2009 ) . the snpc is a da - rich brain region that contains neuromelanin and a high content in iron which have been described to induce oxidative stress being related to the specific neurodegeneration occurring in pd . the decrease in daergic neurons and the consequent reduction of neuromelanin are responsible for the pale color of pd patients substancia nigra ( sn ) as compared to age - matched healthy controls and is a neuropathological hallmark of the disorder . protein aggregation is also a central feature of pd pathophysiology the presence of lewy bodies ( lbs ) being other prominent histopathological hallmark of pd . lbs are eosinophilic intracytoplasmatic aggregates of several proteins such as alpha - synuclein , ubiquitin , synphilin - 1 , 14 - 3 - 3 protein , tubulin and other cytoskeletal proteins ( forno , 1996 ) . lbs are also typical features of other alpha - synucleinopathies such as dementia with lbs and multiple system atrophy . these aggregates may be classified in classical lbs , which are mainly located in brain stem and have a dense hyaline appearance surrounded by a halo , or cortical type lbs , when they are less well defined . the major protein component of both lbs types is alpha - synuclein ( spillantini et al . , 1997 ) , whose cellular function remains unknown . mitochondrial dysfunction , oxidative stress or / and proteasome system impairment , were shown to potentiate alpha - synuclein aggregation in sporadic pd models ( revised by arduino et al . , 2010 ) . despite alpha - synuclein presence in lbsis a histopathological marker for pd , the mechanisms leading to the gradual transition of soluble alpha - synuclein into insoluble lbs or lewy neuritis are still unknown . in the familial form of pd due to the mutation of parkin gene the classic lbs pathologymoreover , toxin - induced parkinsonism is not associated with typical lbs formation , thus suggesting that alpha - synuclein aggregates are not a cause of the disease but probably a chronic mechanism of cell protection against soluble oligomeric alpha - synuclein toxicity . evidence exists supporting the notion that oxidative stress and impaired mitochondrial function are involved in the pathogenesis of the disorder . however , the mechanisms responsible for the death of snpc dopaminergic neurons has not yet been established . in this reviewwe will focus on the role of mitochondria , ups and oxidative stress as key players in the degeneration of daergic neurons . the most common type of pd is the sporadic or late - onset ( lopd ) form which affects about 1 % of individuals older than 65 years ( de lau and breteler , 2006 ) . this form seems to be related with the aging process and / or the exposure to environmental toxins . however , 5 % of pd cases manifesting before 4050 years , have been referred as familial or early - onset pd ( eopd ) ( hatano et al . , 2009 ) , with a classical recessive or dominant mendelian inheritance . mutations in some genes are the origin of familial and , in some cases , sporadic pd . in the last decadelinkage studies revealed 15 pd - related genetic loci ( park1 - 15 ) ( hatano et al . , 2009 ) , and in a recent report a new locus , park16 , was identified ( satake et al . , 2009 ) . mutations described for these familial forms of pd , include autosomal dominant mutations of alpha - synuclein gene ( park1 ) ( polymeropoulos et al . , 1997 ) , uchl1 gene ( park5 ) and lrrk2 gene ( park8 ) ( funayama et al . , 2002 ) or autosomal recessive mutations of parkin gene ( park2 ) ( kitada et al . , 1998 ; 2008 ) , pink1 gene ( park6 ) ( hatano et al . , 2004 ; valente et al . , 2004a ) , dj - 1 gene ( park7 ) ( bonifati et al . , 2003 ) and atp13a2 gene ( park9 ) ( ramirez et al . , 2006 ) additionally , in fibroblasts of a single patient , mutations in mitochondrial dna , nd5 and nd6 genes that codify for two complex i ( cx i ) subunits ( piccoli et al . , 2008 ) were identified . despite the overall rarity of the familiar forms of pd , the identification of single genes linked to the disease has yielded crucial insights into possible mechanisms of the pd pathogenesis , giving strong evidences of the involvement of organelles like mitochondria and intracellular degradation pathways as ups and autophagy in the pathophysiology of pd ( revised in arduino et al . polypeptide ( 51 kda ) that plays an important role in the ups as ubiquitin e3 ligase ( shimura et al . , 2000 ) . protein which is a component of the ups , which cleaves the carboxy - terminal peptide bond of polyubiquitine chains , working as a deubiquitinating enzyme ( wilkinson et al . moreover , both parkin and uchl1 were found to be lbs components ( lowe et al . ubiquitously expressed protein , pink1 ( pten induced kinase 1 ) , with serine / threonine kinase activity , found in mitochondria ( hatano et al . , 2004pink1 mitochondrial localization is due to a n - terminal mitochondrial - targeting signal ( mills et al . , 2008 ) , being one of the most direct evidences of a primary role of mitochondria in pd etiopathogenesis . pink1 was found in a small group of brain stem lbs as well ( gandhi et al . , 2006 ) . moreover , mitochondria are also indirectly involved in most of other genetic forms of eopd . alpha - synuclein mouse model ( martin et al . , 2006 ) and both parkin - knockout mouse and drosophila models ( greene et al . , 2003 ; palacino et al . , also dj - 1 and lrrk2 proteins were shown to be localized into the mitochondria ( canet - aviles et al . mutations in atp13a2 gene give rise to an autosomal recessive form of early - onset parkinsonism . this gene encodes a predicted lysosomal p - type transmembrane cation transporting atpase that is localized in the lysosome . mutant atp13a2 proteins are retained in the endoplasmic reticulum and degraded by the proteasome ( ramirez et al . , 2006 ) . moreover , atp13a2 suppresses alpha - synuclein and manganese toxicity in primary neuron cultures ( gitler et al . analysis of these genes products lead us to conclude that mitochondria and proteasome are deeply involved in the molecular mechanisms of pd pathogenesis . moreover , in some genetic defects they are involved simultaneously due to the relation of the protein product with both , mitochondria and proteasome , which somehow mean a probable interplay between them . the most common type of pd is the sporadic or late - onset ( lopd ) form which affects about 1 % of individuals older than 65 years ( de lau and breteler , 2006 ) . this form seems to be related with the aging process and / or the exposure to environmental toxins . however , 5 % of pd cases manifesting before 4050 years , have been referred as familial or early - onset pd ( eopd ) ( hatano et al . , 2009 ) , with a classical recessive or dominant mendelian inheritance . mutations in some genes are the origin of familial and , in some cases , sporadic pd . in the last decadelinkage studies revealed 15 pd - related genetic loci ( park1 - 15 ) ( hatano et al . , 2009 ) , and in a recent report a new locus , park16 , was identified ( satake et al . , 2009 ) . mutations described for these familial forms of pd , include autosomal dominant mutations of alpha - synuclein gene ( park1 ) ( polymeropoulos et al . , 1997 ) , uchl1 gene ( park5 ) and lrrk2 gene ( park8 ) ( funayama et al . , 2002 ) or autosomal recessive mutations of parkin gene ( park2 ) ( kitada et al . , 1998 ; mizuno et al . , 2008 ) , pink1 gene ( park6 ) ( hatano et al . , 2004 ; 2004a ) , dj - 1 gene ( park7 ) ( bonifati et al . , 2003 ) and atp13a2 gene ( park9 ) ( ramirez et al . , 2006 ) . additionally , in fibroblasts of a single patient , mutations in mitochondrial dna , nd5 and nd6 genes that codify for two complex i ( cx i ) subunits ( piccoli et al . , 2008 ) were identified . despite the overall rarity of the familiar forms of pd , the identification of single genes linked to the disease has yielded crucial insights into possible mechanisms of the pd pathogenesis , giving strong evidences of the involvement of organelles like mitochondria and intracellular degradation pathways as ups and autophagy in the pathophysiology of pd ( revised in arduino et al . , 2010 ) . parkin protein is a 465 - aminoacid ( a.a . ) polypeptide ( 51 kda ) that plays an important role in the ups as ubiquitin e3 ligase ( shimura et al . , 2000 ) . protein which is a component of the ups , which cleaves the carboxy - terminal peptide bond of polyubiquitine chains , working as a deubiquitinating enzyme ( wilkinson et al . moreover , both parkin and uchl1 were found to be lbs components ( lowe et al . , 1990 ; shimura et al . , 1999 ; ubiquitously expressed protein , pink1 ( pten induced kinase 1 ) , with serine / threonine kinase activity , found in mitochondria ( hatano et al . , 2004pink1 mitochondrial localization is due to a n - terminal mitochondrial - targeting signal ( mills et al . , 2008 ) , being one of the most direct evidences of a primary role of mitochondria in pd etiopathogenesis . pink1 was found in a small group of brain stem lbs as well ( gandhi et al . , 2006 ) . moreover , mitochondria are also indirectly involved in most of other genetic forms of eopd . alpha - synuclein mouse model ( martin et al . , 2006 ) and both parkin - knockout mouse and drosophila models ( greene et al . , 2003 ; palacino et al . , also dj - 1 and lrrk2 proteins were shown to be localized into the mitochondria ( canet - aviles et al . , 2004 ; mutations in atp13a2 gene give rise to an autosomal recessive form of early - onset parkinsonism . this gene encodes a predicted lysosomal p - type transmembrane cation transporting atpase that is localized in the lysosome . mutant atp13a2 proteins are retained in the endoplasmic reticulum and degraded by the proteasome ( ramirez et al . moreover , atp13a2 suppresses alpha - synuclein and manganese toxicity in primary neuron cultures ( gitler et al . , 2009 ) . analysis of these genes products lead us to conclude that mitochondria and proteasome are deeply involved in the molecular mechanisms of pd pathogenesis . moreover , in some genetic defects they are involved simultaneously due to the relation of the protein product with both , mitochondria and proteasome , which somehow mean a probable interplay between them . misfolding diseases are a wide group of devastating disorders characterized by the accumulation of pathological protein aggregates . despite different origins ( sporadic , familial or transmissible ) , they are sometimes called conformational diseases to emphasize aberrant conformations as the putative cause of deposits that precede or accompany the clinical manifestation of the disease . alzheimer 's disease ( ad ) , prion disorders ( prd ) , parkinson 's disease ( pd ) , and huntington 's disease ( hd ) are the most typical examples of protein misfolded disorders , which are characterized by protein conformational changes . the misfolded protein process entails protein conformational transitions that go from oligomers , protofibrils or mature aggregates formation ( ciechanover and brundin , 2003 ) . the accumulation of those proteins may result from either genetic rare mutations , or post - translational changes mainly due to oxidative / nitrosative stress ( further described in section neurotoxic mechanisms ) , which is more likely to be related to sporadic forms of neurodegenerative diseases ( nakamura and lipton , 2009 ) . even though mutations in alpha - synuclein gene ( ala53thr , ala30pro and glu46lys ) are very rare causes of hereditary pd , its apparent role as the major structural feature of the lbs , both in eopd and lopd , suggests that alpha - synuclein may have a key role in daergic neuronal cell death . firstly identified as synaptic - associated protein in the rat brain ( maroteaux et al . , 1988 ) and highly expressed in pre - synaptic nerve terminals , alpha - synuclein is a 140 - a.a . data from the last decade studies indicate that alpha - synuclein has important roles in synaptic vesicle formation and catecholamine metabolism in daergic neurons ( hatano et al . , ( 2000 ) , reported that alpha - synuclein may regulate the size of synaptic vesicles in mature neurons by observing a significant reduction in distal synaptic vesicles pool formation when the expression of alpha - synuclein is suppressed by antisense oligonucleotide technology ( murphy et al . , 2000 ) . however , later in 2006 , cooper and colleagues referred that alpha - synuclein blocked endoplasmic reticulum ( er ) - to - golgi vesicular trafficking and induced er stress followed by cell death ( cooper et al . , 2006 ) . in the meanwhile , some studies revealed that alpha - synuclein may modulate signal transduction , cytoskeleton organization and membrane trafficking due to interaction with membrane through lipid rafts ( fortin et al . relatively to catecholamine metabolism , it was shown that alpha - synuclein is capable to inhibit da release in an activity - dependent negative regulator manner ( abeliovich et al . , 2000 ) , through exocytosis alterations ( larsen et al . , 2006 ) . it is also suggested that alpha - synuclein may modulate the activation of tyrosine hydroxylase ( perez et al . , 2002 ) and down - regulate vesicular monoamine transporter - 2 activity ( guo et al . , 2008 ) . a recent study report that alpha - synuclein may also be involved in the regulation of ca homeostasis specifically increasing ca entry via l - type ca channels and , in this way , deregulation promoted by mutant forms can originate neurotoxicity ( hettiarachchi et al . , 2009 ) . moreover , it seems to be clear that alpha - synuclein interacts with tubulin , inhibiting microtubule formation and thus regulating microtubule dynamics in neurons ( zhou et al . , 2009 ) . ( 2006 ) demonstrated that overexpression of alpha - synuclein caused disruption of microtubule network and impairment of microtubule - dependent trafficking . in the other hand , alpha - synuclein may induce polymerization of purified tubulin into microtubules , a capacity lost by the mutant forms of alpha - synuclein ( alim et al . we demonstrated , in cells with chronic mitochondrial deficit ( pd cybrids ) an increase in free tubulin and in oligomeric alpha - synuclein content ( esteves et al . additionally , we proved that an increase in free / polymerized tubulin ratio may increase alpha - synuclein oligomerization when a mitochondrial dependent atp depletion and reactive oxygen species ( ros ) generation occurs ( esteves et al . , 2009 ) . interestingly , tubulin can stimulate alpha - synuclein fibrils formation in yeast and it was proved that by inhibiting microtubule dynamics or deleting genes involved in microtubule biogenesis , alpha - synuclein aggregation and toxicity increased ( kim et al . , 2008 ) . in this way , microtubule impairment affects alpha - synuclein distribution and toxicity and also may be responsible for mitochondria synaptic depletion , consistent with thealpha - synuclein exists in solution as an unfolded monomer but can easily aggregate and form insoluble antiparallel beta - sheet fibrillar oligomers ( moore et al . alpha - synuclein mediated toxicity in pd is thought to be due to soluble intermediate oligomers fraction than to fibrillar deposits , as found in lbs ( outeiro et al . , 2008 ) . toxic - gain of function of mutant protein and over - expression of the human wild - type are both related to pd pathology ( figure 2 ) . the misfolding process of alpha - synuclein may result from either genetic mutations , responsible for familial forms of the disease , or post - translational changes to the protein mainly due to oxidative / nitrosative stress , which is more likely to be related to sporadic forms of pd . two main events are related to ros / rns formation : ( 1 ) excessive ca influx due to activation of nmda - type glutamate receptors in nervous system , with activation of neuronal no synthase as well , as the generation of ros and ( 2 ) dysfunctional mitochondrial respiration that is one of the major sources of ros in the cell . excessive ros / rns formation by these two processes may induce ups impairment , thus resulting in protein aggregation . this may explain the etiology of the two pd neuropathological hallmarks , lbs formation and neuronal death . other fact that supports the importance of alpha - synuclein in the pathogenesis of the disease is the decreased sensitivity to mptp - induced degeneration of da neurons in alpha - synuclein - deficient mice ( dauer et al . , 2002 ) . inversely , it was shown that mptp sensitivity is increased in some lines of alpha - synuclein transgenic mice ( nieto et al . , 2006 ; yu et al . , 2008 ) . these results also indicate a probable relationship between mitochondrial dysfunction and alpha - synuclein toxicity , since mptp is a well known mitochondrial electron transport chain ( etc ) cx i inhibitor . besides alpha - synuclein accumulation being evident in alpha - synucleinopathies , its degradation pathway is not well defined . evidences exists that ups is the primary mechanism for its degradation ( rideout et al . , 2001 ) , but it can be inhibited by alpha - synuclein protofibrils ( zhang et al . , 2008 ) . defective proteasome activity is found in transgenic mouse models of alpha - synuclein ( chen et al . , 2006 ) . moreover , liu et al . ( 2009 ) showed that loss of pink1 function leads to proteasome impairment and alpha - synuclein aggregation . in this way , mitochondrial dysfunction and ups impairment seem to be strictly involved and related in formation of alpha - synuclein aggregates , since alpha - synuclein transgenic mice show mitochondrion and ups loss of function , as shown separately in the studies referred above . even being this the most unknown field of the disease , there are several evidences that suggest a list of conditions working as neurotoxic mechanisms underlying pd pathogenesis . according to gallacher and schapira , oxidative stress and free radical generation , mitochondrial dysfunction , glutamate mediated excitotoxicity , inflammation , oligodendrocyte interaction and neurotrophic factors , ups impairment , autophagy involvement and apoptosis ( gallagher and schapira , 2009 ) are mechanisms involved . oxidative stress is considered to compromise the integrity of vulnerable neurons and thus to contribute to neuronal degeneration . the source of the increased oxidative stress observed in pd is unclear but may derive from mitochondrial dysfunction , increased da metabolism ( that can yield excess of hydrogen peroxide and other ros ) , increased reactive iron , impairment of antioxidant defenses pathways , and / or due to the highly oxidative intracellular environment within dopaminergic neurons ( revised by cardoso et al . , 2009 ) . in pd oxidative stress may be also related to an activation of n - methyl - d - aspartate ( nmda ) - type glutamate receptors , with an increased production of rns ( reactive nitrogen species ) due to neuronal no synthase ( nnos ) over - activation ( garthwaite et al . , 1988 ; bredt et al . , a mitochondrial defect generates ros , specially the superoxide anion ( o ) , which rapidly reacts with free radical no creating peroxinitrite radical ( onoo ) ( beckman et al . , 1990 ; lipton et al . , 1993 ) . excessive ros / rns formation by these two processes may induce ups impairment and / or misfolding of molecular chaperons , thus resulting in protein aggregation and neuronal damage ( nakamura and lipton , 2009 ) . this is another point of intersection between mitochondria and ups functioning , since mitochondria , producing excessive ros , may adversely affect ups activity . in this reviewwe focus those mechanisms we believe to have a central importance in the disease pathogenesis , especially mitochondrial dysfunction and ups alteration and the correlation between both . at first , it is important to consider mitochondrial dysfunction , because mitochondria are essential organelles for the production of atp , especially in high energy demand cells such as neurons . moreover , mitochondria are involved in the regulation of calcium homeostasis , which allows the cell to maintain low levels of cytosolic calcium and avoid neurotoxicity . mitochondrial respiratory chain cx i in the brain is the major source of endogenous relevant free radicals . regarding ups dysfunction is significant , since proteasome is a major protein degradation cell complex and protein aggregation appears as a main event in pd pathology . as mentioned before , genetic studies highlighted the growing importance of mitochondria role in pd etiopathogenesis , mainly pink1 and parkin genes , whose mutated forms have been linked to eopd . a recent report by liu and colleagues proved that pink1 exists as a dimer in mitochondrial protein complexes . the protein is composed of a kinase domain , where the mutations are clustered , which is responsible for the enzymatic activity and the formation of the dimer . although mutations in pink1 do not affect dimerization and localization with mitochondrial complexes , those mutations impair mitochondrial respiration and atp synthesis in pd cell models . in addition , pink1 knockdown also contribute to a statistical decrease in oxygen consumption ( liu et al . , 2009 ) . it was also observed a significant reduction in mitochondrial respiration in the striatum of pink1 knockout mice ( gautier et al . , 2008 ) and mitochondrial pathology in pink1 drosophila mutants ( clark et al . , 2006 ; park et al . , 2006 ) . thus , and according to deas and colleagues work , pink1 is thought to be related with mitochondrial respiration . . review that pink1 protects cells against oxidative stress induced apoptosis by interacting with the mitochondrial chaperone tumor necrosis factor receptor - associated protein 1 ( trap1 ) / heat shock protein 75 ( hsp75 ) ( pridgeon et al . , 2007 ) . pink1 is also involved in ( 1 ) mitochondria fisson / fusion , functioning as a potential pro - fusion protein in mammals , in ( 2 ) mitochondrial trafficking by interacting with miro and milton proteins and playing a probable role in anterograde mitochondrial transport , and in ( 3 ) mitochondrial calcium homeostasis ( esteves et al . , 2010b ) by direct regulation of calcium efflux from mitochondria through the mitochondrial sodium / calcium exchanger ( deas et al . , mitochondrial dysfunction and increased apoptosis were also shown in drosophilaparkin null mutant or in overexpressed parkin mutation models ( greene et al . , 2003 ) . parkin is a protein that may have a role in maintenance of the outer mitochondrial membrane integrity ( darios et al . , 2003 ) . these results were supported by evidences that relate parkin function with mitochondrial dynamics ( riparbelli and callaini , 2007 ) . additionally , it seems to be involved in mitochondria trafficking since it was shown that parkin may bind and stabilize microtubules ( yang et al . , 2005 ) . ( 2008 ) reported that parkin is recruited to dysfunctional mitochondria and induces their autophagy , what means that degradation of impaired mitochondria in park2 eopd is reduced , contributing to neuronal death . stronger evidence of mitochondrial involvement in pd provided by genetic studies , the mitochondrial etc cx i impairment has been shown to have great relation with pd , since 1989 , when schapira and coworkers first discovered cx i deficiency in sn of postmortem pd brain ( schapira et al . , 1989 ) . , 1990a , b ; janetzky et al . , 1994 ; gu et al . , 1998 ) . moreover , some studies reported a decrease of relevant subunits of cx i in pd human brain ( mizuno et al . interestingly , mptp ( 1 - methyl -4-phenyl-1,2,3,6-tetrahydropyrine ) , a neurotoxin capable to induce pd symptoms in humans ( langston et al. ,1983 ) , is a mitochondrial cx i inhibitor . mptp cross the blood brain barrier and is converted to 1 - methyl 4 phenylpyridinium ( mpp ) within glial cells and then released to the extracellular space . mpp is also concentrated into daergic neurons via da transporter . in this way , as cx i deficiency was also found in other pd patients tissues , as platelets and lymphoblasts ( barroso et al . , 1993 ; schapira , 1994 ) . to address the potential causes of complex i defect , namely if it was due to an environmental toxin or to an alteration of mitochondrial or nuclear dna , the cytoplasmic hybrid ( cybrid ) technique , first described by king and attardi ( 1989 ) , has been applied . in pd cybridsit was observed a decrease in cx i activity , increase in ros production and a higher susceptibility to mpp ( swerdlow et al . , 1996 ; cassarino et al . these results indicate that the complex i defect in pd appears to be genetic and arising from mtdna . foremost , it was reported the generation of fibrillar and vesicular inclusions in a cybrid model of sporadic pd , which replicates the essential antigenic and structural features of lb , without the need for exogenous protein expression or inhibition of mitochondrial or proteasomal function ( trimmer et al . , 2004 ; esteves et al . it is rational that mitochondria in vulnerable pd neurons are under greater stress condition that increases the probability of mtdna mutation ( soong et al . , 1992 ) . recently , another incontestable piece of evidence of mitochondrial dysfunction in pd has come from conditional knockout mice , termedmice , the first animal model showing the slow progressive degeneration of dopamine neurons seen in pd . these mice have a disruption of the gene for mitochondrial transcription factor a ( tfam ) in dopaminergic neurons . in addition , this mouse model shows reduced mtdna expression , reduced respiratory chain function in midbrain dopaminergic neurons which , in turn , leads to a parkinsonian phenotype , with adult onset of slowly progressive impairment of motor function associated to the formation of intraneuronal inclusions and dopamine nerve cell death ( ekstrand et al . , 2007 ) . further , there is evidence of reduced mitochondrial mass and size in mouse sn dopaminergic neurons as compared to non - dopaminergic neurons , suggesting selective vulnerability of dopaminergic neurons as a result of a mitochondrial dysfunction ( liang et al . , 2007 ) . accordingly , a progressive mitochondrial dysfunction process leads to a loss of atp , decreased calcium buffering capacity and increased oxidative stress that act synergistically to promote daergic cell death . although mitochondrial dysfunction is a major factor , ups impairmentmay also be associated as a consequence of mitochondrial dysfunction , or as a causative factor . protein degradation by the ups consists in a tightly regulated process , starting with target - protein tagging with a polyubiquitine chain by ubiquitin ligases e3 in an atp dependent manner andending with degradation by the 26s proteasome , which also requires atp to assemble 19s and 20s subunits ( goldberg , 2003 ) . the proteasome is a large protease complex that eliminates intracellular misfolded , oxidized or aggregated proteins ( ciechanover and brundin , 2003 ) . there is proteasome loss of function with aging , reflected on proteasome subunits expression , activity and response to oxidative stress ( bulteau et al . , 2000 ; in addition to the existence of eopd forms caused by mutations in genes that codify proteins of ups pathway , such as parkin and uchl1 , as previously referred , the colocalization of proteasome subunits in lbs ( ii et al . , 1997 ) and alsothe presence of ubiquitinated proteins in lb may indicate ups failure in pd , since ubiquitin is the signal protein for degradation by ups . beside ups impairmentbeing evidently related with some eopd forms , it was also reported proteasomal dysfunction in the sn in lopd ( mcnaught and jenner , 2001 ) .2001 ) reported that expression of mutant alpha - synuclein significantly reduces chymotryptic - like , tryptic - like and post - acidic activities of the proteasome . cell lines expressing wild - type alpha - synuclein also showed a reduction in proteasomal activity but there was no significant difference compared with control cell lines . in the presence of lactacystin , a highly selective proteasome inhibitor , mutant cell lines demonstrated an increased sensitivity to alpha - synuclein toxicity with significantly increased cell death ( tanaka et al . , 2001 ) . additionally to the relation with mitochondria discussed in the previous section , parkin protein is an e3 ubiquitin - protein ligase . mutations in the gene of parkin , originate lack of enzymatic activity of this enzyme and consequent misfolded proteins accumulation . some studies revealed that over - expression of parkin , using viral vectors , may be effective against alpha - synucleinopathy ( lo bianco et al . 2004thus , parkin over - expression may be a therapeutic strategy for pd , due to increased ups activity and misfolded proteins clearance , avoiding aggregates - induced cell death . pink1 interacts with several chaperons , like hsp90 and cdc37 , and loss of this interaction can contribute to pd pathogenesis ( moriwaki et al . , 2008 ) . pink1 also interacts with parkin which is responsible for pink1 homeostasis by ubiquitination and posterior degradation via ups ( deas et al . , 2009 ) . pink1 and parkin also form a functional e3 ligase complex with dj - 1 , which promotes degradation of misfolded parkin substrates by ups , including parkin itself and synphilin - 1 . pd - pathogenic mutations in genes that code these three proteins are likely to impair e3 ligase activity of the complex , which may explain somehow the pd pathogenesis ( xiong et al . , 2009 ) . mutations of the gene uchl1 ( park5 ) and alteration of coded protein activity have been found to associate with several neurodegenerative disorders . in addition to a deubiquitination function previously referred , in vitro studies reported that uchl1 has dimerization - dependent ubiquitin ligase activity ( liu et al . , 2002 ) . after a latency period of 12 weeks rats developed the characteristic symptoms of the disease and also showed , in the postmortem analysis , striatal da depletion and daergic cell death in snpc . as mentioned before , genetic studies highlighted the growing importance of mitochondria role in pd etiopathogenesis , mainly pink1 and parkin genes , whose mutated forms have been linked to eopd . a recent report by liu and colleagues proved that pink1 exists as a dimer in mitochondrial protein complexes . the protein is composed of a kinase domain , where the mutations are clustered , which is responsible for the enzymatic activity and the formation of the dimeralthough mutations in pink1 do not affect dimerization and localization with mitochondrial complexes , those mutations impair mitochondrial respiration and atp synthesis in pd cell models . in addition , pink1 knockdown also contribute to a statistical decrease in oxygen consumption ( liu et al . , 2009 ) . it was also observed a significant reduction in mitochondrial respiration in the striatum of pink1 knockout mice ( gautier et al . , 2008 ) and mitochondrial pathology in pink1 drosophila mutants ( clark et al . , 2006 ; park et al . , 2006 ) . thus , and according to deas and colleagues work , pink1 is thought to be related with mitochondrial respiration . review that pink1 protects cells against oxidative stress induced apoptosis by interacting with the mitochondrial chaperone tumor necrosis factor receptor - associated protein 1 ( trap1 ) / heat shock protein 75 ( hsp75 ) ( pridgeon et al . , 2007 ) . pink1 is also involved in ( 1 ) mitochondria fisson / fusion , functioning as a potential pro - fusion protein in mammals , in ( 2 ) mitochondrial trafficking by interacting with miro and milton proteins and playing a probable role in anterograde mitochondrial transport , and in ( 3 ) mitochondrial calcium homeostasis ( esteves et al . , 2010b ) by direct regulation of calcium efflux from mitochondria through the mitochondrial sodium / calcium exchanger ( deas et al . , mitochondrial dysfunction and increased apoptosis were also shown in drosophilaparkin null mutant or in overexpressed parkin mutation models ( greene et al . , 2003 ) . parkin is a protein that may have a role in maintenance of the outer mitochondrial membrane integrity ( darios et al . , 2003 ) . these results were supported by evidences that relate parkin function with mitochondrial dynamics ( riparbelli and callaini , 2007 ) . additionally , it seems to be involved in mitochondria trafficking since it was shown that parkin may bind and stabilize microtubules ( yang et al . , 2005 ) . ( 2008 ) reported that parkin is recruited to dysfunctional mitochondria and induces their autophagy , what means that degradation of impaired mitochondria in park2 eopd is reduced , contributing to neuronal death . stronger evidence of mitochondrial involvement in pd provided by genetic studies , the mitochondrial etc cx i impairment has been shown to have great relation with pd , since 1989 , when schapira and coworkers first discovered cx i deficiency in sn of postmortem pd brain ( schapira et al . , 1989 ) . , 1990a , b ; janetzky et al . , 1994 ; gu et al . , 1998 ) . moreover , some studies reported a decrease of relevant subunits of cx i in pd human brain ( mizuno et al . , 1989 ; keeney et al . , 2006 ) . interestingly , mptp ( 1 - methyl -4-phenyl-1,2,3,6-tetrahydropyrine ) , a neurotoxin capable to induce pd symptoms in humans ( langston et al. ,1983 ) , is a mitochondrial cx i inhibitor . mptp cross the blood brain barrier and is converted to 1 - methyl 4 phenylpyridinium ( mpp ) within glial cells and then released to the extracellular space . mpp is also concentrated into daergic neurons via da transporter . in this way , as cx i deficiency was also found in other pd patients tissues , as platelets and lymphoblasts ( barroso et al . , 1993 ; schapira , 1994 ) . to address the potential causes of complex i defect , namely if it was due to an environmental toxin or to an alteration of mitochondrial or nuclear dna , the cytoplasmic hybrid ( cybrid ) technique , first described by king and attardi ( 1989 ) , has been applied . in pd cybridsit was observed a decrease in cx i activity , increase in ros production and a higher susceptibility to mpp ( swerdlow et al . these results indicate that the complex i defect in pd appears to be genetic and arising from mtdna . foremost , it was reported the generation of fibrillar and vesicular inclusions in a cybrid model of sporadic pd , which replicates the essential antigenic and structural features of lb , without the need for exogenous protein expression or inhibition of mitochondrial or proteasomal function ( trimmer et al . , 2004 ; esteves et al . , 2010a ) supporting this theory , it is rational that mitochondria in vulnerable pd neurons are under greater stress condition that increases the probability of mtdna mutation ( soong et al . , 1992 ) . recently , another incontestable piece of evidence of mitochondrial dysfunction in pd has come from conditional knockout mice , termed mitopark mice , the first animal model showing the slow progressive degeneration of dopamine neurons seen in pd . these mice have a disruption of the gene for mitochondrial transcription factor a ( tfam ) in dopaminergic neurons . in addition , this mouse model shows reduced mtdna expression , reduced respiratory chain function in midbrain dopaminergic neurons which , in turn , leads to a parkinsonian phenotype , with adult onset of slowly progressive impairment of motor function associated to the formation of intraneuronal inclusions and dopamine nerve cell death ( ekstrand et al . , 2007 ) . further , there is evidence of reduced mitochondrial mass and size in mouse sn dopaminergic neurons as compared to non - dopaminergic neurons , suggesting selective vulnerability of dopaminergic neurons as a result of a mitochondrial dysfunction ( liang et al . , 2007 ) . accordingly , a progressive mitochondrial dysfunction process leads to a loss of atp , decreased calcium buffering capacity and increased oxidative stress that act synergistically to promote daergic cell death . although mitochondrial dysfunction is a major factor , ups impairment may also be associated as a consequence of mitochondrial dysfunction , or as a causative factor . protein degradation by the ups consists in a tightly regulated process , starting with target - protein tagging with a polyubiquitine chain by ubiquitin ligases e3 in an atp dependent manner and ending with degradation by the 26s proteasome , which also requires atp to assemble 19s and 20s subunits ( goldberg , 2003 ) . the proteasome is a large protease complex that eliminates intracellular misfolded , oxidized or aggregated proteins ( ciechanover and brundin , 2003 ) . there is proteasome loss of function with aging , reflected on proteasome subunits expression , activity and response to oxidative stress ( bulteau et al . , 2000 ; in addition to the existence of eopd forms caused by mutations in genes that codify proteins of ups pathway , such as parkin and uchl1 , as previously referred , the colocalization of proteasome subunits in lbs ( ii et al . , 1997 ) and also the presence of ubiquitinated proteins in lb may indicate ups failure in pd , since ubiquitin is the signal protein for degradation by ups . beside ups impairmentbeing evidently related with some eopd forms , it was also reported proteasomal dysfunction in the sn in lopd ( mcnaught and jenner , 2001 ) . tanaka et al . ( 2001 ) reported that expression of mutant alpha - synuclein significantly reduces chymotryptic - like , tryptic - like and post - acidic activities of the proteasome . cell lines expressing wild - type alpha - synuclein also showed a reduction in proteasomal activity but there was no significant difference compared with control cell lines . in the presence of lactacystin , a highly selective proteasome inhibitor , mutant cell lines demonstrated an increased sensitivity to alpha - synuclein toxicity with significantly increased cell death ( tanaka et al . , 2001 ) . additionally to the relation with mitochondria discussed in the previous section , parkin protein is an e3 ubiquitin - protein ligase . mutations in the gene of parkin , originate lack of enzymatic activity of this enzyme and consequent misfolded proteins accumulation . some studies revealed that over - expression of parkin , using viral vectors , may be effective against alpha - synucleinopathy ( lo bianco et al . thus , parkin over - expression may be a therapeutic strategy for pd , due to increased ups activity and misfolded proteins clearance , avoiding aggregates - induced cell death . pink1 interacts with several chaperons , like hsp90 and cdc37 , and loss of this interaction can contribute to pd pathogenesis ( moriwaki et al . , 2008 ) . pink1 also interacts with parkin which is responsible for pink1 homeostasis by ubiquitination and posterior degradation via ups ( deas et al . , 2009 ) . pink1 and parkin also form a functional e3 ligase complex with dj - 1 , which promotes degradation of misfolded parkin substrates by ups , including parkin itself and synphilin - 1 . pd - pathogenic mutations in genes that code these three proteins are likely to impair e3 ligase activity of the complex , which may explain somehow the pd pathogenesis ( xiong et al . , 2009 ) . mutations of the gene uchl1 ( park5 ) and alteration of coded protein activity have been found to associate with several neurodegenerative disorders . in addition to a deubiquitination function previously referred , in vitro studies reported that uchl1 has dimerization - dependent ubiquitin ligase activity ( liu et al . , 2002 ) . ( 2004 ) proposed a progressive pd rat model by systemic administration of proteasome inhibitors . after a latency period of 12 weeks rats developed the characteristic symptoms of the disease and also showed , in the postmortem analysis , striatal da depletion and daergic cell death in snpc . after discussing the possible involvement of mitochondria dysfunction and proteasome impairment in both familial and sporadic forms of pd , we will discuss the possible molecular mechanisms that underline mitochondrial and proteasome interplay in the disease course ( see figure 3 ) . the four mitochondrial main functions are ( 1 ) atp production ( 2 ) regulation of calcium homeostasis ( 3 ) oxidative stress and ( 4 ) apoptotic cell death mediation . reduction in mitochondrial cx i activity in lopd and the acute model of pd ( mpp ) inhibit proteasome activity , as it actually happens in lopd and with aging . also in park6 ( pink1 mutation - eopd ) there is mitochondrial function compromise and therefore proteasome impairment . however , recent and preliminary results shown an up - regulation of proteasomal activity in ndufa knockdown cells . in the opposite way of this two ways crosstalk , lactacystin and / or mutations in genes that code pink1 ( park6 ) , parkin ( park2 ) and dj - 1 ( park7 ) may interfere with the function of the ubiquitin e3 ligase activity complex , inducing alpha - synuclein aggregation and mitochondrial - mediated apoptosis . also described in the figure are parkin function of induce autophagy in dysfunctional mitochondria and uchl - 1 deubiquitinating activity , impaired in park2 and park5 , respectively . recent evidence in cell culture systems , where mutant pink1 or loss of pink1 was induced , showed a relation between mitochondrial dysfunction and proteasomal impairment ( liu et al . , 2009 ) .2009 ) demonstrated that proteasomal function is impaired due to a reduction of mitochondrial dependent atp synthesis . these authors claim that mitochondrial compromise is the primary event followed by proteasome impairment and consequent alpha - synuclein aggregation . alpha - synuclein aggregates are proved to be able to reduce even more the proteasomal activity , resulting in a vicious cycle . moreover , tanaka et al . ( 2001 ) also reported that proteasome inhibition by lactacystin in cells expressing mutant alpha - synuclein increases mitochondria - dependent apoptotic cell death . ( 2009 ) showed that only a co - systemic administration of the proteasome inhibitor z - ile - glu ( otbu ) - ala - leu - aldehyde ( psi ) with mptp in mice , produced a significant reduction in locomotor activity that was correlated with degeneration of the nigrostriatal dopaminergic pathway . ( 2009 ) reported that after proteasome inhibition in dopaminergic neuronal cells , there is a prominent accumulation of polyubiquitinated proteins that are likely to be related with activation of mitochondrial apoptosis and consequent neuronal loss . an increase of polyubiquitinated proteins in mitochondria may be indicative of the potential role of mitochondria as an early key sensor of ups impairment and accumulation of misfolfed ubiquitinated proteins . in this point of viewproteasomal dysfunction seems to appear as the causal disturb , followed by mitochondria participation in the molecular mechanism of the disease . moreover , the formation of the ubiquitin e3 ligase activity complex ( by pink1 , dj - 1 and parkin ) seems to have a neuroprotective role in mitochondria - mediated apoptosis ( darios et al . gorner et al . , 2007 ) . additionally , as referred above , mutation in genes that code these proteins and consequent protein alteration contribute to ups impairment and at same time mitochondrial dysfunction . ( 2003 ) also demonstrated that proteasomal inhibition in mesencephalic dopaminergic neurons caused mitochondrial dysfunction , reduced glutathione levels , and increased generation of free radicals . mitochondrial neurotoxins ( mpp , rotenone , 6 - ohda , etc ) induce an increase production of ros and oxidative stress ( sun et al . , 2007 ) . this sustained increase could lead to an increase in protein oxidation that overwhelms proteasomal degradative capacity . moreover , an increase in free radicals production , may induce oxidative modifications of proteasomal subunits that also compromise the proteolytic capacity ( for review see sun et al . , 2007 ) . cheng and coworkers , showed that the antioxidant , puerarin attenuated mpp - induced proteasomal dysfunction , by reducing the accumulation of ubiquitin - conjugated proteins ( cheng et al . , 2009 ) . thus , oxidative stress may link mitochondrial dysfunction to ups impairment , whereas the cross - talk between mitochondria and proteasome is likely to be a two ways dead - road inside the cell . in an effort to clarify the pd pathogenesis we hypothesize that interaction between mitochondrial and proteasome plays a critical role in the daergic cell death . to support that , some results from our group demonstrated an effective correlation between mitochondrial dysfunction and proteasomal impairment , suggesting that they act synergistically and not only exclusively by themselves . we reported that mpp induced in nt2 human teratocarcinoma a marked increase in ubiquitinylated protein levels , free radicals generation and a decrease in atp levels . accordingly , we also showed a reduction in proteasomal activity ( chymotrypsin and post - acidic - like activities ) in nt2 - mpp treated cells after 24 h and in nt2 - 0 ( mitochondrial dna depleted ) cells under basal conditions ( domingues et al . our results show that in the absence of a functional mitochondria , due to mitochondrial dna knockdown , the ups is down - regulated . in this way , mitochondrial alteration leads to an imbalance in the cellular oxidative status , inducing a proteasomal deregulation , which may exacerbate protein aggregation and consequently degenerative events . our recent results corroborate the notion that a mitochondrial dysfunction induces an oligomerization of alpha - synuclein ( esteves et al . , 2010a ) . moreover , it seems that proteasomal dysfunction may potentiate alpha - synuclein oligomerization , which in turn can have an inhibitory effect on the proteasomal activities . interestingly , recent and preliminary results shown an up - regulation of proteasomal activity in ndufa cxi subunit knockdown cells ( with a decrease in cxi activity ) ( martins branco et al . , unpublished results ) . the evident discrepancy between nt2 - mpp and ndufa knockdown cells may reflect that mpp treated cells are an acute toxic model while ndufa knockdown cells represent a chronic mitochondrial dysfunction model whereas an ups up - regulation reflects a cell rescue phenomenon . recently , endo and coworkers showed that a dysfunction of the mitochondrial import system without atp alterations may up - regulate proteasome activity ( endo et al . , 2009 ) . the authors declare that this review was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "parkinson 's disease ( pd ) is the most common progressive neurodegenerative movement disorder , characterized by the selective loss of nigrostriatal dopaminergic neurons , and the presence of intracellular insoluble proteinaceous inclusions , known as lewy bodies . although pd etiopathogenesis remains elusive , the leading hypothesis for the death of specific groups of neurons establishes that mitochondrial dysfunction , alterations in the ubiquitin - proteasomal system ( ups ) , and oxidative stress are major events that act synergistically causing this devastating disease . in this review we will focus on mitochondrial impairment and its implications on proteasomal function and alpha - synuclein aggregation . we will address the role of mitochondria and proteasome cross - talk in the neuronal loss that leads to pd and discuss how this knowledge might further improve patient therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tsetse flies are vectors of african trypanosomes , the causative agents of sleeping sickness in humans and nagana in animals . following a long period of increasing prevalencehowever , this debilitating disease still affects a wide range of people in sub - saharan africa and is invariably fatal if untreated . nagana is estimated to cost african agriculture us $ 4.5 billion per year . until now , therefore , the search for novel strategies must continue and among them are alternative vector - based strategies . these strategies require a clear and full understanding of the various steps and mechanisms involved in the transmission of the parasite . to be transmitted , trypanosomes must undergo cycles of development of varying complexity within the tsetse fly , transforming from bloodstream forms to procyclic nonmammalian infective forms in the fly midgut ( establishment ) . to complete their life cycle , trypanosoma brucei brucei andthe causative agents of human african trypanosomiasis , trypanosoma brucei rhodesiense , and trypanosoma brucei gambiense must migrate from the midgut to the salivary glands where they transform into infective metacyclic forms . the fly 's ability to acquire the parasite , favor its maturation , and transmit it to a mammalian host is known as vector competence , which depends on complex interactions between glossina , the parasite , and the environment . the factors involved in establishment are largely unknown and those involved in maturation are unclear . nevertheless , among factors involved in vector competence appear to be the sex of the fly , the trypanosome genotype , the tsetse intestinal lectin , and the tsetse immune responses . more recently , antioxidants have been shown to greatly increase midgut trypanosome infection rates in tsetse , suggesting that oxidative stress plays a role in the refractoriness of tsetse to trypanosome infection . moreover , a no signal has been suggested to be required to promote the trypanosome migration to the salivary glands and its subsequent maturation into mammalian infective forms . nevertheless , vectorial competence of a given glossina species could also be influenced by the nature of the parasite species . moreover , differences in the establishment and maturation rates have even been observed for different genotypes belonging to a given parasite subspecies . these observations demonstrate the complexity of the mechanisms governing parasite development in the tsetse fly . given that knowledge on the infection process that remains limited , further studies are required to characterize the overall glossina - parasite molecular interactions . the identification of the proteins secreted by the insect procyclic parasite may contribute to the increasing of the understanding of the infection process and lead to the identification of potential targets for drug and / or vaccine design . in this respect , we have investigated the excreted / secreted proteins ( esps ) produced by two procyclic trypanosoma brucei parasite subspecies ( t. brucei brucei and t. brucei gambiense ) and compared their respective secretomes . stib 215 and biyamina procyclic forms of trypanosoma brucei brucei and trypanosoma brucei gambiense , respectively , were grown at 25c , in cunningham 's medium supplemented with 20 % fetal calf serum . when the cultures displayed logarithmic growth , procyclic parasites were washed four times with phosphate buffer saline ( pbs ) and spun for 10 minutes for 2600 g at 25c . the parasites were resuspended at a concentration of 210 cells / ml in a secretion buffer and incubated for 2 hours at 25c for esp production . during the incubation process , the parasite cell viability was controlled every 15 minutes by flow cytofluorometry using the dna intercalant propidium iodide ( ip ) procedure . briefly , 210 parasites were incubated with 1 g ip in 1 ml pbs as recommended by the manufacturer ( immunotech , marseille , france ) . the cells were immediately analyzed with a facscan flow cytometer ( becton dickinson , ivry , france ) using an argon - ion laser . the secretion of esps was stopped by centrifugation of the parasites , 2600 g for 10 minutes at 4c . the supernatant was collected and filtered on 0.2 - m filter and immediately mixed with protease inhibitors . the esps were then concentrated by ultrafiltration on a pm 10 ( 10 kda cut - off ) membrane ( amicon ) for further protein electrophoretic separation ( sds - page ) . the protein concentration was determined by the bradford dye binding procedure ( bio - rad ) , and 300 g of esps were further separated using sds - page . parasite pellets were resuspended at a concentration of 210 cells / ml of laemmli buffer . the protein concentration was determined , and 100 g of proteins of the total proteomes were further separated using sds - page . proteins from the different samples ( esps and total proteome ) were heated at 100c for 2 minutes and spun for 5 minutes for 14.000 g prior to separation using one - dimensional sds - page . proteins were separated on 2418 cm tricine / sds / urea - polyacrylamide gels ( 12 % acrylamide ) . after migration , the gels were fixed , and the proteins were visualized using coomassie brilliant blue r - 250 . pictures of the gels were taken with an amersham biosciences personal densitometer ( bio - rad ) . sixty four protein spots were excised manually from the one - dimensional gels of esps , washed , digested with trypsin , and extracted with formic acid . protein digests were analyzed using either a triple - quadrupole mass spectrometer ( q - trap 4000 ; applied biosystems ) , coupled to a nanochromatography system ( dionex ) or an ion trap mass spectrometer ( esquire hct ; bruker ) , and interfaced with an hplc - chip system ( agilent ) . ms / ms data were searched against ncbi and trypanosoma brucei databases using mascot software . raw data were analyzed using data analysis software ( bruker ) to generate a peak list for searching a trypanosoma database extracted from the sanger institute . the mascot ( v2 .2 ) search engine was used with the following parameters : one missed cleavage allowed for trypsin , carboxymethylation of cyst as fixed modification , methionine oxidation as variable modification , and a 0.6 - da tolerance range for mass accuracy in ms / ms . at least one matching sequence of tags of high quality was needed for positive identification of proteins . potential false - positive identifications have been addressed as described by elias et al . , ( 2005 ) , using identical search parameters against a database in which the sequences have been reversed . we set a false discovery rate ( fdr ) of 1 % . when the mascot peptide score was below ( and even above ) the mascot peptide score indicated for an fdr of 1 % , a systematic manual validation was done with stringent parameters ( at least 6 y or b ions , at least 4 consecutive ions , and peptidic sequence formed of more than 7 amino acids ) . the main objective of the study was a comprehensive characterization of the proteins secreted by two different strains of t. brucei in procyclic form , t. brucei gambiense / biyamina strain ( whose bloodstream form is pathogenic for humans ) and t. brucei brucei / stib 215 strains ( whose bloodstream form is pathogenic for animals ) . a three - step investigation was conducted and consisted in the following : ( 1 ) one - dimensional electrophoresis profiling of the secreted proteins and comparison with the corresponding proteomes , ( 2 ) the identification of the secreted proteins by mass spectrometry and distribution into functional classes , and ( 3 ) a cross - comparative analysis between ( a ) the secretomes of the two strains ( procyclic forms ) and ( b ) the secretome of the procyclic forms and the proteome . the profiles generated by the electrophoretic separation of the secretome proteins from the two procyclic parasite strains ( biyamina and stib 215 ) and their corresponding proteomes are shown in figure 1 . a high number of bands were separated , corresponding to proteins with molecular weights ranging from 7.2 to 205.8 kda . clear differences were noted between the electrophoretic profiles of the proteome of the two procyclic strains and their corresponding secretome profiles , in terms of both proteic band intensity and presence or absence of several protein bands . furthermore , since over the entire 2 - hour secretion process ( a ) the parasites ' viability remained constant and was greater than 98 % and ( b ) the incubated trypanosomes presented normal morphology and motility , all these data indicate that the secretome resulted from an active export of proteins from living trypanosomes and not from cellular lysis . the electrophoretic profiles of the proteome of the two procyclic strains show that they have many protein bands in common ( 3234 visible bands ) ; some differences in intensity were noted after coomassie staining . visual observation of the 1d gels showed similarities as well as some quantitative and qualitative differences between the secretome profiles of the two parasite subspecies . secreted proteins from procyclic strains were fractionated by 1d sds - page , and 64 spots were selected all along the 1d gel for ms / ms analysis . this resulted in the identification of 427 secreted proteins from the stib 215 ( t. brucei brucei ) strain and 483 proteins from biyamina ( t. brucei gambiense ) . supplementary table 1 ( in supplementary material available online at doi : 10.1155 / 2010 / 212817 ) lists the proteins identified . they were classified into 12 main functional categories ( figure 2 and supplementary table 1 ) . both of the procyclic strains ' secretomes , the proteins associated with unassigned functions , those associated with ( un ) folding and degradation processes , and protein synthesis were quantitatively the largest categories , with a total of 60 % of the secreted proteins ( figure 2 ) . moreover , lipid and cofactor , transport , rna / dna metabolism , cell cycle and organization , nucleotide metabolism , and amino acid metabolism contribute approximately 26 % of the secreted proteins , and finally carbohydrate metabolism accounts for about 9 % of the secreted proteins . globally , the importance ( expressed as the percentage of the proteins concerned ) of each functional class is similar for both procyclic strains , except for the redox and signaling classes that are under - represented in the t. brucei brucei strain ( stib 215 ) secretome as compared with the t. brucei gambiense strain ( biyamina ) ( figure 2 ) . comparing the secretomes of two procyclic strains ( figure 3 ) showed 279 common secreted proteins ( 57.8 % and 65.3 % of the biyamina and the stib 215 esps , resp . ) , 204 ( 42.2 % ) were specifically secreted by t. brucei gambiense ( biyamina ) , and 148 ( 34.7 % ) were secreted by t. brucei brucei ( stib 215 ) . the proteins specifically secreted by either stib 215 or biyamina were represented in all 12 functional categories previously identified . however , the ( un ) folding and degradation protein class was particularly valuable because it grouped 14 different families of peptidases ; four of which were specifically secreted by the t. brucei gambiense procyclic strain ( biyamina ) and two others by t. brucei brucei ( stib 215 ) . the other eight secreted peptidase families were common to both strains ( table 1 ) . surprisingly , we also identified a serine protease inhibitor among the proteins secreted by both strains . more than one - third of the proteins ( 39.2 % ) specifically secreted by stib 215 procyclic strain corresponds to hypothetical proteins , although they account for only 27.8 % in biyamina . of major interestwas the observation that some proteins , such as calreticulin and ige - dependent histamine - releasing factor which belong to the class of signaling proteins , were specifically secreted only by the biyamina strain ; this strain also secreted higher levels ( 2.9 % ) of proteins belonging to the redox class . finally , only 45 % of the proteins secreted by the procyclic strains were common to the proteins from the procyclic total proteome ( figure 4 ) . this data also corroborates that the secretome results from an active protein exportation from living cells . the life cycle of trypanosoma is complex and requires the expression of specialized proteins for the development of the parasite in both invertebrate and vertebrate host environments , to escape host immune responses . for successful glossina infection , the parasite has to adapt to its novel environment ; it must switch both from a homoiothermic to a poikilothermic host and from a mammal to an insect . furthermore , it must develop new weapons or choose among its panel of weapons to fight a novel type of host defense . in vertebrate hosts , trypanosome bloodstream forms are protected by the variant surface glycoprotein ( vsg ) , which prevents their recognition by the host immune system . when the parasites are taken up by the insect in the blood meal , they must confront the insect 's immune system , mainly composed of midgut proteases , physical barriers such as peritrophic matrix , reactive oxygen species , and antimicrobial peptides . a number of studies have revealed that the procyclins , surface glycoproteins expressed by trypanosome procyclic forms , may protect these forms against tsetse midgut proteases . however , there are yet no examples of direct interactions between tsetse fly and trypanosome molecules . the purpose of this study was to identify the whole excreted / secreted proteins in two trypanosome procyclic forms to better understand the interactions between the trypanosome and tsetse fly in terms of establishment in the midgut or vectorial competence and to search for new tools for vector control strategies . we successfully used 1d electrophoresis and ms / ms to establish the first extensive protein map of the secretome of the procyclic form of the parasite using stringent mass spectrometry criteria to validate potential candidates ( false discovery rate ( fdr ) 1 % ) . the substantial differences between the set of proteins secreted by both trypanosome strains and those of their respective total proteomes demonstrate that the proteins identified in the secretome are indeed secreted and are not an artifact resulting from possible cell lysis during the secretion step . sequencing 1d gel showed that a large number of proteins were specifically secreted by both biyamina ( t. brucei gambiense ) and stib 215 ( t. brucei brucei ) ( 42.4 % and 34.6 % , resp . ) . the differences in the protein secretion profiles between the two parasite subspecies may reflect their genetic differences and could possibly be related to differences in glossina vector competence . to better understand the possible role of the secreted proteins , the groups of unfolding and degradation proteins , protein synthesis , and proteins with no assigned functions were the most numerous . unknown or hypothetical proteins are a source of candidates that could be used to explore novel functions . we did not expect to find so many different peptidase families among the unfolding and degradation classes of secreted proteins . the group of proteases deserves the greatest attention because these enzymes cover a large panel of physiological and pathological functions . consequently , representatives of this group are known to be virulence factors , to favor parasite invasion and its growth in the hostile host environment , to make it possible to escape the host immune defenses , and / or , finally , to produce nutrients by hydrolyzing host proteins . some parasites such as plasmodium falciparum produce a diversified panel of secreted and surface - bound proteases . in a variety of animals , including humans as well as arthropods , the blood clotting system plays an important role in the immobilization of invading parasites , and in preventing their dispersal from the site of initial invasion . how the parasite proteases process to inactivate or cause the inappropriate expression of host immune defense systems is a major question . in addition to their direct role as virulence factors , secreted proteases are involved in various housekeeping functions during parasitic infection . as shown in porphyromonas gingivalis , the proteolytic degradation of host proteins is able to produce nutritive elements for parasite growth . virulence has correlated positively with the expression of secreted proteases in a variety of systems where virulence can be modified genetically or in response to environmental cues . as a result , strains of leishmania mexicana , engineered by targeted gene disruption of the genes encoding a pair of cysteine proteases , showed attenuated virulence . the virulence of laboratory strains and clinical isolates of entamoeba histolytica correlates well with the level of activity of a secreted cysteine protease . in addition , inhibitors of serine proteases have been shown to block the entry of merozoites of plasmodium into erythrocytes . surprisingly , an inhibitor of serine proteases ( ecotin ) has been discovered in the secretion products of trypanosome strains . the wide distribution of serine protease inhibitors , and their ability to regulate a variety of divergent proteinase - dependent physiological functions , shows that they are closely involved in a host of biological processes . in several systems , serine protease inhibitors from viruses have been implicated in pathogen escape from the host immune system . in brugia malayi , cysteine - protease inhibitors that can inhibit host proteases involved in antigen processing have been discovered . besides contributing to protect the parasite against the host 's defense mechanisms , in addition to their protein degrading activity , proteases perform highly specific processing tasks that can affect protein structure , function , life span , and localization . by limited and specific cleavage , proteases can act as switches , turning protein activity on or off ; they can also modulate protein function in more complex ways , regulating vital processes . consequently , proteases constitute both promising candidates for developing diagnostic tools and attractive drug targets to fight trypanosomes and subsequently to control sleeping sickness . proteins involved in signaling make up another group of proteins identified in the secretome of procyclic trypanosome , but even this is not a major class ; some proteins , such as calreticulin , could play physiopathological roles . autoantibodies against calreticulinare found in the sera of human hosts in a number of parasitic diseases and it was suggested that the parasite - derived calreticulin could trigger an inappropriate immune response against self - antigens through molecular mimicry . the class of proteins involved in protein synthesis is quantitatively ( 17 % ) well represented in the secretome . however , some proteins , such as elongation factor - 1 , were suggested to be a virulence factor in leishmania . we did not expect to find so many representatives of the carbohydrate metabolism protein class ( 9.79 % in the t. brucei gambiense secretome and 8.27 % in the t. brucei brucei secretome ) . several papers have reported on the ability of the procyclic cell to adapt its metabolism to different environments . because tsetse hemolymph contains abundant supplies of amino acids , and because the tsetse fly itself uses proline as a major carbon source during flight , it has long been speculated that in situ , the procyclic form of trypanosomes , might use proline . accordingly , proline is a key component in the culture media currently used to cultivate the parasite . in contrast , another study has shown that , when grown in high glucose - concentrated media , the procyclic cells are susceptible to glycolytic inhibitors and to the downregulation of genes encoding glycolytic enzymes . this confirms the flexibility of the trypanosome metabolism and its adaptability to diverse growth conditions . cells grown under chemostat conditions were shown to regulate their glucose metabolism according to the availability of proline . since the buffer we used to stimulate protein secretion contained sugar , it was not surprising to find a high level of enzymes involved in carbohydrate metabolism . besides , procyclic forms establish mainly in the vector 's midgut where sugar may be abundantly available immediately after a blood meal . nevertheless , two major questions remain unresolved because glycolytic enzymes are expected to be intracellular enzymes . ( 1 ) why is there such a high level of carbohydrate metabolism enzymes secreted ? ( 2 ) what is the role of such enzymes when secreted in the fly 's midgut ? the redox - protein class of secreted proteins was poorly represented . this finding was also unexpected because in the flies ' midgut , reactive oxygen species are generated during immune responses or because of the abundance of heme molecules freed from the digested blood meal . in addition , some of these proteins may play roles other than the detoxification of reactive oxygen . therefore , a superoxide dismutase ( sod ) has been shown to be secreted by t. cruzi ; it was suggested that this enzyme was involved in both the parasite defense mechanism and the establishment of the parasite in the host . in another context , sod was considered to participate in the immune escape in filarial infections . finally , in the procyclic parasite secretome , we have identified 13 ( gapdh , clathrin heavy chain , rab protein , ubiquitin , 14 - 3 - 3 proteins , cyclophilin , enolase , hsp70 , actin , cofilin , tubulin and , and histone ) out of the 22 proteins commonly associated with the exosome secretion pathway in various organisms . moreover , we have also identified translationally controlled tumor protein ( tctp ) in this secretome . this protein was shown to be present in exosomes . these results suggest that the secretome proteins may be secreted via an exosome pathway that has never been described until now in trypanosomes . this also suggests that exosome - directed transmission - blocking vaccines could be developed and are capable of suppressing the capacity of the parasite to infect the vector and consequently preventing the spread of the parasite in human populations . to conclude , the trypanosoma parasite is a multistage organism that evolves in tsetse flies and vertebrates . designing drugs that persistently interrupt the life cycle of this parasite requires a comprehensive understanding of its biology and the mechanism involving the vector - parasite interactions . the primary goal of our proteomic investigation was to identify secretome proteins of procyclic parasites to improve the knowledge of these interactions . the secretome encompasses a spectrum of proteins that may be required for every facet of the parasite 's lifestyle , from the modification of the physiological environment to the immune escape . this may open leads to initiate novel strategies for controlling the parasites and sleeping sickness .\noutput:\n" }, { "from": "agent", "value": "trypanosoma secretome was shown to be involved in parasite virulence and is suspected of interfering in parasite life - cycle steps such as establishment in the glossina midgut , metacyclogenesis . therefore , we attempted to identify the proteins secreted by procyclic strains of t. brucei gambiense and t. brucei brucei , responsible for human and animal trypanosomiasis , respectively . using mass spectrometry , 427 and 483 nonredundant proteins were characterized in t. brucei brucei and t. brucei gambiense secretomes , respectively ; 35 % and 42 % of the corresponding secretome proteins were specifically secreted by t. brucei brucei and t. brucei gambiense , respectively , while 279 proteins were common to both subspecies . the proteins were assigned to 12 functional classes . special attention was paid to the most abundant proteases ( 14 families ) because of their potential implication in the infection process and nutrient supply . the presence of proteins usually secreted via an exosome pathway suggests that this type of process is involved in trypanosome esp secretion . the overall results provide leads for further research to develop novel tools for blocking trypanosome transmission ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: low back pain ( lbp ) which has risen in most industrialized countries is one of the most frequent reasons both , for consulting a primary care physician and for taking time off routine activities . long term sickness absence , is associated with serious health risks , and future serious illness . low back pain disorder affects 80 % of the population at some time of them life , and corresponding costs led to important researches , concerning determinants , preventive exercises , and treatments . studies showed that , having previous history of lbp is often prognostic of future back problems . chronic cases of this problem which represent decreased muscle flexibility and trunk strength led to significant burden on the health care and compensation systems . perhaps , prevention of lbp in primary stages , contribute to prevention of disabilities of back pain in progressive stages . some indicative health instrument would be useful to explore health related quality of life ( hrqol ) in relation to lbp . hrqol measurement instruments have been developed to evaluate health status and its components , such as physical activity , psychological functioning ( emotional and mental activity ) , social functioning ( relationships with others and participation in social activities ) , perception of health status , and pain . these measurements have been widely used to evaluate the broad impact of various diseases on patients and the effectiveness of different conditions and also to be related to the extent of satisfaction with care associated with various treatments . the documentation of factors predictive of a developed impact of lbp on hrqol would be of great value for defining management strategies . although lbp tends to increase over time , for many people it becomes chronic , requiring different interventions . surgery can be effective where there is a clearly recognized structural pathology that is possible to be the cause of the pain but , chronic lbp may exist without having an identifiable structural pathology . considering the costs , risks and distresses associated with surgery methods and the indistinct results , surgery is often considered as the last treatment option for lbp . many patients search for non - surgical conservative treatment at clinics where both modern procedures and integrative treatments are available . in many asian countries , the traditional system of medicine has developed in to a more integrative systems consist of herbal medicine spinal manipulation , bee venom acupuncture , and acupuncture . we report this study , using up dated statistical modeling to evaluate the impact of acute lbp on hrqol and determine the contributions of physical and psychosocial factors to the lbp recovery adjusted by some probable confounders , according to 24 weeks carefully followed , a preventive cohort of patients with lbp traditional treated . one hundred and fifty consecutive patients aged 18 years and older , self - referring to ( i.e. first consultation with ) for a primary complaint of lbp or had referred with lumbar disc herniation already confirmed by mri , between november 2006 and october 2007 at jaseng hospital in korea , which offers both , western and korean medical services . of the 150 patients who were registered in the study , 116 had sub - acute or chronic lbp , and 34 experienced acute lbp . exclusion criteria were having lbp caused by non - spinal or soft tissue problems , vas of pain 4 or less , pregnancy , spinal tumor , rheumatoid arthritis , unexplained weight loss ; and major organ transplantation . the therapeutic package consisted of weekly treatments and daily intake of herbal medicine for 24 weeks . treatments included : 20 min sessions of acupuncture , 20 min sessions of a korean version of spinal manipulation known as chuna , bee venom acupuncture 20 min at physician 's discretion , and special herbal medicines in dry powder form and water extracted form as prescribed by attending physicians from the 10 herbal medicines 2 g and 120 ml , respectively , twice a day , 30 min after meal . we considered the following as independent variables : visual analogue scale ( vas ,0 - 10 ) of back pain and leg pain , while the oswestry disability index ( odi ) , sex , age and bmi . sf - 36 health related quality of life questionnaire was secondary outcomes was assessed as response variable . the time dependent variables were evaluated at baseline , 4 , 8 , 12 , 16 , 20 , and 24 week as longitudinal form . a skew - symmetric random intercept mixed model was used to take into account the intra - patient and inter - patient variability in an outcome attributable to repeated measurements and to allow the inclusion of patients with missing values . the skew - symmetric models as alternative to the normal model can be applied in application where the symmetry seems unreasonable . thus , the construction of asymmetric distributions can accommodate practical values of skewness and kurtosis can be useful for data modeling and robustness studies of normal theory methods . for the purpose of inference , we used the bayesian markov chain monte carlo ( mcmc ) approach that provides a comparatively simple numerical tool that finds a solution as analytical difficulties inherent in the ml approach . to perform the skew - modeling , we mainly focus on some elliptical family , such as normal and student 's t distributions , as well as the skew form of these densities as the skew - symmetric families of distributions for the random intercept . in the bayesian framework , this is equivalent to the two - stage hierarchy form . these bayesian hierarchical models , equivalent to the two - stage hierarchy form , for the data analysis based on mcmc techniques . the estimated random intercepts distribution according to the normal model by the estimated plots clearly showed deviation from normality in such a way that the distribution of intercept shows evidence of skewness . the results of modeling determining the effect of traditional treatment on quality of life variable by considering vas , odi , age , sex , surgery recommended status , baseline hrqol measures and bmi between different follow - ups . for each time - dependent variable , we analyzed the difference between the measurements obtained at the six time points . one hundred and fifty consecutive patients aged 18 years and older , self - referring to ( i.e. first consultation with ) for a primary complaint of lbp or had referred with lumbar disc herniation already confirmed by mri , between november 2006 and october 2007 at jaseng hospital in korea , which offers both , western and korean medical services . of the 150 patients who were registered in the study , 116 had sub - acute or chronic lbp , and 34 experienced acute lbp . exclusion criteria were having lbp caused by non - spinal or soft tissue problems , vas of pain 4 or less , pregnancy , spinal tumor , rheumatoid arthritis , unexplained weight loss ; and major organ transplantation . the therapeutic package consisted of weekly treatments and daily intake of herbal medicine for 24 weeks . treatments included : 20 min sessions of acupuncture , 20 min sessions of a korean version of spinal manipulation known as chuna , bee venom acupuncture 20 min at physician 's discretion , and special herbal medicines in dry powder form and water extracted form as prescribed by attending physicians from the 10 herbal medicines 2 g and 120 ml , respectively , twice a day , 30 min after meal . we considered the following as independent variables : visual analogue scale ( vas ,0 - 10 ) of back pain and leg pain , while the oswestry disability index ( odi ) , sex , age and bmi . sf - 36 health related quality of life questionnaire was secondary outcomes was assessed as response variable . the time dependent variables were evaluated at baseline , 4 , 8 , 12 , 16 , 20 , and 24 week as longitudinal form . a skew - symmetric random intercept mixed model was used to take into account the intra - patient and inter - patient variability in an outcome attributable to repeated measurements and to allow the inclusion of patients with missing values . the skew - symmetric models as alternative to the normal model can be applied in application where the symmetry seems unreasonable . thus , the construction of asymmetric distributions can accommodate practical values of skewness and kurtosis can be useful for data modeling and robustness studies of normal theory methods . for the purpose of inference , we used the bayesian markov chain monte carlo ( mcmc ) approach that provides a comparatively simple numerical tool that finds a solution as analytical difficulties inherent in the ml approach . to perform the skew - modeling , we mainly focus on some elliptical family , such as normal and student 's t distributions , as well as the skew form of these densities as the skew - symmetric families of distributions for the random intercept . in the bayesian framework , this is equivalent to the two - stage hierarchy form . these bayesian hierarchical models , equivalent to the two - stage hierarchy form , for the data analysis based on mcmc techniques . the estimated random intercepts distribution according to the normal model by the estimated plots clearly showed deviation from normality in such a way that the distribution of intercept shows evidence of skewness . the results of modeling determining the effect of traditional treatment on quality of life variable by considering vas , odi , age , sex , surgery recommended status , baseline hrqol measures and bmi between different follow - ups . for each time - dependent variable , we analyzed the difference between the measurements obtained at the six time points . the number of patients who had normal bmi category ( 18.5 - 23 ) , overweight ( 23 ) , obesity and underweight ( 18.5 ) was 63 ( 42 % ) , 37 ( 24.7 % ) and 48 ( 32 % ) , respectively . figure 1 show odi and vas levels ( as two important factors which can show the effect of the traditional treatment ) , over time for 25 randomly selected subjects and suggests that odi and vas have uncertain trend over time for selected subjects . visual analogue scale of back pain ( right ) , and oswestry disability index ( left ) based on bugs codes used for fitting different models , we use 10 , 000 iterations after discarding the first 5 , 000 iterations to make inference . to avoid correlation problems in the generated chains , resulting parameter estimates ( posterior means ) . according to the best model based on bayesian model selection criteria ( skew - normal random intercept model ) , vas and odi measures , age and bmiwere significant based on the 95 % bayesian probability intervals in skew - symmetric modeling also , based on insignificant coefficients , there was no significant difference in hrqol measures between different genders or different groups of surgery recommended . subjects with more bmi had better response to traditional treatment according to their hrqol trend . estimated coefficients for different covariates indicated that the variation of vas was more effective than that of other considered factors ( bmi and sex ) . the conventional treatment of lbp consists of medication , tissue stimulation ( e.g. , electrical stimulation , ultrasound ) , rest and orthotics . failure of the non - surgical treatment leads to alternative options , such as a variety of surgical approaches to achieve spinal fusion with various results . given the inadequate results of traditional treatment and their side effects , there has been increasing usage of complementary and alternative medicine ( cam ) by lbp sufferers to relieve their symptoms . there are more than 50 potential therapies promising to alleviate the pain , and provide a cure for this problem . so , several groups of health care providers , such as physicians , physiotherapists , chiropractors , and a host of more alternative caregivers are involved in management of lbp . nothing works very well singly for lbp and recommend multi - disciplinary treatment programs . the results of the current study showed that our integrative treatment package comprised of herbal medicines , acupuncture , bee venom acupuncture , and a korean massage ( chuna ) significantly decreased vas and odi and improved the hrqol of patients . several traditional chinese and korean herbal medicine including cibotium barometz , atractylodes japonica , ostericumkoreanum , eucommia ulmoides , acanthopanax sessiliflorus , achyranthesbidentata , psoraleacorylifolia , peucedanum japonicum , lycium chinense , boschniakia rossica , and cuscuta chinensis have been used as treatments for lbp in this study . the above herbal medicines in powder and decoction forms are part of the historically developed treatment practiced at jaseng hospital for low back pain . it has been shown that the compounds of cibotium barometz and atractylodes japonica showed inhibition of osteoclast , and protection of the osteoblasts respectively . furthermore , it has been reported that eucommia ulmoides , dioscorea spongiosa and cuscuta chinensis have anti - osteoporotic effects through osteoblast - like cell proliferation , osteoclast inhibition effects and recover bone mineral density . psoralea corylifolia and lycium chinense have known anti - inflammatory effects while peucedanum japonicum and boschniakia rossica are good anti - oxidant . acupuncture is based on ancient chinese philosophical theories about the flow of vital energy through the body along the discrete pathways termed meridians . in acupuncture , specific points alongside of the meridians are utilized to balance the energy flows within the body . many different styles of acupuncture and adjunctive techniques have been developed and disseminated into other cultures . there are several systematic reviews on efficacy of acupuncture in lbp patients comparing acupuncture with sham acupuncture , other sham treatments , no additional treatment , or another active treatment . traditional korean doctors have used apitoxin , or honey bee venom , as a type of pharmacopuncture . it has been shown that bee venom administration is effective in pain relief of rheumatoid and degenerative arthritis , which require long - term treatment , as well as resolution of inflammation . several mechanisms have been suggested to clarify the bee venom induced antinociceptive and anti - inflammatory effects , including the activation of spinal alpha 2 - adrenoceptors of descending noradrenergic , adrenergic , and serotonergic pathways and activation of capsaicin - sensitive primary afferent ( cspa ) fibers . the analgesic effects induced by bv acupuncture also may be attributable to bioactive bv compounds , including peptides ( melittin , adolapin , apamin , and the mast - cell degranulating peptide ) , enzymes ( phospholipase a2 ) , and amines ( histamine and epinephrine ) massage is a simple way of pain relief , which stimulates large diameter nerve fibers that finally inhibits nociceptive fibers . it may also provide its benefits through shifting the autonomic nervous system from a state of sympathetic response to a state of para - sympathetic response , and increasing the pain threshold through the release of endorphins the results of a systematic review showed that massage is beneficial for patients with sub - acute and chronic nonspecific lbp in terms of improving symptoms and function . two studies compared massage to sham treatment reported that massage was superior for pain and function on both short and long - term follow - ups . however , a latest cochrane review of spinal manipulation in chronic lbp concluded that spinal manipulative therapy results in a small , statistically significant but not clinically significant pain relieve and function in patients with chronic lbp compared with other treatments . to the best of our knowledge , this is the first study investigating the effect of an integrative treatment package on lbp . furthermore , while most of the studies considered short term beneficial effects of traditional and cam approach to relieve pain , the long observational period of 6 months allowed us to predict progress of treatment outcomes . however , we were unable to compare the results of our study to others and could not find which treatment of the package is more effective than others . our new analysis showed that the older participants in our study benefited more from the lbp integrated package . the prevalence of benign back pain appears to increase with an increasing age , with a peak in the sixth decade . back pain is one the four most commonly reported symptoms in the elderly and the prevalence of osteoarthritis , disc degeneration , osteoporosis and spinal stenosis are known to increase with age . furthermore , it has been shown that the risk of disabling back pain rises in older age . in light of this , it is highly desirable to find a safe way for lbp in elderly patients . since , lbp has such human and financial impacts on society and since the numbers of people aged are increasing our package will be a good suggestion for this group . another new finding of the current study was the more benefits of the integrated package in patients with higher bmi . the data for association between obesity and low back pain appears to be controversial however , there are stronger evidences showing that overweight and obesity are associated with an increased risk of low back pain . yet , there is no appropriate therapeutic approach for the obese patient with low back pain . so the more positive result of the integrated package for more obese patients in the current study is favorable . one more interesting finding of the re - analysis of the results with new method is the similar results in patients with and without the herniated disc surgery . it seems that this package may lead to impressive outcomes even in patient with serious underlying patho - physiology similar other study . we suggest a stepwise controlled study to address : ( 1 ) whether this package approach is more effective than other treatments ; and ( 2 ) which treatment components of the package are more substantial than others . in summary , this integrative package was effective in the treatment of lbp with leg pain and warrants further rigorous investigations .\noutput:\n" }, { "from": "agent", "value": "background : to investigate the respective contribution of various biologic and psychosocial factors , especially health related quality of life ( hrqol ) as a main outcome , in the natural history of acute low back pain ( lbp ) and to evaluate the impact of this condition on hrqol.methods : in a prospective cohort study for 24 weeks , 150 patients were assessed at an outpatient clinic in korea consulting for low back and confirmed disc herniation duration at inclusion and treated with treatment package comprised of herbal medicines , acupuncture , bee venom acupuncture , and a korean version of spinal manipulation ( chuna ) . study participants were evaluated at baseline and every 4 weeks for 24 weeks . low back intensity levels were measured on a visual analog scale ( 0 - 10 ) , back function was evaluated with the oswestry disability index ( 0 - 100 ) , disability assessed by hrqol assessed by the short form 36 health survey ( 0 - 100 in 8 different sub - categories ) . results : out of 150 patients , 128 completed the 24 weeks of traditional therapy . patients reported improvements sf - 36 outcome measures . at the completion of the study , low back pain scores improved by a mean of 3.3 ( 95 % ci = 2.8 to 3.8 ) . according to the results of our modeling , low back intensity level , back function and bmi measures had significant effects on quality of life during study . interpreting the coefficients of modeling , the impact of the decreasing acute lbp episode on hrqol by vas and odi outcomes , was high and important.conclusions : this study highlights the large contribution of integrative package therapy as an effective preventive method for improving lbp patient 's hrqol ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: as an undergraduate student at dartmouth college in the mid-1950s , i always looked forward to the yearly visit of the poet robert frost , a former student , who would read his poetry to an enthralled audience . one of my favorites was the road not taken , which ends with the line : two roads diverged in a wood , and ii took the one less traveled by , and that has made all the difference . when i entered the field of glycobiology , there were only a handful of investigators working in this area . my first experience in this field was in the lab of luis glaser at washington university where we showed that baker 's yeast contains a phosphomannomutase that converts mannose 6 - phosphate ( man -6-p ) to man -1-p for the formation of gdp - mannose , a donor for mannan synthesis . i worked on this project during the summer before i entered medical school , and while i found the experience thrilling , the topic seemed to have little relevance to medicine . i never imagined that 37 years later mutations in this enzyme would turn out to be the most common cause of a newly recognized group of genetic disorders termed congenital disorders of glycosylation . it is a personal example of a well - established truth in science , that studies of simpler organisms often lead to major advances in clinical medicine . during my time with luis , i learned that most mammalian cells also contain a coat of sugar on their surfaces , termed the glycocalyx . there was little known about the structure or function of the molecules that comprise the glycocalyx , but it had been shown that one of the component sugars , sialic acid , served as a receptor for viral attachment . i also became aware of the work of walter morgan , winifred watkins , and elvin kabat showing that the abo blood group determinants were carbohydrate in nature , with the a and b determinants differing by a single sugar that was selectively recognized by antibodies and plant lectins . this raised the possibility that the sugars in the glycocalyx might also be arranged in specific sequences to serve as information molecules in cell cell interactions . energized by this possibility , i decided to take the road less traveled and enter the emerging field of glycobiology . after working several summers in the glaser lab , i went to victor ginsburg 's lab at the nih for two years to gain more experience in this area . it was an exciting time to be at the nih , but one event was particularly important for my career . this was the start of my long - term scientific collaboration with my wife rosalind , who had just received her ph.d . in biochemistry , studying glycogen biosynthesis . as joe goldstein has eloquently pointed out , if you are fortunate to hook up with the right collaborator , the combined efforts of two minds can be a powerful force toward discovery . but he warned that one must be careful to choose a partner who is smarter than you ( goldstein and brown , 2000 ) . certainly in my caseafter two years at the nih we were anxious to start our own lab and were fortunate to obtain faculty positions in the department of medicine at washington university . one of the attractive features of the department was its strong support for the performance of basic research by its faculty . there was a recognition that basic research ultimately propels advances in clinical medicine . with the belief that knowledge of the structure of protein - linked oligosaccharides was fundamental for understanding the diversity and function of these molecules and for gaining insight into the enzymes involved in their synthesis , we set out to determine the structures of the n - and o - linked glycans of the monoclonal antibodies of patients with multiple myeloma as this provided large amounts of homogeneous glycoproteins synthesized by a single clone of plasma cells . as this work progressed and n - linked structures of other proteins became available , we noted a striking similarity of the core regions of high - mannose and complex - type glycans with each other and with the yeast mannan structures determined by clint ballou . a few years later the significance of this observation became clear when our lab , as well as the labs of phil robbins and don summers , showed that both high - mannose and complex - type glycans are derived from a common oligosaccharide of 14 sugars ( three glucoses , nine mannoses , and two n - acetyl glucosamines ) that is transferred from a lipid - carrier to the nascent protein in the endoplasmic reticulum ( er ) and then is processed in the er and the golgi to produce these two types of structures . it appears that as multicellular organisms developed and required a greater array of glycans , mother nature chose to use the existing system of high - mannose oligosaccharide synthesis as the template for generating the required oligosaccharide diversity rather than developing an entirely new biosynthetic pathway . interestingly , one of the glucose residues of the oligosaccharide was subsequently found to serve a special function in facilitating the folding of recipient glycoproteins mediated by lectin - containing chaperones , as shown by ari heleneus , armando parodi , and john bergeron . this is a wonderful example of carbohydrate lectin interactions serving an essential biological role . our initial effort to study the biological role of cell surface glycans involved the use of toxic lectins such as ricin to select chinese hamster ovary ( cho ) cells that fail to bind the lectins due to blocks in the synthesis of protein and lipid - linked oligosaccharides . this approach , taken simultaneously by pam stanley , was successful in selecting cells with a variety of defects in glycan biosynthesis . the study of these mutant cells provided a number of new insights into the biosynthetic pathways for glycan assembly , but the alterations in cell behavior were modest , a disappointing outcome . it turned out that cho cells grown in tissue culture were not good models for studying the biological roles of glycans , for when the same genes were inactivated in mice , the phenotypes were often quite dramatic , in some cases resulting in embryonic lethality . this demonstrated that the proper synthesis of glycans is important for normal development and tissue function . the growing number of genetic defects that give rise to the congenital disorders of glycosylation leaves no doubt as to the essential nature of protein and lipid glycosylation . as frequently happens in research , there have been numerous and often unexpected uses of the lectin - resistant cell lines . the most spectacular example comes from the work of jim rothman , with whom i am sharing this year 's e. b. wilson award along with randy schekman . jim used our 15b ricin - resistant cell line as a key reagent in his brilliant studies of copi - mediated vesicular transport in the golgi . while we were in the midst of our studies of the n - linked oligosaccharide processing pathway , bill sly reported his discovery that man -6-p residues in the high - mannose units of lysosomal acid hydrolases serve as recognition markers for the targeting of this family of proteins to lysosomes . it was initially assumed that there must be an atp - dependent kinase that carried out this reaction , but attempts to detect such an activity were unsuccessful . in view of this , student in the lab who had performed the [ h ] mannose pulse - chase experiments demonstrating oligosaccharide processing on the vesicular stomatitis virus g glycoprotein , and i decided it might be informative to carry out a similar experiment with - glucuronidase , a lysosomal acid hydrolase . this would tell us the timing of the phosphorylation event , which would provide clues as to where the phosphorylation occurred , e.g. , er versus golgi . as it turned out , the experiment was very successful and set us on the path toward discovering a novel biosynthetic pathway , but not before we had to sort out some puzzling results . ira readily detected phosphorylation of mannose residues on the newly synthesized - glucuronidase , but these were resistant to alkaline phosphatase , whereas sly had shown that this treatment removes the phosphate from the - glucuronidase that he had isolated from tissues . my first reaction was that ira had messed up the assay , but the finding was reproducible , so we were convinced by the data and tried to figure out what it was telling us . eventually we realized that the phosphorylated mannose might be in the form of a diester , which would be resistant to phosphatase treatment . this indeed turned out to be the case , and after considerable effort we were able to show that the diester linkage involved a covering n - acetylglucosamine residue . this immediately suggested a biosynthetic scheme involving two enzymes whereby glcnac -1-p is first transferred from the nucleotide sugar udp - glcnac to a mannose residue to form a glcnac - p - man diester , and then the glcnac is excised to form the man -6-p monoester described by sly ( tabas and kornfeld , 1980 ) . at this point , marc reitman and ajit varki joined the project , and within a very short time we were able to demonstrate the presence of the two postulated enzymes . proof that we had identified the correct pathway came from our studies showing that fibroblasts of patients with i - cell disease , an autosomal recessive lysosomal storage disorder characterized by hypersecretion of acid hydrolases due to the failure to synthesize the man -6-p recognition marker , lack glcnac - p transferase activity ( reitman et al . , 1981 ) . these initial studies set us on a path that we followed for the next 30 years , addressing key questions such as how glcnac - p transferase recognizes acid hydrolases as specific substrates and exploring new areas , such as the nature of the receptors that recognize the man -6-p residues ( e.g. , the two man -6-p receptors ) and how they transport the acid hydrolases from the golgi to lysosomes and return to repeat the process . this work has shown how an oligosaccharide recognition molecule serves a critical role in a fundamental cell biological process , the sorting of proteins . while we have been exploring the role of the man -6-p recognition system in cell biology , other labs have discovered many more examples of biological functions of protein and lipid - linked oligosaccharides . and many of these functions have proved to be relevant to clinical medicine . as a physician - scientist who strongly believes in the value of basic research in the advancement of clinical medicine , looking back , i 'm very glad that i decided to take the road less traveled .\noutput:\n" }, { "from": "agent", "value": "we now recognize that a large number of membrane and soluble proteins contain covalently linked oligosaccharides that exhibit a vast array of structures and participate in a wide variety of biological processes . nowhere is this better illustrated than the mannose 6 - phosphate ( man -6-p ) recognition system that mediates the trafficking of newly synthesized acid hydrolases to lysosomes in higher eukaryotes . the asn - linked high - mannose oligosaccharides of these hydrolases facilitate folding of the nascent proteins in the endoplasmic reticulum via interaction with lectin - type chaperones and after phosphorylation in the golgi , function as ligands for binding to man -6-p receptors , a critical step in their transport to lysosomes . failure to synthesize the man -6-p recognition marker results in a serious lysosomal storage disease , one of a growing number of genetic conditions , termed congenital disorders of glycosylation , that result from faulty glycan biosynthesis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the phosphorylation of specific protein residues is a crucial event in the regulation of several cellular processes , operating on activation , deactivation or recognition of the target protein . a great deal of eukaryotic proteins ( 30 % in the human genome ) undergo this reversible post - translational modification ( 1 ) . phosphorylation on serine / threonine or tyrosine residues is accomplished by protein kinases ( pks ) , one of the largest protein families , comprising 1.52.5 % of all eukaryotic genes ( 2 ) . although the amount of data produced in various screening assays is steadily growing ( 36 ) , experimental identification of phosphoproteins and the determination of individual phosphorylation sites remains a difficult and time - consuming task . hence , the implementation of computational tools proves to be very useful for collecting and analysing experimental data . several sequence - based methods to predict phosphorylation sites were developed using different computational approaches such as regular expressions with context - based rules ( 7 ) , position - specific scoring matrices ( pssms ) ( 8 ) , artificial neural networks ( 9,10 ) , support vector machines ( svms ) ( 11,12 ) , hidden markov models ( 13 ) and iterative statistical methods ( 14 ) . all these methods are based on the hypothesis that the sequence surrounding the phosphorylated residue represents the main determinant for kinase specificity . however , the specificity determinants and rules remain elusive for a large number of protein kinases that display a number of substrates sharing little or no sequence similarity in the known phosphopeptides . we propose that , at least in some cases , the rules of kinase specificity may reside in the presence of structural determinants which only occasionally overlap with sequence consensi and which might be independent of the residue order in protein sequences . hereit collects information retrieved from the phospho.elm database ( 15 ) and is enriched with structural information and diverse annotations at the residue level . in addition , the database stores the results of a large - scale local structural comparison which suggest functional annotation of phosphorylation sites by 3d similarity . cases of significant structural similarity between phosphorylation sites may indicate that they are phosphorylated by the same kinase . the phospho3d database was constructed by collecting data from the phospho.elm database which gathers experimentally verified phosphorylation sites manually extracted from the literature . the phospho.elm dataset used in this work ( version 4.0 ) contains 5314 phosphorylation sites , or instances , belonging to 1805 different sequences . the correspondence between phospho.elm sequences and the protein data bank ( pdb ) chains was established via the seq2struct resource ( 16 ) , an exhaustive collection of annotated links between swissprot - trembl and pdb sequences . links are based on sequence alignment using pre - established highly reliable thresholds . from a list of 4530 sequencestructure links ( for further details see website documentation ) , only the ones having the phosphorylable residue in the alignment region were retained , this resulting in 2726 instances ( 166 unique phospho.elm instances on 1219 protein chains ) . the basic information stored in phospho3d consists of the instance , its flanking sequence ( 10 residues ) and any residue whose distance from the instance does not exceed 12 thus defining a 3d neighbourhood which we define as zone . for each zone , annotation at the residue level is provided , namely solvent accessibility supplied by the naccess program ( 17 ) , secondary structure assignment given by the dssp program ( 18 ) and residue conservation as from the consurf - hssp database ( 19 ) . users can also retrieve information extracted from the phospho.elm dataset ; for instance , the medline reference pmid and , when available , the kinase ( s ) that phosphorylate ( s ) the given site . in addition , for each zone the results of a large - scale local structural comparison versus a representative dataset of pdb ( 20 ) protein chains from eukaryotic organisms are also given . the comparison was carried out using the query3d sequence / fold independent algorithm ( 21 ) . the structural similarity demands that matching residues have a root mean square deviation ( r.m.s.d . ) lower than a given threshold , whereas the biochemical similarity is evaluated using a dayhoff substitution matrix ( 22 ) . the score of the match is the number of matching residues which fulfil the similarity criteria . the significance of the score is evaluated by calculating the z - score over the score distribution of the query zone comparison to the whole dataset . the phospho3d database can be searched by kinase name , by pdb identification code or keyword . a browsing function has been also implemented . the information returned to the user consists of a brief description of the pdb structure ( s ) which fulfil the search criterion and of a list of instances presented along with associated information ( figure 1 ) . for each instance , the user can select three options related to the surrounding structural zone : a graphical view using the jmol java applet ( ) ; a tabular view reporting the zone annotation at the residue level ; a list of 3d matches identified by local structural comparison . a tabular view of the matching residues is also presented ( figure 1 ) . in the central panel a list of instances for the pdb file 1a52 is shown . for each of them , users can visualize the corresponding zone via the jmol viewer , the annotation at the residue level and the results of the large - scale local structural comparison . for each structural match the score , the z - score , and the rmsd are reported along with the scop fold ( 27 ) of the matching pdb files . the phospho3d database is a useful tool for the analysis of the structural features of experimentally verified phosphorylation sites . moreover , it provides the results of a large - scale local structural comparison between the zones and a representative set of eukaryotic protein chains . the results of such a comparison identify new putative phosphorylation sites and suggest the kinase ( s ) responsible for phosphorylation . the annotations will be integrated as a feature in the pdbfun server ( 23 ) . we are also planning to identify and annotate those sites which are recognized by protein phosphatases and phosphoresidues - binding modules ( 2426 ) . the phospho3d dataset ( annotations at the residue level and structural comparison results ) is available upon request .\noutput:\n" }, { "from": "agent", "value": "phosphorylation is the most common protein post - translational modification . phosphorylated residues ( serine , threonine and tyrosine ) play critical roles in the regulation of many cellular processes . since the amount of data produced by screening assays is growing continuously , the development of computational tools for collecting and analysing experimental data has become a pivotal task for unravelling the complex network of interactions regulating eukaryotic cell life . here we present phospho3d , , a database of 3d structures of phosphorylation sites , which stores information retrieved from the phospho.elm database and is enriched with structural information and annotations at the residue level . the database also collects the results of a large - scale structural comparison procedure providing clues for the identification of new putative phosphorylation sites ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: rhabdoid tumor of the kidney ( rtk ) is a rare and highly malignant neoplasm of infancy3 ) . rtk constitutes only 1.7 % of all renal tumors15 ) , but has a strong tendency for early metastasis to distant region2 ) . according to previous studies , 22 - 28 % of the patients had metastatic disease at the initial diagnosis , and lung metastases were predominant13 ,14 ) . rtk is known to be associated with primary or metastatic brain tumors3 ) , and previous studies reported that 10 - 21 % of rtk patients had central nervous system ( cns ) involvements11 ,13 ) . since there is a possibility of tumor spread through csf pathway , cns involvement is considered as a poor prognostic factor1 ) . however , most of cns involvements in previous studies described brain involvement . the symptoms of brain involvement are associated with raised intracranial pressure such as vomiting and a decrease level of consciousness6 ) . however , since the symptoms of spinal involvements are inability to walk , pain , or sphincteric deficit , it is difficult to detect spinal metastasis in young patients who are unable to express their symptoms . in the current report , we present a case of an 8 - month - old girl who had rtk with solitary spine metastasis . due to her young age , an 8 - month - old girl without specific past medical history was admitted to the hospital due to nausea and diarrhea . on physical examination , abdominal computed tomography ( ct ) revealed a 6.85.85.3 cm sized left renal mass without lymph node enlargement ( fig . gross examination revealed a well circumscribed , ovoid , firm mass in the lower pole of the kidney ( fig . the mass was abutted on the renal capsule , and the surface of the mass was whitish gray with multifocal hemorrhages . microscopic findings revealed that the tumor was a highly cellular neoplasm composed of tumor cells of varying size with prominent nucleoli and abundant cytoplasm ( fig . one week after the operation , weakness of both lower extremities and voiding failure were noted . on neurological examination , she failed to respond to pain in both legs . brain magnetic resonance imaging ( mri ) did not show evidence of metastatic disease , but lumbar mri revealed a 6.51 cm sized intradural extramedullary tubular mass with heterogeneous enhancement at l1 - s1 level ( fig . laminoplastic laminotomy was performed by a neurosurgeon to remove the tumor and decompress spinal cord . conus medullaris was displaced by the hypervascular tumor with yellowish color , however the upper margin of the tumor was clear ( fig . near total removal of the tumor was performed using cavitron ultrasonic surgical aspirator , and there was no root injury during the surgery ( fig . the pathologic findings were consistent with metastatic malignant rhabdoid tumor ( fig . 5 ) . she received adjuvant radiotherapy for 2 weeks and 13 cycles of chemotherapy ( vincristine , doxorubicin , and cyclophosphamide ) for 3 months postoperatively . the patient showed general weakness , seizure and changes in mental status during the chemotherapy . once regarded as a sarcomatous variant of wilms ' tumor , it is now regarded as a distinct entity unrelated to wilms ' tumor7 ) . incidence of metastatic disease in rtk ( 22 - 28 % ) is more frequent than wilms ' tumor , and cns involvement is reported as 10 - 21 % 11,13,14 ) . cns involvement in rtk patients also includes synchronous intracranial neoplasm like pineoblastoma , medulloblastoma , primitive neuroectodermal tumor , astrocytomy , ependymoma , and germ cell tumor as well as brain metastasis3 ) . national wilms ' tumor study ( nwts ) reported a high rate of cns involvement with an incident rate of 21 % 13 ) . in the international society of pediatric oncology , only 2.8 % of the rtk patients had cns involvement because cns evaluation was not a mandatory diagnostic procedure14 ) . reinhard et al. 10 ) reported that only 1 patient had synchronous brain lesion among 70 patients of rhabdoid tumor ( 32 rtk patients ) . however , these studies only reported either cns involvement or brain lesion , and failed to evaluate the rate of solitary spinal metastasis . to our knowledgein previous studies , mri was reported as a highly accurate diagnostic modality to detect spinal cord tumor , and the sensitivity of mri was reported as 100 % 9,12 ) . the sensitivities of ct scan were 93 % and 73 % for patients with extradural and intradural tumors , respectively . in the present case , usually , back pain may be a leading clinical complaint from spinal cord tumor5 ) . however , since the incidence of spinal cord tumor is very rare , physicians may start conservative management for back pain if abdomino - pelvic ct or radiography is negative . only 7 cases of primary malignant rhabdoid tumor of the spine have been reported in the literature4 ) , and solitary spinal metastasis of rtk is extremely uncommon as mentioned above . although spinal mri could be not performed in all rtk patients , thorough neurological examination might aid early detection of spinal involvement , especially in patients who are too young to express their symptoms such as back pain or sensory / motor loss of lower extremity . nwts reported that rtk patients younger than 1 year of age had poor prognosis older than 1 year of age13 ) . furthermore , among 30 patients who had cns involvement , 26 patients ( 86 % ) were younger than 1 year of age at diagnosis . thus , the evaluation of cns involvement including spinal mri or neurological examination should be considered especially in young patients ( 1 year of age ) . with early recognitionhowever , failure to recognize the condition and its serious nature , in addition of a lack of awareness of the importance of early referral for treatment can result in irreversible paralysis . tantawy et al. 12 ) reported that it took 2 - 22 months to diagnosis malignancy in spine after the first appearance of symptoms of spinal cord compression ( inability to walk , pain , or sphincteric deficits ) . in adult patients with spinal cord compression due tometastatic spinal tumor , clinical outcome in terms of ambulatory recovery was promising after decompressive surgery , especially in patients with preoperative grade iii of lower extremity motor power8 ) . the median age of rtk patients is 11 months13 ) , about half of the patients seem to be unable to walk at diagnosis . in these patients , it may be difficult to predict the return of the lower extremity motor power after decompressive surgery . rtk is considered one of the most aggressive malignant solid tumors , and the overall survival is reported to be 20 - 25 % 13 ) . thus , early diagnosis and intervention is necessary for preventing sequela such as spinal cord compression in survivors . in the present case , the motor power of lower extremity was returned after laminotomy , although the patient failed to survive . although oncological outcome is the most important , permanent sequela after treatment should be always considered in infants because it affects quality of life . since rtk prevalent in young children , the early detection of spinal metastasis may be difficult until paraplegia is seen . thorough neurological examination at diagnosis to detect spinal metastasis should be considered in young rtk patients .\noutput:\n" }, { "from": "agent", "value": "rhabdoid tumor of the kidney ( rtk ) is a rare malignancy in infancy . central nervous system involvement in rtk is already known . however , solitary spinal metastasis in rtk has been hardly reported . the authors report a case of metastatic rtk to spine causing paraplegia in an 8 - month - old girl . since the patient was young , the diagnosis of spine metastasis was delayed until paraplegia was seen after radical nephrectomy . thorough neurological examination should be performed for early diagnosis of spinal metastasis in young patients with rtk . if there are any abnormal signs in neurologic examination , magnetic resonance images of brain and spine are recommended ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: medline , embase , and the cochrane central register of controlled trials were searched from 1950 to june 2010 . abstracts of identified articles were reviewed by two reviewers , and full texts were examined by two reviewers ( j.a.h . and r.a . ) . for inclusion , trials were required to fulfill the following criteria : 1 ) be a randomized controlled design ; 2 ) report data on participants with diabetes ; 3 ) have a patient follow - up of at least 12 weeks ; 4 ) have a treatment group of metformin monotherapy , or metformin as an add - on therapy ; 5 ) have a placebo or background treatment comparator group ; 6 ) randomize patients to a fixed dose of metformin ; 7 ) blind patients to oral medications ; 8 ) use the same metformin dose for each patient in the trial ; and 9 ) use the same fixed dose of any other oral glucose - lowering medication used in combination with metformin in both the metformin and comparator arms . data were abstracted using standardized forms to include trial characteristics ( design and duration ) , interventions , trial quality , patient characteristics , and outcome measures . the quality of trials was assessed using items for selection bias , treatments , outcome measurement statistical methods , and outcome assessment . outcome measures were the change in hba1c levels from baseline to the end of the trial , total adverse events , and gastric adverse events ( diarrhea and abdominal cramps ) . in 12 trials where change in hba1c was not reported , it was calculated from baseline and end point data , and sd of the change was estimated from baseline and end point sds ( 9 ) . in five trials , sd of hba1c was not given , and it was imputed by averaging the sds from trials in which it was reported ( 9 ) . trials in which data were estimated or imputed were excluded from the meta - analysis in a sensitivity analysis . when a study had two metformin arms of different doses , we included both in the analysis and present results ordered by dose , splitting the comparator group into two to avoid covariance problems ( 9 ) . when a study had more than two metformin arms , we selected the lowest and highest dose arms for inclusion in the analysis . sensitivity analyses of trials of 24 weeks or longer were conducted to verify that the treatment effect observed was sustained in the longer trials . a second review comparing head - to - head trials of two metformin doses was conducted . the same inclusion criteria were applied with the exception that the comparator arm included a different dose of metformin to the intervention arm . in each multiarm trial , we pooled arms with metformin doses of 1,000 and 1,500 mg into a single low - dose arm and arms with metformin dose 1,500 mg into a single high - doseall of the trials covered in this review reported hba1c units as a percentage of total hemoglobin standardized to the methods of the diabetes control and complications trial ( dcct ) . results are therefore reported in dcct units as a percentage and have been converted into the new standard international units using international federation of clinical chemistry and laboratory medicine units of millimoles per mole of hemoglobin . data analysis was performed in stata 11.1 ( stata corporation , college station , tx ) using a random - effects model based on the dersimonian and laird method to pool the data , reporting the mean difference in change in hba1c levels between the metformin and comparator arms or high - dose versus low - dose metformin . adverse - events data were analyzed using the mantel - haenszel method , with a random - effects model reporting risk ratio under the approximating assumption that adverse events occur independently . heterogeneity was explored using subgroup analyses and metaregression to look at the effect of type of diabetes , trial size , bmi , age , metformin dose , baseline hba1c levels , length of follow - up , year of publication , country of trial , and change in hba1c in the comparator group . medline , embase , and the cochrane central register of controlled trials were searched from 1950 to june 2010 . abstracts of identified articles were reviewed by two reviewers , and full texts were examined by two reviewers ( j.a.h . and r.a . ) . for inclusion , trials were required to fulfill the following criteria : 1 ) be a randomized controlled design ; 2 ) report data on participants with diabetes ; 3 ) have a patient follow - up of at least 12 weeks ; 4 ) have a treatment group of metformin monotherapy , or metformin as an add - on therapy ; 5 ) have a placebo or background treatment comparator group ; 6 ) randomize patients to a fixed dose of metformin ; 7 ) blind patients to oral medications ; 8 ) use the same metformin dose for each patient in the trial ; and 9 ) use the same fixed dose of any other oral glucose - lowering medication used in combination with metformin in both the metformin and comparator arms . data were abstracted using standardized forms to include trial characteristics ( design and duration ) , interventions , trial quality , patient characteristics , and outcome measures . the quality of trials was assessed using items for selection bias , treatments , outcome measurement statistical methods , and outcome assessment . outcome measures were the change in hba1c levels from baseline to the end of the trial , total adverse events , and gastric adverse events ( diarrhea and abdominal cramps ) . in 12 trials where change in hba1c was not reported , it was calculated from baseline and end point data , and sd of the change was estimated from baseline and end point sds ( 9 ) . in five trials , sd of hba1c was not given , and it was imputed by averaging the sds from trials in which it was reported ( 9 ) . trials in which data were estimated or imputed were excluded from the meta - analysis in a sensitivity analysis . when a study had two metformin arms of different doses , we included both in the analysis and present results ordered by dose , splitting the comparator group into two to avoid covariance problems ( 9 ) . when a study had more than two metformin arms , we selected the lowest and highest dose arms for inclusion in the analysis . sensitivity analyses of trials of 24 weeks or longer were conducted to verify that the treatment effect observed was sustained in the longer trials . a secondthe same inclusion criteria were applied with the exception that the comparator arm included a different dose of metformin to the intervention arm . in each multiarm trial , we pooled arms with metformin doses of 1,000 and 1,500 mg into a single low - dose arm and arms with metformin dose 1,500 mg into a single high - doseall of the trials covered in this review reported hba1c units as a percentage of total hemoglobin standardized to the methods of the diabetes control and complications trial ( dcct ) . results are therefore reported in dcct units as a percentage and have been converted into the new standard international units using international federation of clinical chemistry and laboratory medicine units of millimoles per mole of hemoglobin . data analysis was performed in stata 11.1 ( stata corporation , college station , tx ) using a random - effects model based on the dersimonian and laird method to pool the data , reporting the mean difference in change in hba1c levels between the metformin and comparator arms or high - dose versus low - dose metformin . adverse - events data were analyzed using the mantel - haenszel method , with a random - effects model reporting risk ratio under the approximating assumption that adverse events occur independently . heterogeneity was explored using subgroup analyses and metaregression to look at the effect of type of diabetes , trial size , bmi , age , metformin dose , baseline hba1c levels , length of follow - up , year of publication , country of trial , and change in hba1c in the comparator group . these were screened on title and abstract to give 293 articles requiring examination of the full text . a total of 35 trials , representing 7,960 participants , met inclusion criteria ( a full list of references of included trials is given in the supplementary data online ) . of these , 15 were receiving metformin monotherapy compared with placebo , no treatment , or diet ( 2,424 participants ) ; 12 were receiving metformin treatment in combination with another oral antihyperglycemic medication compared with the other medication ( 4,511 participants ) ; and 13 were receiving metformin in combination with insulin treatment compared with patients on insulin treatment only ( 1,025 participants ) . five trials with multiple arms ( 1014 ) were included in the meta - analysis of both monotherapy and metformin combination . all of the included trials were double blinded , with the exception of one trial from the insulin subgroup ( 15 ) in which the comparator group received an extra insulin injection and , thus , was only partially blinded . all monotherapy and combination oral therapy trials were conducted on patients with type 2 diabetes . in the metformin monotherapy trials , hba1c was reduced by 1.12 % ( 95 % ci 0.921.32 ; p 0.00001 , i = 80.2 % ) , corresponding to a reduction of 12 mmol / mol more with metformin than placebo ( fig . when we restricted the analysis to trials of 24 weeks , the hba1c in 10 trials was 1.19 % lower ( 0.981.41 ; i = 71.2 % ) in the metformin groups versus placebo . in the trials of metformin as add - on to oral therapy , hba1c was reduced by 0.95 % ( 0.771.13 ; p 0.00001 , i = 77.1 % ) , corresponding to a reduction of 11 mmol / mol more with metformin than in the comparator group . when we restricted the analysis to trials of 24 weeks , the hba1c in 11 trials was 0.94 % lower ( 0.761.13 ; i = 78.6 % ) in the metformin groups versus comparator groups . mean difference in change in hba1c of metformin treatment versus comparator ( boxes ) and pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method , stratified by metformin monotherapy and metformin added to an oral antidiabetes medication . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) in trials of metformin as add - on to insulin therapy , hba1c was reduced by 0.60 % ( 95 % ci 0.300.91 ; p = 0.0001 , i = 79.8 % ) , corresponding to a reduction of 6 mmol / mol more in the metformin groups than in the comparator group . a subgroup analysis of these trials performed on type of diabetes ( fig .2 ) found that patients with type 2 diabetes taking metformin with their insulin treatment had hba1c levels 0.83 % lower ( 0.481.18 ; p = 0.000 , i = 74.2 % ) in nine trials , corresponding to hba1c of 9 mmol / mol lower than patients on insulin alone . patients with type 1 diabetes , however , showed no change in their hba1c levels when metformin was added to their insulin treatment ( change in hba1c 0.02 % [ 95 % ci 0.25 to 0.21 ] ; p = 0.43 , i = 0 % ) in four trials . restricting the analysis to trials of 24 weeks included three trials of type 1 diabetes that gave no change in hba1c ( 0.01 % [ 0.22 to 0.25 ] ; i = 0 % ) and five trials of type 2 diabetes in which hba1c was 0.79 % lower ( 95 % ci 0.151.42 ; i = 83.4 % ) in metformin versus comparator groups . mean difference in change in hba1c of metformin added on to insulin versus placebo and insulin comparator ( boxes ) and pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method , stratified by type of diabetes . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) metaregression , carried out to investigate the effect of other variables and to explore sources of heterogeneity , found that no single factor could explain the heterogeneity . year of publication reduced the i by 11.8 % for metformin combination trials and 18.5 % for insulin trials . no other factor reduced heterogeneity by 10.4 % in any of the analyses , even though year of publication , metformin dose , mean bmi , mean patient age , and mean duration of diabetes were significantly associated with the mean outcome in some of the analyses . the dose - comparison review identified seven trials with head - to - head comparisons of two different metformin doses for inclusion , two of which could be used for more than one comparison , giving nine comparisons .3 ) found significantly greater change in hba1c in the higher - dose arms with a reduction in hba1c of 0.26 % ( 95 % ci 0.140.38 ; p 0.0001 , i = 55.5 % ) more in these arms . mean difference ( boxes ) in change in hba1c of high dose metformin , combining trial arms allocated to at least 2,000 mg metformin , versus low dose metformin , combining trial arms allocated to 1,0001,500 mg metformin , showing pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) the most commonly reported adverse events were gastrointestinal events , such as diarrhea , nausea , vomiting , flatulence , and abdominal pain , but also included were hypoglycemia , dizziness , headache , urinary tract infection , hypertension , coughing , and palpitations . a2 ) found an increase in the number of adverse events in metformin - treated groups in comparison with comparator groups in the monotherapy trials ( with an approximate risk ratio of 1.13 [ 95 % ci 1.061.21 ] ; i = 3 % , p = 0.0003 ) , and in oral combination trials ( 1.03 [ 0.951.12 ] ; i = 82 % , p = 0.45 ) . the number of adverse events in insulin trials was not significantly different between the metformin group and the comparator group ( 2.37 [ 0.658.67 ] ; i = 73 % , p = 0.19 ) . there was no significant difference in adverse events between higher and lower dose in the dose - comparison trials ( approximate risk ratio = 1.23 , p = 0.13 ) . an analysis of gastric adverse events ( diarrhea and abdominal cramps ) showed significantly more adverse events in the metformin arms of the monotherapy trials ( approximate risk ratio 2.26 [ 95 % ci 1.603.20 ] ; i = 0 % ) and combination trials ( 1.55 [ 1.291.87 ] ; i = 0 % ) and nonsignificantly more adverse events in the metformin arms of insulin trials ( 2.18 [ 0.687.01 ] ; i = 78 % ) . there were also more gastric adverse events in the higher - dose trials compared with the lower - dose trials , although this was not significant ( 1.18 [ 0.981.42 ] ; i = 7 % , p = 0.08 ) . these were screened on title and abstract to give 293 articles requiring examination of the full text . a total of 35 trials , representing 7,960 participants , met inclusion criteria ( a full list of references of included trials is given in the supplementary data online ) . of these , 15 were receiving metformin monotherapy compared with placebo , no treatment , or diet ( 2,424 participants ) ; 12 were receiving metformin treatment in combination with another oral antihyperglycemic medication compared with the other medication ( 4,511 participants ) ; and 13 were receiving metformin in combination with insulin treatment compared with patients on insulin treatment only ( 1,025 participants ) . five trials with multiple arms ( 1014 ) were included in the meta - analysis of both monotherapy and metformin combination . all of the included trials were double blinded , with the exception of one trial from the insulin subgroup ( 15 ) in which the comparator group received an extra insulin injection and , thus , was only partially blinded . all monotherapy and combination oral therapy trials were conducted on patients with type 2 diabetes . in the metformin monotherapy trials , hba1c was reduced by 1.12 % ( 95 % ci 0.921.32 ; p 0.00001 , i = 80.2 % ) , corresponding to a reduction of 12 mmol / mol more with metformin than placebo ( fig . when we restricted the analysis to trials of 24 weeks , the hba1c in 10 trials was 1.19 % lower ( 0.981.41 ; i = 71.2 % ) in the metformin groups versus placebo . in the trials of metformin as add - on to oral therapy , hba1c was reduced by 0.95 % ( 0.771.13 ; p 0.00001 , i = 77.1 % ) , corresponding to a reduction of 11 mmol / mol more with metformin than in the comparator group . when we restricted the analysis to trials of 24 weeks , the hba1c in 11 trials was 0.94 % lower ( 0.761.13 ; i = 78.6 % ) in the metformin groups versus comparator groups . mean difference in change in hba1c of metformin treatment versus comparator ( boxes ) and pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method , stratified by metformin monotherapy and metformin added to an oral antidiabetes medication . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) in trials of metformin as add - on to insulin therapy , hba1c was reduced by 0.60 % ( 95 % ci 0.300.91 ; p = 0.0001 , i = 79.8 % ) , corresponding to a reduction of 6 mmol / mol more in the metformin groups than in the comparator group . a subgroup analysis of these trials performed on type of diabetes ( fig .2 ) found that patients with type 2 diabetes taking metformin with their insulin treatment had hba1c levels 0.83 % lower ( 0.481.18 ; p = 0.000 , i = 74.2 % ) in nine trials , corresponding to hba1c of 9 mmol / mol lower than patients on insulin alone . patients with type 1 diabetes , however , showed no change in their hba1c levels when metformin was added to their insulin treatment ( change in hba1c 0.02 % [ 95 % ci 0.25 to 0.21 ] ; p = 0.43 , i = 0 % ) in four trials . restrictingthe analysis to trials of 24 weeks included three trials of type 1 diabetes that gave no change in hba1c ( 0.01 % [ 0.22 to 0.25 ] ; i = 0 % ) and five trials of type 2 diabetes in which hba1c was 0.79 % lower ( 95 % ci 0.151.42 ; i = 83.4 % ) in metformin versus comparator groups . mean difference in change in hba1c of metformin added on to insulin versus placebo and insulin comparator ( boxes ) and pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method , stratified by type of diabetes . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) metaregression , carried out to investigate the effect of other variables and to explore sources of heterogeneity , found that no single factor could explain the heterogeneity . year of publication reduced the i by 11.8 % for metformin combination trials and 18.5 % for insulin trials . no other factor reduced heterogeneity by 10.4 % in any of the analyses , even though year of publication , metformin dose , mean bmi , mean patient age , and mean duration of diabetes were significantly associated with the mean outcome in some of the analyses . the dose - comparison review identified seven trials with head - to - head comparisons of two different metformin doses for inclusion , two of which could be used for more than one comparison , giving nine comparisons .3 ) found significantly greater change in hba1c in the higher - dose arms with a reduction in hba1c of 0.26 % ( 95 % ci 0.140.38 ; p 0.0001 , i = 55.5 % ) more in these arms . mean difference ( boxes ) in change in hba1c of high dose metformin , combining trial arms allocated to at least 2,000 mg metformin , versus low dose metformin , combining trial arms allocated to 1,0001,500 mg metformin , showing pooled estimates ( diamonds ) calculated by the random - effects dersimonian and laird method . horizontal bars and diamond widths denote 95 % cis , and box sizes indicate relative weight in the analysis . ( a high - quality color representation of this figure is available in the online issue . ) the most commonly reported adverse events were gastrointestinal events , such as diarrhea , nausea , vomiting , flatulence , and abdominal pain , but also included were hypoglycemia , dizziness , headache , urinary tract infection , hypertension , coughing , and palpitations . a2 ) found an increase in the number of adverse events in metformin - treated groups in comparison with comparator groups in the monotherapy trials ( with an approximate risk ratio of 1.13 [ 95 % ci 1.061.21 ] ; i = 3 % , p = 0.0003 ) , and in oral combination trials ( 1.03 [ 0.951.12 ] ; i = 82 % , p = 0.45 ) . the number of adverse events in insulin trials was not significantly different between the metformin group and the comparator group ( 2.37 [ 0.658.67 ] ; i = 73 % , p = 0.19 ) . there was no significant difference in adverse events between higher and lower dose in the dose - comparison trials ( approximate risk ratio = 1.23 , p = 0.13 ) . however , the assumption of independence was clearly an approximation ( supplementary fig . an analysis of gastric adverse events ( diarrhea and abdominal cramps ) showed significantly more adverse events in the metformin arms of the monotherapy trials ( approximate risk ratio 2.26 [ 95 % ci 1.603.20 ] ; i = 0 % ) and combination trials ( 1.55 [ 1.291.87 ] ; i = 0 % ) and nonsignificantly more adverse events in the metformin arms of insulin trials ( 2.18 [ 0.687.01 ] ; i = 78 % ) . there were also more gastric adverse events in the higher - dose trials compared with the lower - dose trials , although this was not significant ( 1.18 [ 0.981.42 ] ; i = 7 % , p = 0.08 ) . this systematic review of double - blinded , randomized , controlled trials has separately examined metformin treatment as a stand - alone therapy and as an add - on therapy both to other oral medications and to insulin to quantify its effect on glycemic control . metformin monotherapy reduced hba1c by 1.12 % , and metformin in combination with other oral antihyperglycemic treatments or insulin reduced hba1c by 0.95 and 0.83 % , respectively , for type 2 diabetes , and these effects were sustained at 24 weeks . of particular interest is that the addition of metformin treatment to insulin treatment improves glycemic control in type 2 diabetes by a clinically significant level despite protocol - permitted insulin dose adjustments in both arms of these trials . treatment of type 1 diabetic patients with metformin did not reduce hba1c . we have also clearly demonstrated that an increase in metformin dose results in a further modest reduction in hba1c of 0.26 % in trials comparing lower doses to higher doses up to a metformin dose of 2,000 mg . it was not possible to establish whether there is further benefit when metformin dose is increased beyond this level because there were too few trials with higher doses , although the trial on which much of the evidence for cardiovascular benefit is based , the uk prospective diabetes study ( ukpds ) ( 16 ) , used a median dose of 2,550 mg metformin . establishing how the dose - effect relationship may vary at different doses and what the maximum effective dose may be is an area for future work . a previous systematic review found lower rates of cardiovascular mortality in people randomized to metformin in six trials of 11,000 patients ( 6 ) . compared with that review , our analysis has the disadvantage of using the surrogate outcome of glucose lowering , albeit a well - established surrogate on which treatment guidelines are based ( 4,17,18 ) , but it has the advantage of an estimate based on more trials . this has allowed us to examine subgroups , such as monotherapy , combination oral therapy , and insulin therapy , and to establish a dose - response relationship . this is the most comprehensive systematic review to date on the effect of metformin treatment on hba1c levels . in addition , to our knowledge , this is the first meta - analysis of metformin dose - comparison studies . significant unexplained heterogeneity observed between the trials , however , is a limitation of this review and , consequently , results need to be treated with caution . our searches identified 5 times more trials than a previous review , which examined the effect of metformin on glycemic control in seven trials ( 8 ) . this is partly explained by the other reviewer s more stringent inclusion criteria , which included a minimum of 50 subjects in each arm of the trial and an explicit statement that informed consent was obtained . inclusion of a larger number of trials has made it possible to separately analyze data from metformin monotherapy , oral combination therapy , and insulin trials . the greatest reduction in hba1c in our analysis was 1.1 % , which is at the low end of the 12 % estimated by nathan et al . the results of our review suggest that these estimated reductions are most likely to be achieved with the highest metformin doses . previous trials that compared different metformin doses from various trials could not establish a dose - effect relationship of metformin ( 8 ) . by including head - to - head trials of metformin in our systematic review , we clearly demonstrate the benefit of using a higher metformin dose to maximize hba1c reduction , although there may be an associated increase in gastric side effects . we have not been able to demonstrate a relationship between baseline hba1c and change in hba1c with treatment observed in other systematic reviews ( 8,19 ) . a previous systematic review of 61 trials of oral glucose - lowering therapy found an association between baseline hba1c and the change in hba1c on treatment , but metformin was a randomized therapy in only seven of these trials ( 8 ) . we were not able to find such a relationship in 15 trials of metformin monotherapy , 12 trials of metformin in combination with oral therapy , and 13 trials of metformin in combination with insulin . . the best data to address this question would make comparisons between individuals ( 20 ) . metformin s known benefit in reducing cardiovascular mortality ( 6 ) , as well as its neutral effects on body weight and low risk of hypoglycemia ( 16 ) , has led to wide recommendations for routine prescribing . however , until now , it has not been clear how different patients may respond to treatment . by separately examining the effect of metformin treatment in various groups of patients , depending on their previous antidiabetes medication , we are providing a tool to assist decisions on treatment combinations and optimal doses . this review demonstrates that metformin treatment can be used to reduce hba1c in all patients with type 2 diabetes regardless of prior antihyperglycemic medication or insulin treatment . use of higher doses of metformin resulted in modestly higher decreases in hba1c compared with lower doses . metformin use in type 1 diabetes may not , however , reduce hba1c . despite this , there may be other indications for treating type 1 diabetic patients with metformin because a reduction in insulin dose required in the metformin arm of these trials was observed consistent with metformin s role as an insulin sensitizer ( 21 ) .\noutput:\n" }, { "from": "agent", "value": "objectivemetformin is the first - line oral medication recommended for glycemic control in patients with type 2 diabetes . we reviewed the literature to quantify the effect of metformin treatment on glycated hemoglobin ( hba1c ) levels in all types of diabetes and examine the impact of differing doses on glycemic control.research design and methodsmedline , embase , and the cochrane library were searched from 1950 to june 2010 for trials of at least 12 weeks duration in which diabetic patients were treated with either metformin monotherapy or as an add - on therapy . data on change in hba1c were pooled in a meta - analysis . data from dose - comparison trials were separately pooled.resultsa total of 35 trials were identified for the main analysis and 7 for the dose - comparison analysis . metformin monotherapy lowered hba1c by 1.12 % ( 95 % ci 0.921.32 ; i2 = 80 % ) versus placebo , metformin added to oral therapy lowered hba1c by 0.95 % ( 0.771.13 ; i2 = 77 % ) versus placebo added to oral therapy , and metformin added to insulin therapy lowered hba1c by 0.60 % ( 0.300.91 ; i2 = 79.8 % ) versus insulin only . there was a significantly greater reduction in hba1c using higher doses of metformin compared with lower doses of metformin with no significant increase in side effects.conclusionsevidence supports the effectiveness of metformin therapy in a clinically important lowering of hba1c used as monotherapy and in combination with other therapeutic agents . there is potential for using higher doses of metformin to maximize glycemic control in diabetic patients without increasing gastrointestinal effects ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the increasing global use of pesticides has led to organophosphate ( op ) poisoning becoming a leading cause of mortality and morbidity in developing countries . cholinergic crisis , intermediate syndrome ( ims ) , and op - induced delayed neurotoxicity ( opidn ) are the three stages observed following op intoxication . opidn results in sensory - motor distal axonopathy characterized by distal degeneration of some axons of both the peripheral and central nervous systems ; even resulting in pyramidal tract and posterior column involvement . we document the case of a patient who showed all three stages of op poisoning along with corticospinal tract signs , recurrent laryngeal nerve palsy , aphonia , and tracheal stenosis and the role of physiotherapy in her rehabilitation . a 20 - year - old female patient attempted suicide by ingesting a large amount of op insecticide . she was admitted in a private hospital in an unconscious , gasping state with frothing from the mouth , smelling of insecticide . she was immediately intubated and was kept on synchronized intermittent mandatory ventilation ( mv ) . seven days later she was brought to medical and neurological intensive care unit of our hospital on mv . on admission , she had poor respiratory effort . she was conscious , oriented , had grade four muscle power in upper and lower limbs , without sensory symptoms . on day 12 , lobar pneumonia was diagnosed . chest physiotherapy along with respiratory muscle training by inspiratory muscle trainer with threshold resistance for strengthening of weak respiratory muscles proved an adjunct for the weaning off of the patient from mechanical ventilation . in stepdown care , her muscle power slowly reduced to grade two in upper limb and grade three in lower limb . three days post - extubation , she developed rapid onset deterioration in muscle power to grade zero and absent deep tendon reflexes , but without respiratory deterioration . nerve conduction studies indicated pure motor axonal neuropathy . patient developed stridor when an attempt to close the tracheotomy was carried out . bronchoscopy revealed tracheal stenosis 2.3 cm distal to the vocal chords along with bilateral adductor vocal cord paralysis indicating involvement of recurrent laryngeal nerve , which explains aphonia evident during partial closure trial of tracheostomy . forty five days from the ingestion of op insecticide , she developed grade ii spasticity according to modified ashwarth scale in bilateral upper and lower limbs with flexor spasms in lower limbs and exaggerated deep tendon reflexes , which indicate pyramidal tract involvement . sensitive symptoms of muscle pain , tenderness and cramps developed in bilateral quadriceps and calf muscles . electrical stimulation with intermittent galvanic current was given to paralyzed distal muscles of upper and lower extremities to restore their properties and hence prevent further muscle wasting . strengthening and proprioceptive neuromuscular facilitation for weak muscles , stretching of hand flexors and gastrosoleus and orthotic devices prevented further deformities . tilt table supported standing helped to overcome the effects of prolonged bed rest and postural hypotension . after discharge the patient was referred to a community rehabilitation center for further management . marital discord withthe liposolubility of op esters in insecticides permits penetration in central and peripheral nervous system . the clinical phases included an acute cholinergic crisis characterized by tachycardia or bradycardia , diarrhea , vomiting , fasciculation , sweating , salivation and micturition , convulsion and coma . inhibition of acetyl - choline esterase leads to accumulation of acetylcholine at nerve synapses and neuromuscular junctions resulting in overstimulation of acetylcholine receptors . the initial over - stimulation followed by paralysis of cholinergic synaptic transmission in the cenral nervous system , autonomic ganglia , and parasympathetic and sympathetic nerve endings is the known mechanism for cholinergic crisis phase . this was characterized in this patient by limb , neck muscle weakness , respiratory fatigue or failure and cranial nerve palsy . she later developed opidn characterized by cramping muscle pain , paresthesia and motor weakness and absent deep tendon reflexes with normal joint position and vibration sense . six weeks after poisoning , corticospinal tract signs evolved slowly and our patient showed spasticity , abnormal posturing and exaggerated deep tendon reflexes . the depression of neurotoxic esterase by some op insecticides in addition to choline esterase can contribute to delayed neurotoxicity . our case showed all three stages along with the recurrent laryngeal nerve palsy , which is rare . this delayed effect could be the result of phosphorylation of nervous tissue protein with resulting wallerian axonal degeneration . the recurrent laryngeal nerve palsy could also be the effect of mechanical factors due to prolonged intubation and effect of tracheostomy and ventilation . the treatment of opidn is long - term and physiotherapy plays a substantial role in making patient functionally independent and enabling integration into the community . this suggests that ongoing evaluation of changes in signs is essential for appropriate selection of physiotherapy modality in various phases . rehabilitation strategies need to be planned before discharge and communication with the patient and community rehabilitation physiotherapist is essential during further follow - up to achieve functional integrity of the patient . at present that is 18 months from onset ,\noutput:\n" }, { "from": "agent", "value": "organophosphorus poisoning is a major global cause of health problems and the leading cause of mortality and morbidity in the developing countries . in this , the inhibition of acetyl - choline esterase and neurotoxic esterase along with nicotinic receptor involvement produces three well - identified and documented clinical phases : the initial cholinergic phase , which is a medical emergency often requiring management in an intensive care unit ; the intermediate syndrome , during which prolonged ventilator care is necessary ; and finally delayed neurotoxicity . vocal cord paralysis is rare and leads to aphonia . role of physiotherapy rehabilitation is substantial in all three stages and aims at early weaning off from mechanical ventilator until the functional independence and community integration of the patient ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: epidemiologic studies have shown that patients with type 1 and type 2 diabetes mellitus ( dm ) are at higher risk than the general population for developing certain malignancies including kidney , liver , biliary tract , pancreas and colon 1 - 6 . in diabetics , cancer contributes 13 % to mortality and these patients suffer from a high rate of cancer recurrence 7 kidney cancer is the most common renal malignancy in adults and responsible for approximately 51,190 new cancer cases and accounting for 2.3 % of all cancer deaths in the united states 8 . rcc is more prevalent in men than in women and occurs most often 50 - 70 years of age . cancer involving the renal parenchyma ( renal cell cancer , rcc ) accounts for the majority of cases , while the minority of cases are usually due to cancer of the renal pelvis 9 . the predominant subtype of rcc is clear cell type that represents 80 % of rcc and is derived from the tubular epithelium 10 . other types of rcc are papillary ( 15 % ) , chromophobe ( 5 % ) , and collecting duct ( 1 % ) . the risk factors for kidney cancer are smoking , obesity , hypertension , kidney transplantation , family history of the disease and exposure to certain toxins 12 - 16 . the importance of diabetes as a potential risk factor for cancer has been shown in clinical and autopsy studies 5 . a prior history of diabetes was associated with a three - fold increased risk for cancer in women 14 . in the retrospective international cancer study , a 5 - to 10 - year history of diabetes increased the relative risk of cancer by 40 % in both men and women 15 . several mechanisms implicated in the development of renal cancer in diabetes have included increased growth factors and / or their receptors , hyperinsulinemia and glucose availability 16 - 20 . as in other states in the u.s . dm is a serious public health problem in texas . of the 19.3 million individuals in the u.s . with diabetes , more than 1.8 million reside in texas , with a high prevalence of hispanic ethnicity 21 . kidney cancer is one of the ten leading sites of cancer incidence in texas ; however , the association of dm and rcc histology has not been explored . to better understand this relationship between diabetes and renal cancer , all rcc cases at our center from 1994 to 2009were analyzed with relation to history of diabetes , diabetic laboratory parameters gender , ethnicity , age and tumor morphology . all rcc cases in patients who underwent nephrectomy at the university of texas health science center at san antonio ( uthsc ) from 1994 to 2009 were analyzed for gender , ethnicity and age at presentation . results from laboratory tests including hga1c ( normal , 5.0 - 5.5 % ) , glucose ( normal , 80 - 100 mg / dl ) and serum creatinine ( normal , 0.6 - 1.2 mg / dl ) were collected . tumors were staged according to the american joint commission on cancer ( ajcc ) tumor , nodes , and metastasis ( tnm ) system . we classified localized disease as tnm stage i : tumors 7 cm , limited to the kidney or stage ii : tumors 7 cm , limited to the kidney . regional disease included tnm stage iii : tumor invasion of perinephric fat or adrenal gland but not beyond gerota 's facia , with or without extension into the renal vein or vena cava . the clinical database did not contain complete information regarding clinical presentation , type of dm , and length of diabetes , treatment modality or comorbid conditions ; thus , these were not included in our study . data are presented as mean standard error and frequency counts with percentages where means were not appropriate . where expected cell counts were below 5 , the exact likelihood ratio chi - square test was used for a more appropriate statistical test of association . statistical differences were determined using contingency table chi - square analysis and analysis of variance ( anova ) followed by multiple comparisons of subgroup means . data are presented as mean standard error and frequency counts with percentages where means were not appropriate . where expected cell counts were below 5 , the exact likelihood ratio chi - square test was used for a more appropriate statistical test of association . statistical differences were determined using contingency table chi - square analysis and analysis of variance ( anova ) followed by multiple comparisons of subgroup means . a total of 473 cases of rcc were identified at our institution from 1994 to 2009 . table 1 shows that males comprised 56.9 % of the cohort and were more prevalent than females ( 43.1 % ) ( p = 0.003 ) . of the rcc cases , 120 ( 25.4 % ) had a history of diabetes and , within this group , a greater proportion ( p = 0.01 ) of females ( 31.4 % ) had diabetes compared to males ( 20.8 % ) ( table 1 ) . analysis of rcc cases for ethnic background and gender together is shown in table 2 . in both rcc and diabetes mellitus ( dm ) cases with rcc , there was a predominance of hispanics ( 63.9 and 75 % , respectively ) with fewer whites ( 28.7 and 19.2 % , respectively ) and other ethnic groups ( 7.4 and 5.8 % , respectively ) . in addition , this difference may have occurred since whites were less likely to have diabetes compared to hispanics and other ethnicities ( refer to table 2 , p = 0.01 ) . when these data were analyzed for an association of gender and ethnicity , we found that in rcc cases , female and male genders were not differently distributed ( p = 0.76 ) among the hispanic ( female 131/302 , 43.4 % ) , white ( female 60/136 , 44.1 % ) and other ( female 13/35 , 37.4 % ) ethnic groups ( table 2 ) . in addition , males were more predominant than females among all ethnic groups of rcc cases ( table 1 , p = 0.003 ; table 2 ) . in contrast , in rcc cases with dm , females predominated table 2 and the predominance was similar ( p = 0.76 ) across all ethnic groups [ table 2 , hispanic ( 51.1 % ) , white ( 60.9 % ) and other ( 57.1 % ) ] . however , the percentage of rcc cases with dm significantly differed ( p = 0.01 ) among ethnic groups : hispanics ( 90/302 , 29.8 % ) , whites ( 23/136 , 16.9 % ) and others ( 7/35 , 20 % ) . subsequently , the rcc and rcc cases with a history of dm were further examined for an association with age and gender . table 3 shows that the dominant age groups of patients with rcc were 50 to 59 years of age ( 36.4 % ) and , to a lesser extent of 60 to 69 ( 23.1 % ) , and 40 - 49 ( 22.3 % ) years of age . within each age group , males consistently predominated ( p = 0.45 ) compared to females for rcc cases ( table 3 ) . in contrast , females predominated ( 64/120 , 53.3 % ) compared to males ( 56/120 , 46.7 % ) and were similarly distributed within age groups ( p = 0.57 ) in cases of rcc with dm ( table 3 ) . there were no significant differences of male and female mean hga1c ( p = 0.73 ) , serum creatinine ( p = 0.14 ) or blood glucose levels ( p = 0.74 ) ( table 3 ) . next the rcc with dm cases ( n = 113 ) were analyzed for tumor morphology and size ( table 4 ) . in this cohort , clear cell type ( 104/113 , 92.0 % ) , nuclear grade 2 ( 60/107 , 56.1 % ) and 1 - 5 cm tumor size ( 65/99 , 65.7 % ) were more predominant among all tumors . analysis of the distribution of histological cell types among ethnic groups found significant differences ( p = 0.01 ) existed ( table 4 ) primarily in papillary cell type . cell chi - square statistical results showed decreased papillary cell type in hispanics whereas it increased in whites ( 4/7 ) . on the other hand , no difference in the distribution of nuclear grades ( p = 0.55 ) was observed across ethnic groups . the distribution of tumor size was significantly different ( p = 0.03 ) among ethnic groups due to decreased frequency of small ( 1 - 5 cm ) and increased frequency of medium ( 5 - 10 cm ) tumors in the other ethnic group ( table 4 ) . interestingly , average of hga1c was significantly higher ( p = 0.05 ) in hispanic patients compared to whites and other ethnicities ( table 4 ) by the least significant difference ( lsd ) pairwise comparison test following a one - way anova . blood glucose and creatinine mean values were not significantly different for the ethnic groups ( p = 0.84 and p = 0.88 , respectively ) . to identify the association between tumor sizes within the rcc diabetic cohort , we analyzed all rcc diabetic subjects for tumor size and diabetic parameters . data in table 5 show that total of 65 cases have tumor size 1 - 5 cm , 31 cases with 5 - 10 cm and 3 cases with 10 cm . interestingly , the average of hga1c was significantly higher ( 8.1 , p = 0.05 ) in patients with tumor size 1 - 5 cm compared to tumor size 5 - 10 cm ( table 5 ) . in addition , the average of glucose level was slightly higher in patients with tumor size of 1 - 5 cm ; however , significant differences among the tumor size groups for serum glucose and creatinine were not detected ( table 5 ) . the association between tumor stage , hga1c , creatinine and glucose levels among all ethnic groups is shown in table 6 . among all ethnic groups , tumor stage i was the predominant stage ( 79/109 , 72.5 % ) compared to advanced stage iii ( 22/109 , 20.2 % ) and iv ( 5/109 , 4.6 % ) ( table 6 ) . interestingly , the hga1c average ( 8.2 ) was higher in patients with tumor stage iv compared to patients with other tumor stages , although this was not statistically significant . in addition , tumor stage was significantly associated with the ethnicity ( p = 0.03 ) due to small frequency differences ( whites had decreased stage iii and others had increased stage ii ) , whereas no significant association was identified between creatinine and glucose levels and tumor stages ( table 6 ) . this is the first report to characterize rcc cases in a south texas population with respect to ethnicity , age , gender , laboratory parameters and tumor morphology . our data indicate that a high proportion of rcc cases are associated with diabetes ( 25.4 % ) , suggesting that diabetes one of the factors for the development of rcc . at our institution , when rcc subjects were screened for a history of diabetes , we observed a higher incidence of diabetes in female rcc subjects compared to male subjects . rcc cases with diabetes were also more prevalent in hispanics compared to white and other subjects and the majority of diabetic patients were diagnosed with rcc at 50 - 59 years of age . in addition , diabetic rcc patients had a predominance of the clear cell type rcc , nuclear grade ii , tumor size 1 - 5 cm and tumor stage i. the average hga1c level was significantly higher in hispanic patients compared to whites and other ethnicities . moreover , the average hga1c level was higher in patients with tumors size 1 - 5 compared to those 5 - 10 cm . the high incidence of localized cancer may be largely due to the increased incidental detection of rcc through the ultrasound and ct for nonrenal cancer - related problems 22 - 24 . rcc is the most common renal malignancy in adults , with a greater incidence in males than females and average age at diagnosis in the early 60s 25 . similarly , the incidence of rcc was predominated in males dominant age range at presentation being 50 - 59 years . this is slightly younger than the mean age of presentation reported by most case series and may be due to early detection within our population . a similar age range was observed in our rcc cases with diabetes ; however , females were more prevalent , consistent with other series . in a previous study , a prior history of diabetes was associated with a three - fold increase in the relative risk for renal cancer in women 21 . these findings indicate that the gender distribution of diabetic rcc is different from its nondiabetic counterpart , suggesting that there may also be differences in the biology of rcc in these patients . adult rcc has been demonstrated to have a slightly greater incidence in african americans than in whites 26 . our data shows that the majority of rcc patients with or without a history of diabetes have hispanic backgrounds . hispanics , and results showed that the incidence of kidney cancer varies depending on the geographic location of the hispanic population analyzed 27,28 . in south texas , hispanics comprise a large portion of the population and the prevalence rate of diabetes in mexican americans is 1.9 fold higher than that in non - hispanic whites . moreover , our study supports the observation that hispanics have higher hga1c levels than non - hispanic whites 29 . in epidemiological and autopsy studies , elevated fasting serum glucose and diabetes were risk factors for the development of cancer in several organs including kidney 18 and the risk of cancer has been reported to increase in proportion to hga1c levels in diabetes 13,14 . several studies showed that hispanics population have higher prevalence of obesity , type 2 diabetes , and high fat diet than non - hispanic whites 27,29,30 . these factors may play a major role in increase the incidence rcc there is evidence of a positive association between obesity and risk of rcc 31,32 . we could not differentiate the type of dm , although most cases among adults would be expected to be type 2 . laboratory values were obtained near the time of nephrectomy and represented the fasting glucose levels of all patients but lacked information regarding the body mass index , duration of diabetes , follow up the laboratory values and treatment . such information is important for determining whether the severity and duration of diabetes is correlated with risk of developing rcc . nevertheless , our findings showed that hga1c values were significantly higher in patients with tumors 1 - 5 cm compared to 5 - 10 cm , suggesting that hga1c may provide a useful marker for early detection of silent or small rcc before they manifest clinically . serum glucose or creatinine levels were not associated with tumor size or stage . in previous studies , the incidence of end - stage renal disease due to dm was higher in minorities including hispanics 30 ; however , in our cohort , little or no increase in serum creatinine was observed at the time of nephrectomy . the predominant subtype of rcc is clear cell type that represents 80 % of rcc and is derived from the tubular epithelium 10 . our data show that majority of tumors ( 92 % , p = 0.01 ) was clear cell type among all ethnic groups in rcc diabetic patients suggesting that diabetes may involve an increased risk of development of clear cell type tumor . recent work in the molecular pathogenesis of clear cell rcc has facilitated the development of therapeutic strategies to target this tumor type . however , few studies have examined who is at increased risk for this histologic variant . obesity is associated with a higher risk of clear cell rcc than with other histologies 6,12,32 . our results provide the first evidence that diabetic rcc patients have a predominance of clear cell subtype with nuclear grade 2 . in 98 % of these tumors , whether familial , sporadic or associated with von hippel - lindau ( vhl ) syndrome , they typically result from a somatic mutation within the vhl tumor - suppressor gene found on the short arm of chromosome 33p2518 , 19 , 32 . mutation of vhl activates hypoxia - inducible factor - 1 ( hif - 1 ) , leading to increased transcription of pro - angiogenic factors including pdgf and vegf that play a key role in renal cell tumorigenesis . in diabetic patients , other pathogenetic mechanisms previously describedmay also contribute to clear cell rcc including : prolonged exposure to pro - insulin products with some homology to igf - 1 , raised growth factors and growth factor receptors , increased endogenous estrogen levels , end - stage renal disease due to diabetic nephropathy and hypertension 5 . interestingly , histologic type varied among ethnic groups , with papillary cell type increased in whites , but decreased in hispanics . , particularly t1 disease and primarily reflects small tumors discovered incidentally on abdominal imaging 33 . in agreement with this finding , our cohort of rcc cases with dm showed a predominance of tumor size 1 - 5 cm and , among all ethnic groups , stage i was more commonly observed than other stages . tumor size and stagewere associated with ethnicity as evidenced by a greater incidence of medium size ( 5 - 10 cm ) tumors and stage 2 in other ethnicities and a reduction in stage 3 tumors in whites . it is tempting to speculate that african americans within the other group , reported to have more aggressive disease than whites , may have contributed to this ethnic diversity 33,34 . tumor staging in adult rcc is a strong prognostic indicator and the presence of lower - stage tumors in dm patients suggests a favorable response to therapy and survival . although hga1c was slightly higher in patients with stage iv , we did not observe a statically significant association of hga1c , blood glucose or creatinine with tumor stage . further studies with larger cohorts of dm patients will be useful for increasing our understanding of the association of dm with clear cell rcc . in conclusion , our findings indicate that diabetic rcc patients have a predominance of localized , small clear cell rcc . prospective studies are needed to further evaluate the importance of glycemic control and effective reduction of glucose levels on the outcome of rcc . in addition , the results of our study may have implications in determining a patient 's risk of harboring a clear cell rcc and subsequent therapeutic recommendations .\noutput:\n" }, { "from": "agent", "value": "background and objectives : there is evidence that the incidence of solid tumors is markedly increased in patients with diabetes mellitus . in the current study , we investigate the association between diabetes and renal cancer.patients and methods : a single - center retrospective analysis of 473 patients who underwent nephrectomy for renal cell carcinoma ( rcc ) was performed . diabetic rcc patients were screened for age , gender , ethnicity , hga1c , glucose levels and renal function.results : of the 473 cases with rcc , we identified 120 patients ( 25.4 % ) with a history of diabetes . the incidence of diabetes in rcc patients was higher in female than male subjects and in hispanic compared to white and other ethnic backgrounds . at diagnosis , the majority of diabetic rcc patients were 50 - 59 years of age . in diabetic rcc cases , clear cell type histology ( 92.0 % ) , nuclear grade 2 ( 56.1 % ) and tumor size range from 1 - 5 cm ( 65.7 % ) were the most common in each category.conclusion : our findings indicate that diabetic rcc patients have a predominance of localized , small clear cell rcc . in addition , females with a history of rcc have a higher frequency of diabetes compared to males . this is the first report of clinical and histopathological features of rcc associated with diabetes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: peri - implant diseases are a prevalent reality : 19 to 65 % of implants present peri - implant mucositis ( weighted mean of 43 % [ ci = 32 to 54 % ] ) and 1 to 47 % develop peri - implantitis ( weighted mean of 22 % [ ci = 14 to 30 % ] ) alongside a positive relationship with function time . moreover , peri - implant diseases are challenging to treat , and , in some cases , with aggressive progression patterns . however , consensus has been reached so far only on few facts associated with increased risk of peri - implant disease development : 1 ) lack of regular supportive therapy ; 2 ) plaque accumulation ; 3 ) smoking ; 4 ) history of periodontal disease ; and 5 ) excess cement . fortunately , it has been established that patient - administered mechanical plaque control ( with manual or powered toothbrushes ) and professional intervention comprising oral hygiene instructions and mechanical debridement are adequate measures to reduce peri - implant mucositis and its progression to peri - implantitis . several strategies are being investigated to reduce plaque accumulation over implants : surface modifications [ 6 - 11 ] , lasers and other physical methods [ 12 - 16 ] , locally delivered antibiotics [ 17 - 19 ] , and even better seals of the connection implant - abutment to reduce this particular reservoir of microbiota [ 20 - 23 ] . however , these and other adjunctive measures to reduce plaque , including systemic antibiotics , have not been found to reduce clinical signs of inflammation . so far , the main diagnostic methods of peri - implant disease are based on clinical and radiographic data . these data are obviously insufficient and they only detect the disease when it has produced some level of destruction . thus , early diagnosis and identification of risk factors are of extreme importance to prevent the disease in the first place . probably the more studied risk factor for peri - implant disease is the microbiota associated with the peri - implant sulcus . in fact , the presence of periodontophatic bacteria in the peri - implant sulcus has been proposed as a risk indicator for both peri - implant mucositis and peri - implantitis . the characteristics of the sulcus environment favour its colonization by anaerobic gram - negative bacteria . the ecological succession of the microbes in the sulcus may lead to the development of the disease . the peri - implant disease has been described as poly - microbial anaerobic infection similar to that found in chronic periodontitis . however , new technologies are finding an increasing number of microorganisms in peri - implant sites not found around teeth . many studies have evaluated the microbiota around healthy and diseased teeth as well as around healthy and diseased implants by different techniques . thus , this systematic narrative review is aimed at identifying the microbiological factors that have been associated with the presence of peri - implant disease by describing the findings published and discussing the main detection techniques . protocol and registration the methods of the analysis and inclusion criteria were specified in advance and documented in a protocol . the review was registered in prospero , registration number : crd42016037647 . the reporting of this systematic analysis adhered to the preferred reporting items for systematic review and meta - analyses ( prisma ) statement . the following focus question was developed according to the population , intervention , comparison , and outcome ( pico ) study design : what are the microbial profiles of human patients suffering peri - implantitis in comparison to healthy implants ? additionally , the comparisons with implants suffering mucositis and with healthy or diseased teeth were also explored . a literature search was performed in medline via pubmed database of the us national library of medicine on april 25 , 2016 using medical subject heading search terms and free text terms in different combinations . a hand search was also performed in dental and implant - related journals from april 2011 to april 2016 , including , journal of clinical periodontology , clinical oral implants research , journal of periodontology , international journal of oral and maxillofacial implants , journal of oral implantology , implant dentistry , clinical implant dentistry and related research , european journal of oral implantology , international journal of oral and maxillofacial surgery , . a hand search of the reference lists in the articles retrieved was also carried out for additional relevant publications . the electronic search strategy and limits was : ( ( ( microbiology ) or ( microbiome ) or ( microbial ) ) and ( dental implants [ mesh ] ) ) and ( ( english and humans [ filter ] ) and ( published last 5 years [ filter ] ) ) not ( review [ filter ] ) . the articles , at any stage ( abstract or full - text assessment ) were independently reviewed by 2 of the authors . reviewers compared decisions and resolved differences through discussion and consulting the other authors when consensus could not be reached . letters , editorials , case reports , literature reviews , and phd theses were excluded . types of participants / population included studies describe findings from human participants with at least one osseointegrated titanium screw - shaped dental implant with signs of peri - implantitis or peri - implant mucositis , with or without healthy implants or teeth . peri - implant mucositis or peri - implantitis must have been defined in each article according to the current classification of peri - implant diseases . inclusion and exclusion criteria to be included in the study , studies had to have clear implant status definition for the conditions health , mucositis and / or peri - implantitis and analyse the microbiome of those situations , with or without comparisons among them or with or without before and after results . the applied exclusion criteria for studies were animal or in vitro studies , not enough information on the microbial analysis , analysis not performed on peri - implant sulcus of dental implants aimed at supporting restorations and no access to the abstract or full - text . sequential search strategy following the initial literature search , all article titles were screened to eliminate irrelevant publications , review articles , case reports , in vitro , and animal studies . next , studies were excluded based on data obtained from screening the abstracts . the final stage of screening involved reading the full texts to confirm each study s eligibility , based on the inclusion and exclusion criteria . data extracted was descriptive findings of microbial profiles around dental implants and additional information such as findings around teeth with or without disease . data collected from the included articles were : full reference - identification of study ; type of patients / sites - healthy implants , peri - implant mucositis or peri - implantitis , and healthy or diseased teeth ; number of patients included in the study for each condition ; number of implants / sites included in the study for each condition ; outcome - description of the main findings of the study ; detection method - how the microbial profile was evaluated ( culture , polymerase chain reaction ( pcr ) , checkerboard or metagenomics ) . risk of bias assessment risk of bias within articles was assessed independently , and in duplicate by the authors according to the rti item bank guide for bias and confounding assessment in observational studies of interventions or exposures . possible sources of bias include : inclusion / exclusion criteria , recruitment of participants , selection of the comparison group , variations in the execution of the study from the proposed protocol , blindness to the outcome , exposure , or intervention , valid and reliable measures , length of follow - up , impact of missing data , missing primary outcomes , harms or adverse events , balance between the groups or match groups , and confounding variables . no meta - analysis was intended as no common microbial detection methodology is used across studies . , 14 were excluded : no analysis of peri - implant sulcus = 4 [ 31 - 34 ] ; not performed in oral mucosa = 2 ; no full - text available = 1 ; not enough microbiological data = 3 [ 37 - 39 ] ; not in conventional dental implants = 4 [ 40 - 44 ] . finally , 46 studies were included in the qualitative synthesis and analysis , as described in tables 1 - 5 . studies using culture techniques studies using pcr techniques ns = not specified ; cist = cumulative interceptive supportive therapy ; pd = probing depth ; cal = clinical attachment level ; hcmv = human cytomegalovirus ; ebv = epstein - barr virus . studies using checkerboard dna - dna hybridization ns = not specified ; bop = bleeding on probing ; pi = peri - implantitis ; cp = chronic periodontitis ; hi = healthy implant ; hp = healthy periodontium . studies using other techniques or a variety of them ns = not specified . study characteristics studies on peri - implant microbiota using culture techniques are limited in the last 5 years ( table 1 ) . with no doubt , this clearly reflects the incorporation of new technologies in the peri - implant diagnosis field as their used is declining . similarly , there is a significantly higher prevalence of porphyromonas , prevotella and anaerobic gram positive cocci in peri - implantitis vs. peri - implant health . in contrast , a reduction on spirochetes was found from implant placement on periodontal sites to 12 months . using bacteria culture , similar effectiveness has been described when using placebo or chlorhexidine for the treatment of peri - implantitis sites . a total of 14 studies have been identified using pcr techniques ( table 2 ) . these studies , overall , fail to demonstrate similar patterns in terms of detected species , frequencies of detection as well as bacterial load . as an example , some studies found no differences in the detection frequencies of aggregatibacter actinomycetemcomitans ( a.a . ) , porphyromonas gingivalis , prevotella intermedia and treponema denticola between healthy and diseased implants . , p. gingivalis , tannerella forsythia , t. denticola , fusobacterium nucleatum , p. intermedia , peptostreptococcus micros , campylobacter rectus , eikenella corrodens , candida albicans , prevotella nigrescens , centruroides gracilis , capnocytophaga ochracea , campylobacter concisus , streptococcus spp . compared to teeth , implants are usually reported to have less bacterial species ; periodontitis is also reported to be more diverse than peri - implantitis . , it seems that the presence of periodontal disease and implants increase the presence of periodontophatic bacteria in the peri - implant sulcus , which does not necessarily mean that these bacteria are involved in peri - implant disease . interestingly , sato et al . found a higher number and detection rate of periodontopathic bacteria as the cumulative interceptive supportive therapy ( cist ) level increased . as expected , plaque and bleeding on probing scores have been significantly correlated with sulcular levels of bacteria , although the total dna count was not significantly different between implants with shallow and deep pockets . however , other studies involving a greater number of patients also found total dna count to be correlated to interproximal bleeding index ( r = 0.409 ) and interproximal probing depth ( r = 0.307 ) but no correlations were present with plaque index or radiographic bone level up to 22 years after implant placement . when comparing healthy vs. diseased implant sites , only 37.5 % of all species showed a higher prevalence , although only 10 species were explored . in contrast , only 14 species out of the 79 studied ( 17.7 % ) were more prevalent in peri - implantitis than in healthy sites in a study by persson and renvert involving 166 peri - implantitis sites and 47 healthy implants . interestingly , this study also found a cluster of t. forsythia , p. gingivalis , treponema socranskii , staphylococcus aureus , staphylococcus anaerobius , staphylococcus intermedius , and streptococcus mitis that comprised 30 % of the total microbiota at peri - implantitis sites . in terms of differences between teeth and implants , although ebadian and co - workers found no significant differences between healthy implants and teeth , other studies have identified some particular species , such as t. forsythia , p. gingivalis , p. intermedia , parvimonas micra , and t. denticola , in higher concentration around implants . in the presence of periodontal disease , differences between periodontitis and peri - implantitis sites , specifically in the concentrations of t. forsythia , p. intermedia and c. rectus , are clear . the difference between periodontal gingivitis and peri - implant mucositis , however , was not significant in an experimentally induced gingivitis mucositis study by salvi and co - workers . finally , 14 studies have been identified that used the 16s rrna gene sequencing technique ( table 4 ) . when comparing peri - implant healthy sites with diseased , 10-fold higher mean colony - forming units have been identified in peri - implantitis sites compared to healthy implant sites , with periodontopathic bacteria not being the only periodontal pathogens active in peri - implantitis . in this sense , the microbiome of mucositis can be described as intermediate in nature between healthy and peri - implantitis sites . in fact , the pathogens found in peri - implantitis sites can already be seen at a moderate abundance in mucositis sites [ 65 - 67 ] . in this transition from health to mucositis , loss of several health - associated species occurs , which interestingly in non - smokers , is based on an increase in diversity . the comparison between implants and teeth in several studies agrees that peri - implantitis sites present higher diversity than periodontitis sites [ 68 - 70 ] . in contrast , other studies have found significantly lower diversity of peri - implant biofilms than subgingival biofilms in both health and disease [ 71 - 74 ] . in this sense , dabdoub and co - workers found that less 50 % of all species were shared between periodontal and peri - implant biofilms in the majority of the patients ( 60 % ) . these numbers are more evident as less than 8 % of species are found in both teeth and implants in more than 85 % of patients . this is , in the vast majority of patients , microbes at each site are different ; therefore , the ecosystem can also be referred to be different . risk of bias within studies as a summary of the risk of bias within studies , we must highlight the fact that most of the studies included were observational cross - sectional studies . most of them made a sound selection of the comparison group ( if present ) and used valid and reliable measures . however , in most cases when a comparison group was present it was difficult to identify the method of balancing the groups by important potential confounding variables that in some cases were not even taken into account , including age , gender , presence of periodontal disease , concomitant intake of antibiotics or anti - inflammatory drugs , type of implant - abutment connection , or last periodontal therapy , among others . because of this , it can be said that most of the studies in this topic contain a moderate risk of bias . the main difficulty in the topic under study is the difference in the microbial detection technique . in addition , the latter consensus in disease classification , diagnosis and reporting is not always followed in the included studies , although they do report the conditions properly . also , few studies analyse simultaneously the microbiome and the host , which indicate limited information on this important interactions . thus , the lack of comparable studies in terms of design , patient selection , defect and systemic conditions and microbial analysis make it difficult to draw solid conclusions . most of the studies on microbiology around implants and teeth use paper points to collect the samples . a recent study concluded that paper points used for sampling can contain contaminating bacterial dna . therefore , the use of paper points as sampling tool for microbial profiling should be substituted by other methods such as sterile curettes . efforts are being made on generating a complete analysis of the human microbiome , the most important of them being the human microbiome project ( hmp ) . it should not be surprising that approximately 26 % of all bacteria in the human body are located in the oral cavity . it has been calculated that the microbiota on a human body outnumbers our somatic cells by 10-fold . therefore , understanding the human microbiome , its distribution and evolution is key in the understanding of the human physiology , as have been highlighted in several reviews . the studies developed under the hmp project try to answer the question on what are the synergistic activities between humans and microbes . other questions come from an ecological point of view such as how stable and resilient is the microbiota over the course of a day within one individual , and during the course of his or her lifespan , how similar they are between members of a family , a human community , and between communities living in different environments , etc . . these studies were proposed to use the deep analysis tools that were developed under the human genome project : random shotgun sequencing procedures , targeted large - insert clone sequencing , and assessments of intra - and inter - individual variation by using high - density microarrays . however , as much as 20 % to 60 % of the human - associated microbiome has been estimated to be uncultivable . it uses an enzymatic replication process of the dna that will be later observed in a gel or quantified after a number of replication cycles . these techniques overcame the limitations of culturing techniques and also allowed great time - saving . then , the dna - dna hybridization ( checkerboard ) technique was applied in periodontal studies by socransky et al . . it allows the evaluation of large amounts of plaque samples for multitude of species on a single support membrane by hybridizing the dna samples against whole genomic dna probes , detecting up to 78 species at once . the use of dna - dna hybridization highly improved the studies performed before using traditional culture techniques . the vast majority of the studies on peri - implantitis , obviously , focused on the species identified before on periodontitis sites , as a high similarity was suspected at the time . however , the main disadvantage of the pcr and dna - dna hybridization methods is the need to preselect probes for the bacteria to be investigated . therefore , there is a certain bias as the observer selects which and which not should be looked for and does not allow findingthus , studies are really difficult to be compared . in addition , the quality of the results depends highly on the quality of the probe and the hybridization conditions . consequently , although useful for exploratory studies , these techniques should be discarded in the future . new studies are sequencing genomic libraries made from dna extracted directly from the sample without looking for a specific organism , a method called metagenomics . the several limitations mentioned above for the previous techniques can be overcome by this new technology . this technique is able to identify universal and conserved targets with important and distinctive phylogenetic information in complex microbial communities . within the specific field of dentistry , the analysis of the 16s ribosomal gene sequence is probably the tool providing the more comprehensive examination of the taxonomically heterogeneous community associated with periodontal health and disease , as well as peri - implant diseases . however , the technique presents limitations in identifying differences at the strain level , which may actually be the level that distinguishes between health and disease . it has been reported that the microbial profile in the peri - implant sulcus and adjacent periodontal pockets is specific for peri - implantitis and have high predictive value . however , periodontal pathogens have been identified in healthy , peri - implant mucositis , and peri - implantitis sites . thus , it could be argued that these microorganisms are not strictly associated with peri - implantitis and other species not analysed in some of those studies may be involved in the pathogenesis of peri - implant diseases . furthermore , in some cases , microorganisms not associated with periodontal disease have been a common finding at implants with peri - implantitis . therefore , conventional pathogens in periodontal disease may not be the only microorganisms active in peri - implantitis . in any case , based on this review and according to others , nonetheless , in general , higher amounts of microorganisms have been found in sites diagnosed with peri - implantitis than in healthy sites . despite the geographic proximity and some common microorganisms , also , as properly discussed by charalampakis and belibasakis , with whom we agree , it may sound logical to think that if the microbiota at teeth and implants share a limited space they should be similar . however , the differences in topography and immunological characteristics of periodontal and peri - implant tissues must also drive to the logical conclusion that the biofilms associated with these surfaces have to be different . most of the studies published so far used techniques such as culture , pcr and checkerboard dna - dna hybridization that limit the possibility to detect species not considered in the analysis . metagenomics techniques must be used in future studies and findings correlated with specific host characteristics ( site , defect , region and systemic conditions and background ) . in most cases comparison groupswere not balanced by important potential confounding variables , including age , gender , presence of periodontal disease , concomitant intake of antibiotics or anti - inflammatory drugs , type of implant - abutment connection , or last periodontal therapy , among others . microbial profile of peri - implant diseases usually includes classic periodontopathogens . however , correlation between studies is difficult , particularly because of the use of different detection methods . new metagenomic techniques to avoid detection bias and careful balance and description of the included patients and implants should be promoted for future studies . the authors of this manuscript were partially supported by research groups # cts - 138 and # cts - 583 ( junta de andaluca , spain ) . mpm is supported by the andaluca talent hub program from the andalusian knowledge agency ( co - funded by the european union s seventh framework program , marie skodowska - curie actions ( cofund grant agreement n 291780 ) and the ministry of economy , innovation , science and employment of the junta de andaluca ) . this research received no specific grant from any funding agency in the public , commercial , or not - for - profit sectors . the authors declare no conflict of interest , either directly or indirectly , in any of the products listed in the manuscript .\noutput:\n" }, { "from": "agent", "value": "abstractobjectivesto describe the microbial profiles of peri - implant diseases and the main detection methods.material and methodsa literature search was performed in medline via pubmed database to identify studies on microbial composition of peri - implant surfaces in humans published in the last 5 years . studies had to have clear implant status definition for health , peri - implant mucositis and / or peri - implantitis and specifically study microbial composition of the peri - implant sulcus.resultsa total of 194 studies were screened and 47 included . peri - implant sites are reported to be different microbial ecosystems compared to periodontal sites . however , differences between periodontal and peri - implant health and disease are not consistent across all studies , possibly due to the bias introduced by the microbial detection technique . new methods non species - oriented are being used to find unexpected microbiota not previously described in these scenarios.conclusionsmicrobial profile of peri - implant diseases usually includes classic periodontopathogens . however , correlation between studies is difficult , particularly because of the use of different detection methods . new metagenomic techniques should be promoted for future studies to avoid detection bias ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: schwannomas are one of the main subtypes of peripheral nerve neurogenic tumours . schwannomas were first described by verocay in 1908 and consists of schwann cells . these tumours can arise in patients with neurofibromatosis types 1 and 2 . around 45 % of neurogenic tumours arise in the head and neck . however , neurogenic laryngeal tumours are not common , comprising of 0.1 % of all laryngeal tumours . malignant transformation is extremely rare and such tumours are known as malignant peripheral nerve sheath tumours or neurofibrosarcomas . they are slow growing and are sporadic solitary lesions affecting sensory nerves more frequently than motor nerves . the common locations of laryngeal schwannoma are in the aryepiglottic folds ( 80 % ) and in the false or true vocal cords ( 20 % ) . there are few published reports in the literature about laryngeal schwannomas and approaches to management . we report a first case where histological diagnosis of laryngeal schwannoma was made through an incidental finding of a laryngeal lesion on radiological imaging and the subsequent surgical management . a 73 - year - old lady under investigation by the medical physicians was referred to the otolaryngology department after a magnetic resonance imaging ( mri ) scan of the brain and cervical spine revealed an incidental finding of a mass on the right side of her larynx . a detailed history revealed a 6 - week history of odynophagia and dysphagia , with no dysphonia . flexible nasoendoscopic examination showed the presence of a 2.5 cm smooth swelling on the right side of the supraglottis , arising from the area of the right aryepiglottic fold . a computed tomography ( ct ) scan of the neck confirmed a heterogeneously enhancing , smooth , likely benign lesion in the supraglottic lesion extending cranially to involve the lower pharynx and the epiglottis , with significant compromise to her airway . the patient then underwent an excision of the right supraglottic mass via a laryngofissure approach and a tracheostomy ( figs 1 and 2 ) . the tracheostomy was undertaken in order to secure her airway and until histological outcome was known . the operative procedure was uneventful with identification and complete excision of the lesion ( fig . postoperatively , the patient recovered well although at first , nutrition was maintained through nasogastric feeding , as swallowing was unsafe with a tracheostomy . once histology was confirmed , decannulation of the tracheostomy occurred and the patient began to build up voice function and swallow . microscopy revealed a well - circumscribed lesion containing spindle cells with round , regular nuclei . postoperatively , 2 - month follow - up showed that the patient had preserved voice quality and swallowing function with no signs of recurrence . schwannomas are benign , encapsulated , well - circumscribed , solitary peripheral nerve sheath tumours originating from schwann cells . women are twice as likely to be affected than men and it can develop at any age ; however , most occur between the fifth and seventh decades . it is essential to differentiate schwannomas from neurofibromas as the latterschwannomas classically affect nerve sheaths rather than nerve fibres and hence symptoms are determined by site and mass effect . typical symptoms of laryngeal schwannoma are hoarseness , dysphagia , dyspnoea , dysarthria , globus sensation , odynophagia , and persistent sore throat . schwannomas are classified as having three main characteristics in order to confirm diagnosis . ( i ) they arise in nerve sheaths and are encapsulated by a fibrous capsule consisting of epineurium and residual nerve fibres . antoni a areas are made up of spindle cells with twisted nuclei , indistinct cytoplasmic borders that are structured in short bundles or interlacing fascicles . antoni b areas are less orderly and hypocellular with large , spaced vessels characteristic of schwannnomas . ( iii ) s - 100 protein is an acidic protein found in the supporting cells of the central and peripheral nervous system and is expressed by schwannoma cells , particularly in antoni a areas . ct and mri are useful in describing the anatomical extent of lesions and also in differentiating between malignant and benign forms . ct findings for benign laryngeal schwannoma usually include heterogenous enhancement of the lesion , no cartilage erosion and absence of infiltrative pattern . diagnosis is based on histological findings , as imaging can not always differentiate between different tumours . surgical excision is recommended as schwannomas are radioresistant and do not recur if excised fully . they are usually submucosal tumours that are extrinsic to the nerve fascicle and therefore easily separated . smaller lesions can be excised endoscopically ; however , larger lesions may require an external approach in the form of median and lateral thyrotomy , lateral pharyngotomy , laryngofissure or transhyoid . in our case , the lesion could not be resected fully at initial microlaryngoscopy as it was difficult access ; hence , the patient underwent excision of the lesion via a laryngofissure approach and a tracheostomy to protect her airway . in summary , laryngofissure had a successful outcome in this case for a supraglottic schwannoma lesion . the size of the lesion dictates the approach for excision and complete resection is needed to prevent recurrence . although rare , it is important to consider a diagnosis of schwannoma with an atypical mass arising in the larynx .\noutput:\n" }, { "from": "agent", "value": "schwannomas are peripheral nerve neurogenic tumours and although not common , laryngeal schwannomas can provide a unique challenge in diagnostic and treatment management . there are limited reports in the literature on approaches to management . a 73 - year - old lady presented to the otolaryngology department after a mri scan demonstrated an incidental right supraglottic mass . further investigations included ct scanning and microlaryngoscopy , which only confirmed the presence of the mass with no histology diagnosis . excision was undertaken by a laryngofissure approach and tracheostomy . histology confirmed a benign ancient schwannoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: each exon of siae was amplified from genomic dna from individual subjects and subjected to automated sequencing . residue numbering was based on enst00000263593 ( ensembl ) , corresponding to the genbank accession number np_733746 . genomic dna was extracted from clotted blood specimens from patients with autoimmune disease using a qiaamp dna blood mini kit ( qiagen , valencia , ca ) according to the manufacturer s instructions . all 10 exons of the human siae gene were amplified by pcr using intronic primers ( supplementary table s4 ) . purification of the amplified products , bidirectional automated sequencing and sequence analysis were performed as described earlier13 . dnas from controls were obtained from ebv - immortalized lymphoblastoid cell - lines established from healthy blood donors14 . all blood samples were collected with approval from the mgh / partners human studies institutional review board and from the institutional review board at north shore long island jewish health system . a human siae cdna was cloned from mda - mb 231 cells and a full length flag - tagged human siae expression construct ( in pcdna3 .1 ) was generated . this clone was targeted for mutagenesis using pfuturbo dna polymerase ( stratagene , ca , usa ) . each siae variant ( other than the w48x truncation ) was recreated by site directed mutagenesis as a c - terminal flag tagged human siae cdna in an expression vector site directed mutagenesis was used to create the s127a variant with a defect in the catalytic site as well as each of the variants listed in table i. the pcr products were digested overnight with dpni ( 10 units ; stratagene ) and transformed into top10 chemically competent cells ( invitrogen , carlsbad , ca ) . lysates and supernatants were immunoprecipitated with anti - flag antibodies and catalytic activity of the immunoprecipitated esterase was assayed by a fluorimetric method15 . equivalent amounts of each lysate and supernatant were immunoprecipitated for the catalytic assay as well as for quantitation of the flag - tagged protein by an immunoblot assay on the li - cor odyssey , using a mouse monoclonal anti - flag antibody ( sigma ) and an ir dye 800cw labeled goat anti - mouse igg ( li - cor ) as a secondary antibody . immunoprecipitation , metabolic labeling , and pulse chase studies were performed as described in ref .1 . these assays were carried out by co - transfecting cdnas encoding v5 - tagged wild type murine siae , together with flag - tagged murine versions of siae mutants discovered in subjects with rheumatoid arthritis into 293 t cells . the v5 - tagged wild type proteins in cell lysates were immunoprecipitated using mouse monoclonal anti - v5 antibody ( invitrogen ) , for quantitative immunoblot and esterase activity assays . expression of flag - tagged mutants was also monitored by immunoprecipitation and western blot assays . the method used was described in murine lymphocytes in reference1and is based on the method described originally by krishna and varki16 . briefly human b cells were stained with antibodies to cd19 and cd27 ( bd pharmingen ) and incubated either with or without f ( ab ) 2 , polyclonal rabbit anti - human igm ( dako ) . cells were also stained either with fitc - f ( ab ) 2 , goat anti - human igg , fc specific ( jackson immunoresearch ) alone , or the che - fcd reagent ( an influenza c hemagglutin esterase - fused to the fc portion of human igg , chemically treated with diisopropyl fluorophosphate ) complexed with fitc - f ( ab ) 2 fragment goat anti - human igg , fc specific . each exon of siae was amplified from genomic dna from individual subjects and subjected to automated sequencing . residue numbering was based on enst00000263593 ( ensembl ) , corresponding to the genbank accession number np_733746 . genomic dna was extracted from clotted blood specimens from patients with autoimmune disease using a qiaamp dna blood mini kit ( qiagen , valencia , ca ) according to the manufacturer s instructions . all 10 exons of the human siae gene were amplified by pcr using intronic primers ( supplementary table s4 ) . purification of the amplified products , bidirectional automated sequencing and sequence analysis were performed as described earlier13 . dnas from controls were obtained from ebv - immortalized lymphoblastoid cell - lines established from healthy blood donors14 . all blood samples were collected with approval from the mgh / partners human studies institutional review board and from the institutional review board at north shore long island jewish health system . a human siae cdna was cloned from mda - mb 231 cells and a full length flag - tagged human siae expression construct ( in pcdna3 .1 ) was generated . this clone was targeted for mutagenesis using pfuturbo dna polymerase ( stratagene , ca , usa ) . each siae variant ( other than the w48x truncation ) was recreated by site directed mutagenesis as a c - terminal flag tagged human siae cdna in an expression vector site directed mutagenesis was used to create the s127a variant with a defect in the catalytic site as well as each of the variants listed in table i. the pcr products were digested overnight with dpni ( 10 units ; stratagene ) and transformed into top10 chemically competent cells ( invitrogen , carlsbad , ca ) . lysates and supernatants were immunoprecipitated with anti - flag antibodies and catalytic activity of the immunoprecipitated esterase was assayed by a fluorimetric method15 . equivalent amounts of each lysate and supernatant were immunoprecipitated for the catalytic assay as well as for quantitation of the flag - tagged protein by an immunoblot assay on the li - cor odyssey , using a mouse monoclonal anti - flag antibody ( sigma ) and an ir dye 800cw labeled goat anti - mouse igg ( li - cor ) as a secondary antibody . immunoprecipitation , metabolic labeling , and pulse chase studies were performed as described in ref .1 . these assays were carried out by co - transfecting cdnas encoding v5 - tagged wild type murine siae , together with flag - tagged murine versions of siae mutants discovered in subjects with rheumatoid arthritis into 293 t cells . the v5 - tagged wild type proteins in cell lysates were immunoprecipitated using mouse monoclonal anti - v5 antibody ( invitrogen ) , for quantitative immunoblot and esterase activity assays . expression of flag - tagged mutants was also monitored by immunoprecipitation and western blot assays . the method used was described in murine lymphocytes in reference1and is based on the method described originally by krishna and varki16 . briefly human b cells were stained with antibodies to cd19 and cd27 ( bd pharmingen ) and incubated either with or without f ( ab ) 2 , polyclonal rabbit anti - human igm ( dako ) . cells were also stained either with fitc - f ( ab ) 2 , goat anti - human igg , fc specific ( jackson immunoresearch ) alone , or the che - fcd reagent ( an influenza c hemagglutin esterase - fused to the fc portion of human igg , chemically treated with diisopropyl fluorophosphate ) complexed with fitc - f ( ab ) 2 fragment goat anti - human igg , fc specific .\noutput:\n" }, { "from": "agent", "value": "sialic acid acetylesterase ( siae ) is an enzyme that negatively regulates b lymphocyte antigen receptor signaling and is required for the maintenance of immunological tolerance in mice1 , 2 . heterozygous loss - of - function germline rare variants and a homozygous defective polymorphic variant of siae were identified in 24/923 caucasian subjects with relatively common autoimmune disorders and in 2/648 caucasian controls . all heterozygous loss - of - function siae mutations tested were capable of functioning in a dominant negative manner . a homozygous secretion - defective polymorphic variant of siae was catalytically active , lacked the ability to function in a dominant negative manner , and was seen in 8 autoimmune subjects but in no control subjects . the odds ratio for inheriting defective siae alleles was 8.6 in all autoimmune subjects , 8.3 in subjects with rheumatoid arthritis , and 7.9 in subjects with type i diabetes . functionally defective siae rare and polymorphic variants represent a strong genetic link to susceptibility in relatively common human autoimmune disorders ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ossifying fibromas occurs mostly in craniofacial bones and has been described in literature since late 1940s . the peripheral ossifying fibroma ( pof ) is a non - neoplastic enlargement of gingiva that is thought to be reactive in nature and not necessarily the peripheral counterpart of cement - ossifying fibroma . pof is typically a solitary , slow - growing nodular mass that is either pedunculated or sessile and has been cited in the literature under various names such as peripheral fibroma with osteogenesis , calcifying fibroblastic granuloma , peripheral cementifying fibroma etc . adjunctive local periodontal treatment in the form of scaling and root planing may ameliorate to only a negligible extent . one vexatious issue with surgical treatment of pof is the rate of recurrence which is reported to vary from 7 % to 45 % . traditionally lesions like pof have been treated with scalpel surgery , which has been further refined with the use of electrocuatery . with the advent of soft - tissue lasers in the last two decades , attempts have been made to approach excision of such lesions with lasers . a review of literature has revealed two reports , which attempted use of lasers in the treatment of pof . the present paper reports the successful management and 1 year follow - up of two cases of pof using neodymium - doped yttrium aluminum garnet ( nd : yag ) laser and advocates the use of lasers in the repertoire of a clinician . a 32 - year - old male reported to the author 's practice in august 2011 with a complaint of growth in the gums . extraoral examination did not reveal any abnormalities and there were no palpable regional lymph glands . intraoral examination showed a neglected mouth with poor oral hygiene as reflected by heavy accumulation of plaque . except for plaque and calculusassociated chronic gingivitis , patient had no overt periodontal disease , teeth mobility or loss of attachment in general . on examination a pedunculated , enlarged interdental papilla in the region of maxillary right central and lateral incisor measuring around 1 cm 1.5 cm was observed . the growth was pinkish red , soft with a smooth surface and was not ulcerated [ figure 1 ] . there was no spontaneous bleeding , but when gently handled with a blunt probe , bleeding was elicited indicating inflamed and engorged tissue . the teeth in the area of enlargement were vital , did not show any periodontal pockets except the deeper sulcus because of the enlargement . intraoral periapical radiographs revealed no abnormality with normal periodontal ligament space , lamina dura and periapical tissues . an orthopantomogaph was taken to have a broader view of the jaws and did not reveal any bony lesions or pathology , which would have any relevance to the gingival enlargement directly or indirectly . patient was systemically healthy , there were no relevant medical problems , he was not on any medications and a hemogram and fasting blood sugar levels were within normal range . the second case involved a 35 - year - old female who presented in the month of october 2011 with a similar overgrowth in relation to right maxillary canine and premolar region . patient noticed it approximately 4 months before and reported that it was painless , but occasionally bleeding on tooth brushing and causing some esthetic problem with people around her noticing the red mass and commenting about it . patients medical history was non - contributory and there was no extraoral changes . on examination a reddish , not too well defined mass of tissue approximately measuring 2 cm 1.5 cm in the interproximal area was observed . the lesion extended onto the palatal aspect and revealed indentations made by the occluding mandibular teeth . the growth was pedunculated , not ulcerated and there was slight bleeding on gentle probing . oral hygiene was fair with only slight plaque and calculus with resultant chronic generalized gingivitis . a provisional diagnosis of pyogenic granuloma and differential diagnosis of irritational fibroma and pof were considered as possibilities in both cases . patients were put on a regimen of 0.2 % chlorhexidine mouthwash and necessary oral hygiene instructions were given . the enlargement did not show perceptible improvement except for very slight reduction in inflammation and the option of surgical excision was considered at this stage . patients were explained about the necessity for surgical excision under local anesthesia and were also given the choice of undergoing the excision either with traditional surgery or laser approach . after patient 's consent for the laser procedure necessary pre - surgical screening were performed . in both the cases , identical procedure for laser excision was followed using nd : yag laser ( fidelis plus iii , fotona ; ljubljana , slovenia ) . standard safety precautions for the patient , operator and the assistant were adhered to according to manufacturer 's advice . after a pre - procedural rinse , 2 ml anesthetic solution ( 2 % lignocaine hydrochloride ) was infiltrated 1 cm from the margins of the lesion . nd : yag laser irradiation was delivered through an optical fiber with 300 m fiber at 4 w , 50 hz , long pulsed ( lp ) as recommended by the manufacturer in contact mode to control the depth of penetration . the lesion was excised 0.5 - 1 mm beyond its clinical extent and the underlying surface was thoroughly curetted and root planing was carried out on the adjacent teeth using the periodontal curettes . there was no bleeding and tissues were well coagulated during the entire procedure [ figure 2 ] . analgesics ( ibuprofen 200 - 400 mg ) were prescribed to be taken as and when required and 0.2 % chlorhexidine mouth rinse was advised twice daily for 4 weeks . immediately laser excision the excised specimens after due processing were evaluated and a final diagnosis of pof was arrived at by the pathologist . the fibrovascular tissue comprised of a large number of plump proliferating fibroblasts intermingling throughout in a delicate fibrillar stroma . the overlying squamous epithelium was intact . within this cellular fibrous connective tissue , different forms of mineralized structureswere observed , ranging from few immature cellular bone / woven bone type to droplets of calcified material resembling acellular cementum . all the histopathological features were suggestive of a diagnosis pof [ figures 3 and 4 ] . photomicrograph showing cellular fibrous connective tissue with an overlying stratified squamous epithelium ( h and e , 4 ) photomicrograph showing mineralized structures in the form of immature woven bone and cementum like droplets ( h and e , 10 ) one week after the treatment , a superficial layer of fibrin was present and 4 weeks after surgery the wound has completely healed [ figure 5 ] . no recurrence was observed during the 1 year follow - up [ figure 6 ] . a 32 - year - old male reported to the author 's practice in august 2011 with a complaint of growth in the gums . extraoral examination did not reveal any abnormalities and there were no palpable regional lymph glands . intraoral examination showed a neglected mouth with poor oral hygiene as reflected by heavy accumulation of plaque . except for plaque and calculusassociated chronic gingivitis , patient had no overt periodontal disease , teeth mobility or loss of attachment in general . on examination a pedunculated , enlarged interdental papilla in the region of maxillary right central and lateral incisor measuring around 1 cm 1.5 cm was observed . the growth was pinkish red , soft with a smooth surface and was not ulcerated [ figure 1 ] . there was no spontaneous bleeding , but when gently handled with a blunt probe , bleeding was elicited indicating inflamed and engorged tissue . the teeth in the area of enlargement were vital , did not show any periodontal pockets except the deeper sulcus because of the enlargement . intraoral periapical radiographs revealed no abnormality with normal periodontal ligament space , lamina dura and periapical tissues . an orthopantomogaph was taken to have a broader view of the jaws and did not reveal any bony lesions or pathology , which would have any relevance to the gingival enlargement directly or indirectly . patient was systemically healthy , there were no relevant medical problems , he was not on any medications and a hemogram and fasting blood sugar levels were within normal range . the second case involved a 35 - year - old female who presented in the month of october 2011 with a similar overgrowth in relation to right maxillary canine and premolar region . patient noticed it approximately 4 months before and reported that it was painless , but occasionally bleeding on tooth brushing and causing some esthetic problem with people around her noticing the red mass and commenting about it . patients medical history was non - contributory and there was no extraoral changes . on examination a reddish , not too well defined mass of tissue approximately measuring 2 cm 1.5 cm in the interproximal area was observed . the lesion extended onto the palatal aspect and revealed indentations made by the occluding mandibular teeth . the growth was pedunculated , not ulcerated and there was slight bleeding on gentle probing . oral hygiene was fair with only slight plaque and calculus with resultant chronic generalized gingivitis . a provisional diagnosis of pyogenic granuloma and differential diagnosis of irritational fibroma and pof were considered as possibilities in both cases . patients were put on a regimen of 0.2 % chlorhexidine mouthwash and necessary oral hygiene instructions were given . the enlargement did not show perceptible improvement except for very slight reduction in inflammation and the option of surgical excision was considered at this stage . patients were explained about the necessity for surgical excision under local anesthesia and were also given the choice of undergoing the excision either with traditional surgery or laser approach . after patient 's consent for the laser procedure necessary pre - surgical screening were performed . in both the cases , identical procedure for laser excision was followed using nd : yag laser ( fidelis plus iii , fotona ; ljubljana , slovenia ) . standard safety precautions for the patient , operator and the assistant were adhered to according to manufacturer 's advice . after a pre - procedural rinse , 2 ml anesthetic solution ( 2 % lignocaine hydrochloride ) nd : yag laser irradiation was delivered through an optical fiber with 300 m fiber at 4 w , 50 hz , long pulsed ( lp ) as recommended by the manufacturer in contact mode to control the depth of penetration . the lesion was excised 0.5 - 1 mm beyond its clinical extent and the underlying surface was thoroughly curetted and root planing was carried out on the adjacent teeth using the periodontal curettes . there was no bleeding and tissues were well coagulated during the entire procedure [ figure 2 ] . analgesics ( ibuprofen 200 - 400 mg ) were prescribed to be taken as and when required and 0.2 % chlorhexidine mouth rinse was advised twice daily for 4 weeks . immediately laser excision the excised specimens after due processing were evaluated and a final diagnosis of pof was arrived at by the pathologist . the fibrovascular tissue comprised of a large number of plump proliferating fibroblasts intermingling throughout in a delicate fibrillar stroma . the overlying squamous epithelium was intact . within this cellular fibrous connective tissue , different forms of mineralized structureswere observed , ranging from few immature cellular bone / woven bone type to droplets of calcified material resembling acellular cementum . all the histopathological features were suggestive of a diagnosis pof [ figures 3 and 4 ] . photomicrograph showing cellular fibrous connective tissue with an overlying stratified squamous epithelium ( h and e , 4 ) photomicrograph showing mineralized structures in the form of immature woven bone and cementum like droplets ( h and e , 10 ) one week after the treatment , a superficial layer of fibrin was present and 4 weeks after surgery the wound has completely healed [ figure 5 ] . no recurrence was observed during the 1 year follow - up [ figure 6 ] . a common growth accounting for about 9 % of all gingival growths , pof is a non - neoplastic enlargement seen more often in females , in the interdental papilla and the anterior part of the maxilla . the predilection of pof to occur in the anterior part of the maxilla is disputable with another source stating that mandible especially the pre - molar and molar areas being the common sites of involvement . the etiology is not known though various possibilities are suggested often without any corroboration and include , trauma , local irritants in the form of plaque and calculus , ill fitting dentures , and poor restorative dentistry . it has been suggested that the origin of this growth is odontogenic or from periodontal ligament . however , microscopically identical neoplasms with cementum such as differentiation also have been reported in the orbital , frontal , ethemoid , sphenoid , and temporal bones consigning the issue of origin to question . the periodontal ligament origin appears plausible for the reasons that the lesions occur exclusively in the gingiva , their proximity to the periodontal ligament ; and the fibrocellular response , which is similar to the other reactive gingival lesions of periodontal ligament origin . histopathological examination of the excised tissue is the sine quo non in this type of lesions as rarely an occasional innocuous and benign looking lesion may sometimes prove to be a dangerous malignant lesion . gingival squamous cell carcinomas masquerading or mimicking soft gingival overgrowth are indeed reported and an astute practitioner should be wary of non - resolving soft - tissue lesions of considerable duration . one vexatious issue with surgical treatment of pof is the rate of recurrence which is reported to vary from 7 % to 45 % . yet another source has given the rate of recurrence at 8.9 % , 14 % , 16 % , and 20 % . nazareth et al . , excised a 3 cm 2 cm lesion and after 3 months there was a suggestion of recurrence . sometimes the recurrence is swift and remorseless and nothing would be more disconcerting to the clinician than facing such a piquant situation . it mandates that all patients with such lesions should be forewarned about recurrences in spite of best surgical technique and judgment . the extremes in recurrence statistics are attributable to surgical technique and the thoroughness of it . a cursory removal and casual curettage is more often likely to result in a recurrent lesion than the one thoroughly excised and the base of the lesion adequately scraped . it has been suggested that the lesion be removed down to the periosteum and adjacent teeth adequately divested of deposits hence that any irritant are eliminated . often large lesions after thorough excision leave unsightly gingival margin defects in the esthetic zones of maxilla and this should be anticipated and an astute clinician will be forearmed with necessary defect coverage procedures like subepithelial connective tissue graft . lasers are not new to dental surgery and have been in vogue for the last 3 - 4 decades for various intraoral procedures . oral surgical procedures including removal of soft - tissue tumors , frenectomies , excision of gingival hyperplasias , vestibuloplasties , hemangioma removal , and periimplant soft - tissue surgery have been successfully carried out using the various wavelengths of lasers . when incising pathologic tissues for biopsy laser provides many advantages over steel surgical instruments including , a dry and bloodless surgery , reduced bacteremia at the surgical site , reduced mechanical trauma with resultant lessened psychological trauma for the patient , minimal scarring , and wound contraction accelerating recovery and post - operative function . nd : yag laser has been successfully used for excision of pyogenic granuloma because of the lower risk of bleeding compared to other surgical techniques . successful laser surgery in 70 patients without anesthesia and minimum bleeding compared to scalpel surgery was reported two decades ago and it was concluded that laser excision is well - tolerated by patients with no adverse effects and that co2 and nd : yag laser irradiation is a successful treatment option . alam et al . , did laser excision in a young patient with cemento - ossifying fibroma of 3 cm 2.5 cm and claimed that it was the first time such a lesion was treated with laser excision ( diode ) . , very recently reported a case of successful laser excision of pof with very little intraoperative bleeding , post - operative pain , and sutureless exercise , excellent healing at the end of 1 week and suggested that laser excision as one of the best option for management of pof . they however , recommended a study of the series of such laser excisions so that recurrence patterns if any can be evaluated . to the best of our knowledge , the present report is the first of its type where laser has been used to excise two case of pof with a follow - up period of 1 year . of unknown etiology , unpredictable clinical course , and pronicity for recurrence , pof is a clinician 's cause for concern . the report of two cases of excision with laser and the absence of recurrence over a period of 1 year makes the laser approach a promising treatment option .\noutput:\n" }, { "from": "agent", "value": "peripheral ossifying fibroma ( pof ) is a non - neoplastic enlargement seen more often in females , in the interdental papilla and the anterior part of the maxilla , accounts for about 9 % of all gingival growths . of unknown etiology , unpredictable clinical course and pronicity for recurrence , pof is a clinician 's cause for concern . surgical excision is the treatment of choice , but with a reported recurrence rate of 7 - 45 % , the management is often frustrating . with increasing acceptance of lasers in the repertoire of clinician 's armory , laser excision of such lesions has become a possible , feasible , and patient - preferred approach . the purpose of this article is to report successful management and 1 year follow - up of two cases of pof using neodymium - doped yttrium aluminum garnet ( nd : yag ) laser . the absence of operative bleeding , relative ease of the procedure and patient acceptance lends the laser excision as an alternate therapeutic modality for excision of gingival enlargements of suspicious and vexatious nature ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: since its introduction , clozapine has been associated with haematological abnormalities , with most common abnormality being leucopenia , and other less commonly reported haematological abnormalities include agranulocytosis , neutropenia , thrombocytopenia , leukocytosis , and thrombocytothaemia . however , there are few reports of eosinophilia associated with the use of clozapine . in this report , we present two cases of eosinophilia associated with clozapine and discuss the clinical implications of detection of eosinophilia in patients receiving clozapine . miss x , a 32 - year female , diagnosed with schizoaffective disorder , hypothyroidism , drug induced polycystic ovary disease , and migraine presented with a relapse while on quetiapine 800 mg / day , lithium carbonate 900 mg / day , thyroxine 150 mcg / day , amitriptyline 75 mg / day , and metformin 1 g / day . her treatment history revealed that she had not responded to three antipsychotic trials in the past and resultantly was considered for clozapine . preclozapine investigations in the form of heamogram , liver function test , renal function test , fasting blood glucose level , electroencephalogram and electrocardiogram did not reveal any abnormality . however , lipid profile was deranged for which she was advised dietary modifications , regular physical activities ; metformin was continued in consultation with the endocrinologist . clozapine was started at the dose of 25 mg / day and her heamogram was monitored . after about 2 weeks ( 13 day of clozapine ) , while she was on clozapine 150 mg / day , her haemogram showed an eosinophil count of 9 % with an absolute eosinophil count of 936 / cmm . at this timeher physical examination did not reveal any rash or any other abnormality to suggest any infection or allergic reaction . in view of the increased eosinophil count , she was investigated further in form of complete blood count , urine microscopic examination and culture , peripheral blood smear for malarial parasite and a chest roentgenogram , all of which were found to be within the normal range except for persistence of increased eosinophil count . her investigations for impending myocarditis in form of troponin - t and creatine kinase ( ck - mb ) also did not reveal any abnormality . in view of the response to clozapine and no symptoms suggestive of any infective or allergic pathology , clozapinewas continued and the dose was gradually increased to 200 mg / day along with an empirical trial of mebendazole . however , on 26 day of clozapine her eosinophil count increased to 42 % with absolute eosinophil count of 6090 / cmm along with leucocytosis ( total leucocyte count of 14500 / cmm ) . all other investigations were repeated including evaluation for myocarditis , but no abnormality was noted except for t - wave inversion in leads v1 - 5 . clozapine was stopped and she was started on haloperidol . following stoppage of clozapine her symptoms again worsened , but her eosinophil count reduced to 18 % with absolute eosinophil count of 2,880 / cmm . in view of the worsening , after a gap of 2 weeks she was restarted on clozapine and dose was increased to 200 mg / day and her eosinophil count was closely monitored . during the initial 2 weeks of re - challengelater on the eosinophil count settled down to 25 % and she was continued on clozapine . she is on clozapine for more than a year and have been maintaining well with eosinophil count varying between 25 % , with no signs of any myocarditis . miss z , 46 years , diagnosed with paranoid schizophrenia presented to the inpatient unit with a relapse . her treatment history revealed that she had not responded to adequate trials of trifluperazine , risperidone , olanzapine , and haloperidol . in view of the treatment resistance , preclozapine investigations in the form of haemogram , liver function test , renal function test , fasting blood glucose level , electroencephalogram , and electrocardiogram did not reveal any abnormality . she was started on clozapine at the dose of 12.5 mg / day and on fourth day while on 37.5 mg / day of clozapine her eosinophil count increased to 7 % . however , there was no evidence of any rash , fever , or infective pathology . her investigations in the form of liver function test , urine examination ( microscopic examination and culture ) , chest roentgenogram , echocardiography , and electrocardiogram did not reveal any abnormality . she was investigated for ova / cysts in stool , serum immunoglobulin e levels , and antinuclear antibodies to rule out allergic etiology or connective tissue disorder . she tested negative for ova / cysts and serum ana levels were within normal range but the ige levels were raised to 3300 iu / ml ( n = 30300 iu / ml ) . in consultation with the rheumatologistin view of the clinical response to clozapine , she was continued on clozapine and the dose of clozapine was increased to 150 mg / day . over the next 5 weeks her eosinophil count varied between 58 % . after this her eosinophil count settled down to 12 % and she tolerated 150 mg / day of clozapine with no other haematological abnormality . the studies which have carried out surveillance of side effects of clozapine have reported an incidence of transient eosinophilia to vary widely from 0.261.7 % patients . eosinophilia whenever develops is usually seen during the initial phase of treatment with clozapine , usually within first 4 weeks of therapy . as with other blood dyscrasia with clozapine , various mechanisms have been proposed to be responsible for clozapine associated eosinophilia . commonly proposed mechanisms include type - i hypersensitivity reaction , which is supported by evaluated ige levels in few reports and stimulation of t - lymphocytes . clozapine - associated eosinophilia is understood as two different forms : first transient benign eosinophilia and second eosinophilia with end organ damage . the eosinophilia has been shown to be associated with myocarditis , pancreatitis , colitis , toxic hepatitis , and pleural effusions . other reports have also linked eosinophilia to predict neutropenia . with regard to the management of clozapine - associated eosinophilia , literature suggests that decision of continuation of clozapine is determined by the presence or the absence of other organ damage . the literature emerging from the case reports suggests that invariably clinicians have opted to stop clozapine in the presence of end organ damage . however , in the absence of end organ damage the eosinophilia is usually benign and transient . accordingly , whenever eosinophilia is noticed it is important to evaluate the patient for the presence of any specific organ damage and decision making should take the same into account . in occasional cases , authors have also rechallenged patients with clozapine even after an episode of clozapine and have used it successfully with only few cases of recurrence of eosinophilia along with other organ damagehowever , clinicians should give due importance to the eosinophil count while reviewing the hemogram . both our patients developed eosinophilia during the initial phase of the treatment and further evaluation did not reveal any other organ damage and , hence , clozapine was continued in the second case and in the first case rechallenged with clozapine did not lead to the recurrence of eosinophilia . our cases add to the existing literature that in the absence of other organ damage clozapine can be continued safely . however , close monitoring should be done .\noutput:\n" }, { "from": "agent", "value": "clozapine , an atypical antipsychotic , has been used in the treatment of schizophrenia and other psychotic disorders . although it has good therapeutic effect but many a time it use is overridden by the associated adverse effects which range from minor to severe life - threatening events . there has been extensive literature for severe side effects like leukocytosis but limited data are available for transient eosinophilia . here , we present two cases of benign transient eosinophilia and discuss the importance of recognizing eosinophilia while using clozapine ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is now widely recognized that many rna molecules are predisposed to forming complexes with proteins by fluctuating spontaneously through an ensemble of structural states . protein recognition is referred to as conformational capture . a description of the physical principles involved in forming rna protein complexes via conformational capture requires complete description of the dynamics of these structurally labile rna molecules , including a characterization of long - and short - lived conformational states sampled by the rna . however , experimental characterization of transitory states is complicated by the fact that the rate of transition may be too fast to allow for a comprehensive catalogue of all states . thus , although progress has been made recently in experimentally isolating the partially folded states of proteins , the complete elucidation of protein or nucleic acid dynamics requires analytical and computational modeling to complement experimental observations . a common approach toward this goal is to fit a limited set of model parameters to experimental data that are sensitive to dynamics , such as nmr relaxation rates , line shapes , or residual dipolar couplings . this procedure involves guessing - and - checking , using physical constraints on possible motions of the labeled residue ( s ) to guide the model - building process . however , this semianalytic approach becomes complicated when further degrees of freedom and new free parameters are required by the model to fit the data adequately . a purely computational approach to the description of molecular states requires an accurate potential energy function ( pef ) , followed by either molecular dynamics ( md ) or energy - minimization calculations . molecular dynamics simulations are able to generate dynamic trajectories of the molecule and , in principle , explore molecular parameter space if sufficient numbers of trajectories are available ; examples are found using the amber and charmm packages and others , such as lindorff - larsen et al . however , the extrapolation of dynamics in nucleic acids to time scales of the order of microseconds or longer , where many conformational changes are expected to take place , has only recently begun to be explored . energy - minimization techniques also rely on a well - validated energy function but involve the subsequent alteration of the relative conformations of parts of the molecule in an iterative manner to find the global energy minima . it is then possible to generate multiple sample structures more easily than for a complete md calculation . in the current manuscript , we utilize structures generated by energy - minimization techniques as a complement to md - based analyses of dynamics . use of energy - minimized structures is facilitated by the availability of structures on the rosetta server . other servers such as the mc - sym / mc - fold pipeline are also available that allow the user to obtain all - atom rna models . we use the hiv - 1 tar ( trans - activation response ) rna molecule as a model for a dynamics simulation based on a set of 500 low energy models generated using the program farfar for the 29 - nucleotide apical section of the rna ( figure 1 ) . the tar rna binds the viral regulatory protein tat , a critical transcription elongation factor essential for viral replication . the tat binding site surrounds the single - stranded , trinucleotide ( ucu ) bulge and is contained within the 29 - nucleotide construct . the bulge region interlinking the two helical stems is the primary binding site for the tat protein and exhibits considerable flexibility allowing for the two helical regions to adopt a wide range of relative orientations . , where the free tar rna exchanges between multiple conformers , one or more of which are amenable to tat binding . tar rna also provides a common rna structural motif , where two helices are connected by a single - stranded bulge on one end and a backbone hinge at the other . other rna s exhibit similar structures , such as k - turns , or the hiv - 1 rre ( rev - response element ) . it is therefore worthwhile to characterize the dynamics of such fundamental motifs , especially to characterize large - scale motions ( as opposed to more localized motions ) of one helical domain relative to another .29 - nucleotide apical stem - loop of hiv - 1 tar rna : ( a ) secondary structure ; ( b ) sample tertiary structure . the different submotifs and the component residues used in the analyses are color - coded : upper helix ( turquoise ) , lower helix ( red ) , and the single - stranded bulge ( green ) . earlier work in our group used solid - state nmr to identify intermediate rate motions for the residue u38 in the upper helix . we more recently characterized the motions of u40 and u42 in the lower helix ( wei huang , unpublished data ) . these data indicate that the two helices move relative to each other at slow rates ( 10 to 10 s ) relative to the rotational diffusion rate of the entire molecule ( 10 s ) . these results motivated us to look at the distributions of the orientations of the upper helix relative to the lower helix among the set of lowest energy structures , as characterized by the euler angles of an upper helix - attached reference frame relative to a different frame attached to the lower helix . reduction to a set of three angles characterizes many features of the dynamical trajectory of this particular structural motif , while simplifying a very large - dimensional problem to a set of three essential coordinates . local base librations , i.e. , rotations of the bases around a base normal ( representing vibrations of the base around the equilibrium base - paired orientation ) or rotations of the base around the glycosidic bond ( for the single stranded bases ) , are included in the simulations as well and provide atomistic detail regarding the motions of individual residues . herewe extend our prior studies of nonrigid rotation and helix reorientation in tar rna to a full description of the concerted dynamics of the upper and lower helices and the bulged loop . our approach describes a dynamic trajectory based on an ensemble of energy minimized structures with the rosetta program farfar . because farfar does not provide a boltzmann - weighted distribution of states ( andthus does not provide the entropy and free energy ) our calculations rely on fitting phenomenological parameters to the data . to reduce the complexity of the problem , a predominant set of conformerswe used experimental residual dipolar couplings ( rdcs ) obtained from partial alignment of the tar rna by one alignment medium to achieve this selection , and other groups have recently used similar filtering techniques . in addition to filtering out a set of long - lived conformers along the stochastic trajectory , we acquire information regarding their relative populations . we complement the rdc filter with principal component analyses ( pcas ) based on a judiciously chosen set of backbone torsion angles , as done to establish conformational clustering and free energy landscapes of rnas and proteins , and a pca can serve as a useful aid in setting up dynamics calculations . finally , we use the outcome of that analysis to calculate solution spin lattice relaxation times t1 and the rotating - frame spin lattice relaxation time t1 for c spins in nucleotides located in the upper and lower helices and in the bulge . the protocol would allow extensions to other observables as well , but the current work focuses on these to provide a clear proof of method . we direct the interested reader to more extensive work on other nmr relaxation parameters and their simulations . the first approach ( slow exchange or se model ) assumes an effectively infinite time scale of exchange ( i.e. , the conformational exchange is much slower than any other relevant motional time scale ) . the second approach ( general rate orgr model ) allows for an arbitrary time scale of exchange ( including one that overlaps with the rotational diffusion time scale ) . by combining complementary experimental and analytical techniques into a single framework , we have been able to construct a viable dynamic trajectory for the tar rna . protocol used in this manuscript for the simulation of domain - dynamics in a molecule . we present here the solid - state nmr ( ssnmr ) - derived models that served as motivations for the solution relaxation simulations . ssnmr studies of the dynamics of the uridine bases u38 , u23 , and u25 in tar were carried out using samples selectively deuterated at the 5 - and 6 - carbon base sites . u38 was chosen to represent the dynamics of the upper helical stem , whereas u23 and u25 are of interest on account of their positions in the single - stranded bulge . more recently , 5,6 - h labels were introduced at the u40 and u42 positions in tar , in correspondence with the lower helix ( u42 ) and an unstable base pair that closes the bulge region ( u40 ) ( wei huang , unpublished data ) . the data included line shapes as well as t1z and t1q relaxation times collected on samples hydrated in all cases to 16 water molecules per nucleotide to reproduce conditions where motions were shown to be solution - like . each of the upper helical and single - stranded sites investigated had characteristically distinct spectral features . within the lower helix , u40 and u42 showed results similar to each other , but distinct from the upper helix or single - stranded sites . motional models generated to fit the data included a slower base motion consisting of jump between two equally populated sites , superposed on a faster motion occurring around the normal to the base - plane for the helical residues and around the glycosidic bond for the bulge residues . the analyses of the spectra recorded for the upper and lower helical sites were done independently resulting in two different sets of parameters . the u38 base was modeled as undergoing a two - site 4 jump process around the base - normal at a rate of 210 s in addition to a two - equivalent - site conformational exchange process , where the upper helix underwent a 9 bend and a 15 twist at a rate of 10 s relative to a crystal - fixed frame . a similar model could fit the data for the lower helix bases u40 and u42 as well , resulting in a 018 bending motion and a 1825 twisting motion of the lower helix , but at slower rates on the order of 10 s. by analyzing relaxation data , we observed small amplitude ( 6 to 9 ) local motions of the base at a rate of 10 s for both u40 and u42 . the u23 data were fit by significantly different models , involving a local two - site jump about the glycosidic bond of 11 at a rate of 10 s , and a 24 hop of the base at a rate of 10 s , whereas u25 was modeled as experiencing a 30 jump at 610 s in addition to a much slower twisting of the base ( 610 s ) with a large amplitude of 40 . we utilized the same two - site jump models for the local base motions of both the helical and bulge residues , under the rationale that solid - state sample conditions should be able to replicate solution conditions at least in the small - amplitude local motions at the hydration conditions of our studies . we also used the time scale of the local base jumps as a starting point for simulations of the solution conditions . finally , we used the observation that conformational exchange motions in solution conditions occur on a time scale similar to that in solid - state samples . formalism for part of the relaxation simulations , which assumes an exchange process much slower than all other motional rates . we did , however , also consider the more general case of an arbitrary rate of conformational exchange . the torsion angles that were altered in the generation of the structures used here were those of the residues in the bulge and the bulge - adjacent base pairs of the two helical domains . the 500 lowest energy structures represented a distribution in energy of about 13 rosetta units , where 1 rosetta unit is approximately 1 kbt ( rhiju das , private communication ) . to reduce the dimensionality of the problem , we assumed that the simple motif of a helix bulge helix can be represented by a reduced set of relative helical orientation parameters . a set of three euler angles transforming between the two helices is taken to be sufficient to discriminate between helical conformations ( figure 3 ) if the helices behave as rigid units . relation between the euler angles determined from the atomic coordinates and the associated domain motions . we have used experimental residual dipolar couplings ( rdcs ) for several bonds along the molecule . because rdcs are long - time weighted averages over all conformational states of the molecule , they potentially provide means of extracting both the best - fit conformers and their relative populations . the structures that were selected by this rdc - filtering process , along with the best - fit populations , were subsequently used to simulate the solution relaxation times . we incorporated the local base motions obtained by fitting the ssnmr data into the rdc - selected structures and calculated the solution relaxation times using previously published methods . when a small amount of variation for the local amplitudes and rates of motion , and for the rates of conformational exchange between the selected structures , was allowed , the solution relaxation times for the 17 residues in the molecule could be calculated ( 7 in the lower helix , 3 in the bulge , and 7 in the upper helix ) with this method . the relative orientations of the upper and lower helices were quantified by considering the orientation of the normal vector of the u38 base relative to a frame defined by a z - axis aligned with the lower helical axis . the method of evaluating this relative orientation and the subsequent binning of structures within this scheme is as follows : ( a ) define the upper and lower helical axes for all structures using the program 3dna . the upper helical axis is taken to be the average local helical axis of the a27 - u38 : : g28 - c37 and g28 - c37 : : c29 - g36 dinucleotide steps , where the base pairs flanking the bulge were excluded due to possible distortions from ideal a - form helical structure . the lower helical axis is calculated similarly as the average over the c19 - g43 : : a20 - u42 and a20 - u42 : : g21 - c41 dinucleotide steps . ( b ) define the lower helix coordinate frame ( lhf ) by choosing the lower helical axis ( calculated above ) as the z - axis and the perpendicular from the z - axis to the g43 c8 atom as the y - axis . this choice of the y - axis was made as the 500 structures did not differ in the orientations of the first few base pairs ( including c19 - g43 ) , so the y - axis would be the same across all structures . however , the specific choice of the g43 c8 atom for this purpose was arbitrary . ( c ) calculate the angles for each structure , defined as the angle between the projection of the upper helical axis onto the xy - plane of the lhf and the x - axis of the lhf . ( d ) calculate the angles , defined as the angle between the upper helical axis and lower helical axis . ( e ) the angle is then defined by the orientation of the normal of u38 base ( the vector perpendicular to the c4c2 and c6c2 bonds ) about the upper helical axis . extracting this information from the structuresrequires first removing the and dependence by rotating the original u38 base - normal vector vu38norm about the fixed lhf axes as follows : vu38norm = rylhf ( ) rzlhf ( ) vu38norm . the resultant vectors are distributed around the lhf z - axis as a function of their angles . the euler angles described above are related to the domain motions as shown in figure 1 . ( f ) bin the 500 structures as a function of the euler angle set { , , } . the bins were chosen in 10 increments for ( 0360 ) and ( 0180 ) angles , resulting in 36 and 18 bins , respectively . instead of binning the angle in terms of degree increments , we fixed the number of bins to 5 because of an observed correlation between the and angles , which results in a shift in the values of for every bin , as well as the restriction of the values to only a portion of the full phase space . thus , trying to bin all possible angles would have unnecessarily increased the computational time . define the upper and lower helical axes for all structures using the program 3dna . the upper helical axis is taken to be the average local helical axis of the a27 - u38 : : g28 - c37 and g28 - c37 : : c29 - g36 dinucleotide steps , where the base pairs flanking the bulge were excluded due to possible distortions from ideal a - form helical structure . the lower helical axis is calculated similarly as the average over the c19 - g43 : : a20 - u42 and a20 - u42 : : g21 - c41 dinucleotide steps . define the lower helix coordinate frame ( lhf ) by choosing the lower helical axis ( calculated above ) as the z - axis and the perpendicular from the z - axis to the g43 c8 atom as the y - axis . this choice of the y - axis was made as the 500 structures did not differ in the orientations of the first few base pairs ( including c19 - g43 ) , so the y - axis would be the same across all structures . however , the specific choice of the g43 c8 atom for this purpose was arbitrary . calculate the angles for each structure , defined as the angle between the projection of the upper helical axis onto the xy - plane of the lhf and the x - axis of the lhf . calculate the angles , defined as the angle between the upper helical axis and lower helical axis . the angle is then defined by the orientation of the normal of u38 base ( the vector perpendicular to the c4c2 and c6c2 bonds ) about the upper helical axis . extracting this information from the structuresrequires first removing the and dependence by rotating the original u38 base - normal vector vu38norm about the fixed lhf axes as follows : vu38norm = rylhf ( ) rzlhf ( ) vu38norm . the resultant vectors are distributed around the lhf z - axis as a function of their angles . the euler angles described above are related to the domain motions as shown in figure 1 . bin the 500 structures as a function of the euler angle set { , , } . the bins were chosen in 10 increments for ( 0360 ) and ( 0180 ) angles , resulting in 36 and 18 bins , respectively . instead of binning the angle in terms of degree increments , we fixed the number of bins to 5 because of an observed correlation between the and angles , which results in a shift in the values of for every bin , as well as the restriction of the values to only a portion of the full phase space . thus , trying to bin all possible angles would have unnecessarily increased the computational time . to select a subset of structures for multisite jump simulations from a starting set of 500 energy - minimized structures generated by farfarwe only consider the data from a peg / hexanol mixture because this uncharged medium aligns the charged rna only through steric hindrance of the overall rotation . this situation does not require a detailed characterization of the rna charge density , as would be required for the simulation of rdcs measured in charged alignment media . extension to charged media data may be considered in the future . the purely steric version of pales was used to calculate the eigenvalues and eigenvectors of the saupe alignment tensor of the molecule by sampling multiple allowed orientations in the presence of a flat ( infinitely large ) obstruction . the alignment tensor eigenvalues are then used in conjunction with directional information for a particular bond relative to the alignment tensor principal axis frame ( pas ) . for the purposes of simulating the experimental rdcs , the only motions to be considered are then the exchanges between distinct conformers . to include dynamic sampling of multiple conformations , we use the weighted average of the rdcs of each conformer rdcistotal = i = 1nconformerspirdcisi for the rdc of a bond between spins i and s , with the population of each conformer i being represented by pi . the residues considered for this study were c19 , a20 , g21 , a22 , u40 , c41 , u42 , and g43 from the lower helical stem , u23 , c24 , and u25 from the bulge , and g26 , a27 , g28 , c29 , g36 , c37 , u38 , and c39 from the upper helical stem . the bond types included the c6h6 bond ( pyrimidines ) , the c8h8 bond ( purines ) , and the c5c6 bond ( pyrimidines ) from the bases , the c1n1 ( pyrimidines ) and the c1n9 ( purines ) glycosidic bonds , the c1h1 and c4h4 bonds from the furanose rings , and the c5h5 and c5h5 bonds from the backbone . furthermore , the rdcs for the bulge residues were considered separately , and not in the same simulations as the helical residues . this is because the bulge is likely to be significantly more mobile than the helices and will sample a significantly larger number of configurations , requiring a different set of simulation conditions . effective bond lengths of the species in question are required in the final pales calculation . the values we chose for the bond lengths are the aliphatic c h bond length , rch , aliph = 1.1 , the aromatic c h bond length , rch , arom = 1.09 ( average of ying et al . and allen et al . ) , the aromatic c c bond length , rcc , arom = 1.4 , the glycosidic c n bond length for the cytosines , rcn , glyccyt = 1.47 , and the glycosidic c n bond lengths for the remaining base types , rcn , glycrest = 1.48 . to gain a geometric perspective on the best - fit structures from the rdc comparison , we binned the simulated couplings for each structure according to the { , , } angles determined for the 500 structures . the rdcs within each bin were then uniformly averaged to produce a single bin - rdc for each bond type and residue , rather than retaining the values for individual structures . this was done because , although the structures within each bin have similar helical conformations , they may differ in the orientations of bonds of certain residues relative to the large - scale conformations . by averaging over these variations in the bonds , we effectively included in the simulations the small amplitude thermal fluctuations of the atomic bond orientations . to select the best - fit set of structures , we started with an arbitrary initial set of n structures and allowed the choice of the ( n + 1 ) th angular bin to float while attempting to optimize the total as well as the pearson s correlation coefficient between the simulated and experimental rdcs . in addition , we varied the relative weights of the ( n + 1 ) bins . once the best - fit parameters were obtained for this first iteration , the ( n + 1 ) th bin so obtained replaced the lowest probability structure from the remaining n , and the search was repeated for a second iteration and beyond . to make the final choice of n , we started with n = 2 and after minimizing the for a choice of two structures , we added a third and repeated the process . proceeding thus , we found that n = 5 structures ( i.e. , 5 bins which also happened to have only one structure in each of them ) were sufficient to produce the best - fit to the rdc data , with no improvement after the fifth iteration . in addition , as a separate , independent check of the results of the previous procedure and to allow for the variation of the number of bins more easily , we generated a markov - chain monte carlo ( mcmc ) simulation to search through the bins and populations for a best - fit to the rdcs , with the potential for varying the number of bins . the number of parameters for an n - conformer search was 2n 1 ( n bin choices + n 1 probabilities to be floated ) . the markov - chain monte carlo method did not yield better results than the iterative technique . to determine the number of exchanging conformers required to describe the dynamics in tar rna , and to corroborate the results of our rdc filter , we performed a principal component analysis ( pca ) , following procedures applied to molecular ensembles of proteins , and rnas . the covariance matrix ij = ( qi qi ) ( qj qj ) was calculated as described by mu et al . , i.e. , by proposing the following variable set { q2j } : 1where j is the jth torsion angle of interest , and ntorsion is the number of torsion angles used in the analysis . the use of the cosine and sine functions removes complications associated with the periodicity of the torsion angles by helping to uniquely identify particular values of the angles . the covariance matrix of these variables is calculated with averages over the full ensemble of structures and is subsequently diagonalized . the eigenvalues ( and associated eigenvectors ) are arranged in descending order , with the highest values representing modes with the largest contributions to the structural scatter . in our results , we have found that 2 or 3 modes contain a majority ( 70 % ) of the total variance in the data . in addition , histograms of the projections of the ensembles for each eigenvalue are examined for gaussianity . as discussed in the above references , a mode whose histogram consists of a single gaussian - like peak only represents continuous fluctuations about a central structure , whereas multimodal distributions describe discrete conformations separated by free - energy barriers . thus , from the perspective of assessing the conformational transitions of the molecule , only modes with multimodal distributions are considered relevant . our results for pcas with different choices of torsion angle sets ( as described in the following ) indicate that the first 2 or 3 modes were non - unimodal in distribution and therefore of primary significance in describing conformational exchanges . the first set included all torsional suites along the bulge and hinge region ( pca method 1 ) . the sugar - to - sugar suite as defined in the above reference consists of the set of 6 backbone torsion angles { , , , , , } as well as the glycosidic torsion angle . in our study , we focused attention only on the 6 backbone torsion angles . the residues included were a22 , u23 , c24 , u25 , g26 , c39 , and u40 . these were meant to encompass the conformationally relevant part of the molecule under the assumption of relatively rigid helices . the number of torsion angles considered was therefore 42 ( 7 bases 6 torsion angles ) resulting in an 84 dimensional pca ( because the cosine and sine functions of the angles are treated as separate variables ) . however , the pca of this set resulted in several modes which contributed substantially , with no clear clusters in any of the largest modes . the inclusion of the single - stranded bulge region may have caused the lack of structure in the pca projections calculated in this first method , because single - stranded regions are significantly more flexible and may add a level of disorder to the torsional distribution . to isolate the interhelical motions , we evaluated the pca of only those torsional suites that extend from u38 to c39 and from c39 to u40 ( pca method 2 ) . these suites include only the hinge region of the molecule , and resulted in a 24 - dimensional pca . to check the robustness of the clustering results obtained from method 2 , we then carried out a series of pcas by successively including an additional sugar - to - sugar backbone suite : u38 through c41 ( pca method 3 ) , u38 through u42 ( pca method 4 ) , c37 through u42 ( pca method 5 ) , and c37 through u40 ( pca method 6 ) . the results of these analyses and the relation to the results from the rdc fit will be discussed in the results below . the evaluation of the solution relaxation times is based on two previously explored techniques . both methods involve the calculation of the two - time correlation function for the orientation of an atomic bond located within a nonrigid brownian rotator relative to a fixed laboratory frame . the evaluation proceeds by introducing an intervening reference frame associated with the principal axis system ( pas ) for the rotational diffusion tensor , which is time dependent as a result of exchange between different structural conformers . the correlation function then becomes dependent on wigner rotation matrices whose arguments are the euler angles that orient the rotational diffusion tensor of the molecule relative to the laboratory frame . in turn , the fokkerplanck equation in three - dimensions allows the evaluation of the transition probabilities from one set of euler angle orientations to another . planck equation , which accounts for coupling between rotational diffusion and conformational changes , is2where p ( , , t | 0 , ) is the probability that the molecule will transition from a diffusion tensor - to - laboratory frame orientation of 0 at time 0 and in a conformational state to an orientation of and a conformational state at time t , given diffusion tensor elements of dij in the conformational state and an exchange rate of r between conformational states and . this equation can also formally cover the case of continuous transitions to new conformational states by allowing the number of conformers to be infinite . however , in all cases considered in the original references , and here as well , only discrete jumps will be considered . if the exchange rate is much slower than the rate of diffusion and all other time scales of exchange processes , yet faster than the relaxation rates themselves , the rotational diffusion problem is effectively decoupled from conformational exchange . under these conditions , the se model applies , and it is possible to calculate the relaxation rates for the molecule as the weighted - average over the relaxation rates for the individual conformational states of the molecule : 3 expressions for the noes can also be derived by appropriate weighting of the noes of individual conformational states . the procedure to calculate the relaxation times for each conformer are provided in the original reference . solution of eq 2 for the case of a general exchange rate ( i.e. , the gr model ) between conformers involves considerably more analytical and computational processing . we have solved this problem for the case in which the eigenvectors of the diffusion tensors of the exchanging conformers are coincident at the moment of exchange ( see ryabov et al . for general case ) and correlation functions have been published . this general rate analysis also indicates that the slow exchange regime occurs at time scales longer than about 1 s . for the carbons considered in this analysis , the rotating frame z - relaxation time t1 was measured instead of t2 . under the application of a weak spin - lock field and the assumption of lorentzian spectral densitiestherefore , for the purposes of this paper we operate under this assumption and simulate the t2 relaxation times . the structure set and the corresponding populations preselected by the rdc filter are the basis for simulations of the relaxation times using eq 2 . eigenvalues and eigenvectors of the rotational diffusion tensor are first calculated using the public - domain program hydronmr . then orientations of the atomic bonds of the residues of interest are calculated with respect to this axis system , i.e. , the principal axis system of the rotational diffusion tensor . the orientational parameters , together with the diffusion tensor eigenvalues are input into the two algorithms we have derived for simulations of the relaxation times of nonrigidly rotating macromolecules : ( a ) the slow - exchange formalism , describing the case where the conformational jumps occur at a rate much slower than the rate of overall rotational diffusion of the molecule , and ( b ) the general rate formalism , where arbitrary rates of exchange are allowed . the slow - exchange formalism , though merely a limiting case of the general rate theory , has the advantage of being significantly faster and easier to implement and so is considered here . the residues considered were a20 , g21 , a22 , u40 , c41 , u42 , and g43 from the lower helical stem , u23 , c24 , and u25 from the bulge , and g26 , a27 , g28 , c29 , g36 , u38 , and c39 from the upper helical stem . in the current work , we have only simulated the motions of the bases of these residues : the c6h6 bonds for the pyrimidines and the c8h8 bonds for the purines . the parameters used in the simulation include the atomic element radius ( aer ) , the radius of the beads used in the hydronmr calculation of the diffusion tensor , and the bond lengths . the aer was chosen to be 2.3 and the bond lengths for the carbonhydrogen bonds for the aromatic bases were chosen to be 1.1 , both choices having been justified in previously published work . the viscosity was chosen to be 1.096 cp to correspond to the conditions of the solution experiments ( 99.9 % d2o at 25 c ) . we have also incorporated the two - site base motions inspired by simulations of the solid - state nmr ( ssnmr ) data : the so - called base libration occurs around a vector normal to the plane of the base in the case of helical residues , whereas the two - site motion is modeled to be around the glycosidic bond for the bulge residues . we floated the values of the rates and amplitudes of these two - site jumps relative to the ssnmr models , which were found to be on a time scale much shorter than that of the conformational exchange . for the slow exchange simulations , these internal , local motional rates and amplitudes were the only free parameters , whereas in the general rate simulations we floated the conformational exchange rates between the states . the fitting procedures were carried out in a combination of grid - searches and mcmc techniques . five structures provided the best values to fit the rdc data , as obtained by iteratively searching through the bins and updating the choices of bins and relative populations . they are shown in figure 4 , and key characteristics are summarized in table 1 . for simplicity , the structures will be referred to by their respective bend angles . thus , the highest population structure will be called the 45 structure , the second highest populate structure as thefive structures obtained by the rdc - filtering procedure to represent the ensemble of tar conformation that describes the experimental data , together with their interhelical euler angles and population percentages . the for the best - fit set of structures was 11460 for a set of 48 rdcs , with 9 degrees of freedom ( 5 bin choices and 4 probabilities ) , for a reduced r2 = 302 ( = 11460 / ( 4891 ) ) , whereas the pearson s correlation coefficient was 0.72 . it is to be noted that the represent unweighted values ; i.e. , the discrepancies between the experimental and simulation rdc values are not inversely weighted with the error bars of the rdc values ( which have not been calculated ) . this assumption is equivalent to assuming that the error on all measurements is 1 hz , which is likely to be a considerable underestimation of the true error bars . the comparison between experiment and simulation is shown in figure 5 . in the figure , we further attempted an mcmc fit procedure with the possibility of 6 , 7 , or 8 structures but were unable to improve upon the fit . it is possible that this fit may be improved by the continuation of the mcmc procedure to a greater numbers of iterations , but the pca analysis reported in the following section provides further corroboration that the model found by rdc fitting represents the conformational landscape of the molecule well . comparison of the experimental rdcs ( red triangles ) with the rdcs generated by the best - fit simulation parameters ( blue circles ) for the helical residues in hiv - 1 tar rna . the values shown include those for backbone ( c5c5 , c5h5 ) , furanose ( c1h1 , c4h4 ) , glycosidic ( c1n1 for pyrimidines , c1n9 for purines ) , and base ( c5c6 and c6h6 for pyrimidines , c8h8 for purines ) bonds . plotting the calculated rdcs against the experimental values ( figure 6 ) , we found that the trend , on average , is toward an underestimation of the rdcs by the simulations . the dashed blue line in figure 6 is the best - fit line to the data and has a slope of 0.4 and a y - intercept of 3.9 . an underestimation of the rdcs may arise from using a smaller degree of alignment in the simulations than in the actual experimental situation . one possible source of this discrepancy may be the current assumption of a simple steric model for the alignment of the molecule by peg / hexanol . recent work has proposed that there are subtleties in the alignment process , including the possible contributions of complex alignment medium topology and electrostatic alignment , that are not incorporated in simulations using only the basic steric version of the pales algorithm . plot of calculated rdc values vs experimental rdc values for the best - fit set of structures and populations . the dashed blue line is a linear fit to the data , and the solid red line is the ideal case where the calculated and experimental values match perfectly . this result is a cautionary statement in the application of simple steric models in the simulation of potentially complex alignment media . we attempted to fit rdc data collected in glucopone / hexanol mixtures and in pf1 filamentous bacteriophage media and found that the models selected were different ( two or three of the structures chosen were the same compared to the peg / hexanol model ) . one obvious reason for this was the availability of rdc data for different bonds in the different media . however , there is potentially a fundamental difference in the alignment properties of the media as well . for example , the pf1 phage medium is negatively charged and , thus , as may be the case with peg / hexanol as well , the alignment has an electrostatic component . this must be taken into account more carefully in future analyses . to further discern the causes of the discrepancy in the fit , we looked at all helical rdc values that contributed to a deviation of magnitude 10 or greater and found a set of 18 rdcs : 8 correspond to c1h1 furanose ring bonds , 2 to c4h4 furanose ring bonds , and the remaining 6 to c6h6 / c8h8 base bonds , occurring in 12 helical residues in both the upper and lower stems as well as among all four nucleotide types . the large deviations observed for furanose ring bonds indicate the existence of additional motions localized to the furanose rings , as has been reported for dna , that have not been accounted for using the current set of 500 structures . these motions involve an exchange between the c2 - endo and c3 - endo conformations , and on the time scale of the rdcs these motions may be averaged out to produce an intermediate conformation . it is likely that the furanose ring samples these conformations even for the residues stacked in a helical configuration . a similar argument holds for those base bonds that show a large discrepancy in rdc values : there may be additional vibrations in the base orientations that are not adequately sampled by the 500 structures . we also compared the five structures selected above to the set of 20 lowest energy tar rna structures recently generated on the basis of noe data that have not been constrained by rdc data . upon calculating helical axes and orientations in the same manner as for the 500 farfar structures in this manuscript , we find that 11 out of 20 of the structures , including 3 out of the 5 structures that best fit the noe data , occur within the same 10 bend angle bin as the highest population structure from the rdc fit described above . thus , we believe that our approach identifies a predominant conformation set . to test the robustness of the search algorithm , we performed two simulations of fitting a reduced data set upon the random removal of ( a ) 10 rdcs and ( b ) 15 rdcs ( different rdcs were deleted in each of these two cases ) . removingthe first set of 10 resulted in the selection of the same 5 conformers as from the full set , along with a sixth new structure with a population of 4 % . the populations of the 5 full - set best - fit structures were slightly different ( maximum change of 12 % ) . removal of 15 rdcs reproduced 4 out of the 5 full - set best - fit structures , and two new conformers with populations of 7 % and 5 % . the maximum change in population among the 4 best - fit structures was 7 % in this case . these results indicate that the choice of structures is robust to a reduction in the size of the experimental data set . jumps between the five conformers shown in figure 4 require a combination of bending and twisting about either the lower or the upper helices . among the entire set of energy - minimized structures , there was an observed correlation between the and angles , as has been reported previously . these correlations may be reflected even in the jumps among this set of five structures , representing a free energy landscape where the exchanges between minima involve coupled shifts in euler angle values . we carried out a series of pcas to ( a ) identify the choice of torsion angles that best captures interhelical motions , ( b ) corroborate the rdc - filtered set by overlaying the five chosen structures on the clusters obtained from the pca of choice , and ( c ) identify jump matrix elements for the exchanges between the five rdc - filtered structures in the dynamics calculation . given the lack of clear clustering results from pca method 1 , which incorporates all backbone torsion angles in the bulge and hinge , we examined whether torsion angles on one side of the helical joint would suffice to describe the interhelical reorientation ( pca method 2 , incorporating the backbone torsion angle suites between u38 and u40 ) . when this was done , only the first two principal components ( pcs ) contributed significantly , accounting for 75 % of the fluctuations in the molecule ( figure 7 ) . furthermore , these two pcs were the only ones with a multimodal probability distribution across the 500 structures . this non - single - gaussian distribution signals the presence of conformational clusters in energy minima separated by significant free energy barriers . the map of these two pcs is shown in figure 7a and shows the presence of three to four major conformational clusters . the large red dots superimposed on the 2d plot correspond to the five structures selected from the rdc filtering procedure . parts b and c of figure 7 show the population distribution histograms for pc 1 and pc 2 , respectively . again , the positions of the five structures from the rdc filter are indicated by red arrows . principal component analysis of the torsion angle suites along the hinge ( residues u38 through u40 ) . ( a ) principal components 1 and 2 for the 500 structures , represented by blue dots , with the positions of the five best - fit structures marked explicitly by red dots , and further encircled for clarity . ( b ) histogram of the first principal component ( corresponding to the largest eigenvalue of the covariance matrix ) , with the positions of the five best - fit structures marked explicitly by red arrows . ( c ) histogram of the second principal component ( corresponding to the next - to - largest eigenvalue of the covariance matrix ) , with the positions of the five best - fit structures marked explicitly by red arrows . first , the five structures chosen as the best - fit set match up well with the main conformational clusters obtained from this pca , suggesting that our rdc - filtered set has captured the relevant information about the major conformational clusters of the molecule . second , structures with similar interhelical bend angles have similar values of each of the principal components . the principal component values of the two structures with bend angles of 115 and 132 occur in close proximity to each other . the same is true of the pair of structures with bend angles of 61 and 76 ( it is true , however , that the 45 structure does not differ significantly from the 61 structure ; the pca suggests that there is a free energy barrier that separates even these two neighboring structures ) . this is important because other pca methods ( described below ) separate structures with similar interhelical orientations , possibly due to the presence of additional degrees of freedom that do not contribute significantly to interhelical reorientation . finally , the sums of the probabilities of the best - fit structures within each cluster are similar to each other : the 45 bend structure has a population of 29 % , the 61 and 76 structures have a joint population of 40 % , and the 115 and 132 structures have a joint population of 31 % . because the histogram heights do not correlate well with the nearly uniform probability distribution , we fit the jump rates numerically , as described below . subsequent attempts at testing the robustness of our cluster analysis yielded further interesting results . pca method 3 ( u38 through c41 ) showed a marked difference in clustering of the structures . three pcs contributed significantly , yielding about 70 % of the total fluctuations , with all three now being multimodal . however , the five structures do not all seem to fall within major clusters . moreover , the 61 and 76 structures no longer fall within the same cluster , nor do the structures with bend angles of 115 and 132 . this occurs because of the intervention of the torsion angles associated with u40 . when the helical parameters of the 500 structures were searched , about 37 % of the structures u40 did not form a canonical watsoncrick pairing with a22 , indicating considerable conformational variability of this residue , at least within the physical picture generated by the energy - minimization ensemble . to test this hypothesis , we extended the pca up to u42 ( pca method 4 ) on the lower stem and up to c37 on the upper stem ( pca method 5 ) . both these methods gave very similar clustering to method 3 , with three significant pcs . we interpret this observation as confirmation that , after the inclusion of u40 , the remaining residues behave fairly rigidly and do not change the results of the pca . as a final confirmation of this conclusion , we carried out a pca including only torsion angles from c37 to u40 ( pca method 6 ) . the clustering results for this pca proved to be the same as for pca method 2 . given the change in clustering associated with the inclusion of the u40 degrees of freedom , we utilized the results of pca method 2 to set up the rate matrix for the relaxation time simulations . in general , for n conformers , the number of combinations of pairwise rate constants that need to be fit is c2 . given the clustering suggested by the pca , we reduce the fit problem from 10 ( = c2 for the five rdc filter structures ) to five parameters in the following manner . for pairs of structures that occur within the same cluster in the two pc distributions , we allow for only one distinct exchange rate between both members of the pair in that cluster and any structure in another cluster . thus , the rates used in the fitting process were for the following exchanges : these exchange processes are shown graphically in figure 8 . the assumption in this parameter reduction is that all the structures within a cluster are separated from other clusters by similar free energy barriers . exchange between clusters inferred from the pca , together with the five rates used in the jump matrix for the relaxation time simulations . the rdc - filtered conformer set of five structures , together with the relative probabilities , were used to calculate the t1 , t2 and noe values . we used two different approaches to calculate the c6h6 ( pyrimidine ) and c8h8 ( purine ) relaxation times : ( a ) the slow exchange method , where the assumption is that the exchanges occur at an infinitely slow rate ( compared to the rotational correlation time ) , and ( b ) the general rate method , where we fit the relaxation times by allowing the exchange rates to vary arbitrarily . the general rate analysis has shown that the slow exchange regime in tar rna effectively occurs for time scales longer than about 1 s . thus , the results of this subsection assume conformational exchanges occur on a scale longer than 1 s . as a starting point for the fitting process , we use rates and jump amplitudes for the base librations close to those obtained to fit the solid - state nmr data of the uridines , and changed both the rates and amplitudes in small increments to improve on the . using the fit to the t1 values as a benchmark , we found that it suffices to fit only two base - libration rates , one for the upper helix residues and one for the lower helix residues . this simulation model was inspired by the results of the two solid - state nmr analyses . the exceptions , however , are the parameters for u40 and u42 in the lower helix . we obtain a significantly better fit by using the rates and jump amplitudes for the upper helix for these two residues , indicating that these residues are more similar in local base motion to the upper helix . windows in the plot for the local motion parameters , with the upper and lower helical parameters behaving independently . the rates in these windows vary between 10 s and 10 s , whereas the amplitudes are less than 20 . we did attempt simulations of additional models of base - libration such as a treatment of the rates of purines and pyrimidines independently , and the assumption of a constant rate across the entire molecule . there is always the possibility that more complex models of base libration rates may fit the data better ; for example , we may treat the libration rate of each individual residue as an independent parameter , or choose the purines and pyrimidines in the lower helix as independent from the purines and pyrimidines , respectively . however , this would increase the number of free parameters in the problem , and we chose the above model as a balance between an arbitrary increase in free parameters and an attempt at a physically realistic representation . the following representative values of the local motion parameters simulate the relaxation times well : ( a ) upper helix , u40 and u42 base - libration rate = 4.610 s ( b ) upper helix , u40 and u42 base - libration jump amplitude = 13.7 ( c ) lower helix ( without u40 and u42 ) base - libration rate = 6.610 s ( d ) lower helix ( without u40 and u42 ) base - libration jump amplitude = 9.8 upper helix , u40 and u42 base - libration rate = 4.610 s upper helix , u40 and u42 base - libration jump amplitude = 13.7 lower helix ( without u40 and u42 ) base - libration rate = 6.610 s lower helix ( without u40 and u42 ) base - libration jump amplitude = 9.8 the match between the experimental and simulation relaxation t1 and t2 values is shown in figure 9 . for quantitative comparison , we calculated the root - mean - square deviation ( rmsd ) across the 14 helical t1 values to obtain an rmsd of 5.3 ms . relaxation time simulations for the c6h6 ( pyrimidine ) and c8h8 ( purine ) bonds using the slow exchange method , and comparisons of residuals ( discrepancies relative to experimental values ) to statistical error bars : ( a ) t1 simulations ( blue circles ) compared to the experimental t1 values ( red triangles ) ; ( b ) t2 simulations ( blue circles ) compared to the experimental t2 values ( red triangles ) ; ( c ) difference between simulation t1 and experimental t1 values , together with the statistical error bars on experimental data ( red dashed lines ) at 3.2 ms ; and ( c ) difference between simulation t2 and experimental t2 values , together with the statistical error bars on experimental data ( red dashed lines ) at 0.5 ms . the error bars shown in figure 9 describe the statistical error in the measurements . however , the potential systematic error , not quantified by the authors , is larger . yet , even at this level of uncertainty there is a consistent difference between the best - fit local jump amplitudes for the upper and lower helices , with the lower helix amplitudes being larger on average ( this is not reflected in the parameter set shown above but is true for the best - fit windows in general ) . thus , the solution relaxation times can be fit to an rmsd close to the statistical error in the experiments by assuming a slow exchange rate ( i.e. , slower than 10 s ) between the five structural configurations of tar rna shown in figure 4 with populations determined by rdc filtering and further corroborated by principal component analysis . the model assumed base - libration rates that range between 10 and 10 s , and libration - rate - dependent jump amplitudes less than about 20 . the solid - state nmr parameters for the local base - libration parameters fall within the windows described above , consistent with the notion that solid - state experiments are able to capture the solution - state local motions accurately . although the slow exchange method provides an approximate scale for exchange processes , the general rate method could further resolve the values of the exchange rates between conformers . for ease of comparison , we used the local base motion rates and jump amplitudes from the slow - exchange fit , whose results were shown in figure 9 . although several combinations of 5 pca - inspired rates were found that could be fit to the 14 helical t1 and 14 helicalt2 values with comparable rmsd s , in all cases the inter - and intracluster exchange rates were on the order of 1010 s , which confirms the validity of the slow exchange approximation . for example , the set of inter - and intracluster exchange rates in table 2 yield the base relaxation times shown in figure 10 with an rmsd for t1 values of 5.2 ms and an rmsd for t2 values of 1.4 ms . interestingly , there is no clear distinction between the intercluster and intracluster rates , as may be expected from a significant difference in the free energy barriers . relaxation time simulations for the c6h6 ( pyrimidine ) and c8h8 ( purine ) bonds using the general rate method with inter - and intracluster exchange rates from table 2 , and using the same local base motion parameters as for figure 9 : ( a ) t1 simulations ( blue circles ) compared to the experimental t1 values ( red triangles ) ; ( b ) t2 simulations ( blue circles ) compared to the experimental t2 values ( red triangles ) ; ( c ) difference between simulation t1 and experimental t1 values , together with the statistical error bars on experimental data ( red dashed lines ) at 3.2 ms ; ( c ) difference between simulated and experimental t2 values , together with the statistical error bars on experimental data ( red dashed lines ) at 0.5 ms . to summarize , if we fix the local motion parameters to the best - fit set obtained using the slow - exchange method but float the conformational exchange rate parameters , we obtain a slight improvement in the quality of the fit . best fits to experimental relaxations using general rate theory are achieved with inter - and intracluster exchange rates on the order of 1010 s , thus justifying the slow exchange approximation of the prior section . we did not float both local motion parameters and conformational exchange parameters simultaneously , but it is reasonable to assume that the results will be similar , especially when we constrain the scale of the local base motion parameters to those observed under solid - state conditions . in addition to helical residues , we also simulated the relaxation times for the bulge residues using the slow exchange and general rate algorithms . in table 3 , we present relaxation time simulations assuming exchange between the conformations shown in figure 4 using the slow exchange and general rate algorithms . the base rotation rate is selected as 510 s and the amplitude as 15 ( to yield good matches to the t1 values ) . for the general rate simulations , inter - and intracluster exchange rates shown in table 2 were assumed . we obtain simulated t1 values that are within 2 % of experimental data , but simulated and experimental t2 values for u23 deviate by about 16 % ; for c24 , the relative deviation is even greater . this is likely due to the fact that the t2 relaxation time has a spectral density component ( the j ( 0 ) term ) that makes this observable sensitive to motions much slower than the larmor frequencies of carbon - 13 and protons ( which are on the order of nanoseconds ) . the fact that we have been unable to capture the t2 values may indicate that there are additional slower motions of these relatively underconstrained residues that are missing from the conformer set we have selected . although we have been able to successfully match most of the solution relaxation times to almost within the statistical error bars using the rdc - filtered conformer set , we must address the basic question , are the relaxation times sensitive to motions occurring at rates on the order of microseconds or slower ? though the t1 time has no spectral density dependence slower than a time scale of a nanosecond , the t2 are determined by slower motions as well and their expressions contain a dependence on the j ( 0 ) spectral density . more importantly , the slow exchange and general rate methods depend on the fact that the time scales of rotational diffusion of many molecules ( including the tar rna considered here ) overlap with the time scales to which both t1 and t2 are sensitive . thus , two different conformers , with slightly different diffusion tensors will have different characteristic relaxation times when calculated separately . even the slow exchange averaging process will result in a unique linear combination of relaxation rates that becomes discernible when enough data points are compared . the general rate theory loses some sensitivity to dynamics for rates much slower than a microsecond , but our least - squares simulations for relaxation times have shown that there is still discernible information to be gained at these time scales . in this manuscript , we introduce a methodology based on energy - minimized structures that ties together structural and dynamic data , as well as solid - state and solution nmr , to build a dynamic trajectory for the hiv - 1 tar rna to atomic - level detail . the protocol uses ( a ) solid - state nmr data to acquire information about local motions of the bases , ( b ) solution nmr rdc data to identify conformational states and their relative populations , ( c ) pca analyses to identify degrees of freedom relevant to the overall reconfiguration of the molecule , as well as to corroborate the clustering of structures and choose parameters for the dynamics analysis , and ( d ) solution nmr relaxation time simulation techniques previously developed to simulate experimental data and fit the jump rates between the molecular conformers . the experimental data utilized covers a wide spectrum of motional time scales , from the picosecond scale for solution relaxation times and micro - to nanosecond times derived from solid - state nmr line shapes to the submillisecond time scale investigated with rdcs . the method reproduces relaxation data at multiple helical residues within the molecule using only five structures out of a set of just 500 possible conformers . the advantage of this approach lies in the coverage of multiple time scales , including long time scales that are difficult to sample with md , and the ease with which energy - minimized conformers may be obtained for small - to - midsized molecules using public - access software like the rosetta suite of programs . the use of these structures inverts the problem of dynamics relative to md methods : instead of starting with an initial structure and running the clock forward from t = 0 , we filter out long - lived structures using experimental data and interconnect them in a stochastic trajectory . thus , the results from such a technique would prove valuable to corroborate md - based simulations , and the protocol could provide a less computationally intensive alternative to extended molecular dynamic simulations . we have been able to simulate relaxation times of most of the helical residues in the molecule with limited conformational sampling from an already small set of structures . the success in matching the experimental data indicates that , to gain an understanding of the gross motional properties of rna , it is sufficient to sample the limited phase space of the particular structural motifs that constitute the molecule . this protocol was designed to derive a geometric picture of interhelical reorientation based on the limited conformational space available to the torsion angles in and around the bulge and hinge regions . the assumption that the helices are rigid and the requirement to close the loop formed by the single stranded bulge , adjacent helical base - pairs and the hinge backbone should restrict conformational possibilities for the entire molecule . steric hindrances and limitations on the stretchability of the single - stranded region would further impose constraints on molecular reorientation . in practice , we found that parameter space for the reorientation of one helix relative to the other was expanded by the possibility of one of the bulge adjacent base pairs opening up . among the energy - minimized structures , a significant number had a missing a22 - u40 base pairthe u40 base often forms a stabilizing interaction with u25 instead and , among the full set of 500 structures , sometimes with u23 and c24 as well . we allowed these possibilities to occur in our sample set to reflect fluctuations in the residue orientations , as well as the impacts of these fluctuations on overall molecular conformation . thus , we believe that models generated using well - vetted potential energy functions can identify sites where new intramolecular bonding and conformational variability might occur . furthermore , we made a conscious choice to characterize the structural bins by their euler angles . this choice of parameters has been made previously to enhance reproducibility and comparability to other analyses of the molecule . such a parametrization represents the core ingredient of most molecular analyses : reduction of the dimensions of the problem to render it tractable . molecular studies often aim to distill out a few degrees of freedom that are implicated in determining either the structure or dynamics of the system , and many different techniques ( ramachandran plots , phenomenological models , pca analyses ) are directed toward identifying a minimal set of relevant coordinates . the methodology relies on the assumption that energy - minimized structures sufficiently populate the available conformational space , i.e. , on the assumption of ergodicity . if ergodic behavior holds , then a sufficiently representative characterization of the energy landscape of the phase space will allow a calculation of the requisite time averages of observables . in the case of the tar rna , the structural motif ( helix bulge helix ) is fairly simple , and it is possible to cover a large region of the interhelical orientation space with a relatively small number of structures . for more complex structural motifs , it would be necessary to generate a sample set that covers both the space of molecular reorientations and the range of conformations of local residues relative to a fixed large - scale molecular orientation . even in the current work , it is possible that we have under - sampled the full range of conformations available to the bulged loop . a richer sample of both interhelical orientations and orientations of bulge residues relative to particular interhelical orientations may improve the rdc fit . a second assumption is that the slow exchange ( se ) and general rate ( gr ) methods assume coincidence of the diffusion tensors at the moment of exchange . this is not a significant problem for conformers that are not significantly different , but it could pose problems for conformers that are widely separated in conformational space . we have not attempted to quantify the actual deviation in relaxation times on account of this assumption . finally , it bears mentioning that there is a 2-fold degeneracy in the choice of the unit eigenvectors of the rotational diffusion tensors , with the negative of a given choice of unit vector being acceptable as the eigenvector as well . the choice of eigenvectors does not change the results for the slow exchange formalism ( the expressions are invariant to such changes ) but does impact the general rate theory expressions . for example , keeping the z - axis the same , the two choices of a right - handed coordinate system vary by 180 and would artificially introduce such an extra jump into the calculations . the means of consistently dealing with such a jump is to track the diffusion tensors as a function of changes in the shape of the molecule , either visually or geometrically and ensure that there is no additional change in the diffusion tensor orientations due to axis inversions . in our particular case , we tested our calculations by artificially inverting the orientation of the diffusion tensors of some of the structures and found very small changes in the relaxation times as a result : a change of at most 0.25 ms in t1 and at most 0.02 ms in t2 . these changes would not significantly impact the conclusions of this manuscript and a detailed analysis is omitted here . we examined the five structures selected from the rdc - filter in light of unbound tar rna structures generated using noe constraints ( but not rdc constraints ) by one of the authors . these 20 energy - minimized structures , termed the tar2013 series , have angles in the range 3859 , but the five lowest energy structures cover a smaller range of 4553 . this range corresponds well to the bend angle of highest population structure we have obtained ( i.e. , = 45 ) . in fact , the lowest energy tar2013 structure has an value of 202 and a value of 225 , similar to thewe previously published two studies where the new methods developed to simulate relaxation times were applied to u38 relaxation data and used to select regions of interhelical motional parameter space that fit the data . the models consisted of two - site jumps between the lowest energy structure of 1anr and structures artificially modified from that structure to reflect changes in interhelical orientation . the closest approximation to a two - site jump in this manuscript is found by considering only exchanges between pairs of conformers within the three most populated structures ( the 45 structure , the 61 structure , and the 115 structure , which are almost equal in population ) . the exchange between the 45 and the 61 structures involves a bend angle modification of 16 , and a twist angle about the upper helix of 2 . cross - checking this parameter set against the results of applying the general rate theory , we find that the u38 data was fit by a two - site jump model with a twist of 0 and bend angle between 5 and 12 ( among other possible models ) . thus , the 45 and 61 structures fit the profiles of two structures selected previously on the basis of the u38 data alone . exchanges between either of these structures and the 115 structure , however , are of a magnitude not simulated in the previous studies . we can also make a few basic comparisons to the results of dayie et al . , even though the authors consider the hiv - 2 tar rna , as both molecules consist of a helix bulge helix motif . given our focus on the c6 and c8 atoms in the current work , we first observe a similarity in the fact that in the relaxation data used in this work ( from bardaro et al . ) the helical residues seem to have similar c ( c6 and c8 ) t1 relaxation times , a fact observed in the work of dayie et al . as wellhowever , the u23 c t1 is nearly half the value of the corresponding u25 time in dayie et al . , whereas bardaro et al . report values much closer in magnitude . also , the magnitudes of the t1 and t1 relaxation times in the two papers are different . we mention these facts to bring up three relevant considerations in interpreting the results of the two different sets of experiments : ( a ) the obvious difference made by the presence of only two residues in the bulge in hiv - 2 rna versus three in the hiv - 1 rna ; ( b ) the fact that the relaxation times of dayie et al . include a component from the c5c6 dipolar coupling for pyrimidines , whereas this coupling is explicitly suppressed in bardaro et al . ( see shajani and varani ) ; ( c ) the use of a model - free analysis in dayie et al . versus the se and gr methods used herein . notwithstanding these caveats , the common results we can extract are that both papers observe significant flexibility in the u23 and u25 residues and rigid , slow motions in the helices . to examine the extent to which our approach matches results obtained by the md approach , we compare our results to those of salmon et al . , where the authors describe the selection of conformers from 8.2 s md simulations of the tar rna using pf1 phage - aligned rdc data sets . it was reported that the best fit to rdc data is obtained with a set of 20 conformations selected from the full md ensemble . though it is not possible to compare the absolute values of the interhelical bend and twist angles due to differing methods of characterizing the helices and their relative orientations , we can compare the spans of the angles reported for their ensemble to those in ours . ensemble of 20 span 88 ( from 3 to 91 ) whereas those in our ensemble span 87 , the rotations of the upper helix about the lower helical axis span 191 in their ensemble whereas those in our set span 215 , and the rotations of the upper helix about its own symmetry axis span 224 in their ensemble and 210 in ours . thus the span of angles obtained by the two approaches are in excellent agreement . moreover , the full , prefilter ensembles in both papers show correlations between the and twist angles . a more fine - grained comparison relates to the behavior of individual residues . we have already mentioned that the a22 - u40 base pair is often found to be open among the full set of 500 structures . we also find that , among our five rdc - filtered structures , four ( the 45 , 76 , 115 , and 132 structures ) lack a a22 - u40 base pair . however , the g26 - c39 base pair is maintained in all five of these structures . find a similar asymmetry between the a22 - u40 base pair and the g26 - c39 base pairs in their rdc - selected ensemble , with the former adopting a broader conformational distribution and the latter being in an a - form helix - like conformation . report the occurrence of three clusters within their rdc - selected ensemble : a 66 % population cluster with a22 stacked on u23 , a 19 % population cluster with u23 flipped out , and a 15 % cluster with paired u25 - u40 and unpaired u23 and c24 . with regard to the third cluster , nearly 30 % of the 500 energy - minimized structures used in our analysis show a u25 - u40 pair , with three of the rdc - filtered structures ( the 45 , 76 , and 132 structures ) included in this list as well . the 115 structure simply lacks the a22 - u40 pair and does not have any alternative pairings of either residue . stated that the u25 - u40 pair is predicted to be the second most energetically favorable bulge conformation in mc - fold . a visual inspection of our structures shows the following behavior for the bulge : ( 1 ) the 45 structure has u23 flipped into the interhelical space but not stacked , c24 is flipped in but not stacked and u25 is paired with u40 . ( 2 ) the 61 structure has u23 stacked on a22 and has c24 and u25 flipped out . ( 3 ) the 76 structure has u23 flipped out , c24 stacked with u25 , and u25 paired with u40 . ( 4 ) the 115 structure has u23 flipped out , c24 flipped in and stacked close to u25 , and u25 flipped in and stacked only with c24 . ( 5 ) the 132 structure has u23 and c24 flipped in but not stacked and has u25 paired with u40 . the 45 structure has u23 flipped into the interhelical space but not stacked , c24 is flipped in but not stacked and u25 is paired with u40 . the 61 structure has u23 stacked on a22 and has c24 and u25 flipped out . the 76 structure has u23 flipped out , c24 stacked with u25 , and u25 paired with u40 . the 115 structure has u23 flipped out , c24 flipped in and stacked close to u25 , and u25 flipped in and stacked only with c24 . the 132 structure has u23 and c24 flipped in but not stacked and has u25 paired with u40 . thus , only one of the structures in our ensemble ( the 61 structure with a 27 % population ) has a significant a22 - u23 stacking interaction and two have u23 flipped out ( 39 % total population ) , a clear deviation from the results of salmon et al . , suggesting that the conformational variability of this region is more than can be captured by a small number of sampled structures . a solution to this problem is to generate energy - minimized structures where the interhelical orientation is fixed ( or nearly so ) and the bulge flexibility is evaluated under the constraint of fixed end points . such an analysis would establish the inherent conformational flexibility of the bulge . to cross - check the results of the program hydronmr , we recalculated the diffusion tensors using the program best , which tessellates the solvent - accessible surface of the molecule and calculates the various diffusion properties using a finite element analysis . the eigenvalues of the rotational diffusion tensors ( in ascending order ) of the two programs are compared in table 4 . we find that the diffusion tensor eigenvalues as found by best were uniformly smaller than those found by hydronmr , indicating that hydronmr underestimated the hydration effect relative to best . we subsequently calculated the relaxation times using the slow exchange formalism and found a t1 shift of at most 18 ms and a t2 shift of at most 1.2 ms , corresponding to a shift of about 4 % of the experimental values for both relaxation times . this may modify the choice of parameters described above , but we believe that the impact will not be substantial . we have carried out a characterization of the essential dynamics of the tar rna molecule using techniques with time scale sensitivities ranging from subnanosecond ( solid - state and solution relaxation times ) to millisecond ( rdcs ) . we have been able to capture the long - time scale behavior of the conformational exchange processes that characterize this molecule and fit experimental relaxation times very well , with exchanges between discrete conformers occurring at time scales longer than 1 s . the similarities of results of this method with those of extended md simulations provide independent corroboration of our conformational analysis . further computational explorations and sample - size increases will enhance the results obtained by this methodology .\noutput:\n" }, { "from": "agent", "value": "complex rna structures are constructed from helical segments connected by flexible loops that move spontaneously and in response to binding of small molecule ligands and proteins . understanding the conformational variability of rna requires the characterization of the coupled time evolution of interconnected flexible domains . to elucidate the collective molecular motions and explore the conformational landscape of the hiv - 1 tar rna , we describe a new methodology that utilizes energy - minimized structures generated by the program fragment assembly of rna with full - atom refinement ( farfar ) . we apply structural filters in the form of experimental residual dipolar couplings ( rdcs ) to select a subset of discrete energy - minimized conformers and carry out principal component analyses ( pca ) to corroborate the choice of the filtered subset . we use this subset of structures to calculate solution t1 and t1 relaxation times for 13c spins in multiple residues in different domains of the molecule using two simulation protocols that we previously published . we match the experimental t1 times to within 2 % and the t1 times to within less than 10 % for helical residues . these results introduce a protocol to construct viable dynamic trajectories for rna molecules that accord well with experimental nmr data and support the notion that the motions of the helical portions of this small rna can be described by a relatively small number of discrete conformations exchanging over time scales longer than 1 s ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acute promyelocytic leukemia ( apml ) is a subset of aml with characteristic clinical , morphological and genetic features . its incidence gradually increases , reaching a plateau during early adulthood , remaining constant until it diminishes after 60 years of age . the identification of specific chromosomal abnormality plays an important role in determining therapy and prognosis in certain subtypes of aml . data from the pediatric oncology group have shown that inv ( 16 ) / t ( 16 ; 16 ) , t ( 8 ; 21 ) , and normal karyotypes are associated with favorable prognostic outcome , whereas poorer outcome was observed in t ( 15 ; 17 ) ( without all - trans retinoic acid ( atra ) treatment ) , 11q23 , and other abnormalities . , several specific recurrent chromosome aberrations have been described in aml , both unbalanced and balanced rearrangements . balanced chromosome rearrangements are detected in approximately 2530 % of adults with de novo aml and have attracted a great deal of attention not only because their molecular dissection has led to identification of genes involved in leukemogenesis but also because specific translocations and inversions are associated with clinical features and treatment outcome of patients harboring them . in this article , we discuss the case study of a two - year - old child with unbalanced chromosome aberrations involving chromosome 17 with a cytogenetically normal chromosome 15 . patient had a history of fever , general weakness and bleeding from the gums . on examination , his general condition was poor , with cervical and axillary lymph nodes . on systemic examination , he had hepatomegaly 23 cm , and splenomegaly 12 cm . at presentation , hemogram was hb 69 g / l , total count of 5210 / l and platelets 2010 / l . differential count showed neoplastic promyelocytes 80 % , neutrophils 12 % , lymphocytes 12 % , bone marrow aspiration showed hyper cellular marrow with sheets of neoplastic promyelocytes ( 70 % ) . ( a ) peripheral smear : auer rods positive , ( b ) mpo positive cytogenetic study was carried out on cells from bone marrow aspiration . short - term culture of 24 and 48 h were set up using rpmi 1640 medium supplemented with 20 % fetal bovine serum . after 1618 h , 50 l of colcemid at a final concentration of 10 g / ml was added for 30 min followed by hypotonic treatment , fixation in carnoy 's fixative . fifteen metaphases were analyzed which consistently showed 46xy , -17 , + der ( 17 ) ( 17qter - cen - 17q21 : ) karyotype [ figure 2 ] . short - term culture of 24 and 48 h were set up using rpmi 1640 medium supplemented with 20 % fetal bovine serum . after 1618 h , 50 l of colcemid at a final concentration of 10 g / ml was added for 30 min followed by hypotonic treatment , fixation in carnoy 's fixative . fifteen metaphases were analyzed which consistently showed 46xy , -17 , + der ( 17 ) ( 17qter - cen - 17q21 : ) karyotype [ figure 2 ] . short - term culture of 24 and 48 h were set up using rpmi 1640 medium supplemented with 20 % fetal bovine serum . after 1618 h , 50 l of colcemid at a final concentration of 10 g / ml was added for 30 min followed by hypotonic treatment , fixation in carnoy 's fixative . fifteen metaphases were analyzed which consistently showed 46xy , -17 , + der ( 17 ) ( 17qter - cen - 17q21 : ) karyotype [ figure 2 ] . to our knowledge , this is a rare cytogenetic abnormality in a child , involving only chromosome 17 . the first report of aml - m3 with normal chromosome 15 with -17 , ins ( 17 ; ? ) ( q11q21 ; ? ) was by baranger et al . the present case demonstrated normal appearance of chromosome 15s , while one of the 17 homologues appeared to be an iso ( 17q ) , but upon detailed examination showed break on one of the arms at q21 band . the presence of 15q + and i ( 17q - ) is one of the most frequent abnormalities reported besides the standard translocation , but with an i ( 17q - ) and two normal chromosome 15 is extremely rare . routinely cytogenetics , fluorescence in situ hybridization ( fish ) , and polymerase chain reaction ( pcr ) analysis are employed for the diagnosis and precise localization of the fusion gene . but in our case , fish could not be performed and even before the cytogenetic results were available the patient died due to disseminated intravascular coagulation . hence , further molecular studies to establish the type of gene fusion transcript which could have had a prognostic value could not be ascertained . a small proportion of apml patients do not have t ( 15 ; 17 ) / pml - rara but do have other chromosomal aberrations and gene fusion , all these rearrangements and t ( 15 ; 17 ) are very strongly correlated with characteristic marrow morphology in which abnormal promyelocytes predominate ( fab - m3 ) . the present who classification recognizes two main morphological subtypes of apml that includes a more frequent hyper granular variant form featured by abnormal dysplastic promyelocytes with abundant cytoplasmic granules and auer rods ( faggots ) and a less frequent micro granular variant of apml characterized by leukemic blast , bilobed nuclei with dusty and minute cytoplasmic granules . the evolution of aml involves leukemogenic events that occur in the stem cell ( stem cell origin model ) and favors self renewal while disrupting normal hematopoietic cell lineage development .\noutput:\n" }, { "from": "agent", "value": "acute myeloid leukemia ( aml - m3 ) is associated with the translocation t ( 15 ; 17 ) ( q22 ; q12 - 21 ) which disrupts the retinoic acid receptor alpha ( rara ) gene on chromosome 17 and the pml gene on chromosome 15 . we report a two - year - old patient with aml - m3 without the usual translocation t ( 15 ; 17 ) . cytogenetic studies demonstrated normal appearance of chromosome 15 while the abnormal 17 homologue was apparently a derivative 17 , der ( 17 ) ( 17qter - cen - q21 : ) , the rearrangement distinctly shows deletion at 17q21 band and the morphology corresponding to an iso chromosome i ( 17q - ) . this case report is a rare cytogenetic presentation of acute promyelocytic leukemia ( apml ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: multidrug efflux pumps cause serious problems in cancer chemotherapy and in the treatment of bacterial infections . in bacteria , drug resistance is often associated with multidrug efflux pumps , which decrease cellular drug accumulation . in gram - negative bacteria , pumps belonging to the resistancedivision family are particularly effective in generating resistance , because they form a tripartite complex with the periplasmic proteins of the membrane fusion protein family and the outer membrane ( om ) channels , ensuring that drugs are pumped out directly to the external medium . high - level fluoroquinolone resistance in salmonella enterica serovar typhimurium phage type dt204 has been shown to be primarily due to multiple target gene mutations and active efflux by the acrab - tolc efflux system belonging to the resistances . enterica is a pathogen that causes a variety of diseases in humans ranging from gastroenteritis to bacteraemia and typhoid fever . previous studies have shown that s. enterica serovar typhimurium has 10 functional drug efflux pumps : acrab , acrd , acref , mdtabc , mdsab , emrab , mdfa , mdtk , macab and smva . among these , acrab is constitutively expressed and is the most effective in intrinsic drug resistance in salmonella . in addition to drug efflux pumps , om is also important for intrinsic antibiotic resistance . gram - negative bacteria , which have an om barrier , are usually much more resistant than gram - positive bacteria to a wide range of drugs . in particular , lipopolysaccharides ( lps ) , located exclusively in the outer leaflet of om , prevent the easy entry of lipophilic agents . the lps molecule comprises three parts : lipid a , core oligosaccharides and the o - antigen ( figure 1 ) . the core oligosaccharides and o - antigen are located in the outer domain of the lps molecule ( figure 1 ) . lps is only found in the om of gram - negative bacteria and many genes required for its synthesis and modification have been identified . lps is important for intrinsic antibiotic resistance and previous studies have shown that the acrb efflux pump is related to both the intrinsic and the acquired multidrug resistance of salmonella . in francisella sp . , another gram - negative bacterium , it has been reported that both the lps and the acrab efflux pump system play a role in azithromycin susceptibility . however , the synergistic interplay between acrb and lps of salmonella remains to be studied in detail . in the present report , we examined the interplay between the acrb efflux pump and lps by determining the drug susceptibilities of mutants with varying lps lengths and by investigating the effect of the acrb deletion in lps mutants . the bacterial strains and plasmids used in this study are listed in table s1 ( available as supplementary data at jac online ) . the s. enterica serovar typhimurium strains were derived from the wild - type strain atcc 14028s . bacterial strains were grown at 37c in lysogeny broth ( 1.0 % tryptone , 0.5 % yeast extract , 1.0 % nacl ) . to construct all mutants , primers used for the construction of the mutants are listed in table s2 ( available as supplementary data at jac online ) . the chloramphenicol resistance gene cat or the kanamycin resistance gene aph , flanked by flp recognition sites , was pcr amplified and the resulting products were used to transform the recipient atcc 14028s strain harbouring plasmid pkd46 , which expresses red recombinase . the chromosomal structure of the mutated loci was verified by pcr , as described previously . acrb was pcr amplified from atcc 14028s genomic dna with primers acrb - f and acrb - r ( table s2 , available as supplementary data at jac online ) which introduced restriction enzyme sites of bamhi and xbai at both ends of the amplified fragments . the pcr fragments were cloned into the corresponding sites of the vector ptrchis2b ( invitrogen ) to produce the plasmid pacrb . culture samples were adjusted to an optical density of 1.0 at 600 nm in a final volume of 100 l , and lps samples normalized to the number of cells were separated on 12 % acrylamide gels using tris glycine / sds buffer systems and stained using a modification of the conventional silver staining method . the antibacterial activities of various agents were determined on lysogeny broth agar plates containing oxacillin , cloxacillin , nafcillin , erythromycin , rhodamine 6 g , crystal violet , ethidium bromide , novobiocin , benzalkonium chloride , sds or deoxycholic acid ( sigma , st louis , mo , usa ) at various concentrations . agar plates were prepared by the 2-fold agar dilution technique , as described previously . to determine mics , bacteria were grown in lysogeny broth at 37c overnight , diluted with the same medium and then tested at a final inoculum of 10 cfu / l using a multipoint inoculator ( sakuma seisakusyo , tokyo , japan ) after incubation at 37c for 20 h. the mic was the lowest compound concentration to inhibit cellular growth . the bacterial strains and plasmids used in this study are listed in table s1 ( available as supplementary data at jac online ) . the s. enterica serovar typhimurium strains were derived from the wild - type strain atcc 14028s . bacterial strains were grown at 37c in lysogeny broth ( 1.0 % tryptone , 0.5 % yeast extract , 1.0 % nacl ) . to construct all mutants , gene disruption was performed as described by datsenko and wanner . primers used for the construction of the mutants are listed in table s2 ( available as supplementary data at jac online ) . the chloramphenicol resistance gene cat or the kanamycin resistance gene aph , flanked by flp recognition sites , was pcr amplified and the resulting products were used to transform the recipient atcc 14028s strain harbouring plasmid pkd46 , which expresses red recombinase . the chromosomal structure of the mutated loci was verified by pcr , as described previously . acrb was pcr amplified from atcc 14028s genomic dna with primers acrb - f and acrb - r ( table s2 , available as supplementary data at jac online ) which introduced restriction enzyme sites of bamhi and xbai at both ends of the amplified fragments . the pcr fragments were cloned into the corresponding sites of the vector ptrchis2b ( invitrogen ) to produce the plasmid pacrb . culture samples were adjusted to an optical density of 1.0 at 600 nm in a final volume of 100 l , and lps samples normalized to the number of cells were separated on 12 % acrylamide gels using tris glycine / sds buffer systems and stained using a modification of the conventional silver staining method . the antibacterial activities of various agents were determined on lysogeny broth agar plates containing oxacillin , cloxacillin , nafcillin , erythromycin , rhodamine 6 g , crystal violet , ethidium bromide , novobiocin , benzalkonium chloride , sds or deoxycholic acid ( sigma , st louis , mo , usa ) at various concentrations . agar plates were prepared by the 2-fold agar dilution technique , as described previously . to determine mics , bacteria were grown in lysogeny broth at 37c overnight , diluted with the same medium and then tested at a final inoculum of 10 cfu / l using a multipoint inoculator ( sakuma seisakusyo , tokyo , japan ) after incubation at 37c for 20 h. the mic was the lowest compound concentration to inhibit cellular growth . to investigate whether the length and branches of lps core oligosaccharides affect intrinsic antibiotic resistance in s. enterica serovar typhimurium , genes encoding lps core biosynthetic proteins ( figure 1 ) were deleted ( table s1 , available as supplementary data at jac online ) . in addition to the mutants of the genes presented in figure 1 , the deletion mutants of the wzz gene , encoding the o - chain length determinant , were constructed ( table s1 , available as supplementary data at jac online ) . the deletion mutant of the rfay gene , which is necessary for phosphorylating the hep ( ii ) heptose in the core region of the lps , was also constructed ( table s1 , available as supplementary data at jac online ) . to confirm the effects of deletions of these genes on the lps structure , we analysed the lps profiles in silver - stained polyacrylamide gels . lps profiles of the deletion mutants were all different from that of the wild - type strain ( figure 2 ) . for the mic measurement , the acrb substrates were chosen to compare the effect of deletion of the genes involved in the lps biosynthesis with the effect of deletion of the acrb gene on drug susceptibilities . compared with the wild - type strain , the rfak , wzz and rfaj strains maintained intrinsic resistance to all antimicrobial agents and chemical compounds tested ; however , the rfai , rfab , rfay , rfap , rfag , rfaf and rfac strains showed increased susceptibility to almost all drugs as the length and branches of lps core oligosaccharides were lost ( table 1 ) . interestingly , deletion of rfab , which encodes a protein that adds a galactose moiety to produce one branch of the lps core oligosaccharide , had no impact on novobiocin resistance ; however , the strains that lost a core oligosaccharide phosphorylation gene ( i.e. rfay or rfap ) were more susceptible to novobiocin than rfac . the electric charge produced by the phosphate group seems to be effective in inhibiting the entry of aminocoumarin antibiotics . these data indicate that the length and branches of lps core oligosaccharides play a role in the maintenance of intrinsic resistance of s. enterica against multiple drugs . table 1 . susceptibility of s. enterica serovar typhimurium acrb and / or lps mutants to toxic compoundsstrainmic ( mg / l ) oxaclonaferyr6gcvebnovbenzsdsdocwild - type102410242048512409625620485125123276832768acrb4416816412848102432768rfak102410242048512409625620485125123276832768rfakacrb4416816412816812832768wzz102410242048512409625620485125123276832768wzzacrb4416816412888204832768rfaj102410242048512409625620485125123276832768rfajacrb4416816412816812832768rfai5125121024512409664204864323276832768rfaiacrb4416416464441638432768rfab51251210245124096642048512323276832768rfabacrb4416416464846432768rfay5125121024256409632204816643276832768rfayacrb248482640 .541288192 rfap25625651212840968204848204832768rfapacrb228281320 .125432512 rfag2562562566440968204832425632768rfagacrb124181320 .5264512 rfaf1281282561610248204832825632768rfafacrb4832816412816825632768rfac1286412816128410243241282048rfacacrb1120 .520.25320.5216128 oxa , oxacillin ; clo , cloxacillin ; naf , nafcillin ; ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid.mic determinations were repeated at least three timeslpss were isolated from the wild - type strain ( atcc 14028s ) , rfai ( nks363 ) , rfab ( nks365 ) , rfac ( nks366 ) , rfaf ( nks367 ) , rfag ( nks368 ) , rfaj ( nks369 ) , rfap ( nks371 ) , rfay ( nks372 ) , rfak ( nks375 ) and wzz ( nks877 ) strains . susceptibility of s. enterica serovar typhimurium acrb and / or lps mutants to toxic compounds oxa , oxacillin ; clo , cloxacillin ; naf , nafcillin ; ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid . lpss were isolated from the wild - type strain ( atcc 14028s ) , rfai ( nks363 ) , rfab ( nks365 ) , rfac ( nks366 ) , rfaf ( nks367 ) , rfag ( nks368 ) , rfaj ( nks369 ) , rfap ( nks371 ) , rfay ( nks372 ) , rfak ( nks375 ) and wzz ( nks877 ) strains . in salmonella , the acrab - tolc efflux system is constitutively expressed and effective in intrinsic drug resistance . to investigate the function of multidrug efflux systems in lps mutants , we disrupted acrb from the genomic dna ( table s1 , available as supplementary data at jac online ) . the acrb strain was more susceptible to oxacillin , cloxacillin , nafcillin , erythromycin , rhodamine 6 g and ethidium bromide than any other single lps mutant and almost all drug susceptibilities of the rfakacrb , wzzacrb , rfajacrb , rfaiacrb and rfabacrb double mutants were comparable to that of acrb . the rfayacrb strain was more susceptible to novobiocin , sds and deoxycholic acid than acrb . the rfapacrb was more susceptible to erythromycin , crystal violet , ethidium bromide , novobiocin , sds and deoxycholic acid than acrb . the rfagacrb and rfacacrb strains were more susceptible to almost all drugs than the acrb strain ( table 1 ) . these results indicate that acrab - tolc plays a role in drug resistance even if the lps function is weakened . to investigate the effect of acrb overexpression on drug susceptibilities of the lps mutants , acrb in s. enterica atcc 14028s was cloned into the vector ptrchis2b and then the constructed plasmid was transformed into lps mutants lacking acrb . overexpression of acrb conferred multidrug resistance to all of the mutants ( table 2 ) . these data indicate that the acrb efflux pump can function in bacteria with imperfect lps . however , overexpressed acrb did not completely restore multidrug resistance of some lps mutants to the wild - type level , e.g. rfafacrb and rfacacrb ( table 2 ) . these results indicate that the multidrug efflux system can not recover the loss of lps required for maintenance of intrinsic salmonella resistance . table 2 . susceptibility of s. enterica serovar typhimurium strains to toxic compoundsstrainmic ( mg / l ) eryr6gcvebnovbenzsdsdocwild - type512409625620482565123276832768acrb / ptrchis2b482324425632786acrb / pacrb25640961282048256643278632786rfakacrb / ptrchis2b4162648412832786rfakacrb / pacrb256409612840965121283278632786wzzacrb / ptrchis2b482328425632786wzzacrb / pacrb128409612840965121283278632786rfajacrb / ptrchis2b4162648412832786rfajacrb / pacrb25640961284096512643278632786rfaiacrb / ptrchis2b482324425632786rfaiacrb / pacrb12840961284096128643278632786rfabacrb / ptrchis2b416164446432786rfabacrb / pacrb1284096324096256163278632786rfayacrb / ptrchis2b24132141284096rfayacrb / pacrb128409664204832323278632786rfapacrb / ptrchis2b141320 .25432512 rfapacrb / pacrb6420481620488825632786rfagacrb / ptrchis2b181324232256rfagacrb / pacrb3220488102416412832786rfafacrb / ptrchis2b41626416412832786rfafacrb / pacrb16256451216412832786rfacacrb / ptrchis2b0 .2520.5640.5416128 rfacacrb / pacrb86421024841282048ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid.mic determinations were repeated at least three times.values in bold are larger than those of the corresponding strains harbouring the vector only . susceptibility of s. enterica serovar typhimurium strains to toxic compounds ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid . values in bold are larger than those of the corresponding strains harbouring the vector only . herein , we investigated the interplay between the multidrug efflux system and the om barrier in intrinsic salmonella antibiotic resistance at the genetic level . the results showed that the length and branches of lps core oligosaccharides and the acrb efflux pump are necessary for the maintenance of the intrinsic resistance of s. enterica serovar typhimurium . the maximal susceptibility was achieved when deletions of acrb and genes related to lps synthesis were combined . compared with acrb , rfagacrb was susceptible to oxacillin ( 4-fold ) , nafcillin ( 4-fold ) , erythromycin ( 8-fold ) , crystal violet ( 4-fold ) , ethidium bromide ( 4-fold ) , novobiocin ( 8-fold ) , benzalkonium chloride ( 4-fold ) , sds ( 16-fold ) and deoxycholic acid ( 64-fold ) . rfacacrb was also susceptible to oxacillin ( 4-fold ) , cloxacillin ( 4-fold ) , nafcillin ( 8-fold ) , erythromycin ( 16-fold ) , rhodamine 6 g ( 8-fold ) , crystal violet ( 16-fold ) , ethidium bromide ( 4-fold ) , novobiocin ( 8-fold ) , benzalkonium chloride ( 4-fold ) , sds ( 64-fold ) and deoxycholic acid ( 256-fold ) when compared with acrb . these data indicate that the acrab - tolc efflux system is important for maintaining the intrinsic antibiotic resistance even when most of the core region of lps is lost . the overexpression of acrb can not completely compensate the function of lps in the maintenance of intrinsic resistance , although functional acrb was present in all of the lps mutants . interestingly , giraud et al . reported that there was an increased density of the long o - polysaccharide chains and an increased level of the acrab pump in in vitro - selected quinolone - resistant mutants of s. enterica serovar typhimurium , suggesting that both efflux pump and lps are also important for the acquired resistance . our results support the notion that both pump inhibition and om disruption could constitute an effective approach to increasing the drug susceptibility of multidrug - resistant strains . in summary , we genetically determined that the acrb multidrug efflux pump and bulkiness of lps core oligosaccharides are essential for intrinsic antibiotic resistance in s. enterica . to investigate whether the length and branches of lps core oligosaccharides affect intrinsic antibiotic resistance in s. enterica serovar typhimurium , genes encoding lps core biosynthetic proteins ( figure 1 ) were deleted ( table s1 , available as supplementary data at jac online ) . in addition to the mutants of the genes presented in figure 1 , the deletion mutants of the wzz gene , encoding the o - chain length determinant , were constructed ( table s1 , available as supplementary data at jac online ) . the deletion mutant of the rfay gene , which is necessary for phosphorylating the hep ( ii ) heptose in the core region of the lps , was also constructed ( table s1 , available as supplementary data at jac online ) . to confirm the effects of deletions of these genes on the lps structure , we analysed the lps profiles in silver - stained polyacrylamide gels . lps profiles of the deletion mutants were all different from that of the wild - type strain ( figure 2 ) . for the mic measurement , the acrb substrates were chosen to compare the effect of deletion of the genes involved in the lps biosynthesis with the effect of deletion of the acrb gene on drug susceptibilities . compared with the wild - type strain , the rfak , wzz and rfaj strains maintained intrinsic resistance to all antimicrobial agents and chemical compounds tested ; however , the rfai , rfab , rfay , rfap , rfag , rfaf and rfac strains showed increased susceptibility to almost all drugs as the length and branches of lps core oligosaccharides were lost ( table 1 ) . interestingly , deletion of rfab , which encodes a protein that adds a galactose moiety to produce one branch of the lps core oligosaccharide , had no impact on novobiocin resistance ; however , the strains that lost a core oligosaccharide phosphorylation gene ( i.e. rfay or rfap ) were more susceptible to novobiocin than rfac . the electric charge produced by the phosphate group seems to be effective in inhibiting the entry of aminocoumarin antibiotics . these data indicate that the length and branches of lps core oligosaccharides play a role in the maintenance of intrinsic resistance of s. enterica against multiple drugs . table 1 . susceptibility of s. enterica serovar typhimurium acrb and / or lps mutants to toxic compoundsstrainmic ( mg / l ) oxaclonaferyr6gcvebnovbenzsdsdocwild - type102410242048512409625620485125123276832768acrb4416816412848102432768rfak102410242048512409625620485125123276832768rfakacrb4416816412816812832768wzz102410242048512409625620485125123276832768wzzacrb4416816412888204832768rfaj102410242048512409625620485125123276832768rfajacrb4416816412816812832768rfai5125121024512409664204864323276832768rfaiacrb4416416464441638432768rfab51251210245124096642048512323276832768rfabacrb4416416464846432768rfay5125121024256409632204816643276832768rfayacrb248482640 .541288192 rfap25625651212840968204848204832768rfapacrb228281320 .125432512 rfag2562562566440968204832425632768rfagacrb124181320 .5264512 rfaf1281282561610248204832825632768rfafacrb4832816412816825632768rfac1286412816128410243241282048rfacacrb1120 .520.25320.5216128 oxa , oxacillin ; clo , cloxacillin ; naf , nafcillin ; ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid.mic determinations were repeated at least three timeslpss were isolated from the wild - type strain ( atcc 14028s ) , rfai ( nks363 ) , rfab ( nks365 ) , rfac ( nks366 ) , rfaf ( nks367 ) , rfag ( nks368 ) , rfaj ( nks369 ) , rfap ( nks371 ) , rfay ( nks372 ) , rfak ( nks375 ) and wzz ( nks877 ) strains . susceptibility of s. enterica serovar typhimurium acrb and / or lps mutants to toxic compounds oxa , oxacillin ; clo , cloxacillin ; naf , nafcillin ; ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid . lpss were isolated from the wild - type strain ( atcc 14028s ) , rfai ( nks363 ) , rfab ( nks365 ) , rfac ( nks366 ) , rfaf ( nks367 ) , rfag ( nks368 ) , rfaj ( nks369 ) , rfap ( nks371 ) , rfay ( nks372 ) , rfak ( nks375 ) and wzz ( nks877 ) strains . in salmonella , the acrab - tolc efflux system is constitutively expressed and effective in intrinsic drug resistance . to investigate the function of multidrug efflux systems in lps mutants , we disrupted acrb from the genomic dna ( table s1 , available as supplementary data at jac online ) . the acrb strain was more susceptible to oxacillin , cloxacillin , nafcillin , erythromycin , rhodamine 6 g and ethidium bromide than any other single lps mutant and almost all drug susceptibilities of the rfakacrb , wzzacrb , rfajacrb , rfaiacrb and rfabacrb double mutants were comparable to that of acrb . the rfayacrb strain was more susceptible to novobiocin , sds and deoxycholic acid than acrb . the rfapacrb was more susceptible to erythromycin , crystal violet , ethidium bromide , novobiocin , sds and deoxycholic acid than acrb . the rfagacrb and rfacacrb strains were more susceptible to almost all drugs than the acrb strain ( table 1 ) . these results indicate that acrab - tolc plays a role in drug resistance even if the lps function is weakened . to investigate the effect of acrb overexpression on drug susceptibilities of the lps mutants , acrb in s. enterica atcc 14028s was cloned into the vector ptrchis2b and then the constructed plasmid was transformed into lps mutants lacking acrb . overexpression of acrb conferred multidrug resistance to all of the mutants ( table 2 ) . these data indicate that the acrb efflux pump can function in bacteria with imperfect lps . however , overexpressed acrb did not completely restore multidrug resistance of some lps mutants to the wild - type level , e.g. rfafacrb and rfacacrb ( table 2 ) . these results indicate that the multidrug efflux system can not recover the loss of lps required for maintenance of intrinsic salmonella resistance . table 2 . susceptibility of s. enterica serovar typhimurium strains to toxic compoundsstrainmic ( mg / l ) eryr6gcvebnovbenzsdsdocwild - type512409625620482565123276832768acrb / ptrchis2b482324425632786acrb / pacrb25640961282048256643278632786rfakacrb / ptrchis2b4162648412832786rfakacrb / pacrb256409612840965121283278632786wzzacrb / ptrchis2b482328425632786wzzacrb / pacrb128409612840965121283278632786rfajacrb / ptrchis2b4162648412832786rfajacrb / pacrb25640961284096512643278632786rfaiacrb / ptrchis2b482324425632786rfaiacrb / pacrb12840961284096128643278632786rfabacrb / ptrchis2b416164446432786rfabacrb / pacrb1284096324096256163278632786rfayacrb / ptrchis2b24132141284096rfayacrb / pacrb128409664204832323278632786rfapacrb / ptrchis2b141320 .25432512 rfapacrb / pacrb6420481620488825632786rfagacrb / ptrchis2b181324232256rfagacrb / pacrb3220488102416412832786rfafacrb / ptrchis2b41626416412832786rfafacrb / pacrb16256451216412832786rfacacrb / ptrchis2b0 .2520.5640.5416128 rfacacrb / pacrb86421024841282048ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid.mic determinations were repeated at least three times.values in bold are larger than those of the corresponding strains harbouring the vector only . susceptibility of s. enterica serovar typhimurium strains to toxic compounds ery , erythromycin ; r6 g , rhodamine 6 g ; cv , crystal violet ; eb , ethidium bromide ; nov , novobiocin ; benz , benzalkonium chloride ; doc , deoxycholic acid . values in bold are larger than those of the corresponding strains harbouring the vector only . herein , we investigated the interplay between the multidrug efflux system and the om barrier in intrinsic salmonella antibiotic resistance at the genetic level . the results showed that the length and branches of lps core oligosaccharides and the acrb efflux pump are necessary for the maintenance of the intrinsic resistance of s. enterica serovar typhimurium . the maximal susceptibility was achieved when deletions of acrb and genes related to lps synthesis were combined . compared with acrb , rfagacrb was susceptible to oxacillin ( 4-fold ) , nafcillin ( 4-fold ) , erythromycin ( 8-fold ) , crystal violet ( 4-fold ) , ethidium bromide ( 4-fold ) , novobiocin ( 8-fold ) , benzalkonium chloride ( 4-fold ) , sds ( 16-fold ) and deoxycholic acid ( 64-fold ) . rfacacrb was also susceptible to oxacillin ( 4-fold ) , cloxacillin ( 4-fold ) , nafcillin ( 8-fold ) , erythromycin ( 16-fold ) , rhodamine 6 g ( 8-fold ) , crystal violet ( 16-fold ) , ethidium bromide ( 4-fold ) , novobiocin ( 8-fold ) , benzalkonium chloride ( 4-fold ) , sds ( 64-fold ) and deoxycholic acid ( 256-fold ) when compared with acrb . these data indicate that the acrab - tolc efflux system is important for maintaining the intrinsic antibiotic resistance even when most of the core region of lps is lost . the overexpression of acrb can not completely compensate the function of lps in the maintenance of intrinsic resistance , although functional acrb was present in all of the lps mutants . interestingly , giraud et al . reported that there was an increased density of the long o - polysaccharide chains and an increased level of the acrab pump in in vitro - selected quinolone - resistant mutants of s. enterica serovar typhimurium , suggesting that both efflux pump and lps are also important for the acquired resistance . our results support the notion that both pump inhibition and om disruption could constitute an effective approach to increasing the drug susceptibility of multidrug - resistant strains . in summary , we genetically determined that the acrb multidrug efflux pump and bulkiness of lps core oligosaccharides are essential for intrinsic antibiotic resistance in s. enterica . this study was supported by a research grant from the uehara memorial foundation ( to k. n. ) , the institute for fermentation ( to m. h . - n . ) , grants - in - aid for young scientists and bilateral joint research projects from the japan society for the promotion of science ( to m. h . - n . ) and a grant next program ( ls080 ) from the cabinet office , government of japan ( to k. n. ) . s. y. was supported by a research fellowship from the japan society for the promotion of science for young scientists . tables s1 and s2 are available as supplementary data at jac online ( http://jac.oxfordjournals.org/ ) .\noutput:\n" }, { "from": "agent", "value": "objectivesin gram - negative bacteria , drug susceptibility is associated with multidrug efflux systems and an outer membrane ( om ) barrier . previous studies revealed that salmonella enterica serovar typhimurium has 10 functional drug efflux pumps . among them , acrb is a major factor to maintain the intrinsic drug resistance in this organism . the lipopolysaccharide ( lps ) content of om is also important for resistance to lipophilic drugs ; however , the interplay between the multidrug efflux pump and lps in the intrinsic antibiotic resistance of salmonella remains to be studied in detail . the aim of this study was to investigate the relationship between acrb and lps in the intrinsic drug resistance of this organism.methodsthe genes encoding lps core biosynthetic proteins and acrb were disrupted from the wild - type s. enterica strain atcc 14028s . the plasmid carrying acrb was transformed into these mutants and then the drug susceptibilities of the mutants and transformants were determined.resultsour results showed that the levels of salmonella intrinsic antibiotic resistance were decreased when the length and branches of core oligosaccharide were lost . furthermore , the deletion of acrb reduced multidrug resistance of all lps mutants and acrb production from the plasmid complemented this phenotype . however , acrb production could not completely compensate for lps function in intrinsic resistance.conclusionsboth pump inactivation and shortened lps enhanced drug susceptibility , although the maximum susceptibility was achieved when the two were combined . hence , these results indicated that the multidrug efflux system and om barrier are both essential for maintaining intrinsic antibiotic resistance in salmonella ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: all cellular life forms encode enzymatic machinery for recombination , and in sexually reproducing organisms multiple recombination events occur during each cycle of reproduction , in the course of meiosis ( friedberg et al . 2005 ) . the ubiquity of recombination poses a theoretical challenge given its cost that results from breaking up combinations of alleles favored by selection ( fisher 1930 ; bodmer and parsons 1962 ) . although the prevalence of recombination might have a proximal or mechanistic explanation , such as its role in dna repair , many studies have focused on evolutionary explanations under which recombination confers a fitness advantage that under certain conditions could offset the cost ( barton and charlesworth 1998 ) . in 1967 , nei proposed the general modifier allele framework for the study of the fitness effect of recombination and showed that selection for recombination was possible only in the presence of interaction between genes ( epistasis ) ( nei 1967 ) . the short - term benefit is in breaking apart less - fit combinations of genes whereas the long - term benefit is in increasing the fitness variance of the offspring thereby increasing the efficacy of selection . in either case , selection on the recombination modifier operates through its association with directly selected loci . whether or not recombination can provide either the short - or the long - term benefit , or both , depends on the character of the linkage disequilibria that exist in the absence of recombination and the nature of epistasis ( kondrashov 1993 ) . when the fitness landscape is constant in time , selection favors linkage disequilibrium of the same sign as the prevailing epistasis of the landscape ( felsenstein 1965 ; eshel and feldman 1970 ) . because pairs of alleles that have higher combined fitness occur at a higher frequency , the short - term effect of recombination which breaks up these beneficial associations is deleteriousnevertheless , recombination can still be beneficial in the long term as long as epistasis is negative and the short - term recombination load is not prohibitively high ( feldman et al .1980 ; barton 1995 ; otto and feldman 1997 ) . under the red - queen hypothesis , fluctuating epistasis results in a mismatch between the current frequent allele combinations and those favored by selection ( sturtevant and mather 1938 ; charlesworth 1976recombination can then be beneficial in the short term by breaking up unfavorable allele combinations . however , both selection and the frequency and magnitude of the epistasis fluctuations need to be strong for this mechanism to operate resulting in a restricted parameter range of validity ( charlesworth 1976 ; barton 1995 ; peters and lively 1999 ; gandon and otto 2007 ) . fluctuations resulting from a finite population size lead to a persistent negative linkage disequilibrium ( hill and robertson 1966 ) , so that recombination is favored for its long - term benefit because it increases genetic variation and restores high fitness allele combinations that have been lost through drift ( felsenstein and yokoyama 1976 ; otto and barton 2001 ; iles et al . this mechanism requires intermediate population sizes to operate although spatial structure or a large number of selected loci both increase the upper population size limit at which recombination remains beneficial ( iles et al . the spatial heterogeneity of selection coupled with migration generates linkage disequilibrium dependent on the sign of the epistasis . therefore , recombination can be either deleterious or beneficial ( pylkov et al . 1998 ; martin et al . a model with recurrent deleterious mutations and complete linkage between loci exhibited selection on a sex modifier sufficiently strong to overcome a 2-fold cost , but only when sex ( recombination ) was rare and the modifier led to modest increases in its frequency ( keightley and otto 2006 ; hartfield et al . theoretical models usually predict a monotonic fitness effect of recombination and strive to identify the conditions under which recombination is selectable . however , the existence of a nontrivial equilibrium level of recombination maintained by selection has been demonstrated in a variety of contexts of variable complexity . in particular , a nonmonotonic effect of recombination on fitness has been reported in a model with a large number of loci under selection ( iles et al . an optimal recombination rate also has been found to exist in a model with cyclical epistasis ( gandon and otto 2007 ) . in contrast , the genomic rearrangement rate is readily measurable ( novichkov , wolf , et al . because the dominant molecular mechanism for rearrangement is homologous recombination ( darmon and leach 2014 ) , we use the rearrangement rate as a proxy for the homologous recombination rate . measurements presented here reveal an upper bound on the rearrangement rate that grows sublinearly with the rate of single gene replacements which we denote the gene flux . this observation is consistent with a wright fisher model with negative epistasis that exhibits an optimal , gene flux - dependent recombination rate maintained by selection . the alignable tight genomic clusters ( atgc ) database ( novichkov , ratnere , et al . 2009 ; puigbo et al .2015 ) for each group of genomes and maps each protein to a unique cluster . cog mapping was used to construct gapped local gene - by - gene alignments ( wolf et al . the genome alignments were constructed by assigning a score of 1 to a pair of genes in the same cog and 0 otherwise . given penalties for a mismatch , gap opening and gap extension , matching segments are merged if the total score exceeds the sum of segment scores prior to merging . all genome alignments were computed for the three penalties set to 0.1 ( see wolf et al . for details ) . when the genome rearrangement rate is smaller than the ratio of the genome size and the typical size of a rearrangement , the number of aligned segments is linear in the number of rearrangement events ; accordingly , the number of segments was used as a proxy for the number of rearrangement events . with the chosen scoring system , the resulting alignments can , in principle , span gaps or mismatched regions an order of magnitude longer than the matching segments . therefore , the alignment is tolerant to most of the gene - scale disturbances and breaks only at the sites of major recombination events , such as chromosomal inversions or translocations into entirely different context . gene flux was defined as the sum of the number of gaps and mismatches in the aligned genomic segments divided by the sum of the lengths of the aligned segments . the number of rearrangements per - genome and the gene flux per gene estimates were normalized by the median number of synonymous nucleotide substitutions ( ds ) among genes that were conserved in a particular atgc . this normalization transformed raw counts to rates measured relative to the rate of ( nearly ) neutral substitutions and allowed the comparison of gene flux and rearrangement rates between different atgcs . importantly , although the measured genome rearrangement rate is expected to be linearly correlated with the homologous recombination rate , the coefficient of proportionality is unknown a priori . in addition , the gene flux , that is , the rate at which accumulated mutations result in a qualitative allele change is different from the underlying nucleotide substitution rate . it is therefore not possible to compute the traditional recombination mutation ratio ( r / m ) ( guttman and dykhuizen 1994 ) . we were prompted to investigate a mathematical model of the evolution of recombination by an empirical observation on bacterial and archaeal genomes . by comparing the genomes within multiple groups of closely related bacteria and archaea , we found that the upper bound of the rate of genome rearrangement scaled sublinearly with the rate of replacements of individual genes . comparative analysis of the growing number of diverse bacterial and archaeal genomes shows that gene flux , that is , the loss and gain of individual genes , and genome rearrangement are the primary modes of microevolution in prokaryotes ( koonin and wolf 2008 ) . although the rates of loss and gain vary substantially , a typical gene family is lost and gained dozens of times during the period in which sequence divergence reaches a unit substitution per site ( puigbo et al . typical genome rearrangement rates are not as well known but a long - term evolution experiment in escherichia coli suggests that the rate could be as high as one event per 10,000 generations ( raeside et al . we performed systematic measurements of the gene flux and genome rearrangement intensities using the atgc database of groups of closely related genomes of bacteria and archaea ( novichkov , ratnere , et al .2009 ) ( see supplementary file s1 , supplementary material online , and materials and methods for details ; the genome alignments are available at ftp://ftp.ncbi.nlm.nih.gov/pub/wolf/_suppl/recombination ; last accessed december 22 , 2015 ) . we assume that individual genes are gained and lost through mechanisms that are distinct from those responsible for the translocation , insertion , deletion , and inversion of large ( at the scale of tens of genes or more ) genomic segments . genomic rearrangement is caused largely by recombination events occurring within the same genome , such as genome segment inversions centered at the origin of replication ( eisen et al . in contrast , the gene flux involves replacement of individual alleles by novel alleles that originate from a large gene reservoir , the supergenome ( lobkovsky et al . 2014 ) . thus , the degree of segmentation of the whole - genome alignment is associated with the intensity of rearrangement whereas gene mismatches and gaps found in aligned segments are attributed to the gene flux . figure 1 shows the dependency of the genome rearrangement rate on the gene flux for all analyzed atgcs . in addition , the variance of the rearrangement rate notably declines with the increasing gene flux . we sought an explanation for this dynamic link between the two rates that does not invoke a common mechanism or a common control on the processes of rearrangement and flux , but possibly could be maintained by selection . the data are presented for 27 atgcs ( each shown by a unique symbol ) each containing at least ten microbial genomes ( see supplementary file s1 , supplementary material online ) . the data are presented for 27 atgcs ( each shown by a unique symbol ) each containing at least ten microbial genomes ( see supplementary file s1 , supplementary material online ) . if the effect of recombination on fitness is monotonic and recombination rate can evolve , selection will drive the rate to zero ( if recombination is deleterious ) or to infinity ( if recombination is beneficial ) . thus , models that predict a monotonic dependency of fitness on recombination intensity can not explain the observed upper bound on the recombination rate ( fig .1 ) without invoking an additional mechanism that would limit the rate from above in a way that is dependent on the gene flux . considering the apparent implausibility of such mechanisms , we sought to construct a model that would naturally exhibit a nonmonotonic effect of recombination . if there exists an optimal recombination rate which maximizes fitness , selection can maintain the rate in the neighborhood of the optimum . the empirical observations could be explained if the optimal recombination rate depended sublinearly on the gene flux . here we construct and analyze a stochastic population model which exhibits a gene flux - dependent , evolvable optimal recombination rate . fundamentally , recombination acts to reduce linkage disequilibrium by breaking associations between genes . if gene association is maintained by selection , recombination is deleterious and its effect is denoted as recombination load . recombination will have a nonmonotonic effect on fitness if , at high recombination rates , the fitness effect is negative due to the disruption of beneficial gene associations , whereas at low recombination rates , the effect is positive owing to the segregation of deleterious alleles . the following population model possesses the ingredients that lead to a nonmonotonic effect of recombination on steady - state fitness . the population of a fixed sizen is composed of genomes whose fitness is the sum of individual contributions of alleles at a fixed number m of loci ( additive fitness ) . evolution is modeled through a wright fisher process with discrete , nonoverlapping generations whereby the new generation is formed by selecting with replacement n organisms with probabilities proportional to their finesses . after the sampling , each gene of each organism is replaced by a novel allele with probability 1 - e - . the contribution of the replacement alleles to the additive fitness is drawn from an exponential distribution with a unit mean , within an infinite allele pool . the results did change qualitatively when the distribution of fitness effects in the allele pool is uniform ( supplementary figs . s1s3 , supplementary material online ) . after the gene replacement round , each organism replaces , with probability 1 - e - r , a genomic region of random uniformly distributed length starting from random position k ( genomes are assumed to be circular ) with the corresponding region of a random organism from the current generation . furthermore , replacing the uniformly distributed recombination region length by an exponentially distributed length did not alter the conclusions qualitatively ( supplementary fig . the mean length of the recombining region was shown to have a weak effect on the steady - state fitness , with an optimum length that was an appreciable fraction of the genome size . because our measurements of the genomic rearrangements revealed that the mean segment length was between 5 % and 20 % of the genome size , we proceed with the exploration of the model in which the length of the recombining region is uniformly distributed . simulations of the wright fisher model were carried out until the steady - state criterion was satisfied . this criterion operated on the set of measurements of the mean fitness made every n generations . simulations were terminated when the means among the middle third ( by time ) and the last third of these measurements were the same . to supplement the termination criterion , we fitted the time - dependent fitness to the expected logarithmic growth law with and without saturation and used the akaike information criterion to determine whether saturation was supported by the data . the infinite allele replacement mechanism causes negative linkage disequilibrium because a newly introduced allele occurs against a background where other loci are more likely to contain high frequency alleles . in addition , because selection drives the average fitness contribution significantly above unity , whereas the newly introduced alleles have a unit mean fitness , the effective fitness landscape exhibits negative epistasis ( following the definition of otto and lenormand ) , in agreement with experimental evolution findings ( khan et al . importantly , negative epistasis in our model is a natural consequence of the additive fitness assumption and does not emerge under the multiplicative fitness model . an extensive body of experimental evidence indicates that negative epistasis is the norm in evolution ( weinreich et al . 2005 ; kouyos et al . 2007 ; khan et al . 2011 ) . the additive fitness assumption is a simple and natural way to construct a model with negative epistasis without having to introduce such epistasis explicitly . the simulation results show that under this model , steady - state fitness has a pronounced peak as a function of the recombination rate r ( fig . the shape of the dependency as well as the position and height of the peak depend on the gene flux . at low gene fluxes , high recombination rates are substantially deleterious , with steady - state fitness dropping below the level at zero recombination ; in contrast , at high gene fluxes , the peak nearly degenerates into a plateau , that is , high recombination rates are almost as beneficial as the optimal value ( fig . the maximum benefit of recombination compared with the r = 0 case is observed at the intermediate values of the gene flux ( fig . when the gene flux is so high that most alleles are replaced in each generation , the mean fitness contribution of genes in a genome is close to unity , and therefore epistasis is weak and the preservation of the association between the genes confers little or no fitness benefit . in contrast , when the gene flux is low ( rare replacements ) , and drift is not too strong , selection can maintain linkage disequilibrium close to the optimal value . in both situations , reduction of disequilibrium caused by increased recombination does not increase the mean fitness . error bars display the standard deviation of the fitness from its mean in steady state .3 . the maximum benefit of recombination versus the gene flux obtained by fitting the mean fitness as a function of the recombination rate . error bars display the standard deviation of the fitness from its mean in steady state . the maximum benefit of recombination versus the gene flux obtained by fitting the mean fitness as a function of the recombination rate . in the model , the recombination rate ropt , at which the maximum benefit is achieved , scales sublinearly with the gene flux ( fig . qualitatively , this is the same dependency as was observed in the atgc analysis through comparison of the measured genome rearrangement ( recombination ) rates and gene fluxes ( fig .1 ) . a direct quantitative comparison of the model predictions to the empirically observed upper bound onthe genome rearrangement rate would require knowledge of the population size and generation time for each species . neither of these values is readily available , and they are likely to exhibit large variability even within an atgc . fig .4 . the optimal recombination rate in the model as a function of the gene flux . the optimal recombination rate in the model as a function of the gene flux . the conclusion that the observed link between the genome rearrangement rate and gene flux results from the existence of an optimal recombination rate , which depends on the gene flux , implies that , when the recombination rate is allowed to evolve , selection can maintain its value near the optimum . this is not a foregone conclusion because , although the average fitness of a population in steady state is increased by recombination , the effect of recombination on the fitness of a genome can be negative because most low frequency alleles are deleterious . we further tested the ability of selection to maintain the recombination rate close to the optimum by making the rate a heritable , mutable trait . in each generation , organisms have a probability of a mutation that changes their recombination rate by a small amount . if r is not subject to selection , the population average recombination rate performs a simple random walk . in contrast , if the trajectory of the population average recombination rate is consistent with diffusion in a potential well , one could conclude that selection maintains r close to an optimal value that corresponds to the bottom of the well . to test whether the trajectory r ( t ) is consistent with simple diffusion , we plotted the autocorrelation function ( r ( t + ) - r ( t ) ) 2 ( the averaging is done over time t ) as a function of ( fig . this quantity is expected to grow linearly with time for simple diffusion , whereas our simulations clearly show saturation which is indicative of a steady state . the width of the peak decreases with increasing gene flux which is compatible with the empirical observations ( fig . ( a ) the main figure shows a plot of the autocorrelation function of the recombination rate against the number of generations for three combinations of gene flux values and the mutation rates of r. the inset shows a typical evolutionary trajectory of the recombination rate under the model . ( b ) probability distribution function of the recombination rate produced by the model depending on the gene flux . ( a ) the main figure shows a plot of the autocorrelation function of the recombination rate against the number of generations for three combinations of gene flux values and the mutation rates of r. the inset shows a typical evolutionary trajectory of the recombination rate under the model . ( b ) probability distribution function of the recombination rate produced by the model depending on the gene flux . we were prompted to investigate a mathematical model of the evolution of recombination by an empirical observation on bacterial and archaeal genomes . by comparing the genomes within multiple groups of closely related bacteria and archaea , we found that the upper bound of the rate of genome rearrangement scaled sublinearly with the rate of replacements of individual genes . comparative analysis of the growing number of diverse bacterial and archaeal genomes shows that gene flux , that is , the loss and gain of individual genes , and genome rearrangement are the primary modes of microevolution in prokaryotes ( koonin and wolf 2008 ) . although the rates of loss and gain vary substantially , a typical gene family is lost and gained dozens of times during the period in which sequence divergence reaches a unit substitution per site ( puigbo et al . typical genome rearrangement rates are not as well known but a long - term evolution experiment in escherichia coli suggests that the rate could be as high as one event per 10,000 generations ( raeside et al . we performed systematic measurements of the gene flux and genome rearrangement intensities using the atgc database of groups of closely related genomes of bacteria and archaea ( novichkov , ratnere , et al .2009 ) ( see supplementary file s1 , supplementary material online , and materials and methods for details ; the genome alignments are available at ftp://ftp.ncbi.nlm.nih.gov/pub/wolf/_suppl/recombination ; last accessed december 22 , 2015 ) . we assume that individual genes are gained and lost through mechanisms that are distinct from those responsible for the translocation , insertion , deletion , and inversion of large ( at the scale of tens of genes or more ) genomic segments . genomic rearrangement is caused largely by recombination events occurring within the same genome , such as genome segment inversions centered at the origin of replication ( eisen et al . in contrast , the gene flux involves replacement of individual alleles by novel alleles that originate from a large gene reservoir , the supergenome ( lobkovsky et al . 2014 ) . thus , the degree of segmentation of the whole - genome alignment is associated with the intensity of rearrangement whereas gene mismatches and gaps found in aligned segments are attributed to the gene flux . figure 1 shows the dependency of the genome rearrangement rate on the gene flux for all analyzed atgcs . in addition , the variance of the rearrangement rate notably declines with the increasing gene flux . we sought an explanation for this dynamic link between the two rates that does not invoke a common mechanism or a common control on the processes of rearrangement and flux , but possibly could be maintained by selection . the data are presented for 27 atgcs ( each shown by a unique symbol ) each containing at least ten microbial genomes ( see supplementary file s1 , supplementary material online ) . the data are presented for 27 atgcs ( each shown by a unique symbol ) each containing at least ten microbial genomes ( see supplementary file s1 , supplementary material online ) . if the effect of recombination on fitness is monotonic and recombination rate can evolve , selection will drive the rate to zero ( if recombination is deleterious ) or to infinity ( if recombination is beneficial ) . thus , models that predict a monotonic dependency of fitness on recombination intensity can not explain the observed upper bound on the recombination rate ( fig .1 ) without invoking an additional mechanism that would limit the rate from above in a way that is dependent on the gene flux . considering the apparent implausibility of such mechanisms , we sought to construct a model that would naturally exhibit a nonmonotonic effect of recombination . if there exists an optimal recombination rate which maximizes fitness , selection can maintain the rate in the neighborhood of the optimum . the empirical observations could be explained if the optimal recombination rate depended sublinearly on the gene flux . here we construct and analyze a stochastic population model which exhibits a gene flux - dependent , evolvable optimal recombination rate . fundamentally , recombination acts to reduce linkage disequilibrium by breaking associations between genes . if gene association is maintained by selection , recombination is deleterious and its effect is denoted as recombination load . recombination will have a nonmonotonic effect on fitness if , at high recombination rates , the fitness effect is negative due to the disruption of beneficial gene associations , whereas at low recombination rates , the effect is positive owing to the segregation of deleterious alleles . the following population model possesses the ingredients that lead to a nonmonotonic effect of recombination on steady - state fitness . n is composed of genomes whose fitness is the sum of individual contributions of alleles at a fixed number m of loci ( additive fitness ) . evolution is modeled through a wright fisher process with discrete , nonoverlapping generations whereby the new generation is formed by selecting with replacement n organisms with probabilities proportional to their finesses . after the sampling , each gene of each organism is replaced by a novel allele with probability 1 - e - . the contribution of the replacement alleles to the additive fitness is drawn from an exponential distribution with a unit mean , within an infinite allele pool . the results did change qualitatively when the distribution of fitness effects in the allele pool is uniform ( supplementary figs . s1s3 , supplementary material online ) . after the gene replacement round , each organism replaces , with probability 1 - e - r , a genomic region of random uniformly distributed length starting from random position k ( genomes are assumed to be circular ) with the corresponding region of a random organism from the current generation . furthermore , replacing the uniformly distributed recombination region length by an exponentially distributed length did not alter the conclusions qualitatively ( supplementary fig . the mean length of the recombining region was shown to have a weak effect on the steady - state fitness , with an optimum length that was an appreciable fraction of the genome size . because our measurements of the genomic rearrangements revealed that the mean segment length was between 5 % and 20 % of the genome size , we proceed with the exploration of the model in which the length of the recombining region is uniformly distributed . simulations of the wright fisher model were carried out until the steady - state criterion was satisfied . this criterion operated on the set of measurements of the mean fitness made every n generations . simulations were terminated when the means among the middle third ( by time ) and the last third of these measurements were the same . to supplement the termination criterion , we fitted the time - dependent fitness to the expected logarithmic growth law with and without saturation and used the akaike information criterion to determine whether saturation was supported by the data . the infinite allele replacement mechanism causes negative linkage disequilibrium because a newly introduced allele occurs against a background where other loci are more likely to contain high frequency alleles . in addition , because selection drives the average fitness contribution significantly above unity , whereas the newly introduced alleles have a unit mean fitness , the effective fitness landscape exhibits negative epistasis ( following the definition of otto and lenormand ) , in agreement with experimental evolution findings ( khan et al . 2011 ) . importantly , negative epistasis in our model is a natural consequence of the additive fitness assumption and does not emerge under the multiplicative fitness model . an extensive body of experimental evidence indicates that negative epistasis is the norm in evolution ( weinreich et al . the additive fitness assumption is a simple and natural way to construct a model with negative epistasis without having to introduce such epistasis explicitly . the simulation results show that under this model , steady - state fitness has a pronounced peak as a function of the recombination rate r ( fig . the shape of the dependency as well as the position and height of the peak depend on the gene flux . at low gene fluxes , high recombination rates are substantially deleterious , with steady - state fitness dropping below the level at zero recombination ; in contrast , at high gene fluxes , the peak nearly degenerates into a plateau , that is , high recombination rates are almost as beneficial as the optimal value ( fig . the maximum benefit of recombination compared with the r = 0 case is observed at the intermediate values of the gene flux ( fig . when the gene flux is so high that most alleles are replaced in each generation , the mean fitness contribution of genes in a genome is close to unity , and therefore epistasis is weak and the preservation of the association between the genes confers little or no fitness benefit . in contrast , when the gene flux is low ( rare replacements ) , and drift is not too strong , selection can maintain linkage disequilibrium close to the optimal value . in both situations , error bars display the standard deviation of the fitness from its mean in steady state .3 . the maximum benefit of recombination versus the gene flux obtained by fitting the mean fitness as a function of the recombination rate . error bars display the standard deviation of the fitness from its mean in steady state . the maximum benefit of recombination versus the gene flux obtained by fitting the mean fitness as a function of the recombination rate . in the model , the recombination rate ropt , at which the maximum benefit is achieved , scales sublinearly with the gene flux ( fig . qualitatively , this is the same dependency as was observed in the atgc analysis through comparison of the measured genome rearrangement ( recombination ) rates and gene fluxes ( fig .1 ) . a direct quantitative comparison of the model predictions to the empirically observed upper bound onthe genome rearrangement rate would require knowledge of the population size and generation time for each species . neither of these values is readily available , and they are likely to exhibit large variability even within an atgc . fig .4 . the optimal recombination rate in the model as a function of the gene flux . the optimal recombination rate in the model as a function of the gene flux . the conclusion that the observed link between the genome rearrangement rate and gene flux results from the existence of an optimal recombination rate , which depends on the gene flux , implies that , when the recombination rate is allowed to evolve , selection can maintain its value near the optimum . this is not a foregone conclusion because , although the average fitness of a population in steady state is increased by recombination , the effect of recombination on the fitness of a genome can be negative because most low frequency alleles are deleterious . we further tested the ability of selection to maintain the recombination rate close to the optimum by making the rate a heritable , mutable trait . in each generation , organisms have a probability of a mutation that changes their recombination rate by a small amount . if r is not subject to selection , the population average recombination rate performs a simple random walk . in contrast , if the trajectory of the population average recombination rate is consistent with diffusion in a potential well , one could conclude that selection maintains r close to an optimal value that corresponds to the bottom of the well . to test whether the trajectory r ( t ) is consistent with simple diffusion , we plotted the autocorrelation function ( r ( t + ) - r ( t ) ) 2 ( the averaging is done over time t ) as a function of ( fig . this quantity is expected to grow linearly with time for simple diffusion , whereas our simulations clearly show saturation which is indicative of a steady state . the width of the peak decreases with increasing gene flux which is compatible with the empirical observations ( fig . ( a ) the main figure shows a plot of the autocorrelation function of the recombination rate against the number of generations for three combinations of gene flux values and the mutation rates of r. the inset shows a typical evolutionary trajectory of the recombination rate under the model . ( b ) probability distribution function of the recombination rate produced by the model depending on the gene flux . ( a ) the main figure shows a plot of the autocorrelation function of the recombination rate against the number of generations for three combinations of gene flux values and the mutation rates of r. the inset shows a typical evolutionary trajectory of the recombination rate under the model . ( b ) probability distribution function of the recombination rate produced by the model depending on the gene flux . evolution and maintenance of recombination is a long standing , often vigorously debated theme in evolutionary biology ( fisher 1930 ; muller 1964 ; felsenstein 1974 ; barton and charlesworth 1998 ; keightley and otto 2006 ) . this debate is linked to the more general and even more controversial problem of evolution of evolvability ( kirschner and gerhart 1998 ; draghi et al . the question whether evolvability mechanisms , of which recombination is arguably the most common one , are evolvable ( subject to selection ) , has a long , chequered history . general considerations based on the popular belief that evolution has no foresight are often taken as an indication that such mechanisms , having no immediate effect on fitness , can not be targets of selection ( partridge and barton 2000 ; chicurel 2001 ) . under this view , recombination would evolve as a by - product of essential processes of dna repair . however , several modeling studies suggest that evolvability could be selectable ( earl and deem 2004 ; jones et al .2007 ) or could evolve neutrally ( lehman and stanley 2013 ) , and a general mathematical solution to this problem has been proposed ( toussaint 2003 ) . the fitness effect of recombination in stochastic population models depends on various factors , such as the structure and dynamics of the fitness landscape , mutation mechanisms and rates and the strength of the genetic drift , and can be either positive or negative ( christiansen et al . 1998 ; otto and lenormand 2002 ; peng et al . 2004 ; martin et al .2006 ; barton 2010 ; rouzine and coffin 2010 ; weissman and barton 2012 ; john and jain 2015 ) . a nonmonotonic fitness effect of recombination has been reported in a number of different scenarios ( iles et al . the model described here has all the ingredients required to manifest a nonmonotonic fitness effect of recombination rate , and our evolutionary simulations indeed reveal the existence of optimal recombination rates that depend on the gene flux . moreover , we explicitly show that , within the framework of this model , the optimal recombination rate is evolvable . thus , in general terms , the results of the present work are compatible with the existence of selection for evolvability . because the main focus of the previous studies of the fitness effect of recombination was on the emergence of recombination , the existence of an optimal recombination rate , although reported on several occasions , has not been thoroughly explored . our aim was to investigate the dependence of the optimal recombination intensity on other parameters , such as allele replacement rate and population size , in an attempt to account for the empirically observed gene flux - dependent upper bound on the genome rearrangement rate . in addition , the model developed here is arguably more general than most of the previous ones because it does not assume the sign or magnitude of the epistasis and the distribution of mutation effects a priori . negative epistasis and predominantly deleterious mutations arise naturally as a consequence of the additive fitness assumption and a fixed distribution of fitness effects in the reservoir from which new alleles arrive . empirical data show that the upper bound of the observed genome rearrangement rates scales sublinearly with the gene flux , whereas many genomes have rearrangement rates much lower than the maximum ( fig . this observation implies that microbial genomes evolve in a gene flux regime where the penalty for the higher than optimal recombination rate is greater than that for the lower than optimal rate . the fitness versus recombination rate dependencies tend to display such behavior at lower gene fluxes ( fig .2 ) . thus , the typical gene flux in prokaryotes appears to be low enough for a certain level of recombination to provide substantial evolutionary benefit . to summarize , we found that the genome rearrangement rate in bacteria and archaea exhibits an upper bound that scales sublinearly with the gene flux . the genome rearrangement level appears to reflect the rate of large - scale segmental recombination that swaps genomic regions among organisms in the same population , whereas gene flux involves gene - scale allele replacement by genes acquired from a much broader reservoir , the supergenome ( puigbo et al . 2014 ) . in an attempt to account for the observed link between these phenomena , we analyzed a stochastic population model with two independent mechanisms for changing the genome content : 1 ) recombination , which copied random genomic regions between organisms in the population , and 2 ) gene flux , which introduced novel alleles . the model included the additive fitness and infinite allele assumptions , resulting in fluctuating negative epistasis . under these assumptions , we found that the steady - state fitness was a nonmonotonic function of the recombination rate , with a pronounced peak at intermediate rates . in agreement with the empirical observations , the optimal recombination rate in the model scaled sublinearly with the gene flux . it should be emphasized that the nonmonotonic effect of recombination is a consequence of the negative epistasis which itself depends on the additive fitness assumption . indeed , in numerical experiments under a multiplicative fitness model , we observed a monotonic effect of recombination . in our model , when the recombination rate was allowed to evolve , its distribution reached a steady state and the variance in steady state decreased with the increasing gene flux , also in agreement with the observations . taken together , these findings suggest that the observed link between genome rearrangement and gene flux is maintained by selection for the optimal recombination rate . supplementary file s1 and figures s1s5 are available at genome biology and evolution online ( http://www.gbe.oxfordjournals.org/ ) .\noutput:\n" }, { "from": "agent", "value": "evolution and maintenance of genetic recombination and its relation to the mutational process is a long - standing , fundamental problem in evolutionary biology that is linked to the general problem of evolution of evolvability . we explored a stochastic model of the evolution of recombination using additive fitness and infinite allele assumptions but no assumptions on the sign or magnitude of the epistasis and the distribution of mutation effects . in this model , fluctuating negative epistasis and predominantly deleterious mutations arise naturally as a consequence of the additive fitness and a reservoir from which new alleles arrive with a fixed distribution of fitness effects . analysis of the model revealed a nonmonotonic effect of recombination intensity on fitness , with an optimal recombination rate value which maximized fitness in steady state . the optimal recombination rate depended on the mutation rate and was evolvable , that is , subject to selection . the predictions of the model were compatible with the observations on the dependence between genome rearrangement rate and gene flux in microbial genomes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: life expectancy at birth ( leb ) is defined as the average number of years one would be expected to live at birth . life expectancy is commonly used as one of the main indicators to assess health status of a population in developed as well as developing countries , and it is also closely associated with the degree of economic and social development of a country or a region ( 13 ) . although life expectancy has increased at the global level in the last decades and increased quantity varies among countries , there is a high disparity between developed and developing countries . for example , based on a recent human development report , published in 2013 , the gap between life expectancy in japan is the highest in the world ( 86.6 years ) and sierra leone has the lowest in the world ( 48.1 years ) at 35.5 years . or the disparity between developed and developed countries is about 11 years ( 4 , 5 ) . the differences between countries can be explained by long - term changes in social , cultural , economic , environmental , and health system factors . health policymakers , in developed and developing countries , are concerned about this discrepancy among countries , and they are interested to know the main factors that affect life expectancy . previous studies highlighted the effect of different variables such as gross domestic production ( gdp ) per capita , healthcare expenditure , urbanization rate , co2 emission , doctors or beds per 10,000 population , literacy rate , total fertility rate , misery index ( unemployment + inflation rate ) , food production index , pharmaceutical , income inequality , and exchange rate on life expectancy ( 28 ) . ( 6 ) reported the main determinant of life expectancy at birth in emr ( eastern mediterranean region ) , based on the grossman model , between 1995 and 2007 using a panel data of 21 countries . their results demonstrated that income per capita , years schooling , food availability , level of urbanization and employment ratio were the main factors affecting leb . sede and ohemeng3 also demonstrated per capita income , years schooling , and government expenditures on health were the main socioeconomic factors affecting life expectancy in nigeria ( 19802011 ) . gulis ( 9 ) has examined the main determinants of life expectancy of 156 developed and developing countries . his study demonstrated that income per capita , public health spending , safe drinking water , calorie intake , and literacy were the main determinants of life expectancy . an analysis of three decades showed that the average of life expectancy at birth in iran between 1980 and 1990 was 57.2 years ; 19912000 was 67.8 years ; 20012011 was 71.6 years . in other words , the leb in iran has increased from 55 years in 1980 to 73 years in 2011 ( 10 ) . understanding the main factors affecting increased leb in iran over the three past decades could provide important insights and further evidence for health policymakers to support governmental health efforts for promotion of health status . however , this study attempted to examine the impact on some of the main socioeconomic factors on life expectancy at birth in iran from 1985 to 2013 . we hope the results of this study could help policymakers to gain an appropriate view about the determinants of life expectancy in the country . the study setting was iran , which consists of 31 provinces , based on the census 2011 , with a population of around 75,149,669 of people and is located in the eastern mediterranean region with an area of 1,648,000 km . the data on number of doctors per 10,000 population ( doc ) , inflation rate ( inf ) , and literate rate ( lit ) were retrieved from the iranian statistical of center ( isc ) and central bank of iran ( cbi ) . also , information on life expectancy at birth , food production index ( fpi ) , urbanization degree ( urb ) , gross domestic production ( gdp ) , total fertility rate ( tfr ) , and co2 emission was obtained from the world bank . these explanatory variables were chosen based on literature review and their availability ( 25 , 7 , 8 ) . the study covers the period 19852013 ( 28 years ) , which has a sufficient degree of freedom to capture a considerably large proportion of the effect of socioeconomic variables on life expectancy in iran over time . in the current study , the following primary model was used : leb = f ( fpi , urb , gdp , doc , inf , co2 , tfr , lit ) . based on this model , the following econometric model was used in order to determine the key explanatory factors affecting life expectancy at birth in iran : llebt = a0 + 1lfpit + 2lurbt + 3lgdpt + 4ldoct + 5linft + 6lco2 t + 7ltfrt + 8llitt + ut , where 0 = intercept , 1 = coefficient of logarithm fpi , 2 = coefficient of logarithm urb , 3 = coefficient of logarithm gdp , 4 = coefficient of logarithm doc , 5 = coefficient of logarithm ifr , 6 = coefficient of logarithm co2 , 7 = coefficient of logarithm tfr , 8 = coefficient of logarithm lit , = error term . in a time series data , it is an important to determine whether or not the variables are stationary and cointegration ( 11 ) . augmented dickey fuller ( adf ) and banergy , dolado , and master ( bdm ) testswere used to examine the stationary and cointegration of the variables included in the study ( 12 ) . an engle granger approach was used in order to determine whether there is a long - run relationship between life expectancy and its determinants ( 13 ) . based on econometrics text , if there is a long - run relationship between dependent variable and its determinants , an ordinary least - square ( ols ) model produces consistent parameter estimates ( 14,15 ) . in addition , variance inflation factor ( vif ) and tolerance tests for assessing the collinearity and shapiro wilk w test were used to assess the normality distribution of residuals of the explanatory variables ( 16,17 ) . a p - value less than 0.05 was considered to be statistically significant , and all the analyses were performed by the stata v. 12 software . the study setting was iran , which consists of 31 provinces , based on the census 2011 , with a population of around 75,149,669 of people and is located in the eastern mediterranean region with an area of 1,648,000 km . the data on number of doctors per 10,000 population ( doc ) , inflation rate ( inf ) , and literate rate ( lit ) were retrieved from the iranian statistical of center ( isc ) and central bank of iran ( cbi ) . also , information on life expectancy at birth , food production index ( fpi ) , urbanization degree ( urb ) , gross domestic production ( gdp ) , total fertility rate ( tfr ) , and co2 emission was obtained from the world bank . these explanatory variables were chosen based on literature review and their availability ( 25 , 7 , 8 ) . the study covers the period 19852013 ( 28 years ) , which has a sufficient degree of freedom to capture a considerably large proportion of the effect of socioeconomic variables on life expectancy in iran over time . in the current study , the following primary model was used : leb = f ( fpi , urb , gdp , doc , inf , co2 , tfr , lit ) . based on this model , the following econometric model was used in order to determine the key explanatory factors affecting life expectancy at birth in iran : llebt = a0 + 1lfpit + 2lurbt + 3lgdpt + 4ldoct + 5linft + 6lco2 t + 7ltfrt + 8llitt + ut , where 0 = intercept , 1 = coefficient of logarithm fpi , 2 = coefficient of logarithm urb , 3 = coefficient of logarithm gdp , 4 = coefficient of logarithm doc , 5 = coefficient of logarithm ifr , 6 = coefficient of logarithm co2 , 7 = coefficient of logarithm tfr , 8 = coefficient of logarithm lit , = error term . in a time series data , it is an important to determine whether or not the variables are stationary and cointegration ( 11 ) . augmented dickey fuller ( adf ) and banergy , dolado , and master ( bdm ) tests were used to examine the stationary and cointegration of the variables included in the study ( 12 ) . an engle granger approach was used in order to determine whether there is a long - run relationship between life expectancy and its determinants ( 13 ) . based on econometrics text , if there is a long - run relationship between dependent variable and its determinants , an ordinary least - square ( ols ) model produces consistent parameter estimates ( 14,15 ) . in addition , variance inflation factor ( vif ) and tolerance tests for assessing the collinearity and shapiro wilk w test were used to assess the normality distribution of residuals of the explanatory variables ( 16,17 ) . a p - value less than 0.05 was considered to be statistically significant , and all the analyses were performed by the stata v. 12 software . the descriptive statistics of variables included in the study are presented in table 1 . as can be seen in table 1 , the mean of leb was 67.9 years with sd of 5.08 years ( ranged from 56 and 74 years ) during the studied period . mean of gdp per capita also rose from 3590 in 1985 to 4763 in 2013 . in addition , the number of doctors per 10,000 population increased from 3.6 at the beginning of the study to 14.3 at the end . the leb in iran increased from 56 years in 1985 to 74 years in 2013 ( + 20 years ) ; the trend of leb is shown in figure 1 . the results of adf unit root test at levels i ( 0 ) and first differenced i ( 1 ) are presented in table 2 . the results indicated that all variables are stationary at the first difference with a constant and without a constant . in other words , finding from adf test showed that all variables are stationary at the first difference . the results showed the mean of vif was 55 , thus indicating there is a high correlation among explanatory variables . ldoc and ltfr were identified as main resources of the collinearity in the model . for reducing collinearity among variables , we replace the first difference of variables ( ltfr and ldoc ) in the model , and the results showed the mean of vif after replacing the first difference was 6.8 . this is indicated that the collinearity among explanatory variables is less than 10 , and it is acceptable for the analysis . the results of shapiro wilk w test showed that the residual of the observations are normally distributed ( p = 0.3 ) ( table 3 ) . because of the order of integration i ( 1 ) , the engle granger ( eg ) test showed that the null hypothesis is rejected , and then the series are cointegrated ( p 0.001 ) . the results of ols model indicated that the food production index , number of doctors per 10,000 population , gdp per capita , and literacy rate have a significant positive impact on life expectancy at birth ( table 4 ) . in addition , there is a positive association between degree of urbanization and co2 emission with life expectancy , but they are not statistically significant . total fertility rate and inflation rate have a negative impact on life expectancy , and just the effect of total fertility rate is statistically significant . the elasticity of fpi was 0.231 ; this indicates that a 10 % increase in food production increases life expectancy by 2.3 % . also , the results revealed that a 10 % increase in the number of doctors per 10,000 population increases leb by 1 % , a similar increase in the total fertility rate reduces leb by 4.5 % . the results of estimation model showed that adjusted r was 0.9 ; this indicates that there is a high correlation between life expectancy at birth and explanatory variables used in the model . on the other hand , morethe 90 % of variation leb can be explained by explanatory variables used in the model . also , the f - statistics confirmed the null hypothesis that at least one independent variable was not zero . the value of durbin watson statistic was closer to 2 , and this indicates there is no autocorrelation . life expectancy at birth is considered one of the main indicators to examine the situation of health status in developed as well as developing countries . in iran , the change in life expectancy is associated with long - term changes in many factors such as food production index , urbanization degree , gross domestic production , total fertility rate , co2 emission , number of doctors , inflation rate , and literate rate . using iranians time series data , the present study attempted to investigate the impact on main explanatory variables of life expectancy over the periods of 19852013 . our findings indicated that food availability has a significant positive effect on life expectancy , and its coefficient was 0.23 . this implies a 10 % increase in food availability associated with an increase in leb , on the average , by 2.3 % . this finding is in line with studies conducted in less developed countries by lin et al . ( 5 ) , sub - saharan africa by faiyssa et al . ( ferda investigated the main determinants of life expectancy in turkey for the period from 19652005 by ardl approach ( 19 ) . he concluded that food availability is the most important factor for improving longevity , and there is a positive significant association between food availability and life expectancy in turkey . in addition , gross domestic production ( gdp ) per capita is considered to be another factor that had a positive and statistically significant effect on life expectancy . this finding can be explained by the fact that higher income per capita is associated with consumption of the goods and services with high quality , better housing , and better quality of medical services , which lead to increasing life expectancy ( 6 , 18 ) . the direct association between gdp per capita and life expectancy has been shown in previous studies ( 6 , 18 , 20 , 21 ) . our empirical analysis indicates that literacy rate also has a positive significant effect on life expectancy . this finding is conforms to results from previous studies ( 1 , 6 , 18 , 21 ) . in addition , it has been shown that individuals with more education earn higher wages . a greater wage is equal to higher average household income , thus enabling people to increase the quality and quantity of the healthcare services that they purchase . moreover , people with more education had higher sensitivity and awareness about proper nutrition , hygiene , and healthcare services as well as common illness - preventative measures ( 6 ) . we used the number of doctors per 10,000 population as a proxy for access to healthcare . the present study indicates a positive and statistically significant relationship between number of doctors per 10,000 populations and leb . this can be explained by the fact that increasing the number of physicians may improve accessibility to primary and basic medical services , which increases the utilization of health services and leads to longevity . in othersword , shortage of medical personnel , particularly physicians , cause most people to not find a way to obtain ordinary medical care . a study conducted by balan and jaba ( 2 ) demonstrated that 10 % increase in the number of doctors increases leb by 0.07 in romania . rogers and wofford ( 22 ) have investigated that the main determinants of life expectancy for developing countries . their study revealed that the doctors per population play an important role in improving life expectancy in a developing nation . we expected the coefficient of co2 emissions on leb was negative , but , similar to other studies ( 6 , 18 , 23 ) , our finding indicated that the co2 emission has a positive ( albeit statistically insignificant ) effect on life expectancy in iran . ali and ahmad ( 23 ) have examined the impact of socioeconomic factors on life expectancy in the sultanate of oman over the period of 1970 to 2012 . the authors found a positive and insignificant direction between co2 emission and life expectancy , for which its coefficient is 0.21 . accordingly , global carbon dioxide ( co2 ) emissions have increased rapidly along with life expectancy and per capita income . our results showed that degree of urbanization and higher education level have a positive and insignificant statistically impact on life expectancy in iran . the positive effect degree of urbanization on leb can be explained by the fact that people living in urban areas have more access to healthcare services . in addition , people who are living in urban areas have more opportunities to more education , which makes them live longer . ( 18 ) in sub - saharan africa . a study by bayatti et al . ( 6 ) also demonstrated a positive relationship between degree of urbanization and life expectancy in emr countries . in contrast with our findings , a study conducted by halicioglu in turkey showed the degree of urbanization has a negative effect on life expectancy ( 19 ) . the total fertility rate ( tfr ) had a negative and statistically significant effect on leb in iran . this finding conforms with the studies conducted by ali and ahmad ( 23 ) in oman , singariya ( 24 ) in india and hussain ( 25 ) in 91 developing countries . also , our results indicated that inflation rate has a negative ( albeit insignificant statistically ) effect on life expectancy in iran . ( 4 ) have examined the determinants of life expectancy in pakistan between 1972 and 2012 . in their study , the misery index ( inflation + unemployment ) was used as one of the main determinants . the authors concluded that the misery index has a negative and significant impact on life expectancy in pakistan . this study has several limitations , and our findings should be interpreted with caution based on these limitations . first , there are other important factors ( e.g. , employment rate , healthcare spending , exchange rate ) , which might have played important roles in the life expectancy over the last three decades in iran . these factors , however , were excluded from the study due to the lack of time series information . second , in this study only aggregate data were included in the model ; although the analysis of the determinants of life expectancy can be improved , only data on type of individual behaviors such as smoking and food habits ( consumption of fats , sugar , fruits , and vegetables ) are available and included in the model . life expectancy at birth could be affected by several factors , including food availability , literacy rate , numbers of doctors per 10,000 population , gdp per capita , and total fertility rate . although some other factors such as urbanization and co2 emission can have a moderate impact on life expectancy , we could not find evidence to support it . the results suggested , however , that , in order to improve life expectancy in the country , health policymakers should focus on the factors that reside outside the healthcare system . finally , some other factors such as employment rate and healthcare spending are not included in the model , and future research may investigate how these factors have an impact on life expectancy in iran .\noutput:\n" }, { "from": "agent", "value": "introductionlife expectancy at birth ( leb ) is closely associated with the degree of economic and social development in developed and developing countries . this study aimed to examine the socioeconomic factors affecting leb in iran from 1985 to 2013 . methodstime series analysis was used to examine the effects of key explanatory factors ( gdp per capita , number of doctors per 10,000 population , degree of urbanization , food availability , co2 emission , total fertility rate , inflation rate , and literacy rate ) on leb in iran from 1985 to 2013 . study data were retrieved from the central bank of iran ( cbi ) , iranian statistical center ( isc ) , and world bank . augmented dickey fuller ( adf ) and banergy , dolado , and master ( bdm ) tests , engle granger approach , and an ordinary least - square ( ols ) model were used to achieve the aim of the study . data analysis was performed by stata v. 12 software.resultsour findings indicated that gdp per capita ( p = 0.003 ) , number of doctors per 10,000 population ( p = 0.036 ) , literacy rate ( p = 0.0001 ) , and food availability ( p = 0.0001 ) have a positive and significant statistically effect on leb . the relationship between total fertility rate and leb was negative and significant ( p = 0.023 ) . in addition , the effect of degree urbanization ( p = 0.811 ) , co2 emission ( p = 0.185 ) , and inflation rate ( p = 0.579 ) on leb were not significant.conclusiongdp per capita , number of doctors per 10,000 population , food availability , literacy rate , and total fertility were identified as the main factors affecting life expectancy in iran . the study , however , suggests that life expectancy in iran could be improved if attention is given to factors that reside outside of the health sector ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: iga nephropathy , first described by berger and hinglais in 1968 , is now one of the most common forms of primary glomerulonephritis . in most cases , it presents as the primary disease , but occasionally , it develops associated with another disease . henoch purpura is the most frequently associated disease , there are a lot of other cases associated with liver disease , inflammatory bowel disease , carcinoma or psoriasis . fabry disease ) is an x - linked recessive inborn error of glycosphingolipid catabolism caused by deficient activity of the lysosomal enzyme - galactosidase a ( - gal - a ) . it leads to many clinical manifestations such as angiokeratoma , acroparaesthesia , hypohydrosis , renal failure and cardiovascular disease . heterozygous females have variable levels of - gal - a activity , and clinical manifestations may range from asymptomatic to severe . here , we report an unusual case of iga nephropathy with concomitant fabry s disease that was incidentally diagnosed by electron microscopy . the patient had been healthy until she was 49 years old when hypertension and proteinuria were detected . her father died of lung cancer at the age of 82 , and had no renal or cardiovascular disease . the patient has one sister with a past history of paroxysmal atrial fibrillation and two healthy brothers . the patient was prescribed an angiotensin - converting enzyme inhibitor and a ca blocker at another hospital when she was 52 years old : good control of blood pressure was then attained , but proteinuria and haematuria persisted . her blood pressure was 126/70 mmhg , pulse was 63 beats / min and body temperature was 35.8 c . physical examination of the head , face , breast , abdomen and extremities showed no abnormalities . the values of blood biochemical parameters were urea nitrogen 5.36 mmol / l ( 15 mg / dl ) , creatinine 47.7 mol / l ( 0.54 mg / dl ) , uric acid 291 mol / l ( 4.9 mg / dl ) , total protein 74 g / l , albumin 43 g / l and iga 4.26 urinalysis showed a ph 6.0 , 2 + of protein , 3 + of occult blood and no glucose . urine sediment was significant for microhaematuria ( 5099 / high power field ) , and hyaline , epithelial and red blood cell casts . the 24 - h protein excretion was 0.2 g , and the level of urine n - acetyl -- d - glucosaminidase was 6.0 u / g creatinine .30 glomeruli were examined , two of which showed global sclerosis and three showed fibrous crescent formation ( figure 1a and b ) . the remaining glomeruli revealed segmental to global proliferation of mesangial cells and mesangial matrix expansion . immunofluorescence microscopy revealed intense granular deposition of iga , igm and c3 in the mesangial area ( figure 1c ) . these light and immunofluorescence microscopic findings were indicative of iga nephropathy . the results of electron microscopy ( figure 2a and b ) obtained later revealed electron - dense deposits thought to be immune deposits of iga in the paramesangial area . moreover , lamellar inclusions , structures characteristic of fabry s disease , were partially observed in epithelial cells . light micrographs were examined in detail , and only one epithelial lesion and / or endothelial vacuolation compatible with the diagnosis of fabry s disease was detected in one glomerulus ( figure 2c ) . the level of leucocyte - gal - a activity was 15.5 agal u ( normal range : cut - off 20.0 agal u ) . to further confirm the diagnosis of fabry s disease , a genetic study of the gla genewas performed . in exon 7 , codon 359 , there was a cytosine instead of thymine . this mutation , which has not been previously reported as far as we investigated , produces an amino acid change from isoleucine to threonine at this position ( i359 t ) . the diagnosis of fabry s disease was thus established based on the results of this gene analysis . nevertheless , the typical symptoms of fabry s disease neuropathic pain , exercise intolerance , gastrointestinal symptoms , hypohydrosis and angiokeratomas were not observed in this patient . echocardiography showed that there was no left ventricular hypertrophy , and she did not present any ocular finding such as corneal changes . after obtaining the informed consent , mutation analysis of the gla gene was performed in the mother , sister and son of the proband , using the standard restriction fragment length polymorphism method ( figure 3 ) . although the proband has two brothers who seemed to be healthy , gene analysis was not done because they did not provide informed consent . the mutation was not detected in the mother nor in the son , but it was detected in the proband s sister . we speculated that the deceased father of the proband had carried the gla gene mutation , but none of his siblings had a medical history suggesting fabry s disease . incidentally , further examination of the proband s sister was performed because she had had a history of paroxysmal atrial fibrillation . the 12 - lead and 24 - h holter electrocardiogram revealed no pathological findings , and echocardiography showed no left ventricular hypertrophy . she did not appear for the follow - up examination 12 months later , and the clinical course thereafter is unknown . this patient has been treated with 10 mg of enalapril for iga nephropathy . as for the treatment of fabry s disease , atherosclerosis ( arrow ) is detectable in this low power field ( pas 40 ) . ( b ) proliferation of mesangial cells , mesangial matrix expansion , focal sclerosis and fibrous crescents compatible with iga nephropathy ( pas 400 ) . ( a ) , ( b ) lamellar inclusions ( arrow ) partially observed in the epithelial cells [ ( a ) 1000 and ( b ) 5000 ] . ( c ) epithelial and endothelial vacuolation ( arrowhead ) compatible with fabry s disease in a glomerulus ( pas 400 ) . since gene analysis showed that the mother of the proband was not affected , the father of the proband was thought to be affected . fabry s disease is an x - linked disease that is fully expressed in hemizygous males . heterozygous females , however , have variable levels of - gal - a activity . in heterozygous females , clinical manifestations may range from asymptomatic to severe , similar to hemizygous males . in this case , there were no apparent clinical symptoms or family history of fabry s disease , and it was virtually impossible to detect it at an earlier stage . three reports of iga nephropathy and concomitant fabry s disease have already been published in the english literature . the first report described the case of a 36 - year - old japanese woman with proteinuria and haematuria who had no clinical manifestations of fabry s disease . the second report described a 28 - year - old japanese man whose - gal - a activity was very low , and his mother s - gal - a activity was low . the third report referred to two adolescent sisters whose father had fabry s disease , and they had the typical manifestations of fabry s disease . typical histological features of fabry s disease were observed in light photomicrographs in all these cases . including our case , three reports ( 75 % ) were from japan , and four patients ( 80 % ) were females . the incidence of iga nephropathy in east asian countries is thought to be relatively high , but fabry s disease is rare in japan , although its precise incidence has not been determined . the specific relationship between iga nephropathy and fabry s disease has not been unveiled , but it is reported that the incidence of autoantibody - positive patients was high in fabry s disease . there might be some immunogenic mechanisms linking iga nephropathy with fabry s disease . in our patient , renal involvement of fabry s disease was so mild that it was almost impossible to detect the complication of this disease from light microscopic findings . however , arteriosclerosis had developed to some extent , and it was not only due to hypertension considering her hypertension history but also to arteriopathy caused by fabry s disease . no other cardiac manifestation was observed in this patient , which was considered quite uncommon since only one case of renal - limited fabry s disease without cardiac involvement has been previously reported . another peculiar point of this case is that the deceased father of the proband whose gla gene was assumed mutated lived out his 82 - year life without any manifestation of fabry s disease . however , it is not so exceptional in fabry s disease that patients of the family with the same mutation can have markedly variable phenotypes due to the influence of modifier genes and / or other genetic and environmental factorsas far as we investigated , there has been no report of electron microscopic findings as the first findings indicative of fabry s disease . the reason for female dominance in this overlapping morbidity is not understood at present . in male patients with fabry s disease , symptoms generally appear in childhood , and the clinical course is rapid . therefore , progression of fabry s disease to end - stage renal disease may precede the onset of iga nephropathy in patients not subjected to renal biopsy . the cause of proteinuria and haematuria in our patient seemed to be iga nephropathy more than fabry s disease . enalapril was administered for iga nephropathy aiming at reducing proteinuria , and no other renal protective therapies nor corticosteroids were introduced because the disease activity was not high . as for the treatment of fabry s disease , this may be controversial . this patient was thought to be heterozygous , and there was no clinical manifestation except for a minor renal lesion possibly due to a relatively preserved enzyme level . several reports , however , indicate the importance of enzyme replacement therapy from an early stage , from renal and cardiac viewpoints . enzyme replacement therapy was therefore adopted after considering the pros and cons . setting - up a screening target of fabry s disease is an issue that remains to be solved because it was completely impossible to suspect fabry s disease in this patient before tissue examination by electromicroscopy . in the future\noutput:\n" }, { "from": "agent", "value": "we present the case of a woman with iga nephropathy and concomitant fabry s disease . she was referred to our hospital with proteinuria and haematuria . a renal biopsy showed findings indicating iga nephropathy under light and immunofluorescence microscopy . electron microscopy , however , showed laminated inclusion bodies characteristic of fabry s disease . the - galactosidase activity in her serum was low , and the diagnosis of fabry s disease was confirmed by genetic analysis . fabry s disease in a patient with iga nephropathy is a very rare occurrence , and fabry s disease diagnosed only by electron microscopy has not been previously reported ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: one of the problems in the scope of dentistry is postoperative complications ; the most common ones are pain , bleeding , swelling and trismus . precise assessment and control of these symptoms , especially pain , is very effective to gain patient 's comfort .1 pain is a series of unpleasant psycho - physiological experience that often begins with harmful provocations , and then is transferred to the cns through nerve fibers .2 the pain after operation is increased by inflammation combined with primary repair . use of non steroidal anti - inflammatory drugs ( nsaids ) , to control the pain , is more effective than narcotics , due to blocking the source of pain which in fact , is inflammation .3 one of the nsaids is diclofenac , which reduces duration of pain .4 like other nsaids , diclofenac inhibits the production of cyclooxygenase enzyme and prevents the arachidonic acid converting to other compounds such as prostaglandins . analgesic effect of the drug is related to its peripheral anti - inflammatory effect and probably by weakening the pain threshold under the thalamus cortex , then the pain is decreased or interrupted .5 at high drug concentrationsin tissues , it seems that diclofenac can act as sodium channel blocker which is mediated by topical analgesic .6 according to systemic complications associated with the use of nsaids , it is preferred to relief pain and inflammation by using topical medications .7 the main benefit of topical application of a drug is the access to more concentration compared to the systemic use and minimizing side - effects . in addition , mucosal surface has usually rich source of blood that causes quick drug transfer in to systemic blood circulation and in most cases prevents the primary metabolism by liver .8 oral rinse , oral suspension and rhombus tablets are the highest dosage forms of topical oral prescriptions .9 diclofenac mouthwash can be a good example in this field that by reducing the required dose of ibuprofen reduces its side effects .10 therefore , the aim of this study was to assess the effect of diclofenac mouthwash on periodontal postoperative pain . this study was conducted as an experimental , double - blind , randomized clinical trial . twenty patients ( 5 males and 15 females ) with the age range between 22 and 54 years , who required mwf ( modified widman flap ) operation in two quadrants of their mouth ( preferably maxilla ) were selected . the symmetry of two quadrants which required operation were confirmed through clinical examination and radiography and all operations were performed by a certain surgeon . after scaling and root lanning and completing the phase i of treatmenteach patient was given local anaesthesia using lidocaine 2 % and epinephrine 1 / 80000 in tow operations . after the operation , no periodontal dressing ( co - pack ) was used and it was emphasised that the patients not to use any other drugs to control the pain but ibuprofen 400 mg every 6 hours and to continue to use it as required . following the operation of one quadrant , in addition to ibuprofen , some patients randomly received diclofenac mouthwash to use 4 times a day for 30 seconds each time ( for a week ) and one month later , in the opposite quadrant which was used as control side , ibuprofen and placebo mouthwash was prescribed to be used in the same order . patients were advised to use ibuprofen only in case of pain and to record the number of ibuprofen pills taken . also , they were advised to record their pain scores based on vas index that is from 0 - 10 in the questionnaires on the first , second and third days and a week after the operation . the patient 's satisfaction with the operation was questioned as well as their preference of mouthwash after using both diclofenac and placebo mouthwashes . the forms were collected for review on the day that the patients attended to remove the stitches . average pain intensity and ibuprofen consumption were compared between the study and control quadrants.the patients were required to record their satisfaction of surgery of both quadrants in high , moderate and low levels . the findings were evaluated and analysed using spss , the frequent two - way anova , statistical t - test and wilcoxon.p - value lesser than 0.05 considered to be significant . the average pain intensity and the number of ibuprofen pills taken in the first week after operation in both study and control quadrants are presented in table 1 . average pain intensity and number of ibuprofen consumption in both groups a week after operation the average values of post operative pain intensity in the study and control quadrants in four time periods are presented in figure 1 . average pain intensity values in the study and control groups at four time periods after opneration . the moderate and high satisfaction rates in the diclofenac consumption were 20 % and 80 % , respectively . the moderate and high satisfaction rates in the placebo consumption were 45 % and 55 % , respectively . during this study , the effect of diclofenac mouthwash was assessed on periodontal postoperative pain and the findings indicated that the maximum intensity of pain in both groups was on the first day after the operation and it reached its lowest level on the seventh day . in evaluating the vas index in four separated time periods after operation ( the first , second , third and seventh days ) , the mean vas in the study group was lower than that in the control group in each day . although there was a significant difference on the second day , but no significant differences were observed on other days between the two groups ( figure 1 ) . mean vas in study group was significantly lower than that of the control group which indicated the positive effects of diclofenac mouthwash in reducing the pain . the results of our study were consistent with the results in tramer and colleagues study10 and weinstein 's study .11 according to weinstein11 study which was conducted in 2001 , the average pain intensity in diclofenac mouthwash consumers was lower than placebo mouthwash consumers in the day of the operation and the day after the periodontal operation at 8 pm . gingival indices including bleeding and color were significantly improved by diclofenac mouthwash compared to placebo . according to this study , the diclofenac mouthwash presented a very well effect and safety in treating inflammation associated with oral or periodontal operation .11 also , in the study conducted by tramer and colleagues in 2001,10 the periodontal postoperative pain was significantly reduced by using diclofenac mouthwash on the day after operation . benefits of our study comparing to the above two studies included assessing pain severity in longer time periods ; also , since the study and control groups in this study were the same , destructive impact factors decreased . in the study conducted by iraji4 in 2005the purpose was to evaluate the effects of 3 % diclofenac in 2.5 % hyaluronan base versus 2.5 % gel base alone on the pain , duration , and healing time of minor aphthous ulcers . the results showed that diclofenac gel is effective in reducing pain duration of the minor ras although it is not effective in healing of it .4 according to the results obtained , diclofenac mouthwash was effective in reducing the periodontal postoperative pain but since in our study , the ibuprofen painkiller was also taken , and to ensure that the pain relief was not entirely related to the effects of ibuprofen , repeated two - way anova was performed considering time and group variables and the removal of ibuprofen which similar results were obtained again . there was not any significant difference observed on the average ibuprofen consumption between the two groups . this can be due to lack of patients knowledge about the mouthwashes or the fear of coming pain that made them to take ibuprofen even before the postoperative pain starts . another reason could be the inadequate impact of the mouthwash to control pain alone that made patients to take ibuprofen . more detailed studies with larger sample numbers in this context are required . among the oral rinses , 60 % of patients preferred the diclofenac mouthwash , which could be due to the relief effect of diclofenac mouthwash and the patients pain palliation in the study group . also , the satisfaction rate of operation was higher in the diclofenac mouthwash consumption . basically , one of the effective factors in patient satisfaction of dental procedures is the amount of pain that the patient will suffer ; therefore , the reason for higher satisfaction of operation in the study group might be due to experiencing less postoperative pain . topical application of diclofenac may make higher drug concentration in tissues that is higher than the drug density used systemically ; so it is likely that other mechanisms are involved in analgesic effect of diclofenac . in high tissue concentration , it seems that diclofenac could act as sodium channel blockers which mediates the topical analgesia . behavioural studies on rats suggest that similar concentration of diclofenac may open the sensitive potassium channels to atp ; however , the importance of this mechanism on the skin receptors is more than muscle receptors . topical application of diclofenac makes the concentration of drug in tissue essentially higher than the concentration needed to inhibit the cyclooxygenase enzyme . therefore , it is suggested that other mechanisms could also accompany the performance of topical medication .6 it appears following the use of topical diclofenac , a collection of topical and environmental - systemic effects , causes more reduction in pain . also , it seems that diclofenac mouthwash alone is not sufficient to control the pain and should be associated with systemic use of other painkillers such as ibuprofen . in the analyses by eliminating the effects of ibuprofen , diclofenac mouthwash acted effectively in relieving pain but more researches with a bigger sample size , without taking any other painkillers are required to accredit this result .\noutput:\n" }, { "from": "agent", "value": "background : the need to relieve pain and inflammation after periodontal surgery and the side effects of systemic drugs and advantages of topical drugs , made us to evaluate the effect of diclofenac mouthwash on periodontal postoperative pain.methods : in this double - blind , randomized clinical trial study 20 quadrants of 10 patients ( n = 20 ) aged between 22 - 54 who also acted as their own controls , were treated using modified widman flap procedure in two quadrants of the same jaw with one month interval between the operations.after the operation in addition to ibuprofen 400 mg , one quadrant randomly received diclofenac mouthwash ( 0/01 % ) for 30 seconds , 4 times a day ( for a week ) and for the contrary quadrant , ibuprofen and placebo mouthwash was given to be used in the same manner . the patients scored the number of ibuprofen consumption and their pain intensity based on vas index in a questionnaire in days 1 , 2 , 3 and the first week after operation . the findings were analysed using two - way anova , t - test and wilcoxon . p - value less than 0.05 considered to be significant.results : there was a significant difference between the mean values of pain intensity of two quadrants in four periods ( p = 0.031 ) . but , there was no significant difference between the average ibuprofen consumption in two groups ( p = 0.51 ) . postoperative satisfaction was not significantly different in two quadrants ( p = 0.059 ) . 60 % of patients preferred diclofenac mouthwash.conclusion : diclofenac mouthwash was effective in reducing postoperative periodontal pain but it seems that it is nt enough to control postoperative pain on its own ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: t helper 17 ( th17 ) cells , characterized by interleukin - 17 ( il - 17 ) production , play a critical role in the pathogenesis of autoimmune disease . in dermatological fields , previous reports suggested that th17 cells are associated with various dermatological disorders , including autoimmune bullous disease such as pemphigus vulgaris ( pv ) and bullous pemphigoid ( bp ) . aplastic anemia ( aa ) , characterized by peripheral blood pancytopenia and bone marrow hypoplasia , is an immune - mediated disorder . recently , it was reported that the th17 immune response contributes to the aa pathophysiology . in this reportinterestingly , biopsy specimens from involved skin lesions included il -17-producing cells in the superficial dermis , which might suggest a relationship between il - 17 and the pathogenesis of bp accompanied by aa . a 58 - year - old japanese man visited our outpatient clinic with a half - month history of pruritic bullous erythema on his trunk and extremities . he had been treated for aplastic anemia ( aa ) by a hematologist for twenty years in another institute . on his initial visit , physical examination revealed large tense bullae and erosion arising on erythematous plaque on the trunk and extremities ( fig .1 ) . a biopsy specimen revealed prominent subepidermal blister formation and dense infiltration of eosinophils in the upper dermis ( fig . direct immunofluorescent study revealed igg deposition on the epidermal side of the basement membrane zone . a full blood count and biochemical profile revealed a prominent decrease of white blood cells ( 2,500 / l ) , platelets ( 20,000 / l ) and red blood cells ( 2.2610 / l ) . in addition , high levels of serum anti - bp180 igg ( 2,180 index ) and platelet - associated igg ( 375 ng / 10 cells ) were detected . from the above findings , we diagnosed this patient as bp accompanied by aa . to further investigate the correlation between aa and bp , we employed immunohistochemical staining for il - 17 ( r & d system , minneapolis ) . immunohistochemical staining revealed il -17-positive cells were infiltrating around the blister and upper dermis ( fig . we treated him with oral prednisolone 30 mg / day for two weeks without any improvement . then , we administered oral prednisolone 50 mg / day with cyclosporine 2.5 mg / kg / day . two weeks later , the initial eruptions had disappeared and his disease was under control . aa , a disease characterized by peripheral blood pancytopenia and bone marrow hypoplasia , is an immune - mediated disorder and , in most cases , with active destruction of hematopoietic cells by effector t cells . recently , de latour et al . reported the significance of the th17 immune response in aa pathophysiology , especially at the early stage in the disease progression . they reported an increased number and frequency of th17 cells in bone marrow and peripheral blood in patients with aa along with a reduction of regulatory t cells ( tregs ) . they concluded that the th17 immune response may contribute to the recruitment of th1 cells and may be important for the proinflammatory cytokine milieu in the bone marrow during the early stages of bone marrow failure . th17 cells have been characterized in mice as a novel subset of cd4 + t cells that produce il - 17a and il - 17f , and il - 22 , and serve as immune effectors in autoimmunity . in human , several studies have reported the association of il - 17 with autoimmune diseases , such as rheumatoid arthritis , multiple sclerosis , and lupus erythematosus . in bullous disorders , recently , arakawa et al . reported the significance of lesional th17 cells in bp . they mentioned that bp shows more th17 cell - related inflammation and less treg - related regulation compared with pemphigus . in aggregate , th17 seems to contribute the pathogenesis of both aa and bp . for the above reasons , in this report , we employed immunohistochemical staining for il - 17 . as we expected , we detected il -17-positive cells in superficial dermal areas of the bp specimens . though we did not examine il -17-producing cells in the circulating peripheral blood , our present case might suggest relationships between il - 17 and the pathogenesis of bp accompanied by aa .\noutput:\n" }, { "from": "agent", "value": "th17 cells , characterized by il - 17 production , play a critical role in the pathogenesis of autoimmune diseases , including autoimmune bullous disorders and aplastic anemia ( aa ) . in this report , we describe a 58 - year - old japanese man with bullous pemphigoid ( bp ) accompanied by aa . interestingly , immunohistochemical staining revealed the existence of il -17-producing cells in the skin biopsy specimens from bp . our findings might suggest relationships between il - 17 and the pathogenesis of these autoimmune diseases , and , to our knowledge , this is the first english report of bp accompanied by aa ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: congenital tuberculosis is a rare clinical presentation of tuberculosis infection . even in areas endemic for the disease , congenital tuberculosis has rarely been reported . we report a 6 - week - old female infant who presented with difficulty in breathing since birth . the diagnosis was made based on x - ray chest , which showed milliary mottling of lungs and demonstration of mycobacterium tuberculosis in endometrial biopsy of mother . the case was further complicated by pulmonary interstitial emphysema ( pie ) , thus causing prolonged oxygen dependence and suspicion in correctness of diagnosis . however , the patient showed clinical improvement and clearing of the pulmonary and splenic tuberculous lesions after anti - tuberculosis treatment . thus , the case is being reported to increase awareness and index of suspicion of the medical practitioners in endemic areas about congenital tuberculosis . the disease should be considered as a differential diagnosis in infant and neonatal pneumonias and there should be ante - natal screening of high risk mothers . the present case report is about a 6 - week - old female child who presented to the department of pediatric with difficulty in breathing since birth and progressively worsening cough since 15 days . she was tachypneic ( respiratory rate = 98 / min ) , with severe subcostal and intercostal recessions . [ figure 1 ] ultrasonography showed hepatosplenomegaly with tiny hypoechoic nodules in spleen suggestive of granulomatous pathology . chest radiograph showing milliary mottling the child 's mother was counseled and investigated for tuberculosis . there was no abnormality detected on chest radiograph of mother and her sputum was negative for afb . however , the diagnosis of genital tuberculosis was confirmed by endometrial biopsy which was positive for afb . thus , the child and the mother both were put on anti - tuberculosis treatment . the child remained on ventilatory support for 6 days and was put on bubble continuous positive airway pressure for the next 10 days . thus , she was put on oxygen inhalation by nasal prongs and remained oxygen dependent for 2 months . computed tomography scan report showed multiple diffuse consolidations and thin walled cystic lesions in upper and middle lobes . [ figure 2 ] the multiple cystic lesions were reported by the radiology department as interstitial pulmonary emphysema / tuberculous bullae ; and were the explanation for air entrapment and prolonged oxygen dependence . thus , the case was a unique case in which congenital tuberculosis , a rare entity itself was complicated by pie , resulting in prolonged oxygen dependence . the child recovered slowly and was put off the oxygen inhalation by nasal prongs after 2 months . he was thus discharged in a satisfactory condition from the hospital after 2.5 months . on follow - up visit to the outpatient department after 2 weeks , there was marked clinical improvement . repeat chest radiograph and ultrasonography showed clearing of tuberculous lesions . computed tomography - scan showing pulmonary interstitial emphysemacongenital tuberculosis is defined as tuberculosis occurring in infants caused by infection during the intrauterine life or before complete passage through the birth canal . in spite of high incidence of tuberculosis and its sub - clinical forms in women of reproductive age group in developing countries , the probable reason for the rarity may be under - reporting of the disease and lack of good diagnostic tools . diagnostic criteria for congenital tuberculosis were proposed in 1935 by beitzke : ( i ) tuberculosis firmly established in 1 few days of life , ( ii ) primary complex in the liver , ( iii ) lesions presenting in 1 few days of life , when extrauterine infection has been excluded with certainty . cantwell later made a modification in the criteria in 1995 according to which there should be proven tuberculosis lesion in the infant plus one of the following : lesions occurring in the 1 week of life , a primary hepatic complex , maternal genital tract or placental tuberculosis and exclusion of postnatal transmission by thorough investigation of contacts . in this age group , the criteria used to differentiate congenital from post - natally acquired tuberculosis is the mode of acquiring the disease . for a diagnosis of congenital tuberculosis to be established there should be a proof of antenatal transmission while the disease may either be acquired in early postnatal period . some experts suggest that distinguishing congenital from early post - natally acquired tuberculosis is clinically irrelevant as presenting clinical features , treatment and immediate prognosis are similar . our case qualifies the diagnosis of congenital tuberculosis as she had milliary tuberculosis lesions in lungs with evidence of endometrial biopsy being positive for afb in the mother . however , the case was unique due to prolonged oxygen requirement for 2.5 months due to pie in spite of starting anti - tuberculosis treatment within first 3 days of admission . pie is a serious complication of mechanical ventilation , associated with prematurity and respiratory distress syndrome . barotrauma of mechanical ventilation , causes rupture of the alveolar space at its junction with less expandable fluid - rich perivascular connective tissue . the air leaks into the perivascular sheath and dissects it , giving rise to pie , pneumothorax and pneumo - mediastinum . in most of the cases , treatment for pie is conservative including high frequency oscillation ventilation , lateral decubitus positioning . in our case , the bullous tuberculous lung tissue was complicated by further air trapping due to pie , thus leading to prolonged oxygen dependence . based on the above case study , it can be concluded that congenital tuberculosis should be considered as a differential diagnosis in neonatal and infant pneumonias . the medical practitioners should have high index of suspicion for the disease especially in neonates born to high risk mothers in endemic areas . prolonged oxygen requirement in such cases may be due to ventilation inflicted interstitial emphysema worsened by bullous disruption of tuberculosis . the case report also signifies the need for maternal screening for tuberculosis in endemic areas .\noutput:\n" }, { "from": "agent", "value": "we report a case of congenital tuberculosis , a rare entity itself ; complicated by pulmonary interstitial emphysema , thus leading to air entrapment in lungs and prolonged oxygen dependence . the diagnosis of congenital tuberculosis is often missed and under - reported due to low index of suspicion and less sensitivity of diagnostic tools ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sodium valproate is a broad - spectrum antiepileptic that has proven efficacy against all seizure types , which makes it a useful antiepileptic when the exact seizure classification is unknown or multiple seizure - types exists . the aromatic antiepileptics , namely , phenytoin , carbamazepine , phenobarbitone , and primidone can cause hypersensitivity reactions . for example , carbamazepine can cause pruritic and erythematous rashes , urticaria , photosensitivity reactions , exfoliative dermatitis , alopecia , diaphoresis , erythema multiforme , stevens - johnson syndrome ( sjs ) , and toxic epidermal necrolysis ( ten ) . in such a case carbamazepineis discontinued and nonaromatic antiepileptics like sodium valproate or a benzodiazepine is usually recommended as an alternative therapy . the common side effects of valproate include anorexia , nausea , vomiting , sedation , ataxia , tremor , alopecia , stimulation of appetite , elevation of hepatic transaminases , and rarely fulminant hepatitis . stevens - johnson syndrome is rarely reported with it . in most of the reported cases of sjs due to valproate , it has been found when it is given with other drugs . sjs due to valproate monotherapy is rarely reported . a 20 - old - medical student had a past medical history of migraine and generalized seizures , with postictal visual and auditory hallucinations , for which sodium valproate 900 mg was prescribed . his baseline investigations , such as , liver function and complete hemogram were within normal limits . after seven days he developed fever with myalgia , followed by lesions in the oral cavity two days later . on examination there were erosions in the oral and nasal mucosa [ figure 1 ] . his complete hemogram , liver function tests , and chest x - ray , were within normal limits . the stevens - johnson syndrome and toxic epidermal necrolysis are rarely reported side effects of valproate . rzany et al , in a case control study on the risk of sjs and ten with various anti - epileptic agents , reported the univariate relative risk as , 120 for carbamazepine , 91 for phenytoin , 57 for phenobarbital , 25 for lamotrigine , and 24 for valproate within the first eight weeks of therapy . the association of sjs with valproate was confounded by concomitant short - term therapy with other casual drugs in many studies . roujeau et al , conducted a case control study to quantify the risks associated with the use of specific drugs . drug use before the onset of disease was compared in 245 people who were hospitalized because of ten or sjs and 1147 patients hospitalized for other reasons . the crude relative risk for sjs or ten was as follows : carbamazepine , 90 ; phenytoin , 53 ; phenobarbital , 45 , and valproic acid , 25 . suresh kumar pn et al , reported a case of sjs after he was put on sodium valproate 600 mg per day , haloperidol 10 mg per day , and trihexiphenidyl 4 mg per day , which resolved after withdrawing sodium valproate and putting him on systemic steroids . in most of the studies , sjs was caused by valproate , when it was used in combination with other drugs . in our case sjs was found with valproate monotherapy and was limited only to the mucosa . as sodium valproate may also cause stevens - johnson syndrome , one should be careful while initiating therapy with valproate .\noutput:\n" }, { "from": "agent", "value": "a case of stevens - johnson syndrome following treatment with sodium valproate is presented here . a 20 - year - old male was put on sodium valproate monotherapy for the migraine , with generalized epilepsy . he developed vesicles and bullae in the oral and nasal mucosa with conjunctivitis , after 10 days of treatment . the lesions resolved after treating with systemic steroids . this case has been presented because stevens - johnson syndrome with sodium valproate monotherapy has been very rarely reported ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cones are a type of sea snails that belong to the conus genus , which is a widespread genus of sea snails . the first conus venom peptides were isolated and characterized two decades ago ( 1 ) , and the systematic investigation of cone snail toxins has continued at an accelerating pace . these unique marine organisms deliver their venom through a specialized radular tooth that serves as both a harpoon and disposable hypodermic needle . the venom of each species contains up to 200 pharmacologically active components that mainly target different voltage - and ligand - gated ion channels ( 2 , 3 ) . conotoxins from cone snails are interesting molecules with a diverse human therapeutic potential , such as analgesic , antiepileptic , cardio - and neuro - protective activity ( 4 , 5 ) . with respect to the venom action on the prey , the various conopeptides are classified according to their biological role for the immobilization of prey ( 6 - 8 ) . conotoxins are generally classified as , , , , and classes ( 9 ) . - mviia ( ziconotide ) is fda approved and the other conopeptides like conantokin - g , a - vc1 .1 and cgx - 1204 are candidates as pharmaceutical drugs ( 4 ) . the present study was aimed to find analgesic activity in the venom of persian gulf conus textile . the conus textile samples were obtained from persian gulf - larak island , from depth of 7 m because of their great abundant in this area in the south of iran , in may 2012 ( figure 1 ) . coordinates of sampling place was n 2652 ' 25.41 \" , e 5620 ' 01.02 \" ( figure 2 ) . the length of specimens ranged from 3 - 7 cm ( figure 3 ) . swiss albino mice weighing 20 to 25 g were chosed after an acclimatization period of at least 7 days in the laboratory environment and standard food pellets and water was provided . specimens were dissected on a petri dish on ice and the venom ducts were removed and the extraction of venom was performed same as previously published method with some modifications ( 10 , 11 ) . the venom ducts were homogenized ( silent crasher , heidolph - germany ) at 16000 rpm for 5 min with 200 l of cold sterile water . finally , the supernatant was lyophilized in a freeze dryer ( 2 - alpha , christ - germany ) and stored at -20 c . sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) was carried out according to standard method ( 12 ) . the venom samples were loaded onto a 15 % polyacrylamide gel ( 13 ) , at 100 v for 90 min . solutions for preparing 15 % resolving gel included h2o ( 1700 l ) , 30 % acrylamide mix ( 3750 l ) , 1.5 m tris ( ph 8.8 , 1950 l ) , 10 % sds ( 75 l ) , 10 % ammonium persulfate ( 75 l ) and n , n , ld50 of a toxin is the dose required to kill half the members of a tested population after specified test duration . in this study ,36 mice were divided into six groups and conus textile crude venom was injected ip in dose ranges 260 g / kg , 300 g / kg , 425 g / kg , 3 mg / kg , 25 mg / kg , 50 mg / kg , 60 mg / kg and 100 mg / kg . the number of dead mice and clinical symptoms were recorded during 48 hour after injection ( 14 ) . to evaluate the central analgesic effects of crude venom in mice , the formalin test is useful to investigate drug effects on both acute and persistent pain because it produces two phases of nociceptive behavior ( 5 ) . normal saline in the volume of 5 l injected intrathecally as negative control , 5 min before formalin test . intrathecal drug injection means the use of a therapeutic substance by injection into the subarachnoid space of spinal cord . mice were shaved on the lower back to help visualize the lumbar region . a 30 - gauge needle attached to a 100l insulin syringewas inserted between the l5 and l6 vertebrae and then injection was carried out . thereafter , 10 l of 5 % formalin in saline were subcutaneously injected into the plantar surface of the left hindpaw ( n = 7 ) , ( 17 ) , and the nociceptive behaviors were observed . the elicited behaviors including licking , biting , scratching or shaking were observed but licking behavior counted . throughout this experiment , the mice were observed in a transparent observation chamber . the time period for first phase was from 0 - 5 min ( acute pain ) after injection , while the second phase was from 20 - 40 min ( inflammatory pain ) after injection . morphine ( 5 ng / 5 l , 10 ng / 5 l , 20 ng / 5 l , 60 ng / 5 l and 100 ng / 5 l ) injected intrathecally as positive control , 5 min before formalin test . then , 10 l of 5 % formalin in saline were subcutaneously injected at the same way , and the licking behavior was recorded . the mice in each test group ( n = 7 ) were intrathecally injected with 5 , 10 , 20 , 60 , and 100 ng of crude venom ( 5 l ) . then formalin test performed as described above . differences between groups in the first and second phase were tested with two - way analysis of variance ( anova ) . the results of similar doses between two phases were compared by student t - test . the conus textile samples were obtained from persian gulf - larak island , from depth of 7 m because of their great abundant in this area in the south of iran , in may 2012 ( figure 1 ) . coordinates of sampling place was n 2652 ' 25.41 \" , e 5620 ' 01.02 \" ( figure 2 ) . the length of specimens ranged from 3 - 7 cm ( figure 3 ) . swiss albino mice weighing 20 to 25 g were chosed after an acclimatization period of at least 7 days in the laboratory environment and standard food pellets and water was provided . specimens were dissected on a petri dish on ice and the venom ducts were removed and the extraction of venom was performed same as previously published method with some modifications ( 10 , 11 ) . the venom ducts were homogenized ( silent crasher , heidolph - germany ) at 16000 rpm for 5 min with 200 l of cold sterile water . finally , the supernatant was lyophilized in a freeze dryer ( 2 - alpha , christ - germany ) and stored at -20 c . sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) was carried out according to standard method ( 12 ) . the venom samples were loaded onto a 15 % polyacrylamide gel ( 13 ) , at 100 v for 90 min . solutions for preparing 15 % resolving gel included h2o ( 1700 l ) , 30 % acrylamide mix ( 3750 l ) , 1.5 m tris ( ph 8.8 , 1950 l ) , 10 % sds ( 75 l ) , 10 % ammonium persulfate ( 75 l ) and n , n , n , n - tetramethyl ethylene diamine ( 5 l ) . ld50 of a toxin is the dose required to kill half the members of a tested population after specified test duration . in this study ,36 mice were divided into six groups and conus textile crude venom was injected ip in dose ranges 260 g / kg , 300 g / kg , 425 g / kg , 3 mg / kg , 25 mg / kg , 50 mg / kg , 60 mg / kg and 100 mg / kg . the number of dead mice and clinical symptoms were recorded during 48 hour after injection ( 14 ) . to evaluate the central analgesic effects of crude venom in mice , formalin test was carried out as previously described ( 15 ) . the formalin test is useful to investigate drug effects on both acute and persistent pain because it produces two phases of nociceptive behavior ( 5 ) . normal saline in the volume of 5 l injected intrathecally as negative control , 5 min before formalin test . intrathecal drug injection means the use of a therapeutic substance by injection into the subarachnoid space of spinal cord . mice were shaved on the lower back to help visualize the lumbar region . a 30 - gauge needle attached to a 100l insulin syringewas inserted between the l5 and l6 vertebrae and then injection was carried out . thereafter , 10 l of 5 % formalin in saline were subcutaneously injected into the plantar surface of the left hindpaw ( n = 7 ) , ( 17 ) , and the nociceptive behaviors were observed . the elicited behaviors including licking , biting , scratching or shaking were observed but licking behavior counted . throughout this experiment , the time period for first phase was from 0 - 5 min ( acute pain ) after injection , while the second phase was from 20 - 40 min ( inflammatory pain ) after injection . morphine ( 5 ng / 5 l , 10 ng / 5 l , 20 ng / 5 l , 60 ng / 5 l and 100 ng / 5 l ) injected intrathecally as positive control , 5 min before formalin test . then , 10 l of 5 % formalin in saline were subcutaneously injected at the same way , and the licking behavior was recorded . the mice in each test group ( n = 7 ) were intrathecally injected with 5 , 10 , 20 , 60 , and 100 ng of crude venom ( 5 l ) . differences between groups in the first and second phase were tested with two - way analysis of variance ( anova ) . the results of similar doses between two phases were compared by student t - test . the recorded signs included reversible strong muscular paralysis at left hindpaw and drooping of both eyelids . two - way anova was calculated to determine the significant differences between groups in first and second phase , which no significant activity differences was observed at 5 , 10 and 20 ng of crude venom concentrations in the first phase ( p 0.05 ) . results of both phases of 60 and 100 ng were similar to control ( p = 0.00 ) . comparison between the control and crude venom doses 5 , 10 and 20 showed significant differences in both phases . significant differences ( p 0.05 ) observed between 100 ng and the other doses of crude venom ( 5 and 10 ng ) . results of 10 ng of crude venom and morphine were similar in second phase ( p = 0.27 ) . ascending amounts of morphine ranged from 5 - 100 ng reduced pain significantly and 100 ng had the most analgesic effect . unlike the crude venom , morphine was more effective in high concentration . all morphine doses except for 10 ng were significantly more analgesic than crude venom in both phases . the analgesic effect of 10 ng conus venom was the same as morphine for reduction of chronic pain ( p = 0.27 ) , the results are shown in table 1 by * . no death was observed up to 100 mg / kg . the recorded signs included reversible strong muscular paralysis at left hindpaw and drooping of both eyelids . two - way anova was calculated to determine the significant differences between groups in first and second phase , which no significant activity differences was observed at 5 , 10 and 20 ng of crude venom concentrations in the first phase ( p 0.05 ) . results of both phases of 60 and 100 ng were similar to control ( p = 0.00 ) . comparison between the control and crude venom doses 5 , 10 and 20 showed significant differences in both phases . significant differences ( p 0.05 ) observed between 100 ng and the other doses of crude venom ( 5 and 10 ng ) . results of 10 ng of crude venom and morphine were similar in second phase ( p = 0.27 ) . ascending amounts of morphine ranged from 5 - 100 ng reduced pain significantly and 100 ng had the most analgesic effect . unlike the crude venom , morphine was more effective in high concentration . all morphine doses except for 10 ng were significantly more analgesic than crude venom in both phases . the analgesic effect of 10 ng conus venom was the same as morphine for reduction of chronic pain ( p = 0.27 ) , the results are shown in table 1 by * . the cone snail ( genus conus ) , amarine gastropodlives mainly in the tropical habitat of shallow waters near coral reefs . all species are venomous with different toxicity ( 19 ) . despite the potential of conopeptides as therapeutic agents , the venom of each species contains many pharmacologically active components that some of these components such as ctx - mviia , so - 3 , acv1 , cvid , and gvia have been identified ( 20 - 23 ) . from the first report on analgesic activity of conus genus ( 1975 ) , ctx - mviia was purified from the venom of conus magus ( 26 ) and was approved by the u.s . fda ( 27 ) under the trade name of ziconotide for the treatment of refractory pain ( 28 ) . although ziconotide is able to reduce pain and improve the quality of life in patients with neuropathic pain ; its therapeutic window is narrow with severe dose - limiting side effects ( 18 ) . in present study , no death observed up to 2.5 mg / mouse ( 100 mg / kg ) , which is 250,000 times higher than the effective dose ( 10 ng ) . ld50 result of this study was similar to published paper that documented no discernible changes in general behavior of examined mice at 100 mg / kg , ip ( 29 ) . buenaflor et al ( 1981 ) reported the ld50 of conus magus at 57.5 mg / kg in mice ( 30 ) which demonstrates more lethality activity than persian gulf conus textile venom . this result indicated that persian gulf conus textile venom could be a favorable species for tracing new analgesic drugs with very low toxicity . mechanism of analgesic effect of conus textile venom show that when the electrical impulse generated along axon , sodium ions rush in and potassium ions rush out . sodium ions set off an electrical impulse along the next nerve . finally , the pain signal will work . blocking channels by conotoxins lead to inhibit pain signals so that the peptides relief the sensation of pain ( 31 ) . conotoxins are powerful analgesic drugs that have a special mechanism of action including selective block of n - type calcium channels that limit neurotransmission at some synapses . the effect of all crude venom doses were more marked during the acute phase than the chronic pain that it is unlike to the results previously reported by lee et al ( 2010 ) and wen et al ( 2006 ) . wen et al showed that the prohibitive effects of so - 3 and mviia on hva ica were both reversible . so so - 3 is more analgesic in the chronic pain . from the point of possible mechanism for this result , it seems that the affinity between the ligand and target receptor is not as high as expected . on the basis of the results , 10 ng of persian gulf conus venom showed the best analgesic activity in both phases comparing to the other doses ( 5 , 20 , 60 , 100 ng ) . this finding is similar to the previously reported results ( 5 ) . in this case , it seems that 10 ng of the venom is the best dose to induce balance between the number of ligands and receptors . crude venom at 10 ng binds to their receptors as rapid as morphine but dissociate faster than it . because morphine is more analgesic in inflammatory pain that it means morphine dissociate slower from receptors . but conus textile venom is better to reduce acute pain that it demonstrates conus textile venom separates from pain receptors faster . in drug delivery systems , the best dose is that , it is more effective for longer time and drug can bind to receptors at the most ( 32 - 35 ) . when dose of drug is optimum , negative competition does not happen between drug and receptors . in this study , the best reaction between ligands and receptors was observed in 10 ng dose of venom . comparing the analgesic results between 10 ng and the other doses of crude venom ( 5 , 60 , and 100 ng ) showed significant differences ( p 0.05 ) in second phase . results demonstrated that the amount of 5 ng was not efficient for pain reduction in both phases . no significant differences observed between the doses 10 ng and 20 ng but 10 ng was more efficient than 20 ng . the results of both phases for 60 ng and the second phase for 100 ng were similar to control . comparison between the first and second phases showed significant differences in all doses ( p 0.05 ) .100 ng morphine had the most analgesic effect . unlike the crude venom , morphine was more effective in high concentration . all morphine doses except for 10 ng were significantly more analgesic than crude venom in both phases . statistically , significant differences observed between 100 ng morphine and the other morphine doses ( 5 , 10 , 20 and 60 ng ) , and also between all morphine doses and control . there was no significant difference between 10 ng of crude venom and morphine in second phase . comparing of ctx - fvia ( conus fulmen venom ) and ziconotide showed that separation of ctx - fvia from receptors occurs faster than ziconotide ( 5 ) . therefore ctx - fvia can be a more appropriate drug for chronic pain reduction . whereas this study results indicated that the persian gulf conus textile venom is more effective in acute pain reduction . it seems that binding and separation of conus textile venom from receptors occurs faster than ziconotide . so conus textile venom with low toxicity is an excellent candidate for acute pain treatment . regarding to similar analgesic potency of morphine and crude venom at 10 ng , it seems that purified peptide will show more analgesic activity than crude venom . this study is pending to purify the target conopeptide from persian gulf conus textile and characterization of the crude venom . based on the results , analgesic activity of crude venom was more significant in acute phase . it is supposed that crude venom contains a rapid analgesic conopeptide , which would be applicable for treatment of acute and refractory pain comparing to morphine with side effects such as addiction .\noutput:\n" }, { "from": "agent", "value": "objective ( s ) : cone snails are estimated to consist of up to 700 species . the venom of these snails has yielded a rich source of novel peptides . this study was aimed to study the analgesic effect of persian gulf conus textile and its comparison with morphine in mouse model.materials and methods : samples were collected in larak island . the venom ducts were isolated and kept on ice then homogenized . the mixture centrifuged at 10000 g for 20 min . supernatant was considered as extracted venom . the protein profile of venom determined using 15 % sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) . venom was administered intraperitoneally ( ip ) to evaluate the ld50 in swiss albino mice . different concentrations of conus textile venom were injected intrathecally to mice to evaluate their analgesic effect in comparison to morphine . injection was carried out between the l5 and l6 vertebrae . differences between groups in the first and second phase were tested with two - way analysis of variance ( anova ) . results : sds - page indicated 12 bands ranged between 6 and 180 kda . finally , ten ng of conus crude venom showed the best analgesic activity in formalin test . no death observed up to 100 mg / kg . analgesic activity of crude venom was more significant ( p < 0.05 ) in acute pain than inflammatory pain . the analgesic effect of 10 ng conus venom was the same as morphine for reduction of inflammatory pain ( p = 0.27 ) . conclusion : the venom of persian gulf conus textile contains an analgesic component for reliving of acute pain which can lead to find an analgesic drug ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: graphene was mechanically exfoliated from highly - oriented pyrolytic graphite onto si / sio2 substrates . surface hybrids were obtained by immersion in a solution of [ fe4 ( l ) 2 ( dpm ) 6 ] in 1,2 - dichloroethane : dichloromethane ( 9/1 , v / v ) at room temperature , followed by washing with isopropanol . bulk samples of the hybrids were prepared by first sonicating 8.4 mg of graphite powder in 20 ml of the solvent mixture for 48 hrs , followed by adding 11.5 mg of [ fe4 ( l ) 2 ( dpm ) 6 ] in 20 ml of the same mixture , followed by stirring for 45 min and final filtering through ptfe membranes ( 0.2 m pore size ) . magnetic measurements were corrected for the diamagnetism of the sample and sample holder , as independently determined . a home - built micro - squid susceptometer inside a dilution refrigerator was used for zero - field measurements , with extremely small ac field amplitudes ( 50 moe ) and the data corrected by the bare graphene signal . afm images were acquired with a bruker icon system in tapping mode , using olympus ac200ts cantilevers . maldi - tof spectra were recorded using a laser pulsed at ~ 4 hz , while the xps spectra were obtained with a monochromatized al - k source ( 1486.6 ev ) , see si for details . electronic devices were fabricated using a pmma resist , e - beam lithography and thermally evaporated au / ti .\noutput:\n" }, { "from": "agent", "value": "controlling the dynamics of spins on surfaces is pivotal to the design of spintronic1 and quantum computing2 devices . proposed schemes involve the interaction of spins with graphene to enable surface - state spintronics3 ,4 , and electrical spin - manipulation4 - 11 . however , the influence of the graphene environment on the spin systems has yet to be unraveled12 . here we explore the spin - graphene interaction by studying the classical and quantum dynamics of molecular magnets13 on graphene . while the static spin response remains unaltered , the quantum spin dynamics and associated selection rules are profoundly modulated . the couplings to graphene phonons , to other spins , and to dirac fermions are quantified using a newly - developed model . coupling to dirac electrons introduces a dominant quantum - relaxation channel that , by driving the spins over villain s threshold , gives rise to fully - coherent , resonant spin tunneling . our findings provide fundamental insight into the interaction between spins and graphene , establishing the basis for electrical spin - manipulation in graphene nanodevices ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: morbidity and mortality in patients on hemodialysis is still high despite significant improvement in dialysis technology ( 1 ) malnutrition and inflammation are related to high rates of morbidity and mortality in patients on hemodialysis ( 2 , 3 ) . serum levels of interleukin 6 ( il - 6 ) , leptin and adiponectin are known to be elevated in dialysis patients ( 4 - 6 ) , and have been associated with morbidity and mortality of dialysis patients through an endothelial injury , pathophysiology of atherosclerotic vascular disease . resistin , one of the adipocytokine , is from inflammatory cells infiltrating fat tissue , not directly from adipocytes ( 7 ) . it causes impairment of glucose tolerance in mice ; however , this physiologic role is not related to insulin resistance in humans . instead , it is known to have an association with inflammation , patient 's nutrition , and residual renal function on hemodialysis ( 7 , 8 ) . however , few studies on the effect of resistin on clinical outcomes in dialytic patients have been conducted . therefore , we attempted to determine whether resistin levels may independently predict clinical outcomes in hemodialysis patients . we enrolled adult outpatients on hemodialysis at the gachon university of medical and science gil hospital , korea . patients who had started on dialysis for less than 3 months , had a recent history of infection , malignancy , amyloidosis or structural heart disease , or cardiovascular events , or had a life - expectancy of less than 6 months for any reason were excluded from this study . all the patients were dialyzed with bio - compatible membranes ( f5 or f6 ; fresenius medical care ag , bad homberg , germany ) using fresenius 4008h ( fresenius medical care ag ) . ninety seven patients underwent regular dialysis three times per week and 3 patients underwent regular dialysis two times per week . we prospectively observed all hospitalization events as well as demographic and laboratory data over an 18 - month period . hospitalization was defined as any hospitalization events , regardless of causes for admission , with more than one overnight stay . the primary clinical outcome was hospitalization - free survival , and the secondary clinical outcomes were annual hospitalization days and annual hospitalization frequency . annual hospitalization days were the days of all hospital stay per year , expressed as days per patient - year . annual hospitalization frequency was defined as number of hospital admissions per year , expressed as times per patient - year . causes of hospitalization included 5 categories ; infection - related events , dialysis - related events ( hyperkalemia , vascular access related events , volume overload / dehydration ) , cardiovascular event , bone - related disorder ( fracture and parathyroidectomy ) and other events . all of the laboratory parameters were measured in patients starting a mid - week dialytic session . fasting blood samples were drawn from the arterial end of the vascular access just before starting hemodialysis . serum samples were taken and centrifuged ; supernatants were separated and immediately frozen at -70 for later analysis . serum urea nitrogen , creatinine , hemoglobin , albumin , total cholesterol , triglyceride , and other biochemistry parameters were measured by standard laboratory techniques using an automatic analyzer ( advia 2004 chemistry system [ siemens , diagnostics , tarrytown , il , usa ] ) . single pool kt / vurea was calculated using the daugirdas equation and normalized protein nitrogen appearance by depner and daugirdas ( 9 , 10 ) . for survival analysis , patients were divided according to quartiles based on the serum levels of resistin . resistin levels were determined using the bio - plex pro human diabetes assay ( biorad laboratories , hercules , ca , usa ) . serum il - 6 concentration was analyzed using the bio - plex multiplex cytokine assay ( biorad laboratories ) . survival analyses were performed using kaplan - meier and the cox proportional hazard model was applied to adjust for co - variables , including age , sex , diabetes mellitus , body mass index ( bmi ) , serum albumin , normalized protein nigtrogen appearance ( npna ) , hemodialysis duration , kt / vurea , hemoglobin , erythropoietin resistance index , and il - 6 levels . the study was approved from the local institutional review board of gachon university gil hospital ( irb approval number : girba2067 ) . survival analyses were performed using kaplan - meier and the cox proportional hazard model was applied to adjust for co - variables , including age , sex , diabetes mellitus , body mass index ( bmi ) , serum albumin , normalized protein nigtrogen appearance ( npna ) , hemodialysis duration , kt / vurea , hemoglobin , erythropoietin resistance index , and il - 6 levels . the study was approved from the local institutional review board of gachon university gil hospital ( irb approval number : girba2067 ) . the mean age of patients was 53.716.3 yr , male 46 % , and the mean hemodialysis vintage was 4.34.4 yr . patient groups were divided according to each quartile of resistin levels ( table 1 ) . there were no significant differences in age , gender , body mass index , biochemical data , hematologic data , and dialysis parameters between the four groups . however , npna appeared to show a statistically significant increase according to quartile of serum resistin ( p = 0.031 ) . a total of 54 patients experienced at least one more admission events during the observational period . hospitalization events included 28.5 % for infection - related events , 12.2 % for dialysis - related events , 11.3 % for vascular access related events , 8.1 % for cardiovascular events , 1.6 % for bone - related disorder , and 38.2 % for other events1 . we defined the second quartile group as reference , the patients with the lowest quartile of serum resistin levels had poor hospitalization - free survival ( p = 0.016 ) . low serum resistin levels , npna , hemodialysis vintage , diabetes mellitus , hemoglobin , and il - 6 were significant predictors for all - cause hospitalization in univariable analysis . after adjustment of all co - variables , lowest quartile of serum resistin levels , higher levels of serum il - 6 , and presence of diabetes mellitus were found to independently increase the probability for hospitalization ( table 2 ) . annual hospitalization frequency andhospitalization days were 0.621.05 times per patient - year and 8.1121.5 days per patient - year . among these patients , frequency of annual hospitalization and hospitalization days of patients with the lowest quartile of serum resistin level were 0.810.83 times per patient - year and 10.1919.6 days per patient - year . annual hospitalization frequency and annual hospitalization days appeared to be high in patients with the lowest quartile of serum resistin levels ; however , they were not statistically significant ( table 3 ) . serum albumin , bmi , and il - 6 did not show significant correlation with serum resistin levels . we demonstrated that the lowest quartile of serum resistin level predicted hospitalization - free survival , and that it was independent of other inflammatory cytokines . although some studies have demonstrated an association of serum resistin levels with inflammation , renal function , and nutrition , respectively ( 8 , 11 - 14 ) , few studies reported on the direct relationship between resistin levels and clinical outcomes . resistin is comprised of 108 amino acid peptide molecules ; its weight is 12.5 kda . the kidney is the major route to elimination of resistin ( 15 ) ; therefore , resistin is elevated in patients with end - stage renal disease . patients with anorexia nervosa had lower serum resistin levels ( 16 - 18 ) , and serum resistin levels showed positive correlation with npna in dialytic patients ( 19 ) , suggesting that there may be a significant relationship between serum resistin and nutritional status . in our data , it could be an explanation that patients with low resistin levels had poor hospitalization - free survival . in survival analysis , in addition , the group with highest quartile of serum resistin had also poor hospitalization - free survival . it suggests that there may not be linear dose - response relationship , but be u - shaped relationship between resitin levels and hospitalizaition . kalantar - zadeh et al . ( 20 ) indicated that low levels of serum cholesterol or low levels of body mass index in the setting of under - nutrition are short - term markers of mortality in dialysis patients . reverse epidemiology can exist in the relationship between short term clinical outcomes and serum resistin levels as a nutritional biomarker . serum resistin levels were significantly correlated with value of npna ; but the correlation coefficient was not strongly positive . it may be caused by mean value of npna in the group with 4th quartile which was insignificantly lower than in the group with 3rd quartile . resistin levels are reported inversely correlated with the protein catabolic rate in a small number cross - sectional study ( n = 33 ) ( 21 ) . in contrast , resistin levels are positively correlated with body fat mass in a relatively large number cross - sectional study ( n = 114 ) ( 22 ) . ( 23 ) reported an association of interleukin - 6 with mortality in predialytic and dialytic patients . in this study , higher level of il - 6 was found to significantly increase the risk for poor hospitalization - free survival . in our data , although resistin has a potential role in inflammation or cardiovascular disease ( 24 , 25 ) , most studies were cross - sectional design . some reports have shown no correlation between resistin and inflammatory cytokines ( 26 , 27 ) . it is possible that resistin levels may predict poor hospital - free survival independently of inflammation in our hemodialysis patients . many studies have used hospitalization as clinical predictor for outcome ( 28 , 29 ) . unfortunately , we failed to reveal the relationship between resistin levels and death , or cardiovascular mortality , because there were only 2 death and 10 admission events for cardiovascular disease during 1 - yr observation period . we did not check other nutritional parameters including prealbumin , triceps / biceps skin - fold thickness . since we measured levels of resistin only at the baseline , we had no data on change in serum resistin levels , which may have some different effects on hospitalization . to elucidate underlying mechanism of the potential link between resistin and nutrition or inflammation , further experimental or large - scale investigation may warrant . in conclusion , it is suggested that low resistin levels may predict poor hospitalization - free survival , independent of inflammation markers in hemodialysis patients .\noutput:\n" }, { "from": "agent", "value": "malnutrition and inflammation are related to high rates of morbidity and mortality in hemodialysis patients . resistin is associated with nutrition and inflammation . we attempted to determine whether resistin levels may predict clinical outcomes in hemodialysis patients . we conducted a prospective evaluation of 100 outpatients on hemodialysis in a single dialysis center ( male , 46 % ; mean age , 53.7 16.4 yr ) . we stratified the patients into 4 groups according to quartiles of serum resistin levels . during the 18 - month observational period , patients with the lowest quartile of serum resistin levels had poor hospitalization - free survival ( log rank test , p = 0.016 ) . after adjustment of all co - variables , patients with the lowest quartile of serum resistin levels had poor hospitalization - free survival , compared with reference resistin levels . higher levels of interleukin - 6 were an independent predictor of poor hospitalization - free survival . in contrast , serum resistin levels were not correlated with interleukin - 6 levels . the current data showed that low resistin levels may independently predict poor hospitalization free survival in hemodialysis patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: this study was conducted on 40 routine private practice patients presenting for dental implant insertion or rehabilitation . approval for surgery and sampling was obtained from the university of sydney human research ethics committee . surgical procedures and samplingwere performed by a calibrated clinician , following a previously described strictly aseptic two - stage open - flap surgical technique ( 12 , 13 ) summarised in fig . a reference sample of normal microflora [ supragingival buccal biofilm scraping of tooth 27 ( ul7 ) ] was made . preparatory stage ( time point 0 ) , microorganisms were removed and soft granulation tissue was curetted using spoon excavators and a mitchell osseo trimmer ( medident , braeside , australia ) . some bone samples were taken at the height of the former periapex , which was determined by measurements of the extracted calibrated lengths from digital radiographs and radiographic confirmation with the preparation drill in situ . overlying bone was debrided with a guide drill to the height of the former tooth root apex ( also at time point 0 ) . a twist drill was used to penetrate the former tooth root apex into trabecular bone . debridement of overlying trabecular and cortical bone was performed with a brnemark system round guide drill equipped with a shaft extender under chilled , sterile saline . extreme care was taken to prevent contamination of drill bits in sample sites from other areas of the oral cavity . in the second stage ( 6 months after initial debridement ) , the previously apparently healed debrided sites were re - debrided in preparation for abutment connection ( implant insertion ) . after measuring the depth of the implant site , implants were mechanically inserted . during curettage and debridement procedures , blood and tissue fluidswere absorbed on a size 80 endodontic paper point ( dentsply maiellefer , ballaigues , switzerland ) , which was left in the sample site for 15 sec . entire drill bits ( with retained bone fragments ) used to debride bone or bone filter particles suctioned out of the sample site were retained for analyses , whereas present , intact granulomas , a failed implant or infected tooth were sampled directly . samples were added to chilled te buffer ( 0.5 ml , 10 mm tris , 1 mm edta , ph 7.6 ) and transported to the molecular laboratory on ice , before storage at 80c , until dna extraction . where patients fell within the study time constraints , at 6 months , apparently healed bone of the implant site was re - debrided and sampled by paper point , bone directly retained on drill bits or bone filter particles suctioned out of the sample site . a total of 196 samples were taken from 104 sites . the failed titanium implant ( a 57 mm wp branemark mk 111 tiunite ) presented with bone loss 8 months after prosthetic connection . dna was extracted by bead - beating samples at 5.5 ms for 30 sec ( fast prep fp - 120 , bio101 ) , followed by purification as described previously ( 14 ) . one extraction blank , consisting of sterile te buffer , was included for every 10 samples . the extracted dna was polymerase chain reaction ( pcr ) amplified using bacterial domain - specific primers , targeting variable regions v1v5 of the bacterial 16s rrna gene , using primers 27f ( 5 - agagtttgatymtggctcag ) and 907r ( 5 - ccgtcaattcmtttragttt ) , which were modified at the 5 end with 5 - fam and 6 - hex fluorophores , respectively . each 25 l pcr reaction contained 1thermopol buffer , 1 m of forward and reverse primers , 200 m dntps and 1.25 u taq dna polymerase . all reagents for pcr amplification and digestion were supplied by new england biolabs ( ipswich , ma , usa ) . pcr conditions included an initial denaturation of 94c for 4 min , then 30 cycles of 94c for 30 sec , 51c for 45 sec and 72c for 60 sec , followed by a final extension at 72c for 10 min on a mastercycler s machine ( eppendorf , hamburg , germany ) . pcr amplicons were separately digested with haeiii ( 10u ) and mspi ( 20u ) , and the resultant terminal restriction fragments ( t - rfs ) were analysed by capillary electrophoresis using an abi prism 3730 dna analyser ( agrf , westmead , australia ) . genemapper v3 .7 ( applied biosystems , foster city , ca , usa ) was used to determine peak length , height and area using the local southern algorithm . t - rfs 50bp or 1 % of the total fluorescent area were excluded from analysis . for the four combinations of fluorophore and restriction enzyme , remaining t - rfs were rounded to the nearest integer and primer vi ( v. 6.1.6 , primer - e ltd , auckland , new zealand ) was used to convert trfs into a presence and absence matrix . non - metric multidimensional scaling ( nmds ) using the braycurtis coefficient ( 15 ) , with a restart value of 200 and a one way analysis of similarities ( anosim ) with a maximum permutation of 9,999 , was carried out ( 16 ) . genomic dna from eight samples was sent to research and testing laboratory ( rtl , lubbock , tx , usa ) for amplification with primers 28f ( 5 - agtttgatcntggctcag ) and 519r ( 5 - gtnttacngcggckgctg ) appended with dnasequencing of v1v3 hypervariable regions of the 16s rrna was performed by the rtl , using a roche gs - flx sequencer with titanium reagents ( roche , indianapolis , usa ) from 28f . sequences were processed with mothur following an established 454 pyrosequencing analysis pipleine [ ( 18 ) , described in detail at : www.mothur.org/wiki/454_sop ) ] . sequence barcodes and primers were removed and sequences were truncated if they fell below an average quality threshold of 30 over a sliding window of 50 base pairs . quality - trimmed sequences were aligned against the mothur - formatted silva bacterial reference alignment . preclustered , diffs = 2 ) if they differed by less than 4 bases ( 19 ) . sequences were classified with the mothur - formatted greengenes 16s rdna reference taxonomy . within sequences that passed quality filteringwere converted to a percentage of the total sequences within each sample ( summarised in supplementary table 2 ) . the average and standard error of the mean were calculated for remaining taxa within each sample type . in preparation for statistical analyses , variation in community structure , samples were grouped into reference biofilms ( n = 3 ) or diseased ( n = 5 ) bins and analysis of molecular variance ( amova ) was used with 1,000 permutations ( 20 ) . the mothur implementation of metastats ( 21 ) was also used to determine if any operational taxonomic units ( otus ) were significantly different in reference biofilm and diseased samples . this study was conducted on 40 routine private practice patients presenting for dental implant insertion or rehabilitation . approval for surgery and sampling was obtained from the university of sydney human research ethics committee . surgical procedures and samplingwere performed by a calibrated clinician , following a previously described strictly aseptic two - stage open - flap surgical technique ( 12 , 13 ) summarised in fig . a reference sample of normal microflora [ supragingival buccal biofilm scraping of tooth 27 ( ul7 ) ] was made . preparatory stage ( time point 0 ) , microorganisms were removed and soft granulation tissue was curetted using spoon excavators and a mitchell osseo trimmer ( medident , braeside , australia ) . some bone samples were taken at the height of the former periapex , which was determined by measurements of the extracted calibrated lengths from digital radiographs and radiographic confirmation with the preparation drill in situ . overlying bone was debrided with a guide drill to the height of the former tooth root apex ( also at time point 0 ) . a twist drill was used to penetrate the former tooth root apex into trabecular bone . debridement of overlying trabecular and cortical bone was performed with a brnemark system round guide drill equipped with a shaft extender under chilled , sterile saline . extreme care was taken to prevent contamination of drill bits in sample sites from other areas of the oral cavity . in the second stage ( 6 months after initial debridement ) , the previously apparently healed debrided sites were re - debrided in preparation for abutment connection ( implant insertion ) . after measuring the depth of the implant site , implants were mechanically inserted . during curettage and debridement procedures , blood and tissue fluidswere absorbed on a size 80 endodontic paper point ( dentsply maiellefer , ballaigues , switzerland ) , which was left in the sample site for 15 sec . entire drill bits ( with retained bone fragments ) used to debride bone or bone filter particles suctioned out of the sample site were retained for analyses , whereas present , intact granulomas , a failed implant or infected tooth were sampled directly . samples were added to chilled te buffer ( 0.5 ml , 10 mm tris , 1 mm edta , ph 7.6 ) and transported to the molecular laboratory on ice , before storage at 80c , until dna extraction . where patients fell within the study time constraints , at 6 months , apparently healed bone of the implant site was re - debrided and sampled by paper point , bone directly retained on drill bits or bone filter particles suctioned out of the sample site . a total of 196 samples were taken from 104 sites . the failed titanium implant ( a 57 mm wp branemark mk 111 tiunite ) presented with bone loss 8 months after prosthetic connection . dna was extracted by bead - beating samples at 5.5 ms for 30 sec ( fast prep fp - 120 , bio101 ) , followed by purification as described previously ( 14 ) . one extraction blank , consisting of sterile te buffer , was included for every 10 samples . the extracted dna was polymerase chain reaction ( pcr ) amplified using bacterial domain - specific primers , targeting variable regions v1v5 of the bacterial 16s rrna gene , using primers 27f ( 5 - agagtttgatymtggctcag ) and 907r ( 5 - ccgtcaattcmtttragttt ) , which were modified at the 5 end with 5 - fam and 6 - hex fluorophores , respectively . each 25 l pcr reaction contained 1thermopol buffer , 1 m of forward and reverse primers , 200 m dntps and 1.25 u taq dna polymerase . all reagents for pcr amplification and digestionpcr conditions included an initial denaturation of 94c for 4 min , then 30 cycles of 94c for 30 sec , 51c for 45 sec and 72c for 60 sec , followed by a final extension at 72c for 10 min on a mastercycler s machine ( eppendorf , hamburg , germany ) . pcr amplicons were separately digested with haeiii ( 10u ) and mspi ( 20u ) , and the resultant terminal restriction fragments ( t - rfs ) were analysed by capillary electrophoresis using an abi prism 3730 dna analyser ( agrf , westmead , australia ) . genemapper v3 .7 ( applied biosystems , foster city , ca , usa ) was used to determine peak length , height and area using the local southern algorithm . t - rfs 50bp or 1 % of the total fluorescent area were excluded from analysis . for the four combinations of fluorophore and restriction enzyme , remaining t - rfs were rounded to the nearest integer and primer vi ( v. 6.1.6 , primer - e ltd , auckland , new zealand ) was used to convert trfs into a presence and absence matrix . curtis coefficient ( 15 ) , with a restart value of 200 and a one way analysis of similarities ( anosim ) with a maximum permutation of 9,999 , was carried out ( 16 ) . genomic dna from eight samples was sent to research and testing laboratory ( rtl , lubbock , tx , usa ) for amplification with primers 28f ( 5 - agtttgatcntggctcag ) and 519r ( 5 - gtnttacngcggckgctg ) appended with dnasequencing of v1v3 hypervariable regions of the 16s rrna was performed by the rtl , using a roche gs - flx sequencer with titanium reagents ( roche , indianapolis , usa ) from 28f . sequences were processed with mothur following an established 454 pyrosequencing analysis pipleine [ ( 18 ) , described in detail at : www.mothur.org/wiki/454_sop ) ] . sequence barcodes and primers were removed and sequences were truncated if they fell below an average quality threshold of 30 over a sliding window of 50 base pairs . quality - trimmed sequences were aligned against the mothur - formatted silva bacterial reference alignment . preclustered , diffs = 2 ) if they differed by less than 4 bases ( 19 ) . sequences were classified with the mothur - formatted greengenes 16s rdna reference taxonomy . within sequences that passed quality filteringwere converted to a percentage of the total sequences within each sample ( summarised in supplementary table 2 ) . the average and standard error of the mean were calculated for remaining taxa within each sample type . in preparation for statistical analyses , variation in community structure , samples were grouped into reference biofilms ( n = 3 ) or diseased ( n = 5 ) bins and analysis of molecular variance ( amova ) was used with 1,000 permutations ( 20 ) . the mothur implementation of metastats ( 21 ) was also used to determine if any operational taxonomic units ( otus ) were significantly different in reference biofilm and diseased samples . a total of 196 samples were collected from 40 patients undergoing dental implant preparation and / or insertion . the disease - associated sample set included granulomas , a failed implant , tooth fragments , paper points soaked with extruded fluids and drill bits with attached tissue . buccal supragingival biofilm scrapings collected from non - diseased teeth were used as references for a normal oral bacterial community . all dental biofilm samples from healthy teeth yielded strong pcr products , but it proved difficult to amplify 16s rrna genes from other samples . attempts to improve the pcr using chemical facilitators ( betaine , dimethyl sulfoxide , bovine serum albumin ) , different polymerases ( kapa blood taq ; kapa biosystems , wilmington , usa ) , different template dilutions , different primer sets or modified thermocycling conditions were not successful ( data not shown ) . addition of a multiple displacement amplification step ( repli - g mini kit , qiagen , hilden , germany ) before the pcr enabled amplification of a few difficult templates , but subsequent t - rflp and nmds analyses showed that these samples clustered erroneously , with few terminal fragments ; therefore , this approach was not pursued further ( data not shown ) . further t - rflp analyses were performed on samples that yielded sufficient pcr products ( 31 of 196 samples ) consisting of intact granulomas ( n = 2 ) , bone fragments ( n = 1 ) , an infected tooth ( n = 1 ) , a failed implant ( n = 1 ) , paper points ( n = 5 ) or healthy tooth biofilms ( n = 21 ) . t - rflp provides a snapshot of community structure based on the size of t - rfs produced from amplified ribosomal rna genes . for both restriction enzymes ( haeiii , mspi ) and fluorophores ( 5 - fam , 3 - hex ) used , the same general pattern was observed , that is , the biofilm samples from reference teeth consistently grouped together , separately from diseased tissue samples ( fig .2 ) , a result confirmed by anosim analysis , in which all four combinations of fluorophore and restriction enzymes were significantly separated ( fig . the number of terminal fragments obtained using msp1 ( 17.65.7 ) was similar to that obtained using haeiii ( 16.55 ) . taken together , the t - rflp data indicated that the bacterial communities in the diseased samples were different from that in the reference biofilm samples . eight of the samples were analysed in greater detail by pyrosequencing of the 16s rdna gene ( regions v1v3 ) . non - metric multidimensional scaling of t - rflp data from reference biofilm versus diseased samples . ( a ) 5 - fam label / haeiii digest ( stress = 0.22 , p 0.01 ) , ( b ) 5 - fam / mspi digest ( stress = 0.26 , p 0.01 ) , ( c ) 3 - hex label / haeiii digest ( stress = 0.20 , p 0.01 ) and ( d ) 3 - hex label / mspi digest ( stress = 0.23 , p 0.02 ) . technical replicates ( amplification and digestion performed in triplicate ) of biofilm samples 22a and 23a have yellow or green centres , respectively . of these sequences , 57 % ( 25,189 ) passed strict quality control filters ( supplementary table 2 ) , yielding 11,248 sequences associated with reference biofilm samples ( average 3,749277 per sample ) and 11,097 sequences associated with diseased samples ( average 2,219638 per sample ) . a total of 2,464 unique sequences were clustered at the 97 % similarity threshold , giving 373 otus across all samples ( supplementary table 3 ) . the total diversity found in disease - associated samples ( 27826 otus per sample ) was higher than that of healthy tooth biofilms ( 21612 otus per sample ) . however , within patients , the abundance of bacteria from reference samples was always higher than corresponding diseased sample ( see below and also rarefaction curves in supplementary fig . an amova revealed that reference and diseased bacterial populations were significantly different ( p 0.049 ) . in the eight patientscombined , the most abundant phyla were actinobacteria ( 24 % ) , fusobacteria ( 23 % ) , firmicutes ( 20 % ) , proteobacteria ( 18 % ) and bacteroidetes ( 10 % ) ( fig . low abundance phyla included synergistetes ( 1.7 % ) , spirochaetes ( 1.3 % ) , tm7 ( 0.8 % ) , gn02 ( 0.1 % ) , sr1 ( 0.1 % ) , tenericutes ( 0.1 % ) , gemmatimonadetes ( 0.04 % ) and ad3 ( 0.04 % ) . synergistetes , sr1 , tenericutes , gemmatimonadetes and ad3 were only detected in disease - associated samples , some of which , such as synergistetes ( tg5 ) , are either not yet culturable or difficult to culture ( 22 ) . sample types are biofilm ( b ) , granuloma ( g ) , infected tooth ( t ) , root canal ( rc ) and failed implant ( i ) from 6 patients ( 18e / 18 g , 2a , 6a , 23b , 24a and 35a / 35c ) . the columns labelled reference and disease show the average sequence abundances in these data sets ( n = 3 and n = 5 , respectively ) . the relative abundance of sequences detected in all samples is shown in table 1 and fig .3 . some of the major trends in the diseased samples were decreases in abundance of sequences from actinomyces ( eightfold ) , corynebacterium ( sixfold ) and streptococcus ( fivefold ) , and increases in abundance of sequences from fusobacterium and prevotella ( both sevenfold ) . tg5 , a clade within the synergistetes phylum , was detected only in diseased tissues , comprising an average of 3.4 % of sequences in these communities . of these changes , metastats identified fusobacterium ( otu 1 ) and corynebacterium ( otu 5 ) as significant ( p 0.004 and p 0.008 , respectively ) between all reference and disease - associated samples . relative sequence abundances ( 16s rdna ) of bacterial taxa in reference biofilm and diseased dental samplesab only otus of 0.5 % abundance in at least one sample group are shown . a comparison of one reference sample ( biofilm , 18e ) and one diseased sample ( granuloma , 18 g ) from the same patient is shown in table 2 and supplementary table 4 . the majority of otus ( 75 % ) from the granuloma corresponded to sequence types in the biofilm , at 97 % sequence identity , indicating the granuloma bacteria were a subset of this patient 's biofilm community . increases in prevotella and fusobacterium and decreases in actinobacteria ( actinomyces and corynebacterium ) were observed in the granuloma relative to the biofilm control ( sample 18e ) . other notable features of the granuloma were increases in veillonella and atopobium sequences ( 6-fold and 29-fold , respectively ) and decreases in capnocytophaga and neisseria sequences ( 11-fold and 52-fold , respectively ) , relative to biofilm . bacterial taxa in biofilm ( 18e ) and granuloma ( 18 g ) from the same patientab only otus of 0.5 % abundance in at least one sample group are shown .3 and supplementary table 6 ) confirmed some of the trends observed in granuloma 18 g . in sample 2a , fusobacterium was the most abundant sequence type ( 69.4 % ) , prevotella sequences were more abundant compared with their average abundance in biofilm samples and actinobacteria decreased in reference to biofilm samples . an unusual feature of the granuloma 2a was that bacteria from phylum tg5 were quite abundant , at 5.5 % of all sequences . tg5 sequences were not detected in granuloma 18 g , or in any of the biofilm samples , but were detected in the failed implant ( sample 35c , discussed below ) . a comparison of the sequences recovered from a failed dental implant ( 35c ) and a biofilm sample ( 35a ) from the same patient ( table 3 , supplementary table 5 and fig .3 ) revealed similar shifts in bacterial genera as were seen in the granuloma samples , with an increase in prevotella and fusobacterium sequences ( 39-fold and 53-fold , respectively ) and a decrease in sequences from actinobacteria , specifically , complete loss of corynebacterium , and 10-fold decrease in actinomyces . other notable trends in the failed implant community included the appearance of tg5 and treponema , an increase in campylobacter sequences ( 54-fold ) and a decrease in streptococcus ( 14-fold ) . a significant portion ( 4.7 % ) of the sequences from the failed implant community mapped to the domain bacteria , but could not confidently be assigned into any known phylum . bacterial taxa in healthy tooth biofilm ( 35a ) and failed implant ( 35c ) from the same patientab only otus of 0.5 % abundance in at least one sample group are shown . pyrosequencing analyses of an infected tooth ( sample 6a , supplementary table 7 ) , a root canal paper point sample ( 23b , supplementary table 8 ) and another reference biofilm sample ( 24a , supplementary table 9 ) reinforced many of the trends of the failed implant bacterial community , especially the increased abundance of fusobacterium and the decreased abundance of actinobacteria in the diseased samples ( see also fig . a total of 196 samples were collected from 40 patients undergoing dental implant preparation and / or insertion . the disease - associated sample set included granulomas , a failed implant , tooth fragments , paper points soaked with extruded fluids and drill bits with attached tissue . buccal supragingival biofilm scrapings collected from non - diseased teeth were used as references for a normal oral bacterial community . all dental biofilm samples from healthy teeth yielded strong pcr products , but it proved difficult to amplify 16s rrna genes from other samples . attempts to improve the pcr using chemical facilitators ( betaine , dimethyl sulfoxide , bovine serum albumin ) , different polymerases ( kapa blood taq ; kapa biosystems , wilmington , usa ) , different template dilutions , different primer sets or modified thermocycling conditions were not successful ( data not shown ) . addition of a multiple displacement amplification step ( repli - g mini kit , qiagen , hilden , germany ) before the pcr enabled amplification of a few difficult templates , but subsequent t - rflp and nmds analyses showed that these samples clustered erroneously , with few terminal fragments ; therefore , this approach was not pursued further ( data not shown ) . further t - rflp analyses were performed on samples that yielded sufficient pcr products ( 31 of 196 samples ) consisting of intact granulomas ( n = 2 ) , bone fragments ( n = 1 ) , an infected tooth ( n = 1 ) , a failed implant ( n = 1 ) , paper points ( n = 5 ) or healthy tooth biofilms ( n = 21 ) . t - rflp provides a snapshot of community structure based on the size of t - rfs produced from amplified ribosomal rna genes . for both restriction enzymes ( haeiii , mspi ) and fluorophores ( 5 - fam , 3 - hex ) used , the same general pattern was observed , that is , the biofilm samples from reference teeth consistently grouped together , separately from diseased tissue samples ( fig .2 ) , a result confirmed by anosim analysis , in which all four combinations of fluorophore and restriction enzymes were significantly separated ( fig . the number of terminal fragments obtained using msp1 ( 17.65.7 ) was similar to that obtained using haeiii ( 16.55 ) . taken together , the t - rflp data indicated that the bacterial communities in the diseased samples were different from that in the reference biofilm samples . eight of the samples were analysed in greater detail by pyrosequencing of the 16s rdna gene ( regions v1v3 ) . non - metric multidimensional scaling of t - rflp data from reference biofilm versus diseased samples . ( a ) 5 - fam label / haeiii digest ( stress = 0.22 , p 0.01 ) , ( b ) 5 - fam / mspi digest ( stress = 0.26 , p 0.01 ) , ( c ) 3 - hex label / haeiii digest ( stress = 0.20 , p 0.01 ) and ( d ) 3 - hex label / mspi digest ( stress = 0.23 , p 0.02 ) . technical replicates ( amplification and digestion performed in triplicate ) of biofilm samples 22a and 23a have yellow or green centres , respectively .57 % ( 25,189 ) passed strict quality control filters ( supplementary table 2 ) , yielding 11,248 sequences associated with reference biofilm samples ( average 3,749277 per sample ) and 11,097 sequences associated with diseased samples ( average 2,219638 per sample ) . a total of 2,464 unique sequences were clustered at the 97 % similarity threshold , giving 373 otus across all samples ( supplementary table 3 ) . the total diversity found in disease - associated samples ( 27826 otus per sample ) was higher than that of healthy tooth biofilms ( 21612 otus per sample ) . however , within patients , the abundance of bacteria from reference samples was always higher than corresponding diseased sample ( see below and also rarefaction curves in supplementary fig . an amova revealed that reference and diseased bacterial populations were significantly different ( p 0.049 ) . in the eight patientscombined , the most abundant phyla were actinobacteria ( 24 % ) , fusobacteria ( 23 % ) , firmicutes ( 20 % ) , proteobacteria ( 18 % ) and bacteroidetes ( 10 % ) ( fig . low abundance phyla included synergistetes ( 1.7 % ) , spirochaetes ( 1.3 % ) , tm7 ( 0.8 % ) , gn02 ( 0.1 % ) , sr1 ( 0.1 % ) , tenericutes ( 0.1 % ) , gemmatimonadetes ( 0.04 % ) and ad3 ( 0.04 % ) . synergistetes , sr1 , tenericutes , gemmatimonadetes and ad3 were only detected in disease - associated samples , some of which , such as synergistetes ( tg5 ) , are either not yet culturable or difficult to culture ( 22 ) . sample types are biofilm ( b ) , granuloma ( g ) , infected tooth ( t ) , root canal ( rc ) and failed implant ( i ) from 6 patients ( 18e / 18 g , 2a , 6a , 23b , 24a and 35a / 35c ) . the columns labelled reference and disease show the average sequence abundances in these data sets ( n = 3 and n = 5 , respectively ) . the relative abundance of sequences detected in all samples is shown in table 1 and fig .3 . some of the major trends in the diseased samples were decreases in abundance of sequences from actinomyces ( eightfold ) , corynebacterium ( sixfold ) and streptococcus ( fivefold ) , and increases in abundance of sequences from fusobacterium and prevotella ( both sevenfold ) . tg5 , a clade within the synergistetes phylum , was detected only in diseased tissues , comprising an average of 3.4 % of sequences in these communities . of these changes , metastats identified fusobacterium ( otu 1 ) and corynebacterium ( otu 5 ) as significant ( p 0.004 and p 0.008 , respectively ) between all reference and disease - associated samples . relative sequence abundances ( 16s rdna ) of bacterial taxa in reference biofilm and diseased dental samplesab only otus of 0.5 % abundance in at least one sample group are shown . a comparison of one reference sample ( biofilm , 18e ) and one diseased sample ( granuloma , 18 g ) from the same patient is shown in table 2 and supplementary table 4 . the majority of otus ( 75 % ) from the granuloma corresponded to sequence types in the biofilm , at 97 % sequence identity , indicating the granuloma bacteria were a subset of this patient 's biofilm community . increases in prevotella and fusobacterium and decreases in actinobacteria ( actinomyces and corynebacterium ) were observed in the granuloma relative to the biofilm control ( sample 18e ) . other notable features of the granuloma were increases in veillonella and atopobium sequences ( 6-fold and 29-fold , respectively ) and decreases in capnocytophaga and neisseria sequences ( 11-fold and 52-fold , respectively ) , relative to biofilm . bacterial taxa in biofilm ( 18e ) and granuloma ( 18 g ) from the same patientab only otus of 0.5 % abundance in at least one sample group are shown .3 and supplementary table 6 ) confirmed some of the trends observed in granuloma 18 g . in sample 2a , fusobacterium was the most abundant sequence type ( 69.4 % ) , prevotella sequences were more abundant compared with their average abundance in biofilm samples and actinobacteria decreased in reference to biofilm samples . an unusual feature of the granuloma 2a was that bacteria from phylum tg5 were quite abundant , at 5.5 % of all sequences . tg5 sequences were not detected in granuloma 18 g , or in any of the biofilm samples , but were detected in the failed implant ( sample 35c , discussed below ) . a comparison of the sequences recovered from a failed dental implant ( 35c ) and a biofilm sample ( 35a ) from the same patient ( table 3 , supplementary table 5 and fig .3 ) revealed similar shifts in bacterial genera as were seen in the granuloma samples , with an increase in prevotella and fusobacterium sequences ( 39-fold and 53-fold , respectively ) and a decrease in sequences from actinobacteria , specifically , complete loss of corynebacterium , and 10-fold decrease in actinomyces . other notable trends in the failed implant community included the appearance of tg5 and treponema , an increase in campylobacter sequences ( 54-fold ) and a decrease in streptococcus ( 14-fold ) . a significant portion ( 4.7 % ) of the sequences from the failed implant community mapped to the domain bacteria , butbacterial taxa in healthy tooth biofilm ( 35a ) and failed implant ( 35c ) from the same patientab only otus of 0.5 % abundance in at least one sample group are shown . pyrosequencing analyses of an infected tooth ( sample 6a , supplementary table 7 ) , a root canal paper point sample ( 23b , supplementary table 8 ) and another reference biofilm sample ( 24a , supplementary table 9 ) reinforced many of the trends of the failed implant bacterial community , especially the increased abundance of fusobacterium and the decreased abundance of actinobacteria in the diseased samples ( see also fig . a molecular profiling approach was used to investigate bacteria associated with a failed dental implant , apical periodontitis and alveolar bone . several characteristic features of the bacterial communities associated with implant failure and periodontitis were defined , including an increased relative abundance of prevotella and fusobacterium and a decreased abundance of actinomyces and corynebacterium relative to the biofilm on reference teeth . the reference biofilm and disease - associated bacterial communities were distinguished by community profiling using t - rflp , and these differences were confirmed by pyrosequencing . great difficulty was encountered in amplifying 16s rdna from the majority of blood and bone - containing samples . using 454 pyrosequencing , a similar phenomenon in root canal samples has been noted and attributed to competitive inhibition by human dna ( 8 ) . in that study , poor pcr amplification was overcome by diluting template dna , but this approach was not successful for our samples . two lines of evidence suggest that our pcr amplification difficulties were primarily because of low numbers of bacteria ; firstly , biofilm samples and obviously infected samples ( such as granulomas ) gave strong pcr products , and secondly , human ribosomal sequences ( 18s rdna ) could be amplified from many samples which did not give positive 16s rdna pcrs ( data not shown ) . on the other hand , pcrs using a mixture of amplifiable and non - amplifiable templates gave similar results to the non - amplifiable templates alone ( data not shown ) , suggesting the presence of pcr inhibitors was a contributing factor . calcium ions ( 23 ) from bone , or blood factors , such as immunoglobulin g or lactoferrin ( 24 ) , may have contributed to the problems with pcr amplification and detection of bacteria in many samples . previous culture - based work detected an increased abundance of actinomyces and prevotella spp . in cases of apical periodontitis and on failed dental implants ( 12 ) . this trend was not revealed by pyrosequencing analyses performed herein , which showed a decreased relative abundance of actinobacteria ( actinomyces and corynebacterium ) . this apparent discrepancy may represent the ease of culturing facultatives ( such as actinomyces ) compared with strict anaerobes ( fusobacterium ) ( 25 ) which may bias apparent viable counts of these clades . it is notable that the shifts in taxa seen between reference biofilm and diseased samples in this study correlate to a large extent with a shift from facultatives to strict anaerobes . this trend underlines the usefulness of pyrosequencing for studying samples that contain unculturable or fastidious bacteria , where taxa detected in the diseased samples may have been overlooked or underrepresented in a culture - based study . one of the most striking patterns observed in the pyrosequencing data was the high relative abundance of fusobacterium sequences in all of the diseased samples . prevotella populations also increased in diseased samples with an average 20-fold increase in this genus ( 19.3 % ) in the failed implant compared to the average detected on reference biofilm . using pyrosequencing , other investigators confirmed that failed implants are dominated by gram - negative bacteria ( 9 ) . however , whilst prevotella populations associated with failed implants increased with respect to reference biofilm , the same investigators detected the highest populations of prevotella on healthy implants ( 9 ) . other taxa that tended to be more abundant in diseased samples than in reference biofilm samples were treponema , veillonellaceae ( selenomonas and veillonella ) and synergistetes ( tg5 ) , all bacteria detected during chronic periodontitis ( 26 , 27 ) . an increase in sample size is required to draw firm conclusions about bacterial pathogenesis during implant failure and apical periodontitis . nevertheless , in this pilot molecular study , it is noted that even in the small sample set , clades of bacteria listed above were consistently overrepresented in diseased tissues . molecular tools were useful here for revealing shifts in bacterial clades in diseased periapical tissues , but it should be noted that dna - based detection of bacteria in these samples was difficult . blood - and bone - derived inhibitors and the low numbers of bacterial cells in alveolar samples pose unique restrictions to molecular profiling techniques . because the numbers of bacteria in alveolar bone were low , application of microscopy - based techniques on intact sections of alveolar bonethe combination of molecular , culture and microscopy - based techniques with a larger sample cohort is required to further define the bacterial communities involved in apical periodontitis and determine whether bacteria are able to proliferate in alveolar bone , leading to early dental implant failure . the authors have not received any funding or benefits from industry or elsewhere to conduct this study .\noutput:\n" }, { "from": "agent", "value": "backgroundpreviously , we demonstrated that bacteria reside in apparently healed alveolar bone , using culture and sanger sequencing techniques . bacteria in apparently healed alveolar bone may have a role in peri - implantitis and dental implant failure.objectiveto compare bacterial communities associated with apical periodontitis , those colonising a failed implant and alveolar bone with reference biofilm samples from healthy teeth.methods and resultsthe study consisted of 196 samples collected from 40 patients undergoing routine dental implant insertion or rehabilitation . the bacterial 16s ribosomal dna sequences were amplified . samples yielding sufficient polymerase chain reaction product for further molecular analyses were subjected to terminal restriction fragment length polymorphism ( t - rflp ; 31 samples ) and next generation dna sequencing ( 454 gs flx titanium ; 8 samples ) . t - rflp analysis revealed that the bacterial communities in diseased tissues were more similar to each other ( p < 0.049 ) than those from the healthy reference samples . next generation sequencing detected 13 bacterial phyla and 373 putative bacterial species , revealing an increased abundance of gram - negative [ prevotella , fusobacterium ( p < 0.004 ) , treponema , veillonellaceae , tg5 ( synergistetes ) ] bacteria and a decreased abundance of gram - positive [ ( actinomyces , corynebacterium ( p < 0.008 ) ] bacteria in the diseased tissue samples ( n = 5 ) relative to reference supragingival healthy samples ( n = 3 ) . conclusionincreased abundances of prevotella , fusobacterium and tg5 ( synergistetes ) were associated with apical periodontitis and a failed implant . a larger sample set is needed to confirm these trends and to better define the processes of bacterial pathogenesis in implant failure and apical periodontitis . the application of combined culture - based , microscopic and molecular technique - based approaches is suggested for future studies ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: glyceol is an intracranial pressure reducing agent composed of 5 % fructose and concentrated glycerol . although children with some congenital metabolic diseases experience hyperlactatemia , there are seldom , if ever , the case in adults . a 53 - year - old woman with a medical history of the craniotomy for meningioma removal 10 years ago , was again scheduled the operation for her regrown tumor removal . she also had hypothyroidism for the past 10 years , which was treated with oral prednisolone at 20 mg / day and levothyroxine sodium at 50 g / day . table 1 shows the results of blood chemistry tests performed at the time of admission to the hospital . laboratory findings on admission the patient was admitted to our icu after the initial attempt of tumor removal , which resulted in failure because of severe hemorrhage prior to tumor handling . surgery was then performed 3 months after icu discharge , and the patient was once again admitted to the icu after surgery . during both stays in the icu the patient was administered 200 ml of glyceol over a period of 30 minutes , every 6 hours from 0:00 am . despite her stable general condition , routine arterial blood gas analysis ( diagnostics 860 , chiron , ca , us ) at around 6:30 every morning indicated reappeared hyperlactatemia . the fact that repeated measurements of her lactate levels were normal at other time points , made us to consider glyceol administration as the cause of her transient hyperlactatemia . to exclude the possibility of impaired tissue perfusion caused by rapid infusion of hypertonic solutions as another cause of this transient hyperlactatemiathe lactate levels increased gradually and peaked 45 minutes after glyceol administration , while no significant change was observed in case of mannitol . blood glucose level increased slightly after glyceol administration but the increase was not significant [ figure 1 ] . black line : 200 ml of glycerol administered in 30 minutes metabolic abnormality was also considered another possible cause of her transient hyperlactatemia ; however her amino acid analysis , urinary organic acid analysis and serum acyl carnitine analysis all showed normal results , and hyperammonemia , hypoglycemia , or ketonuria were not observed . in addition , impaired perfusion , infection and convulsive seizure were not observed during patient admission . liver diseases including hepatitis , congenital metabolic diseases , glycerol metabolism abnormality , any diseases similar to reye 's syndrome , mitochondrial disorders and other conditions were all considered as differential diagnoses but were all unlikely because of her laboratory finfings . moreover , glyceol administration produced hyperlactatemia even after correcting her hemoglobin concentrations in order to improve oxygen transport , while increased urinary excretion of lactic and pyruvic acids was found [ table 2 ] . urinary organic acid profiles 1 hour after the administration of glycerol since mannitol and glyceol administration resulted in different levels of lactate concentration , transient hyperlactatemia was unlikely to be triggered by impaired tissue perfusion caused by rapid infusion of hypertonic solutions . we then performed a retrospective chart review and found other nine patients admitted to jichi medical university hospital icu after intracranial surgery and administered glyceol during the past year . all nine cases were confirmed to be without notable dehydration , infection or convulsive seizure before or after the administration of glyceol . we found that their lactate levels increased in general , peaked approximately 45 minutes after glyceol administration and returned to preadministration levels around 3 hours after [ figure 2 ] . majority of the intravenously administered fructose is taken up by the liver and converted by fructokinase into fructose -1-phosphate , which then enters the glycolytic or gluconeogenesis system and is metabolized into lactate , glucose or glycogen . fructokinase activity remains unchanged under insulin deficiency , and since fructose metabolism does not involve glucokinase or phosphofructokinase , which activities are reduced under insulin deficiency , fructose is easily metabolized and causes the accumulation of pyruvate even in the conditions of reduced glucose tolerance . metabolism of fructose into pyruvate in the liver is rapid enough to accumulate large amount of unmetabolised pyruvate by the tca cycle , and hence cause hyperlactatemia . lactate as an end - metabolite of fructose competes with renal uric acid excretion , and hence , accelerate nucleic acid turnover and increase uric acid production , and then induces hyperlactatemia . renal excretion of uric acid is known to be inhibited competitively by acidosis of most organic acids including lactate . because of the rapid metabolism of fructose , large quantities of atp are consumed in the liver , thus affect the hepatic metabolism . furthermore , along with decreased atp , amount of inorganic phosphoric acid is also reduced and can cause hypophosphatemia . although we did not measure phosphoric acid and uric acid levels in the case reported here , it is likely that phosphoric acid levels may differ from baseline levels immediately after glyceol administration . the preferred rate of fructose administration is generally taken as not more than 0.3 g / kg / hour . according tothe report that investigated the optimum dosage of glyceol for intracranial pressure reduction , recommended dosage of glyceol administration in the case of 50 kg body weight would be 200 ml / 40 minutes or 300 ml / hour and below . in our case described here and in nine cases investigated retrospectively , the rate of glyceol dosage all exceeded the above - mentioned recommended limit . therefore , excessive fructose loading might be the cause of transient hyperlactatemia in our cases . hyperlactatemia is a sensitive indicator of impaired tissue metabolism , and associated with morbidity in circulatory shock patients . in septic shock patients , lactate measuring within 3 hours of glyceol administration will not represent an accurate clinical status , critical care physicians must keep this rather unfamiliar phenomenon in mind when evaluate the lactate levels in patients with critically ill . since the cause of hyperlactatemia was deemed to be the rapid loading of fructose contained as a constituent of glyceol , clinicians must be cautious about the dosage of this hypertonic solution . furthermore , lactate measurement should be done before glyceol administration , and as one possible cause of hyperlactatemia , physicians must keep this rather unfamiliar phenomenon in mind .\noutput:\n" }, { "from": "agent", "value": "glyceol is an intracranial pressure reducing agent composed of 5 % fructose and concentrated glycerol . although rapid administration of fructose is known to cause lactic acidosis , little is known about hyperlactatemia caused by glyceol administration itself in adults . we observed an adult case of hyperlactatemia occurred after administration of 200 ml of glyceol over a period of 30 minutes . since there was no evidence of an underlying liver disease or metabolic abnormality , and no findings of sepsis or impaired tissue perfusion , the cause of this condition was deemed to be the rapid loading of fructose contained as a constituent of glyceol . we then performed a retrospective chart review and found other 9 cases admitted to jichi medical university hospital icu and administered glyceol during the past year . their lactate levels increased in general , peaked approximately 45 minutes after glyceol administration and returned to pre - administration levels around 3 hours after . although hyperlactatemia is an important indicator of sepsis and impaired tissue perfusion , caution is required when performing such an assessment in patients being administered glyceol ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: subjects and animals : six 5 to 7 years old ( mean : 6 years ) clinically normal beagle dogs ( three males and three females ) with body weights of 11 to 15 kg ( mean : 14 kg ) were used in this study . in addition , the right eye of each dog was selected for use in this study . the dogs had no abnormalities on neurologic and ophthalmic examinations before the study , including pupillary light reflex , menace response , tonometry , slit - lamp biomicroscopy , ophthalmoscopy and electroretinography . this study was conducted according to the guidelines of the experimental animal research committee of rakuno gakuen university . methods of anesthesia : each dog was administered sevoflurane in oxygen ( os ) anesthesia using a mask and was intubated with an endotracheal tube that could accommodate a sampling endotracheal gas tube ( 8 fr , 100 cm ; feeding tube , terumo , tokyo , japan ) at the tip , and then , os anesthesia was started with the dog in the right lateral recumbent position with a vaporizer for sevoflurane ( sevoflurane asv - 5 , kimura medical instrument , tokyo , japan ; ohmeda sevotec 3 , datex - ohmeda , tokyo , japan ) set to 3 % . for os anesthesia , an inhaler equipped with a vaporizer for sevoflurane ( siesta 21 , kimura medical instrument ) as an outside circuit vaporizer andthe mac of sevoflurane was measured by the tail clamp method in all dogs , according to the previous method reported by ko . each dog was allowed to equilibrate for 30 min at an end - tidal sevoflurane concentration ( etsev ) of 2.4 % . the hair was clipped from a section of the dog s tail with a diameter approximately equivalent to the diameter of a standard backhaus towel clamp ( backhaus towel clamp , mizuho , tokyo , japan ) . after equilibration for 30 min , a towel clamp was placed around the dog s tail and closed to the third ratchet . the clamp was left in place for 60 sec or until the dog showed any gross purposeful movement . purposeful movement was defined as substantial movement of the head or extremities and did not include coughing , chewing , swallowing or increased respiratory effort . the clamp circumscribed the tail and did not puncture the skin of the dog , thereby producing a blunt force on the tail . if the dog exhibited any purposeful movement in response to tail clamping , the etsev was increased by 0.2 % . if the dog did not exhibit any purposeful movement in response to tail clamping , the etsev was reduced by 0.2 % . after changing the etsev , testing continued until the lowest etsev at which the dog did not demonstrate purposeful movement in response to tail clamping was determined . mac was calculated as the mean of the etsev at which the dog did not demonstrate any purposeful movement and the next lower concentration tested ( i.e. , the highest concentration at which the dog still demonstrated purposeful movement in response to tail clamping ) . all dogs were administered os anesthesia using a mask and intubated with an endotracheal tube . subsequently , os anesthesia was started at the concentration of sevoflurane for 1.25 mac . while recording p - vep , dogs were changed to the prone position . during anesthesia , heart rate , blood pressure , body temperature , etsev , partial pressure of carbon dioxide ( paco2 ) and percutaneous oxygen saturation ( spo2 ) were monitored by using a patient medical monitor ( colin bp - 508 , omron colin co. , ltd . , respiration was controlled by ippv ( respiration rate , 12 times / min ; inspiration / expiration ratio , 1:2 ) using a volume - controlled respirator . blood pressure was maintained above 60 mmhg . intravenous infusion of lactated ringer s solution was started at a continuous rate of 10 ml / kg / hr via the catheter placed in the cephalic vein of the right forefoot . the body temperature of all dogs was kept at 37.5 to 38.0 c using a warm air blanket ( ad - j200 , mitsubishi electric home appliance co. , ltd . , fukaya , japan ) . while recording p - vep , the position of the eye was fixed by administration of rocuronium bromide ( eslax , msd , tokyo , japan ) . continuous intravenous infusion of rocuronium bromide was performed at 0.2 to 2.0 mg / kg / hr from a catheter placed in the saphenous vein using a syringe pump . bis was recorded with a bis monitor ( a-2000xp , aspect medical systems , natick , ma , u.s.a . ) and spiral electrodes . a reference electrode was positioned at the center point of the left and right medial canthus . one of the recording electrodes was positioned in the parietal region , and the other was positioned 2 cm behind the right lateral canthus on the zygomatic process . the refractive power of the recorded eyes , the right eyes of all dogs , was measured by skiascopy . all measured eyes were corrected to 2 diopters ( d ) using soft contact lenses ( premio , menicon , nagoya , japan ) . mydriasis and cycloplegia of the recorded eye were obtained by instillation of cyclopentolate hydrochloride eye drops ( cyplegin 1 % , santen pharmaceutical co. , ltd . , osaka , japan ) 20 min before p - vep recording at each concentration of sevoflurane . p - vep was recorded with a portable vep system ( le - 3000 , tomey , nagoya , japan ) and pattern stimulus display ( ps - 410 , tomey ) . for p - vep recording , needle electrodes ( vep needle electrodes , mayo co. , nagoya , japan ) were positioned at the inion ( external occipital protuberance ) as the recording electrode and the nasion ( nasal point ) as the reference electrode . a plate type electrode ( le ear electrode , mayo ) 1 . positions of the electrodes for p - vep recording . . dogs were placed in a lighted room during equalization of anesthesia . then , the light was turned off , and p - vep was recorded from the right eye under dim lighting . an eye speculum was used to keep the eyelids open , and physiological saline eye drops were instilled for corneal hydration . the testing distance , which was the distance from the cornea to the display , was 50 cm , the stimulus pattern size was 7.31 mm , and the visual angle was 50.3 arc - min . p100 implicit time and n75 - p100 amplitude were estimated according to a standard determined by the iscev . p - vep and bis recording was started after maintaining 1.25 mac of os anesthesia for 20 min . we also recorded p - vep without pattern stimulation as a negative control in dog no . 1 at 1.25 mac . after recording at 1.25 mac , p - vep and bis were recorded at 0.5 , 1.0 , 1.5 , 2.0 , 2.5 and 2.75 mac for each dog . when the vep waveform disappeared , we stopped recording vep and bis at deeper depths of anesthesia . statistical analysis : the p100 implicit times and n75 - p100 amplitudes obtained at concentrations of sevoflurane for 0.5 , 1.0 , 1.5 and 2.0 mac were analyzed by anova . the statistical significance of differences was determined with p 0.05 as the minimum level of acceptable significance . the refractive power of the recorded eyes , the right eyes of all dogs , was measured by skiascopy . all measured eyes were corrected to 2 diopters ( d ) using soft contact lenses ( premio , menicon , nagoya , japan ) . mydriasis and cycloplegia of the recorded eye were obtained by instillation of cyclopentolate hydrochloride eye drops ( cyplegin 1 % , santen pharmaceutical co. , ltd . , osaka , japan ) 20 min before p - vep recording at each concentration of sevoflurane . p - vep was recorded with a portable vep system ( le - 3000 , tomey , nagoya , japan ) and pattern stimulus display ( ps - 410 , tomey ) . for p - vep recording , needle electrodes ( vep needle electrodes , mayo co. , nagoya , japan ) were positioned at the inion ( external occipital protuberance ) as the recording electrode and the nasion ( nasal point ) as the reference electrode . a plate type electrode ( le ear electrode , mayo ) 1 . positions of the electrodes for p - vep recording . . dogs were placed in a lighted room during equalization of anesthesia . then , the light was turned off , and p - vep was recorded from the right eye under dim lighting . an eye speculum was used to keep the eyelids open , and physiological saline eye drops were instilled for corneal hydration . the testing distance , which was the distance from the cornea to the display , was 50 cm , the stimulus pattern size was 7.31 mm , and the visual angle was 50.3 arc - min . p100 implicit time and n75 - p100 amplitude were estimated according to a standard determined by the iscev . p - vep and bis recording was started after maintaining 1.25 mac of os anesthesia for 20 min . we also recorded p - vep without pattern stimulation as a negative control in dog no . 1 at 1.25 mac . after recording at 1.25 mac , p - vep and bis were recorded at 0.5 , 1.0 , 1.5 , 2.0 , 2.5 and 2.75 mac for each dog . when the vep waveform disappeared , we stopped recording vep and bis at deeper depths of anesthesia . statistical analysis : the p100 implicit times and n75 - p100 amplitudes obtained at concentrations of sevoflurane for 0.5 , 1.0 , 1.5 and 2.0 mac were analyzed by anova . the statistical significance of differences was determined with p 0.05 as the minimum level of acceptable significance . mac of sevoflurane and refractive power of the eye : the mac of sevoflurane and refractive power of the eye for each dog are shown in table 1table 1 . mac of sevoflurane and refractive power of the eyes in each dogdog no.end - tidal sevoflurane concentration at 1.0 mac ( % ) refractive power of eyes by skiascopy ( d ) 11.95 + 1.022.87 + 2.032.33 + 1.042.85 + 2.052.05 + 0.562.65 + 3.0 . p - vep : the p100 implicit times and n75 - p100 amplitudes at each concentration of sevoflurane are shown in table 2table 2 . p100 implicit time , n75 - p100 amplitude , bis value and sr at each concentration of sevofluranemac of sevofluranep100 implicit time ( msec ) n75 - p100 amplitude ( v ) bis valuesr ( % ) 0.5104.37.82.290.5773.82.601.0113.113.13.341.9256.24.001.25109.324.02.670.9656.05.401.5110.924.22.700.9655.514.25.210.82.0104.42.23.441.9943.032.337.739.52.587.21.6025.02.843.52.12.75 not - recordablenot - recordable88 .09.0 data are shown as the mean standard deviation . p - vep responses were obtained in 6 dogs at 0.5 to 1.5 mac , in 2 dogs at 2.0 mac and in one dog at 2.5 mac . p - vep responses were not obtained at 2.75 mac , and the bis value and sr were recorded in 6 dogs at 0.5 to 2.0 mac , in 2 dogs at 2.5 mac and in one dog at 2.75 mac . , and p - vep waveforms obtained from all dogs at each sevoflurane concentration are shown in fig .2 fig . 2 . p - vep waveforms obtained from all dogs at each sevoflurane concentration and negative control of dog no . . graphs for the p100 implicit time and mac and the n -75-p100 amplitude and mac are shown in figs . 3 and 4fig .3 . the graph shows the correlation between the p100 implicit time of each dog and different mac concentrations of sevoflurane . the plots show the p100 implicit times of each dog , and the bars show the means.fig .4 . the graph shows the correlation between the n75 - p100 amplitude of each dog and different mac concentrations of sevoflurane . the plots show the n75 - p100 amplitude of each dog , and the bars show the means . it disappeared at 2.0 mac in four dogs and at 2.5 and 2.75 mac in one dog each . p - vep responses were obtained in 6 dogs at 0.5 to 1.5 mac , in 2 dogs at 2.0 mac and in one dog at 2.5 mac . p - vep responses were not obtained at 2.75 mac , and the bis value and sr were recorded in 6 dogs at 0.5 to 2.0 mac , in 2 dogs at 2.5 mac and in one dog at 2.75 mac . p - vep waveforms obtained from all dogs at each sevoflurane concentration and negative control of dog no . 1 at 1.25 mac . the graph shows the correlation between the p100 implicit time of each dog and different mac concentrations of sevoflurane . the plots show the p100 implicit times of each dog , and the bars show the means . the graph shows the correlation between the n75 - p100 amplitude of each dog and different mac concentrations of sevoflurane . the plots show the n75 - p100 amplitude of each dog , and the bars show the means . although there was no significant change in p100 implicit time at any of the concentrations of sevoflurane , the p100 implicit time showed a tendency toward prolongation with increasing concentrations of sevoflurane . no significant change in n75 - p100 amplitude was recognized at any of the concentrations of sevoflurane . bis value and sr : the bis value and sr at each concentration of sevoflurane are shown in table 2 . bis value and sr recording were performed in all dogs at 0.5 to 2.0 mac , in two dogs at 2.5 mac and in one dog at 2.75 mac , because p - vep responses disappeared at 2.0 mac in four dogs and at 2.5 mac in one dog . in this study , p - vep was recorded in all dogs from 0.5 to 2.0 mac of sevoflurane , and there was no significant influence of different sevoflurane concentrations on p100 implicit time . therefore , sevoflurane showed no effect on p - vep at the concentrations normally used to produce immobilization and surgical anesthesia as demonstrated in p - vep recording in the present study . in the dogs in this study , the bis value decreased from 56 to 43 , and the sr began to appear and increased from 5.2 to 38 % , which coincided with the decrease in bis when the sevoflurane concentration increased from 1.5 to 2.0 mac . at the same time , burst suppression began to appear beginning at 1.5 mac of sevoflurane . thus , it is suggested that strong cns suppression starts at 1.5 mac of sevoflurane . in this study , a flat eeg was observed , and bis values decreased rapidly when the sevoflurane concentration was greater than 1.5 mac . further increasing sevoflurane to 2.0 macresulted in strong suppression of the cns as well as the visual cortex , resulting in disappearance of the vep . there was no significant change in p100 implicit time associated with the changes in sevoflurane concentrations . in f - vep recording in humans , it has also been reported that prolongation of the positive peak implicit time and disappearance of the vep signal were observed depending on the concentration of an inhalational anesthetic like sevoflurane and isoflurane . it has been reported that a p100 implicit time is 100 msec after stimulation when visual recognition of a subject to a stimulation pattern was appropriate . but , disappearance of a vep signal or prolongation of the p100 implicit time would be observed when a subject could not well recognize a stimulation pattern in humans . in this study , the rights eyes of all dogs were corrected to 2 d according to the results of skiascopy to focus the stimulus pattern after administration of a cycloplegic drug , and the effect of blur on p100 implicit time was minimized . however , no prolongation of the p100 implicit time in beagle dogs depending on the concentration of sevoflurane was observed , which is different from the report for f - vep in humans . it was suggested that the visual function of a dog was maintained until the vep disappeared . it was difficult to compare the n75 - p100 amplitude between dogs in this study , because the amplitudes of n75 - p100 in each dog varied significantly . in f - vep recording in humans , there are some reports showing that the n75 - p100 amplitude was reduced with increasing isoflurane or sevoflurane concentrations during general anesthesia . in contrast , it has also been reported that fluctuations of the n75 - p100 amplitude varies from person to person . even in the same subject , the values varied under light anesthesia or no anesthesia in p - vep recording in humans . many factors , e.g. , illumination in the laboratory room , the condition of the optic media , fixation to the stimulus device and drowsiness , affect the amplitude of vep , thus making it difficult to evaluate the amplitude of n75 - p100 in dogs as a result of the large variation . at presentbased on our results , sevoflurane does not affect p - vep recording when the concentration of sevoflurane was within the general percentages normally used for immobilization and surgical anesthesia . a number of studies have investigated the effects of various anesthetics on vep in human medicine . prolongation of the p100 implicit time in f - vep recording is observed depending on the dosage of anesthetic , and f - vep is useful as an index of depth of anesthesia . in this study , the p100 implicit time stayed at approximately 100 msec , and no significant change was recognized . a normal vep waveform was observed up to an anesthetic depth just before vep disappeared . although p - vep in dogs can not be used as an index of the precise depth of anesthesia , the anesthetic concentrations at which p - vep disappeared were greater than 1.2 to 1.5 mac , which is normally the range for concentrations of sevoflurane that produce surgical anesthesia . in other words , the result of this study suggested that p - vep is a useful indicator to determine whether a patient is too deeply anesthetized or not .\noutput:\n" }, { "from": "agent", "value": "the purpose of this study was to investigate the effects of sevoflurane concentration on canine visual evoked potentials with pattern stimulation ( p - veps ) . six clinically normal laboratory - beagle dogs were used . the minimum alveolar concentration ( mac ) of sevoflurane was detected from all subjects by tail clamp method . the refractive power of the right eyes of all subjects was corrected to 2 diopters after skiascopy . for p - vep recording , the recording and reference electrode were positioned at inion and nasion , respectively , and the earth electrode was positioned on the inner surface . to grasp the state of cns suppression objectively , the bispectral index ( bis ) value was used . the stimulus pattern size and distance for vep recording were constant , 50.3 arc - min and 50 cm , respectively . p - veps and bis values were recorded under sevoflurane in oxygen inhalational anesthesia at 0.5 , 1.0 , 1.5 , 2.0 , 2.5 and 2.75 sevoflurane mac . for analysis of p - vep , the p100 implicit time and n75 - p100 amplitude were estimated . p - veps were detected at 0.5 to 1.5 mac in all dogs , and disappeared at 2.0 mac in four dogs and at 2.5 and 2.75 mac in one dog each . the bis value decreased with increasing sevoflurane mac , and burst suppression began to appear from 1.5 mac . there was no significant change in p100 implicit time and n75 - p100 amplitude with any concentration of sevoflurane . at concentrations around 1.5 mac , which are used routinely to immobilize dogs , sevoflurane showed no effect on p - vep ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: historically , radical nephrectomy ( rn ) has been the mainstay treatment for renal cell carcinoma ( rcc ) . increased incidental detection of small renal masses with the development of radiologic diagnostic toolshas brought increased attention to treatment options and operation modality for small renal masses . with the evidence of comparable oncologic outcomes with partial nephrectomy ( pn ) and the risk of de novo renal failure with rn for a small renal tumor , attentionis focused on expanding and setting the indications of pn in small renal tumors . in the last decade , pn has developed rapidly and supplanted rn as the standard treatment for t1a rcc , with comparable oncological outcomes , superior renal function preservation and better quality of life . although treatment for tumors larger than 4 cm remains controversial , emerging data indicates that pn for t1b rcc provides comparable cancer control compared with rn , as well as pn for t1a rcc . however , most of those studies are single - center , retrospective and observational studies with low - level evidence , and the results and interpretation are questionable because of uneven distribution of patients and patient selection bias . therefore , we conducted a pair - matched clinical outcome study in patients who underwent pn or rn for t1b renal tumors . factors that can affect oncologic and functional outcomes were matched , and data were distributed evenly with regard to age , sex , preoperative renal function , comorbidity , american society of anesthesiologists score , body mass index ( bmi ) , tumor size , and histologic subtype . in this study , we evaluated the oncologic and functional outcomes of pn versus rn in t1b renal tumors within a pairmatched control cohort . after approval was obtained from the institutional review board at each center , we retrospectively reviewed our database . we identified 611 patients treated between 1999 and 2011 with rn or pn for a solitary , nx / no mo solid renal mass ( 4 - 7 cm ) at five institutions in korea . after excluding patients with benign pathology and those with missing records , 577 ( pn , 100 ; rn , 477 ) patients with pathologically confirmed pt1b remained for analysis . patients who underwent pn ( n = 100 ) were matched to patients who underwent rn ( n = 458 ) . to eliminate the influence of the confounding factors and achieve equal distributions of patients between the two groups , we pair - matched the patients of the two groups using propensity scores . the propensity score included age , sex , comorbidities ( hypertension , diabetes ) , bmi , tumor size and depth , histologic type , and preoperative estimated glomerular filtration rate ( egfr ) . preoperative egfr was classified into five groups according to the current guidelines for chronic kidney disease ( ckd ) . clinical data including age , sex , bmi , tumor size and location , and surgical approach were recorded . intraoperative and postoperative data including operative time , estimated blood loss ( ebl ) , intraoperative transfusions and serum creatinine and hemoglobin levels on postoperative day 1 were recorded . complication rates , tumor recurrences , overall survival ( os ) rate , cancer - specific survival ( css ) rate , progression - free survival ( pfs ) rate , and renal function outcomes were documented . the os , css , and pfs rates were measured until the last date of follow - up . patients were evaluated for postoperative recurrence by chest x - ray and computed tomography scan every 6 months for the first 3 years . renal function evaluation included serum creatinine and egfr on preoperative , one day and 3 months postoperative and annually thereafter . the egfr was calculated for each creatinine value based on the cockcroft - gault equation . postoperative new - onset ckd was defined as egfr lower than 60 ml / min / 1.73 m , according to the national kidney foundation dialysis outcomes quality initiative clinical practice guidelines . procedures performed included pure laparoscopic , handassisted laparoscopic , robot - assisted laparoscopic and open rn and pn . surgical modality and approach were decided by surgeon preference and tumor characteristics . clinical and pathological variables were compared between patients who underwent pn and rn using the chi - square test and student s t test as appropriate . the os , css , pfs , and new - onset ckd rates were analyzed using the kaplan - meier method . post operative renal functions between groups were compared as the mean percent of decline in egfr from baselines at postoperative 3 , 12 , 24 , 36 , and 48 months by student s t test . to compare the survival rate between groups , was then used to compare the os , css and pfs rates of patients who underwent pn as opposed to rn . the associations between variables and the outcome parameters are presented with the hazard ratios and 95 % confidence intervals . null hypotheses of no difference were rejected if p - values were less than 0.05 , or , equivalently , if the 95 % confidence intervals ( cis ) of hazard ratio estimates excluded 1 . after approval was obtained from the institutional review board at each center , we retrospectively reviewed our database . we identified 611 patients treated between 1999 and 2011 with rn or pn for a solitary , nx / no mo solid renal mass ( 4 - 7 cm ) at five institutions in korea . after excluding patients with benign pathology and those with missing records , 577 ( pn , 100 ; rn , 477 ) patients with pathologically confirmed pt1b remained for analysis . patients who underwent pn ( n = 100 ) were matched to patients who underwent rn ( n = 458 ) . to eliminate the influence of the confounding factors and achieve equal distributions of patients between the two groups , we pair - matched the patients of the two groups using propensity scores . the propensity score included age , sex , comorbidities ( hypertension , diabetes ) , bmi , tumor size and depth , histologic type , and preoperative estimated glomerular filtration rate ( egfr ) . preoperative egfr was classified into five groups according to the current guidelines for chronic kidney disease ( ckd ) . clinical data including age , sex , bmi , tumor size and location , and surgical approach were recorded . intraoperative and postoperative data including operative time , estimated blood loss ( ebl ) , intraoperative transfusions and serum creatinine and hemoglobin levels on postoperative day 1 were recorded . complication rates , tumor recurrences , overall survival ( os ) rate , cancer - specific survival ( css ) rate , progression - free survival ( pfs ) rate , and renal function outcomes were documented . the os , css , and pfs rates were measured until the last date of follow - up . patients were evaluated for postoperative recurrence by chest x - ray and computed tomography scan every 6 months for the first 3 years . after that periodrenal function evaluation included serum creatinine and egfr on preoperative , one day and 3 months postoperative and annually thereafter . the egfr was calculated for each creatinine value based on the cockcroft - gault equation . postoperative new - onset ckd was defined as egfr lower than 60 ml / min / 1.73 m , according to the national kidney foundation dialysis outcomes quality initiative clinical practice guidelines . procedures performed included pure laparoscopic , handassisted laparoscopic , robot - assisted laparoscopic and open rn and pn . surgical modality andclinical and pathological variables were compared between patients who underwent pn and rn using the chi - square test and student s t test as appropriate . the os , css , pfs , and new - onset ckd rates were analyzed using the kaplan - meier method . post operative renal functions between groups were compared as the mean percent of decline in egfr from baselines at postoperative 3 , 12 , 24 , 36 , and 48 months by student s t test . to compare the survival rate between groups , was then used to compare the os , css and pfs rates of patients who underwent pn as opposed to rn . the associations between variables and the outcome parameters are presented with the hazard ratios and 95 % confidence intervals . null hypotheses of no difference were rejected if p - values were less than 0.05 , or , equivalently , if the 95 % confidence intervals ( cis ) of hazard ratio estimates excluded 1 . patient demographics and surgical and perioperative data from both groups are summarized in table 1 . the two groups were similar in age , sex , bmi , and number and type of comorbidity . preoperative mean creatinine and egfr were similar between the groups : 0.98 pn ( range , 0.4 to 2.0 ) and 1.04 rn ( range , 0.62 to 1.75 ) ( p = 0.28 ) , 80.46 pn ( range , 24.5 to 177.7 ) , and 88.79 rn ( range , 24.9 to 192.0 ) ( p = 0.41 ) , respectively . the mean pathologic tumor size was similar between the two groups : 4.90 cm pn and 4.91 cm rn ( p = 0.98 ) . the ratio of the pathological variables was also similar between the two groups ( p = 0.3 ) . laparoscopic surgery was performed in 130 patients . among them , 64 patients underwent pure laparoscopic surgery ( pn , n = 37 ; rn , n = 27 ) , 14 patients underwent handassisted laparoscopic surgery ( pn , n = 1 ; rn , n = 13 ) , and 52 patients underwent robot - assisted laparoscopic surgery ( pn , n = 18 ; rn , n = 34 ) . open surgery was performed in 70 patients ( pn , n = 44 ; rn , n = 26 ) . perioperative parameters including mean operative time , ebl and transfusion rate between the two groups did not differ significantly ( p 0.05 ) . the mean change in preoperative hemoglobin ( hb ) to postoperative hb was similar between groups ( p = 0.16 ) . renal pedicle clamping was conducted only in the pn group , in 96 patients ( warm ischemia , n = 82 ; cold ischemia , n = 14 ) , and the mean ischemic time was 29.97 minutes ( range , 9 to 68 minutes ) . intraoperative complications in the pn group consisted of three organ injuries ( one spleen injury , one major vessel injury , and one ureter injury ) and four pleural injuries . in the rn group , there were two organ injuries ( one major vessel injury and one duodenal injury ) and three pleural injuries . the postoperative complication rate was comparable in patients treated with pn and rn ( p = 0.09 ) . postoperative complications for pn included five patients with grade i , two patients with grade ii , and one patient with grade iiia complications . in the rn group , there were four cases of grade i and two cases of grade ii postoperative complications . in the pn group , three patients had a positive surgical margin ( psm ) , and of those , two were treated laparoscopically and one treated with open pn . the median follow - up duration in the rn group was 48.1 and 42.6 months for the pn group . tumor progression was found in six of 100 patients after pn . of those , three patients developed local recurrence and three patients developed distant metastases after a median duration of 97.0 months ( 95 % ci , 85.05 to 109.04 months ) . in the pn group , three patients had a psm , and none of these developed local or distant recurrence after a median followup of 37 months ( range , 19 to 45 months ) . in the rn group , 12 of 100 patients developed distant metastases after a median of 110.7 months ( 95 % ci , 98.54 to 123.00 months ) . the pfs rate was comparable between the two groups ( log - rank , p = 0.66 ) . the 5 - and 10 - year pfs rates were 86.4 % and 79.2 % for the pn group and 86.0 % and 66.0 % in the rn group , respectively ( table 3 , fig . the css rates for patients with t1b rcc treated with pn or rn were comparable ( log - rank , p = 0.52 ) ( table 3 ) . in the pn group , the estimated 10 - year css rate for pn was 85.7 % , similar to the rn rate of 84.4 % . the cox proportional hazards model adjusting for propensity scores also did not differ in css rate between groups ( hazard ratio [ hr ] , 2.01 ; 95 % ci , 0.22 to 18.33 ) . the estimated 10 - year os rate was significantly higher in the pn group ( 85.7 % ) than the rn group ( 73.3 % ) in the kaplan - meier analysis ( log - rank , p = 0.003 ) . using the cox proportional hazards model , tumor size ( p = 0.947 ) , type of surgery ( p = 0.131 ) , and postoperative renal function ( p = 0.146 ) forty - six patients ( pn , 22 ; rn , 24 ) had pre - existing ckd before surgery . there was no difference in baseline egfr between pn and rn ( p = 0.41 ) . renal function declined in both groups from preoperative to 3 months postoperative ( 80.46 ; range , 24.5 to 177.7 ) to 71.99 ml / min / 1.73 m ( range , 9.6 to 172.3 ml / min / 1.73 m ) and 88.79 ml / min / 1.73 m ( range , 24.9 to 192.0 ml / min / 1.73 m ) to 59.27 ( range , 29.8 to 137.4 ) in the pn and rn groups , respectively ) . the mean percent decline of egfr from baseline to postoperative 3 , 12 , 24 , 36 , and 48 months were all greater in the rn group compared to the pn group ( p 0.05 ) . new - onset ckd ( egfr 60 ml / min / 1.73 m ) occurred more frequently in the rn group ( n = 27 ) than in the pn group ( n = 5 ) ( p = 0.00 ; hr , 11.83 ; 95 % ci , 4.09 to 34.20 ) ( fig . the ratio of new - onset ckd increased as end - stage ckd ( egfr 15 ml / min / 1.73 m ) occurred in only one patient who underwent pn and in no patients in the rn group ( p 0.99 ) . patient demographics and surgical and perioperative data from both groups are summarized in table 1 . the two groups were similar in age , sex , bmi , and number and type of comorbidity . preoperative mean creatinine and egfr were similar between the groups : 0.98 pn ( range , 0.4 to 2.0 ) and 1.04 rn ( range , 0.62 to 1.75 ) ( p = 0.28 ) , 80.46 pn ( range , 24.5 to 177.7 ) , and 88.79 rn ( range , 24.9 to 192.0 ) ( p = 0.41 ) , respectively . the mean pathologic tumor size was similar between the two groups : 4.90 cm pn and 4.91 cm rn ( p = 0.98 ) . the ratio of the pathological variables was also similar between the two groups ( p = 0.3 ) . laparoscopic surgery was performed in 130 patients . among them , 64 patients underwent pure laparoscopic surgery ( pn , n = 37 ; rn , n = 27 ) , 14 patients underwent handassisted laparoscopic surgery ( pn , n = 1 ; rn , n = 13 ) , and 52 patients underwent robot - assisted laparoscopic surgery ( pn , n = 18 ; rn , n = 34 ) . open surgery was performed in 70 patients ( pn , n = 44 ; rn , n = 26 ) . perioperative parameters including mean operative time , ebl and transfusion rate between the two groups did not differ significantly ( p 0.05 ) . the mean change in preoperative hemoglobin ( hb ) to postoperative hbrenal pedicle clamping was conducted only in the pn group , in 96 patients ( warm ischemia , n = 82 ; cold ischemia , n = 14 ) , and the mean ischemic time was 29.97 minutes ( range , 9 to 68 minutes ) . intraoperative complications in the pn group consisted of three organ injuries ( one spleen injury , one major vessel injury , and one ureter injury ) and four pleural injuries . in the rn group , there were two organ injuries ( one major vessel injury and one duodenal injury ) and three pleural injuries . the postoperative complication rate was comparable in patients treated with pn and rn ( p = 0.09 ) . postoperative complications for pn included five patients with grade i , two patients with grade ii , and one patient with grade iiia complications . in the rn group , there were four cases of grade i and two cases of grade ii postoperative complications . in the pn group , three patients had a positive surgical margin ( psm ) , and of those , two were treated laparoscopically and one treated with open pn . the median follow - up duration in the rn group was 48.1 and 42.6 months for the pn group . tumor progression was found in six of 100 patients after pn . of those , three patients developed local recurrence and three patients developed distant metastases after a median duration of 97.0 months ( 95 % ci , 85.05 to 109.04 months ) . in the pn group , three patients had a psm , and none of these developed local or distant recurrence after a median followup of 37 months ( range , 19 to 45 months ) . in the rn group ,12 of 100 patients developed distant metastases after a median of 110.7 months ( 95 % ci , 98.54 to 123.00 months ) . the pfs rate was comparable between the two groups ( log - rank , p = 0.66 ) . the 5 - and 10 - year pfs rates were 86.4 % and 79.2 % for the pn group and 86.0 % and 66.0 % in the rn group , respectively ( table 3 , fig . the css rates for patients with t1b rcc treated with pn or rn were comparable ( log - rank , p = 0.52 ) ( table 3 ) . in the pn group , the estimated 10 - year css rate for pn was 85.7 % , similar to the rn rate of 84.4 % . the cox proportional hazards model adjusting for propensity scores also did not differ in css rate between groups ( hazard ratio [ hr ] , 2.01 ; 95 % ci , 0.22 to 18.33 ) . the estimated 10 - year os rate was significantly higher in the pn group ( 85.7 % ) than the rn group ( 73.3 % ) in the kaplan - meier analysis ( log - rank , p = 0.003 ) . using the cox proportional hazards model , tumor size ( p = 0.947 ) , type of surgery ( p = 0.131 ) , and postoperative renal function ( p = 0.146 ) forty - six patients ( pn , 22 ; rn , 24 ) had pre - existing ckd before surgery . there was no difference in baseline egfr between pn and rn ( p = 0.41 ) . renal function declined in both groups from preoperative to 3 months postoperative ( 80.46 ; range , 24.5 to 177.7 ) to 71.99 ml / min / 1.73 m ( range , 9.6 to 172.3 ml / min / 1.73 m ) and 88.79 ml / min / 1.73 m ( range , 24.9 to 192.0 ml / min / 1.73 m ) to 59.27 ( range , 29.8 to 137.4 ) in the pn and rn groups , respectively ) . the mean percent decline of egfr from baseline to postoperative 3 , 12 , 24 , 36 , and 48 months were all greater in the rn group compared to the pn group ( p 0.05 ) . new - onset ckd ( egfr 60 ml / min / 1.73 m ) occurred more frequently in the rn group ( n = 27 ) than in the pn group ( n = 5 ) ( p = 0.00 ; hr , 11.83 ; 95 % ci , 4.09 to 34.20 ) ( fig . the ratio of new - onset ckd increased as end - stage ckd ( egfr 15 ml / min / 1.73 m ) occurred in only one patient who underwent pn and in no patients in the rn group ( p 0.99 ) . our results with t1b rcc demonstrated comparable 5 - and estimated 10 - year pfs and estimated 10 - year css rates and superior estimated 10 - year os for patients treated with pn versus rn . five - and estimated 10 - year pfs rates were 86.4 % / 79.2 % for pn and 86.0 % / 66.0 % for rn . estimated 10 - year css rate was 85.7 % for pn and 84.4 % for rn . as the tendency changes toward performing more pn procedures for t1b rcc , studies demonstrate that the oncologic outcome and survival rate are comparable in patients treated with pn compared with rn . reported that pn led to higher 5 - year css and 5 - year tumor recurrence rates compared to rn in 4 to 7 cm rcc using univariate analysis . similarly , thompson et al . found no significant difference in 5 - and 10 - year css rates in patients with t1b who underwent pn or rn , although there was a tendency for a high rate of solitary kidney or ckd in the pn group , implying the possibility of patient selection bias . reported that there was no significant difference in the 5 - year css rate in patients with t1b rcc treated with pn versus rn ( 82.5 % and 85 % , p = 0.161 , respectively ) . based on these reports and the results of the present study , we suggest that pn is oncologically safe and has comparable , at least not inferior outcomes , compared with rn for the treatment of t1b rcc . a major benefit of pn is renal function preservation and the derived potential positive effects on os and quality of life . reported that a postoperative decline in gfr of 16.6 % and 23.5 % was observed in patients treated with pn and rn for t1b rcc , respectively . reported that pn for ct1b resulted in a similar postoperative egfr level to that of ct1a . in addition , the probability of freedom from the new onset of ckd after pn did not differ between ct1b or ct1a tumors . in our study , renal function , estimated by egfr , decreased after both pn and rn , but pn led to better postoperative renal function preservation compared to rn . the change in egfr from baseline to 3 months and 4 years was 10.52 % / 8.04 % for pn and 33.24 % / 35.12 % for rn . pn was less likely to induce newonset ckd and end - stage ckd compared with rn . the present study demonstrates the feasibility and validity of pn for t1b rcc with respect to oncologic outcome and superior renal function preservation . in the present study , renal function decreased sharply during the first 3 months after pn and rn and was maintained for 4 years . the percent decline of egfr from baseline to postoperative follow - up time was significantly smaller in the patients treated with pn compared with rn . although technical concerns relative to the effect of renal artery occlusion or reperfusion injury and warm ischemia , and the association of resection volume and remnant renal function in t1b rcc require additional consideration and investigation , it seems clear that the functional outcome after pn is superior to that after rn in patients with t1b rcc . several studies show an advantage in os for patients who underwent pn , mainly attributed to the renal function preservation after surgery . however , in a randomized trial by van poppel et al . , 10 - year os was greater in patients treated with rn ( 81.1 % ) than in patients treated with pn ( 75.7 % ) ( p = 0.03 ) . they criticized the superior outcome of pn in other studies , saying those results depend heavily on patient selection . in the present study , postoperative renal function manifested as egfr was better preserved in the pn group , and the rn group had more frequent new - onset postoperative ckd . the os rate was significantly higher in the pn group compared with the rn group ( p = 0.003 ) . while our study , in design , may also fundamentally present results of careful patient selection when choosing candidates for pn , neither has our study shown that renal function following rn or pn significantly affected os . while we hypothesized that postoperative renal function may prognosticate os , in multivariate cox regression analysis , postoperative egfr was not associated with os , despite a significant higher ratio of new - onset of ckd in the rn group than the pn group . also , there was no significant prognostic factor for os using the multivariate cox regression analysis . the critical opinions and concerns of pn for rcc include multifocality and microscopic satellite of rcc and incomplete tumor resection . multifocality is a characteristic of rcc and occurs in approximately 16 % and 47 % of rcc patients in the form of a satellite lesion . however , the local recurrence rate after pn for t1b rcc was 1 % to 5.4 % , lower than the high rate of multifocality or microscopic satellite tumor lesions . since the local recurrence rate of pn for t1a rcc is 0 % - 10 % , we suggest no significant increase in t1b rcc . reported that , after pn for t1a and t1b rcc , local recurrence rates were comparable , 5 % and 1 % , respectively ( p = 0.57 ) . in the present study , the local recurrence rate was 3 % , similar to other studies . pn for larger renal tumors can be technically challenging and requires extensive experience , causing concerns of higher perioperative complications and incomplete tumor resection . the risk of perioperative complications with pn is slightly higher than with rn . in a prospective , randomized study , van poppel et al . reported that pn is associated with increased hemorrhage ( 3.1 % and 1.2 % ) , urinary fistula ( 4.4 % and 0 % , p 0.001 ) and re - operation due to side effects ( 4.4 % and 2.4 % ) . in the present study , there was no significant difference in mean operative time , ebl or transfusion rate , and the overall intraoperative complication rate was similar between the groups . however , patard et al . reported that the psm rate was comparable in small tumors and tumors larger than 4 cm . psm after pn for t1b rcc occurs in 0 % - 13.3 % of cases . whether or not psm is a risk factor for tumor recurrence after pn , which is still controversialreported that patients with psm after pn were not at increased risk for local recurrence or metastasis after a mean follow - up time of 3.4 years . psm rates after pn are reported differ by surgical approach and tend to increase in minimally - invasive approaches ( 0.7 % - 4 % in laparoscopic approach , 3.9 % - 5.7 % in robot - assisted approach ) compared to an open approach ( 0 % - 7 % ) . in the present study , psm was 3 % , and none of the patients developed local or distant recurrence after a median followup of 37 months ( 19 - 45 months ) . since rn was established as a surgical treatment for rcc , it has been the standard of care in treating rcc . during the last decadealthough the cutoff of 4 cm in the treatment of rcc generated controversy after t1 substratification was introduced in 2002 , it has been validated by a number of studies showing differences between t1a and t1b rcc in a 5 - year css . however , emerging data about pn for t1b rcc indicate that pn provides cancer control and survival comparable to rn . the present study is valuable in that it adds the evidence of feasibility of pn for t1b rcc based on data that is evenly pair - matched and includes both basic patient characteristics and tumor characteristics . also , in the present study , both oncologic and functional outcomes were simultaneously compared between pn and rn . it is important to evaluate the benefit of os in the patients treated with pn . although we conducted a pair - matched study and the data were distributed evenly with regard to patient and tumor characteristics , it was nevertheless a retrospective design . to overcome the disadvantages of a retrospective study , this method is suggested as a way to overcome the effects of observed covariates and allowing focus on the treatment method . through propensity score matching , studies may overcome the difficulties of conducting large randomized prospective studies where covariates other than the purposed outcome can not be manipulated , and thus may introduce new bias if the sample size is not sufficiently large . however , propensity score matching has its failings , as it can not compensate for unobserved covariates such as , in our study , the lack of cause of death ( except death from rcc ) and occurrence of cardiovascular events . unidentified potential confounders may have resulted in some early cases of rn showing significant change on survival . our study suggests that pn shows similar css and pfs compared with rn in t1b rcc in a pair - matched clinical outcomes study . though there are several limitations of the present study , our results suggest additional support for the feasibility of pn in t1b renal tumors . a large - scale prospective study is needed to clarify the association of os and postoperative renal function .\noutput:\n" }, { "from": "agent", "value": "purposethe study was to compare the oncologic and functional outcomes of partial nephrectomy ( pn ) and radical nephrectomy ( rn ) for pathologically proven t1b renal cell carcinoma using pair - matched groups.materials and methodswe reviewed our prospectively maintained database for rn and pn in t1b renal tumors surgically treated between 1999 and 2011 at five institutions in korea . of 611 patients treated with pn or rn for a solitary and nx / n0 m0 renal mass ( 4 - 7 cm ) , 577 ( pn , 100 ; rn , 477 ) patients with pathologically confirmed pt1b remained for analysis . study subjects were grouped by pn or rn , then matched by age , sex , comorbidities , body mass index , tumor size and depth , histologic type , and preoperative estimated glomerular filtration rate ( egfr ) using propensities score . to evaluate oncologic outcomes , overall survival ( os ) , cancer - specific survival ( css ) , and progression - free survival ( pfs ) rates were analyzed . the functional outcomes were evaluated by postoperative egfr.resultsthe median follow - up in the rn group was 48.1 and 42.6 months in the pn group . the estimated 10 - year css rate ( pn 85.7 % vs. rn 84.4 % , p = 0.52 ) and 5 - and estimated 10 - year pfs rates ( pn : 86.4 % and 79.2 % vs. rn : 86.0 % and 66.1 % , p = 0.66 ) did not differ significantly between groups . the estimated 10 - year os rate was significantly higher in the pn group ( 85.7 % ) compared to the rn group ( 73.3 % ) ( p = 0.003 ) . pn was less likely to induce new - onset chronic kidney disease ( ckd ) and end - stage ckd compared with rn.conclusionour study suggests that patients treated with pn demonstrate a superior os rate and postoperative renal function with analogous css and pfs rates compared with pair - matched patients treated with rn ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in long - distance transportation of thoroughbred racehorses there have been issues with pyrexia ( shipping fever ) or with transport pneumonia , which occurs with the aggravation of shipping fever . these problems have been caused mainly by transportation stress and / or degradation of the environments in trucks for transportation of horses . although these diseases have shown a tendency to decrease in incidence because of improvements in transport environments and in the management of individual thoroughbred racehorses before transportation , no decisive methods for their prevention have yet been established , and they are still among the major risks posed by equine long - distance transportation . human interferon - alpha ( ifn ) is a protein produced in the body mainly during virus infection ; it has known immunostimulatory and anti - viral activity . high - dose injections of ifn have been given to treat tumors and viral infections in the medical care of humans and small animals . however , similar immunostimulation activity has been reported from the oral administration of low - dose human ifn . although the mechanisms of action have not been completely elucidated , the binding of ifn to the receptors of the immune - related cells commonly present in the pharynx and esophagus may trigger the cytokine network to promote the activation of immune cells . the oral administration of low - dose human ifn to horses has been reported as effective in inflammatory airway diseases and in the prevention of shipping fever in young racing thoroughbreds . however , there have been no reports on the oral administration of human ifn for preventing shipping fever in thoroughbred racehorses which have trained with a sufficient load for racing . we investigated the efficacy of low - dose human ifn in shipping fever of thoroughbred racehorses locked and loaded for racing . the drug was given orally before long - distance transportation of the horses for participation in racing . the ifn ( ifn : 200 iu / g ; bimuron , biovet , tokyo , japan ) used was human native ifn produced for use in powder form for animals by the culture of human cells , using maltose as a base . we used trucks exclusively designed for transportation of horses , which have a carrying capacity of six horses in the direction of travel . if air - conditioning was unnecessary , the truck could be naturally ventilated by drawing fresh air in through the window . the subjects were 73 thoroughbred racehorses ( 52 males or geldings , 21 females ; mean standard deviation ( sd ) ; age , 3.61.3 years old ) transported from the ritto training center of the japan racing association ( jra ritto ) to the hakodate racecourse of jra ( jra hakodate ) or the sapporo racecourse of jra ( jra sapporo ) . the duration of transportation was approximately 20 hr from jra ritto to jra hakodate and approximately 26 hr from jra ritto to jra sapporo . the 48 horses randomly sampled from among the 73 horses investigated were orally administrated the ifn ( 1.25 g / head / day : ifn group ) ; while the remaining 25 horses were orally administered maltose as the drug base ( maltose , wako pure chemicalindustries , osaka , japan ; 1.25 g / head / day : control group ) . on the basis of the results of a previous study , the drugs were administered once daily and continued for 3 successive days before transportation ( including on the day of transportation ) . rectal temperatures ( rt ) were measured and blood sampled immediately before the initial administration of ifn or maltose , as well as just before transportation and immediately after transportation . blood samples were collected from the jugular veins of the animals in plain blood collection tubes ( vp - p100k , terumo , tokyo , japan ) or tubes containing sodium citrate buffer ( vp - c050 , terumo ) or edta ( vp - dk050k , terumo ) . blood collected with the tube containing sodium citrate buffer was centrifuged ( 4c , 2,000 g , 10 min ) to obtain plasma and measure plasma fibrinogen ( fbg ) concentrations by the salting - out method ( iatroset fbg , mitsubishi kagaku iatron , tokyo , japan ) , using human fbg as a standard . for blood collected with the edta tube , white blood cell counts ( wbc ) in peripheral bloodwere measured by an automated hemocytometer ( k - 4500 , sysmex , hyogo , japan ) . blood collected with the plain tube was centrifuged ( 25c , 2,000 g , 10 min ) to obtain serum to measure serum amyloid a ( saa ) concentrations by latex agglutination turbidimetric immunoassay ( lz test eiken saa , eiken chemical , tokyo , japan ) , using equine saa as a standard . the data were analyzed by analysis of variance for comparison within each group or by mann whitney s u test for intergroup comparison , with p 0.05 considered significant . in addition , the proportions of animals that demonstrated clinically evident abnormalities in rt , wbc , fbg , and saa ( 39.0 c , 15,000 / mm , 400 mg / dl , and 1 g / ml , respectively ) were calculated . the horses general condition ( physical condition , appetite , and feces ) was also observed . the ifn ( ifn : 200 iu / g ; bimuron , biovet , tokyo , japan ) used was human native ifn produced for use in powder form for animals by the culture of human cells , using maltose as a base . we used trucks exclusively designed for transportation of horses , which have a carrying capacity of six horses in the direction of travel . if air - conditioning was unnecessary , the truck could be naturally ventilated by drawing fresh air in through the window . the subjects were 73 thoroughbred racehorses ( 52 males or geldings , 21 females ; mean standard deviation ( sd ) ; age , 3.61.3 years old ) transported from the ritto training center of the japan racing association ( jra ritto ) to the hakodate racecourse of jra ( jra hakodate ) or the sapporo racecourse of jra ( jra sapporo ) . the duration of transportation was approximately 20 hr from jra ritto to jra hakodate and approximately 26 hr from jra ritto to jra sapporo . the 48 horses randomly sampled from among the 73 horses investigated were orally administrated the ifn ( 1.25 g / head / day : ifn group ) ; while the remaining 25 horses were orally administered maltose as the drug base ( maltose , wako pure chemicalindustries , osaka , japan ; 1.25 g / head / day : control group ) . on the basis of the results of a previous study , the drugs were administered once daily and continued for 3 successive days before transportation ( including on the day of transportation ) . rectal temperatures ( rt ) were measured and blood sampled immediately before the initial administration of ifn or maltose , as well as just before transportation and immediately after transportation . blood samples were collected from the jugular veins of the animals in plain blood collection tubes ( vp - p100k , terumo , tokyo , japan ) or tubes containing sodium citrate buffer ( vp - c050 , terumo ) or edta ( vp - dk050k , terumo ) . blood collected with the tube containing sodium citrate buffer was centrifuged ( 4c , 2,000 g , 10 min ) to obtain plasma and measure plasma fibrinogen ( fbg ) concentrations by the salting - out method ( iatroset fbg , mitsubishi kagaku iatron , tokyo , japan ) , using human fbg as a standard . for blood collected with the edta tube , white blood cell counts ( wbc ) in peripheral bloodwere measured by an automated hemocytometer ( k - 4500 , sysmex , hyogo , japan ) . blood collected with the plain tube was centrifuged ( 25c , 2,000 g , 10 min ) to obtain serum to measure serum amyloid a ( saa ) concentrations by latex agglutination turbidimetric immunoassay ( lz test eiken saa , eiken chemical , tokyo , japan ) , using equine saa as a standard . the data were analyzed by analysis of variance for comparison within each group or by mann whitney s u test for intergroup comparison , with p 0.05 considered significant . in addition , the proportions of animals that demonstrated clinically evident abnormalities in rt , wbc , fbg , and saa ( 39.0 c , 15,000 / mm , 400 mg / dl , and 1 g / ml , respectively ) were calculated . the horses general condition ( physical condition , appetite , and feces ) was also observed . in both treatment groups , no statistically significant differences in rt , wbc , fbg , or saa were observed between the measurements taken just before the initial administration of ifn or maltose and those taken immediately before transportation ( table 1table 1 . changes of rectal temperature , fibrinogen , and serum amyloid a in just before the initial administration of ifn , immediately before transportation , and immediately after transportationgroupsa mplingrectal temperature ( c ) wbc ( / mm ) fbg ( mg / dl ) saa ( g / ml ) controlpre - administration * 37.90.19,4602,137237.542.70.00.1 pre - transportation * * 37.90.18,6081,363230.433.10.00.1 post - transportation * * * 38.50.611,7083,134304.276.46.515.4 ifnpre - administration 37.90.19,5351,962235.227.20.00.1 pre - transportation 37.90.18,3731,419238.630.60.00.1 post - transportation38 .30.510,3443,000262.042.41.02.9 * pre - administration : just before the initial administration of ifn . * * pre - transportation : immediately before transportation . * * * post - transportation : immediately after transportation . the data were analyzed by analysis of variance for comparison within each group or by mann whitney s u test for intergroup comparison , value of p 0.05 were considered significant . significantly different from the pre - administration value at each sampling time ( p 0.01 ) . significantly different from the pre - transportation value at each sampling time ( p 0.01 ) . significantly different from the pre - administration value at each sampling time ( p 0.05 ) significantly different from the pre - transportation value at each sampling time ( p 0.05 ) . * pre - administration : just before the initial administration of ifn . * * pre - transportation : immediately before transportation . * * * post - transportation : immediately after transportation . the data were analyzed by analysis of variance for comparison within each group or by mann whitney s u test for intergroup comparison , value of p 0.05 were considered significant . significantly different from the pre - administration value at each sampling time ( p 0.01 ) . significantly different from the pre - transportation value at each sampling time ( p 0.01 ) . significantly different from the pre - administration value at each sampling time ( p 0.05 ) significantly different from the pre - transportation value at each sampling time ( p 0.05 ) . rt immediately after transportation was significantly higher ( p 0.05 ) than immediately before transportation ( table 1 ) . rt immediately after transportation in the ifn group tended to be lower than in the control group ( table 1 ) . furthermore , 14.6 % of the animals in the ifn group and 16.0 % in the control group had rt of 39.0 c or higher , although there was no significant difference between the two groups ( table 2table 2 . the percentage of horses showing abnormal values just before the initial administration of ifn , immediately before transportation , and immediately after transportationgroupsamplingrectal temperature ( % ) wbc ( % ) fbg ( % ) saa ( % ) controlpre - administration * 0000pre - transportation * * 0000post - transportation * * * 16.020.012.044.0 ifnpre - administration0000pre - transportation0000post - transportation14 .68.30.016.7 rectal temperature : percentage of horses showing rectal temperature of 39.0 . saa : percentage of horses showing saa value of 1.0 g / ml . the data were analyzed by mann whitney s u test for intergroup comparison , with values of p 0.05 considered significant . : see table 1 for key ) . no further increases in rectal temperature and deterioration in general condition were found 2 days after transportation , and all the horses that developed fevers improved within a few days . saa : percentage of horses showing saa value of 1.0 g / ml . the data were analyzed by mann whitney s u test for intergroup comparison , with values of p 0.05 considered significant . : see table 1 for key in both treatment groups wbc immediately after transportation was significantly greater than immediately before transportation ( p 0.05 ) . however , wbc just after transportation in the ifn group was significantly lower ( p 0.05 ) than in the control group ( table 1 ) ; moreover , 8.3 % of horses in the ifn group and 20.0 % in the control group had wbc of 15,000 / mm or higher immediately after transportation ( table 2 ) . fibrinogen levels immediately after transportation were significantly higher ( p 0.05 ) than immediately before transportation in both groups , and fbg just after transportation in the ifn group was significantly lower ( p 0.05 ) than in the control group ( table 1 ) . just after transportation ,12.0 % of animals in the control group had fbg levels greater or equal to 400 mg / dl , whereas no animals in the ifn group had such high fbg levels ; this difference was significant ( p 0.05 ) ( table 2 ) . significant increases ( p 0.05 ) in saa levels just after transportation compared with those immediately before transportation were observed in both groups . the saa level in the ifn group was lower ( p 0.05 ) than in the control group . the proportion of horses in the control group with abnormal saa just after transportation ( 44.0 % ) was higher ( p 0.05 ) than in the ifn group ( 16.7 % ) ( table 2 ) . low - dose oral administration of ifn , a technique that has recently been used in clinical settings , has been reported to show efficacy in the treatment of inflammatory respiratory diseases and the prevention of shipping fever in young thoroughbred racehorses during long - distance transportation . hobo et al . reported that oral administration of human ifn at 0.5 iu / kg / day resulted in preferable outcomes in respect of prevention of shipping fever in young thoroughbred racehorses ( 2 years old ) . they also stated that multiple administrations of human ifn reduced the incidence of shipping fever , and continuous human ifn for 3 days was more effective than a single administration for preventing the disease . in this study , referring to the reports by hobo et al . , we decided on duration of administration of low - dose human ifn of 3 days before transportation , including the day of transportation . on the basis of the average body weight of a racing thoroughbred ( 450 to 500 kg ) we chose a drug dose rate of 1.25 g / day / head ( 250 iu / day / head ) , without variation . determination of dosage on the basis of individual body weights would have been difficult in a clinical situation . the safety of low - dose human ifn has already been confirmed in previous reports on young thoroughbred racehorses , and we observed no hematological or clinical condition abnormalities in during or after administration of the drug . we confirmed that low - dose human ifn could be safely used in thoroughbreds trained with a sufficient load for racing . immediately after transportation , rt , wbc , and inflammatory markers ( fbg and saa ) were significantly higher than immediately before transportation . these results indicate that long - distance transportation yields considerable stress on the horses , and that the stress itself could not be completely mitigated by the administration of low - dose human ifn . however , comparison between the treatment groups revealed that the extent of the increase in rt in the ifn group just after transportation tended to be smaller than in the control group . as for the ifn group , increases of wbc , fbg and saa were inhibited significantly in comparison with the control group , but shipping fever was not prevented . accordingly we think that detailed consideration of these factors is required to clarify the effect of treatment regimen ifn administration to thoroughbred racehorses . in this study , fbg and saa values in the ifn groupwe think that this was due to ifn administration inhibiting the intravital inflammatory degree due to transportation . we also think that the other acute phase proteins it will be necessary to measure in the future . in this study , we did not examine the mechanism of ifn action , and it will be necessary to clarify this mechanism in the future . in conclusion , long - distance transportation had a relatively profound impact on thoroughbred racehorses , which was mitigated by ifn treatment .\noutput:\n" }, { "from": "agent", "value": "to assess the effect of human interferon - alpha ( ifn ) on shipping fever of thoroughbred racehorses subjected to long - distance transportation , an ifn preparation was orally administered to 48 horses three times ( once daily , 3 successive days ) before transportation ( ifn group ) . in the control group ( 25 horses ) , maltose was administered in the same way . these treatments induced no abnormal findings in thoroughbred racehorses before transportation . immediately after transportation , significant increases in rectal temperature were observed in both treatment groups , whereas the rectal temperature of the ifn group tended to be lower than that of the control group . although wbc , fbg , and saa immediately after transportation were significantly increased due to transportation in both groups , the extent of the increases in the ifn group was significantly smaller than in the control group . long - distance transportation had a relatively profound impact on thoroughbred racehorses , which was mitigated by ifn treatment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: oral lichen planus ( olp ) represents a common mucocutaneous disease that affects 0.5 to 2 % of the population . malignant transformation of olp in oral squamous cell carcinoma ( oscc ) is possible according to a 10 - year retrospective study , besides some cross - sectional and cohort studies . however , the mechanisms involved in malignant transformation have not yet been elucidated ; therefore , some authors do not consider that olp presents this potential . the establishment of new biomarkers to predict or indicate malignant transformation would be very useful in the management of olp patients . some genes and antibodies , such as p16 , bub3 and sox4 , are currently studied in different types of cancer in order to establish new possible markers . however , little is known about such antibodies in oscc precursor lesions or conditions , especially olp . this paper aims to report a case of an in situ oral carcinoma ( isoc ) that developed on a previous olp lesion in a 79 - year - old man . we evaluated the immunohistochemical expression of ki67 , p53 , p16 , and , for the first time , bub3 and sox4 . a 79 - year - old white man complained of a white lesion in the buccal mucosa to his dermatologist . he was being monitored in a medical service for older adults for a long time because of multiple basal cell skin carcinomas previously treated . an incisional biopsy of the buccal lesion was conducted by the dermatologist at the right buccal mucosa . five months after such procedure , the patient became symptomatic , and some erythematous areas appeared mixed with white areas . at that time , the diagnosis of olp was established by the dermatologist who prescribed 0.05 % clobetasol ointment . after two months without lesion remission , the patient was referred to an oral and maxillofacial surgeon , who found an ulcer with an erythematous halo and some small white plaques around in the right buccal mucosa ( figure 1 ) . a new incisional biopsy was performed by the oral surgeon at the same area of the right - sided lesion , previously diagnosed as olp . figure 1clinical aspect of the right buccal mucosa : ulcer with an erythematous halo and small white plaques in the center of the picture histological examination revealed pleomorphic epithelial cells with hyperchromatic nuclei and evident nucleoli . a few mitotic figures and loss of epithelial stratification were also identified . adjacent to the isoc area , the epithelium showed hyperkeratosis , angulated rete pegs and basal cell liquefaction . altogether , the histological and clinical findings were consistent with the previous diagnosis of olp . [ hematoxylin & eosin , 100x ( a ) , 400x ( b ) ] : a ) band - like lymphocytic infiltrate in the lichenoid area ; b ) carcinoma in situ showing several changes from basal layer to upper layer of epithelium . the following alterations are present : cells with enlarged nuclei , pleomorphic cells , hyperchromatism , increased nuclear - to - cytoplasmic ratio , loss of epithelium stratification and basal cell hyperplasia an immunohistochemical panel with ki67 ( biocare , sp6 , 1:100 ) , p53 ( dako , clone do - 7 , 1:200 ) , p16 ink4a ( pharmingen , clone g175 - 405 bd , 1:200 ) , sox4 and bub3 ( abcam , clone epr5319 , 1:500 ) antibodies was conducted ( figure 3 ) . p16 was positive both in the area of olp as the isoc , with cytoplasmic and nuclear staining in the basal and suprabasal layers . p53 showed less than 10 % nuclear staining in the olp and less than 20 % in the isoc . figure 3immunohistochemistry ( 400x ) : p16 nuclear and cytoplasmic staining basal and suprabasal layers oral lichen planus ( olp ) area ( a ) ; p16 nuclear and cytoplasmic staining basal and suprabasal layers in situ oral carcinoma ( isoc ) area ( b ) ; bub3 nuclear staining - olp area ( c ) ; bub3 nuclear staining - isoc area ( d ) ; p53 nuclear staining - olp area ( e ) ; p53 nuclear staining - isoc area ( f ) ; ki67 negative - olp area ( g ) ; ki67 nuclear staining basal and suprabasal layers - isoc area ( h ) table 1immunohistochemical panelantibodie olpisocp16 ink4aclone g175 - 405 bd pharmingen ( + ) ( + ) 1:200 weak and focalweak and focal cytoplasmaticcytoplasmatic basal layerbasal layerbub 3clone epr5319 ( 2 ) ( + ) ( + ) 1:500 abcamstrong ( 90 % ) strong ( 90 % ) nuclearnuclear basal , espinous and granular layers.basal , espinous and granular layers.p 53clone do - 7 ( + ) ( + ) 1:200 dakoweak 10 % weak 20 % nuclearnuclear basal layerbasal and spinous layerssox 4policlonal ( - ) ( - ) 1:800 abcam ki67clone sp6 ( - ) ( + ) 1:100 biocare strong 20 a 30 % nuclear basal and spinous layersolp = oral lichen planus ; isoc = in situ oral carcinoma olp = oral lichen planus ; isoc = in situ oral carcinoma the lesion was resected with safe surgical margins . histological examination revealed some areas compatible with isoc , some compatible with epithelial dysplasia ( moderate to severe ) , and also one area close to the lateral limit of the specimen compatible with olp . four months after surgery , the patient had scarring in the buccal mucosa , but no signs of recurrence were observed . olp can manifest as whitish striations or plaques , atrophic erythematous areas , ulcers , papules and vesicles . three morphological types are usually described : the reticular form - asymptomatic whitish striations ; the erythematous or atrophic form - reddish areas alone or between whitish striations , and the erosive form - painful ulcerations added to the other features . the present case is compatible with the erosive form that has the highest probability of malignant transformation . however , lichenoid reaction to captopril could also be considered , which represents a limitation in the present case . in a prospective study conducted with 327 olp patients , although the sample had 229 women and only 98 men , the rate of transformation of olp to oscc was higher in men ( 3 % ) than in women ( 2.1 % ) . the mean age in patients who developed oscc was 68 years in women and 62 years in men , both higher than the overall group . moreover , some authors indicate that that olp can evolve both in squamous cell carcinoma and , possibly , oral melanoma . timing for carcinoma appearance in preexisting olp in the same study varied from 2.68 to 3.26 years . however , time between olp diagnosis and development of malignancy in the current case was only seven months . it is possible that olp was already present for much longer as a reticular form without symptoms . the patient was being monitored in a medical service for older adults for a long time before complaining of mouth problems . nevertheless , he was only referred to the dentist after an attempt to treat the oral problems . we consider that the mouth exam should be performed preemptively by a dentist , aiming to achieve early diagnosis and avoid complications . a large study conducted with 3142 patients found that 1 % had oral potentially malignant disorders , among them 9 cases of olp . the importance of oral analysis and tactile examination in earlier diagnosis of oral mucosal diseases was emphasized . multiple basal cell carcinomas may be a component of several syndromes such as gorlin - goltz . no keratocysts or other phenotypes of this syndrome were detected by the dental team . in the same way , higher expression of ki67 and p53 in olp compared with normal oral mucosa was previously observed , which may favor the malignant potential of olp . its mutations have been detected in olp and oscc among other lesions , and may be related to malignancy development . in the present case , although weak , there was p53 marking in both isoc and olp areas , confirming the potential of malignancy associated with the olp . ki67 antibody is widely used to assess cellular proliferation in cancer and cancer precursor lesions including oral lesions . there was no considerable expression of ki67 in the olp area , different from what was observed in some previous studies , in which the expression ranged from 13 to 20 % . this suggests that some cases of olp may present a potential for malignant transformation independent of ki67 expression . suppression of p16 expression appears to represent an initial event in oral carcinomas development . however , similar to cervical intraepithelial neoplasia and cervical cancer , p16 overexpression was also found in oscc . the hpv inhibition of rb protein leads to high p16 levels , due to negative feedback regulation in cervical lesions . p16 expression in olp was evaluated in three previous studies , with positivity index ranging from 26.7 to 65.2 % . however , the criteria used in each study was very different ( p16 expression 1 % , 5 % and 70 % to be a positive case ) . this expression , similarly to cervical carcinoma , may reflect the malignant potential of olp or simply suggest the presence of hpv in olp . some studies using different molecular biology techniques have correlated deregulation of bub3 expression in different types of cancer . the low expression of bub3 can lead to abnormal chromosome segregation and allow specific oncogenic mutations to appear . however , overexpression of bub3 gene was also correlated with high expression of ki67 in gastric cancer . in a similar pattern , an intense epithelial expression of bub3 was detected in the present case , indicating that bub3 may behave in the same way in oral cancer and precursor lesions as olp . since this is a pioneer report of bub3 expression in an oral lesion , scientific studies with appropriate design should be conducted to confirm that hypothesis . increased expression of sox4 has been detected in malignant tumors of breast , lung , colon and salivary glands , among others . a study with 50 cases of oscc showed a significant correlation between the expression of sox4 and tumor staging . the expression of sox4 in poorly differentiated oscc was higher than that observed in well - differentiated tumors . the authors suggested that sox4 may have a role in the differentiation of oral cancer . there are no studies evaluating the immunohistochemical expression of sox4 in olp lesions so far in scientific literature to compare the present finding . in addition , the pattern of ki67 ( absent ) and p53 ( weak ) expression in olp areas suggest that even in presence of typical histological appearance , olp can undergo malignant transformation . these findings emphasize the utmost importance of early diagnosis and continuous monitoring of olp lesions , especially in older patients . bub3 expression , first reported in the present case , and p16 may suggest some influence of these genes on the pathogenesis or the malignant potential of olp .\noutput:\n" }, { "from": "agent", "value": "oral lichen planus ( olp ) represents a common mucocutaneous disease . various authors have suggested that olp has malignant potential ; however , the mechanisms involved in malignant transformation have not yet been elucidated . a 79 - year - old man presented a white lesion for five months in the buccal mucosa diagnosed as olp . after two months using 0.05 % clobetasol ointment for treatment , the lesion became ulcerated . a new biopsy of the same lesion was performed , and histological analysis showed an in situ oral carcinoma ( isoc ) . an immunohistochemistry panel was performed , and p16 expression was negative in olp , however , it showed weak cytoplasmic staining in isoc . there was strong nuclear bub3 staining in both olp and isoc areas . p53 showed less intense nuclear staining in both regions . ki67 was negative in olp area , but showed nuclear staining in the isoc . sox4 was negative in both studied areas . bub3 expression , first reported in this case , and the p16 expression may suggest some influence of these genes on pathogenesis or malignant potential of olp ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in this prospective , cross - sectional controlled study , a total of 200 consecutive children with iron deficiency and / or iron deficiency anemia were referred to the neurology and pediatrics departments of the medical faculty of bezmialem vakf university , istanbul , turkey between january and june 2013 . the ethics committee of the faculty of medicine of istanbul university approved the study , and informed consent was obtained from the all participants . children between the ages of 8 - 18 years in whom blood tests revealed iron deficiency and / or iron deficiency anemia were included in the study . the control group consisted of volunteers between 8 - 18 years old who had no medical problem . patients aged 8 years with a limited expressive capability of thoughts and language or 18 years , patients unwilling to participate in the study , patients with an underlying disease other than iron deficiency , such as uremia , cancer , peripheral vascular disease , rheumatoid arthritis , hypothyroidism , polyneuropathy , lumbosacral radiculopathy , myelopathy , multiple sclerosis , and poliomyelitis . patients using neuroleptic and antiepileptic drugs , and those with local and systemic infectious disease , chronic hepatitis , high serum transaminases ( more than twice ) , serum c - reactive protein and sedimentation rates , portal hypertension , collagen tissue disease , hematologic malignancies , hemolytic anemia , and inflammatory bowel disease were also excluded . both the study and control groups were evaluated by pediatric and neurology residents with face to face questionnaires according to the irlssg diagnostic criteria .11,12 patients complaints , in their own words , were taken into consideration . serum ferritin levels measured by advia centaur classic , iia ( centaur chemiluminescent enzyme immunoassay analyzer , siemens , 2006 , germany ) . serum ferritin levels of below 12 ng / ml was accepted as indicating iron deficiency .13 we did not calculate sample size before starting the study ; however , the power analysis performed after completion of study was 90 % . statistical analysis was performed with spss for windows ( version 13.0 , spss inc . , descriptive data were expressed as meanstandard deviation ( sd ) for continuous variables , and n ( % ) for categorical variables . demographic characteristics were compared between the patients ( serum ferritin level lower than12 ng / ml ) and controls ( serum ferritin level higher than 12 ng / ml ) . categorical variables were compared using the chi - squared test , while continuous variables were compared using mann - whitney u tests as variables did not show normal distribution . multivariate analysis was performed to find independent predictors for the occurrence of rls by using a binary logistic regression analysis ( enter method ) . a p - value less than 0.05 ; 95 % confidence intervals was considered statistically significant . in this prospective , cross - sectional controlled study , a total of 200 consecutive children with iron deficiency and / or iron deficiency anemia were referred to the neurology and pediatrics departments of the medical faculty of bezmialem vakf university , istanbul , turkey between january and june 2013 . the ethics committee of the faculty of medicine of istanbul university approved the study , and informed consent was obtained from the all participants . children between the ages of 8 - 18 years in whom blood tests revealed iron deficiency and / or iron deficiency anemia were included in the study . the control group consisted of volunteers between 8 - 18 years old who had no medical problem . patients aged 8 years with a limited expressive capability of thoughts and language or 18 years , patients unwilling to participate in the study , patients with an underlying disease other than iron deficiency , such as uremia , cancer , peripheral vascular disease , rheumatoid arthritis , hypothyroidism , polyneuropathy , lumbosacral radiculopathy , myelopathy , multiple sclerosis , and poliomyelitis . patients using neuroleptic and antiepileptic drugs , and those with local and systemic infectious disease , chronic hepatitis , high serum transaminases ( more than twice ) , serum c - reactive protein and sedimentation rates , portal hypertension , collagen tissue disease , all participants were questioned regarding their medical family history and drug usage . all patients and controls underwent systemic physical examination . both the study and control groups were evaluated by pediatric and neurology residents with face to face questionnaires according to the irlssg diagnostic criteria .11,12 patients complaints , in their own words , were taken into consideration . serum ferritin levels measured by advia centaur classic , iia ( centaur chemiluminescent enzyme immunoassay analyzer , siemens , 2006 , germany ) . we did not calculate sample size before starting the study ; however , the power analysis performed after completion of study was 90 % . statistical analysis was performed with spss for windows ( version 13.0 , spss inc . , descriptive data were expressed as meanstandard deviation ( sd ) for continuous variables , and n ( % ) for categorical variables . demographic characteristics were compared between the patients ( serum ferritin level lower than12 ng / ml ) and controls ( serum ferritin level higher than 12 ng / ml ) . categorical variables were compared using the chi - squared test , while continuous variables were compared using mann - whitney u tests as variables did not show normal distribution . multivariate analysis was performed to find independent predictors for the occurrence of rls by using a binary logistic regression analysis ( enter method ) . a p - value less than 0.05 ; 95 % confidence intervals was considered statistically significant . ninety - eight patients with anemia ( 88 female and 10 male patients ) as the patient group , and 102 patients without anemia ( 51 female and 51 male ) as the control group were included in the study . there was a statistically significant difference between patients and controls with regard to age ( the patient group was older ) , gender , ferritin levels , and presence of rls p = 0.000 . the frequency of rls was found higher in patient group than control group ( p = 0.001 ) . we also compared the frequency of wed / rls between children with serum ferritin levels below and over 50 ng / ml . there were 26 children whose ferritin levels were over 50 ng / ml . the wed / rls was not found in 92.3 % ( n = 24 ) of these children , while 7.7 % ( n = 2 ) of them had the diagnosis . there were 174 ( 89.4 % ) patients who had serum ferritin levels below 50 ng / ml ( table 2 ) . the frequency of wed / rls was significantly higher among the group with serum ferritin levels under 50 ng / ml ( p 0.01 ) . also , there was a significant difference regarding serum ferritin levels between the wed / rls positive and negative group ( p 0.001 ) . the multivariate logistic regression model showed that rls was not associated with age or gender . this model indicated that decreasing ferritin levels ( odds ratio 0.95 ; p = 0.000 ; 95 % confidence interval : 0.93 - 0.97 ) were independent risk factors for rls ( table 3 ) . presence of rls in turkish pediatric patients with ferritin levels above and below 50 ng / dl . multivariate logistic regression analysis of potential risk factors for presence of rls among turkish pediatric patients . this study aimed to show the frequency of wed / rls among children who had iron deficiency with , or without anemia . there are 2 important findings : 1 ) frequency of wed / rls among children with iron deficiency anemia may be much higher than adults ( 61.2 % in children and 40 % in adults ,7,8 and many patients of this group are already taking iron replacement therapy ; 2 ) wed / rls was found in half ( 55.2 % ) of the children with serum ferritin levels below 50 ng / dl . also , the wed / rls frequency dramatically decreased in patients with serum ferritin levels over 50 ng / dl ( only 7.7 % ) . the prevalence of wed / rls among school aged children , and adolescents is 2 - 4 % according to studies in turkey and other countries .3,9,10 turkdogan et al9 found that 15.4 % of these patients had also attention deficit and hyperactivity . however , there is not enough data on the etiology of the wed / rls among this age group . iron deficiency anemia is accepted as the most important cause of wed / rls throughout the world , and several treatment strategies have been suggested . iron plays an important role in oxygen transport , energy metabolism , and brain development and children are more prone to the effects of iron deficiency because of their fast growth and development . even in the presence of solely iron deficiency without anemia , the long - term negative effects may be seen in mental , psychomotor , and behavioral development .14,15 the who reported that rls / wed was seen in 37.3 % of children without iron deficiency anemia ( serum ferritin level of higher than 12 ng / dl ) . our study result is actually very different from other prevalence studies .3,7,8 but when we divided the patient group into 2 groups according to serum ferritin levels below or over 50 ng / dl , the results decreased to 7.7 % . our study result is also different from 2 previously reported turkish studies .9,10 we suggest that this difference may be because of several reasons . one of the previously reported studies was among adolescents , and the other among patients aged between 10 - 19 years .10 our study covered a wider range of ages compared with the other studies , and younger age groups are more sensitive to serum ferritin levels . the previous studies were community based , whereas our study was performed among children referred to hospital , which is the most probable explanation of our higher results . however , we suggest that iron deficiency either directly or with wed / rls affect routine life and sleep , which causes impairment of growth and development of school aged children and adolescents . although it is not fully understood , the dopaminergic system and iron metabolism have been suggested to be the basic mechanisms .14 the presence of low ferritin and high transferrin values in the csf of wed / rls patients support the suggestion that symptoms arise from dopaminergic dysfunction due to low iron levels in the brain .14 it has been reported that the wed / rls symptoms worsen when serum ferritin levels drop under 50 ng / dl .16,17 iron replacement therapy is suggested for children with serum ferritin levels less than 50 ng / dl .18 a significant correlation was previously reported between serum and csf ferritin levels .19 as our study group consisted of many younger aged patients , we could not conduct a severity evaluation . hence , we were unable to evaluate the relationship between the level of serum ferritin levels and severity of wed / rls symptoms . however , we found that almost half of our study group with ferritin levels less than 50 ng / dl had wed / rls , and so suggest to maintain serum ferritin levels of children at over 50 ng / dl or even higher . our study also indicated a negative correlation between serum ferritin levels and the presence of wed / rls . as ferritin levels increased , the frequency of wed / rls decreased in our study group . iron is the co - factor of thyrosine - hydroxylase , which is essential for synthesis of dopamine , and its deficiency disturbs normal dopamine synthesis . both levels of iron and dopamine show a circadian rhythm , and lowest levels are seen during night time when wed / rls symptoms are reported to be increased .20 - 22 an increase in wed / rls symptoms causes an increase in sleep latency , sleep disturbances , and shortening of total sleep time in children . other limitations were that we could not provide age - and gender - matching between patients and controls , and we did not perform polysomnography examination in the patients . in conclusion , we demonstrated that the incidence of rls / wed is high in children aged between 8 - 18 years with iron deficiency and / or iron deficiency anemia . the frequency of rls / wed is higher if ferritin levels below 50 ng / ml . iron replacement therapy is very important in these children in order to avoid growth and developmental retardation . in order to determine the lower cut - off level of ferritin levels among children ,\noutput:\n" }, { "from": "agent", "value": "objective : to examine the incidence of restless legs syndrome ( rls ) among children with iron deficiency , or iron deficiency anemia , or both , and the relationship between rls prevalence and serum ferritin levels.methods : this prospective , cross - sectional , case controlled study was carried out between january and june 2013 , and included 98 iron deficiency and / or iron deficiency anemia , and 102 healthy children referred to the neurology and pediatric departments of the medical faculty of bezmialem vakif university , istanbul , turkey . both groups were evaluated according to the international restless legs syndrome study group diagnostic criteria.results : the range of ferritin levels was 0.01 - 12 mg / ml in patients while it was 12.3 - 91.8 mg / ml in the control group . restless legs syndrome was detected in 61.2 % of children with iron deficiency anemia , and in 37.3 % of children with normal biochemistry values . a statistically significant correlation was found between serum ferritin levels and frequency of rls . in patients with serum ferritin levels higher than 50 ng / ml , 92.3 % had no rls , while 55.2 % of patients with serum ferritin levels lower than 50ng / ml had rls . the patients with serum ferritin levels of > 50ng / ml had a significantly higher incidence of rls . serum ferritin levels were significantly different between the 2 groups.conclusion : the incidence of rls , also known as willis - ekbom disease , is high in children aged between 8 - 18 years with iron deficiency , or iron deficiency anemia , or both . this finding supports the importance of iron replacement therapy especially during the growth and development of children ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: gross haematuria can be a very distressing and frightening symptom and usually leads patients to seek immediate medical care . the cause of haematuria should be thoroughly evaluated and in adults should be regarded as a sign of malignancy until proven otherwise . ultrasound ( us ) is one of the initial examinations performed and is very useful in detecting kidney and bladder lesions . the sensitivity of us in detecting bladder tumours ( bt ) is variably reported to range from 26 % to over 80 % . however , this rate is much lower in patients with tumours smaller than 5 mm or for tumours located on the bladder dome or anterior wall . similarly , specificity is decreased in the presence of coexisting focal cystitis , bladder trabeculations , and haematuria with clots . for this reason , a significant number of bladder us are normal or inconclusive , and cystoscopy is necessary to discard the presence of a bladder tumour . three - dimension us imaging has recently become a widely available feature in many ultrasound machines . this technology permits the acquisition and storage of a dataset , selected from a specific region of interest . this dataset can be further analysed , either by multiplanar display , surface rendering , or volume calculation . as there is a considerable contrast gradient between the bladder lumen and its wall , the surface rendering algorithm can usually display with sufficient detail the surface of the bladder , revealing a cystoscopic - like image , enhancing the characterization of bladder wall abnormalities . in this study , we examined the value of 3d us in diagnosing bladder tumours in patients with haematuria of unknown cause . patients admitted in the emergency department presenting with painless gross haematuria and without history of trauma or evidence of urinary tract infection were prospectively enrolled . all patients underwent conventional 2d bladder and kidney us in the emergency department performed by a radiologist . when needed , bladder clot evacuation was performed previous to the us . examining physicians were asked to report the bladder us as with bt or no bt . in some patients , the radiologist observed bladder lesions that were more difficult to characterize , because of unclear limits or image artefacts . patients diagnosed with kidney disease , bladder tumours , or calculi causing the haematuria were excluded . uncertain bladder us findings were scheduled for a 3d us examination , usually the next day , followed by flexible or rigid cystoscopy . a philips hdi 4000 ultrasound system ( philips medical systems , best ; netherlands ) with a 3.55 mhz transabdominal probe was used . patients were asked to drink about 1 l of water and not to void 1 h before the study in order to perform it with near maximum bladder capacity ( volume 250 cc ) , a 2d us was carried out in the sagital and transverse plane , and afterwards several 3d acquisitions ( 2 to 5 datasets , mean 2,5 ) were made and evaluated using the surface rendering algorithm . comparative analysis was carried out between the imaging findings collected by 2d and 3d us to those of the cystoscopy . twenty one patients ( 19 men and 2 women , mean age 69.0 years old ) were enrolled in the study . twelve ( 57 % ) where reported as no bt and 9 ( 43 % ) as uncertain on the conventional 2d us performed in the emergency department . the 3d examination found no bt in 15 patients ( 71.4 % ) . in 5 of these patients , uncertain , largely because they had bladder trabeculation that made the 2d us difficult to interpret . none of these patients had bladder tumour on cystoscopy ( figure 1 ) . in 5 ( 23.8 % ) patients , 3d us identified bladder tumours that were not detected in the previous us examination . this was statistically different from the results of 2d us ( p = 0,025 ) . all these patients were found to have bladder tumours on cystoscopy , although in one patient cystoscopy revealed another 5 mm lesion that was not detected on us . in one patientall 6 patients with bladder tumours on cystoscopy underwent a transurethral resection ; 4 had transitional cell carcinomas ( tccs ) , 1 had a papilloma , and the remaining patient was revealed to have only inflammation . lesion diameter ranged from 5 to 20 mm ( mean 7 mm ) . in the population with negative 2d us , the 3d us showed a sensitivity of 83,3 % and a specificity of 100 % in identifying patients with bt , with a positive predictive value and negative predictive values of 100 % and 93,8 % , respectively . when evaluating patients with painless haematuria , it is mandatory to exclude the existence of tumours of the urinary tract . us imaging is one of the frontline examinations since it is widely available and noninvasive . when a us clearly shows a bladder tumour , a transurethral resection is usually subsequently performed ; however , when the us examination is normal or ambiguous , a diagnostic cystoscopy becomes mandatory . flexible cystoscopy , though less traumatic , is still an invasive procedure associated with patient discomfort and can by itself be the cause of urinary tract infections and haematuria . in order to overcome these problems , other imaging techniques such as contrast enhanced us , and virtual cystoscopy performed with computed tomography or magnetic resonance imaging , have been developed with promising results . these techniques seem to be more sensitive than us but significantly more time consuming , expensive , and frequently inaccessible for clinicians . moreover , all these imaging techniques are unable to detect subtle alterations of bladder mucosa such as carcinoma in situ . for such lesions , cystoscopy and , more recently , fluorescence cystoscopy and narrow - band imaging cystoscopy are still the most accurate examinations . three - dimensional ultrasound is now an established imaging tool in several specialities , this technology is available in most medium and upscale equipments and is routinely used in obstetric us . in urology , it has been used in planning and guiding prostate cancer treatments , to accurately measure bladder volume and in imaging the urethral sphincter in pelvic floor disorders . recently , the use of 3d us in the evaluation of bladder tumours has been reported showing a moderate - to - perfect interobserver agreement . wagner et al . studied 3d us as a staging tool in distinguishing invasive from noninvasive bladder tumours , showing an overall accuracy of 79 % . this technology has also been studied as a screening tool ; mitterberger et al . studied 42 patients with painless haematuria , all of whom had an abnormal 2d us . they found that 3d us diagnosis was correct in 86 % of patients whereas 2d us diagnosis was correct only in half of them . another group compared the accuracy of 2d and 3d us in 14 patients with proven bt and found 3d us to have better sensitivity . in our study , we evaluated only patients with an undetermined cause of haematuria after 2d us , and we similarly found greater sensitivity of 3d us in detecting bladder tumours ( table 1 ) . however , this sensitivity was not related to lesion size since 57 % of lesions were 10 mm or more . this might be explained by the fact that the 3d reconstruction facilitates the distinction of tumour lesions from bladder folds , becoming particularly useful in patients with bladder trabeculations and diverticula . although cystoscopy is still mandatory in those patients with an unidentified cause of haematuria , we think that 3d us can avoid cystoscopies by clearly identifying and accurately characterizing bladder lesions . in this series ,5 patients ( 23.8 % ) could have skipped cystoscopy and be directly referred for a transurethral resection , saving patient discomfort , time , and money . although not prospectively assessed in this study , the specificity of 3d us seems to be superior to 2d us . in our series , in 5 patients which had uncertain findings on 2d us , the subsequent 3d reconstruction has shown better characterization of their lesions and clearly identified bladder trabeculae and prostatic median lobe that could mimic a bt on 2d us . further investigation is necessary to determine the actual improvement in specificity of 3d us in these patients . we are aware that in this study 2d and 3d us were performed under different conditions : the first was done in the emergency department by a radiologist , and the second in a different day by a urologist . the degree of haematuria may also have been different between the two examinations , however , clot removal was performed before the us whenever necessary , so the degree of haematuria should not have a major impact on the exam performance . we usually carry out 2 to 3 volume acquisitions with a mechanical motor - driven transducer and evaluate the images using a surface - rendering algorithm . bladder tumours appear as round or oval protrusions into the bladder lumen and most software allows navigation through the surface of the bladder , and looking at the lesions from different angles . overall , this procedure may add as little as 5 to 10 minutes to the examination time but substantially improves the overall accuracy of the exam , therefore , we think that this technology when available should be used in the diagnostic workup of patients with haematuria of unknown cause . three - dimensional bladder us has superior sensitivity than 2d us in diagnosing bladder tumours in patients with haematuria . although cystoscopy is still the gold standard examination , 3d us is a promising tool in diagnosing bladder tumours and might reduce the number of cystoscopies needed to study these patients .\noutput:\n" }, { "from": "agent", "value": "purpose . bladder cancer is a frequent cause of haematuria in elderly patients , and bladder ultrasound ( us ) is a valuable tool in diagnosing these malignancies . we examined the accuracy of 3d bladder us in diagnosing bladder tumors in patients with haematuria . patients and methods . twenty - one patients observed in the emergency department for haematuria underwent a kidney and bladder us . patients with normal or uncertain bladder us findings underwent a 3d us and a cystoscopy . results . in 5 ( 23.8 % ) patients , the 3d us detected bladder tumours not seen in 2d us . all these patients were found to have bladder tumours on cystoscopy . another 5 ( 23.8 % ) patients with uncertain findings on 2d us had normal 3d us and cystoscopy . 3d us showed a sensitivity of 83.3 % and a specificity of 100 % with a positive predicted value and negative predictive values of 100 % and 93.8 % , respectively . conclusion . 3d us was more sensitive than 2d us in diagnosing bladder tumours in patients with haematuria ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: changes in reimbursement policies that require patients to contribute a large amount towards the cost of their medication can have a negative impact on disease control . the use of separate inhaled corticosteroid ( ics ) and long - acting 2 - agonist ( laba ) inhalers results in reduced asthma control , compared with the use of a fixed ics / laba combination . in addition , non - consensual inhaler switches have been linked to reduced disease control in patients with previously controlled asthma . following changes in respiratory medication reimbursement policy in iceland , fewer fixed ics / laba combinations were used by patients with previously controlled / partly controlled asthma and / or chronic obstructive pulmonary disease . fewer ics monocomponents were dispensed , and patients used more oral corticosteroids and short - acting 2 - agonists . fixed inhaled corticosteroid / long - acting 2 - agonist ( ics / laba ) combination therapy is well documented in both asthma 1 and chronic obstructive pulmonary disease ( copd ) 2 management guidelines to achieve and maintain control of symptoms , and reduce the risk of exacerbations . randomised controlled trials in patients with controlled asthma show that discontinuing a fixed ics / laba combination in favour of ics monotherapy results in a greater loss of asthma control compared with reducing the dose of the existing fixed ics / laba combination 3 . use of ics and laba monocomponents is associated with a higher risk of exacerbations and higher reliever use than fixed ics / laba combinations via a single inhaler 4 . non - consensual inhaler switches in patients with controlled asthma have been linked with reduced disease control 57 . finally , using laba monotherapy without a concurrent icsleads to poorer outcomes in asthma and is associated with increased mortality ; therefore , the use of separate inhalers should be avoided to prevent use of laba monotherapy 8,9 . among patients with copd , several studies have shown that the use of a fixed ics / laba combination is more effective at controlling copd than ics or laba monotherapy 1014 . however , to our knowledge , the effects of non - consensual therapy switching on copd control have not been studied . in september 2008 , the icelandic national economy faced an unprecedented level of financial crisis , with the possibility of national bankruptcy 15 . one step taken by the icelandic government to ensure economic survival was to place restrictions on various aspects of healthcare , including the use of specific medications , procedures and specialist care across a number of therapeutic areas a cost - containment step that has been used in other european countries as a means of reducing expenditure 16 . particularly , on 1 january 2010 , the icelandic ministry of health introduced a new regulation regarding the reimbursement of fixed ics / laba combinations related to any diagnosis . this change in the regulation immediately moved the cost of continued therapy with fixed ics / laba combinations to the patient ( unless a special reimbursement of the medication cost was applied for and approved ) or forced physicians and patients to find alternative regimens and / or treatment strategies , such as receiving the two medications via separate inhalers . changes in reimbursement policies that require patients to contribute a large amount towards the cost of their medication may result in a negative impact on overall adherence 17,18 , as has been shown for asthma medications 19,20 . in addition , the use of separate ics and laba inhalers results in reduced asthma control , compared with the use of a fixed ics / laba combination 4 . the same is true when asthma patients change from a fixed ics / laba combination to ics monotherapy 3,21 . ascertaining whether the revised reimbursement policy in iceland led to changes in medication use , loss of disease control or an increased risk of exacerbations in patients with asthma and copd is of clinical interest . the current observational study investigated the impact of the policy change on medication and healthcare utilisation in patients diagnosed with asthma and / or copd that was previously controlled / partly controlled . patients with uncontrolled disease were excluded from this analysis as changes in medication use among these patients were more likely to be because of medical reasons than the reimbursement policy . this was a population - based , retrospective , observational , registry study ( nct01369810 ) . the study was approved by the icelandic bioethics committee ( reference vsnb2010110021 ) , the icelandic data protection committee ( reference 2011030368 ) , the bioethics committee of the landspitali university hospital ( reference 16 h / ei ) and the icelandic directorate of health ( reference 2010110080 ) . data derived from medical records included : date of birth ; gender ; diagnoses [ international classification of diseases , 10th edition , clinical modification ( icd -10-cm ) codes ] ; and number of healthcare contacts . the pharmaceutical database provided data on : date of birth ; gender ; dispensed drugs ; drug name ; drug strength ; number of doses ; number of defined daily doses ( the assumed average maintenance dose per day for a drug used for its main indication in adults ) ; and date of collection . the linking of data from patient medical records and the icelandic pharmaceutical database was performed by the icelandic directorate of health . the linked database is held by the faculty of pharmaceutical sciences , university of iceland , reykjavik , iceland . the index date was 1 january 2010 ( the date of the reimbursement changes ) ; data for this study were collected from 1 january 2009 to 31 december 2010 . data were collected for all patients in the icelandic pharmaceutical database ( n = 46,269 ) who had been dispensed at least one fixed ics / laba combination at any time during 2009 . patients were classified as having controlled / partly controlled disease if they had been dispensed 1 oral corticosteroid ( ocs ) course and 2 short - acting 2 - agonists ( sabas ) during 2009 . patients exceeding these limits were considered to be uncontrolled and were excluded from the analysis ; patients who did not have a diagnosis of either asthma and / or copd were also excluded . the impact of the reimbursement policy change on controlled / partly controlled patients was assessed using the following outcomes : number of fixed ics / laba combinations , ics , labas , ocs and sabas dispensed pre - and post - index ; and number of healthcare visits for any reason ( visits to general practitioners , pulmonary specialists and allergists / asthma specialists ; data for private care visits were not available ) in the 1 - year period before and after the index date . visits or admissions to hospitals were not possible to extract in this study . to assess the impact of the volcanic ash cloud that affected iceland in april 2010 on medication use and healthcare visits , we performed a sensitivity analysis in which these outcomes were also assessed for a 3 - month period ( august october ) during 2009 and 2010 . the medication possession ratio [ mpr ; i.e. ( number of dispensed defined daily doses / 365 ) 100 ] was used to determine the use of fixed ics / laba combinations in the pre - index period ( i.e. in 2009 ) . the mpr was used to categorise patients as follows : continuous users ( 80 % ) ; intermediate users ( 4080 % ) ; occasional users ( 40 % ) . patients were also stratified according to age : adolescents / children ( aged 18 years ) , adults ( aged 1865 years ) or elderly patients ( aged 65 years ) . the main statistical analyses for this study were descriptive , for which data are presented using standard summary statistics such as mean ( with standard deviation ) and frequency ( % ) . the risk of stopping fixed - combination ics / laba treatment and of having uncontrolled disease during the post - index period ( 2010 ) was analysed using a logistic regression analysis ; the independent factors in the model were diagnosis ( asthma and / or copd ) , age and gender . the results are presented as odds ratios with corresponding 95 % confidence limits and p - values . the statistical analyses were performed using r version 2.14.1 ( r foundation for statistical computing , vienna , austria ) . this was a population - based , retrospective , observational , registry study ( nct01369810 ) . the study was approved by the icelandic bioethics committee ( reference vsnb2010110021 ) , the icelandic data protection committee ( reference 2011030368 ) , the bioethics committee of the landspitali university hospital ( reference 16 h / ei ) and the icelandic directorate of health ( reference 2010110080 ) . data derived from medical records included : date of birth ; gender ; diagnoses [ international classification of diseases , 10th edition , clinical modification ( icd -10-cm ) codes ] ; and number of healthcare contacts . the pharmaceutical database provided data on : date of birth ; gender ; dispensed drugs ; drug name ; drug strength ; number of doses ; number of defined daily doses ( the assumed average maintenance dose per day for a drug used for its main indication in adults ) ; and date of collection . the linking of data from patient medical records and the icelandic pharmaceutical database was performed by the icelandic directorate of health . the linked database is held by the faculty of pharmaceutical sciences , university of iceland , reykjavik , iceland . the index date was 1 january 2010 ( the date of the reimbursement changes ) ; data for this study were collected from 1 january 2009 to 31 december 2010 . data were collected for all patients in the icelandic pharmaceutical database ( n = 46,269 ) who had been dispensed at least one fixed ics / laba combination at any time during 2009 . patients were classified as having controlled / partly controlled disease if they had been dispensed 1 oral corticosteroid ( ocs ) course and 2 short - acting 2 - agonists ( sabas ) during 2009 . patients exceeding these limits were considered to be uncontrolled and were excluded from the analysis ; patients who did not have a diagnosis of either asthma and / or copd were also excluded . the impact of the reimbursement policy change on controlled / partly controlled patients was assessed using the following outcomes : number of fixed ics / laba combinations , ics , labas , ocs and sabas dispensed pre - and post - index ; and number of healthcare visits for any reason ( visits to general practitioners , pulmonary specialists and allergists / asthma specialists ; data for private care visits were not available ) in the 1 - year period before and after the index date . visits or admissions to hospitals were not possible to extract in this study . to assess the impact of the volcanic ash cloud that affected iceland in april 2010 on medication use and healthcare visits , we performed a sensitivity analysis in which these outcomes were also assessed for a 3 - month period ( august october ) during 2009 and 2010 . the medication possession ratio [ mpr ; i.e. ( number of dispensed defined daily doses / 365 ) 100 ] was used to determine the use of fixed ics / laba combinations in the pre - index period ( i.e. in 2009 ) . the mpr was used to categorise patients as follows : continuous users ( 80 % ) ; intermediate users ( 4080 % ) ; occasional users ( 40 % ) . patients were also stratified according to age : adolescents / children ( aged 18 years ) , adults ( aged 1865 years ) or elderly patients ( aged 65 years ) . the main statistical analyses for this study were descriptive , for which data are presented using standard summary statistics such as mean ( with standard deviation ) and frequency ( % ) . the risk of stopping fixed - combination ics / laba treatment and of having uncontrolled disease during the post - index period ( 2010 ) was analysed using a logistic regression analysis ; the independent factors in the model were diagnosis ( asthma and / or copd ) , age and gender . the results are presented as odds ratios with corresponding 95 % confidence limits and p - values . the statistical analyses were performed using r version 2.14.1 ( r foundation for statistical computing , vienna , austria ) . from the database of 46,269 individuals , 13,814 patients received a fixed ics / laba combination during 2009 . of these , 1895 ( 13.7 % ) were uncontrolled based on our predefined criteria ( dispensed 1 ocs course and 2 sabas during 2009 ) and were , therefore , excluded . in addition , another 3678 patients were excluded because they had not been diagnosed with either asthma or copd . the remaining 8241 patients were considered to be controlled / partly controlled ( mean age , 47.0 years ; 58.4 % females ) and were included in the analysis ( figure1 ) . the majority of the controlled / partly controlled patients had a diagnosis of asthma ( n = 6142 ; 74.5 % ) , 1340 ( 16.3 % ) patients had copd , while 759 ( 9.2 % ) had a diagnosis of both asthma and copd ( table1 ) . patient baseline and demographical characteristics and medication use ( by disease type ) in the pre - index period ( i.e. during 2009 ) each dispensation was assumed to account for a 3 - month supply of reliever or maintenance medication . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; lama , long - acting muscarinic antagonist ; ltra , leukotriene - receptor antagonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist ; sd , standard deviation . as per definition , visits to general practitioners , pulmonary specialists and allergists / asthma specialists ( excludes hospital visits / admissions ) . patient flow . copd , chronic obstructive pulmonary disease ; ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist prior to the index date , the majority of patients were considered to be occasional users of fixed ics / laba combinations ( 62.0 % ; n = 5111 ) , while 25.9 % ( n = 2134 ) were intermediate users and 12.1 % similarly , continuous users had more healthcare visits and asthma - and copd - related healthcare visits , compared with occasional or intermediate users ( table2 ) . in addition , occasional users were more likely to be ocs free during the pre - index period than continuous or intermediate users of fixed ics / laba combinations . patient baseline and demographical characteristics and medication use for occasional , intermediate and continuous users of fixed ics / laba combinations in the pre - index period ( i.e. during 2009 ) values presented as mean ( sd ) , unless otherwise stated . each dispensation was assumed to account for a 3 - month supply of reliever or maintenance medication . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist ; sd , standard deviation . visits to general practitioners , pulmonary specialists and allergists / asthma specialists ( excludes hospital visits / admissions ) . the total use of respiratory medications 6 months after the index date was 51.4 % ( figure2 ) . a total of 48.6 % of the patients who were controlled / partly controlled prior to index were not dispensed any respiratory medications during the post - index period : 54.0 % of patients with asthma , 27.0 % of those with diagnoses of both asthma and copd , and 35.7 % of those with copd . drugs collected during the first 6 months following the index date ( 1 january 2010 ) . drugs for obstructive airway diseases . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; saba , short - acting 2 - agonist overall , there were 47.8 % fewer fixed ics / laba combinations dispensed after the index date ( mean change from 197.5 to 103.1 fixed ics / labas dispensed per 100 patient - years ) ; this included 34.4 % fewer ics / laba combinations dispensed in continuous users ( from 450.9 to 296.0 per 100 patient - years ) , 39.8 % fewer in intermediate users ( from 254.2 to 153.0 per 100 patient - years ) and 64.1 % fewer in occasional users ( from 124.4 to 44.7 per 100 patient - years ; figure3a ) . there were 68.0 % fewer dispensed ics monocomponents ( from 127.9 to 40.9 per 100 patient - years ) , although more laba monocomponents were dispensed ( 611.8 % ; from 1.7 to 12.1 per 100 patient - years ) . comparison between medications dispensed [ fixed ics / laba combinations ( a ) , ocs ( b ) and sabas ( c ) ] and healthcare visits ( for any reason ) ( d ) per 100 patient - years in the pre - ( 2009 ) and post - index ( 2010 ) period in continuous , intermediate and occasional users and in all patients combined . ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist occasional and intermediate users of fixed ics / laba combinations and adolescents / children were significantly more likely to discontinue ics / laba combination therapy during the post - index period ( all p 0.001 vs. continuous users and adult patients , respectively ; table3 ) . elderly patients and those with a copd or asthma / copd diagnosis were significantly more likely to continue fixed ics / laba treatment post - index than adult patients and those with an asthma diagnosis only , respectively ( all p 0.001 ) . the same factors were predictive of having uncontrolled disease during the post - index period ( all p 0.001 ; table4 ) . patient characteristics associated with a change in the risk of not receiving previously prescribed fixed ics / laba combination therapy ( yes / no ) post - index ( during 2010 ) as a dependent variable cl , confidence limit ; copd , chronic obstructive pulmonary disease ; ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; or , odds ratio . vs. an asthma only diagnosis . vs. adult patients ( aged 1865 years ) . s. continuous users . or values 1.00 and 1.00 indicate an increased or decreased risk , respectively , of discontinuing fixed ics / laba therapy . patient characteristics associated with a change in the risk of having uncontrolled disease during the post - index period ( 2010 ) cl , confidence limit ; copd , chronic obstructive pulmonary disease ; or , odds ratio . vs. an asthma only diagnosis . vs. adult patients ( aged 1865 years ) . vs. continuous users . orvalues 1.00 and 1.00 indicate an increased or decreased risk , respectively , of having uncontrolled disease . more ocs and sabas were dispensed during the post - index period , compared with pre - index ( figure3b and c ) . in the overall patient population , there were 76.3 % more ocs and 51.2 % more sabas dispensed ( from 16.0 to 28.2 and from 37.5 to 56.7 dispensations per 100 patient - years , respectively ) . the same pattern was seen in the continuous , intermediate and occasional users subgroups for the number of ocs dispensations [ ranging from 64.3 % ( from 12.6 to 20.7 per 100 patient - years ) to 88.8 % more dispensations ( from 25.9 to 48.9 per 100 patient - years ) ] and saba dispensations [ ranging from 38.7 % ( from 35.4 to 49.1 per 100 patient - years ) to 85.7 % more dispensations ( from 42.0 to 78.0 per 100 patient - years ) ] . the change was greatest in the continuous users subgroup for both ocs ( 88.8 % ) and sabas ( 85.7 % ) dispensed . during the post - index period , there were 44.0 % more total healthcare visits ( from 79.8 to 114.9 visits per 100 patient - years ) in the overall patient population ( figure3d ) ; this change was particularly high in the occasional users subgroup ( 71.0 % ; from 54.8 to 93.7 visits per 100 patient - years ) . healthcare utilisation in august october of the pre - and post - index periods was assessed to exclude the potential confounding effect of the volcanic ash cloud that affected iceland during april 2010 . in these analyses , data for the pre - and post - index periods regarding the number of fixed ics / labas , ocs and sabas dispensed were similar to those obtained for the whole study period : overall , there were 49.7 % fewer fixed ics / labas dispensed ( from 51.5 to 25.9 dispensations per 100 patient - years ) ; in the occasional users subgroup , there were 69.0 % fewer fixed ics / laba dispensations ( from 34.8 to 10.8 per 100 patient - years ) . in the total population , there were 75.6 % more ocs dispensed ( from 4.1 to 7.2 dispensations per 100 patient - years ) and 41.4 % more saba dispensations ( from 9.9 to 14.0 per 100 patient - years ) during the post - index , vs. the pre - index , period . by contrast , the volcanic ash cloud may have impacted healthcare visits , as somewhat different findings were observed when data for august october of the pre - and post - index periods were compared . overall , there were 10.9 % fewer healthcare visits ( from 29.3 to 26.1 visits per 100 patient - years ) ; this was primarily driven by the fact that there were 27.7 % fewer healthcare visits in the occasional users subgroup ( from 25.3 to 18.3 visits per 100 patient - years ) . more healthcare visits were seen in continuous and intermediate users ( 16.1 % , from 40.9 to 47.5 visits per 100 patient - years and 3.9 % , from 33.6 to 34.9 visits per 100 patient - years , respectively ) . from the database of 46,269 individuals , 13,814 patients received a fixed ics / laba combination during 2009 . of these , 1895 ( 13.7 % ) were uncontrolled based on our predefined criteria ( dispensed 1 ocs course and 2 sabas during 2009 ) and were , therefore , excluded . in addition , another 3678 patients were excluded because they had not been diagnosed with either asthma or copd . the remaining 8241 patients were considered to be controlled / partly controlled ( mean age , 47.0 years ; 58.4 % females ) and were included in the analysis ( figure1 ) . the majority of the controlled / partly controlled patients had a diagnosis of asthma ( n = 6142 ; 74.5 % ) , 1340 ( 16.3 % ) patients had copd , while 759 ( 9.2 % ) had a diagnosis of both asthma and copd ( table1 ) . patient baseline and demographical characteristics and medication use ( by disease type ) in the pre - index period ( i.e. during 2009 ) each dispensation was assumed to account for a 3 - month supply of reliever or maintenance medication . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; lama , long - acting muscarinic antagonist ; ltra , leukotriene - receptor antagonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist ; sd , standard deviation . as per definition , visits to general practitioners , pulmonary specialists and allergists / asthma specialists ( excludes hospital visits / admissions ) . patient flow . copd , chronic obstructive pulmonary disease ; ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist prior to the index date , the majority of patients were considered to be occasional users of fixed ics / laba combinations ( 62.0 % ; n = 5111 ) , while 25.9 % ( n = 2134 ) were intermediate users and 12.1 % similarly , continuous users had more healthcare visits and asthma - and copd - related healthcare visits , compared with occasional or intermediate users ( table2 ) . in addition , occasional users were more likely to be ocs free during the pre - index period than continuous or intermediate users of fixed ics / laba combinations . patient baseline and demographical characteristics and medication use for occasional , intermediate and continuous users of fixed ics / laba combinations in the pre - index period ( i.e. during 2009 ) values presented as mean ( sd ) , unless otherwise stated . each dispensation was assumed to account for a 3 - month supply of reliever or maintenance medication . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist ; sd , standard deviation . visits to general practitioners , pulmonary specialists and allergists / asthma specialists ( excludes hospital visits / admissions ) . the total use of respiratory medications 6 months after the index date was 51.4 % ( figure2 ) . a total of 48.6 % of the patients who were controlled / partly controlled prior to index were not dispensed any respiratory medications during the post - index period : 54.0 % of patients with asthma , 27.0 % of those with diagnoses of both asthma and copd , and 35.7 % of those with copd . drugs collected during the first 6 months following the index date ( 1 january 2010 ) . drugs for obstructive airway diseases . copd , chronic obstructive pulmonary disease ; ics , inhaled corticosteroid ; laba , long - acting 2 - agonist ; saba , short - acting 2 - agonist overall , there were 47.8 % fewer fixed ics / laba combinations dispensed after the index date ( mean change from 197.5 to 103.1 fixed ics / labas dispensed per 100 patient - years ) ; this included 34.4 % fewer ics / laba combinations dispensed in continuous users ( from 450.9 to 296.0 per 100 patient - years ) , 39.8 % fewer in intermediate users ( from 254.2 to 153.0 per 100 patient - years ) and 64.1 % fewer in occasional users ( from 124.4 to 44.7 per 100 patient - years ; figure3a ) . there were 68.0 % fewer dispensed ics monocomponents ( from 127.9 to 40.9 per 100 patient - years ) , although more laba monocomponents were dispensed ( 611.8 % ; from 1.7 to 12.1 per 100 patient - years ) . comparison between medications dispensed [ fixed ics / laba combinations ( a ) , ocs ( b ) and sabas ( c ) ] and healthcare visits ( for any reason ) ( d ) per 100 patient - years in the pre - ( 2009 ) and post - index ( 2010 ) period in continuous , intermediate and occasional users and in all patients combined . ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; ocs , oral corticosteroid ; saba , short - acting 2 - agonist occasional and intermediate users of fixed ics / laba combinations and adolescents / children were significantly more likely to discontinue ics / laba combination therapy during the post - index period ( all p 0.001 vs. continuous users and adult patients , respectively ; table3 ) . elderly patients and those with a copd or asthma / copd diagnosis were significantly more likely to continue fixed ics / laba treatment post - index than adult patients and those with an asthma diagnosis only , respectively ( all p 0.001 ) . the same factors were predictive of having uncontrolled disease during the post - index period ( all p 0.001 ; table4 ) . patient characteristics associated with a change in the risk of not receiving previously prescribed fixed ics / laba combination therapy ( yes / no ) post - index ( during 2010 ) as a dependent variable cl , confidence limit ; copd , chronic obstructive pulmonary disease ; ics / laba , inhaled corticosteroid / long - acting 2 - agonist ; or , odds ratio . vs. an asthma only diagnosis . vs. adult patients ( aged 1865 years ) . s. continuous users . or values 1.00 and 1.00 indicate an increased or decreased risk , respectively , of discontinuing fixed ics / laba therapy . patient characteristics associated with a change in the risk of having uncontrolled disease during the post - index period ( 2010 ) cl , confidence limit ; copd , chronic obstructive pulmonary disease ; or , odds ratio . vs. an asthma only diagnosis . vs. adult patients ( aged 1865 years ) . vs. continuous users . or values 1.00 and 1.00 indicate an increased or decreased risk , respectively , of having uncontrolled disease . more ocs and sabas were dispensed during the post - index period , compared with pre - index ( figure3b and c ) . in the overall patient population , there were 76.3 % more ocs and 51.2 % more sabas dispensed ( from 16.0 to 28.2 and from 37.5 to 56.7 dispensations per 100 patient - years , respectively ) . the same pattern was seen in the continuous , intermediate and occasional users subgroups for the number of ocs dispensations [ ranging from 64.3 % ( from 12.6 to 20.7 per 100 patient - years ) to 88.8 % more dispensations ( from 25.9 to 48.9 per 100 patient - years ) ] and saba dispensations [ ranging from 38.7 % ( from 35.4 to 49.1 per 100 patient - years ) to 85.7 % more dispensations ( from 42.0 to 78.0 per 100 patient - years ) ] . the change was greatest in the continuous users subgroup for both ocs ( 88.8 % ) and sabas ( 85.7 % ) dispensed . during the post - index period , there were 44.0 % more total healthcare visits ( from 79.8 to 114.9 visits per 100 patient - years ) in the overall patient population ( figure3d ) ; this change was particularly high in the occasional users subgroup ( 71.0 % ; from 54.8 to 93.7 visits per 100 patient - years ) . healthcare utilisation in august october of the pre - and post - index periods was assessed to exclude the potential confounding effect of the volcanic ash cloud that affected iceland during april 2010 . in these analyses , data for the pre - and post - index periods regarding the number of fixed ics / labas , ocs and sabas dispensed were similar to those obtained for the whole study period : overall , there were 49.7 % fewer fixed ics / labas dispensed ( from 51.5 to 25.9 dispensations per 100 patient - years ) ; in the occasional users subgroup , there were 69.0 % fewer fixed ics / laba dispensations ( from 34.8 to 10.8 per 100 patient - years ) . in the total population , there were 75.6 % more ocs dispensed ( from 4.1 to 7.2 dispensations per 100 patient - years ) and 41.4 % more saba dispensations ( from 9.9 to 14.0 per 100 patient - years ) during the post - index , vs. the pre - index , period . by contrast , the volcanic ash cloud may have impacted healthcare visits , as somewhat different findings were observed when data for august october of the pre - and post - index periods were compared . overall , there were 10.9 % fewer healthcare visits ( from 29.3 to 26.1 visits per 100 patient - years ) ; this was primarily driven by the fact that there were 27.7 % fewer healthcare visits in the occasional users subgroup ( from 25.3 to 18.3 visits per 100 patient - years ) . more healthcare visits were seen in continuous and intermediate users ( 16.1 % , from 40.9 to 47.5 visits per 100 patient - years and 3.9 % , from 33.6 to 34.9 visits per 100 patient - years , respectively ) . this population - based , retrospective , observational study shows that the icelandic government 's policy change regarding respiratory medications , whereby reimbursement of fixed ics / laba combinations was limited , resulted in fewer dispensations of fixed ics / laba combinations . while somewhat more laba monotherapies were also dispensed , this change was not large enough to compensate for the lower ics / laba use , and fewer ics monotherapies were dispensed . notably , a marked proportion of patients with asthma and / or copd were no longer receiving any respiratory medications at all . deterioration in disease control was observed following the policy change , as demonstrated by more ocs and saba dispensations and more healthcare visits . occasional users , the patient subgroup who had the fewest fixed ics / laba combinations dispensed before the index date , were the least likely to receive these medications after the reimbursement change , which may , in part , have been because of an unwillingness to pay for their own medication . these patients were , on average , younger than intermediate or continuous users , and were most likely to be ocs free during the pre - index period . the patients most likely to receive ics / laba treatment post - index were the continuous users , suggesting that physicians and healthcare providers exercised good judgement by concentrating the use of this class of drug in patients likely to have the greatest need for the fixed combination . nonetheless , although continuous users had a smaller relative reduction in fixed ics / laba combination use , compared with occasional and intermediate users , they had a greater increase in ocs and saba use , showing the greatest loss of disease control . this increase was apparent despite higher baseline ocs and , to a certain extent , saba use in the continuous than occasional users of ics / laba and , therefore , suggests that these changes are not explained by potential regression to the mean , but perhaps that continuous - use patients had the highest level of underlying disease activity . in addition , the occasional users had the greatest relative increase in healthcare visits , an effect that may stem from a lack of preparation regarding the switch of medication . however , these visits could be because of a number of reasons , and may not have been in response to respiratory symptoms . it is particularly worrisome that 2754 % of patients diagnosed with asthma , copd or both were no longer receiving any respiratory medications at all during the post - index period , as this will inevitably lead to loss of disease control , especially in patients with copd . this suggests that there are inconsistencies between recommended disease management and actual clinical practice , an observation that has been noted elsewhere 22,23 . our results are similar to those observed following changes to the reimbursement schedule for cardiovascular medications implemented by the icelandic ministry of health in 2009 . specifically , changes in the reimbursement policy for statins were associated with increases in cholesterol levels in patients with hyperlipidaemia and heart disease 24 . other studies in the setting of asthma and copd have drawn similar conclusions to ours 19,20 . a study in children with asthma in the usa found that an increase in out - of - pocket medication costs led to a reduction in adjusted medication use and increased asthma - related hospitalisations in children 19 . in canada , a significant reduction in the use of inhaled medications was seen following the implementation of cost - sharing policies , mostly because of a reduction in treatment initiation and greater treatment discontinuation 20 . the results of this study raise the question of whether any reimbursement reductions made by the government with the intent to save cost are partially or completely offset by increases in other healthcare resource use . there was more ocs and saba use , as well as more healthcare visits , after the reimbursement change . a complete assessment of the health - economic and financial consequences of this change in reimbursement policy was beyond the scope of this study . a strength of this study is that it was performed in a large group of patients without any restrictions in factors such as age , employment status , concomitant medications and comorbidities or healthcare insurance . observational studies using clinical databases enable outcomes to be assessed in a real - life , non - interventional , naturalistic setting 25 . as a result , the management , prescribing patterns and adherence to guidelines in clinical practice may be effectively studied and characterised . however , such a construct is not without its weaknesses ; as with all database studies , data retrieval is limited to the variables included in the databases , and potential unknown confounding factors may still reside in the data . in addition , the fact that patients with uncontrolled asthma or copd were excluded from this analysis could have led to an overestimation of the effect of the reimbursement change . however , it was necessary to exclude these patients as they were more likely to switch medications because of medical reasons than patients with controlled / partly controlled disease . a significant environmental change that coincided with the study period was the volcanic eruption in iceland and subsequent ash cloud that may have confounded the results . it is not known whether the ash particles in the atmosphere had an effect on respiratory conditions or influenced the availability of , or access to , healthcare resources ( e.g. because of disruptions in travel ) . we controlled for this potential confounding factor by assessing data from a 3 - month period during 2009 and a 3 - month period in 2010 during which the ash cloud had dissipated ( august october ) ; the results of this sensitivity analysis indicated that the volcanic ash cloud did not markedly influence the full 12 - month outcomes . in this study , the validity of the asthma and copd diagnoses could not be verified , and the study was limited by the inability to perform further evaluations involving more detailed clinical characteristics of the patients ( e.g. hospital data and categorisation by disease severity or lung function measurements ) . such further evaluation would have permitted more detailed examination of the relationship between poor compliance and disease outcomes ; however , it was beyond the scope of the current analysis to subdivide the continuous users group into balanced subgroups by severity to quantify if the degree of change in continuous use correlated with the degree of deterioration in disease activity . in addition , it was not known if some patients had non - eosinophilic asthma . asthe role of ics therapies in these patients is controversial , the presence of patients with non - eosinophilic asthma could have had an impact on the results of this analysis 26,27 . in conclusion , among patients with previously controlled / partly controlled asthma and / or copd in iceland , the use of fixed ics / laba combinations was lower following a reimbursement policy change , but the use of ics and laba monotherapy was not comparably higher . there were , however , more ocs and sabas dispensed and more healthcare visits , suggesting decreased disease control . the results of this study indicate that changes to healthcare policy and medication reimbursement should be made cautiously , since they can lead to unintended clinical consequences .\noutput:\n" }, { "from": "agent", "value": "backgroundin 2010 , the icelandic government introduced a new cost - saving policy that limited reimbursement of fixed inhaled corticosteroid / long - acting 2 - agonist ( ics / laba ) combinations.methodsthis population - based , retrospective , observational study assessed the effects of this policy change by linking specialist / primary care medical records with data from the icelandic pharmaceutical database . the policy change took effect on 1 january 2010 ( index date ) ; data for the year preceding and following this date were analysed in 8241 patients with controlled / partly controlled asthma and / or chronic obstructive pulmonary disease ( copd ) who had been dispensed an ics / laba during 2009 . oral corticosteroid ( ocs ) and short - acting 2 - agonist ( saba ) use , and healthcare visits , were assessed pre - and post-index . resultsthe ics / laba reimbursement policy change led to 47.8 % fewer fixed ics / laba combinations being dispensed during the post - index period among patients whose asthma and / or copd was controlled / partly controlled during the pre - index period . fewer ics monocomponents were also dispensed . a total of 48.6 % of patients were no longer receiving any respiratory medications after the policy change . this was associated with reduced disease control , as demonstrated by more healthcare visits ( 44.0 % ) , and more ocs ( 76.3 % ) and saba ( 51.2 % ) dispensations.conclusionsoverall , these findings demonstrate that changes in healthcare policy and medication reimbursement can directly impact medication use and , consequently , clinical outcomes and should , therefore , be made cautiously ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: urinary incontinence is not a life - threatening disorder ; however , it can significantly affect a woman 's health . today , elderly women are a rapidly growing segment of the population in the industrialized world , and the prevalence of urinary incontinence increases as patients age . aging women today are healthier than the previous generation owing to an improved general health care system , and they also seek surgical treatment for incontinence . in the most recent publication , lee et al . reported a 6 - year follow - up cure rate after the tension - free vaginal tape ( tvt ) procedure of 83.0 % with a satisfaction rate of 80.1 % . however , the effect of age on the outcomes of the tvt procedure is relatively undefined . various studies have reported cure rates between 67 % and 85.3 % with 24 months of follow - up [ 2 - 4 ] . the aim of this study was to examine whether the tvt procedure is a successful and safe procedure for the long - term treatment of stress urinary incontinence ( sui ) in elderly women aged 65 years or over and to identify the factors influencing failure in these cases . the study sample included 241 consecutive women who underwent a tvt procedure performed by a single urologist surgeon between august 2005 and july 2008 . at the time of follow - up , 136 patients had been contacted through routine postoperative visits or by telephone for an extensive interview . patients were divided into two groups : the middle - aged group ( 65 years ) and the elderly group ( 65 years old or older ) . demographics , urodynamic study , and surgical variables were reviewed in a retrospective manner and were compared between the two groups . patients were asked about sui symptoms by use of sandvik 's incontinence severity index and their satisfaction with the tvt procedure by a single urology investigator at the final contacts . women responded with a satisfaction score based on a 5 - point likert - type scale as 1 ( completely dissatisfied ) , 2 ( mostly dissatisfied ) , 3 ( neutral ) , 4 ( mostly satisfied ) , or 5 ( completely satisfied ) . cure rate , improvement rate , failure rate , satisfaction score , and incontinence severity after tvt failure on the basis of the questionnaires were compared between the middle - aged and the elderly group . \" cure \" was defined as patients answering as having no urine leakage at all in any circumstances , and \" improvement \" was defined as patients answering as having some urine leakage but over 4 points out of 5 in the satisfaction inquiry . \" failure \" was defined as patients answering as having some urine leakage and at most 3 points out of 5 in the satisfaction inquiry . demographics , urodynamic studies , and surgical variables were compared between the two subgroups to identify the factors influencing tvt procedure failure . reported p - values were two - sided and a p - value of 0.05 was considered statistically significant for all comparisons . the patients were divided into two groups according to age : the middle - aged group ( n = 106 ) and the elderly group ( n = 30 ) . all tvt procedures were performed as previously described by ulmsten et al . , except that surgeries were carried out with the patient under general or spinal anesthesia . the patients ' mean age was 53.55.9 years ( range , 35 to 64 years ) for the middle - aged group and 72.05.0 years ( range , 65 to 82 years ) for the elderly group . the mean follow - up time was 50.59.4 months ( range , 36 to 70 months ) and 48.89.1 months ( range , 36 to 69 months ) , respectively . twenty - nine women ( 27.4 % ) in the middle - aged group and 18 women ( 60 % ) in the elderly group had concomitant medical diseases , such as diabetes , hypertension , and cerebrovascular disease ; this was significantly different between the two groups ( p = 0.002 ) . five women ( 4.72 % ) in the middle - aged group and seven ( 23.3 % ) in the elderly group underwent concomitant cystocele repair ; this was also significantly different between the two groups ( p = 0.001 ) . parity , body mass index ( bmi ) , and previous operation history showed no statistically significant differences between the two groups ( p 0.05 ) . concerning urodynamic parameters , the maximum urethral closure pressure ( mucp ) in the middle - aged group was 78.144.7 ; that in the elderly group was 50.726.3 cmh2o ( p = 0.002 ) . other parameters , such as detrusor overactivity , maximum flow rate , post - voided residual urine ( pvr ) , valsalva leak point pressure ( vlpp ) , and the urethral hypermobility rate , were not significantly different between the two groups ( table 1 ) . concerning long - term clinical outcomes based on the patients ' subjective symptoms , the cure rate , improvement rate , and failure rate were 80.2 % vs. 66.7 % , 4.7 % vs. 3.3 % , and 15.1 % vs. 30 % , respectively . satisfaction scores in the middle - aged and elderly groups were 3.81.1 and 3.31.5 points , respectively . these parameters showed no statistically significant differences ( p 0.05 ) ( table 2 ) . in the middle - aged group , de novo urgency was 31.3 % , and 60.3 % of the patients were cured of their overactive bladder symptoms after the tvt procedure . in the elderly group , de novo urgency was 28.5 % , and 42.9 % of the patients were cured of their overactive bladder symptoms after the tvt procedure . for surgical outcomes , in the elderly group , one patient had vaginal erosion , one had urinary tract infection , and one had urinary retention . in the middle - aged group , there were no postoperative complications during the follow - up . in the elderly group , according to the multivariate analysis , age , concomitant medical disease , concomitant overactive bladder symptoms , mucp , vlpp , and urethral hypermobility were not significantly different between the cure and no cure subgroups ( p 0.05 ) . the bmi of the cure and no cure subgroups was 24.63.3 kg / m and 26.61.0 kg / m , which was significantly different ( p = 0.028 ) ( table 3 ) . urinary incontinence is not a life - threatening disorder ; however , it can significantly affect a woman 's psychological , emotional , sexual , and social functioning . the prevalence of urinary incontinence has been reported to be between 10 % and 40 % in women older than 70 years and it increases as women age . the increased prevalence of incontinence in late life reflects the compounding effects of functional deterioration and coincidental disability . from a urological point of view , intrinsic sphincter deficiency increases in prevalence with advancing age as the result of a combination of factors , such as decreased estrogenization , age - related atrophy of the urethral tissue , and increased likelihood of a previous incontinence procedure . furthermore , older women may have had a lesser degree of urethral mobility or greater degrees of urethral rigidity , thus reducing tape effectiveness as well as detrusor instability and symptoms of urgency . as patients age , morbidity and mortality from surgery increase . regarding the surgical risks , some studies have suggested that preexisting comorbidities , and not age , are the predominant determinants of perioperative morbidity and mortality following urogynecologic surgeries . by contrast , some other studies have shown that elderly women over the age of 60 years have an increased risk of mortality and morbidity compared with women younger than 60 following urogynecologic procedures regardless of comorbidities . furthermore , as patients age , new illnesses and new pharmacological treatments can negatively influence the outcome of the tvt operation . a possible negative impact of later pelvic surgery would also be considered as a negative factor . regarding these possibilities , the literature indicates that elderly women are excluded from most clinical trials for incontinence surgeries . this might be because of the perception that such interventions are less effective and have more complications in the elderly population , and in the end , surgical procedures in elderly groups are performed less frequently . today , elderly women are healthier than ever before and recent literature suggests that currently performed procedures for sui in elderly women are relatively safe and effective , although the exact surgical results and complications vary in different study populations . sevestre et al . reported that in the elderly group who were aged over 70 years old , the cure rate was 67 % after 24 months of follow - up . reported that in the elderly group who were aged over 70 years , the subjective cure rate was 85.3 % and there were no significant differences in efficacy outcomes between the elderly and younger patients after 1 year of follow - up . in our study , we evaluated the clinical outcomes following the tvt procedure in patients 65 years old or older with a mean follow - up duration of 48 months . the success rates for tvt in the elderly and middle - aged groups in our study showed results similar to those of recent studies [ 14 - 16 ] . the success rate of the elderly group was slightly lower than that of the middle - aged group in our study , and the complication rates were slightly higher in the elderly groups than in the middle - aged group without statistical significance . significant comorbidities and concomitant surgeries occurred more often in the elderly group and may have been a cause of these results . various studies have reported that the factors predicting failure of the tvt procedure in the elderly are high bmi , low vlpp , rigid urethra , and a high grade of incontinence . we evaluated the outcome of the tvt procedure and examined the factors influencing the outcome in elderly patients . in the multivariate analysis , our results showed that bmi was the only significant factor associated with the failure of the tvt procedure in elderly patients . obese women have chronically increased stress of the pelvic floor , which is generally regarded as being causally related to the increased prevalence of urinary incontinence . in addition , obesity is related to detrusor instability and many medical and neurogenic diseases . this might be the major cause of failure of the tvt procedure in elderly women . the limitations of our study include not having geriatric - specific measures of functional status such as activities of daily living in order to characterize the potential change in functional status with surgery . other major limitations of the study include the relatively small number of elderly patients and the lack of objective outcome measures . a small cohort number can bias the study results , and a larger cohort number is needed to clarify our results . our outcomes based on subjective symptoms from questionnaires at the interview used less stringent criteria when compared with other studies that used pad tests and filling cystometry . in addition , the prevalence of overactive bladder symptoms and symptom severity may increase as patients age . however , in this study , we did not use any specific questionnaire to distinguish the severity of overactive bladder in our study groups . despite these limitationsfurthermore , our results encouraged us to perform the tvt procedure even in elderly women . as the number of older women seeking care for this debilitating condition continues to increase , we will continue to adequately counsel them with respect to the risks and benefits of surgery . our findings with long term follow - up suggest that women who are older than 65 years are candidates for surgical benefits after a tvt procedure . however , clinicians should consider the possibility of a failed tvt procedure in elderly women who are obese .\noutput:\n" }, { "from": "agent", "value": "purposethe aim of this study was to assess the long - term clinical outcomes of the tension - free vaginal tape ( tvt ) procedure for stress urinary incontinence ( sui ) in elderly women and to identify the factors influencing failure in these cases.materials and methodswomen with sui who underwent a tvt procedure were studied . \" cure \" was defined as no urine leakage at all in any circumstances and \" improvement \" was defined as some urine leakage but a score of over 4 points out of 5 in a satisfaction inquiry . patients were divided into two groups ( middle - aged , < 65 years and elderly , 65 years ) for comparison of clinical outcomes . in the elderly group , patients were subdivided into two groups ( cure and no cure groups ) and were compared to identify the factors influencing failure.resultsa total of 136 women ( middle - aged group , 106 ; elderly group , 30 ) were enrolled in the study . the mean ages of the patients in the 2 groups were 53.55.9 and 72.05.0 years and the mean follow - up times were 50.59.4 and 48.89.1 months , respectively . the cure and improvement rates in the middle - aged and elderly groups were 80.2 % vs. 66.7 % and 4.7 % vs. 3.3 % , respectively ( p > 0.05 ) . the satisfaction scores in the middle - aged and elderly groups were 3.81.1 vs. 3.31.5 points ( p > 0.05 ) . in the elderly group , the body mass index of the cure and no cure groups were 24.63.3 kg / m2 and 26.61.0 kg / m2 , and body mass index was the only factor that differed significantly between the two subgroups ( p = 0.028 ) . conclusionsour long - term results suggest that tvt is an effective treatment even in elderly women . however , elderly women who are obese should be counseled carefully about the success rate ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the hyperimmunoglobulin - m syndrome ( higm ) is a group of genetic disorders in which the b - cells can not switch to other kind of antibodies , resulting in the overproduction of igm and underproduction of iga , igg , and ige . a majority of the higm cases are x - linked type - 1 . during the signaling between t - and b - cells , activated cd4 t - cells express the cd40 ligand ( cd154 ) , which binds to cd40 on the resting b - cells , and accounts for the immune and inflammatory responses regulating b - cell proliferation , immunoglobulin class switching , germinal center formation , growth suppression , inflammation , and cell death . cd40 is a cysteine - rich type - i transmembrane cell surface protein belonging to the tumor necrosis factor ( tnf ) receptor family , which is expressed by a variety of cells including b - cells , macrophages , dendritic cells , and other nonimmune cell types . in higm type - 3 , mutations of the cd40 gene cause lack of surface expression of cd40 and loss of interaction between cd40 and cd40l , resulting in a lack of immunoglobulin isotype switching , impaired generation of memory b - cells , defective somatic hypermutation , monocyte activation , and t lymphocyte priming . there are cases in literature where b - cells do express cd40 , but are dysfunctional . only 16 cases with cd40 mutation , a rare autosomal recessive disorder , have been reported thus far . the clinical manifestations include recurrent sinopulmonary infections , pneumocystis carinii pneumonia , and cryptosporidium parvum infection , with very low levels of igg , iga , and normal / high levels of igm . flow cytometry analysis shows peripheral blood b - lymphocytes that lack expression of surface cd40 . here we present possibly the first case of cd40 deficiency from india , evaluated clinically , immunophenotypically , and molecularly . a two - and - a - half - year - old first female child , born of a non - consanguineous marriage , was referred with a history of repeated episodes of infections since birth . recurrent diarrhea and skin boils ( culture showed growth of staphylococcus aureus ) were the predominant clinical manifestations , with increased leukocyte count and eosinophilia . after informed consent 2 ml of blood was collected in ethylenediaminetetraacetic acid ( edta ) . laboratory evaluation revealed a white blood cell ( wbc ) count of 11400 / mm with absolute lymphocyte count of 9690 / mm and absolute neutrophil count of 1026 / mm . the lymphocyte subset analysis , using a six color tbnk bd antibody ( bd biosciences , san diego , ca , usa ) showed normal counts of nk - cells and elevated counts of t - cells ( cd4 , cd8 ) and b - cells [ table 1 ] . serum immunoglobulin showed low levels of igg , iga , and ige , and an elevated level of igm [ table 2 ] . analysis of different lymphocyte subsets with normal count levels of serum immunoglobulin with normal control cd154 analysis was normal . after dna extraction , polymerase chain reaction ( pcr ) amplification and the direct dna sequencing technique were used for detection of mutations in the cd40 gene , using the big dye terminator v3 .1 cycle sequencing kit ( applied biosystems , usa ) , on an automated dna sequencer , applied biosystems 3130xl genetic analyzer . this showed a novel deletion of 3bp ( aag ) [ g.4407_4409delaag p.glu107glyfsx84 ] in a homozygous state in exon 4 , leading to a frame - shift mutation and generation of a stop codon at p. 192 in exon 7 [ figure 2 ] . panel a and c : b - cell gating on side scatter and cd19 in normal and patient , respectively . panel d : b - cells with absence of cd40 expression in patient sequence of novel mutation in the cd40 gene along with a wild - type normal sequencehere we discuss the clinical presentation , immunophenotypic analysis , and characterization of a novel mutation leading to cd40 deficiency . the largest reported study of higm type - 3 was in 11 patients from saudi arabia collected retrospectively over a eight year period . it was also reported to be the most common clinical presentation in two cohorts of higm from europe and usa . the opportunistic infection in these patients could be due to improper maturation of dendritic cells leading to a defect in t - cell priming and interferon - secretion , besides cd40 deficiency . most reports suggest low levels of iga , igg , and ige and normal or high levels of igm , which was in agreement with our patient . reported reduced nk - cells in few of the patients on more than one occasion , whereas , our patient showed normal nk - cells . the molecular analysis reported by al - saud et al. showed missense and splice site mutations in exon 3 in all 11 patients , whereas , we got a novel mutation in exon 4 of the cd40 gene , with a 3bp deletion , leading to the absence of cd40 expression . demonstrated three cd40 mutations and showed that mutated proteins that could not fold were either retained in the endoplasmic reticulum causing stress and cell apoptosis or were degraded by the endoplasmic reticulum degradation pathway . a total of 3/11 patients reported by al saud et al . died due to severe sepsis suggesting the condition was fatal even after regular supplements of intravenous immunoglobulin and granulocyte colony - stimulating factor ( g - csf ) , whereas , the others were doing fairly well . similarly , our patient showed reduction in the infection rate after regular intravenous immunoglobulin supplements and prophylactic antibiotics . although stem cell transplant is the only cure for the disease , early screening in all newborns within the affected kindred can be considered along with prenatal diagnosis in this disease subject to cost effectiveness .\noutput:\n" }, { "from": "agent", "value": "hyperimmunoglobulin m ( higm ) type 3 due to cd40 deficiency is a very rare syndrome . only 16 cases have been reported thus far . the clinical presentation is very variable . we present the first case of this rare disorder from india . the case is of a two - and - a - half - year - old female , with a history of repeated episodes of skin infections and diarrhea since birth . laboratory evaluation revealed elevated absolute lymphocyte count and an absolute neutrophil count ( anc ) of 1026 / mm3 . the lymphocyte subset analysis showed normal absolute counts of natural killer ( nk ) cells and elevated absolute counts of t - cells ( cd4 and cd8 ) and b - cells . the serum immunoglobulin estimation showed low levels of igg , iga , ige and an elevated level of igm . the cd154 analysis was normal and expression of cd40 was absent on the b - cells . molecular analysis showed a novel mutation , with deletion of 3bp ( aag ) [ p.glu107glyfsx84 ] in the homozygous state , in the cd40 gene . thus the patient was diagnosed as higm type 3 . the parents were screened and counseled regarding prenatal diagnosis at the time of next pregnancy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acute myeloid leukemia ( aml ) is the most common form of acute leukemia and accounts for 15 % of childhood leukemias . modern induction chemotherapy results in complete remission in 50 to 90 % of patients with de novo disease , but between 10 and 25 % of patients have primary refractory disease and the majority of those who gain remission relapses within 3 years of diagnosis . the development of drug resistance is the limiting factor in the therapy of aml . treatment of relapsed leukemia is difficult and well - controlled trials in this group of patients are uncommon . there is scanty information available on long - term disease - free survival in aml patients with second relapse . we reported a case of high - risk aml patient who relapsed a second time after undergoing conventional therapy . later , he received oral ayurvedic treatment ( ayt ) along with supportive care and recovered . a 16 - old - boy was admitted in the dharamshila cancer hospital and research centre , new delhi , on february 05 , 1997 with complaints of bone pains for the last 2 months and fever for last one month . his bone marrow aspiration study done earlier from indraprastha apollo hospital on february 07 , 1997 suggested acute lymphoblastic leukemia ( all ) l2 . the patient was given two cycles of induction chemotherapy ( 3 + 7 protocol ) with daunomycin and cytosine arabinoside cytosar , following which the patient achieved incomplete remission with bone marrow aspirate showing 14 % blast . subsequently , patient received two cycles of high - dose cytosine arabinoside ara - c . the bone marrow study done on may 21 , 1997 after the completion of first cycle showed less than 1 % blast cells . the patient completed the second cycle of chemotherapy on june 01 , 1997 . during chemotherapy , the patient had 3 to 4 episodes of infection for which antibiotic coverage was given along with supportive care . however , bone marrow studies done on august 29 , 1997 indicated relapse of the disease . the option of further chemotherapy and / or bone marrow transplant was discussed with the patient . however , the caregivers of the patient did not consent for any of the two options . the patient was given oral ayt comprising of navjeevan , valapani , kamdhuda , prak - 20 , etc . the patients was given supportive therapy for fever and infection time to time after getting culture and drug sensitivity test under the guidance of a competent md , modern medicines . the patient tolerated the therapy well and cytopathology studies done about 6 months after the start of ayt on march 09 , 1998 showed about 1 % blast cells in bone marrow , whereas no blast cell was found in peripheral blood . apart from clinical condition , his body weight and cbc were checked on monthly basis using the same pathology run by a md , pathology at dehradun or dr lal path lab in delhi . thereafter , the patient received intermittent maintenance ayt , same as mentioned before , in the same doses for three months in the next two years . details of the ayurvedic medicines in october 2007 , the patient developed a testicular lesion suspected to be tuberculosis . however , cytology studies of the lesion , pcr analysis , and semen culture were all negative . the ayt was restarted for six months from november 2007 . at present , the patient is normal and healthy and has completed 12 years of disease - free survival with ayt . there is no concrete reference with me , except the teaching of my late father who experienced his first success in early 1960s and made his own interpretations . despite improvement in the remission rate and overall survival during the last 20 years or more , disease recurrence remains the most common cause of treatment failure . in contrast to all , the progress in the therapy of childhood aml lags behind , with cure rates of approximately 40 to 60 % . the present case indicates that the oral herbomineral ayurvedic medicines can be effective in treatment of aml without producing any toxic side effects . as the patient has not taken any other therapy after his disease relapsed , we believe that the ayurvedic therapy was responsible for the remission of his disease .\noutput:\n" }, { "from": "agent", "value": "a 16 - year - old boy was detected with acute myeloid leukemia ( aml m0 ) with bone marrow pathology showing 85 % blasts in february 07 , 1997 . he received two cycles of induction chemotherapy ( 3 + 7 protocol ) with daunomycin and cytosar , following which he achieved incomplete remission with bone marrow aspirate showing 14 % blasts . subsequently , the patient received two cycles of high - dose cytosine arabinoside ara - c and achieved remission . however , his disease relapsed on august 29 , 1997 . peripheral blood smear showed 6 % blast cells and bone marrow showed 40 % blast cells . the patient refused further chemotherapy and / or bone marrow transplant and volunteered for ayurvedic therapy ( ayt ) advocated by the author from september 09 , 1997 . bone marrow studies done after six months of ayt indicated that the disease was in remission . the ayt was continued for five years and stopped . thereafter , the patient received intermittent maintenance ayt for three months in the next two years . at present , the patient is normal and healthy and has completed 12 years of disease - free survival with ayt ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the intergovernmental panel on climate change ( ipcc ) reports unequivocal evidence for the warming of climate systems with a global mean temperature rising 0.74 c between 1906 and 2005 , and the 11 years 19952006 have been reported as being among the 12 warmest years since 1850 . the warming from climate change increases the risk of heat waves by compounding the existing problem of urban heat islands a result of urban areas being hotter than surrounding rural areas due to more impervious and heat absorbing surfaces that retain and subsequently reradiate incident solar radiation , less vegetation , and more local heat production . as such , climate change affecting these areas will have far - reaching consequences , as the proportion of the global population living in urban areas increases . for example , the urban proportion of the global population increased from 30 % in the 1950s to over 50 % in the early 2000s and , by the year 2030 , 60 % of the world 's population is expected to live in cities , according to the united nations ( 2001 ) world population prospects revision report . one city of importance is ahmedabad , india , with a population of 7.2 million . ahmedabad is the largest city in gujarat and among the fastest growing cities in india . located in the arid northwest region of india , ahmedabad 's hot season typically runs from march to june , with an average monthly maximum of 38.8 c ( 101.8 f ) during this period . according to the india national assessment , the region of western ghats where the city of ahmedabad is located is projected to have mean annual temperatures of 26.80.4 c27 .50.4 c in the 2030s , an increase of 1.7 - 1.8 c with respect to the 1970s . in may 2010 , ahmedabad experienced a record - setting heat wave which anecdotally resulted in increased all - cause mortality as temperatures locally reached as high as 46.8 c . the health department of the ahmedabad municipal corporation ( amc ) reported that the total death toll from this heat wave was 47 , with 29 deaths from heatstroke alone . however , this was based on a preliminary analysis without a formal excess mortality assessment . the informal death toll reported in ahmedabad is unfortunately realistic or even an underestimate of the actual health impact from the heat wave according to studies of heat - health impacts elsewhere . for example , in some northern us cities , the effects of heat have increased summer mortality by nearly 40 % over baseline averages . also in the united states , heat waves cause more deaths annually than any other natural disaster . centers for disease control and prevention lists the three most common types of heat - related illnesses ( hri ) as heat cramps , heat exhaustion , and heatstroke . these types of illness can occur when individuals are exposed to extreme heat and may lead to death if not properly diagnosed and treated . the study of heat - related illness is a growing area and , thus far , has been primarily studied in occupational settings . for example , studies have found that workers exposed to extreme heat may be at risk of several types of heat - related illnesses . however , the effects of extreme heat are not limited to occupational settings nor only heat - related illness . in a review looking more broadly at elevated ambient temperatures , defined in this review and for the purposes of this study as outdoor temperatures as measured by standard meteorological services and mortality studies from 2001 to 2008 , there was an association with higher ambient temperatures and increased risk of death from respiratory , cerebrovascular , and cardiovascular diseases , including ischemic heart disease , congestive heart failure , and myocardial infarction across all ages , race , and gender . higher ambient temperatures are also associated with other types of illness besides heat - related illness . in a california study , high ambient temperature was significantly associated with preterm birth , regardless of maternal racial / ethnic group , maternal age , maternal education , or sex of the infant . importantly , certain groups such as younger mothers , blacks , and asians had an even higher association of negative outcomes and temperature indicating the potentially important role of socioeconomic factors . one review of epidemiological literature identified 20 studies that investigated seasonality of birth outcomes and reported statistically significant seasonal patterns . most of the studies found peaks of preterm birth , stillbirth , and low birth weight in winter , summer , or both , which indicates the extremes of temperature may be an important determinant of poor birth outcomes . increasing ambient temperature has also been associated with infectious diseases such as diarrhea - associated morbidity in a 10 - year taiwanese study and , indirectly , through changes in air quality , with respiratory illness . ambient temperatures are shown to be a universal hazard and concern , as they present various and vital implications to public health . this epidemiologic literature indicates that infants are a population particularly vulnerable to the rising global temperatures . while keeping an infant warm enough to prevent hypothermiahomeothermy requires a balance among heat production , skin blood flow , sweating , and respiration in such a way that changes in heat loss or gain from the environment are precisely compensated . greater susceptibility of body temperature to ambient temperatures is to be expected in smaller organisms because of their large surface area to volume ratio , the relatively small insulating body shell , despite a higher percentage of brown adipose tissue in newborns , and the smaller body mass that acts as a heat buffer in large organisms . additionally , any pathological conditions such as malnutrition , as is widespread in india , or pulmonary disease can further exacerbate a baseline physiologic susceptibility . a review of data suggests that despite attempts to eliminate heat through adjustments in the peripheral circulation ( narrowing central peripheral gradients ) infants are not as able as older children and nonelderly adults to maintain set - point temperatures . in addition , the difficulty neonates have in thermoregulation makes them a potentially vulnerable population during times of extreme heat . in previous reports on heat waves and high ambient temperature , very few studies have considered or found effects in infants and young children . this is perhaps due to most studies being conducted using data from developed countries with likely higher rates of climate - controlled , indoor settings . a retrospective study of mortality related to a 2003 heat wave in france found moderate but significant excess mortality also occurred among male infants aged less than 1 year . another study done in california found increased mortality risk in infants 1 year of age or less . during a scientific workshop in gujarat , india during the spring of 2011 focusing on heat and health , preliminary data highlighted the potential burden of disease on infants in non - climate - controlled buildings there , such as most homes and hospitals . non - climate - controlled refers to the absence of a heating or cooling system that regulates temperature and humidity within a building . one energy survey estimated that only 129 hospitals have air - conditioning of the approximately 16,000 total hospitals across the country . a review of the literature including both pubmed and web of science searches revealed little work on the association of elevated ambient temperatures with morbidity or mortality in non - climate - controlled settings ( see supplementary annex 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/946875 ) . while absence of air - conditioning is a known risk factor for heat stroke and death among the elderly in residential settings and nursing homes in new york city , other institutional settings and health effects have not been studied . this study examines neonatal morbidity in a non - climate - controlled hospital setting during the may 2010 heat wave in ahmedabad . two primary questions of interest are ( 1 ) was there a relationship between high ambient temperatures and the rate of neonatal intensive care unit ( nicu ) admissions during the may 2010 heat wave in ahmedabad ? and ( 2 ) did the relocation of the maternity ward from top to ground floor have an effect on subsequent nicu admission rates ? this study is a retrospective review of hospital records for births and nicu admissions with a diagnosis for heat - related illness that occurred between april 1st and june 30th during the years 2009 , 2010 , and 2011 at the scl general hospital , serving a primarily low income population , in ahmedabad , gujarat , india . the data was obtained by manual transcription of the paper charts from the years of study . in 2009 and 2010 , the maternity ward was on the fourth , highest , and reportedly hottest floor of the hospital , including may 2010 when the heat wave struck the city . after the 2010 heat wave but prior to the 2011 warm season of april , may , and june , the maternity ward was relocated to the ground and reportedly coolest level ( figure 1 ) . selection of the nine months enabled comparison with similar season months both before and after the 2010 heat wave event . temporal matching such as the one used here is commonly used in heat wave analyses and helps to minimize confounding by population scale variables . for the nine months in study , the data included the number of daily births at the hospital , total daily nicu admissions , and daily nicu admissions for heat - related illness ( i.e. , heat - related admissions ) . infants 028 days old born outside of hospital and in - hospital transfers from maternity ward . the study outcome of heat - related illness was a diagnosis of exclusion defined as neonates admitted to the nicu with body temperature 38c with any of the following signs or symptoms : refusal to feed , signs of dehydration , weight loss 10 % of birth weight , increased respiratory rate , convulsions , and / or lethargy . exclusion criteria included evidence of septicemia , acute gastroenteritis , or central nervous system infection based on available cultures or labs . weather data was obtained in person by study author ( kk ) directly from the india meteorological department . data included daily maximum and minimum temperatures and two daily relative humidity levels for the time period of april 1june 30 for the years 2009 , 2010 , and 2011 . air pollution data was not available . to evaluate the effects of extreme heat on neonatal outcomes , we looked for an effect of maximum temperature and floor of the nicu on admissions for heat , as well as on total deliveries and non - heat - related nicu admissions . humidity was included in preliminary models but ultimately excluded because no association was seen and from a policy perspective humidity is not included in the weather department 's heat wave definition . first , graphical methods were used to suggest the type of function that would relate ( heat - related ) admissions to temperature . the preliminary visual evaluation suggested that the effect of temperature on admissions began at some point between 40c and 42c . we used generalized linear models to evaluate the number of daily events , which we assumed followed a poisson distribution . the variables used to predict this outcome were ( i ) maximum temperature per day , ( ii ) number of deliveries over the past three days , ( iii ) and whether the icu was located on the top floor ( in 2009 and 2010 ) or on a lower floor . for the effect of heat , we used segmented regression and specifically chose a horizontal line up to a certain temperature t and then for max_t t joined this segment with a line with slope 3 . to further explore breakpoints , temperatures were selected from the 10th percentile of maximum temperature at 38c , to the 90th percentile at 43.5 c for the temperature , t , in which the segmented line was allowed to slope upwards . the temperature of the best fit for the equation below , evaluated based on the log likelihood , was 42c . we used proc genmod of sas software , to estimate the parameters , 1 , 2 , 3 in ( 1 ) log [ heat - related admissions ] = +1 ( births7 .4 ) +2 floor for max_t tc , log [ heat - related admissions ] = +1 ( births7 .4 ) +2 floor + 3 ( max_tt ) for max_ttc , where births is the average number of births over the previous 3 days , floor = 0 for years 2009 and 2010 and floor = 1 for 2011 , and max_t is the maximum temperature in degrees celsius . the same model was used for the secondary analysis of all nicu admissions , and a similar model was used for births except , obviously , the births term was removed . municipal medical college of ahmedabad 's intramural research committee and the program for the protection of human subjects of the icahn school of medicine at mount sinai . in the context of evaluating the effect of heat , we note that over the entire 9 months of study , daily maximum temperatures ranged from 31.0 to 46.8 c . the average maximum temperature for 2009 was 40.8 c , 41.8 c for 2010 , and 40.3 c for 2011 ( figure 2 ) . according to the india meteorological department criteria ( heat wave definition used the climate of ahmedabad booklet ( india meteorological department , january 2012 ) criteria : ( a ) when normal maximum temperature of a station is less than or equal to 40c : ( i ) heat wave : departure from normal is 5 to 6c and ( ii ) severe heat wave : departure from normal is 7c or more . ( b ) when normal maximum temperature of a station is more than 40c : ( i ) heat wave : departure from normal is 4 to 5c and ( ii ) severe heat wave : departure from normal is 6c or more . ( c ) when actual maximum temperature remains 45c or more irrespective of normal maximum temperature , heat wave should be declared ) , the days of april 17 and 18 and may 1315 , 17 , and 2025 in 2010 qualified as a heat wave with daily maximum temperatures varying between 44.5 and 46.8 c . during these 12 days , there were 111 total births at scl gh with an average of 8.5 per day , and a total of six neonates were admitted to the nicu with heat - related illness . over the 273 study days , the temperature mean ( sd ) was 40.8 ( 2.3 ) ; the median temperature was 41.1 c , and the middle 50 % of the days were between 39.5 c and 42.4 c , the 10th percentile was 38c and the 90th 43.5 c . table 1 tabulates , for each of the 9 months of the study , the average maximum temperature , number of births to the study hospital , number of icu admissions , and number of heat - related admissions . a total of 2,025 births occurring at the hospitalmonthly total deliveries at scl general hospital ranged from 203 to 253 with an average of 225 deliveries per month . there were 554 total neonates admitted to the nicu , averaging 2 per day , with 36 of these being classified as admitted for heat - related illness . the number of total admissions to the nicu ranged from 51 to 82 per month , with an average of 61.5 admissions per month . the number of admissions to the nicu with a heat - related illness ranged from 113 per month . during the months of april , may , and june of 2010 , there were 24 nicu admissions for heat , versus 8 and 4 in 2009 and 2011 , respectively . when considering only babies transferred from the hospital 's maternity ward into the nicu for heat - related illness , the number was 20 in the 2010 period versus 5 and 2 in 2009 and 2011 , respectively descriptive statistics of infants admitted to the nicu with a heat - related illness , including gender , gestational ages , mode of delivery , low birth weight prevalence , age in hours at time of admission to nicu , 10 % weight loss , fever , and maternity ward versus out of hospital transfer , can be found in table 2 . in the models , in which the t , the turn for the segmented regression , that is , breakpoint , varied from the 10th percentile of maximum temperature at 38c to the 90th percentile at 43.5 c , the effect of floor and of increases in temperature was statistically significant . as described in section 2.3 , the temperature of the best fit for our segmented regression model was 42c . at this temperature ( 42c ) , moving the maternity ward to a lower floor was associated with a predicted 64 % reduction in heat - related admissions , 95 % confidence intervals 3 % to 89 % . as for temperature association at this same breakpoint of 42c , each increase in degree celsius over 42c was associated with a 43 % increase in heat - related admissions , 95 % confidence intervals 9.2 % to 88 % . when examining non - heat - related nicu admissions instead of heat - related admission and then total number of deliveries , we found a similar direction of association though non - statistically significant results . for example , in the model looking at non - heat - related nicu admissions , controlling for floor and number of admissions , there was a 1 % increase in admissions per degree increase over 40c ( p = .83 ) and a predicted 14 % reduction due to moving the floor to a lower level ( p = .13 ) . for deliveries per day , adjusting for floor , there was an increase of 2 % in the number of deliveries per 1 % increase in degree over 40c ( p = .29 ) . of note , we observe several outliers in which more heat - related admissions still occurred despite lower temperatures . various factors including alterations in individual or community protective factors conditions or behaviors that lower the effect of high temperatures on neonatal health or other meteorologic variables could be responsible , but limited data sets prevented exploration . analysis of the hospital and weather data found a relationship between ambient , or outdoor , temperatures and the number of nicu admissions for heat at a non - climate - controlled hospital in ahmedabad , india . we also found moving the location of a maternity ward within hospital from the fourth and highest floor to the ground and reportedly cooler floor after the may 2010 heat wave showed a protective effect . our data suggest that during the month of the heat wave , while the maternity ward remained on the top floor of the non - air - conditioned hospital , there was an increase in heat - related admissions to the nicu . there are several possible reasons for the observed increase in nicu admissions for heat during the month of the 2010 heat wave . it could be that heat affects the infant in utero and causes him or her to be more vulnerable at birth due to either a younger gestational age ( perhaps even just a few days ) or physiologic stress from heat independent of the timing of the labor and delivery . another possible reason for increased heat - related admissions is detection bias which perhaps shifted diagnosis of other illnesses toward heat . this possibility could not be ruled out completely because of lack of information about other diagnoses for other nicu admissions in our data set . additionally , the findings from this study would have been strengthened if , when looking at the effect of the maternity ward location , we had patient data on a period of outdoor temperatures comparable to that of the may 2010 heat wave but from the ground floor location . a previous study conducted on pregnant women in barcelona found episodes of a relatively high heat index on the day before delivery was associated with a 2 - day reduction in average gestational age at delivery and the most extreme heat condition was associated with a 5 - day reduction , suggesting a dose response relationship . while all babies admitted to the nicu for heatwere listed as full term , the specific gestational age in weeks and days was not available to explore this further . as previously mentioned , little research exists on the effects of high ambient temperatures and the vulnerable population of neonates . one area that has been looked at is the relationship between temperature and sudden infant death syndrome ( sids ) . a possible role for hyperthermia in sids has been hypothesized because some victims are found in unusually warm environments , are warm and sweaty when found dead , are wrapped tightly in clothing or bedding , have a history of febrile illness before death , or have high rectal temperatures at examination or autopsy . in our study , a larger dataset would permit exploration of these outstanding questions , which warrants the need for further study . one of the primary limitations to this study is that the lack of descriptive information on non - heat - related cases limited the ability to examine individual level risk factors . being able to examine other factors would possibly lead to evidence about protective effects and modifiable risk factors . for example , information is needed on neonates born at scl general hospital but not admitted to nicu , on all nicu admissions , and ideally on those brought into hospital following an outside of hospital birth . this information could be used to study other variables that may have contributed to heat vulnerability such as birth weight , socioeconomic status , mode of delivery , and breast or formula feeds . harsh environmental conditions and other negative factors could have a relatively large effect on birth outcome . we do know that some of the infants admitted to the nicu during the study period were born outside of the hospital , but we do not know their specific conditions nor their proportion of the total and thus are limited in the extent that we can explore the characteristics of these infants . our meteorological data were for ambient , that is , outdoor , conditions only and were used as a proxy of indoor conditions . direct indoor measurements would permit more precise characterization of the exposure . we can only estimate and infer based on what we know of indoor conditions in relation to outdoor temperature . the india meteorological department ( imd ) records their temperature data near the airport located on the outskirts of the city . an urban heat island effect of 24c has been reported in ahmedabad , suggesting that residents may experience hotter temperatures than those reported . lastly , in terms of limitations , the highest temperatures occurred when the nicu unit was on the top floor . we can find both temperature and floor significant even with the other in the model . however the co - linearity will increase the variability , and in interpreting the findings we should bear this dependence in mind . considering global health implications , it is important to note the difference in the heat wave criteria of ahmedabad compared to that of a developed city in a temperate zone such as new york , ny . new york city and much of the northern united states issues alerts of excessive heat when the maximum heat index is expected to reach 37.8 c for a 24 hr period . as previously mentioned , in ahmedabad a heat wave , the 2010 heat wave was the first time the imd issued a severe heat wave warning in ahmedabad , cautioning people against sun stroke . repeated heat exposure has been known to decrease the sweating threshold , that is , a sensitization occurs in the course of repeated heat exposure rather than development of tolerance . those exposed to extreme ambient temperatures for extended periods of time will over time begin to sweat less . the sweating threshold shifts as it occurs during heat adaptation , accompanied by similar changes in the threshold temperatures for shivering and vasodilatation . in ahmedabad , the problem of repeated exposure to extreme heat is further compounded by a lack of easily available resources and public health awareness . such climatic differences underscore the importance of local or regional data for best characterization of any given population 's risk . from a public health perspective , further research resources need to be directed to places where heat adaptation resources such as air - conditioners are scarce , yet the need is high . it is important for initiatives to be specific for a target audience and to consider heat wave criteria of location . in addition , public health solutions should look toward engineering and architectural design solutions such as central ventilation shafts used in older ahmedabad buildings but not commonly in newer building and light - colored surfaces on rooftops to help with cooling on the top floors of buildings . there is a growing body of work regarding the energy savings from such relatively simple technologies , but the health effects of such interventions in non - climate - controlled buildings have not been well documented . recommendations for improved future research include a longitudinal study with descriptives collected on all data subjects . improved data would include temperature measurements taken from inside the maternity ward and birth information from those brought into the hospital from outside births . in order to explore in more depth the preceding questions regarding protective factors or modifiable risk factors and the vulnerabilities of the fetus in utero versus the neonate in the prenatal period , additional epidemiologic studies , and ultimately a randomized controlled trial with comparable hospitals and control groups would add to the understanding of the effects of hospital cooling interventions . this preliminary study supports the hypothesis that neonatal morbidity increases in non - climate - controlled settings during periods of extreme high ambient temperatures , applying evidence from study in ahmedabad , india . analysis of the maternity ward 's location revealed both the detrimental effects of high outdoor temperatures and the positive health effects of a simple hospital level intervention . these findings demonstrate the importance of simple surveillance measures in motivating a hospital policy change toward climate change adaptation here relocating one ward and the potential , as yet little studied , increasing health burden of heat in non - climate - controlled institutions serving vulnerable populations . the health effects of climate change are a growing international concern that may have dramatic implications for the health of future generations . newborns and pregnant women comprise some of our most heat - vulnerable populations and thus could be among those most affected by climate change . we emphasize the need for further research on climate change effects on and viable adaptation strategies for such heat - vulnerable populations .\noutput:\n" }, { "from": "agent", "value": "health effects from climate change are an international concern with urban areas at particular risk due to urban heat island effects . the burden of disease on vulnerable populations in non - climate - controlled settings has not been well studied . this study compared neonatal morbidity in a non - air - conditioned hospital during the 2010 heat wave in ahmedabad to morbidity in the prior and subsequent years . the outcome of interest was neonatal intensive care unit ( nicu ) admissions for heat . during the months of april , may , and june of 2010 , 24 nicu admissions were for heat versus 8 and 4 in 2009 and 2011 , respectively . both the effect of moving the maternity ward and the effect of high temperatures were statistically significant , controlling for each other . above 42 degrees celsius , each daily maximum temperature increase of a degree was associated with 43 % increase in heat - related admissions ( 95 % ci 9.288 % ) . lower floor location of the maternity ward within hospital which occurred after the 2010 heat wave showed a protective effect . these findings demonstrate the importance of simple surveillance measures in motivating a hospital policy change for climate change adaptation here relocating one ward and the potential increasing health burden of heat in non - climate - controlled institutions on vulnerable populations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: critical airway is a life - threatening scenario of hypoxemia about to become hypoxia , following failed or inadequate ventilation . in such scenarios , esophageal intubation compounds the criticality of the situation as , besides the loss of oxygenation , the risk of stomach contents being aspirated into the airways is enhanced by ventilating into the stomach . cervical spine injury or non - exclusion is not an issue , as almost always endotracheal intubation ( eti ) can be done with little head manipulation and without neck manipulation ; the problem would lie , in the end , on whether the patient can be ventilated or not . in the last two decades , a new philosophy of airway control has shifted emphasis from mask ventilation to supraglottic ventilation with the introduction of supraglottic ventilatory devices ( sgvds ) . sgvds obviate the need for cervical manipulations and can be used as a bridge during the attempts at eti , even by untrained or inexperienced personnel in outdoor settings . protection from stomach contents being aspirated is not guaranteed , but the risk is reduced with the introduction of extra channels for nasogastric tube ( ngt ) and endotracheal tube ( ett ) . other drawbacks are the effects of decubitus on oral and pharyngeal structures , the decrease of lung compliance with increase of airway resistance and the need to be inserted in an unconscious patient . sgvds are optimally placed for airway control outdoors in suspected or not excluded cervical spine injuries ( csis ) or in the small percentage of cases of severe maxillofacial traumas difficult to intubate , for obviating the need for neck manipulation or for the protective tamponade effect on intra - pharyngeal bleeding , respectively . indications for surgical airway in elective scenario , specifically for tracheostomy , are well established : in intensive care unit ( icu ) . it is required for medium - to long - term ventilation and advised as an early procedure in head injury with coma expected not to recover in the short term ; in patients with any cancer in the neck compressing the trachea , and it is often the only practicable procedure for inoperable cancer or as an airway control procedure before or during surgery ; after thyroid surgery in patients with longstanding goiter and tracheomalacia , as a tracheostomy prevents postoperative airway obstruction ; before surgery in some neck abscesses , as it protects the lower airways from accidental or spontaneous pus release into the lungs during the procedure . in emergency or urgent scenarios , on the other hand , there is no clear or established consensus , for example , as to specifically who should receive a tracheostomy as a life - saving procedure ; and more importantly , when . this is partly due to a biased , specialist , incomplete perspective , partly as a result of generic recommendations that do not keep an account of logistics , timing and the specific situations / scenarios in which to use one . , laryngeal injury and failure to intubate and / or ventilate the patient , are too generic and encompass a broad spectrum of possibilities . in literature , specific indications for emergency tracheostomy are scattered and are biased , partially comprehensive , not clearly described or not homogeneously gathered . as a matter of fact , the two groups of indications are not sensitive , specific or accurate . in principle , they are unquestioned ; in practice , they are of difficult application and not helpful in deciding who exactly should have an emergency tracheostomy as a life - saving bedside procedure ; and most importantly , when . their application , therefore , depends often on the operator 's experience and skills . a universal algorithm on the indications and timing for a surgical airway in emergency , as such , can not be drawn , due to the multiplicity of variables and the inapplicability in the context of life - threatening critical emergency , where human brain elaborates decisions better in cluster rather than in binary fashion . some categories of patients in specific scenarios are to be considered as candidates for an emergency surgical airway ( esa ) [ table 1 ] . scenarios potentially requiring an esa patients with anticipated [ table 2 ] or unanticipated [ table 3 ] difficult airway who can not be intubated and / or ventilated with an sgvd fall in the critical airway category . percutaneous / transtracheal jet ventilation ( ptjv / ttjv ) can not be relied upon for long in patients who are unconscious or have inadequate ventilation , due to unpredictable effect on ventilation and the predisposition to barotrauma with high or prolonged exposures ; so readiness to follow with cricothyroidotomy or tracheostomy is mandatory.high - frequency jet ventilation ( hfjv ) is used for tracheo - bronchial surgery or procedures , but occasionally it can be used as an emergency oxygenation method through the trachea too.trismus . critical airway scenarios are best managed by cricothyroidotomy ( cty ) ; where trismus is expected to last for some time and secretions are a problem , like in tetanus , an urgent tracheostomy is practically always necessary from the start.foreign body in the upper airways . patients with foreign bodies in the upper airways ( from oropharynx to vocal cords ) with impending or actual airway obstruction where heimlich maneuver ( if patient standing and not fainted yet ) or abdominal thrust ( if patient on the floor or fainted ) , and direct laryngoscopy have failed to relieve the obstruction , should also have emergency surgical airway , specifically cty . a coughing patient with foreign body in the airways should be encouraged to continue coughing more strongly . in upper airways obstruction , the acute and dramatic picture of inspiratory stridor , central cyanosis and extra - respiratory muscles recruitment should prompt the mental gear into fulminous action . upper airways obstruction kills by hypoxia and / or reflex hyperacute vagal - mediated cardiac arrest . in less emergent cases , any tumor rapidly expanding within the upper airways following internal hemorrhage and narrowing of the passage , or bleeding into the airways and making difficult the visualization of the vocal cords , can require esa if eti fails and an sgvd can not ventilate the patient or prevent blood from tracking down in the lower airways.neck abscess . some patients with ludwig angina , retropharyngeal abscess and some with para - pharyngeal abscesses deemed to be at risk of spontaneous rupture or actually having narrowing of the upper airways , require esa as standard preoperative management to prevent the catastrophic consequences of rupture of the abscess with release of pus into the lungs . a surgical airway remains a rare indication in not complicated or stable abscesses when techniques such as awake fiberoptic intubation are available.edema of the larynx . patients with acute allergic , inflammatory or infective edema , whose stridor and hypoxemia do not improve satisfactorily with adrenaline , or less emergent cases of patients who do not show improvement with intravenous anti - inflammatory drugs or antibiotics and continue to exhibit stridor , overuse their accessory respiratory muscles , have respiration - related tachycardia , and are not able to maintain acceptable pao2 , paco2 and sao2 levels , should receive a tracheostomy under ga if they can still ventilate satisfactorily or be induced under ptjv followed by tracheostomy if they cannot.face / neck burn . patients with burns involving face and neck in presence of soft tissue swelling or signs of inhalation injury in the nasopharynx ( carbonaceous discoloration of naso - oropharynx , inflammatory edema or mucosal damage ) must be intubated soon . a delayed intubation leads almost invariably in the great majority of cases to the requirement of a surgical airway even if the epiglottis entry is visible to direct laryngoscopy ( dl ) , due to the impossibility to negotiate the entry of an endotracheal tube of suitable size in an edematous hypopharynx . a delay in eti also increases the damage to the vocal cords as the ett has to negotiate an already involved swollen larynx.penetrating face / neck trauma . penetrating injuries to the face and neck , when a tracheal wound is already in communication with a skin wound and it is straightforward , quicker and easier to introduce a tracheostomy cannula , or even an ett , than to attempt endotracheal intubation , which must anyway follow as more secure and convenient route . rarely , however , these wounds are central or near central and the tracks are suitable for direct device insertion . in these casesif ett can not be inserted from above and the track is too distal and straight for a tracheostomy cannula , a smaller size than standard ett through allows for 100 % oxygenation and protected ventilation support until surgical control of the leak is achieved . a loss of airway pressure , besides prevention of blood / debris aspiration , is the reason why airway control is an emergency and should be done as soon as possible.blunt face / neck trauma . in the category of patients with blunt trauma to face andneck , no precise guidelines have been standardized for the requirement of an emergency surgical airway . blunt trauma to the airways is less common but has higher injury severity score ( iss ) and mortality than the penetrating one , with injury to the lower airways having a higher mortality than injury to the upper ones . patients with anticipated [ table 2 ] or unanticipated [ table 3 ] difficult airway who can not be intubated and / or ventilated with an sgvd fall in the critical airway category . percutaneous / transtracheal jet ventilation ( ptjv / ttjv ) can not be relied upon for long in patients who are unconscious or have inadequate ventilation , due to unpredictable effect on ventilation and the predisposition to barotrauma with high or prolonged exposures ; so readiness to follow with cricothyroidotomy or tracheostomy is mandatory . high - frequency jet ventilation ( hfjv ) is used for tracheo - bronchial surgery or procedures , but occasionally it can be used as an emergency oxygenation method through the trachea too . critical airway scenarios are best managed by cricothyroidotomy ( cty ) ; where trismus is expected to last for some time and secretions are a problem , like in tetanus , an urgent tracheostomy is practically always necessary from the start . foreign body in the upper airways . patients with foreign bodies in the upper airways ( from oropharynx to vocal cords ) with impending or actual airway obstruction where heimlich maneuver ( if patient standing and not fainted yet ) or abdominal thrust ( if patient on the floor or fainted ) , and direct laryngoscopy have failed to relieve the obstruction , should also have emergency surgical airway , specifically cty . a coughing patient with foreign body in the airwaysshould be encouraged to continue coughing more strongly . in upper airways obstruction , the acute and dramatic picture of inspiratory stridor , central cyanosis and extra - respiratory muscles recruitment should prompt the mental gear into fulminous action . upper airways obstruction kills by hypoxia and / or reflex hyperacute vagal - mediated cardiac arrest . in less emergent cases , any tumor rapidly expanding within the upper airways following internal hemorrhage and narrowing of the passage , or bleeding into the airways and making difficult the visualization of the vocal cords , can require esa if eti fails and an sgvd can not ventilate the patient or prevent blood from tracking down in the lower airways . some patients with ludwig angina , retropharyngeal abscess and some with para - pharyngeal abscesses deemed to be at risk of spontaneous rupture or actually having narrowing of the upper airways , require esa as standard preoperative management to prevent the catastrophic consequences of rupture of the abscess with release of pus into the lungs . a surgical airway remains a rare indication in not complicated or stable abscesses when techniques such as awake fiberoptic intubation are available . patients with acute allergic , inflammatory or infective edema , whose stridor and hypoxemia do not improve satisfactorily with adrenaline , or less emergent cases of patients who do not show improvement with intravenous anti - inflammatory drugs or antibiotics and continue to exhibit stridor , overuse their accessory respiratory muscles , have respiration - related tachycardia , and are not able to maintain acceptable pao2 , paco2 and sao2 levels , should receive a tracheostomy under ga if they can still ventilate satisfactorily or be induced under ptjv followed by tracheostomy if they can not . face / neck burn . patients with burns involving face and neck in presence of soft tissue swelling or signs of inhalation injury in the nasopharynx ( carbonaceous discoloration of naso - oropharynx , inflammatory edema or mucosal damage ) must be intubated soon . a delayed intubation leads almost invariably in the great majority of cases to the requirement of a surgical airway even if the epiglottis entry is visible to direct laryngoscopy ( dl ) , due to the impossibility to negotiate the entry of an endotracheal tube of suitable size in an edematous hypopharynx . a delay in eti also increases the damage to the vocal cords as the ett has to negotiate an already involved swollen larynx . penetrating face / neck trauma . penetrating injuries to the face and neck , when a tracheal wound is already in communication with a skin wound and it is straightforward , quicker and easier to introduce a tracheostomy cannula , or even an ett , than to attempt endotracheal intubation , which must anyway follow as more secure and convenient route . rarely , however , these wounds are central or near central and the tracks are suitable for direct device insertion . in these cases if ett can not be inserted from above and the track is too distal and straight for a tracheostomy cannula , a smaller size than standard ett through allows for 100 % oxygenation and protected ventilation support until surgical control of the leak is achieved . a loss of airway pressure , besides prevention of blood / debris aspiration , is the reason why airway control is an emergency and should be done as soon as possible . blunt face / neck trauma . in the category of patients with blunt trauma to face and neck , blunt trauma to the airways is less common but has higher injury severity score ( iss ) and mortality than the penetrating one , with injury to the lower airways having a higher mortality than injury to the upper ones . anticipated difficult airway in adults standard eti drill , management of unanticipated difficult airway , deviation from the drill a great deal of intuition and experience are required in decision - making . in a blunt trauma to face and neck , only four scenarios , eachoccurring singularly or in combination , will benefit from , or necessitate , an esa , specifically an open standard tracheostomy [ table 4 ] . severe and complex facial injuries with disruption of the mid - face or of the lower face ( mandible and mouth floor / tongue complex ) warrant emergency tracheostomy under three different rationales : the risk of airway loss that can occur at any time unpredictably as a consequence of the mechanical derangements and the posttraumatic hemorrhage / edema ; the inability to intubate the patient or fix safely the ett ; the inefficacy or contraindication of facemask and the inability to open the mouth fully . face - mask ventilation in facial traumaworsens hypoxemia by pushing blood , debris and tissues into the lower airways , and compounds the damage to facial structures . sgvds are particularly suitable outdoors as a temporary method of airway control and safe ventilation , to avoid blood and debris going down the airways , when eti fails ; and as a bridge to definitive tracheostomy . tracheostomy for these patients represents also the most convenient and definitive way to secure the acute airway , and it obviates technical difficulties and disadvantages of doing delayed emergency / elective surgery in an area with an ett in situ . indications for esa in blunt trauma to face and neck [ ref28 ] retropharyngeal hematoma following cervical spine injury and posterior cerebellar fossa hematoma following head injury , results of associated concomitant injuries to head and cervical spine often involved in severe facial trauma , are very rare causes of posttraumatic respiratory obstruction , requiring esa , that need to be kept in mind . hyoid bone ( hb ) fractures after blunt injuries are also rare due to the strategically well - protected position of the bone , but potentially lethal ; the bone , in fact , gives posterior attachment to the tongue / mouth floor complex , and its breakage is ominous of unpredictable onset of sudden airway obstruction . furthermore , a hyoid bone fracture with hematoma tracking down its inferior musculo - facial attachments , as well as a direct injury to the larynx complex , can obscure the thyroid cartilage ( tc ) and cricoid cartilage ( cc ) landmarks . extravasations of blood from blunt vascular injury in the carotid sheath instead , though pushing or compressing the trachea , remain usually confined within its facial compartments and do not obscure the anterior neck landmarks . indications for esa after blunt trauma to face and neck have been delineated and can be regarded as a paradigm for universal indications for esa [ table 4 ] . in a life - threatening situation such as a critical airway , the time window for useful decision - making is often very narrow , and any delay in recognizing the need for the most demanding of esas , i.e. , a tracheostomy , affects patients outcome in terms of exitus and severe neurological or cardiac damage . while definitions of emergency and urgent are clear in case of hemorrhage or hemorrhagic shock , in airway compromise such definitions can not be used due to the impossibility to predict how many minutes to hours of fatigue endurance a patient can tolerate in hypoxemia from incomplete airway obstruction [ table 5 ] . actual ( complete ) airway obstruction causes cardiac arrest by acute severe vagal reflex or respiratory arrest soon followed by cardiac arrest ( respiratory - cardiac arrest ) , depending on functional residual capacity ( frc ) and cardiac physiological reserve . impending ( incomplete or partial ) airway obstruction kills by exhaustion from hypoxemia or by the damages from relative hypoxia to organs like heart and brain . signs suggesting an impending airway obstruction warranting esa must therefore be recognized in a clear and unmistakable manner [ table 6 ] . cluster indications for esa in critical airway in adults signs indicating the need of an esa for impending airway obstruction and impending respiratory - cardiac arrest deformity may be the only hard sign of significant laryngeal injury elicited in an unconscious or not ventilating patient , whereas inspiratory stridor is the most important sign in a conscious , spontaneously ventilating patient ; tenderness , hoarseness , voice change and subcutaneous emphysema are soft signs of laryngeal injury and per se not indicators of significant damage . blunt trauma to the neck is almost always associated with facial trauma , different degrees of head injury , and posttraumatic edema with loss of anterior neck landmarks . the loss of those landmarks has two important clinical implications : a cricothyroidotomy can not be performed safely , and deformity can not be confirmed or excluded . in such a scenario , gurgling noises or stridor in presence of clinical ( central cyanosis ) and objective ( low sao2 and pao2 ) hypoxemia , or hypoventilation and hypercapnia ( visible slow respiratory rate or apnea , high pco2 ) are cardinal signs of impending ( incomplete ) airway obstruction demanding esa . other nonspecific signs of impending airway obstruction that invariably present in different scenarios are use of accessory respiratory muscles , tachypnea , tachycardia , systolic hypertension , diaphoresis , restlessness , agitation , confusion . the presence of such specific and nonspecific signs also demands an esa in presence of edema of the glottis not relieved medically by intravenous cortisone within 6 to 8 hours , even in presence of a borderline scenario . furthermore , operator 's training and experience are relevant for indications and performance . guidelines for specific indications , timing and type of esa can therefore only be given according to axioms and corollaries ; personal experience ; reliable comparative studies of the techniques in election done by teams of ent and maxillofacial or cardiothoracic surgeons experienced in both procedures , and their meta - analyses . advantages , scenario indications , contraindications and disadvantages of the different methods are outlined in table 7 . pros and cons of surgical airways despite the wave of enthusiasm accompanying percutaneous tracheostomy ( pct ) in the last two decades , there is no evidence that the closed technique is superior to , or more convenient than , the open standard tracheostomy ( ost ) . far too many comparative studies between pct and ost done in election in the last 20 years have stated pct has less complications and mortality rates , is less costly and faster than ost . these conclusions , in fact , can not be accepted , for different reasons such as small sample size , lack of randomization of the patients , lack of randomization for the procedure , biased patient selection criteria , uneven operators - to - procedures ratio within the same team , lack of a single - team performance of both the procedures , no direct comparison between the techniques but indirect comparison with other studies . the evidence brought on elective patients by teams experienced in both techniques with sound prospective randomized controlled trials ( prcts ) has however proved , as a matter of fact , a superiority of ost over pct in elective scenarios ( icu , operating theater and bedside ) in terms of overall safety and cost - effectiveness and in terms of perioperative and postoperative complications ; and an increased risk of delayed airway loss ( more difficult cannula changes or inability to replace the cannula ) in the pct groups . indeed a major meta - analysis of elective studies had found much higher perioperative complications rate and mortality with pct than with ost , which appeared to have more minor problems related to postoperative wounds . the same conclusions were confirmed in a meta - analysis of studies on elective tracheostomies on cardiothoracic patients . late complications , i.e. , airway structural damages in the form of stenosis , seem not to differ among the techniques , suggesting a direct correlation between length of tracheostomy and damage to the trachea . pct , though , is reported to give an earlier and more serious subglottic stenosis compared to open tracheostomy ; burns are an indication particularly prone to this complication . the problem of late stenosis in patients receiving ett or tracheostomy for burns is a difficult one to solve . it can be speculated that apart from duration , a direct damage to tracheal mucosa from the burns or from smoke inhalation must have occurred . consideration should be given to low - dose steroids as adjuvant prophylactic therapy in patients with burns to face and neck or those with smoke inhalation requiring airway control . ( pers obs ) the decision with regard to which esa to use in critical airway , in the end , depends essentially on three factors , namely , i ) setting and logistics , i.e. , whether outdoors or indoors and which equipment is available ; ii ) underlying pathology , i.e. , whether temporary and reversible or a medium - to long - term one ; and iii ) presence or the absence of palpable anterior neck landmarks ( hb , tc , cc , trachea of sufficiently palpable length and circumference ) . the author 's personal recommendations for esa in critical airway are outlined in table 8 . recommendations on which esa to use in critical airway the non - exclusion or presence of csi by palpation of the posterior neck landmarks ( spine processes , intervertebral gaps ) for tenderness , deformity and swelling ; and / or by suggestive history and neurological examination is not a discriminating criterion in the choice of an esa as long as there is a palpable trachea with sufficient length and diameter . ( pers obs ) if this is not the case , any attempt to position the neck in deep impalpable tracheas has to be resisted and an open or semi - open technique should be utilized . in the short term , what is needed would be the capacity to know beforehand who with certainty can not be intubated . this can be achieved only with ( magnetic resonance imaging ) mri studies of the structure and dynamics of oropharynx and larynx on those patients who present with objective risk factors for both difficult - to - impossible intubation and sgvd insertion . other very useful information to obtain possibly with certainty and beyond doubt is before the administration of a general anesthesia is whether the stomach is empty or not . this can only be achieved with advances in sonar technology , which is at the moment not reliable , especially in emergencies without ileus or obstruction . the medium - to long - term future of esa is an instrument like a mechanical nail - shooter or a pistol , which by aided incorporated sonar and video guidance under blue tooth technology and by a trachea - clasping or partially encircling mechanism while oxygenating via a separate channel during trephine , makes a hole in one go from skin to anterior wall of the trachea . the long - term future of eti is in a heat - laser - guided blind eti insertion with the ett cuff stopping above tracheal bifurcation as directed by a percutaneous landmark identified with external sonar on the anterior aspect of the neck at a level above the carina .\noutput:\n" }, { "from": "agent", "value": "an algorithm on the indications and timing for a surgical airway in emergency as such can not be drawn due to the multiplicity of variables and the inapplicability in the context of life - threatening critical emergency , where human brain elaborates decisions better in cluster rather than in binary fashion . in particular , in emergency or urgent scenarios , there is no clear or established consensus as to specifically who should receive a tracheostomy as a life - saving procedure ; and more importantly , when . the two classical indications for emergency tracheostomy ( laryngeal injury and failure to secure airway with endotracheal intubation or cricothyroidotomy ) are too generic and encompass a broad spectrum of possibilities . in literature , specific indications for emergency tracheostomy are scattered and are biased , partially comprehensive , not clearly described or not homogeneously gathered . the review highlights the indications and timing for an emergency surgical airway and gives recommendations on which surgical airway method to use in critical airway ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: intussusception is a rare cause of postoperative intestinal obstruction in adults .1 various kinds of symptoms have been expressed such as epigastric pain , nausea / vomiting , and hematemesis . intussusception can be diagnosed by performing upper gastrointestinal series , endoscopy , ultrasonography , or a computed tomography scan .2 we report our experience with a patient who developed early postoperative retrograde jejunojejunal intussusception after total gastrectomy . a 77 - year - old woman visited chonbuk national university hospital because of gastric adenocarcinoma detected at a periodic examination . after radical total gastrectomy , the jejunum was resected 20 cm below from the treitz ligament . distal part of resected jejunum was pulled up through the transverse mesocolon , and esophagojejunostomy was constructed in end - to - side anastomosis by using an eea stapler ( 25 mm ; covidien , mansfield , ma , usa ) . fifty centimeters below the esophagojejunostomy site , a jejunojejunostomy was constructed by performing end - to - side hand - sewn anastomosis . a nasojejunal feeding tube ( njft ) was inserted into the distal part of the efferent loop of the jejunostomy for early postoperative enteral nutrition . a closed drain tube was placed at the esophagojejunostomy through the abdominal wall . on the fifth postoperative day , the patient complained of abdominal pain , and bile - colored fluid was seen in the closed drain tube . a water - soluble contrast swallowing imaging study indicated leakage at the esophagojejunostomy site and dilatation of the roux limb and the afferent loop of the jejunojejunostomy , which indicated intestinal obstruction ( fig . , retrograde jejunojejunal intussusception accompanied with njft was found at the efferent loop of the jejunojejunostomy . the intussusception was approximately 7 cm in length from the njft tip portion to the jejunojejunostomy and showed mild edematous changes without necrosis ( fig . manual reduction without bowel resection and primary repair of esophagojejunostomy was performed , and the njft was removed . feeding jejunostomy for enteral nutrition was constructed at the distal part of the efferent loop of the jejunojejunostomy . on the ninth repostoperativeday , intussusception after abdominal surgery is a comparatively rare disorder and occurs in only 0.07 % to 2.1 % of individuals who undergo gastrectomy .3 however , the majority of intussusceptions following abdominal surgery occur after gastrectomy ; many are associated with the billroth ii method or roux - en - y anastomosis .4,5 in adults , the exact mechanism is unknown ; however , postoperative intussusceptions are likely to be caused by altered peristalsis after prolonged and excessive manipulation with drying and bruising of the bowel , extensive preperitoneal dissection , abdominal serum electrolyte level , local hypoxia , anesthetic agents , and postoperatively administered drugs .6 in general , the majority of small intestinal intussusceptions are caused by benign lesions such as benign neoplasm , inflammatory lesion , meckel 's diverticuli , appendix , adhesion , intestinal tubes , whereas the majority of large intestinal intussusception have a malignant etiology .7 in general , retrograde intussusceptions arise late in the postoperative period , whereas the antegrade cases occur during the early period following gastrectomy .8 the first case of retrograde jejunojejunal intussusception after total gastrectomy was reported in 1954.9 yoneda et al. 3 analyzed 20 cases of retrograde jejunojejunal intussusception after total gastrectomy . there were only 3 cases that occurred in the early postoperative period ( i.e. , within 30 days postoperatively ) , whereas 17 cases occurred variously from 1 year to 21 years later . all cases except one underwent surgical treatment ( 6 cases with manual reduction and the other cases with enterectomy ) . in our case , intestinal obstruction occurred because of retrograde jejunojejunal intussusception after total gastrectomy in the early postoperative period . the use of long cantor tubes caused both antegrade and retrograde small bowel intussusceptions in adults . antegrade intussusception in this situation occurs through telescoping of the bowel over the tube , especially when it is fixed in place with tape at the nose . retrograde intussusception occurs during or after the tube is removed , especially if it is removed quickly and with force .10 however , our patient did not eliminate the njft , and we could not find any palpable mass in the small bowel . additionally , the postoperative adhesion was not severe because reoperation was performed in the early postoperative period . the tip of the njft irritates the jejunal lumen , so it alters normal peristaltic activity and causes an invagination of the distal jejunum .10 however , the etiology and mechanism remain unclear . retrograde jejunojejunal intussusception after total gastrectomy commonly occurs with roux - en - y anastomosis and braun 's anastomosis . , it progressed to dilatation of the distal portion of esophagojejunostomy and leakage of the esophagojejunostomy site . we experienced rare early postoperative retrograde jejunojejunal intussusceptions after total gastrectomy with esophagojejunostomy and report our results with a brief review of the literature .\noutput:\n" }, { "from": "agent", "value": "intussusception is a rare cause of postoperative intestinal obstruction in adults . many retrograde intussusceptions occur during the period following gastrectomy . a 77 - year - old woman visited our hospital because of detected gastric adenocarcinoma . she received radical total gastrectomy with roux - en - y esophagojejunostomy . on the fifth postoperative day , she complained of abdominal pain , and we found leakage at the esophagojejunostomy site and dilatation of the roux limb and the afferent limb of the jejunojejunostomy . emergency surgery was performed . retrograde jejunojejunal intussusception accompanied with a nasojejunal feeding tube was found at the efferent loop of the jejunojejunostomy . no ischemic change was found ; therefore , manual reduction and primary repair of esophagojejunostomy was performed . she was discharged without complications on the 23rd re - postoperativeday . we suggest that the nasojejunal feeding tube acted as a trigger of intussusception because there was no definitive small bowel mass or postoperative adhesion . we present our findings here along with a brief review of the literature ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: balanced general anesthesia comprises amnesia , analgesia , hypnosis , muscle relaxation , and obtundation of reflexes . to achieve all these components , we use different combinations of drugs . however muscle relaxants may confound our evaluation of depth of anesthesia due to lack of motor activity and may make the patient aware of the intraoperative events . bispectral index ( bis ) is a widely used quantitative parameter for evaluating depth of anesthesia and sedation . it is a continuous noninvasive electroencephalographic method that has been proposed to monitor the hypnotic state during sedation and anesthesia . the alpha - 2 receptor agonist dexmedetomidine has potent sedative properties and has received food and drug administration approval for use in the intensive care unit ( icu ) for sedation . dexmedetomidine has analgesic sparing properties and is not associated with respiratory depression in therapeutic doses . . it has been used as an anesthetic sparing agent but not as a sole anesthetic agent . we have proposed to evaluate the effect of dexmedetomidine on depth of anesthesia and compared it with that of propofol by using hemodynamic variables and bis values , with the aim of studying the feasibility of dexmedetomidine as a sole anesthetic agent in maintaining depth of anesthesia . approval for the study was obtained from our institution 's ethics committee and written informed consent was obtained from the patients . sixty male and female patients , 18 - 65 years of age , asa physical status of i , scheduled for laparotomy under general anesthesia were considered for enrolment randomly into two groups ( 30 patients in each ) by a computer - generated randomization scheme . patients having heart block , hypertension , diabetes mellitus , renal dysfunction , psychiatric illness , or patients taking antipsychotic drugs or sedatives were excluded from the study . baseline hemodynamic variables were noted by attaching monitors [ noninvasive blood pressure , heart rate ( hr ) , oxygen saturation , end - tidal carbon dioxide , electrocardiogram , and temperature ] . group a patients received bolus dose of propofol ( 1 mg / kg for 10 min ) followed by an infusion of propofol ( 50 mcg / kg / min ) and group - b received bolus dose of dexmedetomidine ( 1 mcg / kg for 10 min ) followed by an infusion of dexmedetomidine ( 0.5 mcg / kg / h ) . after preoxygenation for 3 min , anesthesia was induced with intravenous ( i.v ) thiopentone sodium ( 3 - 5 mg / kg ) . sedation and anesthesia was maintained with infusion of study drugs ( propofol or dexmedetomidine ) . depth of anesthesia was evaluated by monitoring intraoperative hemodynamic values ( hr , blood pressure ) and bis value . sensors were placed as follows : one at the center of forehead approximately 2 inches above the bridge of nose ; second one directly above forehead , and third one on temple between the corner of the eye and hairline . parameters [ age , gender , weight , mean arterial pressure ( map ) , hr , bis value , sedation score ] were compared between the two groups by unpaired t test . all data with pthese two groups were comparable in respect to demographic variables ( age , weight , gender , asa ps i , type of surgery , and duration of anesthesia ) [ table 1 and figure 1 ] . demographic data of two groups the two groups were also comparable with respect to their baseline map and hr . postintubation rise was less in group b. subsequent map and hr were also less in group b. but the difference between the two groups was statistically significant only for map at 20 min after infusion ( p = 0.039 ) [ figures 2 and 3 ] . trend of mean arterial pressure in two groups trend of heart rate in two groups baseline bis value was comparable between the two groups . bis value decreased after induction in both the groups but patients getting dexmedetomidine infusion showed statistically significant lower values of bis when compared with propofol ( p 0.0001 ) [ table 2 and figure 4 ] . intraoperative bis value trend of bispectral index in the two groups sedation score was noted in the immediate postoperative period by ramsay sedation scale . it was seen that patients recieving dexmedetomidine were more sedated in the postoperative period , but it did not impair ventilation though the difference between the two groups was statistically significant ( p 0.0001 ) [ table 3 and figure 5 ] . none of the patients in both the groups was able to recall any intraoperative events . general anesthesia has several components , namely , amnesia , hypnosis , analgesia , immobility , and blunting of autonomic reflexes . often in operating rooms anesthetic induction has been referred to as going to sleep . but all the components of general anesthesia may not be achieved as muscle relaxants may confound our evaluation of depth of anesthesia due to lack of motor activity and may make patients aware of the intraoperative events . for achieving adequate depth of anesthesia , use of inhalational or intravenous anesthetic agents in hypnotic doseshowever , it has been observed that certain anesthetic drugs in subhypnotic concentrations produce amnesia , ( eg , propofol , midazolam ) due to engrams ( physical alterations in neural tissues thought to be substrate for memory ) impaired by these drugs . in these cases of episodic amnesia , memory is lost before consolidation . in our study , we have similarly used subhypnotic equisedative doses of propofol and dexmedetomidine and observed episodic amnesia in these cases . similar dosing pattern of bolus and infusion were used by previous authors who used a higher loading dose of dexmedetomidine . in the current study , a minimum dose of both the drugs was chosen that ensured amnesia but caused least side effects such as hypotension , bradycardia , or arrhythmia alpha - 2 agonist dexmedetomidine is a sedative and analgesic agent , which has been used for icu sedation upto 24 h after surgery . dexmedetomidine provides hemodynamic stability and appears to have no clinically important adverse effect on respiration . compared with propofol and midazolam , dexmedetomidine was as effective in maintaining adequate sedation for prolonged mechanical ventilation . dexmedetomidine has also been used for sedation for short surgical procedures and as an adjunct resulting in reduced intraoperative requirements of anesthetics . it has been used as sole anesthetic agent only in a few occasions , whereas propofol has been used to maintain the depth of anesthesia routinely . the results of our study validate the use of dexmedetomidine as a maintenance anesthetic agent . loading dose in this study has been reduced as maximum adverse effects were observed immediately after administration of the loading dose . target bis is delayed when loading dose is reduced but in this study target bis ( 40 - 65 ) was achieved with the addition of an induction agent . dexmedetomidine even in lower loading dose produced better amnesia for procedural sedation compared with remifentanil . ramsay and his co - workers reported the use of dexmedetomidine at a higher dose for intubation in difficult airway scenarios without any induction agent or neuromuscular blocker and observed hypotension , bradycardia , and upper airway obstruction . in the current study , along with study drug , induction agent and neuromuscular blockers were used to facilitate endotracheal intubation and much less dose could be used in contrast to the cases reported by ramsay . bis is a continuous noninvasive electroencephalographic method that has been proposed to monitor the hypnotic state during sedation and anesthesia . its use has been documented to be associated with lesser chance of intraoperative awareness . in a study on volunteers , yusuke and his co - workers compared bis value with a clinical scoring [ observer assessment of alertness sedation score ( oaa / s ) ] both with propofol and dexmedetomidine . they found that equivalent doses of dexmedetomidine produced lower bis value and the bis value of 46 with dexmedetomidine was comparable to bis value of 67 with propofol both of which produced oaa / s score 2 ( oaa / s 2 denotes adequate sedation ) . in the current study patients getting dexmedetomidine infusion showed statistically significant lower values of bis when compared with propofol ( bis value 60 - 65 in propofol as opposed to 50 - 55 with dexmedetomidine ) . despite the difference in bis equal depthwas achieved with both the drugs with no recall in any patient as assessed by modified brice questionnaire . this may be explained by the different mechanisms of sedation by the two study drugs . dexmedetomidine produces sleep by hyperpolarization of noradrenergic locus ceruleus neurons as opposed to gaba agonism by propofol . a rise in map and hr was noted after intubation with subsequent fall of both in the two groups . postintubation rise was less in group b. subsequent map and hr were also less in group b. but the difference between the two groups was statistically significant only for map at 20 min of infusion ( p = 0.039 ) . earlier study has also shown that dexmedetomidine attenuates stress response to intubation by decreasing central sympathetic outflow . another study done in bariatric surgery found dexmedetomidine produces better control of hemodynamic parameters compared with fentanyl . sedation score was calculated in both the groups in immediate postoperative period by ramsay sedation scale . it was seen that patients receiving dexmedetomidine were more sedated during postoperative period ( p value 0.0001 ) , but without any impairment of ventilation . it is consistent with the result of the study done by venn and grounds who also found more sedation with dexmedetomidine postoperatively but without any delay in extubation . the longer sedation with dexmedetomidine could be explained by longer elimination half - life of the drug . butincidence of delayed recovery and longer discharge time with dexmedetomidine were observed by other investigators . the observations of the present study could have been more conclusive with larger sample size , multicenter trial and measurement of plasma levels of drugs . from our study we can conclude that dexmedetomidine is comparable with propofol as maintenance anesthetic agent and it can produce better control of hemodynamic variables and bis value . so , dexmedetomidine may be used as sole anesthetic agent for maintenance of depth of anesthesia .\noutput:\n" }, { "from": "agent", "value": "background and aims : intravenous agents such as propofol are commonly used to maintain adequate depth of anesthesia . dexmedetomidine which has an anesthetic sparing effect is being considered for maintaining intraoperative depth of anesthesia . we hypothesized to compare the effect of dexmedetomidine on depth of anesthesia with propofol and evaluated whether dexmedetomidine can be used as sole anesthetic agent in maintaining depth of anesthesia.materials and methods : sixty patients of asa ps i , 18 - 65 years of age , scheduled for laparotomy under general anesthesia were randomly divided into two groups of 30 each . group a received propofol 1 mg / kg bolus followed by infusion ( 50 mcg / kg / min ) and group b received dexmedetomidine 1 mcg / kg bolus followed by infusion ( 0.5 mcg / kg / h ) . both the groups were administered standard general anesthesia with routine monitoring along with bispectral index ( bis ) and values were recorded at intervals of 10 min . in all patients ramsay sedation score was recorded after extubation and they were assessed for recall of intraoperative events using modified brice questionnaire.results : heart rate and mean arterial pressure were less in group b than group a. intraoperative bis values were significantly lower in group b ( p < 0.0001 ) . although sedation score was more in group b it did not prolong recovery . no recall was found in any patient.conclusion : dexmedetomidine was comparable with propofol in maintaining anesthesia and it can produce better control of hemodynamics and bis value . thus dexmedetomidine can be used as the sole maintenance anesthetic agent ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: computer - aided design / computer - aided manufacturing ( cad / cam ) technology allows restorative dentists to create a custom - made restoration in a short period of time that has only been possible through mass production . cad / cam technology has quickly begun replacing conventional manufacturing processes in commercial use in the early 1970s . the first cad / cam dental restoration was produced in 1983 , and its applicability expanded into restorative aspects of implant dentistry in the early part of the 1990s .1 - 4 as the international gold price surged from the late 1970s to the early 1980s during the united states ' economic depression , various all - ceramic restorations , including dicor , inceram , and empress system were introduced into the market . with the recent rapid rise of the price of gold , the cad / cam technology and zirconia restorations have become more prominently developed and introduced . cad / cam titanium abutments offer the advantages of cast abutments , such as anatomic contour and correction of angulations . in comparison to cast abutments , there is no need for complicated and time - consuming casting and post - casting manipulations that may produce inaccuracies . there is also no need to buy high - priced abutment inventory .5 on the other hand , there are still several disadvantages of cad - cam abutments such as misfit between abutment base and fixture top portion depending on the manufacturer , relative strength problem of the titanium abutment compared to fixture , and limited applicability to cementation type prosthesis . wiskott et al. 6 has mentioned that the screw joint stability depends on the relationships between the pretension of abutment screw , mating surface preload , and friction upon screw tightening . the screw joint stability improves with the increase of preload , but the preload can not exceed the elastic limit of the screw material . other researchers have reported that the screw joint stability also depends on the rotational movement of abutment and fit tolerances of the flat - to - flat of the implant hexagon to the abutment internal hexagon walls .7 - 9 numerous studies have indicated that after implant osseointegration , abutment screw loosening appears to be the most common problem . the two most probable causes of abutment screw loosening is excessive bending of the joint and the settling effect of screw interfacial surfaces .10,11 screw loosening occurs when the joint - separating forces acting on the screw joint are greater than the clamping forces holding the screw unit together . excessive forces can cause slippage between threads of the screw and the bore , resulting in a loss of preload and screw loosening .11 the mechanism of \" settling effect \" is based on the fact that every machined surface exhibits some degree of microroughness . under a dynamic load , micromovement may bring two surfaces of screw interface closer together . thus , screw loosening will occur when the total settling effect is greater than the elastic elongation of the screw . for cement - retained prostheses , abutment screw could be loosen in cases of too tapered abutments or failure to achieve passivity of the prosthesis . meanwhile , misfit of the prostheses could induce metal fatigue , and finally screw loosening or fracture could happen in screw - retained type . thus , each system has their characteristic problem , there has been trial to solve these by combining both system , such as screw - and cement - retained prostheses ( scps ) . however , little is known about accuracy of fit and its correlation with stress transfer and even screw loosening . there are several methods of assessing the screw joint stability and possibility of screw loosening of various implant systems . martin and colleagues have recorded the micromotion of the screw joint interface after dynamic loading with strain gauge , while cibirka et al . measured detorque value of abutment screw with a digital torque gauge .9,12,13 several investigations have attempted to measure the fixture - abutment gap . one method is to measure the gap around the outer perimeter of the fixture - abutment connection . the other is to study the adaptation as a function of radius for more accuracy .14 according to coelho , using the ground sections observed under a microscope at 1000 magnification , adaptation values of interface as a function of radius were measured .15 the average gap distances found for all implants were constantly below 10 m to the outer radius similar to previously published data . because there may be morphologic aberrations , large variationsit is therefore of practical interest to know the minimal number of measurements necessary for determining gap sizes . groten et al. 16 reported that approximately fifty measurements along the margin yielded clinically relevant information and a consistent estimate for the gap size . the lower boundary for the minimum number of measurements did not depend on the size of the gap .17 - 21 the aim of this study was to assess the screw joint stability of cad / cam titanium and conventional gold - cast ucla abutment with both external and internal connections . this was achieved by means of measuring the detorque values and the gaps between fixture and abutment after cyclic loading . two types of implant system ( n = 20 ) were used . brnemark mark iii implant system ( nobel biocare , usa ) as a representative of the external connection system ( n = 10 ) , andreplace select implant system ( nobel biocare , usa ) which has the characteristic triangular internal connection structure ( n = 10 ) were selected for this study . for the superstructure of each system , five of mark iii fixtures and five of select fixtures were connected to the milled titanium abutment custom made by commercial manufacturer ( addtech , south korea ) with the cad / cam technology . milling machine processed the titanium rod into the customized abutment . at first , the engaging connection part was precisely milled . the other 10 fixtures were connected to the ucla abutment ( nobel biocare , usa ) which was carved after wax add - up , burned out , and casted to the gold structure . one individual completed all waxing and castings for consistency . to compensate for the different abutment height and width of specimens , custom crowns of the same height ( 8 mm ) were fabricated by means of a lost wax technique . the upper surface of each crown was carved to make an even linear contact to the metal cylinder of the loading system . in the ease of removal after a cyclic loadingthe jig was customized by the iso standard so that the force could be applied to the custom crown at 30 degrees off - axis to produce a clinically severe single tooth bending force or cantilever load . the specimen holder was fabricated to hold an implant body firmly and to set a distance from the loading action point to the exposed position of the fixture at 11 mm ( fig . torque values and detorque values were measured by a digital torque gauge ( mgt12 , mark - 10 corp . , copiague , ny , usa ) , the details of which were as follows : the maximum measurement was 135 ncm , the scale was 0.1 ncm and the measurement error was 0.5 % . the implant fixture and abutment were tightened to a torque of 35 ncm using a digital torque gauge . after cyclic loading , the detorque values were measured by a digital torque gauge ( fig .2 ) . after temporarily filling the screw hole with cotton and caviton ( gc corp . , tokyo , japan ) , the custom crown was cemented temporarily with cavitec ( kerr , romulus , mi , usa ) . the prepared sample was fixed to the mts loading machine .23,24 the programmable hydraulic loading machine ( mini bionix ii test system , mts ; mts systems corp . , usa ) was set under constant temperature ( 18 ) and humidity ( 38 % ) . the load was set such that the stress amplitude range would be within a 0 n to 100 n range of the static strength , which is within the physiologic clinical range with a pulsating load of the sine wave .22 cyclic loading was applied at 14 hz for one million cycles , or the approximate equivalent of 1 - year mastication ( fig . the fixture - abutment gap was evaluated with an optical microscope using image - processing software ( acura 2000 ; intek plus , taejon - city , korea ) at the original magnification 240 . the specimens were fixed horizontally under a microscope after the abutment screw was retightened to 35 ncm . the gap was measured as the minimum distance from one point of the fixture edge to a line determined by the least squares of points at the abutment edge . all measurements and the least squared lines were computed by the programmed macro provided by acura 2000 software system . the fixture - abutment gaps were measured and recorded with an accuracy of 0.1 m at 50 points . the means and standard deviations of the fixture - abutment fit were rounded to 1 m level ( fig .4 ) . spss statistical software for windows ( release 12.0 , spss inc . , the means and standard deviations per group were calculated and statistical inferences among the groups were made using mann - whitney test at .05 level of significance . the mean detorque values and standard deviations found in all groups before and after 10 cycles of loading are shown in table 1 . initial detorque values of the cad / cam milled abutment groups were significantly higher than those of the ucla cast abutment group . after excessive dynamic loading , neither the implants nor the abutments loosened and there were no signs of mechanical failure in the experimental model . in addition , the abutments did not show any signs of deformation or fracture . detorque values after one million dynamic cyclic loadings were not significantly different among the groups . after the cyclic loading , detorque values of ucla abutment increased , but those of cad / cam milled abutment decreased ( fig . 5 ) . there was no significant difference of gap dimension between the cad / cam milled abutment group and the ucla abutment group ( fig . there was no major morphologic aberration at the fixture - abutment gap for all groups ( fig . cad / cam technology has been introduced in an attempt to overcome limitations of stock and custom cast abutments . the cad / cam titanium abutments fabricated in this study were milled to the desired morphological size and shape from solid blanks of titanium . there is no need to merge the prefabricated connection component and solid titanium blank together because of the precise milling process enabling the replication of the connection part . the cad / cam titanium abutment manufacturing process begins with a model fabrication from a fixture level impression . using a laser scanner , the 3d data of a master model is put into the workstation computer . at this time , the precise location and angulation of the fixture top is recorded . after checking occlusion of a virtual tooth from the cad program , the height , width , and the angulation of abutment are adjusted to maintain an ideal space between the virtual tooth and abutment . finally , the titanium rod is milled into the customized abutment and the abutment is evaluated on the master cast . the ucla abutment used in this study is the premachined abutments made of gold alloy , which can be cast directly onto to allow integration of the restoration with the abutment . it has the advantages of overcoming angulation and esthetic problem , but it may reflect difficulties with distortions introduced by the casting technique , and / or porcelain firing cycles or limitations inherent in the finishing procedures . byrne and his colleagues reported a lesser screw contact in premachined ucla abutments cast onto and subjected to porcelain firing cycles than in the same abutments that were not cast onto or subjected to porcelain firing cycles .14 possible reasons for this finding relate to stress release within the premachined abutments induced with heat during the procedures or distortion induced by contraction of the surrounding casting . a poor fit with resultant lack of frictional resistance to rotation may be a possible cause of screw loosening .25 for this reason , the comparative studies between the premachined ucla abutment and the cad / cam milled titanium abutment were performed by measuring detorque values and gap dimensions . two implant designs from the same manufacturer were selected in this study to represent both the external and internal designs in the screw joint stability . the brnemark mark iii implant was used for the design of the external connection , and hexagonal feature for rotational resistance , indexing , and lateral stabilization . the replace select implant has an internal cylindrical connection with three cams that fit into slots in the inner implant wall . quek and his colleagues26 evaluated the load fatigue performance of four implant - abutment interface designs . while one abutment screw fracture and two implant fractures were noted out of 15 samples of the brnemark group , there was no abutment screw fracture and one implant failure out of 15 replace select samples , and load fatigue failure occurred at the weakest point of the implant . steinebrunner et al. 27 reported that tube - in - tube connection of the replace select and camlog implant system showed significantly longer survival times under dynamic loading than the other tested implant groups . in their study , the increased length of the implant - abutment joint was suggested as a reason for the good outcome . while the ratio of the tube diameter to the length of the joint is 1.36 in the replace select system , that of the brnemark system is 0.16 . the longer the internal lever arm , the less force is transferred to the internal wall , and the force is distributed more evenly . in combination with the cam - slot fixation , this structure may minimize micromovement at the screw joint and prevent screw loosening . in this study , although not statistically significant , the absolute deviation of detorque value in the internal connection group is smaller than that of the external connection group ( table 1 ) . this result shows that most of the tensile force may be transferred to the internal wall instead of the abutment screw and the abutment screw can be subjected to little force for the tube - in - tube connection design implants . dimensions , properties , or conditions may vary within certain practical limits without significantly affecting the function of equipment or a process . tolerances are specified to allow reasonable leeway for imperfections and inherent variability without compromising performance . dimensional tolerance is related to fit in mechanical engineering , which is a designed - in clearance or interference between two parts .28 the cad / cam titanium abutment fabricated in this study was milled with the dimensional tolerance recommended by the manufacturer . the significantly higher mean initial detorque value of the cad / cam milled abutment than that of the ucla abutment was due to the narrow dimensional tolerance of the cad / cam abutment manufacturer , which is different from nobel biocare recommendations . it is important to determine how wide the tolerances may be without affecting the fitness of abutment - implant interface . cold welding is a solid - state welding process in which joining takes place without fusion at the interface of the two parts to be welded . because of the plastic deformation involved , it is necessary that at least one of the mating parts be ductile . exposure to oxygen or certain other reactive compounds produces surface layers that reduce or eliminate the cold welding effect . this is especially true if , for example , a metal oxide has mechanical properties similar to those of the parent element , in which case surface deformations do not crack the oxide film . the reason cold welding does not normally occur between metals is that there is a very fine layer of oxidized metal . for the same reason , the interface is degreased , wire - brushed , and wiped to remove oxide smudges prior to the intentional cold welding .29 sutter et al. 30 demonstrated that the loosening torque of iti morse taper design was 124 % of the tightening torque at a clinically relevant level of 25 ncm ; however , little information was given as to the nature of the apparatus to record this data . norton31 evaluated the loosening torque and for clinically relevant levels of tightening touque ( 20 to 40 ncm ) , the loosening torque decreased and cold welding did not occur . in this study , we suggest that the increase of detorque value may be the cause of cold welding of ductile gold to titanium after one million cycles of pulsating loads equivalent to a one - year mastication . meanwhile , there were more gap discrepancy in external type implant for both ucla & cad / cam abutments comparing to the internal type implant . there seems relatively more stress for the external - implant abutment connection comparing to the internal type , which is caused by the different load transfer mechanism . also , joint instability caused by the micromovement may induce more gap discrepancy as well in the external type implant - abutment joint . in this study , the fifty gap measurements around the outer perimeter of the fixture - abutment connection for each specimen were performed with a microscope . the minimum of 50 measurements necessary for determining gap sizes is based on a report by groten .16 this survey was originally performed to measure single crowns . because the morphologic aberrations of implant components are unnoticeable and the gap discrepancy of fixture - abutment interface is smaller than that of a tooth - crown margin , a number of 50 are sufficient for the consistent estimate of the mean gap discrepancy . the results of these experiments demonstrate that cad / cam titanium abutments can be fabricated with sufficient accuracy to permit screw joint stability between abutment and fixture comparable to that of the traditional gold cast ucla abutment . these findings may have important implications , since the price for fabrication can be reduced once the process becomes organized . the occlusal force is distributed in a complex manner in vector and magnitude in vivo . for this study , the load was applied on a single implant crown with an already determined magnitude and vector for a limited time . the actual preload achieved in the components is dependent on the friction between components , finish of the interfacial surface , and material properties . even within the same prosthetic componentsfor this study , we focused solely on abutment and connection design , and did not consider those factors mentioned above . in addition to the earlier limitations , investigations involving more realistic loading conditions and larger sample sizes are necessary for future research . although the cad / cam milled titanium abutment was more resistant to screw loosening than the ucla abutment immediately after initial tightening , it was more difficult to loosen the ucla abutment after one million cycles of loading . this may be the result of a cold welding not anticipated with the cad / cam titanium abutment . there was also no gap dimension difference between the cad / cam milled abutment group and the ucla abutment group .\noutput:\n" }, { "from": "agent", "value": "purposethe aim of this study was to evaluate the interface accuracy of computer - assisted designed and manufactured ( cad / cam ) titanium abutments and implant fixture compared to gold - cast ucla abutments.materials and methodsan external connection implant system ( mark iii , n = 10 ) and an internal connection implant system ( replace select , n = 10 ) were used , 5 of each group were connected to milled titanium abutment and the rest were connected to the gold - cast ucla abutments . the implant fixture and abutment were tightened to torque of 35 ncm using a digital torque gauge , and initial detorque values were measured 10 minutes after tightening . to mimic the mastication , a cyclic loading was applied at 14 hz for one million cycles , with the stress amplitude range being within 0 n to 100 n. after the cyclic loading , detorque values were measured again . the fixture - abutment gaps were measured under a microscope and recorded with an accuracy of 0.1 m at 50 points.resultsinitial detorque values of milled abutment were significantly higher than those of cast abutment ( p < .05 ) . detorque values after one million dynamic cyclic loadings were not significantly different ( p > .05 ) . after cyclic loading , detorque values of cast abutment increased , but those of milled abutment decreased ( p < .05 ) . there was no significant difference of gap dimension between the milled abutment group and the cast abutment group after cyclic loading.conclusionin conclusion , cad / cam milled titanium abutment can be fabricated with sufficient accuracy to permit screw joint stability between abutment and fixture comparable to that of the traditional gold cast ucla abutment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recent experiences with new ( e.g. sars and avian influenza ) and emerging infectious diseases ( e.g. clostridium difficile associated diarrhea ) has reinforced the importance of effectively communicating and applying fundamental infection control principles across the healthcare spectrum . developing better tools for teaching these principles is essential , and this includes determining which new tools are , in fact , most effective . innovative avenues of content delivery are available to infection control educators with electronic media such as interactive television , web - based learning , cdroms and satellite broadcasts allowing faster , more economic and less labor - intensive information sharing with larger audiences . newer instructional methods such as team based or problem - based learning break down the traditional roles of teacher student and potentially allow for direct application of knowledge to a clinical situation . these are exciting times for infection control practitioners , however , it is important to understand the advantages and limitations of the different modalities and learning tools in order to use them effectively . on - line learning , also known as e - learning , web - based training or distance - distributed learning has various definitions but can globally be described as anything delivered , enabled or mediated by electronic technology for the explicit purpose of learning . information technology such as personal computers , cdroms and the internet are used along with tools such as email , discussion forums , whiteboards , video - streaming , electronic pictures and hyperlinks to enhance the learning process . software for training content can be developed in - house or purchased and content can be delivered via the web or can simply be computer - based , depending on facility and organizational needs and resources . on - linelearning is cost - effective by potentially allowing access to information on the students own time and by reducing the expenses associated with time - off for attendance at educational sessions , printing educational material and instructional time . on - linelearning allows health care workers ( hcws ) to readily access infection control educational modules at their own pace and encourages the consistent application of infection control precautions to protect the healthcare workforce as well as their patients and the public . on - line learning is of particular advantage in under - serviced or remote areas and enables the learner direct access to expert opinion and content . most information technology contains assessment tools , allowing educators to critically evaluate content in a timely manner . educators may also have the option of monitoring the progress of learners as they proceed through the course and quickly address any key learning issues or problems . traditional didactic learning still has its place , however , techniques such as problem - based learning ( pbl ) may be used to permit the student to apply their knowledge to a relevant situation . an example of this instructional methodology that focuses on experiential learning and adult learning theory is the university of british columbia s basic infection control course . briefly described , pbl involves the presentation of a scenario ( the problem ) designed to guide the student to acquire the knowledge needed to understand , and hopefully solve , the problem . scenarios developed to cover the basic knowledge areas essential to a beginning practitioner are coupled with guiding questions to direct their learning . instructor interactions are integrated into the course and students work in small groups in which they are expected to have on - line interaction . this may be at their convenience either individually ( asynchronous ) ( figure 1 ( fig . 1 ) and figure 2 ( fig .2 ) ) or in real time in course chat rooms ( synchronous ) . recommended text and internet - based references as hyperlinks provide resource material . the instructor s role is to ensure that relevant topics have been discussed , that all points have been heard and that closure is brought to each scenario . a set of objectives to ensure that relevant material has been covered is given at the end of the scenario . in our experience at the university of british columbia infection control certificate program , the pbl process works well for those interested in enhancing their existing knowledge in infection control ( e.g. practitioners in infection control , public or occupational health and physicians ) and lends itself well to smaller groups of students who are self - motivated to take the course . it mimics the way in which infection control is practiced , which requires a large degree of problem solving and consultation , and requires that learners not only acquire a certain knowledge base , but also know how to seek new information and apply it in a practical situation . pbl allows students to immediately apply the knowledge they acquire and instills confidence in their ability to support an opinion . geographical limitations are overcome with students from across canada taking the course and participating in asynchronous group discussions . instructors have also mentored the learning sessions from a variety of countries through the course of an academic session . other tutors have also recognized the value of this learning format with a recent survey of 1,286 faculty at 22 us and canadian medical schools rating pbl more positively than traditional methods . the asynchronous learner to learner interaction has been rated as one of the most important types of knowledge acquisition in an on - line environment as it permits bidirectional learning with time for consideration and research on issues raised during the course of discussion . pbl is , however , more labor - intensive for the instructor , requiring regular monitoring of student progress and involvement in the discussions and may not be the optimal method of delivering basic content to large groups quickly and efficiently . virtual classrooms that deliver material twenty - four hours a day , seven days a week and are self - directed may better address the needs of large organizations where issues such as shift work and geographic separation impede traditional learning activities . this has been the format employed in our health authority to teach healthcare workers basic principles of infection control . the workers are provided with an infection control module that can be distributed via the intranet or on cdrom . basic demographic information is collected to allow senior educators to assess who is using the material and when . software has been written to allow hcws to return to the section of the module they were working on when they re - renter the course material . a particular advantage is that course material can be updated quickly in response to new information or changes in policy or procedure . instructional methodologies that include didactic learning , illustrational and resource material and a self - assessment component have been the most effective means of content delivery . key to selecting the appropriate instructional methodology is ascertaining the target audience , the material that must be covered and the resources available to your institution . a successful program must have the support of senior administration , meet the needs of the learners as well as satisfy and involve the content developers . the potential impact of on - line learning is great ; by providing access to educational material from an internet - connected computer any time and anywhere , healthcare workers have increased accessibility to infection control material . infection control , occupational health and public health experts benefit by being able to post and widely disseminate new information expeditiously . providing a consistent message across the continuum of care onattractive as its potential may be , it is imperative that the effectiveness of on - line learning as an educational strategy is assessed . rigorous research and investigation regarding the performance of on - line leaning including the understanding of both barriers and strategies to ensure its effectiveness are required to understand the scope of the potential for this learning technology in the field of infection control . user evaluation of computer - assisted learning packages is required as are assessments of the ability of students to actually learn and retain the content . the ability of this mode of learning to transfer knowledge to health care workers can be assessed fairly readily through the use of self - assessment quizzes , particularly if they are administered before and after completion of the on - line material . weakness in specific subject areas can be ascertained , vague questions and / or content can be identified and addressed and workers can be monitored for their ability to gain knowledge over time . this type of assessment has been readily implemented and evaluated . desai et al evaluated a computer - assisted interactive infection control program and found that nursing staff and medical students found the program effective and enjoyable . on - line learning improved infection control understanding at least as effectively as the traditional infection control lecture . higher level of use by night shift and weekend staff was noted and a demonstrable increase in infection control knowledge was found . evaluations of on - line learning have generally rated the courses favorably , although admittedly the results are biased towards those already more accepting of technology and newer forms of learning , , . prior to implementing the infection control module at our health authority , a pilot evaluation of the on - line learning methodfive facilities were chosen to participate ; each site provided hcws who were randomly assigned to the infection control module or a control module containing workplace material hazards information . a nurse was hired from the casual pool to replace participating staff to ensure that all hcws ( including those who might not normally use on - line learning ) assessed the module . pre and post - tests of infection control knowledge and a user satisfaction survey were conducted . of the 114 individuals participating in the evaluation ( 85 % nursing staff ) , a significant increase in the pre to post quiz scores was noted for the online modules compared to the control material , indicating that the course was successful in transferring knowledge . interestingly , the user satisfaction survey revealed that , although 79 % of the participants indicated they would recommend the online course to coworkers , 28 % preferred classroom - based education when given a choice of learning modalities . more difficult to assess is the ability of on - line learning to assist in effecting a sustained change in behaviour i.e. knowledge translation . knowledge translation involves the ability to make evidence - based research available to frontline workers in a timely , efficient and accessible manner ; as such , on - line platforms certainly have the potential to fulfill this one aspect of translating knowledge into practice , however , it is unclear whether they facilitate the final process of altering behaviour . on - line learning , by predisposing to behavioral change through knowledge acquisition , is simply an aid to the final goal of knowledge translation . this is a relatively unexplored field and further research is needed to test the effectiveness of on - line education as a successful tool for change . on - line learning has been an educational tool in nursing since the early 1990s and offers the advantages of self - paced learning , time and cost savings . it breaks down the barriers of geographical location and time - of - day and has already been used successfully in presenting infection control training modules , . both traditional and newer instructional methodologies adapt readily to this method of content delivery and this venue is generally seen to be user friendly , accessible and relevant to professional practice . while knowledge has been demonstrated to be effectively transferred , future research needs to be conducted to assess the ability of the knowledge gained to be translated into a behavioral change as well . exciting opportunities abound in this field and infection control practitioners , as well recognized players in healthcare worker education , are encouraged to take advantage of these newer technologies . regional medical director for infection control at vancouver coastal health , co - chair of the british columbia provincial infection control network . she is the regional medical director for infection control at vancouver coastal health and is co - chair of the british columbia provincial infection control network . bryce is the former director of standards and guidelines for the community hospital infection control association canada , and is a member of the canadian nosocomial infection surveillance program . she is the co - developer of the only canadian university accredited infection control certificate program which has been developed for on - line learning . bryce has been the recipient of grants to develop on - line courses and to evaluate the impact of on - line educational modules for health care workers . regional medical director for infection control at vancouver coastal health , co - chair of the british columbia provincial infection control network . she is the regional medical director for infection control at vancouver coastal health and is co - chair of the british columbia provincial infection control network . bryce is the former director of standards and guidelines for the community hospital infection control association canada , and is a member of the canadian nosocomial infection surveillance program . she is the co - developer of the only canadian university accredited infection control certificate program which has been developed for on - line learning . bryce has been the recipient of grants to develop on - line courses and to evaluate the impact of on - line educational modules for health care workers .\noutput:\n" }, { "from": "agent", "value": "the experiences gleaned from new and suddenly emergent infectious diseases ( e.g. sars , avian influenza or diarrhea caused by clostridium difficile ) have highlighted how important it is , also for infection prophylaxis , to be able to find instruments for rapid and effective communication . since 1990 online ( e ) learning has been used to train nursing staff and offers the advantage of being able to study at an individual pace as well as cut down on the time and financial resources needed . it serves to overcome geographic distances in respect of the teaching institution , can be used at any time of day according to individual needs and has proved suitable for presenting learning modules in infection prevention.no doubt , traditional didactic learning continues to be the most important approach , but new technologies such as problem based learning ( pbl ) are becoming more popular , and allow students to acquire knowledge in concrete situations . translating knowledge into behavior calls for an ability to convert scientific theoretic knowledge quickly , efficiently and clearly into practical behavior . hence e learning is an ideal way to ensure that the latter requirements are met . while it is obvious that knowledge can be easily imparted by this method , further research is needed to establish whether and to what extent it is possible to use this method to translate the acquired knowledge into altered behavior too . experts believe that novel media technologies hold out several new prospects for accomplishing this ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: osteoporosis is a very common disease in japan that is associated with significant morbidity , mortality , and economic / social burdens . indeed , recent estimates from japan suggest that 3.4 % 12.4 % of men and 16.3 % 26.5 % of women ( mean ( standard deviation ) age : 69.9 ( 11.2 ) years ) have lumbar , femoral neck , or hip osteoporosis . if left untreated , osteoporosis can lead to osteoporotic fractures and increased mortality . a number of factors increase the risk of subsequent fractures , including advanced age , low bone mineral density ( bmd ) , previous vertebral fracture , and previous clinical fracture . the number of osteoporotic fractures in japan has increased during the last 20 years as the elderly population has increased in number . as the size of the elderly populationis expected to continue increasing in the future , the prevalence of osteoporosis in japan will also increase . long - term adherence and persistence with medications in the treatment of chronic conditions are crucial for preventing increases in morbidity , mortality , and healthcare costs . in particular , long - term adherence and persistence are important factors underlying the effectiveness of osteoporosis treatments ; both are essential for increasing bmd and reducing the risk of fracture . common reasons for poor adherence and persistence include adverse events , inconvenience of treatment , and the lack of appropriate patient education . poor adherence can have serious health consequences , including smaller increases in bmd and an increased risk of new fractures . indeed , there is an inverse relationship between treatment adherence and fracture probability . poor adherence also increases general healthcare costs and decreases the cost - effectiveness of treatment . adherence and persistence with osteoporosis treatments in clinical practice are generally poor , with approximately 50 % of patients not adhering or persisting with treatment after 12 months . further , a meta - analysis of observational studies found that only 53 % of patients achieved a medication possession ratio ( mpr ) 0.8 six months after starting treatment and that only 43 % of patients achieved an mpr 0.8712 months after starting treatment . there are very limited data in the peer - reviewed literature on adherence and persistence with osteoporosis medications in japan . findings from the only real - world clinical practice study in japan published to date suggest that adherence with osteoporosis medications may be low , with approximately 45 % of patients found to be adherent with bisphosphonates 12 months after starting treatment . once - daily teriparatide , the recombinant 134 fragment of human parathyroid hormone , became available in japan in october 2010 for the treatment of osteoporosis in patients with a high risk of fracture . given as a subcutaneous injection , teriparatide stimulates osteoblastic activity and the formation of new trabecular and cortical bone . clinical studies have shown that once - daily teriparatide administered over 1824 months significantly reduces the incidence of vertebral , nonvertebral , and fragility fractures , reduces back pain , and improves quality of life in postmenopausal women with osteoporosis . adherence and / or persistence with once - daily teriparatide have been investigated in studies carried out in europe and north america . after 12 months , adherence ( mpr ) in these studies ranged from 0.660.81 , whereas persistence ranged from 57 % 87 % . it is unclear whether once - daily teriparatide adherence and persistence patterns in japan are similar to those in other countries or to those for other osteoporosis treatments . the aim of this prescription database study was to describe real - world adherence and persistence with once - daily teriparatide during the first year of treatment for patients who started treatment during the first eight months of availability in japan . data were obtained from a pharmacy prescription database provided by japan medical information research institute inc . the database comprises the deidentified , pharmacy - specific records of approximately 630,000 patients , 840,000 prescriptions , and 45,000 prescribing physicians per month . further , the database includes 0.8 % ( 400/50 ,000 ) of pharmacies and 1.5 to 2.0 % of prescriptions nationwide and contains information on demographics , dispensing records , prescribers , hospital size , and type of insurance . the age , sex , and prescriber distributions in the database are consistent with those of the general japanese population ( japan medical information research institute inc . , men and women were eligible for inclusion if they had an index date ( first claim for once - daily teriparatide 20 g ( forteo , rhpth ( 1 - 34 ) , eli lilly japan k.k . , kobe , japan ) ) between october 2010 and may 2011 , a preindex period 6 months , a postindex period 12 months , and aged 45 years . the primary study objectives were to assess adherence and persistence during the first 12 months of treatment . adherence was measured by calculating the mpr , defined as the sum of the days ' supply of medication dispensed between the start and the end of the study period divided by the total number of days in the study period . once - daily teriparatide is prescribed in 30 - day increments ( note that once - daily teriparatide received an exemption from the 14 - day supply limit that is standard during the first 12 months after approval for any new medication in japan ) . therefore , the days ' supply of medication for most prescriptions fell into one of three increments : 30 ( one month ) , 60 ( two months ) , or 90 days ( three months ) . persistence was calculated using the time from the start of treatment to the discontinuation of treatment or the end of the study period . discontinuation was defined as a 60 - day gap between two prescriptions or discontinued use of once - daily teriparatide . secondary objectives were to compare baseline demographic and clinical characteristics between patients who had and had not been prescribed glucocorticoids during the pre - index period ; to compare baseline demographic and clinical characteristics , adherence , and persistence between patients who were early ( months 14 of availability ) and later ( months 58 of availability ) initiators of treatment ; and to assess the proportion of patients switching treatment / restarting treatment after discontinuation . we compared characteristics between patients who had and had not been prescribed glucocorticoids because glucocorticoid use is an established risk factor for osteoporosis . we compared characteristics , adherence , and persistence between patients who were early and later initiators of once - daily teriparatide to explore potential differences ( e.g. , due to patient education and prescribing physicians ' attitudes / knowledge ) related to the timing of approval in japan . demographic and clinical characteristics were summarised for the full analysis sample and were compared ( two - sample t - test for continuous variables / fisher 's exact test for categorical variables ) between patients who had and had not been prescribed glucocorticoids during the pre - index period and between patients who were early and later initiators of treatment . variables associated with high adherence ( mpr 0.80 ) were identified using stepwise logistic regression ( odds ratio ( or ) and 95 % confidence interval ( ci ) ) , with age , sex , timing of treatment initiation , prescribing physician 's specialty , hospital size , insurance type , and previous medications as potential covariates . the cut - off for high adherence was selected in accordance with previous studies reporting adherence with osteoporosis medications . a kaplan - meier survival curve for persistencevariables associated with persistence were identified using a stepwise cox proportional hazard model ( hazards ratio ( hr ) and 95 % ci ) , with age , sex , timing of treatment initiation , prescribing physician 's specialty , hospital size , insurance type , and previous medications as potential covariates . adherence and persistence for patients who were early and later initiators of treatmentdata were analysed using sas software , version 9.2 ( sas institute inc . , cary , nc ) . a total of 287 patients in the database initiated treatment between october 2010 and may 2011 . of these patients , 123 ( 42.9 % ) met the eligibility criteria and 164 ( 57.1 % ) did not ( figure 1 ) . of the 123 patients included in the study , the majority ( 70 % ) were aged 70 years , were women , and were prescribed once - daily teriparatide by physicians who were orthopaedic specialists ( table 1 ) . two - thirds of patients had been prescribed osteoporosis medications during the pre - index period , most commonly bisphosphonates . other common ( 40 % of patients ) disease prescriptions during the pre - index period included medications for rheumatoid arthritis and cardiovascular disease . there were several statistically significant differences in demographic and clinical characteristics between patients who were and were not prescribed glucocorticoids during the pre - index period and between patients who were early and later initiators of treatment ( table 1 ) . compared with patients who were not prescribed glucocorticoids , patients who were prescribed glucocorticoids were younger , were more commonly prescribed medications for osteoporosis , rheumatoid arthritis , and cardiovascular disease , and were more commonly prescribed immunosuppressants and anticoagulants during the pre - index period ( p 0.05 ) . compared with patients who were early initiators of once - daily teriparatide , patients who were later initiators of once - daily teriparatide were less commonly prescribed raloxifene , vitamin d , and calcium and more commonly prescribed medications for rheumatoid arthritis during the pre - index period ( p 0.05 ) . overall mean ( standard deviation ) mpr was 0.702 ( 0.366 ) , with 61.0 % of patients having high adherence ( mpr 0.8 ) ( table 2 ) . adherence ( mean and mpr 0.8 ) was numerically , but not statistically significantly , higher for patients who were later initiators of treatment compared with patients who were early initiators of treatment ( table 2 ) . adherence was similar between patients who were and were not prescribed glucocorticoids during the pre - index period ( data not shown ) . the odds of high adherence were significantly greater for patients aged 7079 years than those aged 80 years ( or : 4.001 ; 95 % ci : 1.53310.445 ; p = 0.014 ) and for women than for men ( or : 6.377 ; 95 % ci : 1.23332.980 ; p = 0.027 ) . the percentage of patients remaining on treatment was 65.9 % at 180 days and 61.0 % at 365 days ( table 2 , figure 2 ) . persistence with treatment was numerically , but not statistically significantly , higher for patients who were later initiators of treatment compared with patients who were early initiators of treatment ( table 2 , figure 3 ) . the decrease in persistence was most evident within the first 60 days , particularly for patients who were early initiators ( figure 3 ) . persistence was similar between patients who were and were not prescribed glucocorticoids during the pre - index period ( data not shown ) . the likelihood of discontinuation was significantly lower for women than men ( hr : 0.404 ; 95 % ci : 0.1790.910 ; p = 0.029 ) and for patients prescribed rheumatoid arthritis medications during the pre - index period ( hr : 0.535 ; 95 % ci : 0.2900.989 ; p = 0.046 ) and was significantly higher for patients prescribed calcium ( hr : 2.588 ; 95 % ci : 1.2835.222 ; p = 0.008 ) or anticonvulsants ( hr : 6.510 ; 95 % ci : 1.82923.169 ; p = 0.004 ) during the pre - index period . of the 123 patients , 27 ( 22.0 % ) switched to other osteoporosis medications and 6the most common osteoporosis medications switched to were bisphosphonates ( 7 patients ; 25.9 % ) and alfacalcidol + calcium ( 6 patients ; 22.2 % ) . in this study , we evaluated real - world adherence and persistence with once - daily teriparatide in japan . we extracted data from a pharmacy claims database and determined 12 - month rates of adherence and persistence with once - daily teriparatide for patients who started treatment during the first eight months of availability . given the importance of adherence and persistence for maintaining the effectiveness of osteoporosis treatments and that once - daily teriparatide has only recently become available in japan , our findings represent timely information on the clinical use of once - daily teriparatide in japan . in general , the estimates for once - daily teriparatide adherence and persistence in our study are consistent with those from similar studies conducted in other countries . usingyu et al . reported mean mprs for once - daily teriparatide at 12 months of 0.66 and 0.81 and persistence rates of 56.7 % and 69.0 % . the most likely explanation for the higher mpr and rate of persistence in the yu et al . study is that patients were excluded from the study if they had only one prescription for once - daily teriparatide . study , where all patients with at least one prescription for once - daily teriparatide were included . the use of prescription data to estimate adherence does not allow for confirmation of medication administration and , therefore , may overestimate adherence . despite this , several nonprescription database studies carried out in canada and europe have reported higher estimates for adherence and persistence with once - daily teriparatide than in our study . however , these studies involved patients with severe disease and / or patient - reported assessments of adherence and persistence , which may have contributed to the higher estimates compared with our own . the estimates of adherence and persistence with once - daily teriparatide in our study compare favourably with those for other osteoporosis medications . of note , our estimates of adherence and persistence are not greatly different to those from a prescription database study of once - daily alendronate ( 12 - month mpr : 0.576 ; persistence : 31.7 % ) , a claims database study of osteoporosis medications ( medication days 80 % of possible : 70 % of patients at 12 months ; persistence : 53 % ) , and a meta - analysis of observational studies examining real - world adherence with osteoporosis medications ( mpr 0.8 at 712 months : 43 % ; persistence : 50 % ) . our estimates of adherence compare favourably with those from a clinical practice study of japanese women with osteoporosis , in which approximately 45 % of patients were adherent with bisphosphonates at 12 months . overall , the available evidence suggests that treatment with once - daily teriparatide is not associated with decreases in adherence and persistence relative to other osteoporosis medications . this is an important point because teriparatide is administered as a once - daily , self - administered subcutaneous injection , which is unlike most other osteoporosis medications that are taken orally and may require less frequent dosing . however , these results are limited by the small number of patients and because we did not have information on a number of other factors that may have affected adherence and persistence , such as disease severity , fracture history , or adverse events . as adherence and persistenceare critical for osteoporosis treatments to be effective , identifying reliable predictors of adherence and persistence with once - daily teriparatide in japan may help provide information on how to optimise treatment strategies . hence , more robust analyses on factors affecting adherence and persistence with once - daily teriparatide in japan are warranted as additional data become available . subgroup analysis of the data in our study suggests that later initiators of treatment had higher rates of adherence and persistence than early initiators of treatment . one potential explanation for this finding is the support program for patients taking once - daily teriparatide . indeed , the importance of patient support / education for persistence with teriparatide has been demonstrated in studies carried out in europe . in japan , the support program for patients taking once - daily teriparatide aims to educate and train patients on the use of once - daily teriparatide to improve adherence and persistence . although we did not assess the effectiveness of the support program in this study , we suggest that the teriparatide support program may have been less well established in the earlier part of the study , which commenced shortly after once - daily teriparatide became available . therefore , patients who were early initiators of treatment may have received less comprehensive education / training than patients who were later initiators of treatment . interestingly , we found that the decrease in persistence was most pronounced shortly after starting treatment . this finding further emphasises the importance of early and effective patient education to help maximise adherence and persistence . therefore , another potential explanation for the different rates of adherence and persistence between early and later initiators of treatment is differing physician attitudes and knowledge about once - daily teriparatide . for example , physicians treating patients who were early initiators of treatment may have been less knowledgeable about teriparatide than physicians treating patients who were later initiators of treatment . the strengths of our study are that the data were obtained from clinical practice settings within a short time after once - daily teriparatide became available in japan . indeed , our study highlights the benefits of using prescription databases to rapidly obtain and analyse data on drug use in clinical settings . however , the small number of patients in our study and the lack of available information on additional patient variables ( e.g. , disease diagnosis and severity , comorbidities , fracture history , fractures during treatment , adverse events , hospitalisation , functioning , treatment costs , and reasons for changing medication / treatment discontinuation ) limited our capacity to produce definitive statistical conclusions regarding the association between these variables and the rates of adherence and persistence in this patient population . similar prescription database studies carried out in the united states have examined some of these associations . reported that bmd screening , use of antiresorptive therapies within 12 months of starting teriparatide , and lower treatment costs were associated with better persistence with teriparatide . yu et al . reported that risk of fracture was lower in patients with high adherence ( mpr 0.80 ) and that persistence with teriparatide for 19 to 24 months was associated with a lower risk of vertebral and nonvertebral fractures compared with persistence for 1 to 6 months . an additional limitation of our study is that , because once - daily teriparatide has only recently become available in japan , the length of follow - up was relatively short given that the treatment regimen is 24 months . hence , a study with a greater length of follow - up and a larger number of patients is warranted . in conclusion , our findings suggest that adherence and persistence with once - daily teriparatide in japan , as determined using prescription data for patients who started treatment during the first eight months of availability , are similar to adherence and persistence with once - daily teriparatide in other countries . despite requiring once - daily injection , adherence and persistence with teriparatide appear to be similar to adherence and persistence with other osteoporosis medications , including oral medications with less frequent dosing .\noutput:\n" }, { "from": "agent", "value": "adherence and persistence with osteoporosis treatments are essential for reducing fracture risk . once - daily teriparatide is available in japan for treating osteoporosis in patients with a high risk of fracture . the study objective was to describe real - world adherence and persistence with once - daily teriparatide 20 g during the first year of treatment for patients who started treatment during the first eight months of availability in japan . this prescription database study involved patients with an index date ( first claim ) between october 2010 and may 2011 , a preindex period 6 months , and a postindex period 12 months and who were aged > 45 years . adherence ( medication possession ratio ( mpr ) ) and persistence ( time from the start of treatment to discontinuation ; a 60 - day gap in supply ) were calculated . a total of 287 patients started treatment during the specified time period ; 123 ( 42.9 % ) were eligible for inclusion . overall mean ( standard deviation ) adherence was 0.702 ( 0.366 ) , with 61.0 % of patients having high adherence ( mpr > 0.8 ) . the percentage of patients remaining on treatment was 65.9 % at 180 days and 61.0 % at 365 days . our findings suggest that real - world adherence and persistence with once - daily teriparatide in japan are similar to that with once - daily teriparatide in other countries and with other osteoporosis medications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in recent years , a significant increase in the incidence of pulmonary tuberculosis ( ptb ) in prisons is reported both in the major industrialized countries and the developing countries ( 1 - 6 ) . epidemic of human immunodeficiency virus ( hiv ) infection among intravenous drug users ( idu ) in the prison is a major cause of this increase ( 7 - 11 ) . another important event in the recent years regarding ptb and prison is mdr - tb epidemic and increasing mortality from tuberculosis ( 12 - 16 ) . increase of tuberculosis in prisons in the other countries , including the developing countries , is also a notable event in the epidemiology of tuberculosis ( 3 , 5 , 17 ) . cohort studies showed a significant association between length of stay in prison and the risk of pulmonary tuberculosis ( 8 ) . in the developed countries , the important role of prisons in the tb epidemic is proven in many studies ( 2 , 4 , 6 , 18 ) . dna studies on mycobacterium tuberculosis isolated from ptb patients showed that over 40 % of pulmonary tuberculosis cases were transmitted by person to person rout and not via reactivation of latent tb ( 19 ) . more than two third of ptb new cases are associated with hiv co - infection ( 19 ) . in addition to hiv infection , another reason for the increase in ptb among prisoners is that prisons are overcrowded . these facts suggest that the incidence of tb infection in prisons plays an important role in ptb epidemic in the society ( 1 , 17 , 19 ) . in our countrythe number of prisoners per year is low , compared to some neighboring countries and even the united states and some european countries , but in recent years the number of drug - related detainees has increased [ judicial official reports , maava newsletter ] . although the exact number of prisoners per year in the province is unclear , in regard to prison entrance rate of 280 per 100 ' 000 population declared by the local law speaker [ maava , 2014 ] , it is estimated that between 12000 and 13000 peoples are imprisoned annually in the province . mycobacterium tuberculosis is spread through the unfavorable prison conditions such as the overcrowded population , improper ventilation , poor nutrition , inadequate health care , etc . prisons , as an important infection reservoir , pump the ptb into the community by the staff , visitors and improperly treated prisoners ( 17 ) . the prevalence of ptb in the patients with a history of imprisonment is not known in the region . regarding to the fact that a significant portion of those detained in the province are associated with injection drug use , and a majority of hiv cases in the region are injecting drug users , this study was carried out . the current study aimed to assess the prevalence and the risk factors of pulmonary tuberculosis in patients with a history of imprisonment . as part of a large retrospective study , medical files of patients with tuberculosis in the khuzestan health center ( khc ) , from 2005 to 2010 were reviewed . the tuberculosis cases were studied in khuzestan province ( excluding dezful and shush ) in the southwest of iran with a population of about 3.8 million people . patients with pulmonary tuberculosis were placed in two groups as : inmate prison ( ip ) group ( with a history of imprisonment ) and non - inmate prison ( nip ) group ( patients without a history of imprisonment ) data extracted from the patients ' records included demographic characteristics , clinical symptoms , microbiological findings and the control measures such as response to treatment , treatment failure , and mortality in both groups were compared . medical files of 363 tb patients in ip group and 4199 tb patients in nip group in khuzestan health center were reviewed . to compare data related to ptb , records of 291 patients in the ip group and 2640 patients in the nip group were analyzed . inclusion criteria were new documented ptb , and diagnosed based on national tuberculosis program ( ntp ) . exclusion criteria were old tb , treatment failure or relapsed tb and the patients under treatment of anti tb drugs . smear positive pulmonary tuberculosis ( sppt ) : cases with at least two sputum smear positive for acid fast bacillus ( ssp - afb ) , or a chest radiography suggestive of tuberculosis plus one ssp - afb , or sputum culture positive for m. tuberculosis and one ssp - afb were defined as smear positive pulmonary tuberculosis ( ptb + ) . one to nine afb per 100 microscopic fields ( x100 ) were considered positive , 10 to 99 afb per 100 microscopic fields ( 100x ) were defined as 1 + , 1 - 10 afb per 1 microscopic fields ( 100x ) as 2 + , and more than 10 afb per microscopic field ( 100x ) as 3 + . smear negative pulmonary tuberculosis ( snpt ) : cases with clinical findings suggestive of tb plus three sputum smear negative afb ( ssn - afb ) after two weeks of antibiotic therapy plus c - x - ray ( suggestive tb ) were defined as smear negative pulmonary tuberculosis ( ptb - ) . hiv infection was diagnosed on the basis of 2enzyme - linkedimmunosorbentassays ( elisa ) test and the confirmatory western blotting test . patients were considered as diabetic if they had baseline diagnosis of diabetes mellitus ( dm ) , self - reporting who were taking oral anti - dm drugs ( hypoglycemic ) , or fbs equal or more than 126 mg / dl or 200 mg / dl or more for random samples . spss software system , version 16 was used to derive descriptive statistics and the subsequent multivariable analyses . chi - square and fisher exact test were used to compare data in both groups . as part of a large retrospective study , medical files of patients with tuberculosis in the khuzestan health center ( khc ) , from 2005 to 2010 were reviewed . the tuberculosis cases were studied in khuzestan province ( excluding dezful and shush ) in the southwest of iran with a population of about 3.8 million people . patients with pulmonary tuberculosis were placed in two groups as : inmate prison ( ip ) group ( with a history of imprisonment ) and non - inmate prison ( nip ) group ( patients without a history of imprisonment ) data extracted from the patients ' records included demographic characteristics , clinical symptoms , microbiological findings and the control measures such as response to treatment , treatment failure , and mortality in both groups were compared . medical files of 363 tb patients in ip group and 4199 tb patients in nip group in khuzestan health center were reviewed . to compare data related to ptb , records of 291 patients in the ip group and 2640 patients in the nip group were analyzed . inclusion criteria were new documented ptb , and diagnosed based on national tuberculosis program ( ntp ) . exclusion criteria were old tb , treatment failure or relapsed tb and the patients under treatment of anti tb drugs . smear positive pulmonary tuberculosis ( sppt ) : cases with at least two sputum smear positive for acid fast bacillus ( ssp - afb ) , or a chest radiography suggestive of tuberculosis plus one ssp - afb , or sputum culture positive for m. tuberculosis and one ssp - afb were defined as smear positive pulmonary tuberculosis ( ptb + ) . one to nine afb per 100 microscopic fields ( x100 ) were considered positive , 10 to 99 afb per 100 microscopic fields ( 100x ) were defined as 1 + , 1 - 10 afb per 1 microscopic fields ( 100x ) as 2 + , and more than 10 afb per microscopic field ( 100x ) as 3 + . smear negative pulmonary tuberculosis ( snpt ) : cases with clinical findings suggestive of tb plus three sputum smear negative afb ( ssn - afb ) after two weeks of antibiotic therapy plus c - x - ray ( suggestive tb ) were defined as smear negative pulmonary tuberculosis ( ptb - ) . hiv infection was diagnosed on the basis of 2enzyme - linkedimmunosorbentassays ( elisa ) test and the confirmatory western blotting test . patients were considered as diabetic if they had baseline diagnosis of diabetes mellitus ( dm ) , self - reporting who were taking oral anti - dm drugs ( hypoglycemic ) , or fbs equal or more than 126 mg / dl or 200 mg / dl or more for random samples . spss software system , version 16 was used to derive descriptive statistics and the subsequent multivariable analyses . chi - square and fisher exact test were used to compare data in both groups . during the study period , from 2005 to 2010 , local tb units reported 4562 patients with tuberculosis to national tb surveillance system in khuzestan health center that 363 ( 7.9 % ) of them were prison inmates at the time of tb diagnosis ( table 1 ) . the average number of persons with tb in each year was 61 cases and the annual tb case rate among the prison inmates was 403.3 per 100000 . the annual tb case rate in the general population during this period was 16.4 per 100 ' 000 ; the figures indicated that the risk of tb in prisons was about 24 times more than the general population . from 2005 to 2010 the percentage of inmate tb cases decreased from 12.3 % of total tb cases to 5.3 % showing the decline rate of 56.9 % , while trend of tuberculosis in the general population through this period of time remained relatively constant ( table 1 ) . the rate of tb cases in the general population from 19.6 per 100 ' 000 in 2005 reached 19.2 per 100 ' 000 in 2010 , while inmate tb case rate from 760 per 100000 in 2005 , significantly decreased to 328 per 100000 in 2010 ( table 2 ) . during these years , new cases of pulmonary tb ( ptb ) among inmate prison decreased from 656 per 100000 in 2005 to 240 per 100 ' 000 in 2010 , a decline rate of 63.4 % whereas new ptb case rate in the general population was relatively unchanged , from 12.8 per 100 ' 000 in 2005 to 11.1 per 100000 in 2010 , a decline rate of 13.2 % ( table 2 ) . mean age of tb case among the inmates was 31.1 years and within the general population was 34.6 years . all patients with tuberculosis in the prisons were male while 80 % of tb cases in the general population were male and 20 % female . thirty nine subjects had a body weight of less than 45 kg , two patients in the ip group and 37 in the nip group . detection rate of smear positive pulmonary tuberculosis in prisons in 2005 was ( 58/82 ) 70 % , which reached ( 26/30 ) 86.6 % in 2010 , indicating the improved microscopic diagnosis and accuracy in the diagnosis of tuberculosis in the inmates ` prison of the region ( table 1 ) . among tb risk factors such as intravenous drug abuse ( idu ) , previous history of tb , chronic renal failure , immunosuppressed drug consumption , history of previous contact with tb patients , hiv infection status , diabetes mellitus , and malnutrition in prisoners with tb ; close contact in prison especially in the recent two years , idu , and hiv infection were more frequent among the prisoners than in the general population with tb ( tables 3 , 4 ) . of the total tb patients who were in prison only 70 ( 19.6 % ) were tested for hiv and nine were hiv positive . pulmonary tb among inmates was more prevalent than in non - inmates ( 372.8 per 100 ' 000 , vs. 12.03 per 100 ' 000 ) . positive sputum results of afb for prisoner tb cases were higher than those of the non - prisoners ( 79.2 vs. 76.5 % ) . extra - pulmonary tb among prisoners compared with non - prisoners was less frequent ( 1 % vs . . abbreviation : tb , tuberculosis ; ptb , pulmonary tuberculosis ; ip , inmate prisoner ; sm + , smear positive ; gp , general population . abbreviation : tb , tuberculosis ; ptb , pulmonary tuberculosis ; gp , general population ; ip , inmate prisoner ; no , number ; p , prevalence per 100000 population . total general population is calculated for people under coverage of ahvaz jundishapur university of medical sciences ( except for dezful university of medical sciences ) . abbreviation : tb , tuberculosis ; n , number ; hiv , human immunodeficiency virus ; idu , injecting drug use . close contact , household contact or at least six hours contact a day with a smear positive tb case . abbreviation : tb , tuberculosis ; n , number ; hiv , human immunodeficiency virus ; idu , injecting drug use ; ip , inmate patients ; nip , non - inmate patients ; ci , confidence interval . close contact , household contact or at least 6 hours contact a day with a smear positive tb case . epidemiology of tuberculosis in the province is affected by tuberculosis control in high - risk individuals , such as prisoners . improvement in the indicators of the national tuberculosis programs plays an important role in reducing tb cases in the province . the prevalence of tb in prisons is always more ( up to 50 times ) than the general population ( 1 , 19 ) . although , the trend of tuberculosis in the province from 2005 to 2010 was unchanged in the total tb cases , the risk of infection in prisons was downward . the incidence of tuberculosis in prisons decreased from 633.3 per 100 ' 000 in 2005 to 273.3 per 100 ' 000 in 2010 with a decline rate of 56.7 % . indeed , if the control of tuberculosis did not occur in prisons , increase of tb in the general population could be more pronounced . this finding was the same as the epidemiology of tb in prisons of industrialized countries where tb in prisons was reduced by tb control measures such as case finding by chest x - ray and sputum examination along with the improved nutrition and environment ( 1 - 5 , 9 , 13 ) . in the present study , tb prevalence rate of the inmate prison was approximately 24 times higher than that of the general population in khuzestan province at the time of study ( 403.3 per 100 ' 000 vs. 16.4 per 100 ' 000 ) . these individuals after their release from prison spread tb in the community . despite differences of methodology , study design , size of population , time of study and duration of the current study in comparison with the previous studies , the current study finding was similar to the results of several investigations in the other parts of the world ( 1 - 6 ) . prisoners , compared with the general population , are at higher risk for tb infection because of over crowdedness of the cells ( the large number of people living in cells with insufficient ventilation ) , poor nutrition , inadequate sanitation and health care services , and having little time outdoors ( 17 , 18 , 20 ) . also , inmate prison due to poor living conditions and their lifestyle , such as socioeconomic status , low education level , drug addiction , and hiv infection has a great chance to progress from infection to tb disease ( 17 - 20 ) . the current study found that close contact with active smear positive pulmonary tb in regional prisons is a major risk factor for tb . the risk of pulmonary tb among the subjects with relatively long duration of time in prison was 20 times more than the ones out of prison . these findings were consistent with most of the previous studies ( 17 , 21 , 22 ) . in the current study the average length of stay in prison for tuberculosis was 12 weeks whereas in most studies ; it has been for more than a year ( 8 , 19 ) . ? did screening with chest radiography and rapid detection of tb in early phase , reduce the time ? answering these questions is not consistent with the current study design and requires future prospective studies . the issue of tb patients with hiv co - infection is known . in the current study , hiv co - infection among tb patients was higher in prisoners compared to the general population ( 2.4 % vs. 1.3 % ) . hiv prevalence among tb patients in the current study ( 2.4 % ) was less than the prevalence of hiv infection in tb patients in tanzania and spanish prisons , 17.9 % and 26 % , respectively ( 7 , 8 , 15 ) . the reasons for the difference are : the prevalence of hiv varies in different societies ; risky behaviors such as unprotected sex and injecting drug vary among prisoners in different countries . immunodeficiency due to hiv infection is an important factor for the spread of tb in prisons . since the outbreak of the hiv infection among detained ivd users in the study region was so much greater than that of the general population , the incidence of tb in prisoners was higher compared with the general population . although hiv infection is a risk factor for tb infection , hiv status is known in less than 20 % of the prisoners , which means hiv screening is not done in prisons of the province . this situation occurs in most countries of the world ; for example , in a study by shafer et al . hiv status of about one third of the prisoners with tb were unknown ( 23 ) . most studies showed that both tb infection and progressing to active tb disease in hiv infected people occur more rapidly . therefore , screening for hiv infection at the time of admission in prison and rapid identification of tb infection and prevention of the disease play an important role in tuberculosis control ( 19 , 24 , 25 ) . negligence in the early diagnosis and delay in rapid treatment of tb patients in prisons is associated with a sad experience in the world . prisoners with tb in the current study had similar nutritional status with the tb cases in the population outside the prison , when the body weight of less than 45 kg in an adult subject was considered as malnutrition . the study found no clue for malnutrition as a risk factor for pulmonary tb in the regional prisons . the current study finding was not similar to those of the previous studies ( 19 , 21 ) . the current study result should be considered with caution because the authors ` definition of malnutrition was based on low body weigh not on body mass index ( bmi ) . . showed that intravenous drug use due to decreased cellular immunity acts as an independent variable to tuberculosis infection and disease progress ( 26 ) . in the current study study , the current study likewise the other studies showed that idu either alone or in combination with hiv infection were important risk factors for pulmonary tuberculosis among prisoners ( 2 , 11 , 15 , 18 , 19 , 22 , 27 ) . alavi et al . in another research in khuzestan concluded that idu subjects were significantly at the risk of both tb and hiv infection ( 28 ) . in conclusion , in the region under study , the prevalence of tb among prisoners was higher than that of the general population . the main risk factors for pulmonary tb in this population were close contact , idu , and hiv infection . this study had limitations such as retrospective design , and limited access to medical files of the reported tb cases . since all the tb cases in the prisons of the region were diagnosed , treated , followed up and supervised by khc , therefore , limited access to khc medical files could not result in significant bias .\noutput:\n" }, { "from": "agent", "value": "background : high prevalence of tuberculosis ( tb ) among prisoners is reported as an alarming public health problem in the world , especially in the developing countries.objectives : since there is almost no information from tb in this population in khuzestan province , the current study aimed to assess the prevalence and identify risk factors of tb among the prisoners of this region.patients and methods : in a retrospective study , medical files of patients with tuberculosis in khuzestan health center ( khc ) , from 2005 to 2010 , were studied . patients with pulmonary tb were placed in two groups as the inmate prison ( ip ) and non - inmate prison ( nip ) groups . data extracted from the patients ' records in the two groups were compared by spss software system using chi square and fisher exact tests . p - value was considered less than 0.05 . results : from the reported 4562 patients with tuberculosis , 363 ( 7.9 % ) were prison inmates at the time of tb diagnosis . prevalence of tb cases among the prison inmates was 403.3 per 100 ' 000 . the annual tb case rate in the general population during this period was 16.4 per 100,000 . among the tb risk factors close contact [ odds ratio ( or ) , 95 % confidence interval ( ci ) , 19.4 , 8.9 - 41.8 , p < 001 ] especially in the recent 2 years , injection drug use ( idu ) [ or , 95 % ci , 4.61 , 1.7 - 12.4 , p = 006 ] , and human immunodeficiency virus ( hiv ) infection [ or , 95 % ci , 2.4 , 1.1 - 5.0 , p = 025 ] were more frequent in the prisoners than in the general population with tb.conclusions : in the region under study the prevalence of tb among the prisoners was higher than the general population . the main risk factors for pulmonary tb in this population were close contact , idu and hiv infection ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a number of these proteins have direct action on vessels walls , platelet function , fibrinogen , and other factors of the hemostatic system . while neurotoxicity is the most pronounced effect of envenomation by snakes from the elapidae family , envenomation by snakes from the viperidae family is usually characterized by local and , in severe cases , systemic effects . these snake venoms are rich sources of metalloproteinases ( mps ) which , along with the transmembrane adams ( desintegrin - like and metalloproteinase - containing proteins ) , are members of the reprolysins subfamily m12 - family of metalloproteinases . ( snake venom metalloproteinases ) svmps have been classified into three basic structural classes , p - i to p - iii . these metalloproteinases are synthesized in the venom gland as large multidomain proteins , including a proenzyme domain and a highly conserved zinc - proteinase domain ( hebxhxbgbxh ) . the p - i ( pia ) metalloproteinase class includes proteins with molecular masses between 2030 kda that have low or no hemorrhagic effect , but strong direct - acting fibrino ( geno ) lytic activity , and contain only a metalloproteinase domain . class p - ii ( p - iia , p - iib , p - iic , p - iid , and p - iie ) comprises proteins with molecular masses of 3060 kda that contain metalloproteinase and disintegrin - like domains . class p - iii ( p - iiia , p - iiib , p - iiic , and p - iiid ) includes a cysteine - rich domain , a melloproteinase domain , and a disintegrin - like and a lectin - like domain . many proteinases have been purified and characterized from venoms of different bothrops species such as : bothrops jararaca , bothrops moojeni , bothrops neuwiedi , bothrops leucurus , bothrops jararacussu , bothrops asper , bothrops cotiara . this paper reports the isolation and partial characterization of a fibrinogenolytic metalloproteinase , bmoo fibmp - i , from b. moojeni snake venom . desiccated b. moojeni venom was purchased from bioagents serpentarium ( batatais - sp , brazil ) . acrylamide , ammonium persulfate , aprotinin , benzamidine , bromophenol blue , ethylenediaminetetracetic acid ( edta ) , bovine fibrinogen , - mercaptoethanol , n , n - methylene - bis - acrylamide , sodium dodecyl sulphate ( sds ) n , n , n , n - tetramethylethylenediame ( temed ) , glycine , tris , molecular weight markers for electrophoresis , and all chromatographic media were purchased from sigma chemical co. ( st . the chromatographic steps were based on a previously published protocol with minor modifications . the crude venom of b. moojeni ( 250 mg ) was dissolved in 0.05 m ammonium bicarbonate buffer ( ph 7.8 ) and clarified by centrifugation at 10,000 g for 10 min at room temperature . the clear supernatant solution was applied to a deae sephacel column ( 212 cm ) , previously equilibrated with 0.05 m ammonium bicarbonate buffer ph 7.8 and eluted with a concentration gradient ( 0.05 m0 .3 m ) of the same buffer . fractions of 3.0 ml / tube were collected and their absorbances were read at 280 nm . the fourth fraction , named d4 , was pooled , lyophilized , dissolved in 0.05 m ph 7.8 ammonium bicarbonate , and applied to a sephadex g - 75 column ( 1120 cm ) previously equilibrated with the same buffer . the fibrinogenolytic fraction ( d4g2 ) was lyophilized and applied to a column of heparin agarose ( 210 cm ) previously equilibrated with 0.01 m ph 7.5 tris - hcl buffer , containing 0.05 m cacl2 and eluted with 0.01 m ph 7 tris - hcl buffer containing 1 m nacl . the flow rate was 40 ml / h and fractions of 2.0 ml were collected . the fraction showing fibrinogenolytic and azocaseinolytic activities , obtained in the previous step , was submitted to reverse phase system on a source 15rpc column ( 0.46 cm 25 cm ) , kta explorer , amersham - pharmacia ( uppsala , sweden ) , equilibrated with the eluent a ( 0.1 % tfa in water milli - q ) , eluted by linear gradient ( from 0 to 60 % in 50 min , and from 60 to 100 % in 7.5 min ) of eluent b ( acetonitrile , 0.1 % tfa ) at a flow rate of 2 ml / min , and monitored by absorbance at 280 nm . the protein concentration of the venom samples and fractions was determined by the method of microbiuret , as described by itzhaki and gill , using bovine serum albumin as standard . polyacrylamide gel electrophoresis was performed in the presence of sodium dodecyl sulfate ( sds - page ) and carried out according to a previously described method using 14 % gels . samples were pretreated under reducing conditions ( sds plus - mercaptoethanol ) at 100c for 5 min . gels were stained with 0.1 % coomassie brilliant blue r - 250 in ethanol : acetic acid ( 5 : 1 , v / v ) for 15 min and distained in 10 % acetic acid : water ( v / v ) . the molecular mass was estimated by interpolation from a linear logarithmic plot of relative molecular mass versus distance of migration . standard molecular weight markers ( sigma ) were b phosphorylase ( 97 kda ) , bovine serum albumin ( 66 kda ) , egg albumin ( 45 kda ) , carbonic anhydrase ( 30 kda ) , soybean trypsin inhibitor ( 20.1 kda ) , and lactoalbumin ( 14.4 kda ) . the protein ( 0.3 mg ) was reduced and s - alkylated as previously described . the sample containing the protein was dissolved in 1 ml of 0.6 m tris - hcl buffer containing 6 m guanidine , ph 8.6 , and 30 l of - mercaptoethanol ( pure liquid 14.3 m ) , under nitrogen atmosphere , and incubated at 50c for 5 h. then , 20 l of 4 - vinylpiridine ( 95 % ) were added and the samples were incubated at 37c during 1.5 h. the protein was recovered by desalting on a vydac c4 column ( 0.46 cm 25 cm ) using a gradient of 0 to 100 % acetonitrile in 0.1 % tfa at a flow rate of 2 ml / min . the proteins were detected by their absorbance at 216 nm . for digestion , the reduced / s - alkylated protein ( 0.2 mg ) was dissolved in 100 l of 8 m urea and diluted to 900 l with 0.1 m nh4hco3 , ph 8.1 , then digested with trypsin ( 5 % w / w , enzyme / protein , for 4 h at 37c ) . the obtained peptides were purified by reverse phase hplc on a vydac c4 column using extended ( ~ 4 h ) linear gradient of 070 % acetonitrile in 0.1 % tfa . the peptides purified were then sequenced using ms / ms in maldi - tof / tof ms autoflex iii ( bruker daltonics , germany ) . the primary sequences of the obtained peptides were compared to sequences of other related proteins in the swiss - prot / trembl data base using fasta 3 and blast programs . five micrograms of the enzyme were added to 50 l of bovine fibrinogen ( 1.5 mg / ml ) , buffered at different phs ( 0.02 m sodium acetate buffer , ph 3 , 4 , and 5 ; 0.02 m sodium phosphate buffer , ph 6 ; 0.02 m tris - hcl buffer , ph 7 , 8 , and 9.0 ; sodium borate buffer , ph 10 and 11 ) at 37c for 60 min . the reaction was stopped by addition of 25 l of 0.05 m tris hcl buffer , ph 8.8 , containing 10 % ( v / v ) glycerol , 10 % ( v / v ) - mercaptoethanol , 2 % ( w / v ) sds , and 0.05 % ( w / v ) bromophenol blue . the reaction products were then analyzed by 14 % ( w / v ) sds - page . to determine the effect of temperature on the fibrinogenolytic activity , 5 g of enzyme ( 0.02 m tris - hcl buffer ph 9.0 ) were incubated at different temperatures ( 40 , 50 , 60 , 70 , and 80c ) for 15 min before chilling in ice bath for 5 min . then , the fibrinogenolytic activity was determined as described above . the effect of inhibitors on the fibrinogenolytic activity was assayed after preincubation of the enzyme ( 5 g ) dissolved in 0.25 ml of 0.05 m tris - hcl buffer , ph 8.0 , with 10 mm edta ( metalloproteinase inhibitor ) or 0.01 m aprotinin ( serinoproteinase inhibitor ) for 30 min at room temperature . the possible haemorrhagic , coagulant , and defibrinating activities of bmoo fibmp - i were investigated . briefly , different doses of the purified enzyme ( 110 g ) , in 100 l of 0.9 % nacl were intradermally injected into the dorsal skin of male swiss mice ( 1822 g ) . skins were removed and the areas of hemorrhage on their inner surfaces were scanned above a sheet of white paper . the area of each halo was cut out and its mass was measured in a precision scale . the hemorrhage was calculated through a previously determined correlation of the area of the white paper with its respective mass ( 7.5 mg / cm ) . the minimum hemorrhagic dose ( mhd ) is defined as the dose of protein wich results in an hemorrhagic lesion of 1.0 cm after 24 h. the coagulant activity of the enzyme was assayed as described by thekston and reid . the minimum coagulant dose ( mcd ) is defined as the minimum amount of enzyme that clots bovine plasma ( mcd - p ) and / or a solution of bovine fibrinogen ( 2.0 mg / ml ; mcd - f ) in 60 seconds at 37c . the defibrinating activity was tested by the method of gen et al . , with minor modifications . the activity was assessed by intraperitoneal injection of different doses of the enzyme ( 20100 g ) , in 100 l of saline solution ( 0.9 % nacl ) , into male swiss mice ( 1822 g ) , using four mice per group at each protein dose ; control animals received 200 l of saline solution . whole blood was placed in tubes and kept at 2530c until clotting occurred . the minimum defibrinating dose ( mdd ) was defined as the amount of venom able to prevent coagulation . the proteolytic activity was quantified by the method of leonardi et al . several concentrations ( 20 , 40 , 60 and 80 g ) of bmoo fibmp - i were added to 500 l of an azocasein solution ( 1 mg / ml in 0.2 m tris - hcl buffer , ph 8.8 , containing 0.004 m cacl2 ) , at 37c for 60 min . the reaction was interrupted by the addition of 5 % trichloroacetic acid ( tca ) and then centrifuged ( 14,000 g , 10 min ) . the influence of ph on proteolytic activity was also tested by preincubation of the enzyme fraction in various buffers at different ph ( 0.02 m sodium acetate buffer , ph 3 , 4 , and 5 ; 0.02 m sodium phosphate buffer , ph 6 , 0 ; 0.02 m tris - hcl buffer , ph 7 , 8 , and 9.0 ; sodium borate buffer , ph 10 and 11 ) at 37c for 60 min . the steady - state parameters km and vmax were determined from initial rate measurements at various azocasein concentrations in 0.2 m tris - hcl buffer , ph 8.8 , containing 0.004 m cacl2 at 25c . reactions were initiated by the addition of appropriate limiting amounts of enzymes and the formation of cleavage products was monitored at 366 nm . this conversion factor was obtained by multiplying the number of hours ( 6 hours ) by the molar mass of the protein ( 2.63 nmol ) and the number of activity units of the enzyme ( every enhancement of 0.1 in the absorbance equals to 1 activity unit ) . the michaelis constant km and vmax were determined by analysis of michaelis menten constant plot of the normalized velocity as a function of substrate concentration . esi - q - tof mass spectrometry analyses were carried out using a q - tof micro ( micromass , uk ) equipped with an electrospray ionization source operated in the positive mode . the capillary voltage was 2.53.0 kv and the sample cone voltages were 3040 v. mass spectrometer calibrations were made by using sodium iodide in 100 to 2000 m / z . samples diluted in 50 % acetonitrile / 0.1 % tfa were introduced by using a syringe pump with a flow rate of 10 l / min . original data ( m / z ) were treated ( base line subtraction , smoothing , and centering ) and transformed into a mass ( da ) spectrum . other analyses , ms and tandem ms , analysis were performed using a maldi - tof - tof autoflex iii ( bruker daltonics ) instrument in positive / reflector mode controlled by the flex - control software . instrument calibration was achieved by using peptide calibration standard ii ( bruker daltonics ) as reference and - cyano -4-hydroxycinnamic acid as matrix . samples were spotted to mtp anchorchip 400/384 ( bruker daltonics ) targets using standard protocols for the dried droplet method . ms data analyses were performed by using the flex - analysis software ( bruker daltonics ) . peptide de novo sequencing was performed using a combination of manual and automatic data interpretation using the softwares flexanalysis and biotools ( bruker daltonics ) . alternatively , ms / ms data were exported as * . txt files and then converted to the * . dta extension . then such files were imported into * . psq files which are recognizable by the pepseq ( micromass , uk ) software which was also used for manual de novo sequencing . similarity searches were performed with the obtained sequences using the fasta3 tool against the swiss - prot data bank , as previously described . the high proteolytic activity of bothrops snake venoms is primarily responsible for most of the local and systemic effects observed during envenomation by these snakes . this activity is caused by a variety of enzymes , for example , metalloproteinases , which are enzymes that possess a metal ion at the active site and are responsible for the bleeding that results from bothrops bites . thus , in this study , the interest was focused on this group of molecules . the purification of the fibrinogenolytic enzyme bmoo fibmp - i from b. moojeni venom consisted of a three - step procedure including ion - exchange on deae sephacel , gel filtration on sephadex g - 75 , and affinity chromatography on heparine - agarose . five protein fractions displaying a280 ( d1 , d2 , d3 , d4 , and d5 ) were obtained when the crude venom was applied onto the deae sephacel column ( 2.0 cm 12.0 cm ) , as shown in figure 1 ( a ) . the ph used in this chromatographic step was 7.8 , which is considered to be the optimum ph for the activity of most proteolytic enzymes already isolated from snake venoms . the fibrinogenolytic activity was found in all the uv - absorbing fractions , but the highest activity was found in d4 fraction . this fraction was pooled , lyophilized , and used in the second step of purification on sephadex g - 75 column ( 1.0 cm 120.0 cm ) , equilibrated with 0.05 m ammonium bicarbonate buffer , ph 7.8 . in this step , d4 fraction was resolved in five fractions named d4g1 , d4g2 , d4g3 , d4g4 , and d4g5 ( figure 1 ( b ) ) . the d4g2 fraction , which displayed fibrinolytic and azoproteolytic activities , was further purified on heparine - agarose type i ( 2.0 cm 10 cm ) column , equilibrated with 0.02 m tris - hcl buffer containing 5.0 mm cacl2 , and eluted with the same buffer until the tenth tube and then with 0.02 m tris - hcl buffer containing 1.0 m nacl . its specific activity was 657 u / mg , and this fraction was called bmoo fibmp - i , as shown in table 1 . the protein yield , based on the absorbance at 280 nm , was 7.0 mg for d4g2h1 ( bmoo fibmp - i ) fraction . the enzyme represents 2.9 % of the total protein in the venom ( table 1 ) . the yield of bmoo fibmp - i was higher than those reported for other fibrinogenolytic enzymes purified from the same venom , for example , msp1 , msp2 , and moo3 that yielded 0.51 , 1.1 , and 1.42 % , respectively . i was apparently homogeneous and migrated as a single band of a molecular mass estimated as 27.6 kda by sds - page under reducing ( figure 2 , lane 3 ) and native ( data not shown ) conditions . for best characterization , bmoo fibmp - i was applied onto an hplc system using a reverse phase chromatography source column ( 0.46 cm 25 cm ) , equilibrated with solution a ( 0.1 % tfa in water ) , and eluted with a gradient of solutions a and b ( 0.1 % tfa in acetonitrile ) . two major fractions were obtained ( bmoo fibmp - i h1 and bmoo fibmp - i h2 ) ( figure 3 ) that did not show fibrinogenolytic or azocaseinolytic activities , as expected . we believe that the loss of activity was due to the presence of the organic solvent acetonitrile . both collected fractions were submitted to mass spectrometry analyses , showing molecular masses of 22.7 kda and 22.9 kda , respectively ( data not shown ) . both proteins are , most likely , isoforms with slight difference in their amino acid residues . the presence of protein isoforms is a common feature found in samples of proteases isolated from snake venoms . bmoo fibmp - i was resistant to cleavage by edman n - terminal sequencing , suggesting that its n - terminal residue could be blocked by the presence of piroglutamic residue , a common feature in proteases from snake venoms , as demonstrated for a fibrinogenolytic protease of bothrops leucurus venom described by bello et al . and confirmed by ferreira et al . . the partial amino acid sequence ( de novo sequencing ) of bmoo fibmp - i was manually established by analyzing the ms / ms data in maldi tof tof of peptides resulting from trypsin digestions ( table 2 ) . as shown in table 3 , the data indicate that one of the tryptic fragments whose sequence is yielvvvadhgmftk ( 1,721 da ) shares homology with metalloproteinases of different snake venoms as , for example , a mp from bothrops moojeni , bmoomp - i , a mp from agkistrodon halys pallas , and an hemorraghic factor from lachesis muta muta ( bushmaster ) . the classes of mp from snake venoms are differentiated by the size and the presence of structural domains in addition to the metalloproteinase domain . these classes are named pi to piii , with molecular masses ranging from 15 to 100 kda . pi class contains exclusively the metalloproteinase domain and possess molecular mass around 25 kda , with or without hemorrhagic effects . it is divided into two subclasses : p - 1a , formed by proteins as bthmp from b. moojeni venom , and p - 1b , for example , neuwidase from b. neuwiedi venom . bmoo fibmp - i showed high fibrinogenolytic and azoproteolytic activities , although its coagulant , anticoagulant , and haemorrhagic activities were absent . thus , we suggest that bmoo fibmp - i is a pi - b class of metalloproteinase by considering its molecular mass of 22.8 kda and the absence of hemorrhagic activity . the structure of fibrinogen is composed of three pairs of disulphide - linked chains termed a , b , and chains . it acts as an adhesive protein essential for platelet aggregation as well as forming an insoluble fibrin clot in the final stage of the blood coagulation cascade . the action of proteinases that may interfere with coagulation and the fibrino ( geno ) lytic system following envenomation by bothrops snake bites have been reported . metzincins , as described by stocker et al . and preferentially cleave the a chain of bovine fibrinogen with a slower cleavage of b chain . bmoo fibmp - i rapidly digested the a-chain of bovine fibrinogen within 5 min , followed by b - chain degradation , in 30 min , leaving the chain unaffected after 60 min of incubation ( figure 4 ( a ) ) . concomitant with the a and b chains partial digestion , degradation products were observed . thus , the sds - page analysis ( under reducing conditions ) of this proteolytic process demonstrated that bmoo fibmp - i is an - fibrinogenase . the optimal temperature ( data not shown ) and ph conditions for a-chain digestion was 37c and 6.010.0 , respectively ( figure 4 ( b ) ) . hydrolysis of the a and b chains was partially inhibited by edta , a standard metalloproteinase inhibitor , and not by aprotinin , a serinoproteinase inhibitor ( data not shown ) . this result confirmed that bmoo fibmp - i is a metalloproteinase , since it was inhibited by a chelating agent , such as edta . the lack of blood coagulation observed in many envenomation circumstancesis caused by the degradation of fibrinogen by fibrinogenolytic enzymes that cause defibrination in vivo . bmoo fibmp - i degraded fibrinogen in vitro , although it did not prevent coagulation in vivo . this can be explained by the presence of endogenous inhibitors , which are able to neutralize the proteolytic activity of snake venom proteases , such as 2 - macroglobulin . bmoo fibmp - i can be compared to a nonhaemorrhagic enzyme named neuwidase identified in the b. neuwiedi venom by rodrigues et al . and izidoro et al . . this enzyme is described as a metalloproteinase with preferential activity towards the a chain of bovine fibrinogen and significantly less activity towards the b chain . another fibrinogenolytic enzyme identified was brevilysin l6 , from agkistrodon halys brevicaudus snake venom , which has a molecular weight of 22,713 , with 203 amino acid residues . besides these fibrinogenases , an enzyme of 24 kda , designated lachesis stenophrys fibrinogenase was isolated from lachesis stenophrys snake venom and classified as class pi metalloproteinase which displays fibrinogenolytic activity , but lacks haemorrhagic activity . bmoo fibmp - i can also be compared to the enzyme fibrolase , a zinc - dependent metalloproteinase , formed by a single chain of 23 kda , with the n - terminal blocked by a pyroglutamate residue that is present in both isoforms . this enzyme has preferential proteolytic activity towards the chain of bovine fibrinogen ( cleavage site between lys - leu residues ) , a lower activity on the b chain and no activity on the chain . recent advances following prospective studies with snake venoms suggest a therapeutic application of fibrinogenolytic metalloproteinase in the treatment of occlusive thrombosis . several of these enzymes have been studied in vivo in animal models and promising results have emerged . bmoo fibmp - i showed proteolytic activity on azocasein and this activity was dependent on the ph and enzyme concentration , optimally occurring between ph 610.0 and being absent in acidic ph ( 3 , 4 , and 5 ) and alkaline ph ( 11.0 ) . considering our data and other tests of proteolysis using azocasein , one may conclude that the optimal ph for the proteolytic tests would be 8.8 . many proteases have the proteolytic activity on azocasein reduced , but not completely abolished , when incubated at ph 5.0 , and these proteases have higher activity in alkaline ph and are inactive at acidic ph values the data were plotted as a michaelis - menten type plot ( figure 5 ) , and the regression line ( r = 0.9931 ) lets us determine the vmax = 0.4596 u h nmol 0.1031 and km = 14.59 mg / ml 4.610 . in conclusion , we have purified a metalloproteinase , named bmoo fibmp - i , with azocaseinolytic and fibrinogenolytic activities , from b. moojeni venom . the properties of bmoo fibmp - i indicate that this protein belongs to class pi - b of svmps . these features suggest that this toxin could interfere with the coagulation cascade that follows envenoming . the cleavage specificity of bmoo fibmp - i for fibrinogen raises the possibility of using this enzyme in formulations for clinical use .\noutput:\n" }, { "from": "agent", "value": "a new fibrinogenolytic metalloproteinase ( bmoo fibmp - i ) was purified from bothrops moojeni snake venom . this enzyme was isolated through a combination of three chromatographic steps ( ion - exchange , molecular exclusion , and affinity chromatography ) . analyses by reverse phase chromatography , followed by mass spectrometry , showed the presence of enzyme isoforms with average molecular mass of 22.8 kda . the sds - page analyses showed a single chain of 27.6 kda , in the presence and absence of reducing agent . the protein has a blocked n - terminal . one of the peptides obtained by enzymatic digestion of a reduced and s - alkylated isoform was completely sequenced by mass spectrometry ( ms / ms ) . bmoo fibmp - i showed similarity with hemorrhagic factor and several metalloproteinases ( mp ) . this enzyme degraded a-chain faster than the b - chain and did not affect the - chain of bovine fibrinogen . the absence of proteolytic activity after treatment with edta , together with the observed molecular mass , led us to suggest that bmoo fibmp - i is a member of the p - i class of the snake venom mp family . bmoo fibmp - i showed ph - dependent proteolytic activity on azocasein , but was devoid of coagulant , defibrinating , or hemorrhagic activities . the kinetic parameters of proteolytic activity in azocasein were determined ( vmax = 0.4596 uh1nmol1 0.1031 and km = 14.59 mg / ml 4.610 ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it is established theoretically and confirmed experimentally that conical intersections play a vital role as mechanistic features of photochemical reactions providing very efficient funnels for an ultrafast nonadiabatic relaxation of the molecular excited states . the correct description of crossing points between the ground and excited state potential energy surfaces ( pess ) of molecules requires a balanced treatment of the dynamic and nondynamic correlation effects . the simplest computational method that can be used in the search for conical intersections is the state - averaged complete active space self - consistent field ( sa - casscf ) method , which , however , misses the major dynamic electron correlation contribution . the latter is introduced via the use of configurational interaction or many - body perturbation theory , thus leading to the well - known mrsdci and caspt2 methods , which require a considerably greater computational effort and are restricted in their application to small and medium size molecules . as regards the dynamic electron correlation , density functional theory ( dft ) represents a more economic alternative to the high - level ab initio wave function methods . however , an accurate treatment of the nondynamic electron correlation still remains problematic with the use of practically accessible approximate density functionals . the application of density functional methods to the search for conical intersections is an endeavor with quite a mixed success . although the excited states of molecules at the franckcondon points can be sufficiently accurately described by the use of the linear - response time - dependent dft ( lr - tddft or tddft , for brevity ) , its reliance on the single - reference description of the ground state renders the standard tddft inappropriate for the description of the excited state pess of molecules near the avoided crossing regions and at conical intersections . a success has been recently reported in the application of the spin - flip tddft ( sf - tddft ) for locating conical intersections in ethylene and stilbene ; however , this approach is not free of certain artifacts . in particular , the unphysical states of mixed spin - symmetry and an artificial dependence on the choice of the reference statehave been identified by casida et al . as potential pitfalls of the sf - tddft approach . furthermore , an excessive spin - contamination may preclude correct identification of physically meaningful excited states . in the present work , an alternative route for describing the strong nondynamic correlation and excited states in dft will be taken , namely the ensemble approach . the development of practically accessible ensemble dft method , the spin - restricted ensemble - referenced kohnsham ( reks ) method , and its application to the ground and excited ( in the state - averaged variant ) states of strongly correlated molecular systems have been reported in the past . in this work , the reks method will be used for describing the energetics and geometry of conical intersections in a number of molecules , which are widely employed as paradigmatic models for understanding the photochemistry and photophysics of organic and biological molecules . the performance of several popular density functionals will be investigated in comparison with the results of high - level ab initio multireference wave function calculations available in the literature . the results of density functional calculations will be analyzed in chemical terms , where the elementary reaction coordinates of photorearrangement will be employed . in section 2 the properties of conical intersection points andthe results of the calculations will be described and compared with the literature data in section 4 , and in section 5 , the conclusions will be drawn . conical intersections ( cis ) are commonly defined as ( manifolds of ) points at which bornoppenheimer potential energy surfaces ( pess ) of two ( or more ) electronic states , which transform according to the same irreducible representation of the space and spin symmetry group , become degenerate . limiting the discussion to two electronic states , i and j for brevity , the true crossings between their pess may occur provided that the conditions in eq ( 1 ) are fulfilled ,1 a1bwhere is the electronic hamiltonian in the born oppenheimer approximation . these conditions , that is , the degeneracy of electronic energies and the vanishing interstate coupling , can only be fulfilled in the space of n2 internal molecular coordinates . the gradients of the conditions 1a and 1b with respect to the nuclear coordinates define the branching space of the intersection ; that is , two directions in the space of all nuclear coordinates along which the degeneracy of the two pess is lifted . in the space of the gradient difference vector g ( the gradient of 1a ) and the interstate coupling gradient h ( the gradient of 1b ) , the two pess near the intersection point have a topography of a double cone , hence the name conical intersection . an important criterion for the occurrence of conical intersections has been formulated by longuet - higgins and is known as the sign - change theorem : whenever a wave function of the given electronic state in the bornoppenheimer approximation is adiabatically transported round a closed path encompassing a conical intersection , the wave function changes its sign . a number of approaches for locating conical intersections based on the sign - change theorem have been proposed in the past ; however , more robust methods of locating cis are based on the use of branching space vectors . in the present work , the sign - change theorem will be used to demonstrate that the degeneracy points between pess of two electronic states located using a selection of dft functionals are indeed the true conical intersections and not weakly avoided crossings . of note , a criterion similar to the sign - change theoremks dft is based on the notion that the ground state density of a real many - electron system can be uniquely mapped on the ground state density of a fictitious system of noninteracting particles moving in a suitably modified external potential . the existence of such a potential , the ks potential , can be demonstrated using the argument based on the adiabatic theorem of many - body physics . gradually switching off the electronelectron interaction in the hamiltonian and modifying the external potential such that the ground state density remains unchanged , the noninteracting particles limit can be reached , in which the ground state density is represented by n lowest eigenvalues of the noninteracting hamiltonian , provided that , along the adiabatic connection path , ( i ) the system remains in its ground state and ( ii ) the perturbation theory remains valid . if a density can be represented by a single ks determinant built from the lowest eigenvalues of a noninteracting system , such a densityis said to be noninteracting pure state v - representable ( ps - vr ) . the fact that not any physical density is noninteracting ps - vr has been theoretically demonstrated already in the early days of density functional theory . in the works of lieb , of englisch and englisch , and later , of kohn and co - workers , it has been demonstrated that any physical density is noninteracting ensemble v - representable ( e - vr ) and that only some densities are ps - vr . e - vr implies that the density is represented by a weighted sum ( ensemble ) of densities of several ks determinants . that the ensemble representation of the density is not merely a theoretical curiosity and may occur in practical calculations has been demonstrated by baerends and co - workers ( e - vr for c2 , h2 + h2 , and ch2 ) and by morrison ( e - vr for be - like atomic ions ) . using inverse engineering approach to construct the ks potential for the known exact density , it has been demonstrated that one needs to switch to the ensemble representation for the density of the noninteracting reference ks system in the cases where strong nondynamic correlation is present in the interacting ( physical ) limit . a practically accessible implementation of the ensemble approach in dft has been achieved in the spin - restricted ensemble - referenced ks ( reks ) method , for the first time introduced in refs ( 22 and 23 ) and later modified in ref ( 24 ) . the reks method is based on a rigorous statement that any positive definite physical density for fermions is ensemble v - representable , cf . theorems 4.2 and 4.3 and eqs 4.5 and 4.7 in ref ( 35 ) and theorem 5.1 in ref ( 36 ) . this leads to the formal representation for the density and the ground state energy , given in eqs 2 and 3,23 by weighted sums over a finite ensemble of ks states . provided that the same set of ks orbitals is used to construct the densities of the individual ks determinants in eq 2 , the fractional occupation numbers ( fons ) of the ks orbitals emerge , as in eq 4,4 where a set of orthonormal orbitals p ( r ) and their fons np are introduced . the implementation of the reks method used in the present work can treat systems with two active orbitals fractionally occupied by two electrons , that is the reks ( 2,2 ) method . this active space is sufficient to describe the low - spin ground state of a diradical , dissociation of a single chemical bond or a situation arising when a double bond is partially broken by an electronic excitation or a conformational change . based on the analysis of multiconfigurational wave functions the working formulas for the reks density and total energy , eqs 5 and 6 , were derived ,56 where k are the doubly occupied core orbitals , a and b are the fractionally occupied active orbitals with the occupation numbers na and nb , respectively , f ( na , nb ) is a function of the occupation numbers the details of which can be found in ref ( 24 ) , and the unbarred and barred orbitals are occupied with spin - up and spin - down electrons , respectively . the last three terms in eq 6 represent a dft analogue of the exchange integral ab | ba in wave function ab initio theory . the occurrence of such a term in eq 6 can be illustrated by the following argument . let us consider a system of noninteracting electrons ( a ks system ) in which two frontier orbitals are fractionally occupied by two electrons and all the other orbitals are doubly occupied . the ground state density of such a system ( see eq 2 and 4 ) can be described by eq 5 or , equivalently , by an ensemble of densities of two ks determinants , | ... aa | and | ... bb | , with the weighting factors na / 2 and nb / 2 , respectively . according to the exact ks simulations and theoretical arguments , the two fractionally occupied frontier orbitals are energetically degenerate and lie at the fermi level of the system . let us now follow the adiabatic connection path between the noninteracting and the fully interacting electronic system and switch on the electron , it should not affect the ks orbitals and the energies of all but two electrons , namely the two electrons in the fractionally occupied ks orbitals . for such a situation , the application of quasi - degenerate perturbation theory to obtain the total energy of the system leads to eq 6 , in which f ( na , nb ) = ( nanb ) . in the reks ( 2,2 ) method , the algebraic form of the function f ( na , nb ) is obtained by interpolating between the above limit of an ensemble ks state and a single - reference ks state . this is done to eliminate the double counting of the nondynamic electron correlation in the latter case and to guarantee that , for a state that is correctly described by a single - determinant ks ansatz , the reks method yields the same energy as the standard ks - dft . the reks ( 2,2 ) energy is minimized with respect to the orbitals and fons of the active orbitals under the constraint of orbital orthonormality and the constraint for active orbital occupation numbers na + nb = 2 . the orbital orthogonality constraint is imposed by the use of the method of lagrange multipliers , which leads to the well - known general open - shell self - consistent field equations . the number particle constraint for fons of the active orbitals is explicitly imposed by utilizing the trigonometric relation cos + sin = 1 , which enables one to minimize the reks energy with respect to the fons of the active orbitals directly thus avoiding the use of lagrange multipliers . because , at the variational minimum , the reks energy is stationary with respect to the fons of the active orbitals , the respective lagrange multipliers should have become degenerate had these multipliers been used in the energy minimization . further details of the reks methodology can be found in refs ( 2224 ) . the outlined reks method can be used in connection with any approximate local or semilocal density functional . the reks ( 2,2 ) method describes a diradicaloid state ( or a state with dissociating single bond or partially dissociating double bond ) , for which the noninteracting ks reference wave function is given by eq 7.7 in the delocalized representation of the active orbitals of a diradical , this state has a predominantly covalent character and is the ground state of a system with a single strongly correlated electron pair . in the space of two active orbitalsa and b , excitation of a single electron from this state leads to an open - shell singlet ( oss ) state 8,8 which represents the lowest singlet excited state of a biradical . the energies of the two states , 0 and 1 , can be obtained with the use of the state - averaged reks ( sa - reks ) method , in which a weighted sum of the energies of these states is minimized with respect to the reks orbitals and , for the 0 state , their fractional occupation numbers . in the sa - reks energy functional , eq9 ,9 the ground state energy is calculated using the reks ( 2,2 ) method and the oss excited state energy is calculated using the roks method . typically , equalthe oss state 8 represents the lowest excited state of a homopolar biradical ( e.g. , ethene at 90 of twist ) , and it does not mix with its ground state 7 . for a heteropolar biradical , either by chemical substitution ( e.g. , styrene ) or geometric distortion ( e.g. , ethene near the ci ) , the two states , 0 and 1 , can mix thus leading to the states with partial covalent and partial ionic character . within the sa - reks formalism , this situation can be described by quasi - degenerate perturbation theory , which leads to a simple 22 secular problem in the space of the two states , 0 and 1 . the diagonal elements of the hamiltonian matrix are given by e0reks ( 2,2 ) and e1roks , calculated using the sa - reks orbitals , and the off - diagonal element is given by eq 10,10 which is obtained as an element of the hamiltonian operator taken between the states described by wave functions 7 and 8 . as the individual determinants in eq 8 are obtained by single excitations from the individual determinants in eq 7 , the hamiltonian matrix element between these wave functions is a combination of the off - diagonal matrix elements of the fock operator taken between the open - shell orbitals a and b . note that , due to the definition of the fock operator in open - shell scf theory , see ref ( 43 ) for more detail , the fock matrix elements should be multiplied by the ( fractional ) occupation numbers of the respective orbitals . the variational condition in open - shell scf theory implies that the fock matrix becomes hermitian and the off - diagonal matrix elements b | nafa | a and a | nbfb | b , where fa and fb are the fock operators for the orbitals a and b , respectively , become equal to one another . for brevity , these elements are denoted in eq 10 as wab , which is the off - diagonal lagrange multiplier for the open - shell orbitals a and b in the sa - reks method . provided that equal weighting factors are chosen in eq 9 , the state - averaged energy functional remains unchanged upon the application of the described procedure and the sa - reks orbitals do not have to be reoptimized . although the correction to the e0reks ( 2,2 ) and e1roks energies is sufficiently small , the outlined procedure yields a more realistic description of the ground and excited states , especially when the excitation energy is vanishingly small , such as near a ci . in the following , this approach will be denoted as the state - interaction sa - reks , or si - sa - reks for brevity . the si - sa - reks method has been already introduced in ref ( 21 ) , where it was observed that the si - sa - reks method yields a more accurate description of the shape of the potential energy surfaces of psb3 retinal model near a ci . a more detailed description of the si - sa - reks method will be provided elsewhere . currently , the analytic energy gradient is available for the reks ( 2,2 ) method , however , is not yet implemented for the individual states in the sa - reks and si - sa - reks methods . this implies that the relaxed density matrix is not yet available for the ground and the excited states in the sa - reks and si - sa - reks approaches and the density matrix is obtained using the state - averaged orbitals only . the reks method , as well as the sa - reks and si - sa - reks methods , can be used in connection with any existing gga , meta - gga , local or global hybrid exchange - correlation density functional . in practical applications of the sa - reks and si - sa - reks methods , especially in situations where a balanced description of the relative stability of ionic and covalent electronic configurations is needed ( e.g. , such as in the vicinity of a ci ) , it was found that hybrid functionals that contain a larger fraction of the exact exchange energy provide for a more accurate description of the excitation energies . indeed , the use of the exact ( hartree fock ) exchange energy mitigates the effect of the electron self - interaction error inherent in the approximate gga density functionals , which is important in the context of the present work . in several recent studies that employ tddft or sf - tddft formalisms , similar observations as regards the performance of hybrid density functionals with increased contribution of the hartreefock ( hf ) exchange energy alone can be used in the context of the reks , sa - reks , and si - sa - reks methods . with the use of the hf exchange only , the reks methods do not become exactly equivalent to the respective casscf ( 2,2 ) approaches , as the dependence of the total energy on the orbital occupation numbers is slightly different in these computational schemes ( see discussion after eqs 5 and 6 ) . however , the results yielded by the reks ( 2,2 ) / hf methods are very close to the casscf ( 2,2 ) results . there is also a vague analogy between the si - sa - reks / hf method and a recently proposed fomo - casci ( 2,2 ) approach ; however , the latter method uses the orbitals obtained from a closed - shell spin - restricted hartreefock calculation with floating orbital occupations , whereas the si - sa - reks approach is based on the open - shell scf theory . the reks ( 2,2 ) , sa - reks , and si - sa - reks methods are implemented in the cologne2012 program , which was used in the calculations . a series of density functionals ranging from a global hybrid functional , bh & hlyp , to a coulomb - attenuated local hybrid functional , cam - b3lyp , to a meta - gga hybrid functional , m06 - 2x , have been used in the calculations . for reasons discussed in the end of the previous section , hybrid density functionals with small fraction of the hf exchange have been excluded from consideration . numeric integration in the density functional calculations employed grids comprising 75 radial points and 302 angular integration points per atom . the scf convergence criterion of 10 for the density matrix was used in all the calculations . to evaluate the importance of the dynamic electron correlation for the geometries and relative energies of the conical intersections , si - sa - reks calculations in connection with the hf exchange only have been also carried out . the geometries of conical intersections were obtained with the use of the ciopt program interfaced with cologne2012 . the algorithm used for the ci optimization employs the penalty function approach in connection with numerically calculated gradients for the ground and excited states obtained using the si - sa - reks method . for several species , transition states on the s0 ground electronic state pes have been optimized using the reks ( 2,2 ) method . for all the transition states , it has been confirmed that the molecular hessian possesses exactly one negative eigenvalue . the hessian has been calculated by numeric differentiation of the analytic energy gradient using a 0.001 increment for the atomic coordinates . the following units are employed throughout the article : all geometric parameters are given in ngstrm ( ) , the total energies are given in hartree atomic units ( a.u . ) , and the relative energies are given in electron - volts ( ev ) . with the use of theoretical method described in the preceding section a number of conical intersections in molecules shown in scheme 1 have been investigated . the species considered in this work include ethylene , for which two cis twisted - pyramidalized ( scheme 1a ) and ethylidene ( scheme 1b ) were calculated ; methyliminium cation , for which two cis twisted ( scheme 1c ) and methylimine ( scheme 1d ) were investigated ; styrene , for which two twisted - pyramidalized cis with pyramidalization on terminal carbon atom ( scheme 1e ) and with pyramidalization of phenyl end of the double bond ( scheme 1f ) were studied ; stilbene , for which a twisted - pyramidalized ci ( scheme 1 g ) was computed ; penta -2,4-dieniminium cation ( the protonated schiff base , psb3 , a commonly used model of the retinal chromophore ) , for which a twisted ci ( scheme 1h ) was optimized ; anionic p - hydroxybenzilideneimidazolinone ( hbi , a model of the green fluorescent protein chromophore ) , for which two twisted - pyramidalized cis with torsion of the phenyl ring ( scheme 1i ) and with torsion of the imidazole ring ( scheme 1j ) were examined . the results of the si - sa - reks calculations along with the reference data from the literature are summarized in table 1 , where the relative energies of the franck condon ( fc ) points and the minimum energy cis ( mecis ) are reported together with the root - mean - square deviations ( rmsd ) of the meci geometries optimized with the use of density functionals from the reference ab initio geometries . a complete list of cartesian coordinates and total energies of the species reported in table 1 can be found in supporting information . the reference energies and geometries at the fc and ci points have been adopted from refs ( 25 and 26 ) where calculations have been performed with the use of the multireference configuration interaction with single and double excitations ( mrsdci ) method or with the use of the second - order many - body perturbation theory corrected complete active space scf ( caspt2 ) approach in connection with medium size basis sets . for hdi , only the ci with phenyl ring torsion was studied using the caspt2 method ; however , both cis , ciph ( scheme 1i ) and ciim ( scheme 1j ) , were investigated by the casscf method . because the latter approach does not systematically include the dynamic electron correlation , the casscf results are not used when benchmarking the density functional calculations . for the geometries at conical intersection points , the root mean square deviations ( rmsd , in ) of the dft geometry from the reference wavefunction ab initio geometry are reported . ci with pyramidalization on the terminal carbon atom ( see text for more detail ) . ci with pyramidalization on the phenyl carbon atom ( see text for more detail ) . ci with torsion of the imidazole ring . at a brief glance , the si - sa - reks method in connection with commonly used density functionals is capable of reproducing the reference data sufficiently accurately . on average , the bh & hlyp functional provides the best agreement with the reference results , in particular for the geometries at ci points . cam - b3lyp shows similar performance ; however , m06 - 2x displays some conspicuous failures for simple molecules , such as ethylene and methyliminium . in the following , this analysis is based on the sign - change theorem and on the use of elementary reaction coordinates for identifying molecular geometries at which the cis occur . the twisted - pyramidalized ci in ethylene is the most efficient funnel for nonadiabatic relaxation of the excited state during the photoisomerization about the double bond . the ci occurs as a result of crossing of the ground and the lowest singlet excited state of ethylene near 90 of torsion about the double bond . in the ground electronic states0 , torsion about the double bond leads to a transition state of isomerization , which has a diradical character and , at the simplest level of approximation , can be described by a two - configurational wave function 7 . at this geometry , the lowest excited singlet state s1 can be described by an open - shell singlet wave function , see eq 8 , and this state has a zwitterionic character . the s1s0 energy gap is substantial , 2.90 ev according to the si - sa - re - bh & hlyp / 6 - 31 g * calculations . pyramidalization of one of the carbon atoms leads to shifting the ( former ) - electron pair toward this atom and to stabilization of the excited state which acquires a charge transfer character . simultaneously , the diradicaloid ground state is destabilized and , at a sufficiently large degree of pyramidalization , both states cross forming a ci . from chemical point of view , the s0 state in the region between the diradicaloid transition state and the ci corresponds to the homolytic - bond breaking and the s1 state to the heterolytic bond breaking , and their characters are interchanged after the ci . hence , it is convenient to analyze the electronic states near the ci in terms of reaction coordinates corresponding to these bond breaking mechanisms . the transition states for the homolytic ( tsdir ) and the heterolytic ( tsct , transition state with charge transfer character ) breaking of the - bond on the s0 ground state pes of ethylene were optimized with the use of the reks ( 2,2 ) formalism and characterized by analysis of the vibrational frequencies . the geometries of tsdir , ci , tsct , and species optimized using the re - bh & hlyp / 6 - 31 g * method are shown in figure 1 . for comparison , the meci structure obtained using si - sa - re - bh & hlyp / 6 - 31 g * calculations is superimposed with the structure obtained by martnez et al . using the mrsdci / 6 - 31 g * method . geometries of tsdir , meci , and tsct points obtained for c2h4 using bh & hlyp functional in connection with reks and si - sa - reks methods . lower panel shows the meci / bh & hlyp structure ( light gray ) superimposed with the reference mrsdci structure ( dark gray ) from ref ( 25 ) . key geometric parameters ( bondlengths in and angles in deg ) are given . using the tsdir , meci , and tsct structures a rigid scan in internal molecular coordinates has been carried out for the s0 and s1 pess . following refs ( 27 and 31 ) , an equilateral triangle was set up around the meci point with tsdir and tsct placed at two of its vertices . the internal molecular coordinates for the remaining vertex structure were obtained in such a way that the meci point would be at the geometric center of the triangle . the position of any point on the plane defined by the triangle was parametrized by two dimensionless parameters , a1 and a2 , see figure 2 . figure 2 shows the energy difference between the s0 and s1 states obtained for c2h4 using the si - sa - re - bh & hlyp / 6 - 31 g * method . both figures demonstrate that the crossing point between the s0 and s1 pess does indeed have the topography of a double cone . to investigate variation of the phase of the si - sa - reks wave function transported round a closed path around meci a number of points have been calculated on a loop with the radius 0.1 shown by a yellow circle in figure 2 . in the plot in figure 4 , the wave function phase angle is obtained by representing the si - sa - reks wave function as cos ( ) 0 + sin ( ) 1 , see eqs 7 and 8 for definitions , and the angle parametrizes the loop starting from the direction from meci to tsdir , see figure 2 . energy difference ( in ev ) between the s0 and s1 states of c2h4 obtained using the si - sa - re - bh & hlyp / 6 - 31 g * method in a rigid scan of the pess around meci . potential energy profiles of the s0 and s1 states of c2h4 obtained using the si - sa - re - bh & hlyp / 6 - 31 g * method in a rigid scan around meci . phase angle of the si - sa - re - bh & hlyp / 6 - 31 g * wave function for c2h4 as a function of the angle parametrizing a loop of the radius 0.1 around meci . shaded area shows the region where the si - sa - reks ground state wave function has a predominant diradical character . figure 4 demonstrates that the si - sa - reks wave function phase does change through ( 180 ) as one transports it round a closed path around a ci . the shaded area in 4 shows the region where the ground state wave function has a predominant diradical character . this region can be identified in figure 2 as the segment to the right of meci and bound from the left by a deep gorge shown by the blue color of varying depth . although the calculation of the interstate coupling gradient vector h is not yet implemented for the si - sa - reks method , it can be estimated from figure 2 as the direction normal to the direction of the gorge . indeed , along the gorge the interstate coupling between s0 and s1 has its minimal magnitude and normal to this direction defines its gradient h. in the coordinates of figure 2 , this is the direction with an azimuth of ca . the estimated h vector corresponds predominantly to rotation of the ch2 group of ethylene . key geometric parameters of twisted - pyramidalized meci points optimized for c2h4 with the use of different density functionals . the geometries of meci points for c2h4 optimized with the use of different density functionals are shown in figure 5 , and figure 6 shows the s0 and s1 pes profiles calculated along an interpolation pathway connecting tsdir , meci , and tsct structures . figure 6 illustrates an observation that ci occurs in a proximity of a ground state ts structure that has a higher energy , in this case tsct . the greater the difference between tsdir and tsct energies , the closer is the ci geometry to the tsct geometry . thus , the use of the hf energy functional in connection with si - sa - reks yields the greatest energy difference between the ground state tsct and tsdir geometries and the respective meci is predicted to lie closer to tsct than with the use of other functionals . the rmsd between meci and tsct geometries obtained with hf is 0.1226 , with cam - b3lyp 0.1751 , with m06 - 2x 0.2039 , and with bh & hlyp 0.1623 . for comparison , the rmsd between meci and tsdir geometries are 0.3602 ( hf ) , 0.3304 ( cam - b3lyp ) , 0.3149 ( m06 - 2x ) , and 0.3328 ( bh & hlyp ) . obviously , the geometric proximity of meci to the tsct geometry correlates with the energy gap between tsdir and tsct . thus , the hf functional yields meci the closest to tsct and m06 - 2x yields meci the farthest from tsct . bh & hlyp and cam - b3lyp yield meci geometries at approximately the same distance from the respective tsct . it can be concluded that the m06 - 2x functional has the strongest preference for charge - transfer electronic structure than other density functionals , and this shows up in the results obtained with the use of this functional , which are the worst in comparison with the reference wave function ab initio calculations . s0 and s1 potential energy profiles of c2h4 obtained along an interpolation pathway connecting tsdir , twisted - pyramidalized meci and tsct structures . all energies are calculated with respect to the energy of the equilibrium ground state conformation . geometries of the ethylidene meci structures obtained with the use of density functionals are shown in figure 7 . the m06 - 2x density functional yields a geometry for this ci that deviates strongly from the reference geometry . the distortion is most likely caused by a much too strong attraction between the cm06 - 2x was parametrized to include some medium range dispersion interaction in the ground states of noncovalently bound systems . it is therefore desirable to develop density functionals which would be capable of describing the dispersion interactions in the excited states of molecules as well . key geometric parameters of ethylidene meci points optimized for c2h4 with the use of different density functionals . for ethylene , the si - sa - re - bh & hlyp calculations have been also performed using the 6 - 311 g * * basis set to investigate how strongly the results depend on the basis set size . the twisted - pyramidalized and ethylidene meci geometries obtained with the use of a bigger basis set deviate only insignificantly from the geometries obtained with a smaller basis set . this is confirmed by rmsd ( 6 - 31 g * 6 - 311 g * * ) of geometries , which for the twisted - pyramidalized meci amounts to 0.0146 and for ethylidene meci to 0.0032 . the excitation energy at the fc point obtained using the si - sa - re - bh & hlyp / 6 - 311 g * * method is 8.112 ev as compared to 8.338 ev when using the 6 - 31 g * basis set ( see table 1 ) . the twisted - pyramidalized meci obtained using si - sa - re - bh & hlyp / 6 - 311 g * * method lies 5.015 ev above the equilibrium ground state energy ( 5.158 ev when using the 6 - 31 g * basis ) , and the ethylidene meci lies at 4.019 ev ( 4.040 ev with 6 - 31 g * ) , which confirms that the basis set extension has only a minor effect on the obtained geometries and relative energies of cis . for more detail on the si - sa - re - bh & hlyp / 6 - 311 g * conical intersections in styrene and stilbene ( scheme 1e , f , g ) have been studied in the past with the use of ab initio multireference wave function methods in connection with photoisomerization reactions which these molecules undergo . for the purpose of the present work , these molecules are interesting because they illustrate the effect of substituents at the double c = c bond on the geometry and relative energy of the conical intersections obtained using density functional calculations . in styrene , the presence of the phenyl ring at one end of the ethylenic double bond creates an asymmetric situation where s0 / s1 cis resulting from twist and pyramidalization of carbon atoms at the opposite ends of the double bond become nonequivalent . indeed , in the literature two possibilities for low energy conical intersections in styrene were identified , a ci with pyramidalization of the carbon atom bound to phenyl ring and a ci with pyramidalization of the terminal carbon atom . unfortunately , a relatively low - level casscf approach was used by bearpark et al . andoptimization of the ci structure was not attempted with the use of the caspt2 method by molina et al . , such that the literature results can not be used as a reference for benchmarking the dft methods . nevertheless , the two s0 / s1 cis resulting from twist - pyramidalization distortion of the ethylenic bond in styrene have been optimized using the si - sa - reks method in connection with various density functionals and the key geometric parameters of the obtained cis are reported in figure 8 and their energies relative to the ground state equilibrium conformation of styrene are reported in table 1 . the meci1 point , where the terminal carbon atom is pyramidalized , lies ca . this trend can be understood by the following reason : crossing between the pess of the states corresponding to the homolytic and heterolytic bond breaking resulting from the torsion of the ethylenic bond is facilitated by pyramidalization of one or another carbon atom . pyramidalization leads to shifting the electron pair toward the pyramidalized end of the double bond , thus leading to a charge transfer electronic structure . in the case of styrene , the relative energy of the ct electronic configurations depends on the energy penalty incurred by ionization of the fragments connected by the double bond , for instance , the benzyl radical and methyl radical obtained by a complete breaking of the ethylenic bond and saturating the dangling - bonds by hydrogens . according to the bh & hlyp / 6 - 31 g * calculations , the ionization potential and the electron affinity of benzyl radical are 6.739 and 0.025 ev , respectively , and those of the methyl radical are 9.523 and 1.969 ev , respectively . hence , ionizing benzyl and adding electron to methyl , which leads to the meci1 electronic structure , should incur a lower energy penalty than ionizing methyl and adding electron to benzyl and , consequently , meci1 has lower energy than meci2 . figure 9 shows the pes profiles of the s0 and s1 states in styrene calculated using the si - sa - re - bh & hlyp / 6 - 31 g * method along an interpolation coordinate connecting transition state tsct for the heterolytic double bond breaking where the charge transfer occurs to the phenyl group , meci2 , diradicaloid transition state tsdir for the homolytic bond breaking , and meci1 . a transition state for the heterolytic bond breaking with charge transfer to the methyl end of the double bondit can be seen from the pes profiles in figure 9 that such a tsct might have occurred in the nearest vicinity of meci1 . from table 1 , both mecis lie at least 0.4 ev below the franckhowever , the reported pes profiles suggest that meci1 may represent a more efficient funnel for radiationless relaxation of the excited state than meci2 as there is a slope toward it on the excited state pes . key geometric parameters of twisted - pyramidalized meci points optimized for styrene with the use of density functionals . similar to ethylene , stilbene serves as a paradigmatic system for studying ultrafast photorearrangement of olefins . it has been experimentally established that cis - stilbene undergoes an ultrafast isomerization to trans - isomer within ca . 1 ps . this very short s1 state lifetime was explained by the existence of a twisted - pyramidalized ci accessible from the cis - stilbene franck condon point . the geometry of the twisted - pyramidalized meci was optimized with the use of multistate caspt2 ( ms - caspt2 ) method by levine et al . this geometry is used as a reference for benchmarking density functionals in the present work . potential energy profiles of the s0 and s1 states of styrene obtained by a rigid scan along an interpolation coordinate connecting for electron transfer to phenyl , meci2 , tsdir , and meci1 using the si - sa - re - bh & hlyp / 6 - 31 g * method . the energies ( in ev ) are given with respect to the ground state equilibrium energy of styrene . the twisted - pyramidalized meci geometry optimized using density functional calculations is compared with the reference ms - caspt2 geometry in figure 10 . the bh & hlyp and cam - b3lyp density functionals yield the best agreement with the reference geometry , with m06 - 2x lagging a little behind in accuracy , see table 1 . the importance of the dynamic electron correlation included into the density functionals is underlined by a visibly worse meci geometry produced with the use of the hf functional . interestingly , all the density functionals yield the trans - stilbene fc point below the meci by ca . 0.10.2 bh & hlyp and cam - b3lyp yield the cis - stilbene fc point 0.185 and 0.063 ev above the respective meci energy , see table 1 . this energy ordering of the meci and the fc points generally agrees with the experimentally observed photorearrangement lifetimes in cis - and trans - stilbenes . the accessibility of the meci point from the cis - stilbene fc point predicted by the si - sa - re - bh & hlyp / 6 - 31 g * and si - sa - re - cam - b3lyp / 6 - 31 g * methods agrees with its short lifetime ( ca . 1 ps ) , whereas the obtained mild energy penalty to reach meci from the trans - stilbene fc point is consistent with a longer excited state lifetime ( ca . 30 ps ) . the calculated excitation energies of trans - and cis - stilbene , see table 1 , can be compared with the energies experimentally measured in n - hexane , ca . key geometric parameters of twisted - pyramidalized meci point optimized for stilbene with the use of density functionals . the ms - caspt2 geometry is taken from ref ( 25 ) figure 11 shows the s0 and s1 pes profiles of stilbene obtained with the use of the si - sa - re - bh & hlyp / 6 - 31 g * method along an interpolation coordinate connecting the structure for the homolytic ethylenic bond breaking and the meci point . the geometry was optimized using the re - bh & hlyp / 6 - 31 g * method , and it features a torsion about the ethylenic double bond with the phph dihedral angle of 97.2 . the s1 pes is essentially flat in the direction toward meci , and at the tsdir geometry , it lies at 4.560 ev , that is , 0.107 ev below the cis fc point . in this regard , the ( weakly sloped ) meci topography in stilbene differs from that of ethylene , where the latter lies at the bottom of a potential minimum on the s1 pes , see figure 6 , and thus provides for a much faster photoisomerization rate than in stilbene . potential energy profiles of the s0 and s1 states of stilbene obtained by a rigid scan along an interpolation coordinate connecting tsdir for the homolytic ethylenic bond breaking and meci using the si - sa - re - bh & hlyp / 6 - 31 g * method . the energies ( in ev ) are given with respect to the ground state equilibrium energy of trans - stilbene . for stilbene , the dependence of the obtained meci geometry and relative energy on the basis set size was investigated by repeating the si - sa - re - bh & hlyp geometry optimizations and energy calculations using the 6 - 311 g * * basis set . rmsd ( 6 - 31 g * 6 - 311 g * * ) of the meci geometry is 0.0344 , the relative energy of the s1 trans - fc point with respect to the ground state is 4.305 ev ( 4.366 ev when using 6 - 31 g * , see table 1 ) , the relative energy of the s1cis - fc is 4.822 ev ( 4.655 ev with 6 - 31 g * ) , and the relative energy of the twisted - pyramidalized meci is 4.332 ev ( 4.470 ev with 6 - 31 g * ) . these results ( for more information see tables 19 and 20 of supporting information ) confirm that the basis set extension has only a minor effect on the results of calculations . introduction of the imine nitrogen atom into the methyliminium cation ( entries c and d in scheme 1 ) results in a strong polarization of the double bond . for this cation , the tsct for heterolytic breaking of the double c = n bond becomes more stable than the tsdir for homolytic breaking and the s0 / s1 ci occurs in the vicinity of tsdir . according to the mrsdci calculations , the twisted meci can be reached by a pure torsion about the double bond without involving pyramidalization of the carbon or nitrogen atoms . si - sa - reks calculations undertaken in the present work predict that , at 90 of twist about the c = n double bond , the ground s0 state has a charge transfer character where the electron pair is transferred toward imine group resulting in a h2n ch2 electronic configuration . thus , to reach the ci at 90 of twist , a slight bending of the methylidene group is needed to destabilize the ct configuration with respect to the diradicaloid electronic configuration . typically , bending through an angle of ca .1020 is sufficient to equalize the energies of the ct configuration ( s0 ) and the diradicaloid configuration ( s1 ) and to reach a ci . the geometries of the twisted meci point obtained with the use of si - sa - reks method in connection with various density functionals are shown in figure 12 . the best agreement with the reference mrsdci meci geometrythis is also valid for the methylimine meci geometries , for which si - sa - re - bh & hlyp / 6 - 31 g * reproduces the reference geometric parameters ( with the exception of the hpsb3 ( penta -2,4-dieniminium cation ) is a widely used model of retinal chromophore . recently , the electronic structure and potential energy surfaces of psb3 have been studied using a variety of ab initio multireference and single - reference wave function methods as well as density functional methods . using casscf , the minimum energy conical intersection in psb3 was found at a geometry that corresponds to twisting the central c = c double bond through ca .90 and along a bond length alternation ( bla ) pathway that connects a transition state with charge transfer character , tsct , and a transition state with diradical character , tsdir . both transition states feature 90 torsion about the central c = c double bond and differ mostly in the difference between the average length of formally single bonds and the average length of formally double bonds , which defines the bla coordinate . key geometric parameters of twisted and methylimine meci points optimized for methyliminium cation with the use of different density functionals . the mrsdci geometry is taken from ref ( 25 ) the geometry of meci optimized for psb3 with a variety of density functionals used in connection with the si - sa - reks method are reported in figure 13 where they are compared with the reference geometry from the ms - caspt2 calculations of keal et al . although the agreement with the reference geometric parameters is reasonably good , especially for the geometry of the allyl fragment , the c c and c = n bond lengths of the ethyliminium fragment deviate from the caspt2 values by ca .0.040.05 . as has been observed earlier by huix - rotllant et al . , for psb3 , density functional methods have a tendency to yield much lower energy of tsct ( which corresponds to the heterolytic breaking of the central double bond ) than that of tsdir ( holomytic bond breaking ) . the latter could not even be located with the use of the density functionals employed in this work . key geometric parameters of twisted meci point optimized for psb3 with the use of different density functionals . the ms - caspt2 geometry is taken from ref ( 26 ) figure 14 shows the s0 and s1 pess of psb3 along the bla pathway connecting tsct with meci . the crossing between the pess occurs on an uphill segment of the curves and , after the meci point , no transition state with diradical character can be found . in the case of the hf energy functional , a possible tsdir structure may find itself in the nearest proximity of the meci geometry , and therefore , this transition state could not be located . the casscf and caspt2 methods both predict that the tsct and tsdir structures have nearly equal energies ( see figure 2 in ref ( 60 ) . ) and only the mrsdci method puts tsct considerably below tsdir . as a consequence of nearly equal tsct and tsdir energies in casscf and caspt2 calculations , the meci , which occurs between these structures , has a substantial charge transfer character and the c = n bond of the ethyliminium fragment possesses a noticeably greater single bond character as a result of the charge transfer to this fragment . the si - sa - reks calculations predict meci considerably farther away from the tsct geometry and the meci geometry has a more pronounced resemblance of a would - be tsdir structure . it is noteworthy that the potential energy curves reported in figure 14 are much closer to the curves obtained using the mrsdci method . however , in the later case , the casscf geometries were employed whereas they are optimized in the present work . potential energy profiles of the s0 and s1 states of psb3 obtained by a rigid scan along the bla coordinate ( in ) connecting tsct for the heterolytic c = c bond breaking and meci using the si - sa - reks method in connection with various density functionals . the energies ( in ev ) are given with respect to the ground state equilibrium energy of cis - psb3 . tsct is always located at the beginning of the potential energy curves corresponding to individual functionals . to investigate whether the crossing points obtained for psb3 satisfy the criteria for conical intersections , the s0 and s1 pess were scanned in the vicinity of the mecis optimized using the si - sa - re - bh & hlyp / 6 - 31 g * and si - sa - re - hf / 6 - 31 g * methods . the pes profiles in figure 15 have been obtained in the same way as for ethylene , see figure 2 and 3 , using interpolation within a triangle defined by the tsct structure and two additional conformations chosen in such a way that the meci geometry would occur at the center of the triangle . the latter two conformations were obtained by applying a clockwise and counterclockwise torsion about the central c c bond to the conformation obtained by extrapolation along the bla coordinate beyond the meci geometry . according to gozemet al . , the bla coordinate corresponds to the difference gradient g direction and twisting about the central cc bond to the interstate coupling gradient h. hence , the two directions in figure 15 should span the branching space of meci ( a2 corresponds to h and a1 to g ) . potential energy surfaces of the s0 and s1 states of psb3 obtained using the si - sa - re - hf / 6 - 31 g * ( left panel ) and si - sa - re - bh & hlyp / 6 - 31 g * ( right panel ) methods in a rigid scan around meci . the relative energies are obtained with respect to the ground state energy of the cis - psb3 . the s0 / s1 intersection does indeed have the shape of a double cone and there is no ramming of the s1 pes into the ground state surface as was observed with the use of the conventional density functionals in connection with the standard td - dft calculations . the further evidence of the proper conical intersection character is presented in figure 16 , which shows the phase of the sa - sa - reks wave function round a closed loop encompassing the meci point ( see text around figure 4 for explanation ) . the s0 / s1 interstate coupling is minimal along the bla coordinate ( the discontinuity occurs at zero angle with respect to the tsct meci direction ) and the direction normal to it defines the h vector of the ci branching space . thus , the si - sa - reks method predicts qualitatively the same branching space of the twisted meci as the ab initio multireference wave function methods . phase angle of the si - sa - re - bh & hlyp / 6 - 31 g * ( solid line ) and si - sa - re - hf / 6 - 31 g * ( dashed line ) wave functions for psb3 as a function of the angle parametrizing a loop of the radius 0.1 around meci . shaded area shows the region where the si - sa - reks ground state wave function has a predominant diradical character . p - hydroxybenzilideneimidazolinone anion ( hbi ) serves as a model of the anionic state of the chromophore of the green fluorescent protein , a biological molecule that finds a wide application in life sciences for imaging and sensing . the spectroscopy and photophysics of hbi represents a considerable interest for synthetic and theoretical chemists , and in a number of studies , the conical intersection seam in this model compound have been investigated with the use of ab initio multireference wavefuction methods . in the most recent study , mori and martnez have investigated the ci seam in the anionic hbi using the casscf method and have identified two low lying ci points . of the two cis , one ( ciim ) is obtained by torsion of the imidazole ring and a slight pyramidalization of the methine bridge , another one ( ciph ) involves torsion of the phenyl ring accompanied by pyramidalization of the methine bridge . the torsion and pyramidalization result in crossing between the electronic states for which the leading valence electronic configurations are shown in scheme 2 . the geometries of the two ci points have been optimized using the si - sa - reks method in connection with various density functionals and the results are presented in figure 17 . although in ref ( 52 ) both cis have been optimized , the dynamic electron correlation was not included into the casscf calculations and these geometries are not used in the present work as the reference data . the only ci for which a higher level ms - caspt2 method was used is the ciph , and its geometry is also shown in figure 17 for comparison . the ciim point has ca . 0.5 ev lower energy than ciph , see table 1 . this can be understood by comparing the electron affinity of the fragments formed by breaking methine - bond as shown in scheme 2 . the homolytic bond breaking leads to diradicaloid ( dir ) electronic configurations and heterolytic bond breaking to charge transfer ( ct ) configurations . the electron affinities were estimated from the energies of fragments formed by breaking the respective methine bond and by saturating the dangling - bonds by hydrogens . for both cis , the ct electronic configurations have the lowest energy and the dir configurations lie ca . 0.5 ev ( ciim ) or ca . therefore , the cis should occur energetically and geometrically closer to the dir structures . it is the greater electron affinity ( ea ) of the p - oxybenzyl fragment as compared to the methylidene imidazolinone fragment ( see the dir configurations in scheme 2 ) that makes ciim more stable .0.8 ev for the difference between eas of p - oxybenzyl and methylidene imidazolinone which qualitatively agrees with the relative stability of the two ci points . key geometric parameters of twisted - pyramidalized meci points optimized for anionic hbi with the use of different density functionals . the left panel shows a ci obtained by the imidazole ring torsion and the right panel shows a ci obtained by the phenyl ring torsion . the ms - caspt2 geometry for the latter ci is taken from ref ( 25 ) . key geometric parameters of twisted - pyramidalized meci points optimized for anionic hbi in ref ( 25 ) . with the use of sa3 - casscf ( 4,3 ) / 6 - 31 g * method . generally , the ciph geometries obtained with the use of density functionals are in a reasonable agreement with the reference ms - caspt2 geometry . it is noteworthy that the geometries of the ciim and ciph points obtained with the use of the hf functional are in a good agreement with the casscf geometries obtained by mori and martnez , which are shown in figure 18 . there is also a reasonable agreement between the relative energy of the two cis obtained by the si - sa - re - hf / 6 - 31 g * method ( 0.562 ev ) and the sa3 - casscf ( 4,3 ) / 6 - 31 g * method ( 0.401 ev ) . a number of popular density functionals employed in connection with the si - sa - reks method have been tested for their ability to accurately reproduce the geometries at the conical intersection points between the ground and lowest singlet excited state pess of several organic molecules . the compounds selected for this study represent paradigmatic models for cis trans photoisomerization of olefins ( ethylene , stilbene ) and widely used models of biologically important chromophores ( psb3 , hbi ) . in the overall assessment , the global hybrid bh & hlyp density functional is capable of producing the meci geometries in the closest agreement with the reference high - level ab initio multireference wave function calculations . the other two density functionals tested in the present work either offer no advantage over bh & hlyp ( local hybrid functional cam - b3lyp ) or yield slightly deteriorated agreement with the reference geometries ( meta - gga hybrid functional m06 - 2x ) while being more time - consuming in practical calculations . the meci geometries obtained with the use of si - sa - reks method were analyzed by the application of the sign - change theorem , whereby it was shown that the obtained crossing points satisfy the criteria for conical intersections and the si - sa - reks wave function changes sign as it is being transported round a closed path around the crossing point . furthermore , following haas et al . , analysis of the obtained potential energy surfaces in terms of elementary reaction coordinates corresponding to two possible mechanisms of the - bond breaking , a heterolytic and a homolytic mechanism , revealed that the energetic and geometric parameters of ci can be estimated from the stationary points on the ground state pes , such as the respective transition states , which correspond to these mechanisms . an even simpler analysis can be based on comparing the electronegativities of fragments obtained by breaking the respective - bond . such an analysis enables one to estimate whether the homolytic or the heterolytic bond breaking is the energetically preferred mechanism and to sketch parameters of a possible ci . the latter may be expected to occur closer to the respective transition state ( even a hypothesized one ) that lies higher in energy . this simple observation can be used for suggesting possible chemical ways of modulating cis , and its veracity will be tested in subsequent works .\noutput:\n" }, { "from": "agent", "value": "a number of commonly available density functionals have been tested for their ability to describe the energetics and the geometry at conical intersections in connection with the spin - restricted ensemble referenced kohn sham ( reks ) method . the minimum energy conical intersections have been optimized for several molecular systems , which are widely used as paradigmatic models of photochemical rearrangements and models of biological chromophores . the results of the calculations are analyzed using the sign - change theorem of longuet - higgins and a method of elementary reaction coordinates of haas et al . the latter approach helps to elucidate the differences between the geometries at conical intersections as predicted by the multireference wave function ab initio methods and by the density functional methods . overall , the bh & hlyp density functional yields the best results for the conical intersection geometries and energetics ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: infection with mycobacterium tuberculosis ( mtb ) , the causative agent of tuberculosis ( tb ) , was responsible for 1.5 million deaths and 9 million cases of tb in 2013 , according to the world health organization . while only 510 % of individuals infected with mtb progress to active tb disease , approximately one - third of the world population , or over 2 billion people , are estimated to have latent mtb infection ( ltbi ) . latently infected individuals control mtb infection and are clinically asymptomatic but retain a significant risk of progressing to tb by reactivation of latent mtb when immune compromised . this is due to the ability of mtb to persist within granulomatous lesions in the lungs of individuals and the inability of host immunity to completely eradicate mycobacteria from host tissues . granuloma formation is initiated by mtb - infected macrophages and continues with the development of multinucleated giant cells ( mgcs ) and lipid - filled foamy macrophages surrounded by a ring of lymphocytes encapsulated in a fibrotic cuff . although macrophages and t cells play a central role in the formation of the granuloma , the complete cellular composition of the human granuloma throughout mtb infection remains unclarified and other cell types , including dendritic cells ( dcs ) , neutrophils , and b lymphocytes , are present and have been shown to contribute to cellular recruitment and the maturation of the granuloma . thus , granulomas are a testament to the involvement of both innate and adaptive immune cells in the human immune response to tb . huge strides have been made towards understanding the acute and chronic t cell response to mtb infection from studies in animal models , but the earliest encounters between mtb and the human innate immune system are incompletely understood . investigations in animal models of tb , human clinical and epidemiological studies on the genetics of mycobacterial susceptibility , and in vitro work with primary human cells strongly indicate that innate immune responses play a major role in determining the outcome of tb by helping control bacterial load and through shaping the nature and magnitude of adaptive immune responses . while innate antimicrobial pathways that are activated early and throughout infection play a role in limiting disease , myeloid cells also serve as the primary niches for mtb replication . moreover , mtb has evolved multiple strategies to modulate innate immune responses and prevent optimal activation of adaptive immunity . thus , understanding the crosstalk between innate and adaptive immune cells in human tb is critical for identifying novel targets of immunomodulatory therapies and for elucidating mechanisms of protective immunity . however , innate immune responses to mtb infection in humans remain relatively poorly understood , largely because of the inherent difficulties in studying lung - specific immunity in humans . this review will focus on the key innate immune cell types implicated in the human response to mtb , the interaction of innate immune cells with mtb , and their influence on adaptive immune responses and the course of disease . we will also review specific human immunogenetics studies that link perturbations in innate immunity to mycobacterial susceptibility . the major innate cell types that have been studied in humans are macrophages , neutrophils , dcs , and natural killer ( nk ) cells . recently , other cell types not classically defined as immune cells , such as airway epithelial cells , have been shown to contribute to the immune response against mtb in animal models of tb and in vitro studies with human cell lines . however , this review will focus on the roles of the classically defined innate immune cells in human tb as these cells serve as both the primary cellular niches for mtb replication as well as the initial sources of immune pressure to contain infection . alveolar macrophages are one of the first host cell types to encounter mtb in the lungs following aerosol transmission . while macrophages function as the first line of defense against mtb infection , early interactions between macrophages and mtb favor the bacteriathus , macrophages are a major cellular niche for bacterial replication during early infection and serve as reservoirs for persistent bacteria within the lung granulomas during chronic infection . in human tb , several aspects of macrophage functions have been investigated , including phagocytosis of bacteria , induction of antimicrobial pathways , and responsiveness to interferon gamma ( ifn - ) ( figure 1 ) . a number of receptors recognizing a wide variety of mycobacterial ligands play a role in human macrophage phagocytosis of mtb . collectins ( e.g. , surfactant proteins a and d and mannose - binding lectin ) , c - type lectins ( e.g. , mannose receptor , dc - sign , and dectin - 1 ) , toll - like receptors ( tlrs ; e.g. , tlr - 2 , tlr - 4 , and tlr - 9 ) , and many others have been implicated in the recognition and uptake of mycobacterial glycolipids , lipoproteins , and carbohydrates . of these , the best characterized are mannose - binding lectin ( mbl ) and mannose receptor ( mr ) . mbl belongs to a family of soluble c - type lectins , called collectins , which are involved in the recognition and clearance of apoptotic cells via calreticulin and cd91 mediated phagocytosis . during mtb infectionin addition to recognition of mtb ligands and phagocytosis , macrophage receptors are also involved in the activation of specific downstream pathways . as an example , mr , a transmembrane c - type lectin , ligates mtb lipoarabinomannan and activates macrophage peroxisome proliferator activated receptor gamma ( ppar ) expression in a phospholipase a2 and tlr - 2 dependent manner . in contrast to the avirulent vaccine strain mycobacterium bovis bacillus calmette - gurin ( bcg ) , virulent mtb activates macrophage ppar and induces the production of cyclooxygenase 2 and il - 8 , which regulate inflammatory responses via arachidonic acid metabolites and the recruitment of neutrophils , respectively . these studies suggest that the earliest mtb interactions with macrophages at the level of receptor - mediated phagocytosis can influence the ensuing inflammatory response . moreover , it is likely that mtb manipulates these responses in order to promote its survival and dissemination . no single receptor has been demonstrated to be essential for macrophage phagocytosis of mtb during human infection and it is clear that mtb is recognized by numerous receptors which induces a network of coordinated receptor - mediated signaling pathways that lead to distinct gene expression profiles of infected macrophages at different stages of disease . studies centered on the gene expression profiles of mtb - infected macrophages have largely been explored in murine cells , though a few studies have examined proinflammatory cytokine profiles in mtb - infected human macrophages as well as global gene expression after infection of in vitro blood monocyte - derived macrophages or human monocytic cell lines with mtb . these early gene profiling studies in infected human macrophages provided evidence for the importance of ifn - transcription in suppressing mtb gene expression , highlighted a prominent role for il - 1 and other proinflammatory cytokines at early and late timepoints after infection , and showed that macrophage responses to pathogenic mycobacteria differed from responses to infection with nonpathogenic mycobacteria . additionally , transcriptional profiling studies of blood monocyte - derived human macrophages after mtb infection in vitro have provided corollary evidence for the importance of known factors such as il - 12 in combating mtb as well as new insights into other factors not known to be important previously , including macrophage - derived chemokine ccl22 ( mdc ) and macrophage inflammatory protein - 1 ( mip - 1 / ccl3 ) . importantly , a study that examined gene expression of ex vivo stimulated macrophages from tb patients resulted in the association of ccl1 with tb susceptibility . studies that investigate gene expression profiles of primary macrophage cells from patients with tb are limited but are required to yield the most relevant insights into how mtb interacts with human macrophages in vivo . with a few exceptions , the gene expression studies in mtb - infected human macrophages and macrophage cell lines highlighted here have validated and supplemented data derived from other mechanistic studies in human monocytic cell lines and mouse cells . much remains unknown about the gene expression profile of mtb - infected primary macrophages from tb patients and studies utilizing primary samples from tb cohorts will provide the best insight into the human macrophage response to mtb infection in vivo . insights into the survival and replication of mtb within macrophage phagosomes have largely been derived from studying murine macrophages , and studies on mtb manipulation of phagosomal function in human macrophages have been relatively limited . interestingly , recent studies have examined alveolar macrophages from the bronchoalveolar lavage ( bal ) of patients coinfected with mtb and hiv and demonstrate that mtb resides within relatively nonacidified compartments in otherwise functionally capable macrophages . this suggests that the phagosome in human macrophages is specifically modulated by mtb to make it a preferential niche and further studies will be needed to clarify mechanisms of immune evasion that specifically target the human macrophage phagosome . tools developed for the assessment of innate immune functions , including vacuole acidification and superoxide burst , will be important in answering questions as to why bacteria are able to replicate within otherwise hostile environments . the ifn - pathway remains a critical pathway for resistance against mycobacterial infection , as highlighted by increased susceptibility to mycobacterial infections in humans with genetic impairments in the il - 12 / stat - 1 pathway , though in vitro evidence indicates that ifn - alone does not fully limit mtb replication in human macrophages and that vitamin d signaling pathways augment macrophage ifn - responsiveness . vitamin d was shown to act synergistically with ifn - to augment antimycobacterial activity in human monocytes . vitamin d treatment enhances a variety of important downstream pathways in macrophages , including autophagy , phagosomal maturation , and the production of antimicrobial peptides . additional studies have demonstrated that the bioactive 1,25 - dihydroxyvitamin d3 can restrict mtb replication within infected human macrophages in a phosphatidylinositol 3 - kinase - dependent and tlr - dependent manner . mechanistically , vitamin d upregulates gene expression of macrophage hcap - 18 , which encodes for the antimicrobial peptide ll - 37 ( cathelicidin ) , and ll - 37 trafficking to mtb - containing phagosomes is purported to mediate the antimycobacterial effects of vitamin d . mtb contains numerous pathogen associated molecular patterns ( pamps ) that are recognized by a variety of cell surface and intracellular pattern recognition receptors ( prrs ) on macrophages . for example , tlr2 recognizes mycobacterial mannosylated lipoarabinomannans and engagement of this receptor - ligand pair leads to downstream nf - b activation and inducible nitric oxide synthase ( inos ) gene transcription . nos2 and nos3 expression has been implicated in the production of nitric oxide ( no ) in human macrophages and clear induction of macrophage nos2 mrna can be seen in the bal of tb patients compared to healthy controls . in contrast to murine studies , no seems to have limited bactericidal or bacteriostatic effects against mtb during in vitro infection of human alveolar macrophages and primary monocytes post - ifn - treatment , suggesting that the critical immune responses to mtb garnered from studies in animal models may not be as important during human infection . alternatively , antimycobacterial effects of no may in fact occur in vivo within the lung microenvironment . the ifn - / il - 12 axis is critical in host resistance to mtb in mice and in humans . clinical observations of increased levels of ifn - in the pleural fluid and bal of patients with confirmed pulmonary tb compared to healthy controls suggest that ifn - plays a prominent role in human tb infection . while murine macrophages activated by ifn - alone show distinctly augmented capacity for antimycobacterial functions compared to untreated macrophages , human macrophages require additional factors such as vitamin d , in addition to ifn - , to maximize antimycobacterial functions . this is perhaps due to mtb - mediated inhibition of critical stat1 protein - protein interactions with camp response element binding ( creb ) binding protein , leading to hyporesponsiveness to ifn - stimulation . additionally , mhc class ii expression , normally upregulated after ifn - activation of macrophages , is downregulated after mtb infection of human macrophages via decreased expression of class ii transactivator ( ciita ) . this may play a role in dampening adaptive immune responses by attenuating t cell recognition of infected macrophages and could explain the reported defects in antigen recognition by mtb - specific lymphocytes in the granuloma . overall , macrophages are clearly at least capable of restricting mtb bacilli given appropriate activation signals from antigen specific t cells and the local lung microenvironment . however , questions remain regarding whether effective juxtaposition of infected macrophages and activated t cells occurs within the confines of the lung . studies aimed at answering basic questions about infected macrophages in human tb , including signaling pathways subverted during infection , the activation status of mtb - infected human alveolar macrophages , and the crosstalk between macrophages and t cells within infected lungs , are critical for developing immunomodulatory therapies for tb . during infection , neutrophils phagocytose bacteria discharge antimicrobial effectors from their granules and constitute a potent population of effector cells that can mediate both antimycobacterial activity and immunopathology in human tb ( figure 2 ) . this is because release of factors such as elastase , collagenase , and myeloperoxidase by neutrophils during their respiratory burst indiscriminately damages bacterial and host cells alike . neutrophils are the most abundant cell type found in the bal and sputum of active pulmonary tb patients and are second only to lymphocytes within lungs . one study found an inverse correlation between the development of pulmonary tb and the number of neutrophils in peripheral blood of contacts of active tb patients and in vitro depletion of neutrophils from whole blood led to poor induction of antimicrobial peptides ( amps ) and failure to restrict bcg and mtb growth . apoptotic neutrophils and purified neutrophil granules , both of which still contain active antimicrobial peptides , have been demonstrated to be taken up by infected macrophages and can lead to impairment of bacterial replication in vitro . apart from their degranulation capacity , neutrophils have recently been implicated in a more immunoregulatory role during mtb infection . interaction between programmed death ligand 1 ( pd - l1 ) on myeloid cells and programmed death receptor ( pd - 1 ) on lymphocytes is thought to promote the development of dysfunctional , or exhausted , lymphocyte responses during chronic infections . recent transcriptional profiling studies determined that cell surface expression of programmed death ligand 1 ( pd - l1 ) by neutrophils was primarily responsible for high levels of pd - l1 expression in whole blood of active tb patients . another study described a 393 blood - based transcript signature that differentiated active tb infection from healthy individuals with ltbi . from this , the authors derived an 86 - gene signature that corresponded to neutrophil expression of type i and type ii interferon inducible genes that distinguished active tb infection from other inflammatory conditions . it will be important to extend such global transcriptional analyses to the lung , which is the primary site of mtb infection in pulmonary tb . indeed , a recent study utilizing biopsy samples from a variety of human tissues to investigate the steady - state t cell compartment in different places throughout the body demonstrated that different tissue compartments , including the lung , contained distinct t cell populations and it is likely that the same principles apply to innate immune populations during states of infection . since neutrophils comprise a significant percentage of cells that infiltrate the lung during human tb , it will be important to determine their roles in lung tissue and their contribution to uncontrolled inflammation and immunopathology . dcs are the primary antigen presenting cells that initiate adaptive immune responses through their capacity to present antigen , their costimulatory capacity , and secretion of t - helper polarizing cytokines ( figure 3 ) . in mouse models of tb , it has been shown that dcs constitute a significant population of cells harboring mtb in vitro and in vivo . however , whether or not human dcs serve as a major cellular niche for mtb replication in vivo remains unclear . in vitro studies in monocyte - derived dcssuggest low levels of bacterial replication within these dcs , but further studies are needed to substantiate these observations . monocyte - derived human dcs express mannose receptors , cd11b , cd11c , and dc - sign , all of which are capable of recognizing mtb ligands . indeed , dc - sign has been shown to serve as a major receptor for mtb entry into dcs via recognition of manlam . under homeostatic conditions , dc - sign functions by binding icam - 2 on endothelial surfaces to allow for efficient dc migration . during mtb infection , ligation of dc - sign by mtb manlam leads to the induction of the anti - inflammatory cytokine il - 10 , which has been implicated in the impairment of dc maturation and expression of costimulatory molecules . other studies suggest that manlams are capable of inducing a negative signal that inhibits il - 12 production through both mannose receptor and dc - sign . these data suggest that mtb may be modulating dc functions in order to prevent optimal induction of host adaptive immunity . subversion of dc functions by mtb represents an ideal strategy for slow growing mtb to evade adaptive immunity . manipulation of dc maturation , cytokine production , and antigen presentation will affect the kinetics , nature , and magnitude of the t cell response and can provide mtb with time to establish a foothold within the lungs . studies that show impaired ability of mtb - infected monocyte - derived dcs to stimulate lymphoproliferation of nave and memory cd4s and cd8s provide strong evidence suggesting that mtb infection of dcs can impair t cell responses during human infection . since mtb is a slow growing organism , antigen availability , especially at the early stages of infection , may be an additional reason for poor t cell responses . under homeostatic conditions , dcs are able to retain peptide - mhc complexes at the cell surface much more efficiently than macrophages , primarily due to the downregulation of membrane associated ring - ch - 1 protein ( march1 ) , a ubiquitin e3 ligase that helps recycle cell surface mhc complexes . mhc class ii cycling from the phagosome to the plasma membraneis induced by dc maturation when tlrs first engage mtb ligands but may occur before the availability of loadable mtb antigens , thereby leading to mtb immune evasion from cd4 t cells . these data might suggest that mtb antigens are not properly represented during the initiation of adaptive immune responses and may lead to an overabundance of antigen specific t cells that are specific for antigens that may not be relevant at different stages of infection . it has been previously shown that bcg vaccination fails to elicit human t cell responses to latency associated mtb antigens and vaccination strategies implementing latency associated antigens have shown some promise in the mouse model . the dc plays a central role in the presentation of any mtb antigen throughout infection and future studies must look to the dc in order to understand why certain antigens are under or nonrepresented at the t cell level . many questions remain regarding the mechanisms that mtb employs to manipulate dcs and the subsequent consequences of that manipulation on the nature , kinetics , and magnitude of the adaptive immune response . studies in humans will remain limited as dcs are poorly represented in bal , and peripheral blood derived dcs may not be representative of dcs found in the lungs . nevertheless , it will be important to pursue mechanistic studies on lung dc biology during mtb infection in humans as well as in animal models of tb , including in mice and nonhuman primates where immunological reagents are readily available . nk cells act early during infection , are not mhc - restricted , and depend upon licensing based on engagement of various activating receptors found on their cell surface by ligands upregulated by stressed or infected target cells ( figure 4 ) . various mtb cell wall components , such as mycolic acids , are direct ligands for the natural cytotoxicity receptor ( ncr ) nkp44 on nk cells , and human nk cells exhibit the capacity to lyse mtb - infected macrophages in vitro . additionally , nk cells can also produce ifn - and il - 22 , which can inhibit intracellular growth of mtb in vitro by enhancing phagolysosomal fusion , or can promote the production of ifn - from cd8 t cells by stimulating il - 15 and il - 18 production from mtb - infected monocytes in vitro . studies on the functionality of nk cells in human tb are limited , but there are indications that nk cells may be functionally impaired during tb . patients newly diagnosed with pulmonary tb display decreased frequencies of nk cell subsets , coinciding with lowered expression of nkp30 , nkp46 , and ifn - . anti - tb treatment regimens leading to reductions in mycobacterial load have been shown to partially restore cytolytic capabilities of nk cells . furthermore , nk cells in patients with tuberculous pleurisy express high levels of icam - 1 , important for the establishment of the immunological synapse , chemokine receptors , and tlr expression , and are able to activate autologous lymphocytes under ex vivo conditions . in addition to direct killing , nk cells can also promote t cell proliferation via cd54 , tnf , gm - csf , and il - 12 and , upon recognition of an nk ligand , ulbp1 can restrict the expansion of regulatory t cells in an nkg2d / nkp46 dependent manner . these cells are sensitive to the local microenvironment and monocyte produced il - 10 has been shown to impair nk cell lytic capacity and decrease expression of activating nk cell receptors . very little is known about nk cells in human tb , but evidence suggests that they play a role in restricting bacterial growth indirectly , via promotion of cd8 and t cell responses , and directly , via killing of mtb - infected monocytes and macrophages . the success of mtb infection likely hinges upon its early interactions with cells of the innate immune system . macrophages and neutrophils can take up and kill bacteria but can be subverted by mtb to promote chronic inflammatory conditions harmful to the lung . additionally , dcs are central to the generation of mtb - specific t cells that can bolster immunity but are manipulated to establish poor or misdirected t cell responses . nk cells are capable of directly and indirectly promoting killing of mtb , but their functional capacity is diminished and little is known about how well they are activated during infection . each cell type has distinct roles to play in defending the host against mtb , but they are also readily coopted into helping mtb establish a long term infection . the difficulties of in vivo and lung in situ human studies are major roadblocks towards the understanding of innate immune responses during mtb infection , but population based immunogenetics studies can offer important insights into innate immune pathways critical for antimycobacterial immunity . historically , our knowledge regarding human innate and adaptive immune pathways involved during mtb infection stems from clinical observations in patients suffering from mendelian susceptibility to mycobacterial diseases ( msmd ) and then validated in murine models of tb . patients suffering from msmd have genetic polymorphisms that predispose them to infections with various environmental mycobacteria as well as infection with classically avirulent mycobacteria such as bcg , though a significant portion of msmd patients also suffer from disseminated tb . the importance of innate immunity in combating mycobacterial infections is highlighted in patients with mutations in two innate immune autosomal genes ( il12b and il12r1 ) , who suffer widespread and recurrent mycobacterial infections early in life . fortunately , individuals with polymorphisms in the il - 12 locus can receive treatment with exogenous il - 12 and are less likely to suffer from fatal infections , highlighting a role for macrophage and / or dc - derived il - 12 in the generation of ifn - responses that control infection . mutations in il12r1 are among the most common genetic factors associated with msmd resulting in susceptibility to primary mycobacterial infections . however , bcg vaccination of these individuals can confer resistance , which indicates that il - 12 signaling , and ifn - responses dependent on il - 12 , may not be completely required for secondary immunity . additionally , mutations in the leucine zipper domain of nf - b essential modulator ( nemo , also known as inhibitor of nf - b kinase subunit gamma or ikk - ) , encoding an intracellular protein involved in the activation of the nf - b pathway , has been demonstrated to predispose individuals to recurrent mycobacterial infections due to a lack of il - 12 production from monocytes and dcs . immunogenetics studies have also implicated other innate pathways , especially those related to pathogen sensing or cytokine and chemokine production , in immunity to mycobacterial infection . polymorphisms in tlr2 , tlr9 , tlr1 , tlr8 , and the intracellular signaling molecule tirap have all been associated with susceptibility to mycobacterial infection . the mechanisms for the association between tlr and mycobacterial infection are still unclear and studies in the murine model of tb seem to indicate redundant roles for tlrs and tlr - associated molecules such as myd88 in the generation of adaptive immune responses to mtb . aside from prrs , individuals with mutations in the inflammasome pathway have provided insight into the regulatory role of the inflammasome during mycobacterial infection . a gain of function gene variant in caspase - 1 coupled with a loss of function for inhibitory caspase recruitment domain family member 8 ( card8 ) promotes inflammatory diseases such as rheumatoid arthritis , but macrophages isolated from these individuals are more efficient at restricting mtb growth in vitro . polymorphisms in the il1 gene cluster and macrophage chemoattractant protein 1 ( mcp - 1 ) also predispose individuals to tb , presumably due to an inadequate inflammatory response against infection . indeed , il - 1 responses in humans seem to be linked to higher eicosanoid induction that curtails excessive inflammation promoted by type i ifns . collectively , these data suggest that the inflammasome pathway , and il - 1 in particular , may be critical in promoting enhanced immunity against mtb in humans . in another example , a population with low serum levels of vitamin d3 metabolites displayed increased susceptibility to active tb , validating in vitro results from human primary cells . these examples highlight the idea that immunogenetic studies on a population level are important parallel approaches that strengthen in vitro derived results in elucidating genes important in immunity against mtb . human immunogenetic studies provide an attractive avenue for the validation of several mechanisms of resistance against mtb observed in animal models of tb and can complement observations from in vitro human cells , but the innate immune response against pathogens , especially one as complex as mtb , is multigenic and very complex . it will be interesting , and potentially very rewarding , to examine innate immune genes in studies examining individuals who are highly exposed to mtb but who do not progress to active tb disease . this relatively resistant population , for example , health care workers in high - burden tb settings , should provide important clues to how the innate immune response may successfully handle mtb infection . innate immunity is a crucial component of the immune response against mtb but has received relatively little attention in studies of human tb . while myeloid cells serve as niches for bacterial replication , innate antimicrobial pathways activated early and throughout infection play a role in limiting disease and serve as potent regulators of antigen - specific adaptive immunity . tb disease results when pathological responses that promote chronic inflammation and lung damage dominate over protective responses that limit disease and eliminate bacteria . there is growing evidence indicating that innate immune cells are uniquely positioned to determine that balance between protective and pathogenic immune responses in human tb . however , mtb employs myriad potent mechanisms for evading antimicrobial responses and subverting the innate immune crosstalk with adaptive immunity , thereby tilting the balance towards pathological rather than protective immune responses . further study of human innate immune pathways during mtb infection will be important for developing host - directed immunomodulatory therapies for tb . further , a greater understanding of how innate immune responses impact adaptive immunity is critical for designing efficacious tb vaccines .\noutput:\n" }, { "from": "agent", "value": "tuberculosis ( tb ) remains a serious global public health problem that results in up to 2 million deaths each year . tb is caused by the human pathogen , mycobacterium tuberculosis ( mtb ) , which infects primarily innate immune cells patrolling the lung . innate immune cells serve as barometers of the immune response against mtb infection by determining the inflammatory milieu in the lungs and promoting the generation of adaptive immune responses . however , innate immune cells are also potential niches for bacterial replication and are readily manipulated by mtb . our understanding of the early interactions between mtb and innate immune cells is limited , especially in the context of human infection . this review will focus on mtb interactions with human macrophages , dendritic cells , neutrophils , and nk cells and detail evidence that mtb modulation of these cells negatively impacts mtb - specific immune responses . furthermore , this review will emphasize important innate immune pathways uncovered through human immunogenetic studies . insights into the human innate immune response to mtb infection are necessary for providing a rational basis for the augmentation of immune responses against mtb infection , especially with respect to the generation of effective anti - tb immunotherapeutics and vaccines ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: two adult ( 9 months of age ) and two old ( 28 months of age ) male wistar rats were used . all animals were bred under controlled environmental conditions with a 12 h light / dark cycle , and fed ad libitum with a standard commercial chow . the experimental protocols comply with the guidelines of the italian ministry of health as well as with internationally recognized guidelines . the rats were deeply anaesthetised with pentobarbital ( 50 mg / kg i.p . ) and then perfused via the ascending aorta with a brief prewash of 0.09 % nacl solution followed by 300 ml of a fixative solution containing 4 % paraformaldehyde in 0.1 m phosphate buffer , ph 7.4 at 4c . biceps brachii and quadriceps femoris muscles were quickly removed and placed in the same fixation solution for 2 h at 4c . after fixationfive - m - thick muscle samples were sectioned both transversally and longitudinally and then submitted to immunohistochemical procedures for fibre typing : sections were incubated overnight at 4c with a mouse monoclonal antibody recognizing the heavy chain of skeletal fast fibre myosin ( clone my - 32 , sigma - aldrich , buchs , switzerland ) , then revealed with an alexa 488 conjugated antibody against mouse igg ( molecular probes , invitrogen , milan ) . the sections were finally counterstained for dna with 0.1 g / ml hoechst 33258 to label the myonuclei and to detect the occurrence of apoptosis based on chromatin morphology . micrographs were taken in an olympus bx51 microscope equipped with a 100 w mercury lamp under the following conditions : 330 - to 385 - nm excitation filter ( excf ) , 400 - nm dichroic mirror ( dm ) , and 420 - nm barrier filter ( bf ) , for hoechst 33258 ; 450 - to 480 - nm excf , 500 - nm dm , and 515 nm bf for alexa 488 . images were recorded with an olympus camedia c - 5050 digital camera and stored on a pc by the olympus software for processing and printing . morphometrical evaluations were performed by using the software image j ( nih , usa ) . the cross - sectional area of transversally cut fibres was measured on 100 myofibres per sample at 40 magnification . moreover , the percentage of fast and slow muscle fibres was calculated on a total of 300 fibres per muscle . to evaluate nuclear density in fast fibres , the area of longitudinally sectioned myofibres was measured up to a total of about 15,000 m per muscle ( mean valuese : 15,072.2115.01 m ) at 40 magnification , myonuclei were counted and the nuclear density was expressed as the number of myonuclei / 100 m of myofibre area . finally , the percentage of apoptotic nuclei was evaluated , using a 20 objective lens , on a total of 25 microscope fields ( at least 2000 myonuclei per muscle sample were counted ) . after fixation , muscle samples were washed in srensen buffer and subsequently in phosphate buffer saline ( pbs ) , kept in 0.5 m nh4cl in pbs for 45 min to block free aldehydes , dehydrated with ethanol and embedded in lr white resin polymerized under u.v . ultrathin sections were collected on formvar - carbon coated nickel grids and used for morphometrical and immunocytochemical analyses . morphometrical evaluations were made on micrographs ( 11,000 ) of twenty myonuclei from longitudinally sectioned fibres per muscle by using a computerized image analysis system ( analysis image processing , soft imaging system gmbh , muenster , germany ) . the following parameters were considered : area of nuclei , nucleoli and fibrillar centres ( fcs ) ; percentage of nuclear area occupied by condensed chromatin ; percentage of total fc , dense fibrillar component ( dfc ) and granular component ( gc ) area per nucleolus ; pg density ( pg / m of nucleoplasm ) ; nuclear pore frequency ( np / m of perimeter ) . to investigate the fine distribution of some rna transcription and processing factors , muscle sections were treated with the following probes : mouse monoclonal antibodies directed against the active phosphorylated form of rna polymerase ii ( research diagnostic inc . , flanders , nj ) or against the ( sm ) snrnp ( small nuclear rnp ) core protein ( abcam , cambridge , ma ) ; rabbit polyclonal antibodies were used against dna / rna hybrid molecules ( testillano et al . , 1994 ) specifically occurring in the transcriptional sites ( malatesta et al . , 2008 , 2009 ) , and the cleavage stimulation factor cstf ( veraldi et al . , 2001 ) . sections were incubated with the primary antibodies revealed by secondary gold - conjugated probes as described in malatesta et al . some grids were incubated without the primary antibody and then processed as described above . in situ hybridization for polyadenylated rnas was carried out by using a biotinylated oligo d ( t ) ( sigma - aldrich , buchs , switzerland ) reacted with a gold - conjugated goat anti - biotin antibody ( aurion , wageningen , the netherlands ) as reported in cisterna et al . some grids were incubated in the absence of the probe , or pre - treated with 0.1 % rnaase for 18 h. to reduce chromatin contrast and selectively reveal nuclear rnp constituents , the sections were bleached by the edta method ( bernhard , 1969 ) and observed in a philips morgagni tem operating at 80kv and equipped with a megaview ii camera for digital image acquisition . quantitative assessment of the immunolabelling was carried out by estimating the gold grain density over selected cellular compartments on sections treated in the same run . the surface area of nucleoplasm and nucleolus was measured on fifteen randomly selected electron micrographs ( 22,000 ) from each animal by using a computerised image analysis system ( analysis image processing , soft imaging system gmbh ) . for background evaluation samples treated in the absence of primary antibody or pre - treated with rnaasegold grains present over each selected compartment were counted and the labelling density was expressed as number of gold grains / m . results for each measured parameterwere pooled according to the experimental groups and the meansstandard error of the mean ( se ) values calculated . statistical comparisons were performed by the mann whitney u test ( significance set at p0 .05 ) . five - m - thick muscle samples were sectioned both transversally and longitudinally and then submitted to immunohistochemical procedures for fibre typing : sections were incubated overnight at 4c with a mouse monoclonal antibody recognizing the heavy chain of skeletal fast fibre myosin ( clone my - 32 , sigma - aldrich , buchs , switzerland ) , then revealed with an alexa 488 conjugated antibody against mouse igg ( molecular probes , invitrogen , milan ) . the sections were finally counterstained for dna with 0.1 g / ml hoechst 33258 to label the myonuclei and to detect the occurrence of apoptosis based on chromatin morphology . micrographs were taken in an olympus bx51 microscope equipped with a 100 w mercury lamp under the following conditions : 330 - to 385 - nm excitation filter ( excf ) , 400 - nm dichroic mirror ( dm ) , and 420 - nm barrier filter ( bf ) , for hoechst 33258 ; 450 - to 480 - nm excf , 500 - nm dm , and 515 nm bf for alexa 488 . images were recorded with an olympus camedia c - 5050 digital camera and stored on a pc by the olympus software for processing and printing . morphometrical evaluations were performed by using the software image j ( nih , usa ) . the cross - sectional area of transversally cut fibres was measured on 100 myofibres per sample at 40 magnification . moreover , the percentage of fast and slow muscle fibres was calculated on a total of 300 fibres per muscle . to evaluate nuclear density in fast fibres , the area of longitudinally sectioned myofibres was measured up to a total of about 15,000 m per muscle ( mean valuese : 15,072.2115.01 m ) at 40 magnification , myonuclei were counted and the nuclear density was expressed as the number of myonuclei / 100 m of myofibre area . finally , the percentage of apoptotic nuclei was evaluated , using a 20 objective lens , on a total of 25 microscope fields ( at least 2000 myonuclei per muscle sample were counted ) . after fixation , muscle samples were washed in srensen buffer and subsequently in phosphate buffer saline ( pbs ) , kept in 0.5 m nh4cl in pbs for 45 min to block free aldehydes , dehydrated with ethanol and embedded in lr white resin polymerized under u.v . ultrathin sections were collected on formvar - carbon coated nickel grids and used for morphometrical and immunocytochemical analyses . morphometrical evaluations were made on micrographs ( 11,000 ) of twenty myonuclei from longitudinally sectioned fibres per muscle by using a computerized image analysis system ( analysis image processing , soft imaging system gmbh , muenster , germany ) . the following parameters were considered : area of nuclei , nucleoli and fibrillar centres ( fcs ) ; percentage of nuclear area occupied by condensed chromatin ; percentage of total fc , dense fibrillar component ( dfc ) and granular component ( gc ) area per nucleolus ; pg density ( pg / m of nucleoplasm ) ; nuclear pore frequency ( np / m of perimeter ) . to investigate the fine distribution of some rna transcription and processing factors , muscle sections were treated with the following probes : mouse monoclonal antibodies directed against the active phosphorylated form of rna polymerase ii ( research diagnostic inc . , flanders , nj ) or against the ( sm ) snrnp ( small nuclear rnp ) core protein ( abcam , cambridge , ma ) ; rabbit polyclonal antibodies were used against dna / rna hybrid molecules ( testillano et al . , 1994 ) specifically occurring in the transcriptional sites ( malatesta et al . , 2008 , 2009 ) , and the cleavage stimulation factor cstf ( veraldi et al . , 2001 ) . sections were incubated with the primary antibodies revealed by secondary gold - conjugated probes as described in malatesta et al . some grids were incubated without the primary antibody and then processed as described above . in situ hybridization for polyadenylated rnas was carried out by using a biotinylated oligo d ( t ) ( sigma - aldrich , buchs , switzerland ) reacted with a gold - conjugated goat anti - biotin antibody ( aurion , wageningen , the netherlands ) as reported in cisterna et al . , some grids were incubated in the absence of the probe , or pre - treated with 0.1 % rnaase for 18 h. to reduce chromatin contrast and selectively reveal nuclear rnp constituents , the sections were bleached by the edta method ( bernhard , 1969 ) and observed in a philips morgagni tem operating at 80kv and equipped with a megaview ii camera for digital image acquisition . quantitative assessment of the immunolabelling was carried out by estimating the gold grain density over selected cellular compartments on sections treated in the same run . the surface area of nucleoplasm and nucleolus was measured on fifteen randomly selected electron micrographs ( 22,000 ) from each animal by using a computerised image analysis system ( analysis image processing , soft imaging system gmbh ) . for background evaluation samples treated in the absence of primary antibody or pre - treated with rnaasegold grains present over each selected compartment were counted and the labelling density was expressed as number of gold grains / m . results for each measured parameter were pooled according to the experimental groups and the meansstandard error of the mean ( se ) values calculated . statistical comparisons were performed by the mann whitney u test ( significance set at p0 .05 ) . fast myofibres ( figure 2 a d ) showed markedly smaller cross - sectional area in both biceps and quadriceps muscles of old rats compared to adult animals ; slow fibres also were reduced in size in old rats , but the difference between the two groups was not statistically significant . in old rats the percentage of slow fibre was higher than in adult animals , but the difference was not significant . nuclear density in the fast fibres ( figure 3 a , b , f ) was significantly higher in old than in adult rats , in both biceps and quadriceps muscles . morphologically recognizable apoptotic nuclei ( figure 3 c e ) were quite scarce ( generally less than 0.2 % ) and their percentage was similar in adult and old animals in both biceps and quadriceps muscles . figure 1light microscopy morphometric parameters considered in biceps and quadriceps muscle myofibres of adult and old rats ( meansse ) . light microscopy morphometric parameters considered in biceps and quadriceps muscle myofibres of adult and old rats ( meansse ) . figure 2immunolabelled fast type ii fibres in the biceps ( a , b ) and quadriceps ( c , d ) of adult ( a , c ) and old ( b , d ) rats . immunolabelled fast type ii fibres in the biceps ( a , b ) and quadriceps ( c , d ) of adult ( a , c ) and old ( b , d ) rats . figure 3quadriceps muscle from an adult ( a ) and an old ( b ) rat ; dna was stained with hoechst 33258 . very few apoptotic nuclei with typical chromatin condensation and nuclear fragmentation ( arrows ) were observed in both adult ( c , d ) and old ( e ) animals . the nuclear density is higher in both biceps and quadriceps muscles of old animals ( f ) ; asterisks show significantly different values . quadriceps muscle from an adult ( a ) and an old ( b ) rat ; dna was stained with hoechst 33258 . very few apoptotic nuclei with typical chromatin condensation and nuclear fragmentation ( arrows ) were observed in both adult ( c , d ) and old ( e ) animals . the nuclear density is higher in both biceps and quadriceps muscles of old animals ( f ) ; asterisks show significantly different values . in all muscle samples myofibres contained multiple , elongated cell nuclei typically placed close to the sarcolemma . myonuclei generally showed finely irregular border , condensed chromatin clumps at both the nuclear and nucleolar periphery , one roundish nucleolus characterized by a few fc , and abundant dfc and gc ( figure 4 ) . in the nucleoplasm , all the usual rnp structural constituents involved in pre - mrna transcription and processing - i.e. , pf , pg and ig - were obvious . morphological evidence of nuclear apoptosis was never observed in all muscle samples examined . in both biceps and quadriceps muscles of old rats , myonuclei had smaller area and were characterized by a higher percentage of condensed chromatin , a higher density of pg and nucleoli with smaller fc compared to adult animals ( figure 5 ) . conversely , there was no difference in either the nucleolar area or the percentage of dfc and gc in adult and old rats . figure 4myonuclei of quadriceps from adult ( a ) and old ( b ) rats . in old animals , condensed chromatin ( ch ) is more abundant and perichromatin granules are more numerous ( inset ) than in adult ones , whereas nucleoli ( nu ) show a similar aspect . myonuclei of quadriceps from adult ( a ) and old ( b ) rats . in old animals , condensed chromatin ( ch ) is more abundant and perichromatin granules are more numerous ( inset ) than in adult ones , whereas nucleoli ( nu ) show a similar aspect . figure 5electron microscopy morphometric parameters considered in myonuclei of biceps and quadriceps muscles of adult and old rats ( meansse ) . electron microscopy morphometric parameters considered in myonuclei of biceps and quadriceps muscles of adult and old rats ( meansse ) . immunocytochemical results showed similar distribution of polymerase ii , dna / rna hybrid molecules , snrnps , cleavage factor cstf and polyadenylated rna in adult and old rats . in both animal groups , polymerase ii was exclusively associated with pf ( figure 6 a , b ) ; dna / rna hybrid molecules specifically labelled pf ( figure 6 a , b ) and the nucleolar dfc ( not shown ) ; snrnps were restricted to pf and , at a lesser degree , to igs ( figure 6 c , d ) ; cstf and polyadenylated rna were located essentially on the pf and also on rnp tails rising from pg ( figure 6 eh ) . figure 6myonuclei from adult ( a , c , e , g ) and old ( b , d , f , h ) ratsquadriceps muscles , anti - polymerase ii ( 12 nm ) and anti - dna / rna hybrid ( 5 nm ) antibodies : both antibody probes specifically label perichromatin fibrils . biceps muscles , anti - snrnp antibody : perichromatin fibrils and interchromatin granules ( ig ) are labelled . quadriceps muscles , polyadenylated rna : the labelling occurs on perichromatin fibrils and on rnp tails rising from perichromatin granules ( arrows ) . myonuclei from adult ( a , c , e , g ) and old ( b , d , f , h ) rats . quadriceps muscles , anti - polymerase ii ( 12 nm ) and anti - dna / rna hybrid ( 5 nm ) antibodies : both antibody probes specifically label perichromatin fibrils . biceps muscles , anti - snrnp antibody : perichromatin fibrils and interchromatin granules ( ig ) are labelled . quadriceps muscles , polyadenylated rna : the labelling occurs on perichromatin fibrils and on rnp tails rising from perichromatin granules ( arrows ) . quantitative evaluation of the immunolabelling ( figure 7 ) revealed lower nucleoplasmic density of polymerase ii , dna / rna hybrid molecules and snrnps in both biceps and quadriceps muscles of old rats ; conversely , cstf and polyadenylated rna were more abundant in the nucleoplasm of old than adult rats . no difference was found between the two age groups for nucleolar labelling obtained with any probes . figure 7quantitative immunoelectron microscopy of myonuclei of biceps and quadriceps mucles from adult and old rats ; labelling density ( gold grains / m ) of several rna processing factors in the nucleoplasm and nucleolar compartments ( meansse ) . quantitative immunoelectron microscopy of myonuclei of biceps and quadriceps mucles from adult and old rats ; labelling density ( gold grains / m ) of several rna processing factors in the nucleoplasm and nucleolar compartments ( meansse ) . fast myofibres ( figure 2 a d ) showed markedly smaller cross - sectional area in both biceps and quadriceps muscles of old rats compared to adult animals ; slow fibres also were reduced in size in old rats , but the difference between the two groups was not statistically significant . in old rats the percentage of slow fibre was higher than in adult animals , but the difference was not significant . nuclear density in the fast fibres ( figure 3 a , b , f ) was significantly higher in old than in adult rats , in both biceps and quadriceps muscles . morphologically recognizable apoptotic nuclei ( figure 3 c e ) were quite scarce ( generally less than 0.2 % ) and their percentage was similar in adult and old animals in both biceps and quadriceps muscles . figure 1light microscopy morphometric parameters considered in biceps and quadriceps muscle myofibres of adult and old rats ( meansse ) . light microscopy morphometric parameters considered in biceps and quadriceps muscle myofibres of adult and old rats ( meansse ) . figure 2immunolabelled fast type ii fibres in the biceps ( a , b ) and quadriceps ( c , d ) of adult ( a , c ) and old ( b , d ) rats . immunolabelled fast type ii fibres in the biceps ( a , b ) and quadriceps ( c , d ) of adult ( a , c ) and old ( b , d ) rats . figure 3quadriceps muscle from an adult ( a ) and an old ( b ) rat ; dna was stained with hoechst 33258 . very few apoptotic nuclei with typical chromatin condensation and nuclear fragmentation ( arrows ) were observed in both adult ( c , d ) and old ( e ) animals . the nuclear density is higher in both biceps and quadriceps muscles of old animals ( f ) ; asterisks show significantly different values . quadriceps muscle from an adult ( a ) and an old ( b ) rat ; dna was stained with hoechst 33258 . very few apoptotic nuclei with typical chromatin condensation and nuclear fragmentation ( arrows ) were observed in both adult ( c , d ) and old ( e ) animals . the nuclear density is higher in both biceps and quadriceps muscles of old animals ( f ) ; asterisks show significantly different values . in all muscle samples myofibres contained multiple , elongated cell nuclei typically placed close to the sarcolemma . myonuclei generally showed finely irregular border , condensed chromatin clumps at both the nuclear and nucleolar periphery , one roundish nucleolus characterized by a few fc , and abundant dfc and gc ( figure 4 ) . in the nucleoplasm , all the usual rnp structural constituents involved in pre - mrna transcription and processing - i.e. , pf , pg and ig - were obvious . morphological evidence of nuclear apoptosis was never observed in all muscle samples examined . in both biceps and quadriceps muscles of old rats , myonuclei had smaller area and were characterized by a higher percentage of condensed chromatin , a higher density of pg and nucleoli with smaller fc compared to adult animals ( figure 5 ) . conversely , there was no difference in either the nucleolar area or the percentage of dfc and gc in adult and old rats . figure 4myonuclei of quadriceps from adult ( a ) and old ( b ) rats . in old animals , condensed chromatin ( ch ) is more abundant and perichromatin granules are more numerous ( inset ) than in adult ones , whereas nucleoli ( nu ) show a similar aspect . myonuclei of quadriceps from adult ( a ) and old ( b ) rats . in old animals , condensed chromatin ( ch ) is more abundant and perichromatin granules are more numerous ( inset ) than in adult ones , whereas nucleoli ( nu ) show a similar aspect . figure 5electron microscopy morphometric parameters considered in myonuclei of biceps and quadriceps muscles of adult and old rats ( meansse ) . electron microscopy morphometric parameters considered in myonuclei of biceps and quadriceps muscles of adult and old rats ( meansse ) . immunocytochemical results showed similar distribution of polymerase ii , dna / rna hybrid molecules , snrnps , cleavage factor cstf and polyadenylated rna in adult and old rats . in both animal groups , polymerase ii was exclusively associated with pf ( figure 6 a , b ) ; dna / rna hybrid molecules specifically labelled pf ( figure 6 a , b ) and the nucleolar dfc ( not shown ) ; snrnps were restricted to pf and , at a lesser degree , to igs ( figure 6 c , d ) ; cstf and polyadenylated rna were located essentially on the pf and also on rnp tails rising from pg ( figure 6 eh ) . figure 6myonuclei from adult ( a , c , e , g ) and old ( b , d , f , h ) rats . quadriceps muscles , anti - polymerase ii ( 12 nm ) and anti - dna / rna hybrid ( 5 nm ) antibodies : both antibody probes specifically label perichromatin fibrils . biceps muscles , anti - snrnp antibody : perichromatin fibrils and interchromatin granules ( ig ) are labelled . quadriceps muscles , polyadenylated rna : the labelling occurs on perichromatin fibrils and on rnp tails rising from perichromatin granules ( arrows ) . myonuclei from adult ( a , c , e , g ) and old ( b , d , f , h ) ratsquadriceps muscles , anti - polymerase ii ( 12 nm ) and anti - dna / rna hybrid ( 5 nm ) antibodies : both antibody probes specifically label perichromatin fibrils . biceps muscles , anti - snrnp antibody : perichromatin fibrils and interchromatin granules ( ig ) are labelled . quadriceps muscles , polyadenylated rna : the labelling occurs on perichromatin fibrils and on rnp tails rising from perichromatin granules ( arrows ) . quantitative evaluation of the immunolabelling ( figure 7 ) revealed lower nucleoplasmic density of polymerase ii , dna / rna hybrid molecules and snrnps in both biceps and quadriceps muscles of old rats ; conversely , cstf and polyadenylated rna were more abundant in the nucleoplasm of old than adult rats . no difference was found between the two age groups for nucleolar labelling obtained with any probes . figure 7quantitative immunoelectron microscopy of myonuclei of biceps and quadriceps mucles from adult and old rats ; labelling density ( gold grains / m ) of several rna processing factors in the nucleoplasm and nucleolar compartments ( meansse ) . quantitative immunoelectron microscopy of myonuclei of biceps and quadriceps mucles from adult and old rats ; labelling density ( gold grains / m ) of several rna processing factors in the nucleoplasm and nucleolar compartments ( meansse ) . sarcopenia entails reduction of skeletal muscle mass , strength and resistance , with consequent impairment of performance in older individuals . in sarcopenia , muscles undergo loss of myofibres as well as decrease in total cross - sectional area of the remaining myofibres , both phenomena affecting preferentially type ii fibres ( larsson et al . , 1978 ; shorey et al . accordingly , our data demonstrate a significant reduction in type ii myofibre size in both biceps brachii and quadriceps femoris muscles of old rats . in addition , an increased - although not statistically significant - percentage of type i fibres is found in old animals , suggesting a preferential loss of type ii fibres ; however , there is conflicting evidence of changes in fibre type proportion in muscle in sarcopenia , some authors reporting no modifications ( review in hepple , 2003 ) . muscle fibres are multinucleated syncitia and a reduction in fibre size could provoke alteration in nuclear number , nuclear domain size or both ; however , studies on fibre atrophy conflict on whether these features undergo modifications or not . this is mainly due to the differences in muscle , myofibre and atrophy type that were investigated ( for a recent review see brooks et al . ,2009 ) ; moreover , it has been demonstrated that myofibre size and nuclear number can be uncoupled in different phases of the ageing process ( wada et al . , 2003 ; , it was found that nuclear density is higher in aged type ii myofibres , according to previous reports on muscle atrophy ( tomonaga , 1977 ; manta et al . , 1987 ; gallegly et al . , 2004 ; kadi et al . , 2004 ; edstrm and ulfhake , 2005 ) . this finding , together with the scarce presence of morphologically recognizable apoptotic nuclei ( both at light and electron microscopy ) suggests that only a limited nuclear death rate occurs in ageing skeletal muscles . it has been hypothesized that apoptotic induced loss of myonuclei may be involved in muscle protein degradation , thus contributing to fibre atrophy and , finally , myocyte death ( leeuwenburgh , 2003 ; dirks and leeuwenburgh , 2005 ; alway and siu , 2008 ) . however , the role of apoptosis in myofibre depletion is still debated ( dirks and leeuwenburgh , 2005 , dupont - versteegden , 2005 ) , some authors asserting that apoptotic signals mostly originate from satellite cells and connective tissue rather than from myofibres ( gundersen and bruusgaard , 2008 ) . the present observations are in agreement with previous data on hindlimb muscles of old mice demonstrating that apoptosis is quite scarce in both sedentary and trained animals ( zancanaro et al . , 2007 ) as well as with ultrastructural studies showing the absence of typical apoptosis in atrophic myofibres ( rodrigues and schmalbruch , 1995 ; borisov and carlson , 2000 ) . however , it should be considered that our data have been collected in old animals where the sarcopenic process had already come to an advanced stage ; this implies that a role of apoptosis in earlier phases can not be excluded . the myonuclei of aged type ii fibres show morpho - functional features suggestive of a reduced activity in comparison to myonuclei of adult individuals . smaller size and an increased amount of condensed chromatin together with lower quantity of phosphorylated polymerase ii and dna / rna hybrid molecules , specifically occurring at transcriptional sites , clearly indicate a decrease in pre - mrna transcription rate ( malatesta et al . , 2008 , 2009 ) . the biological activity of many transcription factors is modulated by the redox state of the cell ( roijkind et al . , 2002 ) and it is possible that the progressive increase of oxidative stress during ageing ( stadtman , 2004 , 2006 ; lesnefsky and hoppel , 2006 ) contributes to the reduction of the transcription rate . according to the decrease in transcription rate , myonuclei of old rats contain lower amounts of nucleoplasmic splicing factors , involved in the co - transcriptional pre - mrna splicing ( lhrmann et al . , in addition , myonuclei of aged fibres show an accumulation of cleavage factors and polyadenylated rna , strongly suggesting a reduction in the processing and transport rate of pre-mrna . the accumulation of pg further supports the hypothesis of decreased pre - mrna transcriptional / co - transcriptional activities and reduced cytoplasmic export . in fact , pg represent storage and / or transport sites for spliced mrna , and pg accumulation has been described as a consequence of altered pre - mrna processing as well as of impaired intranuclear or nucleus - to - cytoplasm transport ( e.g. puvion et al . , 1977 ; puvion - dutilleul et al . , 1981 ; lafarga et al . , 1993 ; accordingly , a decrease in nucleus - to - cytoplasm transport factors ( pujol et al . , 2002 ) has been reported during ageing , when the degradation systems also undergo alterations ( jameson , 2004 ) leading to the accumulation of crosslinked , insoluble and often oxidized proteins which may damage the intracellular transport mechanisms ( hallen , 2002 ; kim et al . , 2001 ) ; the intranuclear accumulation of rna with poly ( a ) tails , known to be involved in stabilization , localization and translation of mrnas ( e.g. soreq et al . , 1974 ; marbaix et al . , 1975interestingly , malfunctions of the proteolytic and autophagic pathways are thought to be involved in sarcopenia ( attaix et al . , 2005 ; combaret et al . , in fact , a significant reduction was observed in the fc only , whereas minor changes were found for the dfc and gc . however , the slight decrease of the dfc together with the lower ( though not statistically significant ) amount of dna / rna hybrid molecules in the nucleoli in aged fibres points to a reduction in the rrna synthetic rate ( schwarzacher and wachtler , 1993 ; shaw and jordan , 1995 ) ; in addition , the small increase of the gc may be the consequence of an impaired nucleus - to - cytoplasm transport of pre - ribosomal subunits . it seems therefore that , during ageing , in myonuclei the entire production chain of rna , from synthesis to cytoplasmic export , is less efficient . the reduction in muscle tissue mass with ageing has been attributed to a disruption in the regulation of skeletal muscle protein turnover , leading to a structural imbalance between muscle protein synthesis and degradation ( reviewed in koopman , 2009 ) ; in this view , altered rna pathways may contribute to the reduced nuclear responsiveness to cellular metabolic needs . accordingly , no decrease in the basal rates of muscle protein synthesis has been found in elderly , whereas during ageing the muscle protein synthetic response to the main anabolic stimuli , i.e. food intake and / or physical activity , is blunted ( koopman , 2009 ) . moreover , a reduction of nuclear activity would be consistent with the reduction in nuclear domain size observed in aged fibres . interestingly , most of the changes found in myonuclei of aged fibres are reminiscent of those observed in senescent hepatocyte nuclei ( malatesta et al . , 2003 , 2004 ) , and indicate that impairment in rna pathways represents a general phenomenon during ageing . moreover , defective rna pathways due to nuclear sequestration of pre - mrnas and processing factors have been recently related to diseases leading to muscle atrophy / dystrophy ( cardani et al . , 2006 ; wheeler and thornton , 2007 ) : the results of the present study suggest intriguing similarities in the basic mechanisms of sarcopenic and dystrophic processes , thus opening promising perspectives for preventing and treating skeletal muscle wasting .\noutput:\n" }, { "from": "agent", "value": "advancing adult age is associated with a progressive decrease in skeletal muscle mass , strength and quality known as sarcopenia . the mechanisms underlying age - related skeletal muscle wasting and weakness are manifold and still remain to be fully elucidated . despite the increasing evidence that the progress of muscle diseases leading to muscle atrophy / dystrophy may be related to defective rna processing , no data on the morpho - functional features of skeletal muscle nuclei in sarcopenia are available at present . in this view , we have investigated , by combining morphometry and immunocytochemistry at light and electron microscopy , the fine structure of myonuclei as well as the distribution and amount of rna processing factors in skeletal myofibres of biceps brachii and quadriceps femoris from adult and old rats . results demonstrate that the myonuclei of aged type ii fibres show an increased amount of condensed chromatin and lower amounts of phosphorylated polymerase ii and dna / rna hybrid molecules , clearly indicating a decrease in pre - mrna transcription rate compared to adult animals . in addition , myonuclei of aged fibres show decreased amounts of nucleoplasmic splicing factors and an accumulation of cleavage factors , polyadenilated rna and perichromatin granules , suggesting a reduction in the processing and transport rate of pre - mrna . during ageing , it seems therefore that in rat myonuclei the entire production chain of mrna , from synthesis to cytoplasmic export , is less efficient . this failure likely contributes to the reduced responsiveness of muscle cells to anabolic stimuli in the elderly ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: evidence has suggested that whole - body cooling prevents oxidative damage after traumatic brain injury ( tbi ) , hemorrhage shock , and transient focal cerebral ischemia . oxidative damage is caused by nitric oxide ( no ) , hydroxyl radical ( oh ) , and peroxynitrite ( onoo ) . nitric oxide is produced in a reaction that converts arginine to citrulline under control of inducible nitric oxide synthase ( inos ) whereas hydroxyl radicals are cleared by superoxide dismutase ( sod ) . superoxide reacts with no to produce peroxynitrite which reacts with tyrosine to produce 3 - nitrotyrosine ( 3 - nt ) . we have demonstrated that hypothermic retrograde jugular vein flush ( hrjvf ) without cardiopulmonary bypass reduces both oxidative damage and cerebrovascular dysfunction during heat stroke in rats . although whole body cooling is effective in reducing oxidative damage after tbi in rats , it is interesting to note whether the oxidative damage that occurred during tbi can be affected by selective brain cooling caused by hrjvf in the rat . the aim of the present study was to investigate the effect of hrjvf caused by infusion of 4c cold saline via the external jugular vein on oxidative damage that occurred during tbi . brain levels of malondialdehyde ( mda ) , glutathione peroxidase ( gpx ) , glutathione reductase ( gr ) , sod , catalase , inos , and 3 - nt were measured as indicators of oxidative stress . animals were kept under a 12 - h / 12 - h light / dark cycle and allowed free access to food and water . all experimental procedures conformed to national institute of health guidelines and were approved by the chi mei medical center animal care and use committee to minimize discomfort to the animals during surgery and in the recovery period . animals were randomly assigned to sham group ( n = 8 ) , untreated tbi normothermic group ( n = 8 ) , or tbi hypothermic group ( n = 8 ) . all tests were run blinded , and the animal codes were revealed only at the end of the behavioral and histological analyses . in tbi normothermic or hypothermic groups , animals were treated with 37c or 4c saline ( 1.7 ml / 100 g of body weight over 5 minutes ) via the right external jugular vein ( cranial direction ) , respectively , and immediately after injury . animals used for histological or behavioral studies were provided food and water ad libitum throughout the study . animals were anesthetized with sodium pentobarbital ( 25 mg / kg , i.p . ; sigma chemical co. st louis , mo ) and a mixture containing ketamine ( 44 mg / kg , i.m . ; nan kuang pharmaceutical , tainan , taiwan ) , atropine ( 0.02633 mg / kg , i.m . ; sintong chemical industrial co. ltd . taoyuan , taiwan ) , and xylazine ( 6.77 mg / kg , i.m . ; bayer , leverkusen , germany ) . after cannulation , the wound was sutured , and the animals were turned to the prone position . the animals were placed in a stereotoxic frame , and the scalp was incised sagittally . after an incision in the scalp was made , a 4.8 - mm circular craniotomy was performed midway between lambda and bregma 3.0 mm to the right of the central suture . a modified luer - lock connector ( trauma cannula ) , 2.6 mm inner diameter , was secured into the craniotomy with cyanoacrylic adhesive and dental acrylic . a moderate tbi ( 2.2 atm ) was produced by rapidly injecting a small volume of saline into the closed cranial cavity with a fluid percussion device ( vcu biomedical engineering , richmond , va , usa ) . the animal was removed from the device , the acrylic removed , and the incision sutured . each injured and sham - injured animals for fluid percussion model was closely evaluated immediately after fpi for behavioral recovery . experiment 1 , brain cooling was randomly performed immediately after tbi , and their effects on both motor function and infarction volume were assessed 3 days after tbi . in experiment 2 , brain cooling was randomly performed immediately after tbi , and their effects on the concentrations of mda , sod , gr , gpx , and catalase in the ischemic cortex were assessed 3 days after tbi . in experiment 3 , brain cooling was randomly performed immediately after tbi , and their effects on the amounts of both inos - positive cells and 3 - nt - positive cells in the ischemic cortex were assessed 3 days after tbi . the inclined plane was used to measure limb strength . animals were placed , facing right and then left , perpendicular to the slope of a 2020 cm ruffer ribbed surface of an inclined plane starting at an angle of 55c . the angle was increased or decreased in 5 increments to determine the maximal angle an animal could hold to the plane . data for each day were the means of left and right side maximal angles . the triphenyltetrazolium chloride ( ttc ) staining procedures followed those described elsewhere . all animals were sacrificed 3 days after fluid percussion injury . under deep anesthesia ( sodium pentobarbital , 100 mg / kg , ip ) , the brain tissue was then removed , immersed in cold saline for 5 minutes , and sliced into 1.0 - mm sections . the brain slices were incubated in 2 % ttc dissolved in ringer 's solution for 10 minutes at 37c , and then transferred to 10 % formaldehyde solution for fixation . the volume of contusion , as revealed by negative ttc stains indicating dehydrogenase - deficient tissue , was measured in each slice and summed using computerized planimetry ( pc - based image tools software ) . the volume of infarction was calculated as 1 mm ( thickness of the slice ) [ sum of the contusion area in all brain slices ( mm ) ] . all animals were sacrificed at the third day after fluid percussion injury . under deep anesthesia ( sodium pentobarbital , 100 mg / kg , i.p . ) , animals were perfused intracardially with saline . the injured brain tissue proper ( core region ) was then removed and dissected out the cortex for determination of mda , gpx , gr , sod , and catalase contents . as demonstrated in figure 1 , the marked contusion focuswas dissected out of the brain for the above - mentioned laboratory tests for free radical compounds . lipid peroxidation was assessed by measuring the levels of mda with 2 - thiobarbituric acid ( tba ) to form a chromophore absorbing at 532 nm . about 0.1 g of brain tissue was homogenized with 1.5 ml of 0.1 m phosphate buffer at ph 3.5 . the reaction mixture ( 0.2 ml of sample , 1.5 ml of 20 % acetic acid , 0.2 ml of 8.1 % sodium dodecylsulfate , and 1.5 ml of aqueous solution of 0.8 tba , up to 4 ml with distilled water ) was heated to 95c for 1 h and then 5 ml of n - butanol and pyridine ( 15 : 1 v / v ) was added . the mixture was vortexed vigorously , centrifuged at 1500 g for 10 minutes , and the absorbance of the organic phase measured at 532 nm . the values are expressed as nanomoles of tba - reactive substance ( mda equivalent ) per milligram of protein . to measure cytosolic gpx and gr activities , tissues were homogenized in buffer solutions containing 50 mm tris - hcl ( ph7 .5 ) , 5 mm edta , and 1 mm dithiothreitol . the homogenates were centrifuged at 8500 g for 15 minutes at 4c , and supernatants were used for gpx and gr activity assay . the gpx and gr activities were performed with a commercial glutathione peroxidase cellular activity assay kit ( oxis research , portland , usa ) and a glutathione reductase assay kit ( oxis research , portland , usa ) , respectively . one unit of gpx or gr activity was defined as the amount of sample required to oxidize 1 mol of nadph per minute based on the molecular absorbance of 6.2210 for nadph . to measure cytosolic sod and catalase activities , tissues were homogenized in 200 mm phosphate buffer , ph7 .0 . the homogenates were centrifuged at 3000 g for 10 minutes at 4c , and supernatants were used for sod and catalase activity assay . the sod and catalase activity were performed with a sod activity commercial kit ( oxis research , portland , usa ) and a catalase activity commercial kit ( oxis research , portland , usa ) , respectively . the sod activity is determined from the ratio of the autoxidation rates in the presence ( vs ) and in the absence ( vc ) of sod . one sod activity unit is defined as the activity that doubles the autoxidation rate of the control bland ( vx / vc = 2 ) . the catalase activity is determined from the catalase standard curve ( oxis research , portland , usa ) . coronal brain sections ( 7 - m - thick ) were cut on a cryostat and were thaw - mounted on gelatin - coated slides . tissue sections were permeabilized , and free protein binding sites were subsequently blocked for a 60 - minute - incubation with 10 % normal goat serum / 0.4 % triton x-100 in pbs . tissue sections were then incubated at 4c with single or a mixture of two primary antibodies ( inos 1 : 100 bd biosciences , 3 - nitro - l - tyrosine 1 : 100 upstate ) diluted in pbs / 1 % normal goat serum and 0.25 % triton x-100 . the immunoreaction product was visualized using the avidin - biotin peroxidase with secondary antibodies ( 1 : 200 sigma ) and the abc substrate kit ( biogenes ) diluted at 1 : 100 and diaminobenzidine as chromogen . alternatively , immunosignals were visualized using fluorescently tagged secondary antibodies ( alexa 568 goat antimouse igg 1 : 400 molecular probe , fitc goat antirabbit igg 1 : 50 molecular probe ) . tissue sections were observed under epifluorescence an microscope ( olympus bx51 , tokyo , japan ) . the behavioral data were analyzed using anova with repeated measures and the kruskal - wallis h test was used for post hoc comparisons . infarct size and biochemical data were analyzed with anova and the newman - keuls post hoc test . figure 2 shows that the core and brain temperature values , respectively , are 37c and 35c for the sham - operated rats within a period of 30 minutes . infusion of 37c saline via the jugular vein for 5 minutes in the fpi rats had an insignificant effect on both the core and brain temperature . however , brain temperature , but not core temperature , of the fpi rats were significantly ( ~ 2c ) decreased by an intravenous infusion of 4c saline for 5 minutes . as shown in our previous findings , during the acute stage ( e.g. , 2 h ) of fpi , both an increase in intracranial pressure ( icp ) and a decrease in cerebral perfusion pressure ( cpp ) were observed in the rat . the decrease in cpp ( map - icp ) was due to an increase in icp because an appropriate level of mean arterial pressure ( map ) was maintained within a 2 - hour post - fpi period . additionally , as revealed 3 days after fpi , body - weight loss was noted in rats with fpi . all the decrease in cpp , the increase in icp , and the body - weight loss that occurred after fpi were significantly reduced following hrjvf . as compared with those of the sham - operated rats , the maximal angle fpi animals treated with 37c saline could cling to an inclined plane significantly decreased 72 h after fpi ( as shown in figure 3 ) . however , the fpi - induced reduction in maximal grip angle measured 72 h after fpi was significantly reversed by hrjvf ( p .05 ) . triphenyltetrazolium chloride staining revealed the marked increase in cerebral contusion in fpi rats treated with 37c saline compared with sham - operated , controls ( figure 1 ) . again , the fpi - induced cerebral contusion was significantly reduced by treating with hrjvf ( or 4c saline ) ( p .05 ) . as compared with those of the sham - operated rats , the fpi rats treated with 37c saline had higher values of mda but lower values of sod , gp , gr , and catalase in contusion brain ( figure 4 ) . the fpi - induced increased mda and decreased sod , gp , and catalase in contusion brain were all significantly ameliorated by hrjvf ( or 4c saline infusion ) ( p .05 ; figure 4 ) . as shown in figure 5 , the 37c saline - treated fpi rats had higher numbers of inos - positive cells in the contusion brain than those of the sham - operated rats . in addition , the fpi - induced increased numbers of inos - positive cells in the contusion brain were significantly reduced by hrjvf ( or 4c saline infusion ) ( figure 5 ) . as demonstrated in figure 6 , the fpi - treated rats that received 37c saline infusion had higher numbers of 3 - nt - positive cells in the contusion brain than those of the sham - operated rats . furthermore , the fpi - induced increased numbers of 3nt - positive cells in the contusion brain were significantly reduced by hrjvf ( or 4c saline infusion ) ( figure 6 ) . the mechanisms that have been proposed to lead to secondary brain injury during tbi include excitotoxicity diffuse axonal injury , oxidative stress , mitochondrial dysfunction , and apoptosis . herein we have demonstrated that nitrostative damage ( evidenced by increased inos and 3 - nt ) , oxidative damage ( evidenced by decreased levels of gp , gr , sod , and catalase as well as increased levels of malondialdehyde ) , cerebral contusion and apoptosis , and behavioral deficits all noted 72 h after tbi in a rat model . it is likely that tbi causes cerebral contusion , induces nitrostative and oxidative damage , and results in cerebral apoptosis , which leads to behavior deficits . poor neurologic outcome is associated with increased levels of nitrotyrosine in the cerebrospinal fluid ( csf ) . pelluffo and coworkers have demonstrated that incubation of motor neurons cultured with nitrotyrosine induced apoptosis .3 - nitrotyrosine has been reported as a causative in induction of mitochondrial dysfunction after tbi in a mouse model . although the aforementioned statements tend to suggest that no derived from the inos is an inflammatory product implicated both in secondary damage and in recovery from tbi , several findings promote that inos is an endogenous neuroprotectant after tbi in rats and mice . in a model of controlled cortical impact , knockout mice lacking the inos gene ( inos ) were compared with wild - type mice ( inos ) . functional outcome during the first 20 days after injury , and histopathology at 21 days , were assessed in both studies . treatment of rats with either of the inos inhibitors after tbi significantly exacerbated deficits in cognitive performance and increased loss in vulnerable regions of hippocampus . however , after tbi , inosmice showed markedly worse performance in the cognitive task than inos , supporting a beneficial role for inos in tbi . additionally , bayir and colleagues provided evidence to support a role for inos - derived no as an endogenous antioxidant after tbi . although many pharmacologic interventions have been suggested to provide neuroprotection , almost all phase ii and iii clinical trials in neuroprotection have failed to show consistent improvement in outcome for patients after tbi . in contrast , whole - body cooling ( 3234c ) has been considered an effective method for reducing neurological injury in animal and human models of tbi . although body cooling protects against contusion brain , several problems are associated with whole - body cooling . for example , a faster cooling method is warranted for application of whole body cooling to tbi patients . whole - body cooling is associated with severe shivering and anesthesia requirement and increases incidents of arterial hypotension , cardiac arrhythmia , hemorrhage , and pneumonia . in addition , retrograde cold saline infusion via the jugular vein is able to induce rapid brain cooling while maintaining systemic normothermia and normal hemodynamic function in the rat . we have previously demonstrated that brain cooling improves outcomes of tbi by reducing intracranial hypertension , cerebral ischemia and infarction , motor , and proprioception deficits , and body - weight loss in the rat . the present results further show that brain cooling may improve outcomes of tbi in rats by compromising oxidative stress . in particular , nitrostative damage ( evidenced by increased inos and 3 - nt ) , oxidative damage ( evidenced by decreased gp , gr , sod , and catalase , but increased malondialdehyde ) , cerebral apoptosis and contusion , and behavioral deficits that occurring during tbi were all reduced by brain cooling . after tbi in rats , enhanced generation of hydroxyl radicals during tbi was attenuated by moderate hypothermia in rats . treatment of rats with whole - body cooling after tbi increased antioxidant enzyme like sod activity . cerebral oxidative stress and cerebrovascular dysfunction that occurred during heat stress could be attenuated by brain cooling in the rat . local saline infusion into ischemic territory induced regional brain cooling and neuroprotection in rats with transient middle cerebral artery occlusion . probably , the volume of physiological saline ( 5 ml of cold saline ) infused with this procedure was an important point that may affect the feasibility and safety in clinical settings . this volume ( 5 ml ) was 1015 % of total blood volume in rats with a body weight of approximately 325 g ( as used in this study ) . in rats , blood flow was approximately 0.87 ml / minutes for the entire brain ( brain weight , 2.2 g for 325 g body weight ) . in humans , the blood flow through the brain tissue averaged 870 ml / minutes in normal adults brain weight , 1500 g . these figures indicate that an infusion volume approximately 870 ml could be applicable in adult patients with an average blood volume of approximately 5000 ml . it is feasible that 70 ml / minutes of infusion volume via the jugular vein can be safely administered to patients . finally , it should be pointed out that the inclined plane was used to measure limb strength . whether it is a suitable index of neuroprotection for traumatic brain injury ( ; present results ) or experimental ischemic stroke in rats needs further explanation . in summary , our data showed that tbi caused brain contusion , induced nitrostatic and oxidative damage , and resulted in brain apoptosis , which led to behavior deficits in rats . these reactions caused by tbi could be significantly ameliorated by selective brain cooling ( caused by retrograde cold saline infusion via the jugular vein ) . the results suggested that selective brain cooling might improve the outcomes in tbi via reducing brain nitrostative and oxidative damage in rats without prominent side effects .\noutput:\n" }, { "from": "agent", "value": "the aim of the present study was to ascertain whether brain cooling causes attenuation of traumatic brain injury by reducing brain nitrostative and oxidative damage . brain cooling was accomplished by infusion of 5 ml of 4c saline over 5 minutes via the external jugular vein . immediately after the onset of traumatic brain injury , rats were randomized into two groups and given 37c or 4c normal saline . another group of rats were used as sham operated controls . behavioral and biochemical assessments were conducted on 72 hours after brain injury or sham operation . as compared to those of the sham - operated controls , the 37c saline - treated brain injured animals displayed motor deficits , higher cerebral contusion volume and incidence , higher oxidative damage ( e.g. , lower values of cerebral superoxide dismutase , catalase , glutathione peroxidase and glutathione reductase , but higher values of cerebral malondialdehyde ) , and higher nitrostative damage ( e.g. , higher values of neuronal nitric oxide synthase and 3 - nitrotyrosine ) . all the motor deficits and brain nitrostative and oxidative damage were significantly reduced by retrograde perfusion of 4c saline via the jugular vein . our data suggest that brain cooling may improve the outcomes of traumatic brain injury in rats by reducing brain nitrostative and oxidative damage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: topical corticosteroids are widely used in various dermatological conditions . by diluting the steroids with emollients , we can decrease the amount of steroids used and thereby reduce the side effects of steroids especially when used in patients with dry scaly dermatoses . the ability of the steroids to inhibit the size of histamine - induced wheal was used to assess their efficacy . this study was conducted to determine the effect of steroids diluted with emollient in the concentration of 1:1 , 1:2 , and 1:3 by the histamine wheal suppression test . a randomized double - blinded study was conducted on 25 volunteers who had not used systemic or tropical steroids and antihistamines for atleast 8 weeks . the syringes were loaded with clobetasol propionate 0.05 % ( diplene ) , emollient - containing propylene glycol 15 mg , diazolidinyl urea 1.5 mg ( emolene ) , or diplene with emolene in dilutions of 1:1 , 1:2 , and 1:3 . syringes loaded with steroid , emollient , steroid with emollients in dilutions of 1:1 , 1:2 , and 1:3 a template with five apertures ( 33 cm ) cut 2 cm apart was placed on the forearm and the squares were outlined with a marker pen [ figure 2 ] . a template with five squares placed on the forearm after randomization , half fingertip unit of the prepared cream which was loaded in the syringe was applied in each square . three hours later histamine prick test was performed because clobetasol propionate has the maximum wheal suppression at the end of 3 h. prick test was performed by placing a drop of 0.1 % histamine solution on the test site skin was pricked through the histamine solution with a lancet . the tip was kept parallel to the skin surface and the skin was lifted by tenting the lancet by 45 to 60 degrees . the size of the wheal was recorded in millimeters after 15 min and the mean size was calculated by measuring the maximum diameter and the orthogonal diameter of the wheal with a transparent scale . at the end of the study , the mean diameter of the wheal after applying steroids with various dilution of emollient is shown in table 1 . the combination of steroids with varying dilutions of emollients ( p value ) in comparison to steroid alone is shown in table 2 . the mean diameter of the wheal after application of steroids with various dilution of emollient the combination of steroids with varying dilutions of emollients ( p value ) in comparison to steroid alonetopical steroids are widely used in various dermatological conditions . for extensive areas of dermatoses , the amount of steroids used is comparatively more and the side effects are also high . the first rationale for combining clobetasol propionate with a moisturizer that includes an emollient , dimethicone , and a humectants is that treatment of a dry scaly dermatoses may contribute to overall clinical improvement . this combination of steroids and emollient have been proved to be useful in various dermatological conditions such as atopic dermatitis and mastocytosis . in atopic dermatitis , the dry skin has diminished water - binding capacity , higher transepidermal water loss , and decreased water content compared with normal skin and it may worsen dermatitis . the degree of epidermal hydration can directly affect the penetration of steroids through the skin . therefore , a combination of steroids and emollients can benefit the patient . high potent topical steroids can cause safety concerns such as suppression of the hypothalamic pituitary axis , acne , atrophy , purpura , and these side effects can be minimized by combining steroids with emollients . therefore , this study was conducted to determine the effect of steroids with varying dilutions of emollients on histamine wheal . from this study , we conclude that the dilution of steroid and emollient ( 1:1 ) in comparison to topical steroid alone caused a decrease in wheal suppression which was not statistically significant . dilution of steroid with emollient 1:2 and 1:3 as compared to steroid alone did not decrease wheal suppression which was statistically significant . steroids and emollients can be mixed in equal proportion ( 1:1 ) and the effect would be the same as that of the steroid alone .\noutput:\n" }, { "from": "agent", "value": "background : the ability of steroids to reduce the histamine wheal was used to assess the efficacy of topical clobetasol propionate with varying dilutions of emollients.aim : to determine the wheal - suppressing ability of topical clobetasol with varying dilutions of emollient.materials and methods : it was a double - blinded randomized study . twenty - five volunteers were included in the study . five syringes of 5 ml were taken and the syringes were loaded with either clobetasol propionate 0.05 % , emollient , or clobetasol propionate with emollient in dilutions of 1:1 , 1:2 , and 1:3 . the syringes were coded 1 to 5 . five squares of 3 3 cm were marked on the flexor aspect of the forearm of the volunteers . after randomization , half fingertip unit of the cream was applied within each square uniformly . three hours later histamine prick test was performed by the standard method . the wheal was measured after 15 min and the results were recorded . after decoding , results were statistically analyzed by analysis of variance.result : the decrease in wheal suppression of steroid with emollient ( 1:1 ) was same as topical steroid and the wheal suppression decreased with increasing dilutions of steroid.conclusion : we conclude that steroids and emollients can be mixed in equal proportion ( 1:1 ) and the effect is same as steroid alone and increasing dilution of steroids with emollients was not effective in suppressing the wheal ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the status of childhood decision - making about medical treatment is a contentious one and , despite its importance and complexity , subject to an opaque and poorly governed legal framework . unlike adults , children have historically been given little real autonomy to make medical decisions for themselves . in this article , two recent cases from australia throw the controversy surrounding medical decision - making by children back into the spotlight , and not for the better . in part i , the bases for children 's medical decision - making are explored . across the common law world , the judicial power to deal with medical decisions about and for children comes in the form of the supposedly unlimited parens patriae power , an inherent power courts possess to make or override decisions for incompetent persons , including children . although the genesis of this power differs between jurisdictions , its application is reasonably consistent . part ii engages with how australian courts have recently muddied the waters by promulgating two facially inconsistent decisions . importantly , it seeks to identify the rationale for why , for the first time , an australian court has limited what was previously unlimited ; the courts parens patriae power to make medical decisions on behalf of incompetent and competent children . self - determination is integral to any liberal society . but how far should society extend that right to children , to make decisions that could have significant long - term impacts , or cut short their lives ? courts have long held a distinction between medical decisions to be made against the wishes of parents and treating practitioners , and those to be made by courts acting parens patriae . most decisions about medical treatment occur within the treatment environment . for young children , parents and guardiansthere is no controversy where children lack the capacity to make medical decisions by themselves ; parents can authorize , or override a child 's refusal of , medical treatment . some treatment is , however , beyond parental power to consent to and requires judicial approval , including sterilization and gender reassignment treatment . parental power wanes once a child is deemed psychologically competent to make medical decisions , a concept known as the mature minor principle . that principle was fashioned in the uk case of gillick , where a parent sued a medical practitioner who had provided her daughter with contraceptive advice . the law lords held that where a child could [ achieve ] a sufficient understanding and intelligence to enable him or her to understand fully what is proposed , a doctor was entitled to provide that advice in the absence of parental consent ( gillick competence ) . since that time , the common law has recognized that mature minors possess a higher legal status than minors generally . in australia , gillick is good law , meaning that children who demonstrate the requisite level of understanding can consent to medical treatment without their parents consent . in the usa , the ability of mature minors to consent to medical treatment , and to refuse it , has been sporadically recognized , although treatment refusals have yet to receive scotus consideration . in addition and supreme to parental powers , a court acting parens patriae can regulate a minor 's decision - making by either displacing parental decision - making or acting in loco parentis where a guardian is unavailable . in australia , the discretionary parens patriae power , an inherent equitable or statutory power , operates over a child 's healthcare decisions in three broad circumstances : consent to treatment in the face of parental disagreement ; refusing medical treatment ; and special treatment for an incapable child , or self - sought for a capable child . thus , in order to bring children within the parens patriae power , they have been classed asincompetent simply by reason of their childhood , and irrespective of any psychological competence they may possess . the past 50 years have seen a gradual decline in the strength of that view , with courts recognizing that as minors age towards 18 years , or demonstrate their maturity , the parens patriae power fades as the minor gets older and disappears upon reaching adulthood . the actions and decisions of mature minors are to be accorded greater weight and effect , increasing on a sliding scale until adulthood , that is , as children are perceived to increase in their ability to understand , their decisions are more likely to be accepted as correct binding . fading effect is not simply an increment of age , as courts ( at least in australia ) are sufficiently empowered to override a decision up to the day before a minor 's 18th birthday . rather , competence is a discretionary factor that may be used to sway a court to accept the child 's decision or not . but , at least until the jamie opinion , a child simply being deemed gillick competent has never displaced the parens patriae power in its entirety . there has been significant debate about whether gillick could be applied beyond its own facts in order to fully emancipate children 's decision - making upon their attaining a threshold of competency . subsequent decisions had shown that this was not the case , at least as a matter of law . for example , re w holds that the gillick competence doctrine does not preclude the parens patriae power for refusals of medical treatment . for some time after gillick , judges were at pains to deal with refusal cases as if gillick competency was relevant , but otherwise dismiss the child 's ability to make a competent decision , sometimes in tortured fashions . the position in the usa is even more clouded , with decision - making capacity of children varying from state to state . the system of federalism adopted by australia makes conflict between state and federal courts almost impossible : the high court of australia is the ultimate arbiter of federal and state common law , and lower federal courts can not adjudicate on state laws . but the inconsistent way in which medical decisions are regulated within australia has led to such a conflict . welfare jurisdiction is , for present purposes , identical . in 2013 , these two jurisdictions collided on the question of children 's medical decision - making . in the case of x , the new south wales court of appeal refused , consistently with established authority , to recognize the decision of a gillick competent 17 year - old jehovah 's witness to refuse athe court of appeal held that the parens patriae power is immutable and can not be abrogated by a determination of gillick competence . however , in the case of jamie , the full court of the family court held that an 11 year - old gillick competent child could consent to treatment for gender identity disorder , on the grounds that once a child was deemed gillick competent , the court had no jurisdiction to approve or disapprove of the proposed treatment . this decision is striking because even countries with federally enshrined human rights have not completely negated a court 's ability to control children 's decision - making in those circumstances where the child is deemed competent . essentially , what these two cases suggest is that if the court agrees with the substance of a child 's medical decision , competency is binding ; if not , then it may be ignored . so while jamie seemingly gives gillick some real teeth , the power is more clouded than ever . jamie suggests that gillick competence provides an inalienable right for a competent child to consent to medical treatment against parents and courts whereas x asserts that gillick competency may be taken into account , but can not abrogate the parens patriae power . what follows evaluates the reasons for the inconsistency between these decisions . in part , the decision in jamie is grounded in a finding from an earlier decision in marion 's case that a child may have the capacity to give informed consent once gillick competent . but gillick and marion 's case are dubious bases for jamie 's validity . first , the plurality 's reasoning in marion 's case was directed towards accepting gillick ; that is , a minor is capable of consenting to medical treatment in the absence of their parents , not courts , and this has commonly been held to distinguish gillick from parens patriae cases . as such , jamie stands alone as authority usurping the parens patriae power . controversy . in jamie , the court attempted to limit its reasons to requests for gender - altering therapy absent some controversy . that is , a child would be able to consent to the gender - altering treatment where all parties agreed . however , such limitation has no grounding in the language employed in jamie , which ultimately relies only on gillick competency . there has been some confusion as to how much weight should be placed on the controversy criterion . justice strickland , writing extra - judicially , has attempted to distance the court from the position that jamie stands for independent decision - making , stating that the parens patriae power is returned when there is disagreement between the parties . but this nuance has been missed both in a subsequent first - instance decision of the family court and academic commentary , and it does not appear plausible to suggest that controversy moderates the court 's exclusion of the parens patriae power . a criterion like controversy is a matter that falls under the discretionary parens patriae power and has no bearing on the ability of a child to understand medical treatment . it can not be controversy that activates the parens patriae power , as that would still undermine a child 's ability to express her will vis - - vis medical treatment , contrary to the united nations convention on the rights of the child ( croc ) . this approach would also undermine the holding that expressly rejected the application of discretionary factors once gillick competency was established . unless controversy operates as some ephemeral predicate to a finding of gillick competence , which finds little support in jamie 's express language , it seems non sequitur to suggest that controversy itself can limit a gillick competent decision . another possible distinction could be the factual difference between x ( addressing refusal of treatment ) and jamie ( addressing consent to special treatment ) . although the law has long considered refusal and consent opposite ends of one decision - making spectrum and identical in terms of the information to be understood , how they have been treated as a matter of discretion has differed markedly . gillick has consistently been held to apply only to decisions of consent to treatment , not refusals , a position echoed in australian jurisprudence and affirmed in x. unquestionably , the unfortunate distinction between consent and refusal decisions is at the heart of the conflict between jamie and x. but two questions flow from this : first , is it normatively correct to maintain that distinction , and second , is the language in jamie broad enough to obviate it in any event ? the x opinion accepted that there was no logical difference between consenting to and refusing medical treatment . and yet , the court did impliedly reinforce this distinction by acknowledging differing factual and legal consequences of consenting to and refusing medical treatment . such consequentialism has long been , lamentably , a driving force behind refusal judgments , nullifying any real weight or purpose to a finding of gillick competence in refusal cases . on this view , where a child refuses treatment , gillick can not prevent or override the parens patriae power . but , at least facially , this is an incorrect categorization of how the parens patriae power is to operate . in the uk , doubt has been cast for some time over the continuing validity of the distinction between consent and refusal . if the parens patriae power protects the vulnerable , the decision 's mere nature can not control its exercise . best interests , irrespective of whether consent or refusal is involved . to assert otherwise presupposes ( falsely ) that consent decisions are beneficial and refusal decisions not . for example , a child may seek orders to consent to a radical new procedure that has a high death rate and horrific side effects . it would be absurd to allow that decision to be made so long as a child is deemed competent , but to deny a request to refuse treatment . that does not mean that greater rigor can not be exercised in determining whether a child is competent to make a refusal decision , although that formulation too is fraught with danger . but even if the consent / refusal dichotomy is maintained , x and jamie can not be reconciled . although the jamie opinion carefully avoids the subject of refusal of treatment , terminating the parens patriae power on the finding of gillick competence arguably extends the court 's reasoning beyond consent to medical decisions generally . the consent / refusal distinction can only come into play under the parens patriae discretion after gillick competence has been assessed and applied . by saying that competency is the terminus of the court 's role , the ability to distinguish between consent and refusal , traditionally the province of judicial discretion , has been lost . either jamie 's hammer blow to the parens patriae power is correct , causing x to be wrongly decided and gillick to presumptively obviate the parens patriae power , or it is not . if the latter is correct , at best , jamie is an aberration that applies only to cases of consent in the family court , and gillick remains trammeled . irrespective of the adopted interpretation , the power is more clouded than ever . to illustrate , a doctor is shielded from liability by x if treatment is given in the face of a child 's refusal , but is left wide open by jamie to both civil and , albeit highly unlikely , criminal liability . and which is the higher authority ? both are intermediate courts of appeal . only the high court can decide which , so far , it has been unable to do . the parenspatriae power is often framed as protective , empowering courts to assist those who are incapable of assisting themselves , such as infants . where mature children fall into this vulnerability categorythe court of appeal referred to children 's vulnerability stemming from their need to rely upon others ( their parents ) to satisfy their needs , whether physical , emotional , or experiential . but this logic is circuitous , for if vulnerability lies at the heart of the disability identified by legal incapacity , such incapacity is brought about by a child 's vulnerability , and yet children are vulnerable because they are legally incapacitated . perhaps a better characterization is simply that the power is enlivened simply by virtue of childhood ; certainly , the language in re frances supports such a notion that the power applies to those who are children or otherwise incapable of looking after themselves . little comfort can be drawn from gillick itself to establish a contrary proposition . in that case , any grant of autonomy was caveated by requiring the treatment to be in the child 's best interests . subsequent interpretations of gillick further limited its scope to little more than its bare facts . arguably , if the family court relied on gillick as authority to extinguish the parens patriae power over children per se , that would conflict with how the power has long been understood . at best , one can say that children can be exempted in the family court , but not in the australian states . but , normatively , which is correct ? holding children incompetent simply by virtue of their childhood conflicts with contemporary psychological literature . in marion 's case , the high court referred to the eminent , but somewhat dated , theories proffered by piaget . the question of what comprises competence as a factual question has been canvassed elsewhere . for present purposes , it is sufficient to note that if the jurisdiction 's object is to protect those who can not protect themselves , by definition , gillick competency meets that threshold . to be gillick competent is to understand the decision and its consequences . vulnerability in terms of medical decisions is manifested by a failure to understand the treatment , not its risks and effects per se . to be receiving medical treatment is already to be at risk . if it is accepted that the decision can be understood , legal vulnerability falls away , leaving only thepublic interest in preserving the sanctity of life . the question that then arises is whether that residuary interest is sufficient to justify the discretionary override of a competent minor 's decision ? attaching the parens patriae power to childhood absent any other factor does bring the power in conflict with jamie . whereas in xthe power was characterized as an unlimited flexible discretion , jamie displaced the power entirely on gillick competence . in the canadian decision of a.c . , referred to at length and relied upon in x , justice abella noted that courts will inevitably be so convinced of a child 's maturity that the principles of welfare and autonomy will collapse altogether and the child 's wishes will become the controlling factor . what distinguishes jamie and x is the nature of that collapse . in x , the collapse can occur after gillick competence and all policy factors are considered ( meaning that the court retains ultimate control ) ; in jamie , the collapse occurs on the finding of gillick competence . the driving force behind this distinction is the weight given to the croc in jamie . while the impact of conventions on australian common law is limited , the croc has been given significant weight in the past and can be used to guide the common law in circumstances of ambiguity . that ambiguity exists in these cases is without question ; the high court has not yet ruled on whether the parens patriae power can be abrogated in this fashion and nor has the legislature seen fit to act . accordingly , if the croc does apply to limit discretionary decisions against children that would not otherwise be applied to adults ( in the absence of clear contrary authority ) , then the conclusion that gillick competent minors are subject to the parens patriae power generally is in doubt . moreover , the continued acceptance of the authority that undermines gillick , re r and re w , is troublesome . in both those decisions , the finding that gillick did not apply was dictathe applicants both failed to establish that they were competent , and both were made in the absence of any human rights legislation or the croc . most importantly , if the raison d'etre of the power , protection of the vulnerable , is no longer established in fact , then any law that targets children solely by reason of their childhood is prima facie in conflict with the croc and exceeds the common law formulation of the power , suggesting that the exclusion of gillick is illogical . if this is accepted , then x is wrongly decided , and the language in jamie operates across the spectrum of decision - making . that would mean that courts lose control over children 's decision making on a finding of gillick competence . such an unprecedented radical shift in jurisprudence is unlikely to be met kindly . ousting the parens patriae powerentirely prevents the courts from using the child 's best interests to restrain a decision . one can imagine recourse to past practices of stipulating that children had not understood enough the relevant evidence in order to avoid gillick competence , further denigrating their decision - making integrity with the added insult of being labeled incompetent to decide their own fate . what these two decisions have done is further cloud an already opaque jurisprudence at one of the most emotionally , physically , and spiritually difficult junctures in a person 's life . the complexity of challenging a medical decision already required significant and expensive input by doctors , hospitals , lawyers and courts , delaying the treatment process and imposing unnecessary burdens on decision - makers . now , on one view , it is worse . until something is done to resolve the conflicts in this areanor is it fair for judges to be left with this task where refusals of treatment are concerned , judicial officers have little time to formulate reasons or hear evidence of competency that might sway them to an alternate view , if such a view is socially desirable . what is needed is a legislative response that deals , finally , with questions of consent and refusal and the place of gillick competency in the decision - making framework .\noutput:\n" }, { "from": "agent", "value": "another chapter has opened in the tortured history of the status of gillick competence . never before has gillick been extended to permit a mature child to make autonomous medical decisions over and above the curial parens patriae power . in 2013 , two judicial decisions promulgated from different australian courts are in conflict over this most fundamental of questions . this article situates the law of the parens patriae power in australia and , drawing on overseas conceptualizations of analogous doctrine , explores the bases for and potential consequences of this conflict ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: neurointerventional surgery has shown exponential growth in the last decade secondary to development of newer devices and more sophisticated techniques enabling neurointerventional surgeons to treat a broader and more complex spectrum of pathologies with increased success rates and safety profile . femoral artery arteriotomy remains the preferred method of vascular access for both diagnostic and interventional procedures in the united states and the rest of the world .6 ) while manual compression has historically been regarded as the \" gold standard \" for achievement of vascular closure after femoral artery puncture , it requires immobilization for up to 6 hours or so after the procedure and can often be associated with patient discomfort . various vascular closure devices have been developed in recent years in an effort to facilitate more rapid hemostasis , lessen patient discomfort , and shorten post - procedure immobilization .4 ) while there are data demonstrating the safety and efficacy of these newer devices , there is also an unique set of rare but potentially serious vascular complications associated with these devices , which all neurointerventional surgeons need to be aware of . we report on a rare case of delayed vascular claudication after use of the angioseal arteriotomy closure device with a review of pertinent literature . a 26 - year - old female presented with worsening headaches , dizziness , and weakness for three months . magnetic resonance imaging ( mri ) of the brain showed the presence of a left parietal lesion concerning for a vascular malformation ( fig .1 ) . a diagnostic cerebral angiogram was performed to confirm the diagnosis and further characterize the lesion for treatment planning . the right common femoral artery was selectively catheterized using a 5f sheath and a 5f hockey - stick diagnostic angiocatheter with a 0.035 glidewire were used for selective catheterization of the left internal carotid artery . cerebral angiogram in anteroposterior / lateral and multiple oblique projections showed a superficial left parietotemporal spetzler - martin grade i arteriovenous malformation ( avm ) measuring 15.310.3 mm in size ( fig .2 ) . then , a 6f angioseal closure device ( acd ) was deployed successfully at end of the procedure . postoperatively , the patient had a small puncture site hematoma with good distal pedal pulses . the small groin hematoma appeared stable after a period of observation and she was discharged home from recovery three hours later on the same day of the procedure . however , three days after the procedure , she developed persistent right groin pain with clinical signs of vascular claudication in the right leg manifested by calf pain exacerbated by ambulation . duplex ultrasound and computed tomography angiography ( cta ) of the right femoral artery showed a partially occlusive thrombus in the right common femoral artery ( cfa ) ( fig . vascular surgery was consulted and the patient was taken to the operating room in order to undergo thrombectomy . intraoperatively , it was found that the previously noted \" thrombus \" was actually the angioseal used to close the arteriotomy ( fig .4 ) . the patient had a stable post - operative course and was discharged in stable condition the day after explanting the angioseal . with rapidly increasing numbers of neuroendovascular procedures performed annually in recent years , technical considerations and complications of peripheral artery access are becoming areas of increasing concern . after femoral artery puncture , adequate hemostasis must be maintained upon removal of the catheter from the artery . classically , this has been achieved with manual compression with very good safety and efficacy . however , this method requires longer surgeon attention , prolonged periods of immobilization for the patient and thus longer hospital stays and monitoring , which translates into increased hospital costs .10 ) in addition , this technique is associated with increased patient discomfort and is more difficult with larger arteriotomies .4 ) in an effort to obviate these limitations , various closure devices have been introduced in clinical practice . nevertheless , in some studies questioning the value of routine use of vascular closure devices , the safety of early ambulation ( after 2 hours ) after the release of manual compression for patients who underwent a diagnostic or therapeutic neuroendovascular procedure without the use of a closure device has been demonstrated .8 ) early ambulation should not be the only concern per se ; however , the majority of inpatients who undergo endovascular interventions have vascular access with larger sheaths and are often on antiplatelet medications , therefore , they are likely to be monitored in the hospital overnight and would not be discharged home in few hours anyway . the advantage of using vascular closure devices under these circumstances are achievement of more rapid hemostasis and vascular closure while reducing patient discomfort and time required for the surgeon 's immediate attention . nevertheless , in high volume centers performing a number of neuroendovascular procedures , arterial puncture closure devices have been developed and used on a routine basis , including the angioseal , which is designed to compress the arteriotomy site between a bio - absorbable intravascular foot place and an external collagen sponge in order to circumvent some of the disadvantages associated with manual compression .10 ) these devices have grown in popularity due to faster rates of hemostasis and avoidance of manual compression . in a recent prospective comparison of neurointerventional treatment via the femoral artery using angioseal vs. manual compression , angioseal was found to achieve significantly faster hemostasis , with a mean hemostasis of 2.4 + / - 27.4 minutes in the manual compression group .10 ) similarly , results of a meta - analysis on complications of peripheral vascular access during cardiac angiography showed that time to hemostasis was significantly reduced with arterial closure devices compared to manual compression , with a mean difference of 17 minutes ; the duration of bed rest was also shorter with arteriotomy closure devices by a mean difference of 10.8 hours .4 ) however , complication rates of groin hematoma , bleeding , arteriovenous fistula , and pseudoaneurysms have not been shown to be reduced with the use of arteriotomy closure devices . in fact , some studies even suggested a higher rate of complications with arteriotomy closure devices .4 ) vascular complications with arterial closure devices are usually associated with pre - existing peripheral vascular disease , concomitant anticoagulation , and presence of an indwelling sheath for an extended period of time .3 ) however , the majority of these complications are considered minor and require no further surgical intervention or hospital admission .3 ) 4 ) 10 ) meta - analysis comparing the use of vascular closure devices to manual compression demonstrated a relative risk of minor complication rates such as groin hematomas , groin bleeding , and pseudoaneurysm of 1.14 , 1.48 , and 1.19 , respectively .4 ) in another study of 698 angioseal closures conducted at a single institution , the minor complication rate was 2.4 % , while the major complication rate was 1.4 % . major complications were defined as those requiring therapy of hospitalization 48 hours , major therapy , unplanned increase in level of care , or those resulting in permanent adverse sequelae .3 ) vascular occlusion is a feared rare complication that is unique to use of vascular closure devices . in the literature , the majority of complications occur on the day of the procedure ; however , major complications such as vessel occlusion and stenosis can also occur in delayed fashion necessitating a high index of suspicion for claudication symptoms and close follow - up after the procedure .9 ) in their retrospective study of femoral artery closures , carey , et al . suggested that angioseal in particular , has a higher rate of occlusion complications , with a rate of 0.7 % , compared to other devices .1 ) one case series by wille et al . reported six surgically - treated complications associated with angioseal , in which five patients had obstructive complications .9 ) in all of these obstructive cases , the angioseal had caused the femoral artery occlusion and the patients required wound exploration , removal of the angioseal , and endarterectomy with venous patch reconstruction . four of the five patients had leg ischemia due to occlusion of ipsilateral cfa and superficial femoral artery ( sfa ) . two of the five patients had a very proximal femoral bifurcation and the puncture site with angioseal was at the cfa - sfa transition . one had a smaller cfa diameter ( 4 - 5 mm ) and in another case the vessel occlusion was caused by posterior wall plaque dissection , which was captured by the angioseal anchor . it seems that in cases where the anchor is absorbed into the vessel lumen , a fibrotic reaction ensues , resulting in occlusion of the artery with a delayed presentation of worsening claudication .9 ) vascular complications associated with arterial closure devices are uncommon but are well documented in the literature .1 ) 4 ) 5 ) 6 ) 7 ) 9 ) 10 ) fortunately , major complications requiring surgical intervention and vascular repair are much less common , and when serious complications occur , they usually occur acutely in the immediate post - operative period , allowing prompt recognition and management .9 ) however , the timing of major complications varies in different studies and has often been documented after 24 hours of using arterial closure devices ,2 ) meaning after the patient has already been discharged home , as happened in our case . plausible risk factors for such complications include age 70 , female , peripheral vascular disease , large size sheath , and arterial puncture very close to the bifurcation , as seen in our case ( fig . in addition , in patients with a puncture close to the bifurcation , it may be prudent to obtain post - operative duplex ultrasound to ensure proper deployment of the angioseal and there should be a low threshold for investigating signs of possible delayed vascular complication in these patients . while large clinical studies have demonstrated the safety and effectiveness of vascular closure devices , rare but serious complications such as vascular stenosis and occlusion can occur in both acute and delayed fashion . awareness of these rare complications associated with vascular closure devices , particularly those occurring in a delayed setting outside of direct observation by healthcare professionals , is important for both neurointerventional surgeons and patients . appropriate pre - procedure counseling of patients receiving these closure devices regarding potential complications is essential in order to educate patients to recognize signs and symptoms of these rare complications and to minimize permanent sequelae .\noutput:\n" }, { "from": "agent", "value": "with rapidly increasing numbers of neuroendovascular procedures performed annually in recent years , use of arterial closure devices after femoral artery access has been exceedingly common secondary to reduced time to hemostasis , decreased patient discomfort , earlier mobilization , and shortened hospital stay . although uncommon , use of these devices can lead to a different spectrum of complications , as compared to manual compression . ischemic symptoms following the use of these devices can have unexpected clinical sequelae and can occur in a delayed fashion . awareness and recognition of such complications is important with the dramatically increased use of these devices in recent years . we report on a case of delayed vascular complication manifesting as vascular claudication following use of the angioseal closure device ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: development is a complex and continuous process of maturity , parallel to the growth of children , which can affect many aspects , and begins from conception and continues until maturity . during the development , an infant can establish a variety of relations with their surrounding environment . unlike the sequence , the rate of development varies from a child to another and depends on genetic factors , environmental aspects , and chronic diseases . development in pediatrics will be evaluated based on four domains of gross motor , fine motor , and social and language skills . children who can not gain / acquire appropriate developmental skills at the expected age have been considered suffering from developmental delay . global developmental delay ( gdd ) is a subset of developmental disorders that is defined as a significant delay or below the appropriate standard in two or more developmental domains . it may occur due to static or progressive disorders in the central nervous system . in the patients with these disorders , the main causes of delay in development include a range of various diseases from which the large number associate with specific findings in brain mri . the most prestigious test is denver developmental screening test ( ddst ) and its modified form is denver developmental screening test ii ( ddstii ) . these causes can not be identified only based on physical examination or patient history ; however , additional studies like genetic analysis , metabolic , serological , strip brain , and neuroimaging are required . neuroimaging provides important information as evidence of previous injuries , specific abnormalities that could indicate a group or a particular disease . brain mri is one of the major evaluations of patients , and based on previous studies , about 60 % of cases has abnormal brain mri . has not been done especially in the khuzestan province , it will provide useful information about the patients , the rate , and type of brain abnormalities . it also helps to identify these diseases informing the parents and preventing the recurrence of similar cases . on the other hand , it may remind the authorities about the necessity of right culture and suitable planning when the cost of diagnostics and care of patients is very high . the aim of this study was to determine the relative prevalence of abnormal brain mri , as the most important method for brain disorder diagnosis , in gdd children aged 2 months to 15 years . in this study , 580 patients with gdd who have been referred for diagnosis to children neurology ward in golestan hospital from the beginning of 1997 until the end of 2009 were selected . the patients have been studied based on clinical , para - clinical information and particularly brain mri findings , then the information extracted and analyzed . the findings presented in the mri reports were divided in six groups as described previously : ( 1 ) normal ; ( 2 ) non - specific findings , including cavum septum pellucidum , cavum vergae , ventriculomegaly , enlarged subarachnoid spaces , hypoplasia of the corpus callosum , and delayed myelination ( 3 ) congenital and developmental abnormalities of the brain , that are divided as three general groups ; ( 4 ) recognisable syndromes such as neurofibromatosis , tuberous sclerosis , sturge - weber syndrome ; ( 5 ) neurovascular diseases and trauma including hypoxic - ischaemic injury or encephalopathy , periventricular leukomalacia , encephalomalacia , atrophy , and gliosis ; ( 6 ) metabolic and neurodegenerative diseases such as demyelination . the information has been extracted based on the desired variables and recorded at a certain form that is provided for this purpose . the patients who had gdd , aged between 2 months and 15 years , admitted for the first time to diagnose the cause of delay , and have brain mri were selected . furthermore , the children who have been admitted several times for various reasons have been considered only once . the needed information has been gathered from all eligible patients and recorded in particular forms that were designed for this purpose . frequency was described and for evaluating any association between qualitative variables was observed using chi - square test . the p value less than 0.05 considered as significant difference . in this study , 580 children with developmental disorders were studied in a comprehensive number of 333 ( 57.4 % ) males and 247 ( 42.6 % ) females . patients are divided in four age groups : 2 to 6 months , 7 months to 2 years , 2 to 5 years , and more than 5 years . brain mri findings in 240 cases ( 41.4 % ) reported normal and in the rest 340 cases ( 58.6 % ) showed abnormal pattern . among 340 abnormal mri cases , 218 ( 37.6 % ) had neurovascular and trauma diseases . the relative frequencies of mri findings in different age groups as well as gender were related mostly to the neurovascular and trauma diseases . from 273 ( 47 % ) children aged 7 to 24 months , 114 ( 41.8 % ) cases were related to the neurovascular and trauma group , and also from 109 ( 19 % ) children aged 61 to 164 months , 32 ones ( 29.4 % ) were in this group . also from the 333 male patients , 137 ones ( 41.1 % ) and , from 247 female , 81 ones ( 32.8 % ) about the gender relation between normal and abnormal mri , results reported that both groups of male and female have abnormal mri meaning from 333 patients , 204 males ( 61.3 % ) and from 247 females 136 cases ( 55.1 % ) showed abnormal mri ( p = 0.147 ) ( table 1 ) . in case of electroencephalography , the mild abnormality was the most frequent one ( 26.6 % ) followed by mild - to - moderate abnormality ( 10.7 % ) ( figure 1 ) . another case where this study was considered was the birth history . in 336 cases ( 57.9 % ) , a positive biography complication at birth or thereafter was noted meaning that 177 cases ( 30.4 % ) showed history of neonatal jaundice and 24 cases ( 4.1 % ) were associated with exchange transfusion .274 cases ( 47.2 % ) did not have the seizure and 306 cases ( 52.8 % ) were reported to have seizure disorders , including different types of seizures . parents of 330 patients ( 56.9 % ) were relatives and parents of 250 ones ( 43.1 % ) were nonrelated . according to the presence of associated disorders , 467 cases ( 80.5 % ) 72 cases ( 12.4 % ) , showed low growth indexes also 12 ( 2.1 % ) organomegaly , 22 ( 3.8 % ) eye problems , and 7 ( 1.2 % ) , metabolic abnormalities was mentioned ( figure 2 ) . according to other disorders evaluated and normal or abnormal mri from 467 children without disorders , 273 ones ( 58.5 % ) and 113 children with disorders listed , 67 cases ( 59.3 % ) had abnormal mri ( table 1 ) ( p = 0.91 ) . in evaluating normal and abnormal mri based on the presence or absence of parents ' consanguinity , 330 cases had relative parents and from those 201 ones ( 60.9 % ) had abnormal mri . this finding in 250 cases with nonrelative parents was 139 ( 55.6 % ) cases ( p = 0.2 ) ( figure 3 ( a ) ) . according to presence or absence of seizures in 306 cases ( 52.8 % ) with gdd , seizure disorder also had been reported , in which 184 cases ( 60.1 % ) had abnormal mri . the rest 274 patients had no seizures , of which 156 cases ( 56.9 % ) showed abnormal mri ( p = 0.44 ) ( figure 3 ( b ) ) . gdd is the relatively common disease that affects 1 % to 3 % of children under five years . for these patients , history reviews and clinical examinationare highly preferred to laboratory examination . based on important data in their history and clinical findings , they may require various evaluations such as metabolic diseases , chromosomal abnormalities , and assessment of lead pollution . neuroimaging routinely is recommended for these children especially if any disorders observed in their clinical examination , and brain mri is preferred to ct - scan . we studied 580 brain mri of children with gdd , while we tried to examine the history and physical examination findings that could be important . the study found 340 cases ( 58.6 % ) with development delay who had abnormal brain mri . statistically , differences were reported in the various studies such as bouhadiba et al . who conducted a study in france between 19971991 on 224 children with developmental delay and observed 109 cases ( 48.6 % ) with positive findings in brain mri from whom 55 cases had structural anomalies of the brain . another study in korea between 19931991 on 34 children with gdd had been detected 26 cases ( 76.5 % ) , with significant abnormal findings on brain mri . as in this study notable cases have been evaluated obtaining statistics intermediate between these figures seem to be logical . most findings in the brain mri of these children have been related to the neurovascular and trauma disease group so 218 cases ( 37.6 % ) were observed in this group . noting that 336 cases of patients ( 57.9 % ) reported positive history of problems around delivery such as asphyxia and neonatal jaundice , we may suggest some relations between these problems and complications occurring in the form of brain mri disorders . we did not observe a gender significant difference between male and female in frequency of normal and abnormal brain mri so that 129 ( 38.7 % ) from 333 male patients had normal and 204 ones ( 61.3 % ) had abnormal brain mri . from 247 females , 111 ( 44.9 % ) had normal and 136 cases ( 55.1 % ) had abnormal brain mri . according to the calculated p = 0.147 we observed more normal brain mri frequency in elder patients whereas the younger cases had higher abnormal brain mri so that from 56 children aged between 2 and 6 months , 40 ( 70.59 % ) had abnormal while from 109 children aged 61164 months , 47 patients ( 43.12 % ) had abnormal brain mri ( p = 0.008 ) . one of the causes of this result is related to the changes that can be seen in the brain mri of younger children and may be considered as positive findings while regarding age and clinical examination those findings are normal . so in the later follow - up and brain mri , abnormal findings will not be seen . this study showed that there are no distinguished differences between the relative frequency of gdd patients who suffer from seizures and those who do not suffer , and electroencephalograph ( eeg ) in 53.8 % of them has been reported normal . on the other hand , seizures frequency was higher in children who had abnormal brain mri than others who had normal brain mri . so from 306 cases , patients with seizures were 184 ( 60.1 % ) and from 274 cases , patients without seizures were 156 ( 56.9 % ) who had abnormal brain mri but noting the p = 0.44 significant difference has not been seen . considering that 56 % of affected children aged less than 2 years admitted before seizure stage , it may be possible that they suffer from seizures in the later stages of their maturity . therefore , to achieve more eligible results , the later followup of these children should be evaluated . other important points of this study are about close relative parents of the affected children ( 56.9 % ) . these findings in children with abnormal brain mri are higher than those reported in normal brain mri meaning that from 330 cases with relative parents 201 cases ( 60.9 % ) were assigned abnormal brain mri where this finding between 250 children with nonrelative parents was only 39 cases ( 55.6 % ) . although this is statistically not considered as the significant difference , regardless of the brain mri findings , and with regard to social context of the region , frequency of relative marriage , hereditary chromosomal disorders , and metabolic diseases as important causes of gdd , this result can be expected and emphasizes the necessity of identifying these diseases .\noutput:\n" }, { "from": "agent", "value": "background . developmental disorders are failure or inability to acquire various age - specific skills at expected maturational age , which affects about 510 % of preschool children . one of the most important methods for evaluation of developmentally delayed children is neuroimaging , especially , brain magnetic resonance imaging ( mri ) that provides useful information regarding brain tissue structures and anomalies . method and material . in this study , hospital records of 580 developmentally delayed children ( aged 2 months to 15 years ) who admitted in pediatric ward of golestan hospital from 1997 to 2009 were selected . information such as age , mri findings were collected in the questionnaire and statistically analyzed . results . total , 580 children including 333 males ( 57.4 % ) and 247 females ( 42.6 % ) were studied . abnormal brain mri was observed in 340 ( 58.6 % ) cases ( 204 males , 136 females ) . the finding includes nonspecific in 38 ( 6.6 % ) , congenital and developmental anomalies of brain in 39 ( 6.7 % ) , recognizable syndromes in 3 ( 0.5 % ) , neurovascular diseases or trauma in 218 ( 37.6 % ) , and metabolic or neurodegenerative diseases in 42 ( 7.2 % ) cases . conclusion . because 60 % of all study groups showed abnormal brain mri , using this method could be effective in diagnosis , management , and almost prognosis determination processes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a malignant pleural effusion is diagnosed by detecting exfoliated malignant cells in pleural fluid or demonstrating these cells in pleural tissue obtained by percutaneous pleural biopsy , thoracoscopy or thoracotomy . pleural effusion associated with malignancy in which there is no direct pleural involvement of the tumor and no other cause of effusion is found called para - malignant effusion . the simplest and minimally invasive way to establish the diagnosis of pleural malignancythoracoscopy is the investigation of choice in pleural effusions where a diagnostic pleural aspiration is inconclusive . obviously it can not be performed routinely in a resource - poor country like india . closed pleural biopsy is less sensitive than pleural fluid cytology or thoracoscopy in evaluation of malignant pleural effusions . moreover about 7 - -12 % of patients with malignant pleural effusion can be diagnosed by pleural biopsy when cytology is negative . our study was to evaluate the role of closed pleural biopsy in patients with malignant pleural effusions in a tertiary care centre where facilities for thoracoscopy are not available . a total of 66 cases with pleural effusions associated with malignancy admitted in the chest inpatient department of a tertiary care hospital between june 2007 and may 2008 were selected for the study . inclusion criteria were ( a ) age more than 18 years , ( b ) radiological evidence of pleural effusion , ( c ) evidence of malignancy in pleural fluid cytology or closed pleural biopsy , or cytological / histological evidence of malignancy in an extra - pleural site without evidence of malignancy in pleural fluid cytology or pleural biopsy . patients with chronic renal failure , bleeding diathesis , and anticoagulant therapy were excluded from the study . all patients were initially evaluated with detailed history , clinical examination , chest radiograph , and ct scan of thorax . the fluid was stained with papanicolaou stain and hematoxylin eosin stain and the stained smear was examined for the presence of malignant cell and type of malignancy . if the second sample was also negative , a third sample was examined for malignant cell . closed pleural biopsy was done using abram 's pleural biopsy needle under local anesthesia and four samples were obtained from each patient . if both cytology and histopathology were negative for malignancy , malignant etiology of the case was proved with any of the following procedures : biopsy of peripheral lymph node , ct - guided fine - needle aspiration cytology ( fnac ) of thoracic mass , fibreoptic bronchoscopic biopsy or ultrasonography - guided fnac of hepatic metastasis . there were 35 ( 53.5 % ) males and 31 ( 46.5 % ) females with age range between 28 and 74 years ( mean 52.3 years ) . chest x - ray showed massive pleural effusion in 14 ( 21 % ) cases , concomitant mass lesions in 12 ( 18 % ) cases , collapse in 12 ( 18 % ) , and mediastinal lymphadenopathy in 6 ( 9 % ) cases . ct scan of thorax revealed mass lesion in 26 cases ( 39 % ) , collapse in 13 cases ( 20 % ) , and mediastinal lymphadenopathy in 19 ( 29 % ) cases . the first sample was positive in 35 patients ( 53 % ) , second sample was positive in 10 patients ( 15 % ) , but the third sample was positive only in 1 ( 1.5 % ) patient . closed pleural biopsy showed malignant histology in 32 ( 48 % ) cases and was negative in 34 ( 52 % ) cases . results of pleural fluid cytology and pleural biopsy ( n = 66 ) out of the 46 cases where cytology was positive , the nature of malignancy could be ascertained in 34 patients . types of malignancy on basis of cytological study ( n = 46 ) adenocarcinoma was also the most common type of malignancy ( 65 % ) on the basis of analysis of histopathological examination of pleural biopsy sample . other histological types were squamous cell carcinoma ( 3 % ) , small cell carcinoma ( 6 % ) , large cell carcinoma ( 3 % ) , and indeterminate ( 23 % ) . there were 22 cases where both pleural fluid cytology and pleural biopsy were positive . cytological - pathological concordance of these cases are as follows : ( a ) cytology and histology same in 12 ( 55 % ) cases , ( b ) cytology inconclusive but histology diagnostic in 5 ( 23 % ) cases , ( c ) cytology diagnostic but histology inconclusive in 3 ( 13 % ) cases , and ( d ) cytology and histology giving different diagnosis in 2 ( 9 % ) cases . all the five cases in which cytology was inconclusive , but biopsy yielded definite results were adenocarcinoma . among the three cases where cytology was conclusive butbiopsy could not ascertain the type , two were adenocarcinoma and one squamous cell carcinoma . in the two cases with cytological -- histological nonconcordance , the cytological diagnosis was squamous cell carcinoma but the pleural biopsy revealed adenocarcinoma . in the 10 patients where both cytology and histopathology were negative , the presence of malignancy was ascertained by excision biopsy of lymph nodes ( n = 5 ) , fnac of lung mass under ct guidance ( n = 3 ) , usg - guided fnac from hepatic metastasis ( n = 1 ) and fibreoptic bronchoscopy ( n = 1 ) . the diagnostic yield of pleural fluid cytology has shown a wide variation ranging from 40 % to 90 % . several factors influence the yield including mechanism of effusion , type of primary tumor , nature of specimens , number of specimens and the skill of the cyto - pathologists . para - malignant effusions will obviously have fewer yields than the malignant effusions . among the primary tumors diagnostic rate is higher in adenocarcinoma than in mesothelioma , squamous cell carcinoma , lymphoma , and sarcoma . if both cell blocks ( formed by centrifuging the sample and extracting the solid cellular portion ) and smears are prepared the yield becomes better than if only one method is used . one study found the yield of 65 % , 27 % , and 5 % from the first , second , and third samples respectively . moreover , there is still controversy regarding the optimal amount of fluid to be submitted for examination . while one recent study showed that 60 ml of fluid produced better sensitivity than 10 ml , another previous study showed that sending fluid more than 50 ml did not improve the diagnostic yield . our study has confirmed the influence of almost all the factors in diagnostic yield . in our studythe overall diagnostic yield was 70 % , adenocarcinoma was the most common diagnosis ( 54 % ) and the yield in the third fluid sample was significantly lower ( 1.5 % ) than the first and second samples ( 53 % and 15 % respectively ) . we used both cell blocks and smears to increase the yield and submitted 50 ml of fluid in each patient to avoid the controversy of optimum amount of fluid . when pleural fluid cytology is negative in a suspected case of malignant pleural effusion , there are several options for further investigations like image - guided cutting needle biopsy , closed pleural biopsy , medical thoracoscopy , video - assisted thoracic surgery , and thoracotomy . in malignant pleural effusions , a review of pleural biopsy yield from 2893 examinations show a diagnostic yield of only 57 % for malignancy . however the yield ranged from 40 % to 75 % . the relatively low yield of blind pleural biopsy is due to scarce , patchy and irregular distribution of the tumor invasion of the pleura . however studies have shown that 7 % to 12 % of patients with malignant effusions may be diagnosed by pleural biopsy when cytology is negative . contrast - enhanced thoracic ct scan will often show a focal area of abnormal pleura which can be biopsied with an image guided cutting needle biopsy . it has a higher diagnostic yield than that of blind pleural biopsy in diagnosis of malignant effusions . in a studythe sensitivity of blind biopsy and cutting needle biopsy to diagnose malignancy was 47 % and 87 % respectively . but thoracoscopy is not available in most centers , is a costly procedure , has about 2.3 % incidence of major complications , and needs hospitalization and thoracic surgery backup . thoracoscopy may also yield false negative results due to insufficient or nonrepresentative biopsy or presence of adhesions that prevent access to neoplastic tissue . it is opined that discouragement of closed pleural biopsy by western literature unfortunately translated into its decline in india . blind pleural biopsy is easily available , can be done on an outpatient basis , and has minimal complications in an experienced hand . it is a useful procedure specially when thoracoscopy is unavailable or the patient is too sick to tolerate thoracoscopy . moreover it is highly sensitive and cost - effective test to exclude unsuspected tuberculosis in a resource - poor country with a high incidence of tuberculosis . so there is necessity to redeem the practice of closed pleural biopsy among pulmonologists through proper awareness and encouragement . it is still highly relevant especially in a resource - limited country like ours where thoracoscopy is available only in few tertiary care centers of large cities .\noutput:\n" }, { "from": "agent", "value": "background : pleural fluid cytology for malignant cells is the easiest way to diagnose malignant pleural effusion with good sensitivity and specificity . with the introduction of medical thoracoscopy , the use of closed pleural biopsy for the diagnosis of cytology negative malignant pleural effusion is gradually decreasing . however use of thoracoscopy is limited due to its high cost and procedure related complications.aims : the aim was to assess the usefulness of closed pleural biopsy in the diagnosis of malignant pleural effusion.materials and methods : sixty - six patients of pleural effusion associated with malignancy were selected from the patients admitted in the chest ward of a tertiary care hospital over a period of 1 year . pleural fluid aspiration for cytology and closed pleural biopsy were done in all the patients.results : out of 66 patients , 46 ( 69 % ) patients showed malignant cells in pleural fluid cytology examination . cytology was positive in 35 ( 52 % ) , 10 ( 15 % ) , and 1 ( 1.5 % ) patients in the first , second , and third samples respectively . closed pleural biopsy was positive in 32 ( 48 % ) patients . among them , 22 also had positive cytology . additional 10 cytology negative patients were diagnosed by pleural biopsy . cytology histology concordance was seen in 12 patients . definite histological diagnosis could be achieved in five patients with indeterminate cytology . pleural biopsy was not associated with any major postoperative complication.conclusion : closed pleural biopsy can improve the diagnostic ability in cytology negative malignant pleural effusion . closed pleural biopsy has still a place in evaluation of malignant pleural effusion especially in a resource - limited country like india ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we tested three female patients with bilateral amygdala damage due to urbach - wiethe disease ( mean age = 39.33 years , s.d . = 1.15 ) and 12 healthy , neurologically - intact females of comparable age ( mean = 43.08 , s.d . all subjects were free of psychiatric diagnoses and medications , and reported no personal or family history of panic attacks . all subjects gave written informed consent , and all procedures were approved by the university of iowa institutional review board . before the procedures , all subjects completed the beck anxiety inventory as a measure of baseline anxiety , and both groups reported experiencing low levels of anxiety that were not significantly different ( amygdala lesion mean raw score = 4 , s.d . = 3.8 ; p = 0.365 ) . during each inhalation challenge , subjects were in a supine position while seated in a reclining chair . a plastic inhalation mask was comfortably placed over their nose and mouth and then strapped to the reclining chair to ensure that it would remain in place during the inhalation . respiratory rate , heart rate , and skin conductance were recorded throughout each trial using a biopac mp150 data acquisition system ( biopac systems , inc ) . baseline recordings were taken during a two minute rest period before each inhalation and recordings continued for two minutes after each inhalation . the volume of each inhalation was recorded using an rss 100 research pneumotach system ( korr medical technologies ) . forced inspiratory vital capacity ( fivc ) was calculated from height and weight as described previously . during all challenges , subjects were required to inhale a minimum of 75 % of their fivc in order for the challenge to be considered valid . all subjects completed 4 single - breath fivc challenges , two with compressed air and two with 35 % co2 mixed with 21 % oxygen ( balanced with nitrogen ) . all bilateral amygdala lesion patients returned for a second visit to complete an additional set of challenges . the challenge order for each subject was air first followed by co2 , and was repeated at least once . each trial was separated by an interval of at least 20 minutes . at the end of each inhalation , subjects completed a number of different self - report questionnaires including : an inhalation symptom checklist containing all of the dsm - iv symptoms of a panic attack ; four separate visual analog scales ( vas ) asking them to rate their level of fear , panic , anxiety , and anger from 0 ( not at all ) to 100 ( extremely ) ; a bipolar valence scale asking them to rate the inhalation from 0 ( extremely unpleasant ) to 8 ( extremely pleasant ) ; an arousal scale asking them to rate the overall intensity of the inhalation from 0 ( not at all ) to 8 ( extremely ) ; and the state portion of the spielberger state - trait anxiety inventory . when completing the self - report questionnaires , subjects were instructed to rate how they felt during and immediately following the inhalation when symptoms were at their peak . the same measures were also completed before each inhalation ( i.e. , baseline ) during which subjects were instructed to rate how they currently felt . after each trial , subjects were interviewed by a clinician or trained researcher and were asked to describe any symptoms they experienced before , during , and after the inhalation . the threshold for a panic attack was based upon conservative criteria for differentiating panic attacks from the strong respiratory and physiological responses that many people have to co2 challenges . this threshold required that the subject endorse at least four dsm - iv symptoms of panic , either express or enact a desire to escape or flee , and report at least a 25 % increase in panic as measured by the panic vas . of note , vas panic scores did not differ significantly between the first and second panic attacks described in supplementary table 1 ( paired t - test , p = 0.13 ) . data from the comparison group was statistically compared to the amygdala - lesion group using two - tailed mann - whitney u - tests with bonferroni - holm correction for multiple comparisons ( when appropriate ) and a significance threshold of p 0.05 . the self - report ratings were converted to pomp scores ( standardized units representing the percent of maximum possible for each scale , ranging from 0100 ) , and the valence scale was reverse - scored . several of the self - report measures were not collected in one of the non - panicking comparison participants . evoked increases in heart rate were calculated by subtracting the baseline rate from the maximum rate during the minute following each inhalation . baseline was calculated as the average heart rate during the 20 beats preceding the minute before inhalation , whereas maximum heart rate following inhalation was found by assessing each beat - to - beat interval averaged over three seconds . evoked increases in respiratory rate were similarly calculated by subtracting the baseline rate from the maximum rate during the minute following inhalation . baseline was calculated as the average respiratory rate during the two minutes prior to inhalation , whereas maximum respiratory rate was found by assessing each breath - to - breath interval during the minute following inhalation . evoked skin conductance responses ( scr ) were calculated by subtracting the average skin conductance level during the first second of inhalation from the peak skin conductance level during the minute following the start of inhalation . differential increases in respiration , heart rate , and scr were calculated in each subject by subtracting their maximum evoked response during the air trial from their maximum evoked response during the co2 trial . we were unable to obtain skin conductance from anywhere on the palm of the hands or the fingers in both sm and bg ( likely due to epithelial pathology caused by urbach - wiethe disease ) , and thus , patient am is the only lesion patient included in the scr analysis and was compared to the comparison participants using a modified t - test . patient sm was excluded from the heart rate analysis since she was taking propranolol for treatment of hypertension . additionally , the heart rate data for am and bg during the first co2 inhalation could not be analyzed due to contamination by motion artifacts secondary to the patients escape behavior , and thus , heart rate could only be analyzed during later trials . an anticipatory scr was considered to be any upward deflection in skin conductance during the 10 seconds prior to inhalation . the magnitude of the response was calculated by subtracting the skin conductance level at the beginning of this deflection from the level at its peak during the 10 seconds prior to inhalation . anticipatory heart rate was similarly calculated by subtracting the previously described baseline heart rate from the average heart rate calculated during each 3 - second interval in the minute before inhalation . we tested three female patients with bilateral amygdala damage due to urbach - wiethe disease ( mean age = 39.33 years , s.d . = 1.15 ) and 12 healthy , neurologically - intact females of comparable age ( mean = 43.08 , s.d . all subjects were free of psychiatric diagnoses and medications , and reported no personal or family history of panic attacks . all subjects gave written informed consent , and all procedures were approved by the university of iowa institutional review board . before the procedures , all subjects completed the beck anxiety inventory as a measure of baseline anxiety , and both groups reported experiencing low levels of anxiety that were not significantly different ( amygdala lesion mean raw score = 4 , s.d . = 2 ; comparison group mean raw score = 3.4 , s.d . = 3.8 ; p = 0.365 ) . during each inhalation challenge , subjects were in a supine position while seated in a reclining chair . a plastic inhalation mask was comfortably placed over their nose and mouth and then strapped to the reclining chair to ensure that it would remain in place during the inhalation . respiratory rate , heart rate , and skin conductance were recorded throughout each trial using a biopac mp150 data acquisition system ( biopac systems , inc ) . baseline recordings were taken during a two minute rest period before each inhalation and recordings continued for two minutes after each inhalation . the volume of each inhalation was recorded using an rss 100 research pneumotach system ( korr medical technologies ) . forced inspiratory vital capacity ( fivc ) was calculated from height and weight as described previously . during all challenges , subjects were required to inhale a minimum of 75 % of their fivc in order for the challenge to be considered valid . all subjects completed 4 single - breath fivc challenges , two with compressed air and two with 35 % co2 mixed with 21 % oxygen ( balanced with nitrogen ) . all bilateral amygdala lesion patients returned for a second visit to complete an additional set of challenges . the challenge order for each subject was air first followed by co2 , and was repeated at least once . each trial was separated by an interval of at least 20 minutes . at the end of each inhalation , subjects completed a number of different self - report questionnaires including : an inhalation symptom checklist containing all of the dsm - iv symptoms of a panic attack ; four separate visual analog scales ( vas ) asking them to rate their level of fear , panic , anxiety , and anger from 0 ( not at all ) to 100 ( extremely ) ; a bipolar valence scale asking them to rate the inhalation from 0 ( extremely unpleasant ) to 8 ( extremely pleasant ) ; an arousal scale asking them to rate the overall intensity of the inhalation from 0 ( not at all ) to 8 ( extremely ) ; and the state portion of the spielberger state - trait anxiety inventory . when completing the self - report questionnaires , subjects were instructed to rate how they felt during and immediately following the inhalation when symptoms were at their peak . the same measures were also completed before each inhalation ( i.e. , baseline ) during which subjects were instructed to rate how they currently felt . after each trial , subjects were interviewed by a clinician or trained researcher and were asked to describe any symptoms they experienced before , during , and after the inhalation . the threshold for a panic attack was based upon conservative criteria for differentiating panic attacks from the strong respiratory and physiological responses that many people have to co2 challenges . this threshold required that the subject endorse at least four dsm - iv symptoms of panic , either express or enact a desire to escape or flee , and report at least a 25 % increase in panic as measured by the panic vas . of note , vas panic scores did not differ significantly between the first and second panic attacks described in supplementary table 1 ( paired t - test , p = 0.13 ) . data from the comparison group was statistically compared to the amygdala - lesion group using two - tailed mann - whitney u - tests with bonferroni - holm correction for multiple comparisons ( when appropriate ) and a significance threshold of p 0.05 . the self - report ratings were converted to pomp scores ( standardized units representing the percent of maximum possible for each scale , ranging from 0100 ) , and the valence scale was reverse - scored . several of the self - report measures were not collected in one of the non - panicking comparison participants . evoked increases in heart rate were calculated by subtracting the baseline rate from the maximum rate during the minute following each inhalation . baseline was calculated as the average heart rate during the 20 beats preceding the minute before inhalation , whereas maximum heart rate following inhalation was found by assessing each beat - to - beat interval averaged over three seconds . evoked increases in respiratory rate were similarly calculated by subtracting the baseline rate from the maximum rate during the minute following inhalation . baseline was calculated as the average respiratory rate during the two minutes prior to inhalation , whereas maximum respiratory rate was found by assessing each breath - to - breath interval during the minute following inhalation . evoked skin conductance responses ( scr ) were calculated by subtracting the average skin conductance level during the first second of inhalation from the peak skin conductance level during the minute following the start of inhalation . differential increases in respiration , heart rate , and scr were calculated in each subject by subtracting their maximum evoked response during the air trial from their maximum evoked response during the co2 trial . we were unable to obtain skin conductance from anywhere on the palm of the hands or the fingers in both sm and bg ( likely due to epithelial pathology caused by urbach - wiethe disease ) , and thus , patient am is the only lesion patient included in the scr analysis and was compared to the comparison participants using a modified t - test . patient sm was excluded from the heart rate analysis since she was taking propranolol for treatment of hypertension . additionally , the heart rate data for am and bg during the first co2 inhalation could not be analyzed due to contamination by motion artifacts secondary to the patients escape behavior , and thus , heart rate could only be analyzed during later trials . an anticipatory scr was considered to be any upward deflection in skin conductance during the 10 seconds prior to inhalation . the magnitude of the response was calculated by subtracting the skin conductance level at the beginning of this deflection from the level at its peak during the 10 seconds prior to inhalation . anticipatory heart rate was similarly calculated by subtracting the previously described baseline heart rate from the average heart rate calculated during each 3 - second interval in the minute before inhalation .\noutput:\n" }, { "from": "agent", "value": "decades of research have highlighted the amygdala s influential role in fear . surprisingly , we found that inhalation of 35 % co2 evoked not only fear , but also panic attacks , in three rare patients with bilateral amygdala damage . these results indicate that the amygdala is not required for fear and panic , and make an important distinction between fear triggered by external threats from the environment versus fear triggered internally by co2 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although no established method exists to evaluate movement in direction change , the gait ability test of the meiji yasuda life foundation of health and welfare is often used1 . in this test , a 10.0 - m walkway is set up with two points indicating where to change direction on the left and right , at intervals of 2.0 m , 0.5 m from the center line . at the start signal , subjects walk around the outside of each point indicating to change direction as quickly as possible , and measure the time taken to reach the goal . it is a performance test for which measurements are taken twice and the lower of the two values is adopted . some reports have described this method in evaluating the physical fitness of elderly people2 , 3 and its association with myofunction4 , 5 . however , the kinematics , specifically of knee joint rotation , during direction change have not been examined . studies have clarified that center of pressure ( cop ) control from active knee joint rotation occurs when maintaining a one - legged stance , which is considered a difficult task in the field of physical therapy6 . therefore , the possibility of using a one - legged stance task in the evaluation of knee joint rotation function and its application in exercise therapy with a goal of improving function was suggested . examining the association between the ability to maintain a one - legged stance and the ability to change directions when walking is also important in terms of physical therapy . however , first it is necessary to ascertain the extent to which knee joint rotation is used during direction changes when walking . however , the methods used in previous studies analyzing direction change were insufficient in terms of dealing with step width . therefore , problems arose with the quantitative measurement of knee joint rotation8 , 9 . for that reason , we specifically examined the tandem gait using a sine wave walkway . the purpose of this study was to ascertain the kinematic characteristics on a horizontal plane , including knee joint rotation , when walking with a tandem gait on a sine wave walkway . eighteen healthy adults ( gender ; 12 male , 6 female , age ; 21.92.7 years ; height ,167.76.8 cm ; weight , 61.68.7 kg ) were enrolled in the study . the pivot leg was defined as the leg opposite to that used when kicking a ball . additionally , we confirmed in advance that subjects did not have a current or history of cns disease that limits walking , orthopedic disease , or visual disturbance or vestibular function disorder that affects balance . we obtained signed consent after explaining the study procedure in detail to all participants . the movement task involved subjects walking with a tandem gait on a sine wave walkway . the adopted walkway was 2.0 m long , with an amplitude of 0.25 m , and the sine wave had three cycles . additionally , the width of the line indicating the walkway was 3.6 cm ( fig . 1fig .1 . tandem gait on a sine wave walkway ) . a six - camera , three - dimensional motion analysis system ( locus 3d ma - 5000 ; anima corp . ) was used to record movement . first , we affixed markers on the following 13 locations : vertex , c7 spinous process , episternum , both acromia , both anterior superior iliac spines , two places on the left lateral epicondyle , right lateral epicondyle , two places on the left lateral malleolus , and the right malleolus medialis . we standardized the markers that we affixed to the left lateral epicondyle and the left lateral malleolus at positions of 1.5 cm and 10.0 cm from each bone index ( fig . tandem gait on a sine wave walkway the 13 locations of the markers the start position was a standing position on the starting line with arms crossed over the chest . at the sound of a signal , subjects started to walk with a tandem gait . the task ended when both feet stepped over the goal line . in performing this task , we set up three discontinuation criteria : if the folded arms became unfolded ; if a foot deviated from the walkway ; and if , when in a double - leg support period , a part of the ankle of one foot and the tip of the other foot were not touching the ground . when any of those occurred , we measured the gait again . we calculated trunk , hip joint , and knee joint rotation angles from one cycle of coordinate data from the 2.0 m walkway . the following calculation method to obtain the rotation angles was used : the trunk rotation angle is the angle formed by the intersection of the perpendicular line connecting c7 and the episternum and the line connecting both asiss . the hip joint rotation angle is the angle formed by the intersection of the line connecting both asiss and the line that connects the two markers on the left lateral epicondyle of the femur . the knee joint rotation angle is the angle formed by the intersection of the line that connects the two markers on the left lateral epicondyle of the femur and the line that connects the two markers on the left lateral malleolus . in addition , regarding the knee joint rotation angle , the position of the thigh and calf were defined as 0 in the upright position . for data processing , we used an original program written in matlab ( the mathworks inc . ) . the angle change in external and internal rotation and angle range are shown in table 1table 1 . segment angleangle change to external rotation ( ) angle change to internal rotation ( ) angle range ( ) trunk rotation 13.06.410.37.223.3 ( 13.010.3 ) hip rotation15 .610.437.79.453.3 ( 15.637.7 ) knee rotation18 .49.428.912.047.3 ( 18.428.9 ) trunk rotation : angle change to right rotation ( + ) angle change to left rotation ( ) . the trunk , hip joint , and knee joint rotation angles were 23.3 , 53.3 , and 47.3 , respectively .3 . the relationship between each segment angle of the representative exampletrunk rotation : angle change to right rotation ( + ) angle change to left rotation ( ) hip rotation : angle change to external rotation ( + ) angle change to internal rotation ( ) knee rotation : angle change to external rotation ( + ) angle change to internal rotation ( ) shows the relationship between each segment angle of the representative example concerned . foot length differed between subjects . the sequential change in each angle varied among subjects , but we were able to confirm the relationship between changes was common to all subjects . the trunk generally rotated towards the direction of movement . when turning left using the left leg as the pivot , the hip joint was internally rotated and the knee joint was externally rotated . in contrast , when making a directional change to the right using the left leg as the pivot , the hip joint was externally rotated and the knee joint was internally rotated . furthermore , the hip joint and knee joint rotation angles showed multiple peaks and overlapped with the movement at the time of direction change . trunk rotation : angle change to right rotation ( + ) angle change to left rotation ( ) the relationship between each segment angle of the representative example trunk rotation : angle change to right rotation ( + ) angle change to left rotation ( ) hip rotation : angle change to external rotation ( + ) angle change to internal rotation ( ) knee rotation : angle change to external rotation ( + ) angle change to internal rotation ( ) rotation of the knee joint while walking is important for smooth changes of direction . however , the kinematics , especially of knee joint rotation , during direction change have not been examined sufficiently . therefore , we specifically examined tandem gait in a sine wave walkway and chose to determine the kinematic characteristics on a horizontal plane , including knee joint rotation . because the gait was linear during the first and second cycles of the sine wave , we used the one cycle of the sine wave for the calculations of rotation angles . in addition , no difference was found in terms of speed or the number of deviations in the tandem gait with changes in the width of the walkway . therefore , considering versatility , we adopted a width of 3.6 cm , as marked using commercially available adhesive tape . as a result of data analysis , each angle range andeach angle range in the first cycle was as follows : the range of the trunk rotation angle was 23.3 , that of the hip joint rotation angle was 53.3 , and that of the knee joint rotation angle was 47.3 . furthermore , each angle showed common relations in all subjects . the reference range of motion that the japanese orthopedics association and the japanese association of rehabilitation medicine established was 90 rotation for the hip joint and 80 for the trunk10 . the reference range of motion is not specified for the rotation of the knee joint . furthermore , few previous studies have measured the movement of the knee joint three - dimensionally . at present , there is no agreed upon method of measurement . inparticularly , the researchers of preliminary studies state that the definition of the position of 0 is one factor that makes unification of measurement methods difficult . however , approximate angle ranges have been reported , although no consensus has been obtained . ross measured the passive rotation angles of the knee joint at different angles of flexion in men . he reported that when the knee joint was flexed at 45 , the rotation range was 41 , at 90 , the range was 37 , and at 135 , the range was 3911 . ouellet et al . measured the passive rotation angle in the sitting position , and reported that it was 40 on the right and 43 on the left12 . they reported that it was 34.9 ( 1855 ) when the knee joint was flexed at 70 , 40.4 ( 2067 ) at 90 , and 44.1 ( 2467 ) at 11013 . because the knee joint rotation angle ranges in the present study were similar to the values shown in preliminary research , we believe the calculated values to be reasonable . considering the results described above , it became evident that in terms of knee joint rotation , it requires a wider range of movement compared with the reference range of motion , unlike the trunk or hip joint . additionally , it is extremely interesting that a definite relation was found for each intersegmental movement . for example , in changing direction to the left with the left leg as the axis , the trunk and the knee joint showed rotation to the left and external rotation , which was the direction of movement . however , the hip joint showed internal rotation , opposite to the direction of movement . when considering changes of direction from the viewpoint of rotary motion of segments on horizontal planes , reverse torque is necessary to cancel out the torque in the direction of movement . in other words , regarding the change of direction examined in this study , the hip joint created reverse torque against the torque in the direction of movement created by the external rotation of the knee joint . furthermore , as for the trunk , the possibility was suggested that it adjusts movements by creating torque in the opposite direction to the hip joints by rotating to the left . to date , when discussing direction change , the function of the hip joint and leg have attracted attention14 . however , through examining tandem gait on a sine wave walkway , knee joint rotation was also found to be important . in addition , the possibility of its use in balance evaluation was shown . regarding each joint , when a certain movement is difficult to execute despite having a reference mobile range , a decline in functionnevertheless , we have not verified in this study whether knee joint rotation is an active movement or whether it is a passive movement . in future research\noutput:\n" }, { "from": "agent", "value": "[ purpose ] the purpose of this study was to ascertain the kinematic characteristics on a horizontal plane , including knee joint rotation , when walking with a tandem gait on a sine wave walkway . [ subjects and methods ] eighteen healthy adults were enrolled as subjects in this study . they walked with a tandem gait on a sine wave walkway . a three - dimensional motion analysis system was used to record data and calculate the trunk , hip joint , and knee joint rotation angles . [ results ] the rotation angle ranges for the trunk , hip joint , and knee joint were 23.3 , 53.3 , and 47.3 , respectively . the trunk generally rotated towards the direction of movement , and when turning left using the left leg as the pivot , the hip joint was internally rotated and the knee joint was externally rotated . in contrast , when making a directional change to the right using the left leg as the pivot , the hip joint was externally rotated and the knee joint was internally rotated . [ conclusion ] through tandem gait analysis on a sine wave walkway , knee joint rotation was found to be important in changes of direction ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the immune system is tightly regulated , maintaining , in normal physiological conditions , a balance between immunity to challenge by pathogens and tolerance in order to suppress inappropriate immune responses . regulatory t cells ( treg ) have been recognized to play a major role in immune homeostasis by maintaining self - tolerance and preventing autoimmunity . expression of the transcription factor forkhead box p3 ( foxp3 ) specifies the treg lineage and confers suppressive function , through activation of a transcriptional program required for regulation . the cytokine transforming growth factor beta1 ( tgf - 1 ) plays a critical role in treg development and function . the liver can be considered an immune - privileged site similar to other immune - privileged organs such as the eye and the gonads . the tolerogenic status of the liver is necessary because the liver receives blood not only from the systemic circulation via the hepatic artery , but also from the gastrointestinal ( gi ) tract via the portal vein . portal vein flow results in a high concentration of non - pathogen - associated antigens reaching the liver , such as food antigens and bacterial breakdown products from commensal organisms residing in the gut . for example , lipopolysaccharide ( lps ) is present in the portal venous blood at a concentration of about 1 ng / ml , a concentration which , if present in the systemic circulation , would lead to septic shock . to handle this immense load of bacteria - derived substances , the liver maintains a state of local immune tolerance , using a variety of mechanisms . the liver treg compartment is one important component of the network of cells that mediates liver tolerance . toll like receptors ( tlrs ) are pathogen recognition receptors that recognize conserved molecules found across diverse bacterial species ; for example , tlr2 recognizes lipoteichoic acid present in most gram - positive bacteria , whereas tlr4 recognizes lps , present in most gram - negative bacteria . tlrs play critical roles in linking the innate and adaptive branches of the immune system . tlr ligands induce dendritic cell ( dc ) maturation from an immature phenotype and upregulate mhc class ii and costimulatory molecules , necessary for proper activation of t cells by dcs . myeloid differentiation primary response 88 ( myd88 ) is a universal cytosolic adaptor protein that is downstream of all bacterial - responsive tlrs . while published studies have looked at the development of tregs in the neonatal thymus , and spleen , the development of tregs in the neonatal liver has not been previously studied . here , we assess the development of the treg compartment in the postnatal liver and examine the contributions of tgf - 1 and myd88 to liver treg development . foxp3 mice on the balb / c background and tlr2 knockout mice were obtained from the jackson laboratory ( bar harbor , me ) . foxp3.tgfb1 knockout mice on the balb / c background were generated by breeding foxp3 with tgfb1 heterozygous mice . the use of these reporter mice ensures that native foxp3 protein remains unmodified , as it has been shown recently that a commonly used reporter mouse expressing a foxp3 fusion protein is a hypomorph with an abnormal treg phenotype . brent berwin at the geisel school of medicine . timed pregnant c57bl / 6 mice were obtained from the national cancer institute ( nci ) . mice were bred at the geisel school of medicine according to association for assessment and accreditation of laboratory animal care practices . foxp3 and tlr2 knockout mice were genotyped by pcr as per the vendors ' protocol . tgf - 1 knockout mice and myd88 knockout mice were genotyped as previously described , whereas leadbetter et al . indicate that pcr products expected from myd88 mice and myd88 mice are approximately 550 and 750 base pair ( bp ) , respectively ; in our hands these pcr products were approximately 600 and 300 bp , respectively . the mouse strain ( s ) ( c57bl / 6 or balb / c ) used in each figure is indicated in the figure legends . liver tissue was dissociated by chopping using a razor blade or by use of a tissue dissociator as per manufacturer 's protocol ( gentlemacs dissociator , miltenyi biotec ) and subjected to treatment with 5 g dnase and 500 units of collagenase ( sigma ) . a cell suspension of liver nonparenchymal cells ( npc ) was obtained by filtering and removal of hepatocytes , followed by red blood cell ( rbc ) lysis . for spleen and thymus , cell suspensions were prepared by grinding between frosted glass slides , followed by filtering and rbc lysis . prior to staining with specific antibody , nonspecific binding was blocked using fc block ( anti - mouse cd16 / cd32 , clone 93 , ebioscience ) . antibodies used for staining were anti - cd4 ( clone gk1 .5 , ebioscience ) , anti - cd3 ( clone 145 - 2c11 , bd pharmingen ) , and anti - foxp3 ( clone fjk - 16s , ebioscience ) . intracellular staining for foxp3 was carried out using a kit according to the manufacturer 's protocol ( ebioscience ) . flow data analysis was carried out using either flowjo version 7.6.5 ( treestar ) software or bd accuri c6 software ( version 1.0.202.1 ) . timed pregnant mice were treated beginning at about two weeks of gestation with the following antibiotics ( in the drinking water ) : ampicillin ( 1antibiotic treatment in the drinking water was maintained until pups were 8 - 9 days old . significance was determined using either the nonparametric mann whitney u - test for two - group comparisons or a two - way anova for kinetic data . significance is denoted as follows : ns not significant ( p 0.05 ) , * p 0.05 , * * p 0.01 , * * * p 0.001 , * * * * p 0.0001 , or as indicated in the figures . error bars indicate mean standard deviation . box and whisker plots show 5th to 95th percentile . we employed a reporter mouse that provides convenience in the detection of foxp3 expressing cells . in foxp3 transgenic reporter mice , foxp3 expressing cells are identified as egfp and are readily detected on flow cytometry without needing additional manipulations , such as intracellular staining . it has been shown recently that transgenic mice in which the egfp reporter is expressed as a fusion protein with foxp3 have subtle immunologic abnormalities , owing to unexpected effects of the egfp fusion partner on foxp3 functionality . for this reason , we used reporter mice in which the foxp3 protein is expressed from a bicistronic reporter construct that coexpresses foxp3 and egfp as separate proteins . we obtained evidence that the expression of gfp is a reliable marker for foxp3 expression . using cell sorting to isolate gfp and gfp populations , we analyzed sorted populations by intracellular staining for the nuclear protein foxp3 ( figure 1 ) . the gfp population did not show expression of foxp3 , whereas greater than 95 % of the gfp population was positive for the expression of foxp3 . next , we assessed the development of foxp3cd4 t cells ( regulatory t cells ( tregs ) ) in early postnatal thymus , liver , and spleen of foxp3 reporter mice . we assessed both the frequency of tregs , defined as the percentage of tregs ( gfp or foxp3 ) among cd4 t cells , and the density of tregs in each organ , defined as treg cells / mg . previous studies show that tregs are detectable in thymus at postnatal days 3 - 4 . consistent with this , about 3 % of cd4 cells in foxp3 mouse thymus were gfp at postnatal days 3 - 4 ( figures 2 ( a ) and 2 ( b ) ) . over the next two to three weeks , the frequency of gfp cells among cd4 cells progressively decreased to ~ 1 % by weaning age ( day 20 - 21 ) . the density of tregs in thymus remained relatively constant throughout the neonatal period ( range 1,200 to 4,000 cells / mg ; figure 2 ( c ) ) . in this analysis , we did not specifically stain for cd8 and therefore can not formally determine whether some of these cells represent cd4cd8 double positive ( dp ) cells . however , this percentage is likely to be quite small , as it has been shown in several previous studies that , in the postnatal period through adulthood , greater than 95 % of cd4foxp3 thymocytes are cd4cd8 single positive cells and less than 5 % of cd4foxp3 thymocytes are dp cells . in spleen , the frequency of tregs was ~ 6 % at days 3 - 4 and quickly increased , reaching a steady state of ~ 1012 % at days 68 , a frequency maintained at 11 - 12 days and 20 - 21 days ( figures 2 ( a ) and 2 ( b ) ) . the density of tregs in the spleen was 500 cells / mg at days 3 - 4 and progressively increased over the next several weeks . by weaning age , splenic treg density increased significantly , to ~ 6,500 cells / mg ( figure 2 ( c ) ) . in liver , tregs were detectable as early as days 3 - 4 , with a frequency ( ~ 6 % ) comparable to that of spleen at similar age . at days 68 and 11 - 12 , approximately 1517 % of cd4 t cells were tregs . at days 20 - 21 , the frequency was lower ( 13 % ; figures 2 ( a ) and 2 ( b ) ) . at all agestested , the density of tregs in liver was lower than in either spleen or thymus ( figure 2 ( c ) ) , consistent with the lower numbers of immune cells in this nonlymphoid organ . a direct comparison of treg frequency in the two organs shows that the spleen and liver were comparable at days 3 - 4 and 20 - 21 . however , in between these two time points , the liver exhibited a significantly greater ( ~ 1.5-fold ) treg frequency ( figure 3 ( a ) ) . statistical analysis using anova revealed that these curves are significantly different ( p = 0.003 ) . assessing later time points , at 6 weeks , the relative frequency of tregs in liver was lower than in spleen , a difference that was even more pronounced at 13.5 weeks ( figure 3 ( b ) ) . thus , at 1 - 2 weeks of age , the liver exhibits a relatively greater treg frequency as compared with spleen ; in the mature adult , the relative frequency is reversed , with liver showing lower treg frequency among cd4 t cells . because tgf - 1 plays an important role in the ontogeny and function of tregs , we analyzed its contribution to the early development of tregs in thymus , spleen , and liver . to facilitate this analysis , we crossed balb / c background foxp3 mice with balb / c background tgf - 1 knockout ( tgfb1 ) mice . balb / c tgfb1 mice develop histologically and biochemically detectable necroinflammatory disease in liver and other organs beginning at around 10 days of age , caused by an influx of cd4 t cells , and die at 1517 days of age . owing to this lethality , we could not measure tregs at 20 - 21 days , so our analyses here are restricted to the 3 - 4 , 68 , and 11 - 12 day time points only . foxp3 littermates with one intact tgfb1 allele ( heterozygous tgfb1 mice ) were used as controls ; tgfb1 mice are healthy and phenotypically indistinguishable from wild type ( tgfb1 ) mice . in thymus , treg frequency in control tgfb1 mice was ~ 4 % at days 3 - 4 and diminished moderately over the next week ( figure 4 ( a ) ) , indicating that the control mice exhibited the expected wt foxp3 mouse pattern ( figure 2 ) . in tgfb1 mice at days 3 - 4 , thymic treg frequency was lower than in littermate tgfb1 mice . the treg frequency in tgfb1 thymus increased dramatically over the next week , reaching 10 % at days 11 - 12 ( figure 4 ( a ) ) . the density of tregs also increased in tgfb1 thymus over this time period ( figure 4 ( b ) ) . the dramatic increase in thymic treg production at days 68 and 11 - 12 is consistent with previous reports showing a similar pattern in mice in which t cells have been rendered conditionally deficient in one of the key components of the tgf - receptor . in spleen , treg frequency in control tgfb1 mice exhibited the expected wt foxp3 mouse pattern ; that is , treg frequency was ~ 7 % at days 3 - 4 and increased to a steady state of ~ 12 to 13 % over the next week . tgfb1 mice exhibited a significant delay in the development of tregs in the neonatal spleen ; at days 3 - 4 and 68 , both frequency and density of tregs in tgfb1 spleen were significantly lower compared to tgfb1 littermates . by days 11 - 12 , there was no difference in either frequency or density between tgfb1 spleens and tgfb1 spleens ( figures 4 ( a ) and 4 ( b ) ) . in liver , treg frequency in control tgfb1 mice was ~ 10 % at days 3 - 4 and increased to over 20 % over the next week , an increase similar to that observed in wt foxp3 liver . as in spleen , tgfb1 liver exhibited a significant delay in the development of tregs ; at days 3 - 4 , the frequency of tregs in tgfb1 liver was significantly lower compared to littermate control tgfb1 livers . at days 11 - 12 , the frequency of tregs among cd4 t cells in tgfb1 liver remained low ( figure 4 ( a ) ) . this is a different pattern from that observed in tgfb1 spleen , where the frequency of tregs normalized by days 11 - 12 . the low treg frequency at day 11 - 12 is likely a function of the massive influx of ( non - treg ) effector cd4 t cells into liver ( but not spleen ) that occurs just prior to 11 days of age in tgfb1 mice . indeed , at days 11 - 12 , the absolute density of tgfb1 liver tregs surpassed that of littermate control tgfb1 liver tregs , consistent with a large overall t cell influx ( figure 4 ( b ) ) . next , we examined these data to test the hypothesis that tgf - 1 is required for the transient increase in liver tregs observed at 1 - 2 weeks of age . we compared the frequency of tregs in liver with the frequency of tregs in spleen in tgfb1 mice , as well as in littermate control tgfb1 mice . at days 11 - 12 , littermate control tgfb1 mice had a significantly higher frequency of tregs in liver as compared with spleen ( p 0.01 by anova ; figure 4 ( c ) ) , similar to what had been observed in wt foxp3 mice . importantly , in tgfb1 mice at any age , treg frequency was no different in spleen versus liver ( p : n.s . ) therefore , the transient increase in liver treg frequency observed in the postnatal period requires tgf - 1 . we sought to further understand the factors that contribute to the transient increase in frequency of liver tregs that occurs one week after parturition . we considered that the transient increase might represent a response to postnatal colonization of the murine intestine . commensal organisms begin to colonize the murine intestinal tract as early as day 1 after birth . the intestinal microbiota is known to play an important role in shaping the mature immune system in the intestine as well as extraintestinally . based on the anatomic relationship between the intestine and the liver , it is reasonable to conjecture that the gut - liver axis is important for the establishment of the immune system in the liver . we attempted to experimentally manipulate commensal colonization by treating pregnant dams with a cocktail of antibiotics before and after delivery . we obtained data from two litters in which the mothers had been treated successfully with oral antibiotics . indeed , treatment with oral antibiotics abrogated the transient increase in liver tregs ( figure 5 ( a ) ) . in general , however , treatment with antibiotics resulted in unexpected and unacceptable morbidity and poor maternal behavior in mothers ( not shown ) , so we took an orthogonal approach to test our hypothesis . we hypothesized that the transient postnatal increase in liver treg frequency is dependent on signals emanating from tlr responses to bacterial products . since myd88 is a common adaptor molecule that mediates downstream signaling from all bacterial responsive tlrs , we hypothesized that myd88 is required for the transient postnatal increase in liver treg frequency . we interbred heterozygous myd88 mice to produce littermate myd88 pups , myd88 pups , and myd88 pups . importantly , a recent study shows that myd88 gene status does not affect colonization of the intestine by commensal organisms ; therefore all mice from the same litter should become colonized with similar microbiota at similar concentrations , removing a potential artifact in interpretation of data . we analyzed mice at a time point ( days 8 - 9 ) at which the difference in frequency between spleen treg and liver treg is expected to be maximal . because these mice do not harbor the foxp3 reporter construct , we directly analyzed intracellular foxp3 expression on flow cytometry . as expected , wild type myd88 pups had a higher frequency of treg cells in liver than in spleen . notably , the increase in liver treg frequency at this age was completely abrogated in myd88 pups , which had the same frequency of treg cells in liver as in spleen ( figure 5 ( b ) ) . myd88 livers also showed a relative increase in liver treg frequency , but this was more modest than in their wild type myd88 littermates , suggesting there is a gene dosage effect in this pathway . thus , myd88 is required for the transient increase of treg frequency seen in murine liver at 1 - 2 weeks of age , strongly supporting the hypothesis that the increase in treg frequency in liver is a response to colonization of the gut by commensal organisms . as myd88 is required for appropriate neonatal treg development in liver , we next sought to identify upstream signaling molecule ( s ) that may be required for detection of gut colonization . tlr2 has been shown to be required for induction and upregulation of tregs in mice . moreover , tlr2 deficient mice exhibit a 50 % decrease in the frequency of circulating treg cells , whereas tlr4 deficient mice have normal treg frequency . we therefore hypothesized that tlr2 is required for the transient increase of treg frequency in murine liver during early development . we tested this hypothesis by examining treg frequency in the liver and spleen of tlr2 deficient pups . as expected , tlr2 mice had a higher frequency of treg cells in liver than in spleen ( analyzed at days 8 - 9 ) . tlr2 mice also had a higher frequency of treg cells in liver than in spleen and were indistinguishable in this regard from their tlr2 littermates ( figure 6 ) . the involvement of myd88 in this response may be downstream of a different tlr , or perhaps a combination of tlrs . while previous reports have studied the development of tregs in the neonatal thymus , nothing is known about the development of this important t cell compartment in the neonatal liver . this study reveals that the development of the treg compartment in the liver starts as early as day 3 after birth and that there is a pattern of a transient increase in the percentage of tregs in the liver between days 6 and days 12 . colonization of the gut by commensal bacteria is seen as early as day 1 after birth . it has been shown previously that the intestinal colonization of germ - free mice leads to the induction , activation , and expansion of mucosal tregs and the maintenance of immune homeostasis . since the liver receives approximately 70 % of its blood flow via the portal vein from the gut , the gut - liver axis plays a very important role in modulating the immune microenvironment of the liver . based on these previous observations and our findings heremicrobial colonization of the intestine may be detected by intestinal cells by one or more tlr signaling pathways , mediated by the downstream adaptor molecule myd88 . expression of tgf - isoforms and receptors is detectable in rat gastric epithelium both during fetal development and in the neonatal stage . in a model of induction of colonic tregs with clostridium species , it has been shown that , upon tlr ligation , intestinal epithelial cells increase tgf - 1 production and upregulate expression of matrix metalloproteinases ( mmp2 , mmp9 , and mmp13 ) that hydrolyze latent tgf - , converting it to its active form . we propose that tlr / myd88 - mediated response to microbial colonization in the intestine enhances production of tgf - 1 , resulting in an increase in treg percentage in the liver . the observed transient increase in neonatal liver tregs may result from expansion of tregs within liver itself , or from an increased influx of tregs from the intestine ; the data presented here neither support nor exclude either possibility . tgf - 1 might act in the intestine to recruit nave intestinal t cells along the treg developmental pathway or cause expansion of an existing treg population , which then traffic to the liver . alternatively , microbial products resulting from gut colonization reaching the liver via the portal vein might only then be detected by tlrs expressed by resident liver cells . tlr expression in the liver is observed in several different cell populations , including kupffer cells , hepatocytes , hepatic stellate cells , lsecs , hepatic dendritic cells , and liver nk cells . interestingly , tlr4 ligation of quiescent hscs results in increased expression of bambi , the pseudoreceptor for tgf - , increasing the sensitivity of hscs to tgf - . tgf - 1 is critical for the development and maintenance of treg cells in the thymus as well as in the periphery . tgf - 1 is critical for the complete development of liver tregs , since the increase in liver tregs observed at one week postnatally is abrogated in mice deficient in the gene encoding tgf - 1 . it has been shown that tgf - 1 may be acquired from the mother through breast - feeding and pups here are indeed born from tgf -1-replete mothers ( tgfb1 heterozygous ) ; moreover , there are two additional tgf - isoforms expressed in mouse . clearly , however , it is endogenously produced tgf - 1 that is critical for the treg increase at one week after birth , and neither maternal tgf - 1 nor endogenous tgf - 2 or tgf - 3 is sufficient to rescue the liver treg development phenotype . in addition to tgf - 1 , several additional secreted or membrane - bound factors are known to affect treg development , including il - 2 , retinoic acid and b - 7 family molecules that signal through cd28 and ctla - 4 . it will be interesting to determine which , if any , of these factors participates in the regulation of liver treg development and how they may interact with tgf - 1 and tlr / myd88 to influence the liver treg compartment . commensal bacteria play important roles in shaping the immune system . as previously noted , the presence or absence of an intact tlr / myd88 response axis does not affect microbiota composition in steady state , and in fact maternal origin and vertical transmission are the important factors that define the structure of the microbiota in colonies of tlr knockout mice and myd88 knockout mice . in humans , it has been shown that maternal exposure to agriculture increases tregs in cord blood , which might later affect allergic responses . our data using antibiotic treatment in wild - type mice , and the use of myd88 deficient mice , suggest that commensals also contribute to shaping the composition of liver resident immune cells , specifically the treg compartment . while myd88 is a common adaptor molecule for all the bacterial responsive tlrs , it is also important in downstream signaling from il - 1r , and this pathway can not be ruled out ; however , the results of the antibiotics experiments argue that the relevant role of myd88 is downstream of one or more tlrs . in our attempts to identify which tlr may be involved , we focused on tlr2 because of its defined role in treg development . we found that tlr2 alone was dispensable for the treg development pattern in the liver . differential composition of the microbiota within the same genetic mouse strain , but obtained from different vendors , has been shown to result in differential development of the immune system . in this studywe used mice bred in our animal facility , so we are not able to comment on whether differences in microbiota might differentially affect treg development in the liver . we also do not know if the pattern of treg development observed in liver is in response to one or more specific bacterial taxa , or if it represents a response to polymicrobial gut colonization . it will be important to determine whether the transient increase in neonatal liver treg frequency contributes to establishing proper liver immune cell function and if this increase in treg frequency is important for the development of liver tolerance . a recent study using gene expression profilinghas shown that exposure to microbiota in the neonatal period is essential for appropriate tlr responses , whose later exposure does not restore appropriately . in this context , the timing of the increased liver treg frequency may be important for establishing immune tolerance . it is notable that the frequency of liver tregs is very high one week after birth but then declines markedly ; in the adult , the frequency of liver tregs is much lower than the frequency of splenic tregs . presumably , as the frequency of liver tregs declines , other tolerogenic pathways begin to have greater effect in maintaining the generally tolerogenic state of the liver . such pathways likely include , as detailed in a comprehensive review by crispe , expression of adhesion molecules to trap effector t cells in liver sinusoids , an abundance of immunosuppressive cytokines such as il - 10 and tgf - , the expression of inhibitory t cell checkpoint molecules such as pd - l1 , and the induction of apoptosis on t cells mediated by death ligands such as fasl that are expressed on various liver nonparenchymal cells , such as kupffer cells . in conclusion , our data suggest an important role for intestinal microbial colonization in the development of the liver treg compartment . this might be important in the establishment of liver tolerance , and interruption or alteration of this physiologic event might contribute to inflammatory liver disease . in light of these studies , it is worthwhile to consider whether there may be a relationship between the use of antibiotics in the neonatal period and the subsequent development of inflammatory liver disease later in life .\noutput:\n" }, { "from": "agent", "value": "neither the early postnatal development of the liver treg compartment nor the factors that regulate its development has been characterized . we compared the early developmental patterns of treg cell accumulation in murine liver , thymus , and spleen . a foxp3egfp reporter mouse was employed to identify treg cells . mononuclear cells were isolated from organs postnatally , stained for cd4 , and examined by flow cytometry to enumerate foxp3 + cd4hi cells . to assess roles for tgf - 1 , myd88 , and tlr2 , gene - specific knockout pups were generated from heterozygous breeders . to test the role of commensal bacteria , pregnant dams were administered antibiotics during gestation and after parturition . the pattern of appearance of treg cells differed in liver , spleen , and thymus . notably , at 1 - 2 weeks , the frequency of cd4hi foxp3 + t cells in liver exceeded that in spleen by 1.5 - to 2-fold . the relative increase in liver treg frequency was transient and was dependent upon tgf - 1 and myd88 , but not tlr2 , and was abrogated by antibiotic treatment . a relative increase in liver treg frequency occurs approximately 1 - 2 weeks after parturition that appears to be driven by colonization of the intestine with commensal bacteria and is mediated by a pathway that requires tgf - 1 and myd88 , but not tlr2 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: macula - on rhegmatogenous retinal detachment ( rd ) is a common cause of ophthalmic emergency that requires surgical treatment in a short period of time to prevent visual loss . the annual incidence of rd varies according to the recent references between 15.4 and 18.2 per 100000 , with a peak incidence of 52.5 per 100000 people between 55 and 59 years of age . myopia is a major risk factor , with a 4-fold higher risk of rd , compared with a nonmyopic eye , in eyes with mild myopia and a 10-fold higher risk in eyes with moderate and high myopia ( greater than 3 diopters ) . the risk of rd is 4 times higher in patients who have undergone cataract surgery . the repair of rd has improved during the last 20 years , and today the goal is not only to reattach the retina but to achieve an adequate final vision . the development of better surgical techniques , such as scleral buckling , pneumatic retinopexy , and pars plana vitrectomy ( ppv ) , has continued to improve the anatomical success rates , going up from 70 % to 90 % and achieving better functional outcomes . nevertheless , proper end vision recovery is a challenge in many cases of rd . besides adequate anatomical reattachment , other clinical factors have been identified as determinants that prevent a good functional recovery . the status of the macula is the main factor for a successful functional result . even in a successful rd surgery with a clinically normal macular area , poor visual acuity ( va ) , color vision defects , and metamorphopsia have been described in successful postoperative rd macula - on surgeries , suggesting the existence of microstructural retina damage . many series of cases have been reported with excellent anatomical results but not so for the functional outcome after rd surgery . in fact , many surgeons assume that having macula - on rd will always have a better visual function prognosis than those with macula - off . and there are few papers dealing with this topic . we performed a pubmed search for english language manuscripts reporting rd and macula - on functional outcomes published since 2003 , and only 4 reports were identified . for this reason we have evaluated data collected in a prospective multicentric study including 17 centers in spain and portugal , with data from rds consecutively treated which was primarily designed to add more information on pvr development and clinical risk factors . the purpose of this report is to analyze those macula - on rd cases that were anatomical successful treated but experienced loss of vision at the third month of follow - up . seventeen clinical ophthalmological institutions in spain and portugal participated in the study . as mentioned the project was designed to improve the sensitivity and specificity of a formula published by rodrguez de la ra et al . by using clinical factors for calculating the risk of developing proliferative vitreoretinopathy ( pvr ) after rd surgery . for that project , a database record was created collecting 83 variables that included all pre - , intra - , and postoperative characteristics . the study protocol was approved by the research committee of the coordinating institution ( ioba , university of valladolid , spain ) and by each of the participating centers . informed consent was obtained from each patient before inclusion of his / her data in a common database . all patients consecutively admitted for surgery between october 2004 and february 2008 with rd and a minimum follow - up of three months were considered for inclusion . for this present analysis only patients with a macula - on rd at the time of the surgery and the macula - on during the entire follow - up were included . cases of preoperative pvr grade c - 1 or higher according to the retina society classification and posttraumatic rd were excluded . patients with incomplete data regarding the status of the macula were also excluded from the final analysis . during the period of time whenthese patients were included , not all the centers had optical coherent tomography ( oct ) technology available , and it was not considered as a routine component of the rd patient examination . therefore , the status of the macula was determined by indirect ophthalmoscopy and posterior biomicroscopy in the immediate preoperative period ( less than 24 hours before surgery ) . fromthe rd patients included in the whole study , 357 had macula - on rds , and they were considered the subject sample of this study . the patients were divided into 4 groups for further analysis according to the status of the lens and the functional outcome after 3 months of follow - up . a reduction of at least one line of best corrected va ( bcva ) in the snellen chart at the third month of follow - up was considered as visual loss . group 1 ( g1 , n = 357 ) included the whole sample of macula - on patients . group 2 ( g2 , n = 53 ) included macula - on patients with reattached retina and who experienced visual loss at the third month of follow - up . group 3 ( g3 , n = 39 ) included phakic eyes out of g2 , and group 4 ( g4 , n = 14 ) involved the pseudophakic eyes out of g2 . the main preoperative characteristics recorded for g2 , g3 , and g4 were retinal breaks type ( tear , hole , dialysis , and giant tear ) , size of retinal breaks in clock hours , extension of rd in quadrants , presence of preoperative pvr less than grade c , previous aphakia , previous vitreous hemorrhage , posterior vitreous detachment , myopia , and preoperative visual acuity ( table 1 ) . only 27 out of the total 83 characteristics gathered in the whole study were used for the analysis of this report . surgeons participating in the study were highly experienced in rd treatment and were allowed to treat their patients on their own criteria and according to their personal experience . the endotamponade with ppv was diverse , including none , air , sf6 , c3f8 , and silicone oil . most of the technical details of the whole series have been already published . anatomical success was defined as a reattached retina at the last postoperative follow - up at three months . functional outcome was recorded as bcva with the snellen chart at the initial ( preoperative ) visit and at the final 3 - month follow - up visit . for statistical analysis , bcva data were grouped into three ranges : 20/40 , 20/50 to 20/100 , and 20/100 . qualitative variables were described by percentages and quantitative ones by mean standard deviation ( sd ) . in all cases , 95 % confidence intervals ( 95 % ci ) were calculated . contingency tables were constructed to evaluate the association between categorical rd characteristics and anatomical and functional outcomes . the independence was checked by chi - square test or fisher 's exact test on sparse tables . statistical analysis was conducted with spss ( v. 19 , spss , chicago , il , usa ) and r software . the average age of the g1 rd subjects was 52.915.6 years when the surgery was performed . the mean time between onset of rd signs or symptoms and surgery was 13.324.9 days , although all patients were macula - on at the time of surgery . comparing the preoperative characteristics of the overall study patients , the g1 patients , all of whom were in the macula - on group , were statistically different for the following ( table 2 ) . ( 1 ) absence of clinical signs of pvr at the preoperative examination was more frequent in g1 . ( 2 ) rd with an extension of 1 quadrant was more frequent in g1 . ( 3 ) percentage of previous cataract surgery in g1 is slightly higher . ( 4 ) eyes without myopia were less frequent in g1 . anddifferences for the other pre - , intra - , and postoperative clinical characteristics were not statistically significant . the main preoperative characteristics in g1 compared to the whole study series cohort are shown in table 2 . in g1 ,345 eyes ( 96.6 % ; 95 % ci : 9498.2 % ) had reattached retinas at the end of follow - up . in 12 eyes , the central retina was not reattached ; therefore , they were excluded from further analysis . single reattachment procedures included ppv ( 67.2 % ; 95 % ci : 62.172 % ) , scleral buckle ( 57.7 % , 95 % ci : 52.4 % ; 62.9 % ) , and explant ( 11.9 % ; 95 % ci : 8.815.9 % ) . the mean bcva in g1 was 0.570.3 in the preoperative visit and 0.590.29 at 3 months of follow - up . the preoperative va in g1 was 20/100 in 44 patients ( 12.3 % ; 95 % ci : 8.9 % , 15.7 % ) , between 20/100 and 20/40 in 79 eyes ( 22.1 % ; 95 % ci : 17.8 % , 26.4 % ) , and 20/40 in 234 eyes ( 65.6 % ; 95 % ci : 60.6 % , 70.5 % ) ( table 2 ) . the postoperative va in this group at the end of the follow - up was 20/100 in 37 eyes ( 10.4 % ; 95 % ci : 7.2 % , 13.5 % ) , between 20/100 and 20/40 in 80 eyes ( 22.4 % ; 95 % ci : 18.1 % , 26.7 % ) , and 20/40 in 240 eyes ( 67.2 % ; 95 % ci : 62.4 % , 72.1 % ) . twenty - six out of 37 eyes with a final va 20/100 ( 7.3 % ; 95 % ci : 4.9 % , 10.6 % ) had a decreased va at the end of the follow - up . in g2 ( table 1 ) , which included phakic and pseudophakic eyes with reattached retinas and visual loss , the final va , 0.230.14 , was lower than the initial va , 0.650.25 ( p 0.0001 , paired t - test ) , despite reattachment of the retina . ppv was the most commonly performed surgery ( 88.7 % ; 95 % ci : 80.297.2 % ) followed by scleral buckle surgery ( 58.5 % ; 95 % ci : 45.271.8 % ) . in some cases , both procedures were used . in g3 ( tables 1 and 3 ) , which included 39 phakic eyes with reattached retinas but with a reduction in va at the end of follow - up , the mean time between onset of rd and surgery was 17.724.9 days . in the preoperative va evaluation , 82.1 % of eyes ( n = 32 ) had 20/40 and none of them had 20/100 but at the end of the third month 30.8 % ( n = 12 ) had 20/100 . the main preoperative characteristics of this group were the following : ( 1 ) no pvr was present in 48.7 % , whereas pvr grades a and b were present in 33.3 % and 17.9 % , respectively , ( 2 ) a visible retinal tear and a unique break were present in 97.4 % and 52.6 % , respectively , ( 3 ) rd extensions of 2 to 3 quadrants were found in 59 % and complete posterior vitreous detachment ( pvd ) was present in 53,8 % of eyes , and ( 4 ) ppv was performed on 87.2 % ( 95 % ci : 71.895.2 % ) of the patients and scleral buckle surgery on 64.1 % ( 95 % ci : 47.278.3 % ) . some patients received both procedures . in g4 ( tables 1 and 4 ) , which comprised 14 pseudophakic patients with macula - on and successful surgery but who had visual loss at the end of the follow - up , the average age was 63.314.4 years . the initial va was 20/40 in 12 eyes ( 85.7 % ) . at the end of the follow - up , the va was 20/100 in 50 % and between 20/100 and 20/40 in 50 % of the cases ( table 4 ) . ppv was performed on 92.9 % ( 95 % ci : 85.9 % ; 99.8 % ) of the patients and scleral buckle surgery on 42.9 % ( 95 % ci : 29.5 ; 56.2 % ) ( p 0.05 ) . while there are published data regarding the improvement of anatomical results of rd surgery , there are few reports showing whether or not rd surgery results in functional improvement and , to the best of our knowledge , there is only a report regarding visual loss in macula - on rd after successful surgery . for rd certain variablesare thought to be significant predictors for functional outcome , for instance , the status of the macula ( which is the most important factor ) , macular elevation when detached , and other factors such as age of the patient , poor initial vision , and interval between onset of rd and surgery . it is generally assumed by most surgeons that the macula - on status before surgery guarantees good functional results , which in most cases means to preserve the patients previous va . however , we have experienced macula - on rd cases in which despite successful surgery the visual results were not favorable . this experience is common among the retinal surgeons but as mentioned there is no specific publication on this topic . thus , although the original study was not specifically set up to investigate this event , we used its data to analyze the frequency of unfavorable outcomes and to add some clinical information . in this study , 53 out of 357 patients ( 14.9 % ; 95 % ci : 11.419.1 % ) meeting the inclusion criteria experienced a worsening of va after rd surgery although the macula was attached . the american academy of ophthalmology has recognized that the status of the macula is the major factor related to visual prognosis . it recommends that when the rd does not affect the macula , repair should be made within the first 24 hours following the diagnosis . in our series , the mean time between the onset of the symptoms and surgery was 13.324.9 days . nevertheless , the surgery was always performed within 72 hours after the admittance at the hospital , although symptoms started several days before . because the central vision was not affected by the rd , it is likely that both the patients and the general practitioners underestimated the severity of the disease and that may explain the delayed diagnosis . in addition , photopsias could appear several days or even weeks before the development of rd . this long interval before surgery was already mentioned by our group and could be a fact related to the structure of the national health system , where most of the patients complaining floaters or flashes are referred to the general practitioner instead of ophthalmologist ( gp ) . it is acknowledged that the time interval to surgery is crucial to prevent progression of subretinal fluid into the macula and disruption of the photoreceptors , causing a possible loss of va in some cases . for our patients with macula - on rds , the evaluations were made only by indirect ophthalmoscopy or fundus biomicroscopy at 24 or 48 hours prior to the surgery . thus , it is possible that we could not detect the presence of a small amount of subretinal fluid under the macula as a limitation of this study . it is possible that systematic analysis of the status of the macula by oct may increase the number of macula - off patients and also that structural changes in patients with visual loss could be detected . recent studies used fourier - domain oct to evaluate postoperatively both macula - on and macula - off rds . foveal anatomical abnormalities were discovered in 62 % of the patients . in macula - off cases , there was disruption of the photoreceptor inner segment / outer segment ( is / os ) junction line ( which correspond to the ellipsoid portion of the photoreceptors : ellipsoid ) in 61 % of the cases , and the external limiting membrane ( elm ) was observed only in 24 % . when followed up overtime , the restoration of a normal is / os line occurred only in eyes without an initially disrupted elm as the investigators also noted . eyes in which the is / os junction returned to normal showed better va than those in which this change did not take place . it is important to take into consideration , however , that although oct is currently a widespread tool , it could take time until patient performs it . considering the timing for the management of this kind of rd , oct become sometimes indispensable auxiliary test . as mentioned we did not perform oct on patients preoperatively to rule out a subclinical extension of subretinal fluid under the fovea , a reason which could explain why some eyes with similar alterations have functional results significantly better than others . for phakic eyes that experienced loss of vision in spite of successful surgery , especially in those operated by vitrectomy , it is possible that the low vision could have been caused by the progression of cataracts . however , there were 14 pseudophakic eyes in the g4 group that experienced visual loss that could not be attributed to progression of lens opacity . some factors such as intraoperative complications like rise intraocular pressure ( iop ) and microscope light toxicity during the surgery , as well as the use of silicon oil or gas as tamponade , could have produced retinal damage , causing a reduction in the inner retinal thickness due to neuronal cell loss in the macular area . however , no postsurgical rise in iop was detected in this series and no one received silicon oil tamponade in these groups , so these variables can be safely excluded as the cause of visual loss in our patients . neither epiretinal membranes nor cystoid macular edema , which are also causes of visual loss after rd surgery , was identified in the follow - up . when these conditions were suspected most of the patients were evaluated by oct , when possible . as no clinical differences were found between groups , further investigations should elucidate if causes of visual loss are related to a gross anatomic factor or could be a photoreceptor damage caused by diffusible factors released by ischemic detached retina . in fact oxidative damage and tnf - are factors used experimentally for inducing damage to the rpe cells and photoreceptors . finally , analysis of retinas after experimental retinal detachments in cats reveals that ultrastructural changes ( apoptosis , gliosis ) occur beyond the specific area of the detached retina . these changes could be one the reasons of the impairment of vision in our patients . first is that the study design was not intended to solve the question of vision loss in patients with macula - on rd , but , in view of the lack of reports on va loss after macula - on rd surgery , we have considered that our data could be interesting . second limitation is that at the time of inclusion of patients oct was not available in all centers , and those having this technology had no similar equipment . so there is no way to know for sure if the data may be extrapolated to other geographical areas , although our retina 1 project reports have yielded similar results of rd surgery to those obtained by other neighboring countries . in summary , we have added information on the prevalence of the clinically significant loss of va following rd with macula - on surgery , a condition affecting a relevant percentage of patients . neither clinical nor surgical factors were identified as responsible . this topic deserves further study , incorporating new technical devices such as swept source oct that is able to identify structural changes at the level of the inner retina . biochemical studies could also elucidate in the future whether or not any molecule released by the detached retina may be responsible for this damage .\noutput:\n" }, { "from": "agent", "value": "purpose . to quantify the frequency of visual loss after successful retinal detachment ( rd ) surgery in macula - on patients in a multicentric , prospective series of rd . methods . clinical variables from consecutive macula - on rd patients were collected in a prospective multicentric study . visual loss was defined as at least a reduction in one line in best corrected visual acuity ( va ) with snellen chart . the series were divided into 4 subgroups : ( 1 ) all macula - on eyes ( n = 357 ) ; ( 2 ) macula - on patients with visual loss at the third month of follow - up ( n = 53 ) which were further subdivided in ( 3 ) phakic eyes ( n = 39 ) ; and ( 4 ) pseudophakic eyes ( n = 14 ) . results . fifty - three eyes ( 14.9 % ) had visual loss three months after surgery ( n = 39 phakic eyes ; n = 14 pseudophakic eyes ) . there were no statistically significant differences between them regarding their clinical characteristics . pars plana vitrectomy ( ppv ) was used in 67.2 % of cases , scleral buckle in 57.7 % , and scleral explant in 11.9 % ( 36.1 % were combined procedures ) . conclusions . around 15 % of macula - on rd eyes lose va after successful surgery . development of cataracts may be one cause in phakic eyes , but vision loss in pseudophakic eyes could have other explanations such as the effect of released factors produced by retinal ischemia on the macula area . further investigations are necessary to elucidate this hypothesis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: liver transplantation ( lt ) may result in significant blood loss and subsequent transfusion of red blood cells ( rbcs ) in most patients . although there is strong evidence supporting hemostatic defects in cirrhotic patients , many preoperative factors such as fulminant liver failure , bacterial infections , renal insufficiency , and severe portal hypertension may also cause imbalance in the hemostatic system . in addition , anatomical local surgical difficulties , prolonged surgical time , perioperative hypothermia , metabolic derangements , and intraoperative dilutional coagulopathy ( blood transfusions and fluid administration ) are factors that could potentially increase blood loss during surgery . in the last decade , the experience acquired in the liver transplantation and management of jehovah 's witnesses patients where transfusions are not possible , the refinement of surgical techniques , and the appropriate anesthetic management has reduced intraoperative bleeding and the need for blood transfusions in the perioperative period during and following lt . it is widely known that there is clear association between intraoperative rbc transfusion and survival in lt . certainly , significant surgical blood loss has been linked to major surgical morbidity and operative mortality , whereas rbc transfusion is associated with multiple disadvantages , risks , and increased financial burden . furthermore , intraoperative operative blood loss independently predicts tumor recurrence and survival after radical surgery for hepatocellular carcinoma ( hcc ) . although the triggering variable to administer rbc is mainly hemoglobin level , today there are no uniform criteria regarding how to prevent perioperative rbc transfusion in lt recipients . there is still high variability between different centers in the use of fresh frozen plasma ( ffp ) , platelets , cryoprecipitate , fibrinogen , antifibrinolytic drugs , or desmopressin during perioperative period to prevent surgical bleeding . other measures such as intraoperative cell saver and phlebotomy , as single or combined strategies , have been established only by few lt centers . as a consequence of the deleterious effect of rbc transfusion during lt , herein , we report our experience with a series of patients receiving deceased donor lt without the need for perioperative red blood cells ( p - rbc ) transfusion and we evaluated their outcome . between september 2006 and november 2011 , all patients who received deceased donor lt at our unit were analyzed using a prospectively collected database . we divided the cohort in two groups according to the use of p - rbc transfusions : no - transfusion and yes - transfusion ( i.e. , when at least one p - rbc transfusion unit was transfused ) . p - rbc transfusion was defined when one or more rbc units were transfused to the recipient during lt or within the first 48 hours following surgery . the aim of our study was to assess the influence on early and long - term outcomes of using p - rbc transfusions in lt recipients . we also evaluated donor and recipient factors that could independently predict the need for p - rbc transfusions . we compared both groups according to patient , donor / graft , and perioperative variables . organ procurement was performed as described elsewhere with aortic and portal perfusion using university of wisconsin preservation solution ( viaspan ; dupont , wilmington , de , usa ) . marginal grafts were defined when three or more of the following criteria coexisted : cardiac arrest 15 minutes or prolonged hypotensive episodes of 60 mm hg for 1 hour , donor age 55 years , high vasopressor drug requirement ( dopamine dose 10 g / kg / min or any doses of other amines ) , hypernatremia 155 meq / l , prolonged intensive care unit ( icu ) stay ( i.e. , 5 days with mechanic ventilation ) , elevated liver transaminases ( ast 170 u / l or alt 140 u / l ) , cold ischemia time 12 hours , warm ischemia time 40 minutes , and liver steatosis 30 % . the following recipient data was collected : age , gender , history of previous upper abdominal surgery , underlying liver disease , biochemical profile , model for end - stage liver disease ( meld ) score , recipient status on the waiting list ( elective , emergency ) , surgical technique , and operative times . all intra - and postoperative transfusion requirements ( rbc , ffp , cryoprecipitates , and platelets ) were recorded . our anesthesiological strategy was focused on fluid restriction with low central venous pressure ( cvp ) during surgery . maintenance fluids and crystalloids were administered to stabilize blood pressure 90 mmhg and ensure diuresis of at least 0.5 ml / kg / h . when fluid restriction was ineffective to keep a low cvp , vasoactive agents were used . liver allograft function was evaluated clinically and through biochemical parameters such as aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , and bilirubin and prothrombin time measured daily during the first week . liver graft vascular patency was evaluated by echo - doppler ultrasound during the first day and when clinically indicated . primary nonfunction ( pnf ) of the graft was defined as death or retransplantation within 7 days following lt in the absence of any vascular problems . primary dysfunction ( pdf ) of the graft was assumed when a peak ast level 1.500 iu / l and a prothrombin time 50 % cooccurred within the first week of lt . postoperative bacterial infection was defined as any clinical sign of infection in conjunction with positive bacteriological cultures within 30 days after surgery . postoperative overall infection was defined as any documented infection ( i.e. , viral , bacterial , or fungal ) with positive serology or cultures within 30 days after surgery . hepatocellular carcinoma and hepatitis c virus ( hcv ) recurrence were studied in each patient as recommended . all hcv recipients underwent 1 - year protocol liver biopsy as part of our routine practice for early hcv recurrence diagnosis . differences between groups were tested by chi - squared test for categorical and mann - whitney u - test for continuous variables . multivariate analysis was performed using a logistic regression model to assess which factors were independently related to the need for p - rbc transfusions . during the 62 - month study period , 235 patients were included in our lt waiting list and , finally , 127 were successfully transplanted . among them , 46 patients ( 36 % ) did not receive any intraoperative rbc transfusion but 7 of them were finally transfused with rbc units after the operation . therefore , 39 ( 31 % ) patients did not receive any p - rbc transfusions constituting the no - transfusiongroup , and 88 ( 69 % ) patients constituted the yes - transfusion group . both groups were comparable regarding age , gender , body mass index ( bmi ) , history of previous upper abdominal surgery , cause of cirrhosis , diagnosis of hcc , diagnosis of hcv infection , and waiting list status ( table 1 ) . group ( 11 versus 21 ; p 0.0001 ) , the number of patients with meld score 25 was equivalent in both groups . moreover , only few patients received meld priority points due to early hcc in both groups ( 4 patients in the no - transfusion and 5 in the yes - transfusion ) . preoperative biochemical profile showed that hematocrit , hemoglobin level , platelet count , and prothrombin time levels were significantly lower inthe number of patients transplanted using marginal grafts was equivalent in no - transfusion and yes - transfusionin addition , variables such as cold and warm ischemia times and the presence of liver steatosis in each liver donor were equally distributed in both groups ( table 3 ) . a full - size liver was implanted in 113 patients ( 89 % ) and only 10 patients received a split liver graft . as expected , median operative time ( 227 versus 240 min ; p = 0.02 ) and blood components transfusion were higher in the yes - transfusiongroup ( table 4 ) . to note , intraoperative transfusion of rbc was not needed in 36 % of our lt patients . aprotinin infusion , cell saver , or phlebotomies were not used to reduce intraoperative bleeding or rbc transfusions in any circumstances . the incidence of pnf , pdf , major complications , and biliary complications was the same in both groups ( table 5 ) . however , hemodialysis need ( 0 versus 10 % ; p = 0.01 ) , bacterial infections ( 10 versus 27 % ; p = 0.03 ) , and postoperative overall infection rate ( 5 versus 22 % ; p = 0.02 ) were significantly higher in the yes - transfusion group ( table 5 ) . median icu ( 2 versus 3 days ; p = 0.003 ) , hospital stay ( 7.5 versus 9 days ; p = 0.01 ) , and prolonged hospital stay 15 days ( 10 versus 27 % ; p = 0.03 ) were also significantly higher in the group of patients needing p - rbc . although 30 - day mortality rate was higher in the yes - transfusion group ( 10 versus 15 % ) , this difference was not significant ( table 5 ) . interestingly , hcc recurrence after lt was only observed in the yes - transfusion group ( 0 versus 6 patients ; p = 0.12 ) , but without statistical relevance . although one - ( 86 versus 70 % ; p = 0.09 ) and 3 - year survival rates ( 77 versus 66 % ; p = 0.09 ) were better in the no - transfusion group , this difference was not statistically significant ( figure 1 ) . all preoperative donor , graft , and recipient data were included in a univariate analysis to determine variables that were unequally distributed in both groups of patients . each significant variable was analyzed using a logistic regression model to assess which factors were independently associated with the need for p - rbc transfusions . baseline patient 's hemoglobin level before surgery ( p 0.001 ) was the unique independent preoperative risk factor associated with p - rbc requirement . surprisingly , extended donor criteria , graft steatosis , and meld score were not a predictive factor for p - rbc transfusion in our series . in contrast with transplantation of other organs , the intrinsic coagulopathy defects of lt candidates and the frequent presence of severe portal hypertension make transfusion - free surgery a major challenge . most studies have focused on the deleterious effect of intraoperative massive blood transfusion without putting emphasis on the importance of avoiding transfusions in the early phase after lt . to the best of our knowledge , this is the first study investigating the influence of using p - rbc on early and long - term outcomes after lt . we observed that early outcome after lt is better with reduced bacterial infections , hemodialysis need , and overall infection rate when p - rbc transfusions are avoided . surprisingly , neither donor / graft quality nor recipients meld score were predictive factors associated with the need for p - rbc transfusions . as hemoglobin level was the only predictive factor in our cohort , maximum efforts should be placed on improving anemia in patients waiting for lt . many strategies have been proposed for reducing intraoperative bleeding including the maintenance of a cvp 5 cm of water , reverse trendelenburg position , systemic infusion of nitroglycerin , and the use of antifibrinolytics agents , recombinant factor viia , or aprotinin . unfortunately , the clinical use of aprotinin has been questioned due to an increased incidence of renal failure , stroke , and myocardial infarction and it has been withdrawn from the market . three randomized controlled trials ( rct ) demonstrated that the routine use of recombinant factor viia for patients undergoing lt is not recommended . our policy based on maintenance of low cvp was used safely with minor hemodynamic disturbance in most patients . however , to achieve this goal , a close communication between the surgical and the anesthesia team is crucial during transplant to delineate perioperative interventions targeted to minimize blood loss . several studies have looked into factors that can predict transfusion requirements . one study demonstrated a relationship between the starting platelet count , duration of surgery , the starting inr value , and the number of rbc units that were transfused during lt . current organ allocation system in argentina is based on giving priority to the patients with the highest meld scores . usually , patients with high meld scores have poor coagulation status with reduced inr values and low platelet count related to hypersplenism . although it could be expected that the need for intraoperative rbc transfusion can be predicted by the preoperative prothrombin time and degree of thrombocytopenia , we failed to confirm this in our cohort . we observed that low baseline hemoglobin level was the only independent predictor for p - rbcs transfusion during lt . in contrast with a previous study , we observed that donor and graft quality did not influence the need for rbc during lt . hence , we believe that extramedical effort must be made to improve hemoglobin levels during waiting list time . in this scenario , many strategies can be considered during the waiting time so as to improve hemoglobin levels , such as administration of eritropoyetin , iron , and folinic acid , and in some situations even considering the use of rbc transfusions during waiting time to patients with hemoglobin levels 7 mg / dl . however , none of these strategies have been correctly validated in the field of lt and further analysis with well - designed rct is needed to support them . unfortunately , the current literature review is unclear about the exact incidence of blood transfusions in lt . while some reported routine rbc transfusions during lt , others made maximum efforts to minimize blood loss . furthermore , there may be a bias towards underreporting due to lack of clear definitions of the perioperative period in this context and , perhaps , disinterest in the medical community on this topic . however , the relationship between immunocompetence during the perioperative period and recurrence - free survival after lt is becoming a topic of interest , especially for patients with hcv infection or hcc . probably because this study is based on a small series , we failed to demonstrate any negative effect on viral or tumor recurrence in patients needing p - rbc . the effect of novel anesthetic techniques and perioperative management on positively influencing the balance between inflammation and immune competence is an intriguing avenue for future studies . thus , we urge transplant community to start reporting data on blood transfusions and to study its impact on clinical outcomes in patients undergoing transplant surgery . apart from the obvious intraoperative life - saving benefits , there is accumulating evidence that rbc transfusions are associated with substantial complications after lt . the risk of allogeneic blood transfusion extends beyond viral transmission and includes allergic reactions , alloimmunization , bacterial sepsis , transfusion - related acute lung injury , renal failure , excessive intravascular volume , and immunosuppressive effects . however , data are only related to the administration of blood components during surgery and scarce data has been published concerning its use during early postoperative time after lt . as probably intra - or early postoperative rbc transfusion could have a similar impact on outcome and considering that probably the reasons for differences on the administration timing or location could be mainly logistic , we decided to analyze transfusions during and within 48 hours after surgery . interestingly , we found that only few patients were transfused after surgery demonstrating some kind of agreement between anesthesiologist and icu doctors . in agreement with others , we observed that postoperative complication in terms of infections and hemodialysis need was increased in transfused patients . we additionally confirmed that icu and hospital stay are longer in patients needing p - rbc transfusions . in the future , a cost analysis of our rbcs - saving strategy will probably provide economic arguments for reducing perioperative transfusions that should be weighed against patient safety . in conclusion , poor donor / graft quality and high recipient meld score are not a predictive factor for p - rbc transfusion during lt . patient requiring p - rbc transfusions had more complications in terms of higher infections and hemodialysis need , prolonging icu and hospital stays . maximum efforts must be focused on developing novel strategies for improving hemoglobin levels during waiting list time to improve early outcome after transplantation .\noutput:\n" }, { "from": "agent", "value": "background . significant amounts of red blood cells ( rbcs ) transfusions are associated with poor outcome after liver transplantation ( lt ) . we report our series of lt without perioperative rbc ( p - rbc ) transfusions to evaluate its influence on early and long - term outcomes following lt . methods . a consecutive series of lt between 2006 and 2011 was analyzed . p - rbc transfusion was defined as one or more rbc units administrated during or 48 hours after lt . we divided the cohort in no - transfusion and yes - transfusion . preoperative status , graft quality , and intra - and postoperative variables were compared to assess p - rbc transfusion risk factors and postoperative outcome . results . lt was performed in 127 patients ( no - transfusion = 39 versus yes - transfusion = 88 ) . while median meld was significantly higher in yes - transfusion ( 11 versus 21 ; p = 0.0001 ) group , platelet count , prothrombin time , and hemoglobin were significantly lower . on multivariate analysis , the unique independent risk factor associated with p - rbc transfusions was preoperative hemoglobin ( p < 0.001 ) . incidence of postoperative bacterial infections ( 10 versus 27 % ; p = 0.03 ) , median icu ( 2 versus 3 days ; p = 0.03 ) , and hospital stay ( 7.5 versus 9 days ; p = 0.01 ) were negatively influenced by p - rbc transfusions . however , 30 - day mortality ( 10 versus 15 % ) and one - ( 86 versus 70 % ) and 3 - year ( 77 versus 66 % ) survival were equivalent in both groups . conclusions . recipient meld score was not a predictive factor for p - rbc transfusion . patients requiring p - rbc transfusions had worse postoperative outcome . therefore , maximum efforts must be focused on improving hemoglobin levels during waiting list time to prevent using p - rbc in lt recipients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: adenomyoma of the gastrointestinal tract is a rare benign tumor - like lesion which usually occurs in the pylorus of the stomach or duodenum . histologically , adenomyoma is characterized by glandular structures lined by a cuboidal to tall columnar epithelium surrounded by bundles of smooth muscle cells . although this lesion originates from abnormal embryonic buds , which can differentiate into pancreatic or duodenal tissue , its pathogenesis has not been fully elucidated . it is generally considered to represent either myoepithelial hamartoma or a form of heterotopic pancreatic tissue . generally , intussusceptions are uncommon in adults and account for 0.0030.02 % of all hospital admissions . adult intussusceptions represent 5 % of all intussusception cases and are rarely caused by idiopathic lesions . due to the high incidence of malignancy , surgical intervention is required for adult intussusceptions , although barium hydrostatic reduction is performed in children . however , the extent of bowel resection required and whether the intussuscepted bowel should be reduced are disputed . herein , we report an adult case of adenomyoma of the ileum leading to intussusceptions as a rare condition . we also performed a review of the english language literature to find cases of adenomyoma of the ileum , and we discuss our findings regarding the diagnosis , optimal treatment , and clinical features of the disease . a 68 - year - old japanese man with a past medical history of impaired glucose regulation and developmental canal spinal stenosis presented with nausea and distension of the stomach , which had lasted for 1 day . the patient 's physical status on admission was as follows : body temperature 36.7 c , blood pressure 122/66 mm hg , and pulse rate 75 beats / min . physical examination indicated distension of the abdomen without tenderness , rebound tenderness , or muscular rigidity . his laboratory data on admission were as follows : white blood cell count 7,000 / l , red blood cell count 53210 / l , hemoglobin 16.1 g / dl , platelets 22.310 / l , lactate dehydrogenase279 iu / l , blood urea nitrogen 39 mg / dl , creatine 0.90 mg / dl , c - reactive protein 1.64 mg / dl , carcinoembryonic antigen 1.7 ng / ml , and carbohydrate antigen 19 - 9 ( ca19 - 9 ) 6.6 u / ml .1 ) showed wall thickening and a tumor in the lumen of the small intestine . moreover , a small amount of ascites and dilation of the proximal ileum were revealed . he was diagnosed with small bowel obstruction or intussusception of the ileum due to a tumor and immediately admitted to our hospital . open laparotomy was performed and normograde intussusception was observed in the ileum and reduced by hand . in addition , a tumor was found in the small intestinal lumen 80 cm proximal to the ileocecal valve . meckel 's diverticulum was not detected , and the tumor and 20 cm of the adjacent ileum were resected . the macroscopic findings of the lesion were consistent with a submucosal tumor , i.e. , the mass was soft and solid and measured 151515 mm . microscopic observation using hematoxylin - eosin staining found that the tumor extended from the mucosa to the serosa and identified proliferating ducts without atypia and hypertrophic smooth muscle cell bundles ( fig . the ducts were lined by a tall columnar epithelium and surrounded by smooth muscle cell bundles .3 ) and ca19 - 9 were strongly expressed , while ck 20 and mucin antigen 2 ( muc 2 ) were not . generally , adult intussusceptions represent 5 % of all intussusception cases and account for only 15 % of obstructions in adults . almost 90 % of adult intussusceptions are secondary to a pathological condition that serves as a lead point such as carcinoma , polyps , meckel 's diverticulum , colonic diverticulum , strictures , or benign neoplasm . adult intussusception requires surgical intervention because of structural anomalies and the high incidence of malignancy . however , the extent of bowel resection required and whether the intussuscepted bowel should be reduced are disputed . intraluminal seeding and venous embolization of malignant cells during intraoperative manipulation are employed for the primary reduction of intussusceptions in adults , which might permit a more limited resection . below , we summarize the characteristics of the 18 previous cases of adenomyoma of the ileum reported in the english language literature ( table 1 ) . while 12 cases ( 63 % ) involved patients that were less than 18 years old ( children ) , 7 cases ( 37 % ) involved patients who were 18 years old or older ( adults ) .11 cases ( 58 % ) presented with symptoms of intussusception , and 9 of these cases involved children . it is known that adenomyoma of the ileum often causes intussusception ; however , the intussusception was often asymptomatic in the adult cases , and hence was found incidentally in 4 of 7 incidental cases ( 57 % ) , as shown in table 1 . it was concluded that ileal adenomyoma often causes intussusception , especially in children , and a tendency towards the incidental discovery of intussusception was noted in adults . as shown in table 1 , the preoperative diagnosis of intussusceptions is difficult , and the frequency of a correct preoperative diagnosis ranged from 40.7 to 50 % in previous studies . abdominal ct is currently considered to be the most sensitive radiological method for diagnosing intussusception . the characteristic ct features of intussusceptions include a homogenous target or a sausage - shaped soft tissue mass with layering . the diagnostic accuracy of ct ranged from 58 to 100 % in recent reports . as mentioned above , the necessity of intraoperative reduction of intussusceptions in adults is disputed . however , especially for enteric intussusception , recent reports have recommended initial reduction of the externally viable bowel prior to resection . the incidence of malignancy is lower in enteric than in colonic intussusceptions , and metastatic tumors were found in the majority of cases . thus , reduction of the intussusception followed by resection is considered to be a prudent approach in order to achieve optimal preservation . adenomyoma of the gastrointestinal tract is rare , and its pathogenesis has not been fully elucidated . the histopathological findings of adenomyoma are characterized by glandular structures lined by a cuboidal to tall columnar epithelium surrounded by bundles of smooth muscle cells ; however , the histogenesis of the condition is disputed . the most widely accepted hypothesis is that these lesions represent a form of myoepithelial hamartoma or a type iii pancreatic heterotopia . in this study , immunohistochemical examination was performed in an attempt to increase our understanding of the pathogenesis of adenomyoma . as a result , we detected the expression of ck 7 and ca19 - 9 and the absence of ck 20 expression , which are similar to the characteristics of the pancreatic duct epithelium . judging from these results and the absence of muc 2 expression , it is suggested that the glandular component of our case was not composed of intestinal epithelial cells , but rather of pancreatic duct epithelial cells . our case was diagnosed as adenomyoma of the ileum , therefore in our opinion the pathogenesis of this lesion supports the heterotopic pancreas theory . in summary ,\noutput:\n" }, { "from": "agent", "value": "adenomyoma of the ileum is a rare condition . a 68 - year - old japanese man presented with nausea and distension of the abdomen . enhanced computed tomography of his abdomen revealed wall thickening in the ileum and dilation of the proximal small intestine . open laparotomy was performed to find the cause of the patient 's small bowel obstruction , and a tumor was found in the ileum , which had resulted in intussusception . the tumor and 20 cm of the adjacent ileum were resected . the resected specimen displayed a macroscopic appearance suggestive of a submucosal tumor . histopathological evaluation showed duct cell proliferation and bundles of smooth muscle cells from the mucosa to the serosa , leading to a diagnosis of adenomyoma . immunohistochemical examination found that cytokeratin 7 and carbohydrate antigen 19 - 9 were expressed in the duct epithelia . we report a rare case of ileal adenomyoma leading to intussusception in an adult and present the immunohistochemical evaluation of the adenomyoma ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in early 2013 , a resurgence of measles in beijing was reported to the china information system for disease control and prevention , chinese center for disease control and prevention ( beijing ) ; by the end of the year , a total of 1,233 suspected cases had been reported and investigated . serum and throat swab samples were collected from 97.3 % and 96.8 % of the suspected case - patients , respectively . the samples were tested for measles igm by using the virion serion elisa measles virus igm test ( virion / serion , wurzburg , germany ) or for measles virus genes by using a real - time reverse transcription pcr kit ( jiangsu bioperfectus technologies , jiangsu , china ) . of the 1,233 samples , thus , a total of 563 measles cases in beijing were confirmed in 2013 ; this number represents a 6-fold increase from the number of cases in 2012 . most cases occurred among a floating population of adult migrant workers and permanent adult residents and their children ( figure ) ; 67.3 % of the cases in adults were in migrant workers . reports of cases increased shortly after the national holidays associated with the spring festival , during which many persons travel to visit relatives . number of measles cases among persons by residency status , age , and month of infection onset , beijing , china , 2013 . floating populations represent internal migrants who move to an area temporarily , usually for employment ( e.g. , migrant workers ) . among the persons with confirmed measles , 22.8 % ( 128 ) were 8 months of age , 11.5 % ( 65 ) were 8 months14 years of age , and 65.7 % ( 370 ) were 15 years of age and defined as adult patients . the median age of the adult patients was 23.5 years ( range 15.070.0 years ) . vaccination history was unknown for 87.6 % ( 324/370 ) of the adults . among the 65 patients in the age group targeted for measles vaccination , positive samples to try to isolate and genotype virus from 468 of the 563 positive samples . genomic sequencing and phylogenetic analyses were based on n450 nucleotide sequences , as previously described ( 68 ) . measles genotype was determined for 45.6 % ( 257/563 ) of the cases reported from 14 of 16 districts or counties . among those 257 cases , 84.0 % ( 216 ) were caused by endemic genotype h1 viruses and 15.2 % ( 39 ) and 0.78 % ( 2 ) , respectively , were caused by imported genotype d8 and d9 viruses . all 14 districts had confirmed measles cases caused by genotype h1 viruses , and 6 and 2 districts , respectively , had cases caused by genotype d8 and d9 viruses . of the 257 measles cases with genotype information , 61.6 % ( 133 ) of those caused by genotype h1 and 97.4 % ( 38 ) of those caused by genotype d8 were in adults ( table ) . measles viruses within a transmission chain had identical or nearly identical n450 sequences ( 9 ) . phylogenetic analysis showed that 216 genotype h1 viruses were associated with 30 different chains of transmission ( technical appendix figure , panels a , b ) , and 39 genotype d8 viruses were associated a single chain of transmission , although 1 virus differed by only 1 nt ( technical appendix figure , panels a , c ) . a search of the world health organization s measles nucleotide surveillance ( means ) database ( 10 ) showed that genomic sequences of genotype d8 viruses from the outbreak shared 99.8 % 100 % nucleotide identity with genomic sequences of strains from measles patients in russia , france , canada , thailand , denmark , germany , and other locations . genotype d8 measles viruses were associated with at least 2 outbreaks in different large , wholesale clothing markets . july 2013 and were almost completely confined to adults ; only 1 child was infected , possibly because of high coverage of measles - containing vaccine among beijing children . phylogenetic analysis suggested that the genotype d8 virus might have been imported to beijing from europe , america , or another location ( 1013 ) and subsequently spread beyond beijing by virus transmission from infected adults ( data not shown ) . for at least 21 years , genotype h1 measles viruses have been the only endemic measles circulating in china ( 68 ) ; measles cases caused by all other genotypes have been associated with imported viruses ( 7 ) . our findings show that transmission of measles virus among adults contributed to a resurgence of measles in beijing during 2013 . nonendemic genotype d8 measles viruses were associated with at least 2 outbreaks in different wholesale clothing markets during march july , 2013 . many persons from domestic and international areas visit wholesale markets every day ; thus , such markets are high - risk settings for the transmission and importation of measles viruses ( 14 ) . because migrant workers were disproportionately affected in the beijing outbreaks and because their work settings have high measles transmission potential , we support an outreach strategy to prevent measles among this floating population . these workers usually live with their families and register with the local authorities for government services . thus , we suggest that the offer of measles vaccine to workers as they register to live and work in the commodity markets might be a reasonable strategy to prevent future measles outbreaks . serologic surveys can be used to refine such a strategy by assessing immunity within the target population . the foundation strategy for eliminating measles globally is based on the timely vaccination of young children with 2 valid doses of measles - containing vaccine . however , laboratory - supported surveillance analysis and outbreak investigations are critical to the identification of gaps in immunity among older age groups , which may need to be filled , and to the identification of strategies to prevent similar outbreaks . the fact that more than a third of infected children in the vaccine - targeted age group were unvaccinated because of vaccination contraindications suggests that an evaluation is needed to ensure the use of valid contraindications only . it is difficult to identify narrow , age - based risk groups to target for vaccination when a high proportion of adults are unvaccinated and may still be susceptible to measles . unselective vaccination of millions of adults , based solely on their age , is unlikely to be feasible in china . additional risk factors for measles need to be identified to develop more feasible immunization strategies . phylogenetic analysis comparing genomic sequences of measles virus isolates from persons infected during a 2013 outbreak in beijing , china , with genomic sequences of world health organization ( who ) reference sequences .\noutput:\n" }, { "from": "agent", "value": "in 2013 , a resurgence of measles occurred in beijing , china . the outbreaks occurred among adults and were associated with endemic genotype h1 and imported genotype d8 viruses . migrant workers were disproportionately represented in the outbreaks ; thus , vaccinating such workers against measles may be an effective strategy toward the elimination of this disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 74 - year - old woman , previously healthy , had been suffering from frequent and intense bilateral spasms of the eyelids for 20 years . she reported an abnormal feeling of tension in the eyelids and subsequently , involuntary excessive blinking developed . these spasms were insuppressible , exacerbated by stress and bright light ; furthermore their frequency and severity have been worsening over the years . she has been treated with botulinum toxin injection ( botox , allergan , irvine , ca , usa ) in the orbicularis oculi muscles ( up to 25 units per eye ) and taken some medications ( trihexyphenidyl 6 mg , clonazepam 1.5 mg , baclofen 30 mg per day ) . accidentally , she found that her symptom was improved after taking zolpidem which had been prescribed for insomnia by her primary physician . when she woke up in the next morning after taking zolpidem , she felt the best condition which she has ever experienced on her eye lids . when she came to our hospital , she could not open her both eyes because of severe eyelids spasm . she did not report any history of head trauma , surgical incidents or neurological disease . there was no exposure to neuroleptic medication and no family history of movement disorder . on neurological examination , she did not show any abnormal finding including bradykinesia , tremor , rigidity . in repetitive nerve stimulation testsshe showed much improvement of blepharospasm after taking zolpidem 10 mg in 20 to 30 minutes and that effect lasted for average 5 hours . blepharospasm is a form of focal dystonia characterized by involuntary spasms of orbicularis oculi muscles . dystonia might be due to basal ganglia dysfunction associated with globus pallidus interna hypoactivation and cortical overactivation .7 basso and colleages revealed that reduced basal ganglia dopamine levels causes a decrease in nucleus raphe magnus inhibition of the blink circuit that increases trigeminal blink excitability .8 some reasons for the improvement of blepharospasm by zolpidem in this case can be suggested . firstly , zolpidem is an imidazopyridine with high selectivity for the benzodiazepine - 1 subtype receptor , which is a part of the - aminobutyric acid ( gaba ) - receptor complex . abundant gabaergic zolpidem - binding sites lie in the output structures of the basal ganglia ; ventral globus pallidus , substantia nigra pars reticulatae , subthalamic nucleus . by binding to these sites , zolpidem could reinforce the gabaergic hypofunction influence on the thalamus and motor cortex , which could regulate the blink circuit that reduces trigeminal blink excitability .9 secondly , anxiolytic effect , not related to a direct action on the basal ganglia , may be another possible mechanism . lastly , the possibility of a placebo effect when this patient took the zolpidem can be considered . but , she did not show any improvement of her blepharospasm after administration of placebo , which meant this effect was not due to a placebo effect . blepharospasm can start as an isolated movement of the eyelids , and occasionally it remains confined to the eyelids or other cranial structures eventually become involved . marsden pointed out that if blepharospasm occurs alone , without the involvement of other craniocervical structures , then the label essential blepharospasm may be appropriate .10 this patient showed isolated blepharospasm without the involvement of other muscles . . reported on 3 patients , 1 with blepharospasm and 2 with meige s syndrome whose symptoms were improved by zolpidem .5 in korea , there is one case report that zolpidem is effective in the treatment of meige s syndrome .6 this is the first report which shows improvement of isolated blepharospasm ( essential blepharospasm ) by zolpidem in korea . further randomized , blinded , placebo - controlled studies are needed to validate the action of this drug on dystonic condition .\noutput:\n" }, { "from": "agent", "value": "zolpidem is usually used for the treatment of insomnia as a hypnotic drug . it was also suggested to be effective in the treatment of dystonia in some studies . a 74 - year - old woman had been suffering from frequent and intense bilateral spasms of the eyelids for 20 years . she has been treated with botulinum toxin injection and taken some medications . but , she experienced a little effect and was not satisfied with those treatments . her symptom was improved after taking zolpidem which had been prescribed for insomnia by her primary physician . she did not show any improvement after placebo injection and neostigmine test . this is the first report which shows improvement of isolated blepharospasm by zolpidem in korea . zolpidem can be one of useful alternative pharmacological treatments for blepharospasm . further randomized , blinded , placebo - controlled studies are needed to validate this finding ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: malaria was endemic in the dry zone of sri lanka and was a major public health problem in the country in the past . chalmers reported the presence of 10 anopheline species in the country by chalmers . to date , 22 anopheline species have been reported in sri lanka . anopheles culicifacies was regarded as the only malaria vector in the country till about the early 1980s . enzyme - linked immunosorbent assay ( elisa ) based evidence has shown a large number of anopheline species to be infected with malaria parasites in addition to a. culicifacies . these include anopheles aconitus , anopheles annularis , anopheles barbirostris , anopheles nigerrimus , anopheles pallidus , anopheles subpictus , anopheles tessellatus , anopheles vagus , and anopheles varuna . among these speciesthat have consistently been incriminated as malarial vectors are a. annularis , a. subpictus , a. varuna , and a. tessellatus . determination of risk of malaria transmission requires quick and accurate methods of identification of anopheles mosquitoes , especially when targeting vector control . anopheles mosquitoes breed in areas with water bodies such as ponds , rivers , surface water , wells , and wastewaters . moreover , these areas are suitable for growth and development of various strains of mosquitoes as ponds , wells , and water bodies of different sizes that are available during rainy seasons . anopheles culicifacies , the primary vector of malaria in sri lanka , is known to breed primarily in stream and river systems . however , this species also breeds in other surface water collections and habitats in sri lanka . recent studies have reported that a. culicifacies breeds in brackish water bodies and wastewater drains in the trincomalee district of sri lanka . mathematical models based on the correlation between the abundance of anopheline species and environmental factors such as rainfall , temperature , and humidity may be used to predict vector abundance and thereby malaria epidemics . over three decades of civil unrest , the conflict situation has had detrimental effects on vector control activities and management of malaria in trincomalee district , which is an endemic region for malaria in sri lanka . with the background that only a few small - scale studies on malaria and its vectors have been reported from this district , a studywas designed to explore the current abundance and distribution of malaria vectors in these areas . therefore , the aim of this study is to identify various anopheles species and the dynamics of anophelines including malaria vectors in trincomalee district for effective vector control under the current malaria elimination program embarked in the country . trincomalee district is situated in the dry zone of the country within the eastern province of sri lanka . the district has a land area of 2,727 km and a population density of 135 / km . the average temperature varies from 24.8 c to 30.7 c and the district receives a mean annual rainfall of 1 , 649 mm . however , very few entomological investigations have been carried out for about three decades in the northern and eastern provinces until 2009 , due to the terrorist war that took place in the country including this district . five sentinel sites , namely , gomarankadawala , ichchallampaththu , mollipothana , thoppur , and padavisiripura , were selected for surveillance in consultation with the national malaria control programme . the factors such as past malaria history , availability of breeding sites , an established agricultural community , and feasibility of field operations to collect relevant data were also considered in selecting the study areas . entomological surveillance was conducted in these 20 localities which lasted 1 week every month ( figure 1 ) . mosquitoes were collected at monthly intervals using five standard sampling methods from june 2010 to june 2012 according to who standard techniques for anopheline mosquitoes . collections were made during the morning ( 06.0008.30 hrs ) by two vector collectors spending a maximum of ten minutes per house . bedrooms , preferably with complete walls and the highest number of persons slept last night were given priority . two mosquito window ( exit ) traps were fixed in a sentinel site for 16 nights per month . on the following day mosquitoesthe trap was made out of white cotton drill ( 3 m 3 m 1.5 m ) with net windows ( 2 m 1 m ) on sides and erected using a strong centre pole of two - meter height and four side sticks of the same height . the trap was set about 50 m away from the houses and away from the place , where cattle are usually tethered or herded during the night . a distance of 1525 cm gap was allowed between the lower edge of the net and the ground , enabling mosquitoes to enter . at sunset a cattle introduced into the trap in the evening and tethered to the pole fixed to the mid of the hut . the cattle removed at dawn for collecting the mosquitoes . all anophelines resting inside the trap were collected . the size of the hut suited the size of the cattle bait and was approximately 2 m 1.25 m 1.25 m. it was made of sticks , poles , and thatched with woven cadjan . at sunset , a removable door made out of sticks and cadjan was fitted to the hut to facilitate the movement of the calf and the collector in and out of the hut . a space of about 1015 centimeters ( cm ) between the ground and the cadjan thatched wall and about a five cm space between the roof and the wall were left for the movement of mosquitoes . all potential breeding habitats were identified in all 20 localities through a preliminary survey conducted for a period of one month prior to the research study and certain fixed and temporary breeding places were identified for the larval survey . a minimum of 50 dips were taken from each breeding habitat depending on the size of the breeding place using standard dippers ( 250 ml capacity ) . large plastic pipettes and small white enamel pans were used for small and shallow water bodies . the anopheles mosquito larvae were classified as early instar stage ( i and ii ) or late instar stage ( iii and iv ) according to gillies and coetzee . all mosquitoes collected by hc , wt , cbnt , and cbht and adults emerging from larvae were identified using an achromatic magnifying lens ( 10 ) and the taxonomic keys . the density of each mosquito species collected by cbht , cbnt , and wtc was calculated as per trap densities ( number of mosquitoes from each species / total number of traps ) and hc as density per house ( number of mosquito from each species / total number of houses surveyed ) , and larval densities were calculated as density per 100 dips { ( number of mosquitoes from each species / total number of dips ) 100 } . monthly climatic data including rainfall ( rf ) , temperature ( mt ) , and relative humidity ( rh ) of the trincomalee district monitored at various locations were obtained from the department of meteorology , colombo , sri lanka . the data obtained in the study were collected and analyzed with respect to anopheles species abundance in the study area . pearson 's correlation coefficients were used to determine the associations between climatic variables and anopheline densities . ethical clearance to conduct the study was obtained from the ethics review committee of the faculty of medicine , university of kelaniya , sri lanka . the overall results of the mosquito collection made by five mosquito sampling techniques named cbhc , cbnc , wtc , hc , and ls during the study period are given in table 1 . a total of 87,710 female mosquitoes representing 17 species were recorded throughout the study . the majority ( 62 % ) of adultswas collected by cattle - baited collections ( cbhc and cbnc ) in the district . the density of each mosquito species collected by cbht , cbnt , and wtc was calculated as per trap densities ( number of mosquitoes from each species / total number of traps ) and hc as density per house ( number of mosquito from each species / total number of houses surveyed ) and larval densities were calculated as density per 100 dips { ( number of mosquitoes from each species / total number of dips ) 100 } . the most abundant species among the immature and adult collections was anopheles subpictus ( 26 % ) . the density of a. culicifacies , a. subpictus , and all anophelines by different surveillance technique is illustrated in table 3 . a. subpictus was the most predominant species , while a. culicifacies comprised only 0.01 % ( 2/10 ,626 ) of all indoor resting mosquitoes . all other anopheline species were present , but in much less densities ( 14 % ) . a total of 1,790 anopheles representing 12 species were recorded from 3,560 traps performed during the study period . a. subpictus ( 63.85 % ) was the most abundant species ( 1,143 / 1,790 ) , followed by 12.12 % ( 217/1 ,790 ) of anopheles nigerrimus , 10.95 % ( 196/1 ,790 ) of anopheles vagus , 5.86 % ( 105/1 ,790 ) of anopheles peditaeniatus , 3.52 % ( 63/1 ,790 ) of anopheles barbirostris , 1.45 % ( 26/1 ,790 ) of anopheles pallidus , 0.84 % ( 15/1 ,790 ) of anopheles varuna , 0.78 % ( 14/1 ,790 ) of anopheles annularis , 0.28 % ( 5/1 ,790 ) of anopheles barbumbrosus , 0.22 % ( 4/1 ,790 ) a. culicifacies , 0.05 % ( 1/1 ,790 ) of anopheles jamesii , and 0.05 % ( 1/1 ,790 ) of anopheles tessellatus . a total of 42,325 anophelines belonging to 15 species were recorded from 1,621 hut days . a. peditaeniatus , 42.97 % ( 18,185 / 42,325 ) , was the most dominant species followed by a. nigerrimus , 30.57 % ( 12,938 / 42,325 ) . a total of 11,622 anophelines representing 16 species were collected from 1,620 trap - days of collection . the average number of anopheline collected per trap day was 7.2 . among the 16 species collected , the most predominant species was a. subpictus , 46.62 % ( 5,419 / 11,622 ) , followed by 15.26 % ( 1,774 / 11,622 ) of a. nigerrimus , 10.4 % ( 1,209 / 11,622 ) of a. peditaeniatus , 9.35 % ( 1,087 / 11,622 ) of a. vagus , 5.16 % ( 600/11 ,622 ) of a. annularis , 4.85 % ( 564/11 ,622 ) of a. barbirostris , 4.48 % ( 521/11 ,622 ) of a. pallidus , and 1.91 % ( 138/11 ,622 ) of a. jamesii . immature stages were collected from all types of breeding sites recorded in each locality of the sentinel sites on a monthly basis ( table 3 ) . a. subpictus 24.72 % ( 5,278 / 21,347 ) was predominant followed by 24.67 % ( 5,267 / 21,347 ) of a. nigerrimus and 14.56 % ( 3,109 / 21,347 ) of a. peditaeniatus . the total annual rainfall in 2010 and 2011 was 1376.22 mm and 2532.44 mm , respectively . the highest rainfall was recorded during the months of october to december ( figure 2 ) . the mean relative humidity was 60 % during the study period while the mean monthly temperature ranged from 25.0 c to 30.4 c ( figure 2 ) . the association between both adult and larval anopheline densities and climatic variables , namely , rf , tm , and rh , were investigated by correlation analysis . a. culicifacies density in hc was positively , though not significantly , correlated with rf having a one - month lag period ( r = 0.25 ; p = 0.23 ) and a two - month lag period ( r = 0.39 ; p = 0.063 ) . a. subpictus and all anopheline densities in hc were positively , though not significantly , correlated with rf having one - month lag ( r = 0.05 ; p = 0.81 , r = 0.087 ; p = 0.69 , resp . ) . a. culicifacies , a. subpictus , and all anopheles densities recorded from hc were positively , though not significantly , correlated with rh having a one - month lag period ( r = 0.28 ; p = 0.15 , r = 0.21 ; p = 0.35 , r = 0.24 ; p = 0.27 , resp . ) and a two - month lag period ( r = 0.35 ; p = 0.11 , r = 0.30 ; p = 0.17 , r = 0.32 ; p = 0.14 , resp . ) . mean temperature of the current month was positively correlated with a. subpictus density in hc ( r = 0.28 ; p = 0.177 ) ( table 5 ) . a. culicifacies and a. subpictus densities were positively , but not significantly , correlated with rf of the current month ( r = 0.36 , 0.29 ; p = 0.07 , 0.15 , resp . ) . there was a positive but not significant correlation between rh of the current month , a. culicifacies ( r = 0.242 ; p = 0.245 ) . a. subpictus density was positively correlated with rh having a one - month lag period ( r = 0.399 ; p = 0.054 ) and a two - month lag period ( r = 0.389 ; p = 0.067 ) . a. culicifacies density was positively correlated ( not significant though ) with tm having a one - month ( r = 0.196 ; p = 0.357 ) and a two - month lag periods ( r = 0.18 ; p = 0.408 ) ( table 5 ) . a. culicifacies density was positively correlated with rf of the current month ( r = 0.187 ; p = 0.37 ) , having one - month lag ( r = 0.25 ; p = 0.25 ) and two - month lag periods ( r = 0.33 ; p = 0.125 ) . the rh of the current month ( r = 0.21 ; p = 0.3 ) , having one - month lag period ( r = 0.27 ; p = 0.20 ) and having two - month lag period ( r = 0.2 ; p = 0.35 ) , was correlated with a. culicifacies . mean temperature of the current month , having one - and two - month lag periods , was negatively correlated with a. culicifacies and a. subpictus densities ( table 5 ) . a. culicifacies density was positively correlated , though not significant , with rf of the current month ( r = 0.066 ; p = 0.75 ) , having one - month lag ( r = 0.23 ; p = 0.28 ) and two - month lag periods ( r = 0.36 ; p = 0.09 ) . a. subpictus was positively correlated with the rf of the current month ( r = 0.31 ; p = 0.31 ) and rf having two - month lag period ( r = 0.31 ; p = 0.13 ) . relative humidity of the current month , having one - and two - month lag periods , was positively correlated with a. culicifacies and a. subpictus densities ( table 5 ) . all anophelines densities including a. culicifacies and a. subpictus densities were negatively correlated , though not significant , with tm of the current month , having one - and two - month lag periods . in larval collections , a. culicifacies , a. subpictus , and all anopheleswere positively correlated with the tm of the current month ( r = 0.18 ; p = 0.39 , r = 0.53 ; p = 0.007 , r = 0.30 ; p = 0.14 , resp . ) , having a one - month lag period with a. culicifacies ( r = 0.004 ; p = 0.97 ) and a. subpictus ( r = 0.30 ; p = 0.15 ) . larval density of a. subpictus was also positively correlated with rh having a two - month lag period ( r = 0.14 ; p = 0.95 ) . there was a significant negative significant correlation between tm of the current month , having two - month lag periods , with a. supictus and all anophelines ( table 5 ) . the density of all anopheline was observed to be high during the monsoonal rains ( may to july and november to january ) ( figure 3 ) . a. subpictus was the most abundant and only indoor resting species collected throughout the study period . a. culicifacies was also collected from trincomalee district only in december 2011 and january 2012 , but very little in numbers when compared to a. subpictus . all anopheline density by wtc was high during november to january periods ( figure 4 ) . the highest indoor resting densities by wtc peaked approximately one to two months after a high rainfall received for a particular period . the similar pattern was observed for a. subpictus also a. culicifacies was detected only in october 2011 . the highest densities were observed during may to june and november to february ( figure 5 ) . all anopheline density was high in july 2010 , march 2011 , and january 2012 . a. subpictus density was observed to be high during december 2010 to may 2011 with increasing rainfall . the outdoor resting anopheline density by cbhc peaked approximately one to two months after that of the indoor resting population . a. subpictus density by cbhc was low , when the indoor resting by hc was observed to be high . it was recorded only from october 2011 to april 2012 throughout the study period , where the highest density was detected in december 2011 . the larval density of all anophelines was high during february to may in both 2011 and 2012 , approximately one to three months after heavy rains were received in december 2010 and october 2011 , respectively ( figure 7 ) . a similar pattern was not identified for a. subpictus densities , where the higher densities were found in march to may in both years . a. culicifacies was detected continuously since may 2011 to june 2012 except in january 2012 . the abundance of malaria vector anopheles mosquitoes has not been studied in some parts of sri lanka , especially in northern and eastern provinces over the past 30 years because of the security situations . mosquito species may have shifted their niche with changing weather patterns and ecology in order to attain a wide dissemination in the environment . the current investigation was focused on the study of malaria vectors and their abundance in selected areas in trincomalee district . vector incrimination studies done for most of these anopheline species under experimental laboratory and field conditions have been reported to play a role in malaria transmission in sri lanka . hence , the study of their abundance becomes important for implementation of effective malaria control measures . anopheles subpictus , the predominant species in all collection techniques we carried out including intradomestic habitats , was the only anopheline species recorded throughout the study period in indoor habitats . although a. subpictus has been incriminated only as a secondary vector of malaria in sri lanka , given its relative abundance in intra - and peridomestic habitats , it is possible that it plays a more dominant role as a primary vector in the transmission of malaria in sri lanka . the outdoor resting anopheline population demonstrated two distinctive peaks corresponding to periods following monsoonal rains . about 47 % and 5 % of collections from cbht and cbnt , respectively , were a. subpictus . in cattle - baited net trap collections , anopheles peditaeniatus ( 43 % ) and anopheles nigerrimus ( 31 % ) were observed ; they were not encountered among the indoor resting populations , indicating their exclusive exophilic nature . the presence of a. nigerrimus in these areas might contribute to malaria transmission since this species is considered as a secondary vector for malaria . however , indoor residual spraying of insecticides ( irs ) is commonly used as the major malaria control intervention targeting adult mosquitoes . therefore , the tendency of resting adult vector mosquitoes in outdoor resting surfaces will depreciate the effectiveness of irs as a controlling measure . hence , the health authorities need to be vigilant to prevent any future epidemics of malaria in these areas . . this technique may be good to study the general mosquito abundance in an area especially in monitoring vector species during a malaria elimination phase as in sri lanka and even thereafter . the results revel that the mosquitoes collected from cbnt were approximately five times than those of cbht . the possible reason for this observation may be the fact that since the cbht is a fixed one at a permanent place , the collection may vary with the seasonality . however , the cbnt is a mobile trap ; therefore , during the study period the net traps were placed in different locations proximity to breeding sites and resting places of adult mosquitoes . the seasonal distribution of anopheline varies in time and space depending upon environmental conditions and availability of breeding habitats . the minimal larval breeding in the district was observed , when rainfall was above 400 mm a month probably due to flushing of larvae as a result of high levels and rapid flow of water in streams and rivers and subsequent flooding that may have led to larval deaths due to reduction in oxygen tension causing physical harm to the larvae . larvae of anopheles mosquitoes have been found in aquatic bodies such as rice fields , the edges of streams and rivers , and small temporary rain pools . many species prefer habitats with vegetation , while some breed in open , sunlit pools . the frequency of larval occurrence varied considerably in different habitats . in this study , anopheles subpictus was the predominant species indicating the presence in all 21 habitat categories . there was no habitat found to have larvae of a single anopheline species . some species such as anopheles annularis , anopheles varuna , anopheles tessellatus , anopheles barbirostris , anopheles barbumbrosus , anopheles pallidus , and anopheles pseudojamesi were limited to selective breeding habitats . this pattern of larval distribution has been attributed to the specificity of mosquito species to prefer different degrees of physicochemical properties of larval habitats . interestingly , anopheles culicifacies , a. subpictus , and some potential vectors were encountered in a variety of breeding habitats including blocked drains with wastewater having low dissolved oxygen levels ( 3 mgthis has serious implications on the epidemiology of malaria in general and the application of control measures in the country in particular , which have focused on rural populations based on the bioecology of the vector . rapid unplanned urbanization observed in many parts of the country is changing the context of human population settlements and natural ecosystem interactions that may have contributed to adaptation of anopheline breeding sites that we observed in this study . the evidence of the adaptation and survival of a. culicifacies and a. subpictus in polluted water should be a warning signal of the potential for the emergence of urban malaria in sri lanka , a phenomenon that has not been reported yet . this needs to be seriously considered by malaria control authorities as the majority of malaria cases reported recently in the country are imported cases detected in people in urban areas . moreover , adaptation of anophelines to breed in polluted water in urban areas could be a serious concern when a. stephensi plays an important role in transmitting urban malaria in neighboring southern india . during this study , there was minimal variation in temperature and humidity . the mean monthly temperature ranged between 25.0 c and 30.4 c ; the upper limit of rh was over 62 % ( 62.2 % 88.5 % ) . the minimal variation in temperature and humidity may also have contributed to the lack of relationship between the abundance of anopheline species and climate variables . the fact that this study could not sample all possible resting or breeding sites of anophelines in the different localities is acknowledged ; our assessment of overall anopheline abundance is based on obtaining representative samples from the selected sampling sites . it is possible that rapid changes in weather conditions and availability of breeding sites within the month may have influenced our results . the association between rainfall and density of vectors may have been confounded by changes in the environment affecting the mosquito population and application and effectiveness of malaria control interventions in these areas . only a few mosquito species recorded in the country have been incriminated as malarial vectors . it is important to monitor the density of these species , both indoors and outdoors , as well as their breeding habitats for application of vector control measures as sri lanka is on the threshold of malaria elimination . a key point from these results is the potential impact of other mosquito species mainly a. subpictus and a. nigerrimus on malaria transmission . this survey makes an important contribution in assessing relative abundances of mosquito vectors which may not be considered in malaria control intervention and may point to ways in which mosquito control could be targeted to address the transmission potential of these vectors . additionally , a. culicifacies may actually contribute a relatively small amount of transmission given its low abundance , which again is an important point for effective vector control under the current malaria elimination program in sri lanka . it is important to determine the abundance , distribution , biology , and relationship with climatic factors of main and secondary malaria vectors in sri lanka in order to apply efficient controlling programs under the current malaria elimination program in sri lanka .\noutput:\n" }, { "from": "agent", "value": "background . malaria was an endemic problem in trincomalee district , eastern province of sri lanka . very few recent data concerning anopheles are available which transmit malaria . therefore , the aim of this study is to identify various anopheles species and the dynamics of anophelines including malaria vectors in trincomalee district for effective vector control under the current malaria elimination program embarked in the country . method . entomological surveys were conducted on a monthly basis , using five entomological techniques , namely , indoor hand collection ( hc ) , window trap collection ( wtc ) , cattle - baited net collection ( cbnc ) , and cattle - baited hut collection ( cbhc ) from june 2010 to june 2012 in 32 study areas under five entomological sentinel sites . results . seventeen anopheline species were encountered , of which anopheles subpictus was the predominant species in all sampling methods . it is noted that a. culicifacies and a. subpictus have adapted to breed in polluted water in urban settings which may cause serious implications on the epidemiology of malaria in the country . conclusions . it is important to determine the abundance , biology , distribution , and relationship with climatic factors of main and secondary malaria vectors in sri lanka in order to initiate evidence based controlling programs under the current malaria elimination program in sri lanka ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: iga nephropathy ( igan ) is one of the most common types of glomerulonephritis worldwide . igan causes a broad range of disease phenotypes from non - progressive mild urinary abnormalities to rapidly progressive crescentic glomerulonephritis . igan may occur in renal allografts and is either de novo , recurrent or donor - transmitted . we report a case of igan affecting a donor recipient pair of identical twins with excellent 11 - year outcome . a 26 - year - old man presented in 1988 with hypertension ( 180/100 mmhg ) , normal urine microscopy , proteinuria ( 2.2 g / 24 h ) and preserved renal function ( radionucleotide glomerular filtration rate 84 ml / min / 1.73 m ) . immunofluorescence was strongly positive for mesangial iga and large electron - dense deposits were seen in the paramesangium and basement membrane subendothelially . his hypertension had been investigated 9 years earlier at which time he did not have microscopic haematuria . he had intermittent microscopic haematuria ( 5510 / l red cells , no dysmorphic red cells ) , no proteinuria , controlled hypertension ( 140/80 mmhg on 10 mg of quinapril ) , normal echocardiogram and 24 - h urine creatinine clearance 168 ml / min . a kidney biopsy showed occasional glomeruli with a slight increase in mesangial matrix but no glomerulosclerosis , interstitial fibrosis or vasculopathy . monozygotic twin status was confirmed by testing with nine highly polymorphic short tandem repeat loci . we discussed the risks and benefits of proceeding with transplantation with the donor and recipient . one supported proceedingit is difficult to present a convincing argument why they should not proceed , provided they understand the potential risks involved , both to the transplanted kidney and to the donor ( sir peter morris , surgeon , oxford , personal communication ) . the second opinion recommended not proceeding based on personal experience from three unpublished cases with poor outcomes ( dr a.r . the first case was an identical twin transplant where the donor ( previously asymptomatic ) developed the disease in his single remaining kidney reaching end - stage renal failure , requiring transplantation within 2 years . the second case was a cadaveric graft containing iga deposits ( found on insertion biopsy ) transplanted into an igan recipient with significant early recurrence . the third case was a patient with igan with a single functioning kidney that had a quicker than expected decline in renal function following diagnosis . this information in addition to the medical findings was discussed with the donor , recipient and their families . they were felt to understand the risks and uncertainties and therefore be in a position to make an informed decision . the operation and immediate recovery were uncomplicated . a graft biopsy at implantation and then 1 month later showed findings consistent with the donor pre - transplant assessment biopsy . eleven years later , both donor and recipient are well at the age of 50 years . the donor 's serum creatinine is currently 129 mol / l [ estimated glomerular filtration rate ( egfr ) 51 ml / min / 1.73 m , modification of diet in renal disease ( mdrd ) ] . the donor 's blood pressure is controlled ( 140/85 mmhg ) taking quinapril 10 mg daily . the recipient has a serum creatinine of 140 mol / l ( egfr 47 ml / min / 1.73 m , mdrd ) , blood pressure of 130/88 mmhg on two agents . we are not aware of a published case in which a kidney transplant recipient was simultaneously at risk for both recurrent and donor - transmitted igan in monozygotic twins with the donor known to have igan prior to donation . recurrent igan occurs in up to 35 % of allographs with similar 10 - year graft survival to de novo igan . series on igan in living - related donors , one recipient with crescentric igan received a healthy kidney from her identical twin . eleven years later , graft biopsy showed mesangial iga deposits , and the recipient had renal impairment with haematuria and proteinuria . two years and 6 months after donation , the identical twin donor had traces of proteinuria . a series of six cases of donor - transmitted igan identified on biopsies 1 h to day 3 post - transplant had good outcomes . no graft was lost but two developed proteinuria and haematuria with one having a serum creatinine over 176 mol / l . a case series of eight recipients confirmed a favourable prognosis of donor - transmitted igan in the recipients without igan . igan can have an excellent prognosis but long - term prognosis for donors with igan is unclear . there are no prospective studies on living - related donors with a complete morphologic study at the time of donation , and therefore , the prognosis for these living donors with iga glomerular deposits in their remaining kidney is not clear . published a case series of three living - related kidney donors with silent igan , observed for 7 years . the first and second donor had a good outcome . by 1 year , the third donor had developed hypertension , proteinuria 1 g / 24 h and intermittent haematuria . his kidney function deteriorated steadily with a creatinine of 880 mol / l by 7 years . they suggest that igan superimposed on a reduced nephron status may be associated with a progressive course of disease . another study from the usa found persistent , asymptomatic , microscopic haematuria is uncommon in healthy prospective donors , but abnormalities were found on kidney biopsy in a high proportion of cases . many may be unacceptable for donation but some may have mild lesions whose long - term risk in the absence of donation is likely to be low . he had several good prognostic indicators ( lack of proteinuria or glomerulosclerosis and preserved renal function ) . given the presumed existence of susceptibility genes , which will be identical to the recipient and the likely hyperfiltration associated with a single kidney , then the donor could be expected to have an increased risk of end - stage renal disease from igan relative to others with good prognostic indicators . this information and the uncertainty were balanced against the donor 's right to autonomy in decision - making around donation . the recipient received a genetically identical kidney with biopsy - proven igan and is at risk of both donor - transmitted and recurrent igan ( which would be indistinguishable ) . no immunosuppression is required in genetically identical twin recipients but the effect of withholding immunosuppression on igan in the graft was unknown . eleven years after transplantation , the donor has stable renal function , well - controlled blood pressure and low risk for progressive renal impairment . it is likely the recipient has igan in the graft but whether this is donor - transmitted or recurrent disease is unclear . the recipient has benefited from kidney transplantation without long - term immunosuppression , and the donor has achieved his aim of donating to his brother without sequelae .\noutput:\n" }, { "from": "agent", "value": "we present a case of iga nephropathy ( igan ) in monozygotic twins with excellent donor and recipient outcome 11 years after transplantation . the recipient developed igan at 26 years and progressed to end - stage renal failure 10 years later . his identical twin who had hypertension , intermittent microscopic haematuria and positive iga immunofluorescence on biopsy became his donor . eleven years following transplant , in the absence of immunosuppression , the recipient has stable graft function [ estimated glomerular filtration rate ( egfr ) 47 ml / min / 1.73 m2 , modification of diet in renal disease ( mdrd ) ] , controlled hypertension on two medications and minor microscopic haematuria . the donor has good renal function ( egfr 51 ml / min / 1.73 m2 , mdrd ) , controlled hypertension on one medication and normal urine ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the technique of lymphatic mapping and sentinel lymph node biopsy ( slnb ) has emerged in the last two decades as a minimally invasive approach to evaluate regional lymph node basins in patients with intermediate and high - risk primary cutaneous melanoma . in particular , slnb is now recommended as a staging procedure for patients with t2 , t3 or t4 melanomas and clinical uninvolved regional lymph nodes ( clinical stage ib and ii ) and suggested also for patients with t1 melanomas and pathologic features associated with an increased risk of nodal micrometastases ( ulceration , high mitotic rate , ) . also positron emission tomography ( pet ) with 18f - fluorodeoxyglucose ( 18f - fdg ) has been extensively investigated in patients with melanoma and plenty of studies have shown its effective role in detecting distant metastases , further increased after the introduction of co - registered computed tomography ( ct ) scan ( 18f - fdg pet / ct ) . in this article , we introduce a case of pt4b thigh melanoma , in which both procedures were performed , together with ultrasonography . an 82 - year - old white male , with a clinically - confirmed cutaneous melanoma of the right thigh , presented to our unit to undergo lymphoscintigraphy , in order to perform slnb at the same time of tumor excision . lymphoscintigraphy with tc - nanocolloids was performed on a hybrid system philips single - photon emission computed tomography / computed tomography ( spect / ct ) precedence 16 slices ( philips healthcare , eindhoven , the netherlands ) after intradermal injection of the radiopharmaceutical around the primary lesion ( four separate injections , 0.1 ml for each aliquot , total activity 100 mbq ) . low dose helical ct scan was performed : 120 kv , 100 ma , d - dom control dose , 3 mm slice thickness , 1.5 mm detector collimation , pitch 0.8 , rotation time 0.75 s. spect scan was acquired with the following parameters : 128128 matrix size , 120 view angle , 10 s time / angle , 5 mm pixel size . spect / ct images showed uptake of the radiocolloids in a right inguinal lymph node . on ct co - registered images , anyway , another lymph node with no radiopharmaceutical uptake but with suspicious aspect ( globular morphology , absence of hilum ) was detectable in the crural region , much closer to the primary tumor [ figures 1 and 2 - left panel ] . axial views of single - photon emission computed tomography / computed tomography ( ct ) lymphoscintigraphy with tc - nanocolloids . tracer uptake can be seen in the site of injection / primary tumor ( green arrow ) and in a right inguinal node ( yellow arrow ) , while there is no uptake in a crural node with suspicious aspect on ct images ( red arrow ) volume rendering of technetium - labeled radiocolloids single - photon emission computed tomography / computed tomography ( left panel ) and f - fluorodeoxyglucose positron emission tomography / computed tomography ( right panel ) . the arrows show the sites of primary lesion ( green ) , true sentinel crural node ( red ) , false sentinelinguinal node ( yellow ) for this reason , and due to the adverse pathologic features of the removed lesion ( clark 's level iv , breslow 's depth 4.6 mm , ulceration , 89 mitoses / mm , poor inflammatory infiltrate , pt4b ) , the patient was further staged with a f - fdg pet / ct scan after surgery . pet / ct showed pathologic uptake of the tracer in the suspected right crural lymph node , which was removed : no other nodal or visceral metastases were seen [ figures 2 - right panel and 3 ] . histology demonstrated signs of chronic inflammation and no neoplastic cells in the inguinal lymph node ( analysis of slices from the whole node with hematoxylin and eosin ( h and e ) stain and confirmation with immunohistochemical staining for s - 100 protein in eachblank slide ) , while a massive metastasis from melanoma was seen in the crural node ( h and e ) . no significant uptake can be seen in the site of the removed primary tumor ( green arrow ) and right inguinal node ( yellow arrow ) , while high metabolic activity is demonstrated in the crural node ( red arrow ) neither inguinal lymphadenectomy nor systemic therapy was proposed , due to age and co - morbidity ( hypertensive cardiomyopathy ) and a follow - up based on abdominal , and inguinal ultrasonography was organized . ten months after surgery the patient developed a metastatic disease , further depicted by a follow - up f - fdg pet / ct scan [ figure 4 ] . follow - up f - fluorodeoxyglucose positron emission tomography / computed tomography scan ( 1 year after tumor excision ) : multiple secondary lesions can be seen in right inguinal nodes , in the liver and in many skeletal segmentsthe prognostic factors for cutaneous melanoma have been recently revised in the 7 edition of the american joint committee on cancer ( ajcc ) ( 2009 ) , based on analysis of data for over 50,000 patients of ajcc database . apart from the features of the primary lesion ( thickness , mitotic rate , ulceration ) , the histologic status of regional nodes has been confirmed as the most powerful independent predictor of survival in clinically node - negative patients . the technique of slnb , first proposed in the 1980s , made inroads once it was clear that the treatment of regional node disease while still microscopic afforded a survival benefit compared to waiting for clinically evident disease . this strategy , minimally invasive , allows the use of more aggressive surgical approaches and systemic therapies only in higher - risk patients , with occult stage iii disease . it has shown high sensitivity ( especially when performed with spect / ct - aided lymphatic mapping and multiple peri - tumour injections ) with very low false - negative rate , mainly related to technical problems associated with identification of the true sentinel node ( sn ) by nuclear medicine physicians and surgeons and errors in tissue sampling and interpretation by pathologists . thus , even if new and more sensitive molecular techniques have already shown promising results , slnb with pathological assessment is now the recommended staging procedure for all stage i and ii patients with primary melanomas 1.0 mm in thickness . nonetheless , with the introduction and the development of noninvasive metabolic imaging techniques ( such as f - fdg pet / ct ) also in patients affected by melanoma , the hypothesis that even slnb could be avoided and replaced by the analysis of tumor metabolism in the lymphatic basin has emerged . in the last 15 years , almost 20 papers concerning the diagnostic performance of f - fdg pet / ct in comparison to slnb ( and ultrasonography ) can be found in literature , all pointing out , with few exceptions , a very low sensitivity of f - fdg pet / ct in discovering small lymph node metastases if compared with slnb . in this scenario , our report looks somewhat interesting , suggesting the possible utility of pet / ct even in the evaluation of regional disease in selected patients . the key point seems to be the missed identification of sentinel lymph node by lymphoscintigraphy , probably due to the obstruction of lymphatic flow to the true sn and the consequent deviation of the flow to another node . this situation has already been described in some papers about sns in melanoma and also in breast cancer . in 2009 , for example , lam et al . described three cases in which preoperative lymphoscintigraphy failed to show sns containing metastatic melanoma ( all with significant tumor involvement ) , that were discovered by ultrasound and then confirmed by fine - needle aspiration biopsy and histopathology . the same circumstance was previously described by estourgie in 2003 in two breast cancer patients : in that report , both lymphoscintigraphy with tc - nanocolloid and patent blue dye administration failed to identify the true sn , completely invaded by tumor and discovered by intra - operative palpation of the biopsy wound . what seems new hereis that not only lymphoscintigraphy , but even preoperative ultrasonography failed to identify the metastatic crural node . in this setting , in our opinion , a double lesson can be learnt . first , this report confirms that a small risk of missing sentinel lymph node by lymphoscintigraphy exists ( especially in thick melanoma ) and highlights the added value of a hybrid tomographic study ( spect / ct ) , that allows a morphologic evaluation of the interested region too . second , it shows that f - fdg pet / ct , usually performed forn staging ( for the well - known lack of sensitivity in the study of the lymphatic basin ) , could give important information also about regional disease in selected patients . the selection of the staging procedures to perform should always be individualized , considering general and local features of the disease , and evaluating together with the patient the risks and benefits of each technique .\noutput:\n" }, { "from": "agent", "value": "the american society of clinical oncology guidelines recommend sentinel lymph node biopsy ( slnb ) for all patients with melanoma tumors of intermediate thickness ( between 1 and 4 mm ) . in case of patients with thick melanoma tumors ( > 4 mm ) , slnb may be recommended as well , for staging purposes and to facilitate regional disease control . we report a case of an 82 - year - old man , undergone excision of a cutaneous melanoma of the right thigh , which shows some limitation of slnb in thick melanoma . lymphoscintigraphy , performed as single - photon emission computed tomography / computed tomography ( spect / ct ) , failed to identify the real sentinel lymph node , as tracer uptake was seen in a right inguinal node . due to the presence on ct co - registered images of another suspicious node ( with no radiopharmaceutical uptake ) in the crural region , and considering the high - risk pathologic features of the removed primary lesion , a 18f - fluorodeoxyglucose positron emission tomography / ct ( 18f - fdg pet / ct ) staging scan was planned . pet / ct showed high metabolic activity in the suspected crural lymphadenopathy . histopathology demonstrated massive invasion of the crural ( sentinel ) node and no metastatic cells in the inguinal node . this report highlights both the higher accuracy of lymphoscintigraphy , when performed as spect / ct and the potential utility of 18f - fdg pet / ct in regional staging ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: peripheral arterial disease ( pad ) , an obstructive atherosclerotic disease in the lower extremities , was repeatedly found to be associated with cardiovascular diseases , stroke , mortality , or decreased quality of life in different populations . the prevalence of pad has been of increasing concern around the world for the last decades . it was reported that a substantial proportion of people in the general population had pad . according to a recent study , however , only around one - tenth of patients with padhad clinical intermittent claudication symptoms and as high as 75 % of these patients could be without symptomatic pad . the national institute for health and clinical excellence ( nice ) recommended that pad patients should be provided with a detailed clinical examination that included assessing the most modifiable risk factors , such as smoking status , glycemic status , abnormal lipid , obesity , and physical activity . in practice , however , epidemiological studies about pad are much fewer compared with those of other type of cardiovascular diseases . thus , there is an urgent need for pad surveillance , to investigate the etiology , and to develop possible preventive and treatment strategies . to assess the prevalence of pad , thorough examinations using ankle brachial index ( abi ) or combing clinical symptoms are the typical methods for most of the present clinical research and epidemiological studies . however , because these methods are sometimes expensive , time - consuming , and resource and labor demanding , many epidemiological surveys do not have these equipment or measurements , which might be a hurdle to further examine the risk factors of pad or its predictive performance for other clinical outcomes . consequently , alternative cost - effective , reliable , and valid instruments for pad prevalence surveillance at the national or regional level , such as scales or other routine examinations in epidemiological studies are on the agenda of the scientific community . in the present study , we aimed to ( 1 ) develop models for pad risk prediction using a combination of self - reported questions and routine metabolic biomarkers from national health and nutrition examination surveys ( nhanes , 19992002 ) ; ( 2 ) to externally validate these models in nhanes ( 20032004 ) . as a nationally representative survey of the us population , nhanes was conducted by the national center for health statistics of the centers for disease control and prevention . the model training survey is based on 4 years of the continuous nhanes ( 19992002 ) , and the model validation survey is based on nhanes ( 20032004 ) . all study participants in this study were examined at homes where detailed information on demographic characteristics , smoking and drinking status as well as other risk factors were collected . a physical examination at a mobile examination center was also offered to those who were able to participate . the abi assessment and the lower extremity disease examinationparticipants who had a bilateral amputation or were obese ( 400 pounds ) were excluded from the examination . according to a predetermined operation protocol , trained health staff performed the abi examination in a separate room at the mobile center . the abi value was calculated for each participant . with the participants in the supine position , trained health staff used an 8.1 - mhz doppler probe to perform the examination following a standard operation protocol . the abi was calculated by dividing the ankle mean systolic blood pressure by brachial mean systolic blood pressure in the same side . hypertension was defined as sbp 140 mm hg , dbp 90 mm hg , or current medication for hypertension and diabetes mellitus was defined as hba1c 6.5 % or current medication for diabetes . all estimates were weighted , with the sample weights accounting for the unequal selection probability of the complex nhanes sampling and the oversampling of selected population subgroups . basic characteristics of the 2 study samples were shown as mean ( standard deviation ) and numbers ( proportions ) . multivariable logistic regression models were applied to develop the prediction models in the model training survey . we first searched the potential variables used in current risk prediction models from the published literature . then we applied likelihood ratio tests to determine which variables being included in the models . for this model selection process , we first included all the potential variables in the models , and then sequentially removed those which were not significant according to the likelihood ratio test in the reduced models compared with the full model . the final model was listed below : area under receiver operating characteristics curve ( c - statistics ) , and goodness - of - fit test in a multiple logistic regression were used as the metrics to assess the model 's performance including discrimination and calibration , respectively . c - statistics from the original study minus optimism was used to calculate the optimisms - corrected c - statistics . the optimal cut - off value for predicted probabilities of pad , distinguishing pad cases from healthy participants , all statistical analyses were performed using stata / mp 13.0 and p 0.05 was regarded as statistical significance . as a nationally representative survey of the us population , nhanes was conducted by the national center for health statistics of the centers for disease control and prevention . the model training survey is based on 4 years of the continuous nhanes ( 19992002 ) , and the model validation survey is based on nhanes ( 20032004 ) . all study participants in this study were examined at homes where detailed information on demographic characteristics , smoking and drinking status as well as other risk factors were collected . a physical examination at a mobile examination center was also offered to those who were able to participate . the abi assessment and the lower extremity disease examinationparticipants who had a bilateral amputation or were obese ( 400 pounds ) were excluded from the examination . according to a predetermined operation protocol , trained health staff performed the abi examination in a separate room at the mobile center . the abi value was calculated for each participant . with the participants in the supine position , trained health staff used an 8.1 - mhz doppler probe to perform the examination following a standard operation protocol . the abi was calculated by dividing the ankle mean systolic blood pressure by brachial mean systolic blood pressure in the same side . hypertension was defined as sbp 140 mm hg , dbp 90 mm hg , or current medication for hypertension and diabetes mellitus was defined as hba1c 6.5 % or current medication for diabetes . all estimates were weighted , with the sample weights accounting for the unequal selection probability of the complex nhanes sampling and the oversampling of selected population subgroups . basic characteristics of the 2 study samples were shown as mean ( standard deviation ) and numbers ( proportions ) . multivariable logistic regression models were applied to develop the prediction models in the model training survey . we first searched the potential variables used in current risk prediction models from the published literature . then we applied likelihood ratio tests to determine which variables being included in the models . for this model selection process , we first included all the potential variables in the models , and then sequentially removed those which were not significant according to the likelihood ratio test in the reduced models compared with the full model . the final model was listed below : area under receiver operating characteristics curve ( c - statistics ) , and goodness - of - fit test in a multiple logistic regression were used as the metrics to assess the model 's performance including discrimination and calibration , respectively . c - statistics from the original study minus optimism was used to calculate the optimisms - corrected c - statistics . the optimal cut - off value for predicted probabilities of pad , distinguishing pad cases from healthy participants , all statistical analyses were performed using stata / mp 13.0 and p 0.05 was regarded as statistical significance . basic characteristics of study participants are shown in table 1 . in model training survey , the average age was 59.6 years with men comprising 51.1 % of the study population , whereas in the model validation survey , the average age was 61.0 years with men comprising 51.7 % . the prevalence of pad was 4.7 % in the model training survey and 5.6 % in model validation survey . basic characteristics of study participants in each cohort the final model included age , sex , race , pulse pressure , tc / hdl ratio , and smoking status as predicting variables ( table 2 ) . figure 1 presented the roc curve for the training and validation surveys . the c - statistics and 95 % confidence interval ( ci ) were 0.82 ( 0.82 , 0.83 ) in the training survey ( table 3 ) . optimism from bootstrap internal validation was 0.0015 and optimism - corrected c - statisitcs was comparable to the previous uncorrected one . lemeshow goodness of fit test revealed p value of 0.56 indicating very good model calibration in the training survey . in terms of model external validation , the c - statistics ( 95 % ci ) was 0.76 ( 0.72 , 0.79 ) as shown in table 3 . model coefficients based on training cohort model performance for peripheral arterial disease prediction in nhanes . the black line indicates model performance in model training survey , and the red line represents model performance in model validation survey . in the present study , we developed a risk prediction model for pad in a training survey and externally validated it in another survey . we found that the models based on self - reported questionnaires and routine clinical metabolic biomarkers had a good discrimination capacity with c - statistics of 0.82 and 0.76 in the training and validation survey , respectively . these results were suggestive that the model performance was moderately good and it might be useful in pad surveillance and epidemiological studies . until now , several groups have proposed pad prevalence estimation algorithms , of which the predictors in the models varied among different studies . for example , the netherland prevalent score model included age , smoking behavior , hypertension , coronary heart disease , and cerebrovascular disease ( cvd ) in the final models using stepwise logistic regression models . likewise , the spain reason risk score included age , sex , smoking status , pulse pressure , and diabetes in the final model , which yielded auc of 0.76 in both the training and validation samples . later , the same group compared the performance of 2 prediction scores and found reason had better performance in spain populations . another group developed a pad score in a us survey and selected age , sex , race / ethnicity , smoking status , bmi , hypertension , heart failure , cvd , coronary artery disease , and diabetes in the final models with a moderate discrimination performance ( c - statistics : 0.610.64 in the training and validation samples ) . an approach for predicting the risk of pad in communities is multivariable modeling using self - reported questionnaires combining some routine examination measurements . in our study , we developed a model in the training survey considering several potential variables including age , sex , race , bmi , pulse pressure , fasting glucose , tc , hdl , tc / hdl ratio , smoking , diabetes , and hypertension . consistent with previous research results , age , sex , smoking , and pulse pressure were selected in the final model . in addition to common lipid biomarkers ( tc and hdl ) , we considered tc / hdl ratio as one of the candidate predicting variables because several studies had found a strong association between tc / hdl ratio and pad independent of other conventional risk factors . in parallel with previous findings , tc / hdl showed a strong association with pad and was superior to other lipid biomarkers , and it was selected in the final models via likelihood ratio test . some more variables were also taken into account of model training in the present study . however , they did not show significant improvement for model performance and were not included in the final model . previous studies have found there were different pad risk among different sex and race groups , and smoking had a greater impact on developing pad . in addition to that , several studies had also found pulse pressure was predictive of pad independent of traditional risk factors , we considered it as a potential predictive parameter that showed similar effect size in the final models compared with previous findings . our results demonstrated that the prevalence prediction model we developed might be a promising pad surveillance instrument for the community - based population . in the first place , bootstrap methods were used to estimate the over - optimism , and the optimism - corrected c - statistics were still good . next , external validation analysis was performed in a different population . because the source populations of the training survey and validation survey might be similar , the model performed well in the validation sample . further information regarding intermittent claudication would definitely reduce information bias . secondly , although the model we developed was validated in an external survey , the survey was based on similar participants in usa . thus , additional community - based surveys used for validation might provide robust evidence for the model performance . in conclusion , we developed a pad risk prediction model based on self - reported questions , demographic characteristics , and routine metabolic biomarkers that moderately predicted the population pad risk . this model was validated in an external sample in a different time period and showed a moderate discriminatory power . our findings may be helpful to assess pad surveillance and to track susceptible populations . in the future , the proposed model should be validated in other community - based surveys to evaluate their external performance .\noutput:\n" }, { "from": "agent", "value": "abstractwe aim to build models for peripheral arterial disease ( pad ) risk prediction and seek to validate these models in 2 different surveys in the us general population.model building survey was based on the national health and nutrition examination surveys ( nhanes , 19992002 ) . potential predicting variables included race , gender , age , smoking status , total cholesterol ( tc ) , body mass index , high - density lipoprotein ( hdl ) , ratio of tc to hdl , diabetes status , hba1c , hypertension status , and pulse pressure . the pad was diagnosed as ankle brachial index < 0.9 . we used multiple logistic regression method for the prediction model construction . the final predictive variables were chosen based on the likelihood ratio test . model internal validation was done by the bootstrap method . the nhanes 20032004 survey was used for model external validation.age , race , sex , pulse pressure , the ratio of tc to hdl , and smoking status were selected in the final prediction model . the odds ratio ( or ) and 95 % confidence interval ( ci ) for age with 10 years increase was 2.00 ( 1.72 , 2.33 ) , whereas that of pulse pressure for 10 mm hg increase was 1.19 ( 1.10 , 1.28 ) . the or of pad was 1.11 ( 95 % ci : 1.02 , 1.21 ) for 1 unit increase in the tc to hdl ratio and was 1.61 ( 95 % ci : 1.40 , 1.85 ) for people who were currently smoking compared with those who were not . the respective area under receiver operating characteristics ( auc ) of the final model from the training survey and validation survey were 0.82 ( 0.82 , 0.83 ) and 0.76 ( 0.72 , 0.79 ) indicating good model calibrations.our model , to some extent , has a moderate usefulness for pad risk prediction in the general us population ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: frster ( or fluorescence ) resonance energy transfer was first explored in the 1920s and is increasingly gaining the attention of multidisciplinary researchers . fret is a technique widely used in probing the conformational changes of biomolecules , examining the structural constitution of a targeted cell and monitoring intracellular processes and many other in vivo biological applications . the main attraction of fret is its sensitivity to very small spatial changes , typically in the nanometer range . fret is based on the near field interaction between two molecules ( dipoles ) in very close proximity , at a distance much smaller than the fluorescence wavelength . the excited state energy of the donor molecule can be transferred to the acceptor molecule in the ground state if there is a considerable overlap between the donor emission and the acceptor absorption . in the past , a variety of organic fluorescent labels were used as probes in fret measurements . however , photobleaching effects have impaired their function as reliable fluorescent markers especially in single - molecule spectroscopic applications . with the discovery of new robust fluorescent material such as semiconductor quantum dots , the possibility of photobleaching the inorganic markers over extended excitation is no longer an issue . qds are well known for their photostability , high quantum yield ( qy ) , broad absorption spectrum , and narrow emission spectrum . in contrast to the standard organic dyes , these favourable features provide a new route to optically pump different size qds using the same photoexcitation energy , thus promoting multicolour microscopic imaging . the specific application area which we seek to address is in vitro cell cycle and cell lineage studies . in this contextwe have confirmed that there is no discernible toxic effect of core / shell qds on the cells over typical analysis period of 15 days which corroborates the fact that the release of free ions from the core lattice is largely obviated by the surface passivation . furthermore , with the advent of the commercial core - shell qds , a variety of emissions that cover the visible and the infrared spectra are readily available . therefore , in view of the superior photostability , the biocompatibility and the wide selection of commercial core / shell qds , the potential of qds as fluorescent labels is very promising . in this work , we explored the potential of far - red cdte / zns core - shell qdot705 ( invitrogen ) as an efficient donor in a fret assay . from the bioimaging perspective , this avoids the detection of autofluorescence , allows the usage of red excitation which has greater depth of penetration into targeted tissue , and facilitates multiphoton absorption / excitation . from a material point of view , the compositional change from selenide to telluride in qdot705 also makes it an interesting experimental test subject . broader emission / absorption spectra and a fluorescence decay lifetime well in excess of 100 nanoseconds at room temperature were seen . in our qd fret investigation , biotinylated dy731 - bio fluorophores with an absorption peak at 720 nm were self - assembled onto qdot705 - stvs that emit at 705 nm using a streptavidin - biotin binding mechanism in the similar conjugation route as that in . due to the strong spectral overlap between qdot705 - stv emission and dy731 - bio absorption , fret signatures were detected in the steady state and also in the time domain spectroscopic measurements .1 mg of streptavidin powder ( sigma - aldrich , dorset , uk ) was dissolved in 100 l phosphate buffered saline ( pbs 0.01 m , ph 7.4 ) to make 170 m streptavidin solution .5 l of the solution was added to 400 l of 2.5 m dy731 - bio to give a loading ratio of 1 with respect to dy731 - bio . as a result , the total biotin binding sites outnumbered dy731 - bio . the steady - state absorption profile of dy731 - bio - stv bio - complex was recorded with a uv / vis / nir jasco v570 spectrometer ( tokyo , japan ) for determining dy731 - bio - stv molar extinction coefficient .10 l of 1 m qdot705 - stv stock ( invitrogen , calif , usa ) was dissolved in 400 l pbs ( ph 7.4 ) in a 10 mm optical path cell .2 l of 30 m dy731 - bio ( mobitec , gttingen , germany ) was first dispensed into the qd solution and then followed by 10 successive titrations of 4 l dy731 - bio . steady - state photoluminescence ( pl ) measurements were taken after each titration using a varian cary eclipse fluorimeter ( palo alto , calif , usa ) . for comparison , identical procedures were repeated for control experiments which involved dy731 - bio without the presence of qdot705 - stv .5 separate pbs diluted qdot705 - stv solutions ( 220 l , 90 nm ) were mixed with increasing amount ( 4 l to 200 l ) of 30 m dy731 - bio to produce qdot705 - stv - dy731 - bio donor - acceptor assay with different labelling ratios . it is estimated that a qdot705 - stv is chemically coupled to 510 streptavidin . as streptavidin is a tetrameric protein , approximately 2040 biotinylated molecules which include dy731 - bio can be arrayed around a single qdot705 - stv . the samples were left to sit at room temperature for 15 minutes . by ultrafiltration with microcon ym50 spin column ( millipore , billerica , mass , usa ) , the unbound dy731 - bio ( molecular weight , mw of 1 kda ) the column with cutoff mw of 50 kda was spun at a centrifugal speed of 2000 g three times for 20 minutes per wash . the collected conjugates were then dissolved in 100 l pbs in 10 mm path length cuvette for time - resolved pl measurements . the average numbers of dy731 - bio per qdot705 - stv were estimated by steady - state absorption using a uv / vis / nir jasco v570 spectrometer in accordance to the molar extinction coefficient at 663 nm for dy731 - bio - stv . steady - state absorptions of qdot705 - stv , dy731 - bio , dy731 - bio - stv and qdot705 - stv - dy731 - bio in pbs ( ph 7.4 ) were measured using a uv / vis / nir jasco v570 spectrometer . ensemble photoluminescence spectra were recorded with a varian cary eclipse fluorimeter . to measure the photoluminescence spectrum of dy731 - bio ,680 nm excitation was chosen . however , the excitation was set to 425 nm for all fret experiments in order to reduce the direct excitation of dy731 - bio fluorophores . qdot705 - stv - dy731 - bio samples ( from section 2.3 ) were photoexcited using a ti : sapphire laser ( coherent , santa clara , calif , usa ) with a repetition rate of 1.1 mhz in order to achieve a longer time window for detecting rather long lived qdot705 - stv photoluminescence . the laser was tuned to 850 nm and was frequency doubled to 425 nm so that direct excitation of dy731 - bio was kept to a minimum . the temporal behaviour of qdot705 - stv in a donor - acceptor assembly was investigated with a hamamatsu c5680 universal streak camera system ( japan ) . the photoluminescence of dot ensemble was spectrally filtered using a 700 nm shortpass filter to cutoff unwanted dy731 - bio fluorescence and a 630 nm longpass filter to attenuate any scattered laser . the acquisition of time - resolved photoluminescence was processed using high - performance digital temporal analyser ( hpd - ta ) software ( hamamatsu , japan ) . as shown in figure 2 , qdot705 - stv sample exhibits a broad , continuous absorption spectrum with no pronounced excitonic peak being resolved . the bulk - like spectrum is due to the relative large size variation in the qdot705 - stv ensemble which have a mean diameter of 20 nm . these qds fluoresce at 705 nm with a full width at half maximum ( fwhm ) of 70 nm ( -- in figure 2 ) . the fwhm of qdot705 - stv emission is approximately 3 times broader than that of the commercial cdse / zns qdots . the inhomogeneous size distribution is likely to be the reason behind the broad photoluminescence spectrum , however , the crystalline geometry and the lattice defects can also be the cofactors to the line width broadening . unlike qdot705 - stv , pure dy731 - bio have a narrow absorption spectrum that peaks at 720 nm with a weaker secondary absorption at 660 nm . this strongly coincides with the photoluminescence of qdot705 - stv which spreads across the absorption band of dy731 - bio . however , the absorptivity was modified when dy731 - bio were attached to streptavidin , as depicted in figure 2 . the molar extinction coefficients of dy731 - bio - stv at respective 660 nm and 720 nm were found to be 100000 mcm and 70000 mcm instead of 50000 mcm and 120000 mcm for pure dy731 - bio . the strong overlap between the dy731 - bio absorption and the qdot705 - stv photoluminescence favours the nonradiative energy transfer within the donor - acceptor assay . with the large stokes shift ( 30 nm ) , dy731 - bio are spectrally well separated from qdot705 - stv and hence , the composite photoluminescence spectrum of a mixed donor - acceptor ensemble can be resolved and deconvoluted into respective spectra for further quantitative fret analysis . successive titrations with 30 m dy731 - bio solution resulted in the progressive quenching of qdot705 - stv photoluminescence . initially , the fluorescence signal at 705 nm dropped abruptly but then gradually levelled off after a total of 26 l dy731 - bio have been dispensed into the qd solution . since the optical densities in the first few titrations ( 2 l - 22 l ) were below 0.2 , the luminescence quenching in qdot705 - stv was primarily attributed to fret . the reabsorption of qdot705 - stv photoluminescence by dy731 - bio was anticipated to be less effective . in concomitant with the quenching of qdot705 - stv fluorescence , a systematic enhancement of dy731 - biophotoluminescence was detected as shown in figure 3 ( a ) with the appearance of a 750 nm peak . the enhanced fluorescence of dy731 - bio in the mixture was many times more intense than the control signal of pure dy731 - bio ( see the inset of figure 3 ) as the absorption of the solution was dominated by the strong optical interaction with the qd excitons at the excitation wavelength of 425 nm . the quenching of qdot705 - stv emission and the concurrent enhancement of dy731 - bio emission signify the occurrence of fret from the photoexcited qdot705 - stv donors to the ground - state dy731 - bio acceptors . since fret theory is formulated based on proximal dipole - dipole interaction , the excited qds were generalised as the oscillating dipoles because of the strong electron - hole wavefunction overlap in the core and the weak carrier tunnelling into the wide band gap zns shell . fret efficiency was calculated in accordance to the following equation : ( 1 ) e = 1fdafd , where fda is the integrated donor fluorescence in the presence of the acceptor and fd is the integrated donor fluorescence alone . as the equation is only dependent upon the changes of donor emission intensity with acceptor , the relevant qdot705 - stv spectra were extracted from the composite spectra in figure 3 ( a ) , provided that the spectral shape of qdot705 - stv stayed unchanged throughout the measurements . as depicted in figure 4 , despite the undesirable size , a reasonably high - efficient energy transfer ( 70 % ) can be achieved by qdot705 - stv as the fret donor since its surface area is large enough to interact with multiple dy731 - bio acceptors . however , the plot of fret efficiency against acceptor / donor ratio shows some signs of saturation when the molar ratio exceeded 50:1 . after the 50:1 molar ratio , the incremental step in fret efficiency for successive dy731 - bio titrations scaled down dramatically . unlike the inorganic qd , the conventional organic dyes are generally confined to single donor - acceptor pairing in a fret assay because of their comparatively small molecular sizes , which in turn impose strict spatial separation condition between the interacting donor - acceptor molecules ( typically less than 100 ) for achieving high fret efficiency . due to the partial crosstalk , the qdot705 - stv emission was spectrally separated from dy731 - bio using a 700 nm shortpass filter . by monitoring the temporal changes in the fluorescence spectrum below 700 nm , the interaction dynamics of qdot705 - stv ensembles in the presence of bound acceptors were studied . as illustrated in figure 5 , with increasing number of bound dy731 - bio from 5 to 20 per dot , the qd fluorescence decay was progressively shortened . henceforth , it would appear that an additional nonradiative relaxation pathway was introduced when dy731 - bio fluorophores were self - assembled around qdot705 - stv : the photoexcited qd excitons recombined at a faster rate by coupling to the radiationless transitions . in view of the fact that a qdot705 - stv can be chemically coupled up to 10 tetrameric streptavidin , the highest elicited number of labelled dy731 - bio per qd from the absorption measurement was relatively low compared with the prediction that a maximum 40 biotinylated biomolecules can be possibly assembled around a qdot705 - stv . therefore , this elucidates , in practise , the average number of streptavidin per qd maybe less than 10 , and also the obscuration of some of the binding sites due to the compactness of large streptavidin proteins around the qd is not unlikely . the fluorescence decay curves shown in figure 5 depict a complex , multiexponential relaxation of the dots and so a specific method of analysis must be adopted in interpreting the data . we use a biexponential fitting that ( i ) is the simplest approach outside of a monoexponential model and ( ii ) provides a conceptual framework for interpretation relating to qd photophysics . there are of course alternative measures that could be adopted , for example , the definition of an effective 1 / e lifetime . our main purpose in this paper is to highlight the complexity of the qd decay dynamics and assess the ramifications of this in quantifying fret - based analyses . we associate each lifetime component to different , spatially distinct excitonic relaxation paths . from the two lifetime components , fret efficiency was explicitly calculated for each dynamic process using the equation below : ( 3 ) e = 1dad , where da is the donor fluorescence lifetime in the presence of the acceptors and d is the donor fluorescence lifetime without the acceptors . since fret is the inverse sixth power to r ( donor - acceptor separation ) , it is intuitive that the efficiency from spatially separated recombination paths will differ . as reflected in figure 7 , the short - lifetime component achieved higher fret efficiency as compared to that of the long - lifetime component . in this fret study , we were able to obtain an approximate 46 % efficiency from the short - lifetime component at an average 20 bound dy731 - bio per qd . on the contrary , the efficiency was merely 27 % for the long - lifetime component at the same labelling ratio . the marked variation asserts the close proximity of the fast decay pathway to the dy731 - bio acceptors . qdot705 - stv is a core - shell qd coated with a layer of amphiphilic polymer for water solubility and further surface functionalized with streptavidin for biolinking purposes . its core is made of direct gap ii - vi cdte with band gap energy of 1.44 ev ( at room temperature ) which coarsely dictates the emission wavelength of qd . by surface passivation with a larger band gap material like zns ( 3.54 ev at room temperature ) , the quantum yield of the qds can be significantly enhanced by suppressing the surface states which may arise from the lattice reconstructions at the final stage of nucleation . however , a perfect passivation is difficult to achieve due to appreciable lattice mismatch between cdte and zns . the lattice constants for cdte and zns are 4.57 and 3.81 ( wurzite ) , respectively , which accounts for a total of 17 % difference in bond length . in comparison to the visible qds which are typically made of cdse , so , the surface defects are more predominant in cdte / zns core - shell qds . the presence of carrier traps near the cdte / zns interface can weaken the oscillator strength of the dipole moment by decreasing the spatial overlap of the exciton wavefunction . photoexcited electrons are quickly delocalized by surface states , but due to a reduced mobility , the heavier hole is restricted to the inner core . other factors such as geometrical characteristics of qd ( shape and size ) can influence the optical absorption as well . qdot705 - stv may not experience the same quantum confinement effects in all dimensions like other commercial visible range qdots ( i.e. , qdot565 and qdot585 ) since it adopts a slightly elongated geometry which means that the photoinduced carriers have greater degree of freedom compared to the symmetric spherical qds . therefore , the quantization of excited states is less pronounced in the qdot705 - stv absorption spectrum . bacterial derivative streptavidin is known to have exceptionally high biotin binding affinity ( ka 2.51013 m ) . lower nonspecific binding as compared to analogous egg white derivative avidin is an added advantage in developing superior bioassays for nanosensing devices . in this work , we study the near - field interactions in qdot705 - stv - dy731 - bio self - assembled assay with the use of streptavidin - biotin noncovalent linkers . with the capacity of accommodating multiple bioconjugations and the good spectral overlap between donor emission and acceptor absorption , we were able to achieve high fret transfer between large qdot705 - stv and dy731 - bio . besides that , we also observed some drastic changes in the absorption properties of dy731 - bio when they were bound to streptavidin . the fluorophore probably reoriented itself during the association of streptavidin - biotin and hence , induced some structural changes to accommodate the binding site . it is unlikely that the changes in the absorption were caused by the surface charge of streptavidin since the same spectral shift was detected when dy731 - bio were dispensed in either ethanol or pbs solvents . the analytical interpretation of the fret - based assay becomes more complicated if the molar extinction coefficient of the acceptor is undesirably modified upon binding . it could possibly influence the overlap integral j , frster distance r0 down to the theoretical fret efficiency prediction . strong enhancement in dy731 - bio emission due to radiationless energy transfer from photoexcited qdot705 - stv was observed . in contrast to the dy731 - bio acceptor , the photoluminescence of qdot705 - stv was quenched drastically during the initial stage of titrations when the majority of the added dy731 - bio should have attached onto qd surface via streptavidin - biotin affinity . based on the findings in section 3.2 , after the centrifugation with a microcon filter device , one qdot705 - stv can bind up to 20 biotinylated acceptors . in regard to that information , for a nonfiltered solution , further titrations ( between 20:1 and 60:1 molar ratio ) should only saturate the outermost surface area of the qds with free dy731 - bio . as a result , the diffused free and the immobilised dy731 - bio were competing for fret which inherently led to the enhanced efficiency after the molar ratio of 20:1 . we speculate that the slow growth in the efficiency after 22 l of dy731 - bio could be the onset of effective radiative quenching by dy731 - bio . it is clear that qdot705 - stv can serve as an efficient donor if the interactions with multiple acceptors are permitted . the photophysical characteristics in qd ensembles have been correlated to decay - time fluctuations in single qds . since the measurements here were taken over an extended period of time , the intensity - dependent effect and the size dispersion in the qd ensemble have averaged out the decay lifetime . the photoluminescence decay can be considered as the collective dynamic behaviour of excited qds . the fitted lifetimes were significantly different , 30 nanoseconds and 100 nanoseconds , respectively . due to a 17 % lattice mismatch at the core - shell interface , the formation of fast response , carrier trapping states at the surface is highly probable . these surface states provide nonradiative relaxation pathways for the photoinduced electron - hole pairs . since exciton quenching by surface states usually occurs within subnanosecond times , we attribute the fast decay to carrier trapping by surface states and the slow decay to radiative recombination from the band edge . besides the qd excitonic state , surface states can also couple to dy731 - bio excited state for radiationless energy transfer provided that the surface - state energy level is within the strong absorption band of dy731 - bio . instead of taking the amplitude - weighted mean lifetime , fret generated from two separate transitions were studied independently . from figure 7 , the reduction of the long - lifetime component was less significant than that of the short - lifetime component with increasing conjugation ratio . fret from surface states was apparently more efficient than that from the band edge level . assuming that this is due to the r relation of fret , the results are consistent with the interpretation based on the biexponential decay model that the surface states are spatially nearer to labelled dy731 - bio and the band edge recombination primarily occurs within the inner core . we explored the possibility of fret in a qdot705 - stv - dy731 - bio assembly with the application of strong streptavidin - biotin binding affinity . by careful selection , we minimized the spectral crosstalk between qd donor and fluorophore acceptor emissions but maximized the spectral overlap between donor emission and acceptor absorption . fret was derived as the resultant of the quenching effect on qd steady - state fluorescence in stepwise dy731 - bio titrations . an efficiency of 70 % was easily achieved at a molar ratio of 50 acceptors to one qd owing to qd 's large surface area . we also recorded the differences in the absorptivity between dy731 - bio and dy731 - bio - stv which could be related to the structural reorientation of fluorophores when molecular complex was formed . however , no further structural studies were conducted to examine the conformation of steptavidin bound dy731 - bio . any variation in the absorption strength of conjugated acceptor can render fret less efficient than predicted , if it is based on the optical density of the noninteracting acceptor . by size exclusion filtrationlifetime measurements on the qdot705 - stv - dy731 - bio assay have further confirmed that fret can be realized despite the undesirable size of qd . however , the highest efficiency obtainable is limited by the number of streptavidin attached to qdot705 - stv .\noutput:\n" }, { "from": "agent", "value": "colloidal quantum dots ( qds ) are now commercially available in a biofunctionalized form , and frster resonance energy transfer ( fret ) between bioconjugated dots and fluorophores within the visible range has been observed . we are particularly interested in the far - red region , as from a biological perspective there are benefits in pushing to 700 nm to minimize optical absorption ( abs ) within tissue and to avoid cell autofluorescence . we report on fret between streptavidin - ( stv - ) conjugated cdte quantum dots , qdot705 - stv , with biotinylated dy731 - bio fluorophores in a donor - acceptor assay . we also highlight the changes in dy731 - bio absorptivity during the streptavidin - biotin binding process which can be attributed to the structural reorientation . for fluorescence beyond 700 nm , different alloy compositions are required for the qd core and these changes directly affect the fluorescence decay dynamics producing a marked biexponential decay with a long - lifetime component in excess of 100 nanoseconds . we compare the influence of the two qd relaxation routes upon fret dynamics in the presence of dy731 - bio ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary breast sarcomas are rare , histologically heterogenous nonepithelial malignancies that arise from the connective tissue within the breast . like soft tissue sarcomas originating in other parts of the body , breast sarcomas consist of a heterogeneous group of several subtypes : liposarcoma , fibrosarcoma , pleomorphic sarcoma , leiomyosarcoma , rhabomyosarcoma , angiosarcoma , and osteosarcoma , sarcomas of uncertain differentiation . undifferentiated pleomorphic sarcoma has been defined as a group of pleomorphic , high - grade sarcomas in which any attempt to disclose their line of differentiation has failed . it constitutes less than 5 % of all sarcomas in adults and has been rarely seen in breast . the clinical features of this rare tumor mimic those of breast carcinoma and often presents diagnostic challenges . herein , we report a case of primary undifferentiated pleomorphic sarcoma in a 76 - year - old man ; this case highlights a rare and interesting variant of primary breast sarcoma and the diagnostic difficulty that physician and pathologist may encounter with it . we report a case of spindle cell sarcoma of the breast in a 76 - year - old man . he presented to the daegu catholic university hospital with a lump in his left breast that had been present for the previous two months . he had been taking medication for hypertension and benign prostate hypertrophy and had not suffered trauma to his chest wall . further , he had no family history of malignancy , including breast cancer . on physical examination , the patient had a poorly demarcated , mobile , firm mass in his left breast . the mass was nontender , approximately 1 cm in diameter , and was detected in the subareolar area of the left breast . there was no clinical evidence of regional lymphadenopathy , and there were no abnormal findings in the right breast . mammography revealed a dense lesion occupying the subareolar region ; this lesion was consistent with prominent fibroglandular tissue and suggested asymmetric left gynecomastia ( figure 1a ) . ultrasonography revealed a poorly demarcated and highly suspicious malignant lesion in the periareolar area of his left breast , and the lesion was categorized according to breast imaging report and data system ( birads ) as birads 4c ( figure 1b ) . he underwent ultrasound - guided core needle biopsy , which indicated the presence of atypical cells in the fibrous , proliferative lesion ( figure 2 ) . preoperative examination consisted of a complete blood count , serum kidney and liver function test , thyroid function test , and tests for the levels of several hormones related to the development of gynecomastia , including estrogen , testosterone , prolactin , and gonadotrophic hormones . the patient underwent wide excision of the lesion , including removal of normal breast tissue to provide a safety margin and he did not require subsequent axillary lymph node dissection . gross examination of the specimen revealed a whitish , fibrotic nodular lesion , measuring 1.51 cm in size including surrounding adipose tissue . were prepared and stained with haematoxylin and eosin ( h & e ) . microscopic examination of the sections from the specimen showed nodular proliferation of fibrous tissue with focal infiltrating margins ( figure 3a ) . the nodules were composed of plump to spindle - shaped fibroblasts , many lymphoplasma cells , eosinophilic infiltrate , and many keloid - like collagen bundles ( figure 3b ) . a few atypical multinuclear giant cells and pleomorphic cellsimmunohistochemical staining for desmin , smooth muscle actin ( sma ) , and s - 100 protein was negative ( figure 3c ) . these diverse histological and immunohistochemical findings established the diagnosis of atypical spindle cell lesion with uncertain malignant potential , exhibiting features of a reactive fibroblastic lesion . the patient 's progress was monitored after the operation , and no specific adjuvant treatment was administered . one year later , he returned with a recurrent mass at the previous surgical site . on physical examination , a firm mass of about 2 cm in diameter was palpated in the wound from the previous surgery . radiological studies , including computed tomography ( ct ) and positron emission tomography - ct ( pet - ct ) , were conducted , and pet - ct showed faint fluorodeoxyglucose uptake in the area of the left breast that corresponded to the lesion seen on the ct scan ( figure 4 ) . a histological assay showed that the recurrent tumor was 3.8 cm sized in diameter and had an irregular margin . on sectioning , the cut surface showed fibrous bands and lobular adipose tissue with focal congestion without necrosis . the nodules were composed of plump to spindle - shaped fibroblasts , many lymphoplasma cells , eosinophilic infiltrate , and many keloid - like collagen bundles . microscopic findings were similar to the previous histological findings ( figure 5a ) , but many atypical cells and abnormal mitotic activity ranging from 6 to 10 mitotic figures per 10 high power fields ( hpf ) were noted and the resected margins were involved with the tumor ( figure 5b , c ) . based on the rapid recurrence of the mass , increase in tumor size , high degree of cellularity , presence of atypical cells , many abnormal mitotic figures , and infiltrating growth pattern , malignancy was indicated . the immunohistochemical staining for cd34 showed focal positivity ; however , the cells were not reactive for other immunomarkers including cytokeratin ( ck ) , epithelial membrane antigen ( ema ) , sma , murine double - minute protein 2 ( mdm2 ) , desmin , s - 100 protein , cd68 and anaplastic lymphoma kinase ( alk ) . these established histological features of malignant pleomorphic spindle cell tumor in addition to the immunohistochemical results demonstrated no line of differentiation and led to the diagnosis of undifferentiated pleomorphic sarcoma of the breast . due to the involvement of the resected margin , the patient underwemt simple mastectomy . primary breast sarcoma is a rare type of cancer arising from the mesenchymal tissue of the breast and represents less than 1 % of all breast malignancies . it includes a heterogeneous group of disease entities . according to the world health organization ( who ) classification , malignant fibrous histiocytoma ( mfh ) is a morphological pattern rather than a distinct clinicopathological entity . many neoplasms diagnosed as mfh previously are actually classified as pleomorphic subtypes of other sarcomas . pleomorphic mfh / undifferentiated pleomorphic sarcoma is defined as a group of pleomorphic , high - grade sarcomas showing no line of differentiation . undifferentiated pleomorphic sarcoma has been a diagnosis of exclusion following thorough sampling and critical use of ancillary diagnostic techniques . in the previous reports , it consisted of 10.5 - 24 % of all primary breast sarcomas . most undifferentiated pleomorphic sarcomas have appeared in patients who are in their sixth and seventh decade of life . neither the symptoms nor the physical findings of undifferentiated pleomorphic sarcoma of the breast present any characteristic pattern that would easily suggest the diagnosis . immunohistochemistry may be useful to distinguish primary breast sarcomas from non - mesenchymal malignant tumors and to delineate the level of differentiation of primary breast sarcomas . desmin , vimentin , smooth muscle antigen , ck , leukocyte common antigen , cd34 , hmb - 45 , sma , ema , and s - 100 protein should all be analyzed in sarcoma patients . further , they have been identified as pale fibrous and fleshy areas admixed with zones of ( cystic ) necrosis , hemorrhage , or myxoid features . microscopically , lesions exihibits cells showing marked pleomorphism admixed with bizarre giant cells , spindle cells , and variable foamy cells . a storiform growth pattern and variable chronic inflammatory cells are also common . limited data on undifferentiated pleomophic sarcoma have indicated that this neoplasm has an aggressive clinical course and high incidence of recurrence and metastasis . local surgical resection is the choice of treatment and negative margins are particularly important , although the extent of the surgery has been controversial . axillary dissection has been generally thought to be unnecessary for undifferentiated pleomophic sarcoma of the breast , since these tumors rarely metastasize via the lymphatics . the role of adjuvant chemotherapy and radiation also has been unclear . in our case , the patient was subjected to wide local excision for recurrent mass without axillary dissection and will undergo simple mastectomy due to involvement of the resected margin . differential diagnosis should include metaplastic ( saromatoid ) carcinoma , malignant phyllodes tumor , inflammatory myofibroblastic tumor ( imt ) , and myofibrosarcoma . metaplastic ( sarcomatoid ) carcinoma , also called spindle cell carcinoma , is a rare heterogeneous neoplasm generally characterized by a mixture of adenocarcinoma with dominant areas of spindle cells , squamous and other mesenchymal differentiation . the tumor shows overgrowth of the stroma in relation to the epithelial component , cellular pleomorphism with sarcomatous elements and frequent mitoses , and invasion of the surrounding tissues . the tumor can be differentiated from undifferentiated pleomorphic sarcoma by more extensive sampling for identifying epithelial component . imt is a neoplasm of myofibroblastic origin , often admixed with prominent inflammatory infiltrate consisting of lymphocytes , plasma cells , macrophages , eosinophils and histiocytes . an imt is a low - grade neoplastic lesion showing lack of atypia , hyperchromasia , and abnormal mitotic figures . immunohistochemistry of imt shows strong sma reactivity within the spindle cells frequently and occasional immunoreactivity for alk , and negative or focal positivity for pankeratin . myofibrosarcomas are malignant tumors of myofibroblasts . electron microscopy examination has been considered a gold standard for diagnosis of myofibrosarcoma , and ultrastructurally , the neoplastic cells have variable rough endoplasmic reticulum ( rer ) as well as peripheral filament bundles resembling stress fibers , collagen secretion granules and , rarely fibronectin fibrils and a fibronexus junction . most myofibrosarcomas are immunoreactive for sma and expression of ck , ema , cd34 , desmin or s100 protein is seen sporadically . although rare , benign spindle cell lesions of the breast may show malignant progression as in our case ; however , breast sarcoma may be misdiagnosed as benign spindle cell lesions such as myofibroblastoma , nodular fasciitis and fibromatosis . the histological criteria for the diagnosis of benign spindle cell neoplasms includes well - circumscribed cells , monomorphic , bland - looking spindle to oval - shaped cells , minimal to moderate cytological atypia , fascicular and / or haphazard growth pattern ; absence of epithelial and myoepithelial components ; mitotic activity of 2 or less per 10 hpf , and the absence of both atypical mitosis and necrosis . currently , it is believed that myofibroblastoma occurs mainly in older men and postmenopausal women . morphologic features of classic - type myofibroblastoma are purely mesenchymal tumor with no epimyoepithelial components , interspersed thick hyalinized collagen bundles , low mitotic count , lack of marked cytologic atypia , no atypical mitoses , and the absence of necrosis . most myofibroblastomas are typically positive to vimentin , desmin , and cd34 and immunoreactivity for sma , bcl - 2 , and cd99 is frequently obtained . nodular fasciitis is a rapidly growing lesion , which is usually subcutaneous and does not reach a large size . it consists of plump active fibroblasts and myofibroblasts arranged in short , loose and irregular bundles . nodular fasciitis is less cellular and uniform than undifferentiated pleomorphic sarcoma and does not infiltrate into surrounding tissue . fibromatosis is non - encapsulated well - differentiated fibroblastic lesion composed of relatively uniform fibroblasts and collagen forming a firm , solitary , or multinodular mass with an infiltrative growth pattern . immunohistochemically , fibromatosis exhibits positivity for sma and vimentin and negativity for ck , estrogen , progesterone and androgen receptors . in our case , the histological sections of the initially excised tumor showed nodular proliferation of fibrous tissue with focal infiltrating margins ; and it was composed of plump to spindle - shaped fibroblasts , eosinophilic infiltrates , many lymphoplasma cells , many keloid - like collagen bundles , a few atypical cells , including multinuclear giant cells and pleomorphic cells . the lack of abnormal mitosis was pointed towards a benign spindle cell lesion , and negative immunoreactivity for desmin , sma , and s - 100 protein was useful to exclude lesions with myofibroblastic components or differentiation such as myofibroblastoma , nodular fasciitis , or fibromatosis . however , the histological sections of the recurrent tumor exhibited different features compared to the initial histological findings ; it revealed increased multinucleated giant and atypical tumor cells and abnormal mitosis , and it was suggestive of malignancy . this case did not arise from the epithelial tissue but from the mesenchymal tissue of the breast , being consistent with the negative immunoreactivity for ck , ema , sma , desmin and s - 100 protein . histologic findings of many atypical cells and abnormal mitotic activity , a negative immunoreactivity for sma and alk helped to exclude imt from the differential diagnostic consideration . this case was distinguished from myofibroblastoma by negative immunoreactivity for sma , ck , ema , cd34 , desmin and s100 protein . although histological features of the recurrent mass were suggestive of a malignant pleomorphic spindle cell tumor , the immunohistochemical results failed to disclose the line of differentiate of the lesion . hence , the final diagnosis of the tumor was undifferentiated pleomorphic sarcoma . in conclusion , most breast cancers originate from the epithelium , and mesenchymal breast tumors are rarely seen , especially in men . also , undifferentiated pleomorphic sarcoma , one subtype of primary breast sarcoma has been uncommon and these lesions represent special diagnostic difficulties . herein , we reported a case of the undifferentiated pleomorphic sarcoma occurring in the male breast . initially , it was difficult to classify the lesion as undifferentiated pleomorphic sarcoma ; finally , based on histological findings and the immunohistochemical results of the tumor , we diagnosed the recurrent mass as undifferentiated pleomorphic sarcoma . in case of undifferentiated pleomorphic sarcoma of the breast , surgical excision of the tumor with adequate margins seems to be the most significant prognostic factor ; therefore , it will be necessary to treat this patient with repeated excision or simple mastectomy to prevent local recurrence and to improve his chances of survival .\noutput:\n" }, { "from": "agent", "value": "undifferentiated pleomorphic sarcoma of the breast are uncommon and often present diagnostic challenges . herein , we report a case of the undifferentiated pleomorphic sarcoma occurring in the male breast . a 76 - year - old man presented with a palpable bean - sized mass in his left breast for two months . core needle biopsy revealed the presence of atypical cells in a fibrous proliferative lesion , which was removed by wide excision . based on examination of the excised tumor , the initial pathologic diagnosis was atypical spindle cell lesion with uncertain malignant potential . one year later , the patient returned with a recurrent mass atthe previous surgical site . the mass was again surgically removed using wide excision . based on histological findings with immunomarkers , the final diagnosis was undifferentiated pleomorphic sarcoma . undifferentiated pleomorphic sarcoma of the breast can cause genuine diagnostic difficulty and appropriate immunohistochemistry is mandatory for differential diagnosis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: for in utero electroporation , timed pregnant e13 .5 cd1 mice were used ( the morning of the vaginal plug was e0 .5 ) . one l of purified dna ( 1 - 2g / l ) mixed with 0.005 % fast green was injected in utero into the lateral ventricle and electroporated into the neocortical ventricular zone according to published protocols26 . brains were pfa - fixed and vibratome - sectioned for analyses by confocal microscopy . in order to determine the spatial interaction between pten and myosinva , pc12 cells were transfected with p - mcherry - mvag and / or pten - egfp - c2 , differentiated for 2 days with ngf ( 50 ng / ml ) and fixed for flim experiments to measure frster resonance energy transfer fret . time - domain flim experiments and data analysis were performed as described previously16 . the globular domain from chick myosinva ( mvag ) was amplified by pcr ( proofstart ; qiagen ) ( primers : 5 - gccaccatgagtctgcagcatgagatcacc - 3 and 5 - gacacgtgatatgaaacccag - 3 ) and cloned into pca - ires - egfpm5 - grip , p - mcherry n1 ( clontech ) or p3xflag - cmv - 7.1 ( sigma ) . similarly , mouse cdna was used to clone the globular domain of myosinvb ( primers : 5 - atgtccaccatcaacggcattaag - 3 and ttgacttcattgagaaactccag - 3 ) and myosinvc ( primers : 5 - atgagtgctattaacggcatcaagc - 3 and 5 - ttcagtctccggagaaagccg - 3 ) into p3xflag - cmv - 7.1 . site directed mutagenesis of parental flag - mvag or mvag - iresgfp vectors were performed using the quikchange ii xl mutagenesis kit ( stratagene ) according to the manufacturer s protocols . the primers used were 5 - gggtgaaaccaacagggctgcaaaacataacatccagcattgctgatga - 3 and 5 - tcatcagcaatgctggatgttatgttttgcagccctgttggtttcaccc - 3 for the mva rkrqni mutation , and 5 - gctgcacagttgttgcaagtgcaaaacataacagatgaagatgca - 3 and 5 - gcttctgcatcttcatctgttatgttttgcacttgcaacaactgt - 3 for the mvacortices or livers from e18 rat embryos were homogenized in lysis buffer ( 50 mm tris ph 7.5 ; 150 mm nacl ; 1 % triton x-100 ; 2 m naov and 500 m naf ) containing protease inhibitors ( roche ) . immunoprecipitations were performed overnight ( 4c ) using 5g of anti - pten antibody ( a2b1 , santa cruz ) or mouse control antibody and protein - g beads ( pierce ) . after washing , beads were boiled in loading buffer and separated on 10 % sds - polyacrylamide gels , which were fixed and stained using brilliant blue g - colloidal concentrate ( sigma ) according to manufacturer s instructions . selected protein bands were isolated , processed and sequenced by proteome sciences plc . in short , after in gel trypsin digestion , samples were analysed by lc / ms / ms , the mass spectral data was processed into peak lists and searched against the swiss prot and ncbi non - redundant databases using mascot software ( matrix science , uk ) . for co - immunoprecipitation experiments , hek293 cells were transfected with different constructs using lipofectamine 2000 and anti - flag m2 affinity gel ( sigma ) was used for isolating the 3xflag - mvag complex . western blot analysis of immunoprecipitates was performed using anti - flag ( sigma ) , anti - gfp ( abcam ) or anti - pten antibodies ( santa cruz or cell signaling ) . cortices from e15 .5 dilute lethal and wildtype littermates were used to isolate total rna ( qiagen rneasy mini kit ) , which was reversed transcribed into random primed cdna ( reverse transcription kit , promega ) and served as template for all qpcr experiments . myosinva , myosinvb , myosinvc and pten mrna levels were measured relative to gapdh , pgk1 and hprt . primers for qpcr analysis of the different mrnas were ordered from qiagen ( quantitect primer assays ) , quantifast sybr green ( qiagen ) was used as a reporter for detection with the light cycler1 .0 ( roche ) . for in utero electroporation , timed pregnant e13 .5 cd1 mice were used ( the morning of the vaginal plug was e0 .5 ) . one l of purified dna ( 1 - 2g / l ) mixed with 0.005 % fast green was injected in utero into the lateral ventricle and electroporated into the neocortical ventricular zone according to published protocols26 . in order to determine the spatial interaction between pten and myosinva , pc12 cells were transfected with p - mcherry - mvag and / or pten - egfp - c2 , differentiated for 2 days with ngf ( 50 ng / ml ) and fixed for flim experiments to measure frster resonance energy transfer fret . the globular domain from chick myosinva ( mvag ) was amplified by pcr ( proofstart ; qiagen ) ( primers : 5 - gccaccatgagtctgcagcatgagatcacc - 3 and 5 - gacacgtgatatgaaacccag - 3 ) and cloned into pca - ires - egfpm5 - grip , p - mcherry n1 ( clontech ) or p3xflag - cmv - 7.1 ( sigma ) . similarly , mouse cdna was used to clone the globular domain of myosinvb ( primers : 5 - atgtccaccatcaacggcattaag - 3 and ttgacttcattgagaaactccag - 3 ) and myosinvc ( primers : 5 - atgagtgctattaacggcatcaagc - 3 and 5 - ttcagtctccggagaaagccg - 3 ) into p3xflag - cmv - 7.1 . site directed mutagenesis of parental flag - mvag or mvag - iresgfp vectors were performed using the quikchange ii xl mutagenesis kit ( stratagene ) according to the manufacturer s protocols . the primers used were 5 - gggtgaaaccaacagggctgcaaaacataacatccagcattgctgatga - 3 and 5 - tcatcagcaatgctggatgttatgttttgcagccctgttggtttcaccc - 3 for the mva rkrqni mutation , and 5 - gctgcacagttgttgcaagtgcaaaacataacagatgaagatgca - 3 and 5 - gcttctgcatcttcatctgttatgttttgcacttgcaacaactgt - 3 for the mvacortices or livers from e18 rat embryos were homogenized in lysis buffer ( 50 mm tris ph 7.5 ; 150 mm nacl ; 1 % triton x-100 ; 2 m naov and 500 m naf ) containing protease inhibitors ( roche ) . immunoprecipitations were performed overnight ( 4c ) using 5g of anti - pten antibody ( a2b1 , santa cruz ) or mouse control antibody and protein - g beads ( pierce ) . after washing , beads were boiled in loading buffer and separated on 10 % sds - polyacrylamide gels , which were fixed and stained using brilliant blue g - colloidal concentrate ( sigma ) according to manufacturer s instructions . selected protein bands were isolated , processed and sequenced by proteome sciences plc . in short , after in gel trypsin digestion , samples were analysed by lc / ms / ms , the mass spectral data was processed into peak lists and searched against the swiss prot and ncbi non - redundant databases using mascot software ( matrix science , uk ) . for co - immunoprecipitation experiments , hek293 cells were transfected with different constructs using lipofectamine 2000 and anti - flag m2 affinity gel ( sigma ) was used for isolating the 3xflag - mvag complex . western blot analysis of immunoprecipitates was performed using anti - flag ( sigma ) , anti - gfp ( abcam ) or anti - pten antibodies ( santa cruz or cell signaling ) . cortices from e15 .5 dilute lethal and wildtype littermates were used to isolate total rna ( qiagen rneasy mini kit ) , which was reversed transcribed into random primed cdna ( reverse transcription kit , promega ) and served as template for all qpcr experiments . myosinva , myosinvb , myosinvc and pten mrna levels were measured relative to gapdh , pgk1 and hprt . primers for qpcr analysis of the different mrnas were ordered from qiagen ( quantitect primer assays ) , quantifast sybr green ( qiagen ) was used as a reporter for detection with the light cycler1 .0 ( roche ) .\noutput:\n" }, { "from": "agent", "value": "the tumour suppressor pten can inhibit proliferation and migration as well as control cell growth in different cell types1 . pten functions predominately as a lipid phsophatase , converting pi ( 3,4,5 ) p3 to pi ( 4,5 ) p2 , thereby antagonizing pi3k ( phosphoinositide 3 - kinase ) and its established downstream effector pathways2 . however , much is unclear concerning the mechanisms that regulate pten movement to the cell membrane necessary for pten s activity towards pi ( 3,4,5 ) p33 - 5 . here we show a requirement for functional motor proteins in the control of pi3k signalling , involving a previously unknown association between pten and myosinv . fret measurements revealed that pten interacts directly with myosinv , dependent on pten phosphorylation mediated by ck2 and / or gsk3 . inactivation of myosinv - transport function in neurons increased cell size , which in line with known attributes of pten - loss6 , 7 - required pi3k and mtor . our data demonstrate a myosin - based transport mechanism regulating pten function , providing new insights into the signalling networks regulating cell growth ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we describe the first documented case of gallbladder agenesis where the clinical presentation was consistent with biliary colic , and radiological investigation suggested the presence of gallstones within a collapsed , fibrosed gallbladder . subsequent operative findings revealed a solitary haemangioma of the liver sited in the normal position of the gallbladder fossa but with absence of the gallbladder . a 23 - year - old female presented with intermittent episodes of nausea , vomiting , right upper quadrant abdominal pain , and occasional diarrhoea . routine haematological and biochemical investigations including full blood count profile , c - reactive protein , liver function tests ( including alanine aminotransferase , total bilirubin , - glutamyltransferase , and alkaline phosphatase ) , and amylase were unremarkable . stool culture demonstrated no abnormality , and faecal elastase was within the normal range . abdominal ultrasonography suggested a contracted gallbladder containing gallstones . on clinical review following the ultrasound examination , the patient 's pain had improved but the vomiting persisted . due to the continued vomiting , nonclassic symptoms of gallstones disease , and absence of dyspeptic symptoms , magnetic resonance cholangiopancreatography ( mrcp ) was performed . the mrcp report commented that the gallbladder was difficult to identify but appeared to be contracted ( figure 1 ( a ) ) . the common bile duct was not dilated , and there were no filling defects ( figure 1 ( b ) ) . at laparoscopy , the gallbladder and cystic duct could not be identified , either by direct vision or by the use of the intraoperative ultrasound probe . a pear - shaped haemangioma was present on the surface of segment 6 of the liver within the gallbladder fossa mimicking the gallbladder ( figure 2 ) . subsequently repeated mrcp , confirmed the absence of the gallbladder , a normal common bile duct and no change in the haemangioma . congenital anomalies of the gallbladder are numerous , and in addition to agenesis , include location in an abnormal site ( ectopic gallbladder ) hypoplasia , diverticula , duplication , heterotrophic tissue , and septation defects . agenesis of the gallbladder ( ag ) is a rare congenital anomaly of the biliary system and was first described by lemary in 1701 . the average incidence of gallbladder agenesis at birth is about 0.02 % , or 1 in 6000 live births . ag has been observed in both children and adults , with a median age of 46 at the time of diagnosis . clinical studies report a female - male ratio of 3 : 1 , while autopsy studies interestingly report an equal gender incidence . approximately 70 % of cases are thought to be isolated anomalies , and 9 % are associated with biliary atresia . the gallbladder is developed by the 4th week of gestation from the pars cystica ( caudal portion ) of the anterior diverticulum of the primitive gut . the pars cystica originates from the anterior duodenum becoming the common bile duct after rotation of the duodenum . the gallbladder is initially a hollow cord as the hollow portion of the pars cystica is obliterated by epithelial proliferation . essentially , ag is an anomaly of the development of vessels located on each side of the gallbladder bud ( sinus venosus cordis , omphaloenteric , and umbilical veins ) which may explain the association of this anomaly in 21 % of cases with cardiac , vascular , gastro - intestinal , and abdominal wall malformations observed in the multiple fetal anomaly group . ag may be inherited , with several familial cases observed , including across two generations . they identified three groups : ( 1 ) multiple fetal anomalies , the most common malformations being cardiovascular , followed by gastrointestinal and genitourinary , ( 2 ) asymptomatic cases , in which agenesis of the gallbladder was found at autopsy or laparotomy for another reason and , in some cases , there was a familial association , and ( 3 ) symptomatic cases , with the most common associated symptoms being biliary colic ( 54 % ) , dyspepsia ( 34 % ) , and jaundice ( 27 % ) . the presenting symptoms of agenesis of the gallbladder are compatible with hepatobiliary dysfunction such as right upper quadrant pain , nausea , vomiting , abnormal liver function , and jaundice , and these symptoms are found in 40 % of cases . it is believed that these symptoms are a consequence of biliary dyskinesia , but 98 % of patients report resolution of symptoms postoperatively where no formal procedure was performed other than identification of an absent gallbladder . this was the situation with our patient who did improve significantly following surgical exploration , but why this occurs remains unclear . the majority of cases in the literature have been diagnosed at laparotomy , but with the increasing use of laparoscopic surgery , case reports describing the diagnosis of gallbladder agenesis at laparoscopy are common . even with advances in imaging modalities , radiology reports are still frequently unable to be dogmatic , particularly in respect of anatomical findings , and uss often reveals what is thought to be a small , contracted gallbladder . gallbladder agenesis encountered during a surgical procedure is almost always unexpected and usually presents the clinician with a surgical dilemma . routine performance of laparoscopic cholecystectomy has produced changes in technique , and the more limited dissection and lack of tactile feedback give less information about the anatomical relationships . this often prompts the conversion to an open procedure if a gallbladder can not be found . frey emphasized the need for a thorough surgical exploration to exclude an ectopic gallbladder prior to being able to confidently confirm the diagnosis of gallbladder agenesis . recognised ectopic locations are intrahepatic , left - sided , between the leaves of the lesser omentum , retroperitoneal , retrohepatic , within the falciform ligament , retroduodenal , and retropancreatic . unfortunately , the wide distribution of these possible abnormal sites means that considerable open dissection and consequent morbidity would occur if an attempt was made to fulfill frey 's criteria rigorously . a potentially less invasive method would be to use intraoperative ultrasonography ( as was used in this case ) , which is able to give extremely clear images of all the potential ectopic sites . in cases reported in the literature , intraoperative cholangiogramis felt to be essential to exclude or confirm the presence of common bile duct stones and to complete the diagnosis . some groups recommend routine common bile duct exploration when its diameter is increased or a common bile duct stone has been found . we elected not to perform an intraoperative cholangiogram or to explore the common bile duct because of reports of iatrogenic common bile duct injury produced during the search for an absent gallbladder . in addition , the preoperative mrcp images ( which were reviewed intraoperatively ) were of good quality , and we could not identify any filling defect suggesting ductal stones . if frey 's criteria are not fulfilled intra - operatively , other authors advocate post - operative ct imaging to search for a potential ectopic gallbladder and confirm the diagnosis of gallbladder agenesis . it can be extremely difficult to diagnose agenesis of the gallbladder preoperatively using routine ultrasound examination . consequently , in this era of minimally invasive surgery , it is important that clinicians should keep this rare condition in mind when the gallbladder appears abnormal on preoperative imaging studies and can not be found at laparoscopy . as symptoms will improve in 98 % of cases , it is very important to avoid unnecessary intervention in patients who have a negative laparoscopy . laparoscopic exploration combined with laparoscopic ultrasonography and potentially post - operative ct or mri is helpful in establishing a definitive diagnosis of agenesis of the gallbladder . they are also to refute a putative diagnosis of ectopic gallbladder , this approach will reduce the morbidity associated with more invasive surgery . when intra - operative imaging is able to exclude an ectopic location of the gallbladder and a diagnosis of gallbladder agenesisis established , then pain will resolve in almost all cases and further investigation will be difficult to justify .\noutput:\n" }, { "from": "agent", "value": "gallbladder agenesis is uncommon . in contrast , liver haemangiomas are the most common type of benign liver lesions . we describe the first documented case of gallbladder agenesis where the clinical presentation was consistent with biliary colic , and radiological investigation suggested the presence of gallstones . subsequent operative findings revealed a solitary haemangioma of the liver sited in the normal position of the gallbladder fossa but with absence of the gallbladder . it is important that clinicians should keep gallbladder agenesis in mind when the gallbladder appears abnormal on preoperative imaging studies and can not be found at laparoscopy . as symptoms will improve in 98 % of cases , it is very important to avoid unnecessary intervention in patients who have a negative laparoscopy . the clinical presentation , investigations , and operative findings are discussed with a review of other relevant reported cases in the literature ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 31 - year - old man presented with a 1 - year history of recurrent lower lip swelling , which eventually became persistent . at the time of his physical examination , the lower lip was diffusely swollen and firm to palpation with no tenderness ( fig . , an erythematous nodular firm lesion of 5 cm by 5 cm with sparse hair was noted in his submental region ( fig . the latter appeared simultaneously with his lip swelling . the patient s other systems were otherwise clinically healthy.fig . a histopathologic examination of a biopsy specimen from the lower lip showed a lichenoid reaction , telangiectasia , and edema in the papillary dermis , as well as severe chronic lymphoplasmacytic inflammation that permeated the deep dermis and striated muscles . a subtle lichenoid reaction , dense mononuclear cell infiltration of the dermis , vasculopathy , partial destruction of skin appendages , and considerable mucinous changes were observed in the biopsy specimen of the submandibular lesion . a positive test result for lupus band ( immunoglobulin g , complement c3 , and immunoglobulin m ) was also found during direct immunofluorescence testing.fig .3 lupus erythematosus : lip biopsy that showed nodular dermal infiltration , subtle lichenoid change , and lymphocytic vasculopathy up to striated muscle [ h & e , ( a ) 30 ; ( b ) 100 ; ( c ) 100 ; ( d ) 400 ] . fig. 3 lupus erythematosus : lip biopsy that showed nodular dermal infiltration , subtle lichenoid change , and lymphocytic vasculopathy up to striated muscle [ h & e , ( a ) 30 ; ( b ) 100 ; ( c ) 100 ; ( d ) 400 ] . chest radiography , routine blood tests , and angiotensin - converting enzyme serum levels were within normal limits . ziehl - neelsen , gram , and periodic acid schiff stainings , as well as a culture and polymerase chain reaction for mycobacterium tuberculosis yielded negative test results . antinuclear antibody titer was 1:6 ( negative ) and anti - double stranded dna titer was 1:120 ( positive 1:30 ) . serum c3 and c4 levels were 118 mg / dl ( 80 - 190 mg / dl ) and 40 mg / dl ( 10 - 40 mg / dl ) , respectively . a diagnosis of chronic cutaneous lupus erythematosus ( le ) was made and treatment with hydroxychloroquine was initiated at a daily dose of 400 mg . at the time of the first post - treatment visit after 2 to 3 weeks , the patient s lip swelling and submental lesion had improved significantly ( fig .4 ) . he continued treatment with hydroxychloroquine for approximately 6 months along with the use of sun protection cream . at the time of the last follow - up visit , 2 years after the first examination , the patient was still in complete remission with no scarring.fig . 4lupus erythematous : dramatic improvement of lip swelling after a few weeks of treatment with hydroxychloroquine.fig .4 lupus erythematous : dramatic improvement of lip swelling after a few weeks of treatment with hydroxychloroquine . chronic lip enlargement or macrocheilia is a challenging problem because it not only impairs the normal daily function of the lips but can also lead to major disfigurement ( park et al . , 2008 ) . both local and systemic conditions can contribute to macrocheilia and chronic macrocheilia may even herald a systemic disease ( williams and greenberg , 1991 ) . causes of constant lip enlargement are protean and may include cheilitis granulomatosa and melkerson - rosenthal syndrome , crohn s disease , infections ( deep fungal infection , leishmaniasis , leprosy , syphilis , tuberculosis , and erysipeloid ) , sarcoidosis , glandular cheilitis , neoplasms ( non - hodgkin s lymphoma , cutaneous t - cell lymphoma , acute myeloblastic leukemia , chronic lymphocytic leukemia , hairy cell leukemia , and natural killer / t - cell lymphoma ) , fibroadenoma , oro - facial granulomatosis , silica granuloma , amyloidosis , port - wine stain , lymphangiectasia , cyclosporine usage , and ascher s syndrome ( criton et al . , 1995 , handa et al . , 2003 , . , 2013 , schulman and chu , 2014 , van der waal et al . , 2001 ) . only when these specific entities are ruled out , chronic idiopathic macrocheilia , a rare nonspecific clinical entity whereby only minor salivary gland hyperplasia without ductal ectasia is seen , should be considered ( park et al . , 2008 ) . despite this causal diversity , handa et al . ( 2003 ) recently reported on a clinicopathologic analysis of 28 patients with chronic macrocheilia and the most prevalent cause was cheilitis granulomatosa ( 13 patients ) . in addition , six patients suffered from tuberculosis of the lip and three patients had macrocheilia due to leprosy . multiple endocrine neoplasia type iib ( two patients ) , non - hodgkin s lymphoma and ascher s syndrome ( one patient each ) were other underlying causes that were identified ( handa et al . , 2003 ) . in another study , eleven patients had melkersson - rosenthal syndrome and 6 patients had an underlying cause of miescher s granuloma . sarcoidosis and crohn s disease were seen each in one patient ( khadir et al . , 2013 ) . ratzinger et al . ( 2007 ) evaluated 14 patients with cheilitis granulomatosa and found an interesting association with close to 30 % of patients diagnosed with crohn s disease . depending on the different etiologies , various treatments are available for this disfiguring condition , including oral or intralesional corticosteroids , antimalarial medications , antibiotic medications , clofazimine , thalidomide , sulfasalazine , erythromycin , azathioprine , cyclosporine , and tnf - inhibitors ( infliximab ) ( williams and greenberg , 1991 ) . reduction cheiloplasty is typically suggested for stabilized diseases ( oliver and scott , 2002 , williams and greenberg , 1991 ) . the first clinical impression for the 31 - year - old patient in our case was granulomatous cheilitis and lymphoproliferative disorders . however , repeated biopsy specimen , direct immunofluorescence , and immunohistochemistry test results were in favor of a diagnosis of le . histopathologically , granulomatous cheilitis , the most common cause of lip enlargement , is characterized by small , noncaseating histiocytic granulomas that are often seen with multinucleated giant cells . biopsy specimens that are obtained during the early stages of the disease may reveal only edema and perivascular aggregations of lymphocytes ( allen et al . . surrounding perivascular and interstitial infiltrates of lymphocytes , plasma cells , and histiocytes are also seen ( allen et al . , 1990 , worsaae et al . , 1982 ) . in this case , there was heavy inflammation that extended deeply up to the striated muscles , vascular damage , and epidermal involvement as subtle lichenoid reaction in addition to positive lupus band test results , which were all highly characteristic for le . a positive anti - double stranded dna test result despite a negative antinuclear antibody test result was unusual but did not rule out the diagnosis . clinical and paraclinical findings did not satisfy the criteria for systemic le according to the systemic lupus international collaborating clinics classification criteria ( petri et al . , 2012 ) despite the high anti - double stranded dna titer . although the diagnosis of labial le is frequently not difficult , exclusive involvement of the lips could be a clinical challenge . ( 2014 ) reviewed different aspects of lip involvement in le in a comprehensive article and concluded that the extension of le lesions from the vermilion to the skin is a distinctive feature that is frequently seen in labial le . multiple blisters along the vermilion were also considered a symptom of bullous le ( nico et al . we found only one published case of labial le that presented as macrocheilia ( mael - ainin and senouci , 2013 ) and involved a 30 - year old female patient with chronic le . seven years after the initial examination , the patient developed a painful upper cheilitis with a gradual enlargement of the lip . the biopsy specimen and antinuclear antibody test results were in favor of her underlying disease . the patient was in complete remission within 6 months of initiating treatment with 4 mg / kg / day of chloroquine and had no recurrence after one year ( mael - ainin and senouci , 2013 ) . in our patient , the histology of the lips and the submandibular lesional biopsy specimen , lupus band on direct immunofluorescence , and positive anti - double stranded dna test results along with the exclusion of other more common possible causes retained le as the etiology of this case of macrocheilia . the dramatic improvement with the introduction of hydroxychloroquine as treatment was also interesting . in conclusion ,\noutput:\n" }, { "from": "agent", "value": "macrocheilia is a challenging problem with a variety of underlying causes that are both local and systemic , and granulomatous causes underlie the majority of cases . in this study , we report on a 31 - year old man who presented with a chronic lower lip enlargement and a nodular submental erythematous lesion . he was otherwise clinically healthy . laboratory test results were within the normal limit except for a positive anti - double stranded dna test result . a diagnosis of cutaneous lupus erythematosus was made on the basis of histopathology and direct immunofluorescence . the lesions resolved dramatically after treatment with hydroxychloroquine . lupus erythematosus should be considered when examining patients who present with chronic lip swelling ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: data reported in this paper were presented at a national meeting , towards the elimination of hepatitis b : celebrating 20 years of vaccination in italy , held in milano ( 19 november 2011 ) under the high patronage of the president of the italian republic . distinguished figures from the world of italian public health as well as international experts participated and paid tribute to the work of those who had contributed to the saving of lives , prevention of suffering , and the savings made to the state . this study is a historical overview on the global impact of vaccination against hepatitis b. viral hepatitis b is a leading cause of acute and chronic liver disease , including cirrhosis and liver cancer . hepatitis b is the most effective measure to control and prevent hepatitis b and its long - term sequelae . according to the who , 179 countries have currently implemented universal vaccination programmes worldwide , and italy was one of the first countries to introduce a universal strategy of hepatitis b vaccination . on the whole , a significant reduction in newly acquired hepatitis b , carrier rate , and hepatitis b - related mortality has been observed in countries where vaccination has been implemented . in italy , universal vaccination started in infants as well as adolescents in 1991 with an outstanding record of safety and efficacy . data collected from italy and elsewhere clearly show the success of this vaccination in terms of public health since its implementation has dramatically contributed to the saving of lives , prevention of suffering , and savings to the community at large . viral hepatitis type b is still a major public health problem on a global scale . infection with hepatitis b virus ( hbv ) can progress to chronic liver disease , including cirrhosis and hepatocellular carcinoma ( hcc ) , which ranks as the third cause of cancer deaths worldwide . vaccination is the most effective measure to control and prevent hepatitis b in terms of both cost - effectiveness and benefit - cost ratios . safe and effective vaccines have been available since the early 1980s when the so - called plasma - derived vaccines were first introduced and then largely replaced by yeast - derived recombinant dna vaccines in the mid-1980s . strategies of vaccination were initially targeted toward groups at increased behavioural ( e.g. injecting drug users , sexually active homosexual men , people with multiple sexual partners ) , professional ( e.g. health - care workers ) risk of infection , to patients like haemophiliacs and those on dialysis maintenance , and to babies born to hepatitis b surface antigen ( hbsag ) positive mothers . failure of such policies of vaccination to reduce the impact of hepatitis b in the population at large led to the who recommendation that all countries introduce a policy of universal infant or adolescent ( or both if economically feasible ) hepatitis b vaccination integrated into their national immunisation programme . at present , 179 countries worldwide have so far implemented this recommendation or are planning to do . in the who european region , uk and scandinavian countries still do not advocate universal vaccination and have opted ( on economic grounds ) for targeted vaccination focussed on well - defined risk groups . globally , several hundred million vaccinations have been administered worldwide so far , with an outstanding record of safety and efficacy . local side effects are generally mild and confined to symptoms at the site of injection , while systemic reactions are uncommon . a number of case reports from france in 1998 and thereafter raised concern that hepatitis b vaccination may lead to new cases or relapses of multiple sclerosis or other neurological disorders , but no clear causal link was established . there is evidence to indicate that anti - hbs ( hepatitis b surface antibodies ) seroprotection ( concentration 10 mu / ml ) rates are close to 100 % in healthy children and over 95 % in healthy adults , and that protective antibodies are long - lasting since they may persist for at least 15 - 20 years . this means that the immunological memory outlasts antibody detection providing protection against clinical disease and the development of carrier state . thus , current evidence shows that there is no need for a booster in the general population . however , some long - term protection studies have recently shown an increasing number of people with no evidence of boostability ( failure to respond to a booster ) ; the reason for this finding and its significance should be further investigated . vaccination has been proved to reduce the incidence , carrier rates , and mortality related to hepatitis b. in taiwan , where mass vaccination of newborns was first introduced in 1984 , the hbsag carrier rates among children dropped from 9.8 % in the year prior immunisation to 0.6 % in 2004 . furthermore , the annual average incidence of hcc declined significantly after the implementation of vaccination , demonstrating that hepatitis b vaccine can prevent a major human cancer . likewise , in other hyperendemic countries such as the gambia , malaysia and alaska , vaccination has clearly proven to be very successful . on the whole , following vaccination , remarkable progress has been achieved in terms of global control and prevention of hepatitis b. however , much remains to be done to meet the who goal by overriding the economic barriers that still hamper the introduction of this vaccination in some countries with low resources and high endemicity . a vaccine against hepatitis b was first introduced in italy in 1981 for the immunisation of haemodialysis patients and their staff . in 1983 , a selective programme started using the vaccine in targeted campaigns among at - risk populations . the results encouraged a broader introduction of the vaccine and in 1988 a decree identified subjects at increased risk for hepatitis b to whom vaccination would be offered free of charge . then , in 1991 , a law was passed mandating the universal vaccination of infants and 12 - year old adolescents ( restricted to the first 12 years of the implementation of the vaccination law ) on a national scale . this programme also includes mandatory screening for hbsag of pregnant women in order to identify babies in need of treatment with hepatitis b immune globulins ( hbig ) and vaccine at birth , and recommendation for vaccination of high - risk groups free of charge . by the end of 2003 , the first infant cohort vaccinated in 1991 reached the age ( 12 years ) at which adolescent vaccination was programmed . thus , in 2004 , vaccination of 12 - year old adolescents was stopped and that of infants maintained . before the mandatory vaccination , a wealth of published epidemiological and clinical data on the national burden of the disease and those collected by the national surveillance system for acute viral hepatitis ( seieva ) prepared the ground by studiously tracking the presence of hepatitis b in the country , emphasizing the need to urgently implement control and preventive measures . take - up of the vaccine was rapid and within a few years over 95 % coverage was consistently reported . today , some 17 million young people are immune against hepatitis b and their immunity has been shown to be long - lasting . data collected prior - and post - vaccination by seieva , clearly show that rates of hepatitis b virus infection fell dramatically . although the decline in incidence of hepatitis b had started before the mandatory introduction of the vaccine as a result of improving socioeconomic conditions , demographic changes ( smaller families ) , better hygiene and the changes in risky behaviour resulting from anti - aids campaigns , refinement in blood screening , and adoption of universal precautions in medical settings , the vaccine ensured that the efforts made towards elimination of the disease were worthwhile . since the mandatory introduction of universal hepatitis b vaccination , the incidence of the disease has fallen from 5.1 per 100,000 inhabitants in 1991 to 0.9 cases per 100,000 in 2010 . the decline was even more remarkable in 15 - 24 - year - old individuals where incidence per 100,000 dropped from 17 to less than 0.5 in the same period of time . furthermore , prevalence of markers of hbv infection ( hbsag and / or anti - hbc ) declined dramatically after the introduction of the vaccination programme . in addition to the decline of hepatitis b , cases of hepatitis delta , which depends on the presence of the hepatitis b virus , are now rarely reported . cases of hepatitis b in vaccinated individuals have rarely been reported to seieva and they were generally confined to those who did not complete the vaccination schedule properly . infections caused by hbv - mutants , including the prototype glycine to arginine substitution g145r ( first identified in italy some 25 years ago in babies born to hbsag carrier mothers and treated at birth with hbig and vaccine ) , are very occasionally the causes of breakthrough infections in successfully vaccinated people . despite the initial concern that these s - gene mutants could evade vaccine - induced immunity and infect vaccinated people , for the moment , in 2000 , two hexavalent vaccines ( hexavac , sanofi pasteur msd and infanrix , glaxo smith kline ) were licensed in europe for vaccinating children against diphtheria , pertussis , poliomyelitis , hepatitis b , and invasive infections caused by haemophilus influenzae b. in 2005 , hexavac was suspended by the european medicines agency ( ema ) due to concerns about long - term protection against hepatitis b. no action was taken over infanrix since immunogenicity of its hepatitis b component did not raise equal concern . until suspension , approximately 10 million doses of hexavac had been distributed globally , of which almost 90 % were used for immunisation of infants in germany , austria , and italy . so the crucial question was whether infants vaccinated with hexavac were protected or required a booster vaccination to sustain immunity . a large randomised , multicentre study carried out in italy showed that five years after primary immunisation , hexavac albeit less immunogenic than infanrix , induced immune memory . therefore , it can be inferred that if such vaccinated children are exposed to hbv , the immune memory rapidly induces a vigorous anamnestic response that prevents acute disease and the development of a chronic carrier state . in other words , even children who have lost protective antibody concentrations may still maintain t - cell memory that is able to trigger anti - hbs production by b cells following activation by revaccination or by natural exposure to hbv . thus , the main message from this finding is that routine booster doses of vaccine do not seem necessary to sustain immunity in children primed with hexavalent vaccines . however , additional follow up is needed to see whether immunological memory persists during adolescence and adulthood , when risk of hbv exposure does significantly increase , or whether a booster may be needed later in life to maintain lifelong protection . our findings compare well with data reported in previously highly endemic countries ( e.g. taiwan , the gambia , alaska ) where the impact of vaccination in terms of reduction in incidence , in carrier rate , and in hbv - related mortality has been highly impressive . economic analyses show enormous benefits to the country at large as well as to individuals , and projections up to 2060 indicate that elimination of hepatitis b will have paid for itself and covered the costs of the campaigns many times over . increasing the hbv vaccination coverage in high - risk - groups , including households of hbsag carriers and immigrants coming from highly endemic countries , must be a priority . new antiviral treatments are being introduced , offering hope to the 600,000 or so people ( mainly over the fifth decade of life ) who remain carriers of hbv in the country ( compared with 2 million 20 years ago ) and those who still contract the disease . the success of italy s hepatitis b vaccination programme should pave the way for the introduction of new vaccines both nationally and in other countries , as well as reinvigorating existing campaigns against vaccine - preventable diseases .\noutput:\n" }, { "from": "agent", "value": "viral hepatitis b is a vaccine - preventable disease . vaccination has proved to be safe and highly effective in reducing the incidence , the carrier rate and hbv - related mortality on a global scale . in italy , universal vaccination against hepatitis b started in 1991 in infants as well as in adolescents , providing an outstanding record of safety and effectiveness . within a few years , over 95 % coverage was consistently reported . today , some 17 million people are immune against hepatitis b and their immunity has been shown to be long - lasting . at present , no booster is required in healthy vaccinated people to sustain protection . surveillance data from italy have shown a clear overall decline in hepatitis b among successfully vaccinated individuals . furthermore , a generation of children and young people ( at present cohorts ranging from 0 to 32 years ) is emerging with practically no markers of hbv infection . italy s vaccination programme has resulted in substantial progress towards the prevention and control of hepatitis b. the vaccination programme must continue . maintaining mandatory vaccination of infants and increasing hbv vaccination coverage in high - risk groups , including households of hbsag carriers as well as immigrants , remain a priority for the future.acknowledgmentsdata reported in this paper were presented at a national meeting , towards the elimination of hepatitis b : celebrating 20 years of vaccination in italy , held in milano ( 19 november 2011 ) under the high patronage of the president of the italian republic . distinguished figures from the world of italian public health as well as international experts participated and paid tribute to the work of those who had contributed to the saving of lives , prevention of suffering , and the savings made to the state ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: nearly half of all diabetic patients also suffer from neuropathy , the most common form being diabetic peripheral neuropathy ( dpn ) 1 . dpn is characterized by a length - related distal distribution of sensory and motor symptoms , as well as autonomic involvement2 , 3 . despite extensive research , common symptoms of dpn include pain , tingling , loss of sensation , a feeling of heat in the lower limbs , and loss of balance4 ,5,6 . dpn patients have been reported to have significantly decreased ankle movement perception and large changes in postural sway compared with normal individuals9 . it has been proposed that the loss of sensation associated with dpn contributes to impaired balance and altered gait patterns that lead to the increased risk for falling seen in dpn patients10 . however , the previously attempted therapeutic interventions targeting the peripheral nervous system in dpn patients11 suggests that other systems may be involved in the pathophysiology of this disease . although dpn has long been considered a disease of the peripheral nervous system , recent evidence has indicated central nervous system involvement12 ,13,14 . selvarajah et al. 12 reported that a reduction in spinal cord area index was correlated with dpn , suggesting that even in the subclinical stages of dpn , extensive and possibly irreversible damage of the spinal cord may occur . with this in mind , it is possible that the spinal reflex , which is critical for balance control , may be affected in dpn patients . the spinal reflex plays a critical role in group la monosynaptic projection and - motorneuron activation15 . recent studies have reported that the inhibitory or excitatory influences of the spinal reflex are highly correlated with postural sway and stability16 ,17,18,19,20 . it has been reported that balance tasks induce a decrease in ia - motorneuron communication , leading to increased levels of presynaptic inhibition ( pi ) 21 , 22 . pi is produced by primary afferent depolarization of axon terminals caused by increased cl permeability across the terminal membrane23 . furthermore , the frequency of spindle afferent feedback has been reported to increase during isometric contraction24 , actively controlled standing balance25 , and walking26 . to the authors knowledgeit was hypothesized that since spinal cord activity has been reported to be affected in dpn patients , pi may be affected as well , indicating that it plays a role in the decreased balance observed in dpn patients . the purpose of this study was to compare the differences in pi and balance in subjects with and without dpn to determine the influence of pi on balance in dpn patients . eight participants with diabetic peripheral neuropathy ( 4 males and 4 females ) were assigned to one group , and eight healthy participants ( 4 males and 4 females ) were assigned to the other group . the eight participants in the diabetic group had been diagnosed with diabetic peripheral neuropathy by their family practitioners and were recruited from local hospitals , pain clinics , rehabilitation centers , and diabetic support groups in the salem and portland , oregon , areas . the exclusion criteria were participants who had sustained spinal or lower leg injuries ( hip , knee and ankle ) in the 12 months preceding the study . written informed consent was obtained from each participant before the study . the institutional review board at willamette university reviewed and approved the study . the double - leg static balance of the subjects was measured using the biodex balance system ( balance system sd ) . prior to testing , a demonstration of the proper balance posture was given , followed by a 3 - trial practice test . the proper posture consisted of an eyes - open double - leg static balance stance with the hands on the hips . once the participant was familiarized with the testing protocol , the testing session , consisting of three trials for 20 seconds each , was started . the overall stability index , presented as the deviation index ( di ) , shows the variance of foot platform displacement in degrees for all motions during the test . high scores indicate a mass amount of movement during the test , alluding to a less stable participant . ( cob ) is the reference point for a perfectly balanced state , i.e. , cob x = 0 ; cob y = 027 prior to electrode placement , the skin of the lower leg of each subject was shaved and cleaned with alcohol to reduce signal impedance . the signal was band - pass filtered online ( 10500 hz ) and collected for a 250 millisecond duration . for paired reflex depression testing , the subjects were tested while lying prone on a padded table with the ankles positioned at 90 . their faces were pointed down towards the relax pad on the table , and they were asked to relax their arms and put them at their sides and to keep their ankles dorsiflexed at the angle ( 90 degree ) directed by the examiner . to elicit and record muscle responses and stimulation intensity , an emg channel with surface electrodes ( mp100 , biopac systems inc . , santa barbara , california , usa ) and a stimulating unit ( stim100c , biopac systems ) and isolation adaptor unit ( stimsoc , biopac systems ) was used to elicit the h - reflex . for the paired reflex depression ( prd ) testing , the standardized h - reflex stimulation intensity was set up with an 80 ms delay between the first and second stimulation . a series of 10 paired reflex depression trials were completed in the dominant leg . the average change of the second h reflex relative to the first h - reflex amplitude was measured ( unconditioned / conditioned * 100 ) . dpn patients showed less pi than the normal subjects ( 4730 % vs. 7522 % , p 0.05 ) , as well as decreased balance ( 0.650.24 vs. 0.380.06 , p 0.05 ) ( table 1table 1 . differences in prd and si between the groups of dpn and healthy elderly participantsgroupsprd ( % ) sidpn46 .629.70.650.24 normal74 .722.30.380.06 prd : paired reflex depression ; si : stability index ; dpn : diabetic peripheral neuropathy ) . no significant correlation was found between pi and balance score ( r = 0.37 , p = 0.15 ) ( table 2table 2 . linear relationship between prd and si in the dpn and healthy elderly participants . the linear relationship was not statistically significant ( p = 0.15 ) no.dpnnormalprd ( % ) siprd ( % ) si140 .00.7393.300.30286.800.6324.500.30310.200.7689.00.43489.00.6682.400.43512.200.5676.700.40633.201.1390.500.40752.00.3365.300.35849.300.4376.300.50 prd : paired reflex depression ; si : stability index ; dpn : diabetic peripheral neuropathy ) . prd : paired reflex depression ; si : stability index ; dpn : diabetic peripheral neuropathy prd : paired reflex depression ; si : stability index ; dpn : diabetic peripheral neuropathydpn has been reported to cause significant impairments in diabetic patients , including loss of balance . despite this serious clinical concern , the etiology of dpn s role in loss of balance is still not well known . recently , it has been suggested that in addition to the peripheral nervous system ( pns ) , the central nervous system ( cns ) also plays a role in dpn . this was the first study to investigate the role of the spinal reflex in balance in dpn patients . the spinal mechanism was quantified through the level of pi of the spinal reflex . it was found that dpn patients possessed significantly lower pi and balance ability than normal subjects . dpn patients possessed significantly lower balance ability than normal subjects ( 0.650.24 vs. 0.380.06 , p 0.05 ) . although several previous studies have reported similar results10 , 28,29,30,31 , the etiology of this discrepancy is still not well known . based on previous literature reporting cns involvement in dpn12 ,13,14 , 32 we hypothesized that the spinal cord may influence balance in dpn patients and therefore that pi may be affected as well . dpn patients showed less pi than the normal subjects ( 4730 % vs. 7522 % , p 0.05 ) . although previous studies have conducted emg tests to detect the h - reflex in diabetic patients33 , 34 , none have measured the level of pi using a paired - reflex depression protocol . these studies revealed that the h - reflex is often not even measurable in some patients . trujillo - hernndez et al. 33 reported that the h - reflex was absent in 22 % of patients . similarly , marya et al. 34 reported an h - reflex abnormality consisting of either prolonged latency or complete absence in 54 % of diabetics . alternatively , many studies have investigated the influence of pi on balance in nondiabetic subjects16 , 21 , 35 , 36 . it has been reported that increased levels of pi lead to changes in postural sway21 ,22,23 , 37 . kitano et al. 21 measured pi through the h - reflex of the soleus muscle and found that pi increased by 50 % after a complex balance test . pi is an indicator of the efficacy of the spinal pathway between group ia afferent neurons and neurons17 . furthermore , presynaptic modulation of the stretch reflex allows muscle stiffness to be controlled independent of the level of activation38 . therefore , pi is functionally significant in that it is an indicator of fine motor control39 , and it is reasonable to assume that an individual with decreased levels of presynaptic modulation may experience decreased fine motor control and therefore balance . there are several possible mechanisms that may contribute to the decreased level of pi seen in dpn patients in the present study . although few studies have investigated the role of the spinal cord in dpn , several mechanisms have been suggested13 . one mechanism proposed is damage to the peripheral nervous systems resulting in secondary spinal cord shrinkage , which causes the cord to die back11 . in addition , ziegler et al. 40 suggested the subcortical lesions may be a contributing factor in the spinal cord damage in dpn patients . furthermore , postmortem studies have suggested that axonal loss , gliosis , and demyelination within the spinal cord may contribute to the cns involvement seen in dpn14 , 41 . however , these studies did not directly examine dpn patients specifically , and therefore they can only be used as the basis for speculation . this lack of research indicates that the role of the cns and spinal cord involvement in dpn needs to be examined further . when examining both dpn and normal subjects , we found a linear relationship between pi and balance ( table 2 ) . although this relationship was not significantly different between the groups , a notable trend was observed . a larger subject pool may have revealed significant results . a paired - reflex depression protocol ( prd ) this protocol has been used previously to measure pi20 , 22 , 42,43,44 . previous studies have reported that the prd is a means of objectively and reliably measuring spinal mechanisms , with a reliability index of 0.93 to 0.9720 . the 80 ms time interval negates influences of concurrent inhibition or ib inhibition that would influence the first pulse45 , and therefore the second reflex represents the true activation of the spinal reflex , or level of pi46 . pi is an important measure of the spinal mechanism because it involves the depolarization of afferent neurons by inhibitory interneurons under descending control . previous findings on the influence of descending pathways on primary afferent depolarization emphasize that the descending pathways can influence both the level of gabaa pi and effectiveness of peripheral afferent feedback of la afferents22 , 47 . additional studies have indicated that the amplitude of the h - reflex varies directly with the afferent return arriving at the ia afferent motor neuron synapse39 . since this was the first study to measure pi in dpn patients , further research is needed to further examine the role of pi in dpn . mri studies measuring the spinal cord area could provide further support for spinal cord and subsequent cns damage in dpn patients . furthermore , measuring the change in pi over time could help determine the progression of cns damage throughout the course of the disease . lastly , the influence of the metabolic effects of dpn on balance could also be investigated . it has been suggested that the metabolic changes seen in dpn ( hyperglycemia , insulin resistance , dyslipidemia , hypertension , etc . ) have a general effect on the nervous system48 , 49 and thus may play a role in spinal cord atrophy12 . therefore , determining if there is a relationship between metabolic changes and balance may also provide insight in the pathophysiology of dpn .\noutput:\n" }, { "from": "agent", "value": "[ purpose ] diabetic peripheral neuropathy can often lead to balance impairment . the spinal reflex is a mechanism that is reportedly important for balance , but it has not been investigated in diabetic peripheral neuropathy patients . moreover , inhibitory or facilitatory behavior of the spinal reflex known as presynaptic inhibition is essential for controlling postural sway . the purpose of this study was to compare the differences in as presynaptic inhibition and balance in subjects with and without diabetic peripheral neuropathy to determine the influence of presynaptic inhibition on balance in diabetic peripheral neuropathy patients . [ subjects and methods ] presynaptic inhibition and postural sway were tested in eight patients ( mean age , 586 years ) and eight normal subjects ( mean age , 597 years ) . the mean percent difference in conditioned reflex amplitude relative to the unconditioned reflex amplitude was assessed to calculate as presynaptic inhibition . the single - leg balance index was measured using a computerized balance - measuring device . [ results ] the diabetic peripheral neuropathy group showed lower presynaptic inhibition ( 4730 % vs. 7522 % ) and decreased balance ( 0.650.24 vs. 0.380.06 ) as compared with the normal group . no significant correlation was found between as presynaptic inhibition and balance score ( r = 0.37 ) . [ conclusion ] although the decreased as presynaptic inhibition observed in diabetic peripheral neuropathy patients may suggest central nervous system involvement , further research is necessary to explore the role of presynaptic inhibition in decreased balance in diabetic peripheral neuropathy patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: imaging is widely used in scientific and technological applications because of the interface it provides between vision and intuition . in particular , biological imaging is a rapidly growing field , not only in fundamental biology but also in medical science .1 recently , biomedical imaging has received enormous attention in view of its capacity to aid analysis and diagnosis through images at the molecular and cellular levels .2 as a result , a new discipline , known as molecular imaging ( mi ) has emerged , which combines molecular biology and in vivo imaging .3 the aim of mi is to monitor and measure biological processes in living subjects via spectral data . the measurement and monitoring of biological processes provides information similar to that from a biopsy , but it is noninvasive and performed in real time , thereby offering the possibility of sequential and longitudinal monitoring . the use of mi techniques permits molecular changes associated with the onset and development of pathologic states to be quantified , and the approach can provide early diagnosis and prognosis of diseases such as cancer . other applications include the evaluation of the response to therapy , and the study of biological processes in living subjects .46 traditional mi modalities include x - ray computed tomography ( ct ) , optical imaging ( oi ) , positron emission tomography ( pet ) , single - photon emission ct ( spect ) , ultrasound , and magnetic resonance imaging ( mri ) .7,8 several promising new imaging modalities , such as fluorescence - mediated tomography and photoacoustic tomography , are currently under development .9 each of these diagnostic modalities has its advantages and disadvantages . for example , mri and ct have high spatial resolution and are able to provide detailed anatomical information , but they lack sensitivity . in contrast , pet and spect are highly sensitive , but have limited resolution and can not provide anatomical information . through the development of highly specialized and efficient contrast agents , mri has evolved into a versatile technique with multiple functions and has become one of the most powerful noninvasive imaging tools in the biomedical toolbox . high resolution and excellent soft tissue contrast are its main advantages over other in vivo imaging techniques . mri relies on large magnetic fields and radio frequencies ( rfs ) , and makes use of the relaxation times of protons in mobile molecules such as water , lipids , and proteins that are present in organs at different concentrations , to produce high - resolution soft tissue anatomical images with good endogenous contrast .10 in the following sections , we review many of the most innovative approaches that have been adopted in the recent history of mri contrast agents based on nanoparticles ; mainly on superparamagnetic iron oxide nanoparticles . in this mini - review , we also include polynuclear or particulate contrast agents that are the result of progression from previous ionic agents . this is the case of the chelates of gadolinium and manganese oxide that were developed from experience with previous gd - and mn - based agents respectively . in contrast , we have excluded from this review diamagnetic chemical exchange saturation transfer ( cest ) and paramagnetic cest ( paracest ) agents , although they can be included in nanoparticulate systems such as liposomes and polymers .1113 the use of nanoparticles as imaging probes has several advantages over conventional imaging agents . loadability is one of the advantages where the concentration of the imaging agent can be controlled within each nanoparticle during the synthesis process . another advantage is the tunability of the surface of the nanoparticles that can potentially extend the circulation time of the agent in the blood or target a specific location within the body . finally , nanoparticles can act as multifunctional mi agents , since they have two or more properties that can be used simultaneously in multiple imaging techniques , and especially in mri .14 when a strong magnetic field is applied to a sample ( in clinical diagnosis , magnetic fields of 1.5 or 3 t are usually used ) , the magnetic field aligns the magnetic moments of protons in the sample , producing an equilibrium magnetization along the longitudinal axis . a rf pulse , at a resonant frequency ( 5100 mhz ) capable of transferring energy to protons , can then rotate their magnetic moments away from the longitudinal axis , in phase , to an angle called the flip angle . upon removal of the radiation , the magnetic moments of the protonsrelax to equilibrium .15 in mri , this process is repeated in a quick succession of rf pulses . the time taken by the magnetic moments to return to their original alignment with the magnetic fieldthis relaxation can be divided into two different , independent processes : 1 ) longitudinal relaxation ( characterized by the parameter t1 ) and 2 ) transverse relaxation ( characterized by the parameter t2 ) . t1 , called the spin lattice relaxation time , relates to how fast the magnetization parallel to the static magnetic field recovers after a perturbation is applied to the system . protons that relax rapidly ( short t1 ) recover full magnetization along the longitudinal axis quickly and produce high signal intensities . for protons that relax more slowly ( long t1 ) , full magnetization along the longitudinal axis is not recovered before subsequent rf pulses , and so they inherently produce a lower intensity signal .15 t2 relates to how rapidly the magnetization in the plane perpendicular to the static magnetic field loses coherence . during an rf pulse , proton nuclei spin in phase with each other , whereas after the pulse , the magnetic fields of all the nuclei interact with each other , and energy is exchanged between them . as a consequence , the nuclei lose their phase coherence and tend to spin in a random fashion .16 because t2 decay is the result of the exchange of energy between spinning protons , it is referred to as spin spin relaxation . longitudinal and transverse relaxation processes are executed independently and simultaneously , although t2 is usually much shorter than t1 , and this difference allows tissues to be differentiated .17 in most cases , the combination of the intrinsic molecular interactions of neighboring molecules and extrinsic magnetic field inhomogeneities means that the observed transverse relaxation time ( t2 * ) is even shorter than the natural t2 that would be caused by pure spinspin interactions . to eliminate external magnetic field effects and generate the real t2 - weighted images based purely on molecular interactions , a spinthis uses 90 pulses to excite the magnetization and one or more 180 pulses to refocus the spins and generate signal echoes named spin echoes .15 the endogenous mri contrast in soft tissue comes from local differences in the proton density ( water concentration ) resulting in different values of t1 and t2 . on this basis , endogenous contrast depends on the chemical and physical nature of the tissues .18 despite the relatively high quality of such images of soft tissues , in some cases there is not enough image contrast to diagnose the pathology of interest . in these circumstances , the low endogenous sensitivity can be enhanced by increasing the magnetic field ( from 3 to 7 t and beyond ) , acquiring data for longer or designing more sensitive sequences and probes . they can be small mononuclear or polynuclear paramagnetic chelates ; metalloporphyrins ; polymeric or macromolecular carriers of covalently or noncovalently bonded paramagnetic chelates ; particulate contrast agents ( including fluorinated or nonfluorinated paramagnetic micelles or liposomes ) and paramagnetic or superparamagnetic particles ( eg , iron oxides and gd - labeled zeolites ) ; diamagnetic cest polymers ; diamagnetic hyperpolarization probes ( gases and aerosols ) ; and c - labeled compounds or ions ( eg , 6 li ) .19 the main role of t1 and t2 contrast agents in mri is to shorten selectively the relaxation times of water protons in the region of interest and thus to provide better contrast for anatomical regions . contrast is enhanced when one tissue has either higher affinity for the contrast agents or higher vascularity than another . diseased tissues , such as tumors , are metabolically different from healthy tissues and have taken up the contrast agent in different ways , resulting in a contrast in mri images .19,20 t1 - weighted images illustrate anatomy well and are preferred when a clear image of the structures is required . t2 - weighted images produce good pathological information since collections of abnormal fluid appear brighter than the normal tissue background . although nearly all mri contrast agents affect both t1 and t2 , the effects of contrast agents are usually more pronounced for either t1 or t2 , leading to their categorization as either t1 or t2 contrast agents . contrast enhancement is measured by the relaxation rate ri = 1 / ti ( s ) , where i = 1 or 2 . the most important parameter for defining the efficiency of a contrast agent is its relaxivity , ri ( ri = ri / cca ( mm s ) , where cca is the analytical concentration of ion responsible for the contrast ) . the r2 / r1 ratio is also used to indicate the contrast efficiency ; the higher the ratio , the greater the efficiency of a t2 contrast agent and vice versa for a t1 contrast agent ( figure 1 ) . the relaxivity for an mri contrast agent is defined as the increase in the relaxation rate of the solvent ( water ) induced by 1 mmoll of the active ion of the contrast agent , and it is calculated according to ri , obs = [ 1ti , obs1ti , water ] / cca ( 1 ) the relaxivity is dependent on the magnetic field applied and the temperature , so it should be reported together with both these parameters . most t1 contrast agents currently available are paramagnetic complexes , while those classed as t2 contrast agents are mostly superparamagnetic iron oxides .18 the first generation of exogenous t1 contrast agents ( also called positive contrast agents ) consisted of high - spin paramagnetic metal ions such as manganese ( mn ) , iron ( fe ) , or gadolinium ( gd ) .21 these contrast agents produce hyperintense signals in t1 - weighted images . to obtain significant changes in proton relaxation and therefore a good contrast , the paramagnetic ion needs to be in close contact with the protons of the surrounding water molecules . however , owing to the toxicity associated with these cations ( eg , transient destruction of professional macrophages , exchange with endogenous calcium ions , etc ) , they are used after complexation with low - molecular - weight chelating molecules with no explicit core and surface coating . it possesses an electron spin of 7/2 and hence seven unpaired electrons promoting spin relaxation due to flipping spins and rotational motion . free gd ions are cytotoxic and are retained in liver , spleen , and bone .22 to avoid this toxicity , a chelating process is applied to gd , in which large organic molecules form a stable complex around the gd . examples of chelating compounds are diethylene - triamine - pentaacetic acid ( dtpa ) , 1,4,7,10 - tetraazacyclo - dodecane -1,4,7,10-tetraacetic acid ( dota ) , and dipyridoxyl - di - phosphate ( dpdp ) .19 the chemical structures of such t1 agents are typically characterized by neutral or anionic metal complexes of the type [ m ( h2o ) ( l ) ] or [ m ( h2o ) ( l ) ] , where m is the paramagnetic gd or mn ion , and l a macrocyclic or acyclic polyaminopolycarboxylate .23 different types of gd - containing contrast agents have been approved by the european medicines agency ( emea ) and the us food and drug administration ( fda ) ( table 1 ) for use in mri as a contrast agent to provide improved images of organs and tissues . however , although gd is regarded as safe when administered as a chelated compound , the use of some gd chelates in people with renal disease has been linked to a rare but severe complication ; the medical condition referred to as nephrogenic systemic fibrosis . for this reason , the world health organization ( who ) issued a restriction on the use of gd contrast agents , informing that these compounds were contraindicated in patients with chronic severe renal insufficiency , in those with acute renal insufficiency of any severity due to hepatorenal syndrome , or in the perioperative liver transplantation period , and in newborn babies up to 4 weeks of age .24 because of their low molecular weight , conventional gd - based contrast agents are mostly nonspecific extracellular contrast agents and exhibit rapid extravasation from the vascular space . in this way , after being intravenously injected , these agents rapidly leak from the blood pool into the interstitium with a distribution half - life ( t1 / 2 ) of about 5 min . they are mainly cleared by the kidneys with an elimination t1 / 2 of about 80 min .19 this limitation , which is inherent to mri , is known as the partial volume dilution effect , and involves a loss of apparent activity in small objects or regions because of the limited resolution of the imaging system . the partial volume dilution effect has often led to the failure of targeted contrast in vivo .25 extracellular agents are typically gd chelates of linear or macrocyclic polyaminocarboxylate ligands , and constitute the most important class of mri contrast agents available . initial attempts to target mri focused on coupling gd atoms directly to antibodies or proteins , but these approaches delivered insufficient paramagnetic material to effectively decrease local relaxation times , and provided inadequate mr signal enhancement in t1 images at typical clinical field strengths . moreover , for certain purposes such as mr angiography ( mra : a special type of mri used to study blood vessels ) the time window for contrast - enhanced images is very narrow , due to rapid extravasation , which limits the acquisition of high - resolution images . for mra , contrast agents must be blood - pool agents ( also known as intravascular contrast agents ) and are characterized by their high molecular weight ( 20 kda ) and higher relaxivities . their large size prevents diffusion through the vascular epithelium and leakage into the interstitial space , and so they reside in the vascular system for an extended period of time . thus , they are eliminated much more slowly from circulation than their extracellular counterparts , providing a larger imaging time window . examples of blood - pool contrast agents are gd - based complexes that interact noncovalently with human serum albumin , and gd chelates complexed to polymers ( eg , dextrans , polylysine derivatives , and polyamidoamines [ panam , ge healthcare institute , waukesha , wi , usa ] ) .26 to produce targeting agents , macromolecular constructs , such as liposomes , micelles , fluorinated nanoparticles , dendrimers , and polymers , have been prepared .17,25,27 the resulting nanoparticles have greater paramagnetic metal surface payloads that rotate or tumble more slowly than small - molecule organometallic compounds typically used as blood - pool agents .28 mn , with five unpaired electrons , is another cation used as a contrast agent . mn - based paramagnetic nanoparticles can be classified into two categories : small - molecule agents and nanoparticulate agents . small - molecule agents are formed by complexing mn ions with chelates such as dpdp , dtpa , or even porphyrin rings , just as gd chelates are . the fda approved , in may 1997 , a mn - based contrast agent , the injectable mangafodipir trisodium ( teslacan , st louis mo , usa ) to image the liver . however , in 2012 , the emea was notified by the marketing authorization holder responsible for telescan the decision to voluntarily withdrawl the marketing authorization in the european union .29 mn chelates can be further modified by their incorporation into lipid bilayers . such nanoparticulate systems are made of manganese oxides such as mno , mno2 , and mn3o4 . after dissolution in cells due to proteolytic degradation , these particles convert from t2 contrast agents to t1 contrast agents .30 although mn is a natural cellular constituent that resembles ca , its toxicity is also known from dust containing mn at high doses . moreover , in view of the capacity of mn to enter cells through calcium channels , mn complexes , dendritic mn chelates , and even mn nanoparticulate systems have potential applications in neuroimaging . one of the limitations of the majority of the contrast agents used , but that especially affects paramagnetic chelates , is that their efficiency decreases at higher magnetic fields . for example , gd complexes are optimal at fields below 1 t ; even at the clinical field of 3 t , the t1 relaxivity of gd - based contrast agents is reduced by as much as one - third compared with its maximum , while at higher magnetic fields , r1 falls to zero .31 moreover , for in vitro cell labeling experiments or long - term in vivo cell tracking studies , the clearance of the particles needs to be far slower , which impedes the use of gd - based chelate agents for these purposes . hence , owing to their short blood circulation times , poor detection sensitivity , and toxicity concerns , mri research has shifted to t2 contrast agents , especially to superparamagnetic iron oxide nanoparticles . t2 contrast agents ( or negative contrast agents ) decrease the mr signal intensity of the regions they are delivered to . consequently , they produce hypointense signals in t2 - and t2 * - weighted images ,32 and thus the affected regions appear darker . the phenomenon can be said to result from the large heterogeneity of the magnetic field around the nanoparticle through which water molecules diffuse , since diffusion induces dephasing of the proton magnetic moments , resulting in t2 shortening . t2 contrast agents are also called susceptibility agents because of their effect on the magnetic field . t2 shortening is a remote effect , whereas the t1 shortening process requires a close interaction between the water molecules and t1 agents , as mentioned .16 another difference with t1 contrast agents is that under high magnetic fields , r2 , the relaxation rate , tends asymptotically to a positive constant .10 iron oxide nanoparticles have been used as t2 contrast agents for more than 25 years . these iron oxides can be ferromagnetic or superparamagnetic , depending on the size of the core of the nanoparticle . two iron oxides are generally considered for biomedical applications : magnetite ( fe3o4 ) and its oxidized and more stable form of maghemite ( - fe2o3 ) . the critical upper size limit for the observation of superparamagnetism is approximately 25 nm for magnetite and 30 nm for maghemite .33 the two compounds fulfill the prerequisites of : 1 ) chemical stability under physiological conditions , 2 ) low toxicity , and 3 ) sufficiently high magnetic moments .34 since these two iron oxides exhibit superparamagnetic behavior , the loss of their net magnetization in the absence of an external magnetic field limits their tendency for self - aggregation , and this helps to obtain a good biological response .10 unfortunately , the ubiquitous van der waals forces induce natural aggregation of the particles , and to circumvent this problem , a large portfolio of chemical approaches exists that stabilize the particles . polymers are the most widely used stabilizing materials , and can be classified as hydrophilic or amphiphilic , neutral or charged , homopolymers or copolymers . the polymers can be adsorbed into or anchored onto the iron oxide surface via hydrogen bonds , electrostatic forces , or pseudo - covalent bonding . among the materials usedare poly ( ethylene glycol ) ( peg ) , dextran and its derivatives , alginate , chitosan , starch , polyvinyl alcohol , albumin , poly ( ethylene imine ) , organic siloxane , sulphonated styrene - divinyl - benzene , and bioactive molecules and structures such as liposomes .35,36 since the biological distribution of the nanoparticles is directly dependent on their size , they have been classified according to the overall size of the particles as follows : 1 ) ultra - small superparamagnetic iron oxide nanoparticles ( uspions ) with diameter ( d ) less than 50 nm , 2 ) superparamagnetic iron oxide nanoparticles ( spions ) with size of hundreds of nanometers , and , ultimately , 3 ) micron - sized particles of iron oxide ( mpio ) with a diameter higher than 1 m. 37 while the overall size of the first two classes allows them to be administered intravenously , the larger particles are usually administered orally , limiting their use to the exploration of the gastrointestinal track . there are also other formulations , such as monocrystalline iron oxide particles ( mion ) and cross - linked iron oxides ( clio ) .19 several spion formulations for intravenous or oral administration have been approved for clinical use as mri contrast agents by the emea and fda ; however , the majority of the compounds that were approved for intravenous administration have , at present , been taken off the market .38 only the spion for oral administration , gastromark ( amag pharmaceuticals , waltham , ma , usa ; ferumoxsil , silicone - coated spions ) , is currently on the market for gastrointestinal bowel marking . it is important to note that both the type of coating and its thickness affect the value of r2 , although the influence is unclear as studies report different effects . for instance , it has been reported that as the coating thickness increases , the ratio r2 / r1 decreases .39 this is due to the inner hydrophobic layer excluding water , while the outer hydrophilic peg layer allows water to diffuse within the coating zone . increasing the peg chain length leads to a reduction in r2 values , although another study has shown that when water molecules are not excluded from regions close to the spion core , r2 relaxivity increases with increased chain length .40 the overall size of the particle governs its pharmacokinetics and biodistribution . nanoparticles with a size 5.5 nm are cleared by the kidneys .41,42 spions whose overall diameter is larger than 200 nm are quickly taken up by phagocytic cells and accumulate in the monocyte phagocyte system ( mps ) , specifically in liver and spleen macrophages . when administered intravenously , approximately 80 % of the dose is found in liver and 5 % 10 % in spleen , with it having a plasma half - life of less than 10 min .16 therefore , such spions decrease the liver and spleen signal within several minutes of administration . malignant tumors or metastases have a lack of kupffer cells , and due to the negligible uptake of nanoparticles , they produce a strong contrast between normal and abnormal tissue on t2 - weighted images . uspions evade mps uptake and consequently increase their blood half - life ( 2 h ) . spions and uspions are metabolized into a soluble and nonsuperparamagnetic form of iron , which is incorporated into the normal iron pool ( eg , ferritin , hemosiderin , hemoglobin ) within a couple of days .19 as with any nanoparticle , spions can invade small solid tumors and metastatic cells thanks to passive targeting through the enhanced permeation and retention ( epr ) effect . the epr effect aids nanoparticle uptake by way of leaky vasculature , which permits particles of nanometric size ( more or less , with a hydrodynamic radius of less than 100 nm ) to cross from the vasculature into the interstitium .43 poor lymphatic drainage then aids the entrapment of particles in solid tumors . spions are used as negative contrast for liver imaging , whereas the typical application of uspions is lymph node imaging . uspions have been tested as blood - pool agents because they are readily distributed in the intravascular extracellular space . in this way , uspions are used as contrast for lymphography44 ,45 and angiography ,46,47 as a bone marrow contrast , or as a perfusion agent in brain and kidney . since biochemical epitopes of interest are often present in nanomolar or picomolar concentrations , particle relaxivities of around 1,000,000 mms are required to achieve acceptable contrast - to - noise ratios at the typical field strength .48 in this way , contrast agents that target specific tissue can increase the sensitivity by increasing the local spion concentration . to achieve such sensitivity in the nanomolar range , the surface of the spions may be modified by active targeting strategies , such as the addition of ligands that are recognized by molecular signatures of afflicted cells . polyethyleneimine ( pei ) is one of the more used ligands .49 the same group50 ,51 has reported that hyaluronic acid targeted iron oxide nanoparticles are efficient probes for targeted mri of cancer cells in vitro and xenografted tumor model in vivo . other types of ligands have been studied for the targeting of such markers including antibodies , small peptides , lectins , aptamers , engineered proteins , and protein fragments .52 for instance , uspions of less than 10 nm in hydrodynamic diameter were tested for tumor - specific mri targeting . in that study , the uspions were stabilized by 4 - methylcatechol , and a cyclic arginine glycine aspartic acid ( crgd ) peptide was coupled via the mannich reaction53 ( figure 2 ) . the peptide rgd binds the v3 - integrin , a cell adhesion molecule that is overexpressed in tumor vasculature and invasive tumor cells .54 after the administration of the rgd - nanoparticles , the tumor mri signal intensity decreased by 40 % .53 one of the largest drawbacks in using spions is related to the contrast mechanism that they generate . as mentioned , they are negative imaging agents , which produce a signal - decreasing effect . the resulting dark signal could be confused with other pathogenic conditions , and renders images of lower contrast than t1 contrasted images . moreover , the high susceptibility of t2 contrast agents induces distortion of the magnetic field on neighboring normal tissues . this distortion of the background is called a susceptibility artifact or blooming effect , and generates dark images with no background around the lesions .55 this effect prevents their clinical use in low signal body regions , in organs with intrinsic high magnetic susceptibility ( eg , lung ) , or in the presence of hemorrhagic events .56 in addition to nanoparticles whose metal core is fully based on iron oxides , other nanosystems with different magnetic cores have been introduced to improve the signal sensitivity and enhance mri diagnostics .57 since the transverse relaxivity r2 depends , apart from size , on the saturation magnetization ( ms ) , the optimization of ms is one of the most effective ways to achieve magnetic nanoparticles with high mri sensitivity . it has been reported that , owing to the higher magnetization , iron nanoparticles have a higher t2 relaxivity than analogous systems containing iron oxides .58 alloy - based nanomaterials are good candidates for developing t2 contrast agents with higher relaxivities . the substitution of one of the fe ions in an iron oxide for a different magnetic atom ( mn , zn , co , ni , etc ) produces the compounds known as ferrites ( mn - ferrite , zn - ferrite , etc ) characterized by their high ms , and this enhanced ms increases the relaxation rate . yang et al59 have reported the suitability of mn - ferrites as mri contrast agents . more pronounced contrast effects are even possible when nonmagnetic ions replace the fe ions .60 interestingly , the substitution of fe with nonmagnetic zn results in an increase in the net magnetization of the nanoparticles . ms increases with zn doping and becomes maximum with a value of x = 0.4 in ( znm ) fe2o4 ( m = mn , fe ) . for comparison , the ms of ( znmn ) fe2o4 is 175 emug magnetic atom , whereas the corresponding value for fe3o4 is 96 emug magnetic atom . the value of r2 reaches 676 mms for the zn - doped magnetic nanoparticles , and 98 mms for fe3o4 .61 other nanoparticles with potential applications in mri include gold - iron oxide ( au - fe3o4 ) nanoparticles , metallic ion nanoparticles , porous hollow fe3o4 nanoparticles , and fe - based alloy nanoparticles , such as iron cobalt ( feco ) and iron platinum ( fept ) nanoparticles . however , metallic nanoparticles are normally very reactive and are subject to fast oxidation in biological solutions . once they are coated with a layer of polycrystalline fe3o4 or a graphitic shell , these metallic nanoparticles are more stable and provide better contrast in mri . fept nanoparticles are chemically more stable than fe and feco nanoparticles , and have been shown to have great potential as contrast agents for mri and ct. 28 however , it is worth pointing out that such systems could be used for preclinical experiments , but clinical assessment of their acute and long - term toxicity is required . recently , some paramagnetic ions , such as dysprosium ( dy ) , have been proposed as good alternatives to iron oxide t2 contrast agents in high - field mri , because of their high magnetic moments .62 dy has been used as a chelate ( eg , dy - dtpa ) or as nanoparticles ( eg , dy2o3 ) .63,64 one type of dy - based nanoparticles are - nadyf4 nanoparticles ; their relaxivity has been studied at 3 and 9.4 t in nanoparticles of 5.4 , 9.8 , and 20.3 nm . it has been reported that their r2 relaxivity is 69 times greater at 9.4 t than at 3 t , and that the larger nanoparticles show higher r2 values than the smaller ones , whereas the r1 relaxivities are almost constant for the three sizes at 3 and 9.4 t. at 9.4 t , the r2 / r1 ratio is 306 for nanoparticles of 20.3 nm , 230 for those of 9.8 nm , and 106 for those of 5.4 nm . one important result of classical outer - sphere relaxation theory65 is that the r2 / r1 ratio increases with increasing particle size , and thus , smaller particles are much better t1 - shortening agents then larger ones ( figure 3 ) . as a consequence of their larger size and magnetic moments , however , a new generation of uspions , with diameters less than 10 nm , has also been reported to have excellent t1 - enhancing properties .28,66 compared with paramagnetic ions , spions have higher molar relaxivities , and , when used as blood - pool and tissue - specific agents , may offer advantages at low concentrations .67 as indicated above , spions generate dark or negative contrast at the target site with a marked blooming effect from magnetite susceptibility artifacts . moreover , for mi applications , persistent t2 * effects from circulating spions delay mri by 2472 h after injection . to overcome these limitations , specific off - resonance pulse sequences capable of generating a bright contrast in the presence of spionshave been proposed .68,69 more recently , another approach , called inversion recovery on - resonant water suppression ( iron ) - mri , has been developed to obtain a positive contrast .70 unfortunately , these techniques do not eliminate the signal loss or magnetic susceptibility artifacts , but rather exploit them to generate more easily perceived bright images of the contrast effects , often at the expense of the surrounding anatomical detail . moreover , the undesirable 2472 h delay between injection of the agent and the imaging result remains . one approach to resolve the prolonged delay between treatment and imaging has been to consider the use of microparticles of iron oxide ( mpio , size range 0.761.63 m ) , which rapidly pass into mps organs .71 however , such large iron oxide particles were prone to aggregation and rapid pulmonary entrapment , and despite the leukocyte mimicking dual homing ligand approach proposed , the potential of the approach will depend on overcoming many challenges .72,73 a more recent approach28 is the preparation of a colloidal iron oxide nanoparticle platform ( cion ) , which is achieved by embedding oleate - coated magnetite particles in a hydrophobic matrix composed of vegetal oil and partially cross - linked phospholipids . contrary to expectations , this formulation decreased t2 effects , thus allowing positive t1 - weighted contrast detection . a cion may be used to detect biosignatures via voxels at very low nanomolar densities . conventional mri contrast agents are mostly effective only in a single imaging mode : either t1 or t2 . they frequently result in ambiguities in diagnostics , especially when the biological targets are small . the combination of simultaneously strong t1 and t2 contrast effects in a single contrast agent could be a new breakthrough , since it can potentially provide more accurate mri via self - confirmation with better differentiation of normal and diseased areas . dual contrast agents would eliminate the possible ambiguity of a single - mode contrast agent when some of the in vivo artifacts are present .57 however , the production of such a contrast has proved extremely challenging .74 uspions with a core of less than 10 nm in diameter are capable of producing positive contrast in t1 - weighted images when administered in moderate concentrations .75,76 while positive t1 contrast is possible with uspions , this benefit is at the expense of their t2 effects .77,78 for this reason , mixing both types of iron oxides , spions and uspions , to form a single contrast agent could potentially be a good choice . however , an important problem arises as a consequence of the strong magnetic coupling between the t1 and t2 contrast agents when they are in close proximity : the spin lattice relaxation process of t1 contrast materials is significantly diminished . one strategy to overcome this phenomenon is the inclusion of a separation layer to modulate the magnetic coupling . to this end , micellar structures incorporating organic block copolymers , inorganic porous materials , and core shell - type inorganic materials have been considered as possible frameworks .52 for instance , a core shell - type t1t2 dual - mode nanoparticle contrast has been described , where the t1 contrast material , gd2o ( co3 ) 2 of 1.5 nm , is located on the shell so as to come into direct contact with water molecules , for high t1 contrast effects ; while the superparamagnetic t2 contrast material , mnfe2o4 of 15 nm , is located at the core , from where it induces a long - range magnetic field for the relaxation of water molecules . the two materials are separated by sio2 . by adjusting the thickness of the sio2 , as the sio2 becomes thicker , t1 quenching reduces and , concurrently , r1 increases ; while the decrease in the t2 effects is relatively weaker . when the sio2 layer is 16 nm thick , both t1 and t2 contrast effects become larger than the effects of the individual single - mode contrast effects ( figure 4 ) .79 in other studies , colloidal suspensions of fe / fe2o3 nanoparticles capable of providing both t1 - and t2 - weighted images were synthesized .80 similarly , an iron core ( with its subsequent oxidation giving a ferrite shell ) with added nickel ions to form nickel ferrite shell nanoparticle has been studied ; its surface treated with dopamine - peg to make it dispersible , and it acts as a dual - mode t1 and t2 contrast agent .81 another approach has been the addition of a gd chelate to the polymer coating of spions .82,83 this dual contrast agent efficiently reduces both t1 and t2 relaxation times and achieved a good contrast in mice for both t1 - and t2 - weighted images . this unique combination allows for the acquisition of both highly detailed t1 - and t2 - weighted images with a single imaging nanoprobe . in addition , such a contrast probe could provide enhanced t1 - weighted imaging for brain tumors . brain barrier ( bbb ) without the use of invasive techniques ,84 which limits their application in brain tumor imaging . a significant advantage of spions is their relatively large surface area , which allows for the efficient addition of biologically active moieties such as bbb - penetrating peptides for noninvasive brain tumor imaging . for several years , liposomes have been the center of interest with regard to mri probes because of their multiple advantages .85 one is their capability to encapsulate hydrophilic substances in their aqueous inner core . another advantage is their biocompatibility , understood as the quality of having no toxic or injurious effects on biological systems . both properties enable liposomes to be utilized as carriers , either for therapeutics or diagnostics in vivo . in this way , liposomes have been used to carry either gd - based contrast agents ( paramagnetic liposomes ) or fe - based contrast agents ( superparamagnetic liposomes ) . as mentioned above in thet1 contrast agents section , when administered in vivo , gd chelates rapidly diffuse into tissue and interstitial space and result in decreased lesion / vessel signal intensity and a concomitantly enhanced signal from surrounding tissues . as a result , contrast between the lesion / vessel and surrounding tissue is reduced , especially in areas where the vasculature is compromised .85 furthermore , due to the latent toxicity of gd chelates , an efficient renal clearance is highly desirable .19 however , for in vitro cell labeling experiments or long - term in vivo cell tracking studies , the clearance of the particles is required to be far lower , which impedes the use of gd chelates for these purposes , since the rapid reduction in blood concentrations of these agents limits the amount of imaging time available after injection . in this case , active targeting or cell labeling contrast agents must be used . for this , contrast agents must be able to recognize specific molecular sites ( eg , cell - specific receptors ) at the cellular membrane and to accumulate at those sites . the development of approaches that use probes capable of recognizing and imaging a specific molecular marker of a given pathological process makes diagnosis and therapy much easier . however , the main problem with approaches that use gd - based contrast agents is the low sensitivity of the resultant mri , so that to reach 50 % contrast enhancement it is necessary to have a local concentration of contrast agent of the order of 0.5 mm . to increase the payload of binding groups delivered to the target site , it is possible to use a single carrier that can bear many ligands to bind to molecular markers . liposomes can be rendered t1 mri active by the incorporation into the bilayer of gd conjugated with lipid moieties ( for instance , gddtpa cholesterol ) or by encapsulation of gd within the aqueous space ( for instance , in the form of gddtpa ) .86 as a high payload of gd - containing amphiphilic lipid can be incorporated to the bilayer , the relaxivity per particle increases spectacularly , countering the sensitivity problem .87 nevertheless , the addition of large amounts of gd alone does not guarantee a low detection limit , since negative effects on the sensitivity may result from a disproportionate increase of r2 with respect to r1 , leading to a reduction of the r1 / r2 ratio . moreover , relaxivity rates are a function of the exchange rate of the inner and outer sphere water molecules . as liposome rigidity limits the flux of water between the liposome aqueous cavity and outer bulk water , the physical state of the liposome and its content of cholesterol can modify the overall impact of the contrast agents on local tissue water relaxivity . moreover , water diffusion at the interface with the phospholipid surface is strongly influenced by the excluded volume provided by the dynamic lipid molecules and head groups .88 these facts mean that the lipid composition of liposomes influences the relaxivity produced by the contrast agents encapsulated or incorporated within them . the encapsulation of a gd chelate in conventional liposomes results in better circulation properties than those of the free gd chelate , and encapsulated gd stays in the circulating blood for longer than free gd chelate does . however , recognition by serum proteins may compromise the stability of the encapsulated gd and may thus produce leakage of the gd chelate in circulation . the leaked gd chelate can diffuse into the extravascular space and diminish the quality of the image . moreover , conventional liposomes are prone to agglomerate when they are obtained at a high lipid concentration , as is usual in these cases . if they were prepared with a low lipid concentration , the dose of liposomes required to obtain a significant signal in vivo would involve an excessively high volume of liposomal suspension . the incorporation of peg into the liposomal membrane by means of a covalent bound creates sterically stabilized liposomes ( stealth liposomes , sequus pharmaceuticals , menlo park , ca , usa ) that have longer blood persistence times . an example of paramagnetic liposomes are pegylated liposomes encapsulating gd dtpa .89,90 the relaxation characteristics of gd pegylated liposomes differ from those of free gd - dtpa . as expected , the encapsulation significantly lowers the r1 value to 1.04 mms compared with 4.0 mms for free gd - dtpa . the low relaxivity of liposomal gd is due to the limited access of the gd atoms to the bulk water molecules , because of the liposomal bilayer , which lowers the rate of water exchange between the bulk and the interior of the liposome . furthermore , if the lipid contains cholesterol , this reduces the permeability coefficient of the water molecules , leading to a greater reduction in the observed relaxivity .91 size is another factor that strongly affects relaxivity . the difference is due either to the high surface - area - to - volume ratio in small liposomes , which facilitates proton transport across the liposomal bilayer , or to the decreased time of residence of water inside smaller vesicles . as indicated , the encapsulation of a hydrophilic gd - based contrast agent in liposomes involves a reduction of the relaxivity . this loss of relaxivity is overcome by an increase in the concentration of gd in the pegylated liposomes , which results in a significant shortening of the blood relaxation time t1 . given the relaxivity problems resulting from the encapsulation of gd inside liposomes , the incorporation of gd chelates into the liposome bilayer is preferable . this approach is expected to enhance the water contact of the gd chelate , potentially leading to significantly enhanced relaxivity .86 to recognize and image a specific molecular marker of a given pathological process or state ( mi ) , such as inflammation , atherosclerosis , angiogenesis , apoptosis , or the presence of tumors , the paramagnetic liposomes are required to target specific molecular markers . targeted mi of sparsely expressed receptors in tissues , where positive contrast is preferred due to intrinsic t1 and t2 relaxation times , requires amplification strategies because of the relatively low relaxivities of t1 - reducing ions , including gd . therefore , it is advantageous to use liposomes in which a large payload of paramagnetic lipids can be incorporated into the bilayers , resulting in efficient t1 - and t2 - shortening lipidic nanoparticles . as an example , gd - dtpa - bis ( steraylamide ) was incorporated into the lipid bilayer of pegylated liposomes . then multiple human recombinant annexin a5 molecules were covalently coupled to introduce specificity for apoptotic cells . the resulting contrast agent increased the relaxation rates of apoptotic cell pellets compared with untreated control cells and apoptotic cells that were treated with nonfunctionalized nanoparticles .92 although recent research has progressed in the preparation and formulation of applications of paramagnetic liposomes for nanoparticle imaging systems , the use of liposomes as contrast agents is mainly based on superparamagnetic liposomes . mlps were the first multifunctional hybrid liposome / nanoparticle assembly , and they have received considerable attention since their introduction in 1988.93 if the superparamagnetic particles are spions , the mlps can be used as t2 contrast agents , whereas if uspions are used , the mlps produce a t1 contrast .75,77,94 the term mlp denotes several types of phospholipid iron oxide constructs with totally different properties . the original mlps consisted of iron oxide cores , upon which a single phospholipid bilayer was adsorbed . the size of such mlps is approximately 20 nm ( for a review of the original mlps , see de cuyper95 ) . another kind of mlps is extruded mlps , which consist of large unilamellar vesicles ( with diameters of the order of a few hundred nanometers ) encapsulating several small nanometer - sized water - dispersible iron oxide cores in the aqueous cavity .96,97 as an alternative to the extrusion method , encapsulation of magnetic particles can also be achieved by sonication , inverse phase evaporation , or a combination of these techniques .98100 finally , a third kind of mlps are formed via the precipitation of iron oxides in the inner space of the vesicles .101 this method has many drawbacks ( for instance , little control over the size and size distribution , and the need for large amounts of starting ferrous and ferric salts , which greatly affects the ph and the peroxidation of unsaturated phospholipids ) . it has been shown that endosomal localization of different iron oxide particles results in their degradation and reduced mr contrast , the rate of which is governed mainly by the stability of the coating .102 the encapsulation of the iron cores in pegylated liposomes affords , as indicated for paramagnetic liposomes , biological stability that improves the contrast agents . moreover , unlike in the case of spions , liposomes may have some advantages , especially in the field of theranostic agents , eg , nanoscale devices that integrate diagnostic and therapeutic functions . the versatility of lipid types and lipid conjugation permits the combination of the magnetic cores with drugs , fluorescent lipid conjugates , and ligands to design a single nanosystem that can be detected with multiple imaging techniques .103 an additional advantage of mlps over liposomes or over naked iron oxide nanoparticles is that they can be successfully targeted to body parts of interest , to tumors , for example , and their progression in the body can be followed by mri . such targeting can be achieved in two ways : 1 ) by attaching antibodies or ligands to the vesicle surface that can be selectively recognized by specific receptors present in the cells ( biological targeting ) ; 1042 ) by applying an external magnet near specific body regions where mlps can then be accumulated ( magnetic targeting ) .105 both approaches allow a reduction in the total number of targeted nanoparticles used compared with untargeted nanoparticles . mlps have been used to combine t1 and t2 mri contrast agents in a single system to obtain bilabeled contrast agents .106,107 gd ions were anchored to the surface of mlps , with up to 500 gd ions per magnetic vesicle . figure 5 is a scheme of a multimodal particle based on a liposomal structure that allows theranostic applications . this liposome contains several individual cores ( or a cluster of cores ) of spions , and , moreover , it can enclose a drug . the presence of magnetic nanoparticles makes bioimaging possible or the generation of heat in therapeutic hyperthermia , and also magnetic targeting . the shell material is responsible for its surface properties , because of the presence of reactive moieties on the surface . in this way , peg is attached covalently to the surface of phospholipids in order to prevent aggregation and opsonization . the shell can be tuned to provide binding to molecules ; as an example , the peptide rgd is bound at the distal end of some peg chains for the purpose of targeted drug delivery . such peptides facilitate the interaction of the liposome with integrins : proteins present on the cellular surface that recognize the peptide rgd . moreover , the liposomal bilayer can contain a fluorescent probe , which permits its interaction with cells to be visualized by confocal microscopy . over the last 25 years , various nanoparticles and complexes have been studied as mri contrast agents , and several formulations have been approved for clinical use . these contrast agents are formed either of transition and lanthanide metals or of iron oxide nanoparticles and , more recently , ferrite nanoparticles . the transition or lanthanide metals , whose most significant representative is the ion gadolinium ( gd ) , have been extensively used as t1 contrast agents since they increase longitudinal relaxation times . a new generation of t1 contrast agents is formed by gd complexes immobilized in various nanostructured materials ( nanoporous silicas , dendrimers , perfluorocarbon nanoparticles , and nanotubes ) . iron oxide nanoparticles with overall diameters greater than 50 nm can also be used as mri contrast agents owing to their capacity to shorten t2 * relaxation times in liver , spleen , and bone marrow by selective uptake and accumulation in mps cells . iron oxide nanoparticles with diameters 50 nm have been used for lymph node imaging ; moreover , depending on the size of the iron core and their concentration , these small iron oxide nanoparticles can enhance t1 relaxation times . moreover , iron oxide nanoparticles functionalized with bioactive materials have been used for targeted imaging via the site - specific accumulation . the presence of dual - mode agents with strong t1t2 contrast effects in a single construct is very challenging , since such dual agents improve the accuracy of biomedical imaging . moreover , the development of nanomaterials that can filter the mri artifacts allows the discrimination between signals coming from contrast agents or artifacts . mlps are an example of multifunctional platforms for either multimodal imaging or simultaneous imaging and therapy . mlps can be carefully manipulated in their composition to incorporate cationic lipids , fluorescent - lipid conjugates , targeting ligands , drugs , and peg , containing all in a single nanosystem . the most notable limitations associated with the use of such contrast agents are the current detection limits and the lack of tissue specificity . current detection limits need to be improved for the successful translation of nanoparticles to in vivo applications . these limitations have been overcome by recent developments in both mri acquisition methods and postsynthesis modification of nanoparticles .\noutput:\n" }, { "from": "agent", "value": "magnetic resonance imaging ( mri ) has become one of the most widely used and powerful tools for noninvasive clinical diagnosis owing to its high degree of soft tissue contrast , spatial resolution , and depth of penetration . mri signal intensity is related to the relaxation times ( t1 , spin lattice relaxation and t2 , spin spin relaxation ) of in vivo water protons . to increase contrast , various inorganic nanoparticles and complexes ( the so - called contrast agents ) are administered prior to the scanning . shortening t1 and t2 increases the corresponding relaxation rates , 1 / t1 and 1 / t2 , producing hyperintense and hypointense signals respectively in shorter times . moreover , the signal - to - noise ratio can be improved with the acquisition of a large number of measurements . the contrast agents used are generally based on either iron oxide nanoparticles or ferrites , providing negative contrast in t2 - weighted images ; or complexes of lanthanide metals ( mostly containing gadolinium ions ) , providing positive contrast in t1 - weighted images . recently , lanthanide complexes have been immobilized in nanostructured materials in order to develop a new class of contrast agents with functions including blood - pool and organ ( or tumor ) targeting . meanwhile , to overcome the limitations of individual imaging modalities , multimodal imaging techniques have been developed . an important challenge is to design all - in - one contrast agents that can be detected by multimodal techniques . magnetoliposomes are efficient multimodal contrast agents . they can simultaneously bear both kinds of contrast and can , furthermore , incorporate targeting ligands and chains of polyethylene glycol to enhance the accumulation of nanoparticles at the site of interest and the bioavailability , respectively . here , we review the most important characteristics of the nanoparticles or complexes used as mri contrast agents ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the growth of protein structures in the protein data bank ( pdb ) and expansion of our understanding of protein physical properties are constantly enhancing our ability to predict structural and functional features . we have contributed three such methods : wesa for predicting the solvent accessibility of amino acids from a protein sequence ( 1 ) , cons - ppisp for predicting interface residues from the structure of a protein which binds a second protein ( 2,3 ) , and displar for predicting interface residues from the structure of a protein which binds dna ( 4 ) . both wesa and displar were found to have higher prediction accuracy than competing methods ( 1,4 ) . cons - ppisp was shown to be able to complement experimental techniques such as nmr chemical shift perturbation in mapping protein protein interfaces ( 3 ) . the methods have found uses in protein structure prediction ( 5 ) and in docking of protein complexes ( 6 ) . for wide access to them , here we describe the functionality of the web servers and illustrate their utility by a structural model , built from predictions of the web servers , for a multicomponent protein dna complex . the web servers are components of pipe , the protein interface / interior prediction engine , located at http://pipe.scs.fsu.edu . together , they serve as a pipeline from protein sequences to tertiary structures , then onto quaternary structures of binary complexes , and finally onto superstructures of functioning , multicomponent complexes . the input in each case consists of data for a list of residues . in wesa , sequential neighbors on the left and on the right . in both cons - ppisp and displar , the input data in wesa are sequential profiles , as given by the position - specific scoring matrix produced by psi - blast ( 7 ) . in cons - ppisp and displar , solvent accessibilities ( defined as percentages of exposed surface areas of residues ) the dataset of wesa was comprised of 2148 proteins chains with sequence identity 25 % . for cons - ppisp , the dataset was comprised of 1256 protein chains that form either heterodimers ( involving 458 chains ) or homodimers ( accounting for the remaining 798 chains of the dataset ) . for displar , the dataset was comprised of 264 protein multimers that form complexes with dna in their pdb entries . the three protein lists can be downloaded at http://pipe.scs.fsu.edu . to illustrate why the prediction methods work , in figure 1 we show the distributions of the 20 types of amino acids in interior and surface regions of folded proteins , and in interface and non - interface portions of protein surfaces that bind proteins or dna . expectedly non - polar amino acids show preference for the interior whereas polar and charged residues for the surface . non - polar amino acids similarly ( albeit less prominently ) prefer interfaces of protein protein complexes . on the other hand , protein dna interfaces appear to be more dictated by electrostatic complementarity ( instead of hydrophobicity ) , with positively charged arginine and lysine significantly enriched while negatively charged aspartate and glutamate significantly depleted in the interfaces . figure 1 . percentages of the 20 types of amino acids in ( a ) interior and surface regions of folded proteins , ( b ) interface and non - interface portions of protein surfaces in protein protein complexes , and ( c ) interface and non - interface portions of protein surfaces in protein dna complexes . in each plot , the amino acids are ordered according to the difference between the two contrasting groups . interior ( or surface ) residues were those with ( or ) 20 % solvent accessibilities ; interface residues were those with a heavy atom that is 5 from a heavy atom across a protein protein or protein dna interface . percentages of the 20 types of amino acids in ( a ) interior and surface regions of folded proteins , ( b ) interface and non - interface portions of protein surfaces in protein protein complexes , and ( c ) interface and non - interface portions of protein surfaces in protein dna complexes . in each plot , the amino acids are ordered according to the difference between the two contrasting groups . interior ( or surface ) residues were those with ( or ) 20 % solvent accessibilities ; interface residues were those with a heavy atom that is 5 from a heavy atom across a protein protein or protein dna interface . another feature , captured by sequence profiles , that distinguishes interior from surface and interface from non - interface is sequence conservation . for structural and functional reasons , interior and interface positionssuch a trend is indeed shown through a comparison in conservation scores between interior and surface positions and between interface and non - interface positions ( supplementary figure 1 ) . in addition to sequence profiles , cons - ppisp and displar also use solvent accessibilities as part of the input . in protein protein complexes , interface positions consistently have higher solvent accessibilities than non - interface positions . on the other hand , in proteindna complexes , positively charged arginine and lysine have higher solvent accessibilities in interface positions than in non - interface positions , but negatively charged aspartate and glutamate show the opposite tendency ( supplementary figure 2 ) . both cons - ppisp and displarwesa is a metamethod , based on a weighted ensemble of five separate methods , one of which is neural network training . further details on the implementations of the methods can be found in the original papers ( 14 ) . wesa has consistently shown a two - state ( interior / surface ) prediction accuracy 80 % . once there , the user is asked to provide the sequence , in fasta format , of the protein on which solvent accessibility is predicted . in addition , the user is asked to type in a unique identifier , at the user 's choice , for referencing the particular wesa submission , and an e - mail address , for receiving the prediction . a link ( http://pipe.scs.fsu.edu/output_wesa.txt ) also provides a sample output ( obtained from submitting the sequence of pdb entry 1who ) , with explanations for the columns of numbers for each residue . in short , for each residue in the sequence , the results predicted by five separate methods and the wesa metamethod are given as 1 for exposed or 0 for buried , along with the prediction confidence ( ranging from 0.00 for no confidence at all to 1.00 for full confidence ) . two figures displaying the actual and wesa - predicted buried residues of 1who are found at the web server . the direct web link for the cons - ppisp web server is http://pipe.scs.fsu.edu/ppisp.html . the protein structure , on which an interface prediction is to be made , in addition , the user must specify the chain ( s ) in the structure to be used for prediction . ( 1 ) the pdb file does not have chain i d ; _ is to be entered . ( 2 ) the pdb file has a single chain i d ( say a ) , or , it has multiple chains but only a single chain is to be used for prediction ; a must be entered . ( 3 ) multiple chains ( e.g. a , b and c ) in a pdb file are to be treated as a single structure and used together for interface prediction ; the user must enterinput and output formats are very similar to cons - ppisp predictions . for convenience of using the web servers , the scripts allow the user to submit multiple jobs by a unix command from his / her terminal , as if the prediction programs are installed on the local computer . in reality the scripts upload the sequences or pdb files to the pipe web servers . the predictions are run at the servers , and results are sent back to the local computer and saved in files specified by the scripts . we now present interface residues predicted by the cons - ppisp and displar web servers to illustrate their utility . first , results are given for three proteins that competitively bind proteins and dna and have unbound structures in the pdb . next , predictions for a protein that simultaneously binds dna and another protein are given , and the results are used to build structures for the proteinfull lists of predicted interface residues for the proteins are given in supplementary table s1 . figure 2a displays the cons - ppisp predictions for the ribonuclease barnase , in reference to the structure of the complex with its inhibitor , barstar ( pdb entry 1brs ) . as shown in figure 2b , the 27 predicted interface residues are concentrated around the binding site for a tetradeoxynucleotide , d ( cgac ) ( as defined in 1brn ) . six residues ( i55 - s57 , r59 , y97 and y103 ) are common in the two sets of predictions . it is of interest to note that cons - ppisp predicted two clusters on the unbound structure of barstar ( 1bta ) , one is in the actual interface with barnase ( shown in figure 2a ) and the other defines an unknown binding site . displar did not make any positive predictions on 1bta , which is not expected to bind dna . figure 2 . predictions of residues in ( a ) barnase barstar and ( b ) barnase dna interfaces by cons - ppisp and displar , respectively , shown on the x - ray structures of the complexes ( 1brs and 1brn ) . predictions were made on unbound structures ( 1a2p for barnase and 1bta for barstar ) . barnase is shown in surface , with predicted interface residues in blue and the rest of the surface in yellow . barstar and d ( cgac ) are shown as red sticks ; side chains of barstar residues predicted in the interface with barnase are shown as green sticks . predictions of residues in ( a ) barnase barstar and ( b ) barnase dna interfaces by cons - ppisp and displar , respectively , shown on the x - ray structures of the complexes ( 1brs and 1brn ) . predictions were made on unbound structures ( 1a2p for barnase and 1bta for barstar ) . barnase is shown in surface , with predicted interface residues in blue and the rest of the surface in yellow . barstar and d ( cgac ) are shown as red sticks ; side chains of barstar residues predicted in the interface with barnase are shown as green sticks . we applied cons - ppisp to the tumor repressor p53 core domain ( 2fej ) . in figure 3a , the predictions are displayed on the structure of p53 in complex with either 53bp1 or 53bp2 ( 1gzh or 1ycs ) . the five predicted residues ( n239 - m243 ) lie in the interfaces with the p53 - binding proteins . a second cluster of 22 residues ( listed in supplementary table 1 ) was also predicted ; many of these residues are found in the dimerdimer interface of a tetramer of the p53 core domain bound to dna ( 8 ) . some of these residues are also implicated in the binding with the e6 / e6 - ap complex ( 9 ) . these also lie in the interface with dna ( as found in 1tsr ) ( figure 3b ) . cons - ppisp predicted residues are close to some of the displar predicted residues , but no residue was predicted by both methods . figure 3.protein - contacting and dna - contacting residues predicted by cons - ppisp and displar , respectively , on the p53 core domain . predictions were made on the unbound structure of p53 ( 2fej ) but are displayed on the bound ( a ) protein protein and ( b ) protein dna ( 1tsr ) complexes . p53 is shown as surface , with predicted residues in blue and the rest of the surface in yellow . in ( a ) the structures of the complexes of p53 with 53bp1 ( 1gzh ) and 53bp2 ( 1ycs ) , after superimposing p53 , are shown , with 53bp1 and 53bp2 as purple and red sticks , respectively . protein - contacting and dna - contacting residues predicted by cons - ppisp and displar , respectively , on the p53 core domain . predictions were made on the unbound structure of p53 ( 2fej ) but are displayed on the bound ( a ) protein protein and ( b ) protein dna ( 1tsr ) complexes . p53 is shown as surface , with predicted residues in blue and the rest of the surface in yellow . in ( a ) the structures of the complexes of p53 with 53bp1 ( 1gzh ) and 53bp2 ( 1ycs ) , after superimposing p53 , are shown , with 53bp1 and 53bp2 as purple and red sticks , respectively . the two - component transcriptional activator phob regulates its dna - binding activity through transiently forming a domain domain complex , thereby blocking the dna - binding site . we used cons - ppisp to predict interface residues on the unbound structures of both the effector and receiver domains ( 1qqi and 1b00 ) . the structure for full - length phob is not available , but we found the structure ( 1ys6 ) for a close homolog , prra , in the pdb . the root - mean - square deviations ( rmsd ) of 1qqi and 1b00 from the corresponding domains in 1ys6 are 2.4 and 2.1 , with sequence identities over aligned positions at 35 and 41 % , respectively . when 1qqi and 1b00 are aligned onto 1ys6 , the 23 and 21 predicted residues on the two respective domains indeed mostly line the interface as modeled on 1ys6 ( figure 4a ) . displar predicted 25 residues on 1qqi , which are located in the actual interface between the effector domain and dna ( as found in 1gxp ) ( figure 4b ) . the binding sites for the receiver domain and dna on the effector domain ( 1qqi ) overlap , and eight residues ( r68 , t69 , d71 , h73 and v93 - t96 ) were predicted by both cons - ppisp and displar . no dna - contacting residues were predicted by displar on the receiver domain ( 1b00 ) , which is not known to binding dna . figure 4 . ( a ) predicted protein - contacting residues on the effector and receiver domains of phob . the two domains are shown as yellow and green ribbons , respectively ; side chains of predicted residues are shown as ball - and - stick . the two unbound structures ( 1qqi and 1b00 ) are superimposed to the respective domains in prra ( 1ys6 ) . ( b ) dna - contacting residues predicted on the unbound structure of the phob effector domain ( 1qqi ) and displayed on the complex with dna ( 1gxp ) . ( a ) predicted protein - contacting residues on the effector and receiver domains of phob . the two domains are shown as yellow and green ribbons , respectively ; side chains of predicted residues are shown as ball - and - stick . the two unbound structures ( 1qqi and 1b00 ) are superimposed to the respective domains in prra ( 1ys6 ) . ( b ) dna - contacting residues predicted on the unbound structure of the phob effector domain ( 1qqi ) and displayed on the complex with dna ( 1gxp ) . core binding factors ( cbf ) form a heterodimer between the and subunits , which in turn forms a ternary complex with dna . using the unbound structures of cbf and cbf ( 1eaq and 1ilf , respectively ) , we predicted interface residues between these two proteins by cons - ppisp . examined on the dimer structure of cbf and cbf ( 1e50 ) , the 20 and 23 predicted residues on the two subunits indeed line the actual interface ( figure 5a ) . previously we have used cons - ppisp predictions to drive the docking of unbound structures ( 6 ) . here we use the predictions to score docked structures , obtained by running zdock 2.3 ( 10 ) with 15 sampling . the best 200 zdock structures ( out of a total of 2000 ) were re - ranked according to the number of cons - ppisp predicted residues among the interfacial residues ( defined as having 10 - contacts across the interface ) . a structure with an rmsd of 2.2 was ranked second according to cons - ppisp predictions ( improved from zdock 's ranking of 49th ) . figure 5 . ( a ) protein - contacting residues on cbf and cbf ( as yellow and green ribbons , respectively ) , predicted on the unbound structures ( 1eaq and 1ilf ) and displayed on the dimeric complex ( 1e50 ) as ball - and - stick . ( b ) structure for the complex obtained by docking 1eaq and 1ilf and re - ranking according to predicted interface residues . ( a ) protein - contacting residues on cbf and cbf ( as yellow and green ribbons , respectively ) , predicted on the unbound structures ( 1eaq and 1ilf ) and displayed on the dimeric complex ( 1e50 ) as ball - and - stick . ( b ) structure for the complex obtained by docking 1eaq and 1ilf and re - ranking according to predicted interface residues . the dimer structure of cbf and cbf , 1e50 , was used to predict dna - contacting residues by displar . as shown in figure 6a , cbf is indeed the subunit that contacts dna in the ternary complex ( 1h9d ) , and the predicted cbf residues line the dna - binding site . we docked the dimer structure with a b - dna decamer built in insightii ( accelrys software inc . , parameters for dna nucleotides required for running zdock were taken from fanelli and ferrari ( 11 ) . a docked structure for the ternary complex , ranked 113th in zdock but improved to 11th by displar predictions , was found to have an rmsd of just 1.2 from 1h9d and is shown in figure 6b . figure 6 . ( a ) dna - contacting residues predicted on the dimeric complex of cbf and cbf ( 1e50 ) , and displayed on the ternary complex ( 1h9d ) . side chains of predicted residues , exclusively located on cbf , are shown as blue ball - and - stick . ( b ) structure for the ternary complex obtained by docking 1e50 and a modeled b - dna decamer and re - ranking according to predicted interface residues . ( a ) dna - contacting residues predicted on the dimeric complex of cbf and cbf ( 1e50 ) , and displayed on the ternary complex ( 1h9d ) . side chains of predicted residues , exclusively located on cbf , are shown as blue ball - and - stick . ( b ) structure for the ternary complex obtained by docking 1e50 and a modeled b - dna decamer and re - ranking according to predicted interface residues . the continuous growth of the sequence database ( ftp://ftp.ncbi.nlm.nih.gov/blast/db/ ) and the pdb ( http://www.rcsb.org ) will further improve the accuracy of the three prediction methods . we plan to periodically upload the ncbi the non - redundant ( nr ) onto pipe ( http://pipe.scs.fsu.edu ) . in addition , we plan to expand the datasets for the three predictors by including new entries from the pdb ; re - training will be done . the high accuracy of wesa predictions suggests that solvent accessibility is now a matured field . future methodological developments will thus focus on protein protein and protein dna interface predictions . a strategy that contributed to the success of wesa is the combination of complementary methods . we plan to combine cons - ppisp and displar with approaches based on phylogenetic tree ( 12,13 ) , surface patch characteristics ( 14 ) , secondary structure ( 15 ) , empirical scoring function ( 16 ) , support vector machine ( 1720 ) and bayesian network ( 21,22 ) . ultimately proteins need to be studied within their functioning units , which often are multicomponent protein complexes .\noutput:\n" }, { "from": "agent", "value": "the side chains of the 20 types of amino acids , owing to a large extent to their different physical properties , have characteristic distributions in interior / surface regions of individual proteins and in interface / non - interface portions of protein surfaces that bind proteins or nucleic acids . these distributions have important structural and functional implications . we have developed accurate methods for predicting the solvent accessibility of amino acids from a protein sequence and for predicting interface residues from the structure of a protein - binding or dna - binding protein . the methods are called wesa , cons - ppisp and displar , respectively . the web servers of these methods are now available at http://pipe.scs.fsu.edu . to illustrate the utility of these web servers , cons - ppisp and displar predictions are used to construct a structural model for a multicomponent protein dna complex ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: smoking was shown to result in vascular lesions and changes in some characteristics of the blood , leading to hypoxia - induced injury of various tissues , including the organ of hearing . researchers from the university of washington in seattle ( united states ) and university of melbourne ( australia ) analyzed the 19802012 data on the prevalence of cigarette smoking in 187 countries . they showed that the number of smokers older than 15 years of age increased from 721 million in 1980 to roughly one billion ( 967 million ) in 2012 . also , the total number of smoked cigarettes increased , from 4.96 billion to 6.25 billion annually . currently , the population of male and female smokers is estimated at 31 % and 6.2 % worldwide , respectively ; 30 years earlier , these were 41 % and 10 % , respectively . according to the who data from 2011 , nevertheless , 27.2 % of adults in poland smoke and mean cigarette consumption is 15.4 per day . the percentages of male and female smokers in poland are estimated at 33.6 % and 20.5 % of the adult population , respectively . the vast majority of polish smokers are individuals between 45 and 59 years of age ( 36 % ) , with 62.5 % having primary or vocational education and 43 % currently unemployed . exposure to harmful components of cigarette smoke leads to disorders of lipid metabolism and vascular endothelial dysfunction , which is reflected by enhanced atherosclerosis and increase in blood viscosity . carbon oxide present in tobacco smoke is a substrate for carboxyhemoglobin synthesis . despite markedly higher affinity than hemoglobinthe vasoconstrictive effect of nicotine results in an impairment of tissue perfusion , which may be associated with cellular dysfunction in the case of chronic exposure to tobacco smoke . according to one hypothesis , the harmful effects of tobacco smoke on hearing are associated with the toxic dysfunction of nicotinic acetylcholine receptors ( nachrs ) , a vital component of the hearing pathway . moreover , the toxic components of cigarette smoke were shown to impair the redox system , which was reflected by enhanced tissue hypoxia and injury , inter alia impairment of the active mechanisms of the outer hair cells ( ohcs ) of the cochlea . measurement of oaes is the only available non - invasive test for selective analysis of the ohc activity , enabling simple , objective , and highly sensitive functional examination of the hearing organ . the aim of this study was to analyze the sex - specific effect of cigarette smoking on the results of subjective and objective examination of hearing , namely ultra - high frequency pta , spontaneous otoacoustic emission ( soae ) , and ceoae and dpoae levels . the study included 84 healthy volunteers aged between 25 and 45 years ( mean 34 years ) , among them 41 non - smokers ( mean age 33.3 years ) and 43 smokers ( mean age 34.7 years ) . the sample comprised 46 women ( 25 non - smokers and 21 smokers ) and 38 men ( 16 non - smokers and 22 smokers ) . the group of smokers included the individuals who smoked at least 15 cigarettes per day for at least 7 years . the exclusion criteria of the study were : abnormal result of otoscopic examination , history of ear problems , conductive hearing impairment , exposure to noise and ototoxic factors , disorders of cholesterol metabolism , arterial hypertension , chronic metabolic disorders ( such as diabetes mellitus or kidney diseases ) , head injuries associated with the loss of consciousness , family history of genetic - related hearing impairment , disorders of the central nervous system , other acute or chronic systemic conditions , and abnormal body mass index ( bmi ) . mean body height of the study subjects was 172 cm ( range 155190 cm ) . the protocol of the study was approved by the local bioethics committee at the medical university of silesia ( decision no . all the experiments were conducted in accordance with the declaration of helsinki ( revision 6 , 2008 ) regarding the principles of human experimentation . written informed consents were obtained from all the participants prior to any procedure included in the study protocol . the protocol of the study included history - taking , otoscopic examination , tympanometry , pta , and the evaluation of different types of oaes . pta included air - conduction audiometry at 2508000 hz , bone - conduction audiometry at 250400 hz , and ultra - high - frequency pta at 800020000 hz . pta was performed in a sound - treated room , using an ac - 40 interacoustics audiometer . all otoacoustic emission tests ( ceoaes , dpoaes , and soaes ) were conducted with an echoport ilo292 analyzer system , version 6.0 ( otodynamics ) . prior to the test , the software automatically checked the resonance of the external ear canal and the probe sealing . ceoaes were recorded in a nonlinear mode with 80 - millisecond clicks presented at 853 db pspl and at a 50 per second rate . the responses to a total of 260 sets of clicks were averaged above the noise rejection level of 45 db . the ilo292 system averages into 2 alternate buffers : a and b. the signal is estimated from the ( a + b ) / 2 waveform , and the noise from the athe reproducibility is defined as the zero - lag correlation coefficient between the a and b buffers . ceoaes were measured within the range of 1.05.0 khz ; the overall ceoae response was analyzed . dpoaes were measured using a 2 - channel probe using the same ilo292 analyzer system . for ceoaes , a soft adapter was used to provide precise adaptation of the probe to the wall of the external ear canal . the otoacoustic emissions evoked by 2 tonal signals of different frequencies ( f1 and f2 ) in a constant relation ( f2 / f1 = 1.22 ) were recorded . the levels of primary tones were different : l1 = 71 db spl and l2 = 60 db spl ( according to neely s and gorg s formula : l1 = 44 + 0.45 l2 ) ; the tones were delivered at a constant frequency ratio f2 / f1 = 1.22 . the dp - grams for 2f1f2 were collected for the f2 frequencies of 842 hz to 7996 hz with the resolution of 4 points per octave . subsequently , dpoaes were tested at the following intensities of primary stimuli , and the distortion 2f1f2 was analyzed . dpoaes were tested as a function of dp - gram and the input / output function at l2 = 40 db spl , 45 db spl , 50 db spl , 55 db spl , 60 db spl , 65 db spl , and 70 db spl . the input / output function was analyzed at 1000 hz , 1500 hz , 2000 hz , 3000 hz , 4000 hz , 5000 hz , and 6000 hz . the ceoaes were considered present at resp 3 db spl and repro 75 % , whereas dpoaes whenever the signal - to - noise ratio ( s / n ) was higher than at 3 db , irrespective of frequency . statistical analysis was carried out with a statistica 8.0 pl package ( statsoft , united states ) . the student t - test and the mann - whitney u - test were used for the intergroup comparisons of normally and non - normally distributed / ranked variables , respectively ( non - smokers vs. smokers , female non - smokers vs. male non - smokers , female non - smokers vs. female smokers , male non - smokers vs. male smokers , and female smokers vs. male smokers ) . the bonferroni correction for the repeated measurements was applied . we did not conduct an anova ( except from ceoae repro , resp , noise ) due to the characteristics of data distribution ( lack of normality ) and their specific character ( the measurements were taken at 5 - unit intervals , up to a maximum value ) . the results of pta and ultra - high frequency pta were recorded to the nearest 5 unit of the interval scale . due to lack of normal distribution , the mann - whitney u - test was used with bonferroni correction for repeated measurements . since the results for dpoae were not distributed normally , the mann - whitney u - test was used with bonferroni correction for repeated measurements . the only variable with normal distribution was dpoae ( noise ) ; therefore , the student t - test was conducted with bonferroni correction for repeated measurements . in the case of ceoae , resp ( db ) , repro ( % ) , and noise ( db ) variables were distributed normally ; therefore , the student t - test was used to compare them . stab ( % ) was the only variable without a normal distribution ; therefore , the mann - whitney u - test was conducted . the statistical characteristics of the analyzed variables are presented as means and their standard deviations ( sd ) . smokers and non - smokers did not differ significantly in terms of their hearing thresholds at 25020000 hz . nevertheless , the smokers presented with slightly higher hearing thresholds at all the frequencies examined ( p 0.05 ) : pta thresholds at 2508000 ( figures 15 ) and pta thresholds at ultra - high frequencies ( figures 610 ) . the levels of ceoaes is smokers were always lower than in non - smokers , but most of these differences did not prove significant on statistical analysis . the only statistically significant differences in the overall ceoae levels were found when the results of male smokers were compared with those of male non - smokers ( p = 0.026 ) and female smokers ( p = 0.001 ) ( tables 15 ) . this suggests that , in contrast to smoking women , male smokers are at increased risk of functional ohc impairment . the analyzed groups did not differ significantly in terms of their dpoae levels at various frequencies , both in snr analysis and when the overall response level was considered . the only exception pertained to the level of dpoaes at f2 = 1685 hz , which was significantly lower in male smokers than in male non - smokers . irrespective of the testing conditions , no significant intergroup differences were found with regards to the background noise level . aside from significant differences between smokers and non - smokersoverall , we also found significant differences between male smokers and male non - smokers , as well as between male and female smokers . irrespective of the testing conditions , no significant intergroup differences were found with regards to the background noise level . smokers presented with significantly lower levels of dpoaes than non - smokers at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl and 45 db spl , 1500 hz + 70 db spl , 65 db spl , 60 db spl and 40 db spl , 2000 hz + 60 db spl or 55 db spl , and 3000 hz + 60 db spl , 50 db spl and 45 db spl . these findings suggest that smoking impairs both active and passive mechanisms of the cochlea , especially at lower and moderate frequencies ( 13 khz ) . compared to male non - smokers , male smokers presented with significantly lower dpoae levels in an i / o function at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl , 50 db spl , 45 db spl and 40 db spl , 1500 hz + 70 db spl and 65 db spl , 2000 hz + 70 db spl , 65 db spl , 60 db spl and 55 db spl , 3000 hz + 45 db spl and 40 db spl , and 4000 hz + 70 db spl . unlike in men , female smokers and non - smokers did not differ significantly in terms of their dpoae levels in an i / o function . comparative analysis of male and female smokers showed that the former presented with significantly lower dpoae levels in an i / o function at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl , 55 db spl , 50 db spl and 45 db spl , 2000 hz + 70 db spl , 65 db spl , 60 db spl and 40 db spl , and 5000 hz + 70 db spl , 60 db spl and 55 db spl . in contrast , male and female non - smokers did not differ significantly in terms of their dpoae levels in an i / o function . altogether , the aforementioned data suggest that smoking impairs the ohc function in men , but not in women . the results of soae analysis were consistent with the abovementioned data on dpoae levels in an i / o function . soaes were observed in 4.3 % and 25 % of male smokers and non - smokers , respectively , and in 47.6 % and 60.5 % of female smokers and non - smokers , respectively . smokers and non - smokers did not differ significantly in terms of their hearing thresholds at 25020000 hz . nevertheless , the smokers presented with slightly higher hearing thresholds at all the frequencies examined ( p 0.05 ) : pta thresholds at 2508000 ( figures 15 ) and pta thresholds at ultra - high frequencies ( figures 610 ) . the levels of ceoaes is smokers were always lower than in non - smokers , but most of these differences did not prove significant on statistical analysis . the only statistically significant differences in the overall ceoae levels were found when the results of male smokers were compared with those of male non - smokers ( p = 0.026 ) and female smokers ( p = 0.001 ) ( tables 15 ) . this suggests that , in contrast to smoking women , male smokers are at increased risk of functional ohc impairment . the analyzed groups did not differ significantly in terms of their dpoae levels at various frequencies , both in snr analysis and when the overall response level was considered . the only exception pertained to the level of dpoaes at f2 = 1685 hz , which was significantly lower in male smokers than in male non - smokers . irrespective of the testing conditions , no significant intergroup differences were found with regards to the background noise level . aside from significant differences between smokers and non - smokers overall , we also found significant differences between male smokers and male non - smokers , as well as between male and female smokers . irrespective of the testing conditions , no significant intergroup differences were found with regards to the background noise level . smokers presented with significantly lower levels of dpoaes than non - smokers at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl and 45 db spl , 1500 hz + 70 db spl , 65 db spl , 60 db spl and 40 db spl , 2000 hz + 60 db spl or 55 db spl , and 3000 hz + 60 db spl , 50 db spl and 45 db spl . these findings suggest that smoking impairs both active and passive mechanisms of the cochlea , especially at lower and moderate frequencies ( 13 khz ) . compared to male non - smokers , male smokers presented with significantly lower dpoae levels in an i / o function at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl , 50 db spl , 45 db spl and 40 db spl , 1500 hz + 70 db spl and 65 db spl , 2000 hz + 70 db spl , 65 db spl , 60 db spl and 55 db spl , 3000 hz + 45 db spl and 40 db spl , and 4000 hz + 70 db spl . unlike in men , female smokers and non - smokers did not differ significantly in terms of their dpoae levels in an i / o function . comparative analysis of male and female smokers showed that the former presented with significantly lower dpoae levels in an i / o function at the following frequencies ( f2 ) and stimulus intensities ( l2 ) : 1000 hz + 60 db spl , 55 db spl , 50 db spl and 45 db spl , 2000 hz + 70 db spl , 65 db spl , 60 db spl and 40 db spl , and 5000 hz + 70 db spl , 60 db spl and 55 db spl . in contrast , male and female non - smokers did not differ significantly in terms of their dpoae levels in an i / o function . altogether , the aforementioned data suggest that smoking impairs the ohc function in men , but not in women . the results of soae analysis were consistent with the abovementioned data on dpoae levels in an i / o function . soaes were observed in 4.3 % and 25 % of male smokers and non - smokers , respectively , and in 47.6 % and 60.5 % of female smokers and non - smokers , respectively . the effects of isolated exposure to tobacco smoke are extremely difficult to determine because smokers are frequently co - exposed to other ototoxic factors , especially in an occupational setting . moreover , the differences in male and female physiology should be considered ; namely , the potential protective effect of hormonal factors on the female hearing organ . finally , the accurate evaluation of the hearing effects requires a group of individuals with sufficiently long and extensive exposure to the components of tobacco smoke . furthermore , the selection of an appropriate method for hearing examination is an important issue since not every test is suitable for detection of changes at a subclinical level . evaluation of otoacoustic emissions is an objective and highly sensitive method for hearing assessment . the sensitivity of this test can be improved by the use of various intensities of l1 and l2 stimuli , as well as by the implementation of an input / output function . the smokers and non - smokers participating in our study did not differ significantly in terms of their results of pta at a 25020000 hz frequency range . however , despite the lack of statistically significant differences , the hearing threshold of smokers was slightly higher than in non - smokers . although the hearing threshold at a standard spectrum did not exceed 25 db hl in any of the subjects participating in this study , the smokers presented with a 210 db higher hearing thresholds than the controls . however , the smokers and non - smokers did not differ significantly in terms of their hearing thresholds at high frequencies . in contrast , paschoal and azevedo found significant differences in the audiometric hearing thresholds of smokers and non - smokers at 8 khz , 12.5 khz , and 14 khz . also , oliveira and lima showed that the individuals who smoked for at least 5 years presented with significantly higher ( albeit within a normal limit ) hearing thresholds at a standard spectrum and at high frequencies than the subjects who never smoked . however , this study involved a relatively small sample of smokers ( n = 30 ) , and its authors did not provide information about the daily number of cigarettes smoked in this group . basar and belgin examined 30 individuals with a 10 - year history of smoking at least 1 package per day and 20 non - smoking controls , and found that the former presented with significantly higher hearing thresholds solely at 16 khz and 18 khz . sousa et al . analyzed the exposure of 625 volunteers to various risk factors of hearing impairment . neither pta nor speech audiometry confirmed the role of tobacco smoking as a risk factor for this condition . the influence of tobacco smoking and noise on hearing , examined by means of tone audiometry at a standard spectrum , was also analyzed by pouryaghoub et al . ; they found that a group of 206 smokers was characterized by significantly higher hearing threshold at 4 khz when compared to 206 non - smoking controls . aside from smoking , the hearing impairment documented in some of our participants might be related to their sex , age ( up to 67 years ) , and / or exposure to noise . an important study analyzing the effect of sex on the auditory consequences of smoking was conducted by uchida et al . . they found that the results of pta at 4000 hz were significantly worse in male smokers than in male non - smokers , but a similar phenomenon was not observed in the case of female smokers and non - smokers . conducted a meta - analysis of 15 studies published between 1966 and 2003 , in order to determine the effects of cigarette smoking on the results of pta . they documented the unfavorable effect of smoking in 9 out of the 15 analyzed studies ; the lack of such an association in the remaining studies suggests that the relationship between smoking and hearing impairment is still not completely understood . previous research on click - evoked otoacoustic emissions showed that smokers present with lower ceoae levels than non - smokers . paschoal and azevedo did not observe ceoaes in 13.9 % and 2.8 % of smokers and non - smokers , respectively ( p = 0.016 ) . the levels of ceoaes do not seem to be modulated by the age of smokers . interestingly , a study of ceoaes in newborns whose mothers smoked during pregnancy demonstrated not only the functional impairment of sound perception , but also the structural abnormalities of the hearing organ . in our study , male smokers presented with significantly lower ceoae levels than male non - smokers and female smokers . to the best of our knowledge , this was the first study to demonstrate sex - specific differences in smokers ceoae levels . apart from ceoaes , we evaluated otoacoustic emissions as a dp - gram function . analyzed the dp - grams obtained using high ( l1 = l2 = 70 db spl ) and moderate ( l1 = 65 db spl , l2 = 50 db spl ) intensity of stimulation , and showed that smokers presented with significantly lower dpoae levels at all frequencies . in contrast , we used l1 = 71 db spl and l2 = 60 db spl stimulus intensities and did not document significant differences in dpoaes levels of smokers and non - smokers on most comparisons , also when adjusted for sex . torre et al . did not find a significant effect of smoking on dpoae levels ( 2.38.0 khz ) , but their results might have been confounded by selection bias , since it included subjects who smoked no longer than for 1 year , which might be an insufficient exposure to tobacco smoke . furthermore , we showed that compared to male non - smokers , male long - term smokers presented with significantly lower dpoae levels at 1685 hz ; this suggests a sex - specific effect of smoking on dpoaes . the results of our analysis of dpoaes in an input / output function , being a highly sensitive test for the active and passive mechanisms of the cochlea , are consistent with the data published by negley et al . . these authors showed that a gradual increase in the stimulation intensity ( from 20 db spl to 80 db spl , at 10 - db intervals ) is reflected by a f2 frequency - specific increase in the i / o emission , by 10 db , 8 db , and 5 db for 2 khz , 4 khz , and 8 khz , respectively . in our study , statistically significant differences between smokers and non - smokers were observed at 1 khz , 1.5 khz , 2 khz , and 3 khz . moreover , we found significant differences between male smokers and male non - smokers at 1 khz , 1.5 khz , 2 khz , 3 khz , and 4 khz , as well as between male and female smokers at 1 khz , 2 khz , and 5 khz . altogether , these findings suggest that smoking exerts particularly unfavorable effects on the cochlear ohc in men , but not in women . importantly , we showed that the incidence soaes in smokers was significantly lower than in non - smokers . , our study is the first to demonstrate sex - specific differences in ceoae , dpoae , and oae responses of smokers . using an objective method for otoacoustic emission analysis , we showed that the smoking - related alterations were more pronounced in men than in women . these sex - specific differences in otoacoustic emission levels might reflect the influence of genetic , hormonal , behavioral , and / or environmental factors . previous studies documented evident sex - specific differences in the ceoae levels of infants and children . cassidy and ditty showed that compared to male newborns , female newborns present with significantly higher ceoae levels at 1.6 khz , 2.4 khz , 3.2 khz , and 4.0 khz . demonstrated that mean ceoae levels in female neonates are higher than in male neonates ( 22.1 db spl vs. 21.4 db spl ) . interestingly , the same study documented significant differences in the ceoae levels recorded in the right and left ear ( 22.4 db spl vs. 21 db spl ) . in another study , 12 - year - old girls were shown to present with significantly higher ceoae levels than their male peers . however , in contrast to aidan et al . , the authors of this study did not observe a bilateral asymmetry in ceoae levels . although we did not reveal sex - specific differences in the otoacoustic emission levels of non - smokers , it can not be excluded that men present with a genetically determined ( i.e. , sex hormone - independent ) greater susceptibility of cochlear ohcs to the ototoxic components of tobacco smoke . the results of experimental studies point to a potential protective effect of female sex hormones as an explanation of sex - specific differences in hearing . estrogens , 17 - estradiol , 17 - estradiol , estrone , and estriol were shown to protect against gentamicin - induced outer hair cell death ; the effect of 17 - estradiol is mediated by estrogen receptor ( er ) . interestingly , the expression of estrogen receptors er and er in the inner ear ( i.e. , in the nuclei of stria vascularis , outer and inner hair cells , spiral ganglion cells , vestibular ganglion cells , and vestibular dark cells ) is known to decrease with age . these findings are consistent with the results of clinical studies . for example , kilicdag et al . demonstrated that estrogen therapy may protect against hearing loss in aging postmenopausal women . taking this evidence into account , it can be hypothesized that female sex hormones may also protect against tobacco smoke - induced hearing impairment . behavioral factors should also be considered as a potential cause of sex - specific differences in susceptibility to tobacco smoke - related hearing loss . men not only smoke more , but also use stronger cigarettes , as well as other stimulants . our study included 21 women and 22 men , who smoked at least 15 cigarettes per day for at least 7 years . we did not compare , however , the total number of cigarettes smoked by the female and male participants . consequently , our male smokers might be exposed to tobacco smoke more often and for a longer period of time than female smokers . finally , the influence of environmental chemical ototoxins should be taken into account as a confounding factor resulting in greater impairment of hearing in our male smokers . to summarize , tobacco smoke likely induces an array of subclinical changes in the organ of hearing , especially in males . therefore , appropriate strategies preventing resultant hearing loss should be implemented before it will manifest clinically and impair patient functioning . these strategies should be adjusted for these documented sex - specific differences in susceptibility to tobacco smoke - induced hearing impairment . this study showed that smoking induces an array of subclinical changes in the organ of hearing . specifically , while it does not modulate the hearing threshold determined with pta at low , moderate , and high frequencies , it causes a significant decrease in oae levels , but only in males .\noutput:\n" }, { "from": "agent", "value": "backgrounda number of studies have documented the influence of cigarette smoking on hearing . however , the association between sex and hearing impairment in smokers as measured by otoacoustic emissions ( oaes ) has not been clearly established . the aim of this study was to analyze sex - specific effects of smoking on hearing via conventional and ultra - high - frequency pure tone audiometry ( pta ) , and oaes , specifically spontaneous oaes , click - evoked oaes , and distortion - product oaes.material / methodsthe study included 84 healthy volunteers aged 2545 years ( mean 34 ) , among them 46 women ( 25 non - smokers and 21 smokers ) and 38 men ( 16 non - smokers and 22 smokers ) . the protocol of the study included otoscopic examination , tympanometry , low - , moderate - , and ultra - high - frequency pta , evaluation of spontaneous click - evoked ( ceaoes ) and distortion - product otoacoustic emissions ( dpoaes ) , assessment of the dp - grams for 2f1 - f2 ( f1 from 977 to5 164 hz ) , and input / output function at l2 primary tone level of 4070 db spl.resultssmokers and non - smokers did not differ significantly in terms of their hearing thresholds assessed with tone audiometry . male smokers presented with significantly lower levels of ceaoes and dpoaes than both male non - smokers and female smokers.conclusionssmoking does not modulate a hearing threshold determined with pta at low , moderate , and ultra - high frequencies , but causes a significant decrease in oae levels . this effect was observed only in males , which implies that they are more susceptible to smoking - induced hearing impairment . sex - specific differences in otoacoustic emissions level may reflect influences of genetic , hormonal , behavioral , and / or environmental factors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: korea has been noted for high prevalence of alcohol use disorders ( aud ) and exceptionally high male - to - female ratio of aud prevalence ( 12 ) based on the results of a national epidemiologic survey conducted in 1984 ( 3 ) . the lifetime prevalence of aud was 42.9 % in men and 2.6 % in women , resulting with a male - to female ratio of 16.5 ( 3 ) . in total population , the prevalence of aud was 23 % , which is higher than reported figures of other countries ( 1 ) such as the united states ( 17 % ) ( 4 ) , taiwan ( 7 % ) ( 5 ) . the fact that the 1984 korean study was conducted with the same methodology used in epidemiologic catchment area ( eca ) study in the us ( 6 ) using the diagnostic interview schedule ( dis ) ( 7 ) allowed for direct comparisons with the dis - based data from other countries . after 15 yr , a regional survey was conducted in 1999 among korean community residents using the composite international diagnostic interview ( cidi ) ( 8 ) to assess diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) disorders . in the study , the prevalence of aud in total population was decreased from 23 % in 1984 to 15.6 % in 1999 . the male - to - female ratio of prevalence dropped from 16.5 in 1984 to 5.8 in 1999 ( 2 ) . although the differences in the diagnostic system could have affected the results of the comparisons between the 1999 survey and the 1984 survey ( 2 ) , the trend of narrowing gender gap in aud was consistent with the reports in the united states ( 9 ) . during the same period in the united states , male - to - female ratio of prevalence for alcohol dependence ( ad ) decreased from 5.17:1 in the 1982 eca study ( 10 ) to 2.45:1 in the 1990 - 92 national comorbidity survey ( ncs ) ( 11 ) . ( 12 ) compared the national longitudinal alcohol epidemiologic survey ( nlaes ) ( 13 ) conducted in 1991 - 1992 and the national epidemiologic survey on alcohol and related conditions ( nesarc ) ( 14 ) conducted in 2001 - 2002 . they found that the gender ratio had further diminished from 3.09 to 2.72 for aa and from 2.45 to 2.34 for ad , although the decrease between nesarc and nlaes was more gradual than the change between eca and ncs ( 12 ) . and additionally , the result from national survey on drug use and health ( nsduh ) conducted by substance abuse and mental health services administration center for behavioral health statistics and quality ( samhsa ) also showed even narrowed gender ratio of 2.0 for 12 - month alcohol use disorder ( male ; 9.4 % ; female 4.7 % ) in 2013 ( 15 ) . meanwhile , in 2001 , the first nation - wide epidemiologic survey for dsm - iv mental disorders in korea , the korean epidemiologic catchment area ( keca ) ( 16 ) survey was conducted . a cross - cultural comparison of the results of keca in korea and nesarc in united states revealed greater gender gap in korea ( 17 ) . the gender ratios of prevalence for abuse and dependence among koreans ( aa , 5.83 ; ad , 4.87 ) were much greater than their american counterparts ( aa , 2.57 ; ad , 2.21 ) . over the 10 yr since 2001 , the korean society had experienced a rapid change in sociocultural environment regarding gender . . college enrollment rate for women increased from 65.4 % in 2000 to 80.5 % in 2010 , surpassing the rate of men , which was 77.6 % in 2010 . employment rate for women has increased from 38.3 % in 2000 to 41.1 % in 2010 ( 18 ) . more specifically , the employment rate for women in their 30s was 54.8 % , 40s was 65.3 % , and 50s was 57.9 % , indicating that more than half of the female population were active participants in the economy . as these changes would inevitably affect the epidemiology of aud , a new research endeavor to evaluate the current trends in gender difference in aud in korea is necessary . understanding true changes in prevalence over time may be crucial for research on the etiology of aud ( 19 ) . since the distribution of genotypes does not vary within such a short period as a decadein addition , the evaluation conducted in korea would generate information about not only secular change , but also cross - cultural difference . the data from who world mental health survey reported substantial cross - cultural variation in substance use disorders by gender ( 20 ) . ( 9 ) remarked that studies about birth cohort effect and gender difference were focused in the western countries and that data from a broader cultural framework are needed . however , few previous studies about change of gender differences for aud have been conducted in asia . only some epidemiologic surveys conducted in china and japan have suggested the trend of narrowing gender gap . in beijing , gender ratio of lifetime prevalence of ad decreased from 48.3 ( men 2.9 % , women 0.06 % ) in 1991 ( 21 ) to 19.5 ( men 7.8 % , women 0.4 % ) in 2008 ( 22 ) . in japan , gender ratio of lifetime prevalence of aud was 11.07 ( men 15.5 % , women 1.4 % ) in a nation - wide survey conducted between 1997 and 1999 ( 23 ) . the ratio was reported as 5.07 ( men 7.1 % , women 1.4 % ) in more recent study conducted from 2002 to 2005 ( 24 ) . however , these direct comparisons of these surveys are problematic due to the differences in diagnostic system and methodologies used in those surveys . in the case of beijing , dis was used to generate dsm - iii diagnosis in 1991 ( 21 ) , while cidi 1.0 was used to make dsm - iii - r diagnosis in 2008 ( 22 ) . japanese studies also used different diagnostic systems of dsm - iii - r in 1999 ( 23 ) and dsm - iv in 2005 ( 24 ) . hence this study is the first report of direct comparison to analyze secular change of the gender difference in aud in asia . this study may provide a foundation for further research endeavor on aud in other asian countries and also among asian immigrants in other parts of the world . the information on changes in aud would also be helpful for policy makers because they can find potentially vulnerable groups and highlight the need for focused planning ( 12 ) . this study compared the results of the most recent national survey , the 2011 korean epidemiologic catchment area study ( keca - 2011 ) with the results of keca in 2001 to investigate the change in gender difference in dsm - iv alcohol abuse ( aa ) and alcohol dependence ( ad ) in korea . since the methods used in keca - 2011 were very similar to those used in the keca survey , direct comparison is possible . the authors hypothesized that gender gap in alcohol use disorders would have decreased in 2011 compared to 2001 , consistent with findings from united states . as the keca and the keca - 2011 were nation - wide surveys for mental illnesses , the target population consisted of community - dwelling adults in korea while excluding institutionalized individuals . both surveys used multistage , cluster sampling method based on the population census of the korean national statistical office in 2000 and 2010 . the catchment areas for sampling were not the same , but very similar between the two surveys . further details concerning the designs and methods of the keca survey can be found elsewhere ( 16 ) . in 2001 , the keca survey was conducted across 10 catchment areas during the period between june 1 and november 30 ( 16 ) . in 2011 , the keca - 2011 survey was conducted across 12 catchment areas between july 19 and november 16 ( 25 ) . face - to face interviews were administered to community residents aged 18 - 64 yr in 2001 ( n = 6,220 ) and to those aged 18 - 74 yr in 2011 ( n = 6,022 ) . for direct comparison , only respondents who were 64 yr old or younger were included in the analysis from the 2011 data ( n = 4,894 ) . to assess dsm - iv disorders , the korean version of composite international diagnostic interview ( k - cidi ) ( 26 ) the cidi ( 8 ) is a fully structured diagnostic interview designed to produce standardized psychiatric diagnoses in various cultures . to gain reliable information for each diagnostic criteria of dsm - iv , the questions in cidifor example , ' a great deal of time is spent in activities necessary to obtain alcohol , use alcohol , or recover from its effects ' which is one of the diagnostic criteria of ad is questioned as \" was there ever a period in your life when you spent a great deal of time drinking or getting over the effects of alcohol ? \" . ( 26 ) according to the world health organization ( who ) guidelines ( 27 ) . data were adjusted to approximate the national population contributions of age and gender using weight values that were calculated according to the population census of 2000 and 2010 ( 18 ) . to assess gender difference in prevalence and risk , the male - to - female prevalence ratios and odds ratios ( or ) for ad and aa in each year and in each age group were calculated . to compare the data of the two national surveys , logistic regression was conducted in each age group by gender . or for alcohol abuse and dependence in 2011spss 18th ( polar engineering and consulting , 2009 ) was used for the analysis . the study protocol was approved by the institutional review board of the seoul national university hospital ( irb no . all the subjects were fully informed about the aims and methods of the study before completing the interview . as the keca and the keca - 2011 were nation - wide surveys for mental illnesses , the target population consisted of community - dwelling adults in korea while excluding institutionalized individuals . both surveys used multistage , cluster sampling method based on the population census of the korean national statistical office in 2000 and 2010 . the catchment areas for sampling were not the same , but very similar between the two surveys . further details concerning the designs and methods of the keca survey can be found elsewhere ( 16 ) . in 2001 , the keca survey was conducted across 10 catchment areas during the period between june 1 and november 30 ( 16 ) . in 2011 , the keca - 2011 survey was conducted across 12 catchment areas between july 19 and november 16 ( 25 ) . face - to face interviews were administered to community residents aged 18 - 64 yr in 2001 ( n = 6,220 ) and to those aged 18 - 74 yr in 2011 ( n = 6,022 ) . for direct comparison , only respondents who were 64 yr old or younger were included in the analysis from the 2011 data ( n = 4,894 ) . to assess dsm - iv disorders , the korean version of composite international diagnostic interview ( k - cidi ) ( 26 ) was administered to all subjects by trained interviewers in both surveys . the cidi ( 8 ) is a fully structured diagnostic interview designed to produce standardized psychiatric diagnoses in various cultures . to gain reliable information for each diagnostic criteria of dsm - iv , the questions in cidifor example , ' a great deal of time is spent in activities necessary to obtain alcohol , use alcohol , or recover from its effects ' which is one of the diagnostic criteria of ad is questioned as \" was there ever a period in your life when you spent a great deal of time drinking or getting over the effects of alcohol ? \" . ( 26 ) according to the world health organization ( who ) guidelines ( 27 ) . data were adjusted to approximate the national population contributions of age and gender using weight values that were calculated according to the population census of 2000 and 2010 ( 18 ) . to assess gender difference in prevalence and risk , the male - to - female prevalence ratios and odds ratios ( or ) for ad and aa in each year and in each age group were calculated . to compare the data of the two national surveys , logistic regression was conducted in each age group by gender . or for alcohol abuse and dependence in 2011spss 18th ( polar engineering and consulting , 2009 ) was used for the analysis . the study protocol was approved by the institutional review board of the seoul national university hospital ( irb no . all the subjects were fully informed about the aims and methods of the study before completing the interview . table 1 presents the socio - demographic profiles of the participants in 2001 and 2011 . the proportion of males was larger in 2011 than in 2001 . compared to the respondents in 2001 , the survey respondents in 2011 included more people over 50 yr of age , more people with higher education , fewer people who were married , and fewer people who were employed . male - to - female prevalence ratios and odds ratios were calculated for lifetime alcohol abuse and dependence in each survey year , in each age group ( tables 2 , 3 ) . while both alcohol abuse and alcohol dependence were still more prevalent among men than in women in all age groups , almost all groups showed a decrease in male - to - female prevalence ratios and odds ratios . in terms of prevalence , the male - to - female ratio had decreased in aa ( from 6.94 to 3.97 ) and in ad ( from 3.43 to 2.26 ) between 2001 and 2011 . the male - to - female odds ratio had also decreased in aa ( from 6.41 to 4.37 ) and ad ( from 3.75 to 2.40 ) . though the 50 - 59 age group showed an increase in the male - to - female prevalence ratio for aa and ad after the interval of 10 yr , after adjusting for demographic factors such as marital status , employment , education year , the male - to - female or decreased in aa ( from 10.06 in 2001 to 9.79 in 2011 ) and ad ( from 8.96 in 2001 to 6.84 in 2011 ) . in the case of the age group of 18 to 29 yr , the odds of men for aa went from being 2.49 times the odds of women in 2001 to being only 1.59 times the odds of women in 2011 . likewise , the odds of men for ad went from being 1.61 times the odds of women in 2001 to being only 1.38 times the odds of women in 2011 . no significant difference was found in the risk of aa and ad between men and women in 2011 in this age group . the age group of 30 to 39 yr also showed a similar pattern . in 2001 , the odds of men for ad were 4.02 times the odds of women , but there was no statistically significant difference between men and women in 2011 in risk of ad ( tables 2 , 3 ) . to evaluatewhether the changes of lifetime prevalence between 2001 and 2011 are statistically significant , the 2011 - to - 2001 odds ratios for aa and ad were calculated by gender in each age group ( table 4 ) . in the case of men , the odds of experiencing aa did not change significantly between 2001 and 2011 . on the other hand , they were less likely to experience ad in 2011 than they were in 2001 . in men aged 40 to 49 and 60 to 64 , odds for alcohol dependence in 2011 were less than half the odds than in 2001 ( or : 0.33 , 95 % ci 0.21 - 0.51 ; or : 0.38 , 95 % ci 0.18 - 0.80 ) . the change in risk for ad between 2001 and 2011 were insignificant ( p = 0.063 ) only in the case of the men in their 50s . in the case of women , the odds of experiencing aa increased significantly in 2011 for females in the 30 - 39 age , which were 2.13 times the odds in 2001 . also , the odds of aa for females in the youngest age group ( 18 - 29 ) in 2011 were 1.68 times the odds in 2001 , approaching significance ( p = 0.053 ) . in short , the risk for aa had increased in young women while risk for ad had decreased in men between 2001 and 2011 . these results indicate that the decrease of gender gap in aa was due to increased prevalence in women , while the change in ad was largely due to decreased prevalence in men . this study found that gender differences in lifetime prevalence of aa and ad had decreased by 2011 compared to 2001 in korea , as the researchers had hypothesized . the gender ratio of prevalence for aa decreased from 6.94 in 2001 to 3.97 in 2011 and the reason for this change was increase in aa among women . in contrast , decrease of ad among men contributed to decreased gender ratio in ad of from 3.43 in 2001 to 2.26 in 2011 . in addition to the prevalence , the male - to - female odds ratios had also decreased for aa ( 6.41 to 4.37 ) and ad ( 3.75 to 2.40 ) . the gender gap was the smallest in the youngest age group ( age 18 - 29 ) . the significant gender gap between men and women in the risk of aa and ad had disappeared by 2011 for young adults . women had as much risk as men for aa in ages 18 - 29 and for ad in ages 18 - 39 in 2011 . these changes are consistent with the previous reports of narrowing gender gap in comparison with nlae ( 13 ) in 1991 - 1992 and nesarc ( niaaa ) in 2001 - 2002 in the united states ( 1228 ) . however , the patterns are different between the united states ( 28 ) and korea . the most remarkable difference is that the secular decrease of gender ratio was much steeper in korea . in the united states , the gender ratio decreased from 3.09 to 2.72 for 12 - month aa and from 2.45 to 2.34 for ad , while the korean data reported that gender ratio decreased from 6.94 to 3.97 for lifetime aa and from 3.75 to 2.4 for lifetime ad . also , the pattern of changes for aud was more markedly different by gender in korea . while ad decreased significantly among men and insignificantly among women in both countries , korean men showed steeper decline . among all age groups by gender , only korean women in their 30s showed increased prevalence of ad , although the change was not statistically significant . in case of aa , aa had significantly increased both in men ( 4.67 % - 6.93 % ) and women ( 1.51 % - 2.55 % ) in the united states . in korea , although aa had slightly increased in both sexes , the increase of aa was only significant in young women . additionally , the gender gap and the prevalence varied greatly by age in korea . the gender ratios of prevalence were 17.0 for aa and 12.6 for ad in the oldest age group ( age 60 - 64 ) of 2011 , which are very close to the figures for the total population in 1984 , where they were 16.85 for aa and 20.4 for ad . on the other hand , the youngest group ( age 18 - 29 ) of 2011 showed very low gender ratios of 1.42 for aa and 1.18 for ad . a comparison between the women aged 18 - 29 yr and women aged 60 - 64 yr showed striking differences in prevalence for aa ( 6.9 % vs. 0.5 % ) and ad ( 6.1 % vs. 0.5 % ) . to explain this steep decrease of gender gap , socio - cultural factors should be considered . who 's world mental health survey ( who wmhs ) had linked the shrinkage of gender gap in recent cohorts for substance use disorders to variation in gender role traditionality by nation . the greatest reductions in the gender gap were reported among countries where women 's roles have shifted the most from traditional to autonomous ( 20 ) . the traditional korean society had very rigid gender roles based on confucianism , which had even set \" the distinction between husband and wife \" as one of the five fundamental moral disciplines in human relationships . confucian principles imposed strict restrictions on social activities of women and expected them to devote themselves in the service of their family . in contrast , men were expected to actively pursue successful careers , engage in profitable endeavors , and socialize with peers , which involved much social drinking . accordingly , the korean society held two distinctive sets of values and attitudes toward men and women 's drinking behavior ( 29 ) . for women , opportunities for social drinking were practically nonexistent and drinking was considered as an immoral and insolent behavior , while for men , drinking alcohol was allowed , encouraged , and even enforced in some social contexts . since alcohol was a social lubricant , and the consumption of alcoholis considered essential to many business and social gatherings ( 29 ) , rejecting alcoholic drinks could be seen as rude and sometimes as an indication of social ineptness . in addition , heavy drinking was often associated with masculinity , encouraging men to drink as much as they can in social gatherings to prove their masculinity . however , the social environment concerning gender has been changing in korea . as more and more women break out of traditional gender roles and hold similar social positions as men , traditional expectations on gender roles are changing . as women are taking on roles that had been traditionally considered for men , experiencing the same kind of stress , and going through the same circumstances as men , they may have extended this imitation effect to susceptibility to aud . just as men participated in social drinking for their own careers , women who ventured forth to the previously male - dominated society of the workforce started to participate in social drinking as part of their career fulfillment . in addition to the correlation between drinking behavior and occupational subcultures ( 30 ) , the increase in economic power for women facilitates their purchasing power for alcohol ( 31 ) . furthermore , the stigma associated with drinking behavior among women may have been reduced in recent years ( 32 ) . compared to the past when confucian gender distinction had rigidly restricted alcohol consumption for women , korean women today are much freer to drink alcoholic beverages . the decreased stigma and increased accessibility of alcohol may allow drinking become more popular as a coping strategy for stress in women . the decrease of ad in korean men could also be associated with socio - cultural changes . the korean public had a high tolerance for drunkenness and mistakes made while drunk ( 217 ) . this high tolerance was only for men and considered to be one of the key reasons for the much higher prevalence rate of aud among korean men than men in other asian countries . recently , the norm of the korean society has shifted toward disapproving the serious problems associated with heavy drinking ( 2 ) . the government had started a campaign against the notorious drinking culture to reduce socioeconomic loss resulting from excessive drinking in 2006 . since 69.6 % of total households had individual transportation such as a car in 2010 ( 18 ) , the increased automobile use has also impacted the drinking habits of the public ( 2 ) . in 2010 , the police declared to deploy intensive control of \" joo - pok \" , which means violence in drunken state . as the public are more informed of the hazards by heavy drinking , its association with negative outcomes like loss of self control , health problem and addiction is increasing instead of positive ones like social competence . such socio - cultural change has probably contributed to the steep decline of gender difference . the strengths of this study include the inclusion of a large pool of respondents on a national scale and the high reliability of aud diagnosis by a systematic diagnostic tool , the cidi . the cidi is expected to lower defensiveness in responses as it asks about behaviors pertaining to diagnostic criteria and has a low false - positive rate because of its rigorous diagnostic criteria . the possible error due to difference in methodologies is minimalized as this study is a direct comparison of two similar surveys that used the same diagnostic tool and sampling method . similar teams of researchers were involved and both studies used the population census of each year as a sampling frame . while the survey did not follow up on the same cohorts , the populations represented by the respondents are likely to be similar to each other as they were recruited from similar catchment areas representing each province of the country . consequently , the resulting evidence provides the strongest support that is realistically possible from a cross - sectional study . the findings of this study may contribute valuable insight into the cross - national epidemiological distribution of aud and its relation with socio - cultural factors and gender differences . firstly , self - report measures are susceptible to memory bias , which can result higher prevalence in younger population . however , because the participants were below 65 yr old , the likelihood of memory bias resulting from decline in cognitive ability is low . also , the bias alone can not explain the difference in gender gap by age group and the change between 2001 and 2011 . secondly , it is possible that changes in social norms caused the young women to be more open to disclosing their personal problems and more aware of alcohol - related problems than older adults . however , the cidi does not ask whether the respondent has a disorder or a problem , but uses neutral questions about behaviors pertaining to diagnostic criteria , which would have helped reduce errors associated with defensiveness .\noutput:\n" }, { "from": "agent", "value": "while decreasing trend in gender differences in alcohol use disorders was reported in western countries , the change in asian countries is unknown . this study aims to explore the shifts in gender difference in alcohol abuse ( aa ) and dependence ( ad ) in korea . we compared the data from two nation - wide community surveys to evaluate gender differences in lifetime aa and ad by diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) . face - to - face interviews using the composite international diagnostic interview ( cidi ) were applied to all subjects in 2001 ( n = 6,220 ) and 2011 ( n = 6,022 ) . male - to - female ratio of odds was decreased from 6.41 ( 95 % ci , 4.81 - 8.54 ) to 4.37 ( 95 % ci , 3.35 - 5.71 ) for aa and from 3.75 ( 95 % ci , 2.96 - 4.75 ) to 2.40 ( 95 % ci , 1.80 - 3.19 ) for ad . among those aged 18 - 29 , gender gap even became statistically insignificant for aa ( or , 1.59 ; 95 % ci , 0.97 - 2.63 ) and ad ( or , 1.18 ; 95 % ci , 0.80 - 2.41 ) in 2011 . men generally showed decreased odds for ad ( 0.55 ; 95 % ci , 0.45 - 0.67 ) and women aged 30 - 39 showed increased odds for aa ( 2.13 ; 95 % ci 1.18 - 3.84 ) in 2011 compared to 2001 . decreased ad in men and increased aa in women seem to contribute to the decrease of gender gap . increased risk for aa in young women suggests needs for interventions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: their carbohydrate metabolism status was determined by a standard 75 - g oral glucose tolerance test ( ogtt ) performed within the previous 6 months . patients filled out a complete lifestyle questionnaire regarding medical history , parental history of cardiovascular disease , smoking habits , and physical activity . a physical examination ruled out peripheral vascular disease by clinical criteria ( absence of peripheral pulses of the lower extremity ) and ankle - brachial pressure indexes 0.9 . the extent of subclinical atherosclerosis was measured by quantitative high - resolution b - mode ultrasound of the far wall of the right and left common carotid arteries . the measurements were carried out as previously reported according to a validated procedure with an hdi - 5000 sono ct ultrasound machine ( philips medical system / atl spa ) equipped with a phased - array 4 - to 7 - mhz transducer . intima - media thickness ( imt ) readings were performed independently by two trained operators as described ( 16 ) . a resting 12 - lead electrocardiogram was performed , and angina was excluded in each patient according to the world health organization rose questionnaire . four subjects were moderately hypertensive and were on antihypertensive drugs ( two subjects on ace inhibitors and two on angiotensin receptor blockers ) . all subjects were following their standard italian diet containing at least 50 % of carbohydrates as energy . each subject was evaluated after overnight fasting at the division of metabolic diseases , university school of medicine , padova , italy . the protocol was approved by the ethics committee of the university hospital of padova and all subjects provided informed consent . a cannula was inserted in a superficial vein of the arm for blood sample collection . then , a mixed meal containing 10 kcal / kg ( 55 % carbohydrate , 15 % protein , and 30 % fat ) was administered in 1015 min . plasma samples were drawn at 5 , 0 , 10 , 20 , 30 , 60 , 90 , 120 , 150 , and 180 min , and plasma glucose , insulin , c - peptide , and free fatty acid ( ffa ) concentrations were determined to evaluate insulin sensitivity index ( si ) ( 17 ) . at baseline , metabolic syndrome was diagnosed according to the revised adult treatment panel - iii ( atp - iii ) criteria ( 18 ) . at time 0 and180 min , blood samples were obtained for the isolation of pbmcs to determine sirt gene and protein expression . the analytic methods , preparation of pbmcs , cell culture conditions , assessment of cell viability , quantitative real time rt - pcr ( q - pcr ) ( supplementary table 1 ) , western blot analysis , p53 - acetylation procedure , sirt1 silencing , measurement of intracellular reactive oxygen species ( ross ) , and nad determination are reported in supplementary methods , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1187/dc1 . insulin sensitivity ( defined as si and expressed as 10 dl kg min peru / ml ) was estimated from plasma glucose and insulin concentrations measured during the meal test using the oral glucose minimal model ( 19 ) . si measures the overall effect of insulin to stimulate glucose disposal and to inhibit glucose production . the minimal model has been validated against the hyperinsulinemic - euglycemic clamp , which is considered the gold standard for assessment of insulin sensitivity . subjects were divided into insulin sensitive and insulin resistant according to the median value of si ( 9.510 dl kg min per u / ml ) . differences between two groups were assessed using student t test for unpaired data or mann - whitney test for nonnormally distributed variables . pearson correlation was used to evaluate univariate correlations . to assess independent association between sirt expression and clinical data , we recruited by advertisement 54 consecutive volunteers who were employees of the padova province offices . their carbohydrate metabolism status was determined by a standard 75 - g oral glucose tolerance test ( ogtt ) performed within the previous 6 months . patients filled out a complete lifestyle questionnaire regarding medical history , parental history of cardiovascular disease , smoking habits , and physical activity . a physical examination ruled out peripheral vascular disease by clinical criteria ( absence of peripheral pulses of the lower extremity ) and ankle - brachial pressure indexes 0.9 . the extent of subclinical atherosclerosis was measured by quantitative high - resolution b - mode ultrasound of the far wall of the right and left common carotid arteries . the measurements were carried out as previously reported according to a validated procedure with an hdi - 5000 sono ct ultrasound machine ( philips medical system / atl spa ) equipped with a phased - array 4 - to 7 - mhz transducer . intima - media thickness ( imt ) readings were performed independently by two trained operators as described ( 16 ) . a resting 12 - lead electrocardiogram was performed , and angina was excluded in each patient according to the world health organization rose questionnaire . four subjects were moderately hypertensive and were on antihypertensive drugs ( two subjects on ace inhibitors and two on angiotensin receptor blockers ) . all subjects were following their standard italian diet containing at least 50 % of carbohydrates as energy . each subject was evaluated after overnight fasting at the division of metabolic diseases , university school of medicine , padova , italy . the protocol was approved by the ethics committee of the university hospital of padova and all subjects provided informed consent . a cannula was inserted in a superficial vein of the arm for blood sample collection . then , a mixed meal containing 10 kcal / kg ( 55 % carbohydrate , 15 % protein , and 30 % fat ) was administered in 1015 min . plasma samples were drawn at 5 , 0 , 10 , 20 , 30 , 60 , 90 , 120 , 150 , and 180 min , and plasma glucose , insulin , c - peptide , and free fatty acid ( ffa ) concentrations were determined to evaluate insulin sensitivity index ( si ) ( 17 ) . at baseline , metabolic syndrome was diagnosed according to the revised adult treatment panel - iii ( atp - iii ) criteria ( 18 ) . at time 0 and180 min , blood samples were obtained for the isolation of pbmcs to determine sirt gene and protein expression . the analytic methods , preparation of pbmcs , cell culture conditions , assessment of cell viability , quantitative real time rt - pcr ( q - pcr ) ( supplementary table 1 ) , western blot analysis , p53 - acetylation procedure , sirt1 silencing , measurement of intracellular reactive oxygen species ( ross ) , and nad determination are reported in supplementary methods , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1187/dc1 . insulin sensitivity ( defined as si and expressed as 10 dl kg min per u / ml ) was estimated from plasma glucose and insulin concentrations measured during the meal test using the oral glucose minimal model ( 19 ) . si measures the overall effect of insulin to stimulate glucose disposal and to inhibit glucose production . the minimal model has been validated against the hyperinsulinemic - euglycemic clamp , which is considered the gold standard for assessment of insulin sensitivity . subjects were divided into insulin sensitive and insulin resistant according to the median value of si ( 9.510 dl kg min per u / ml ) . differences between two groups were assessed using student t test for unpaired data or mann - whitney test for nonnormally distributed variables . pearson correlation was used to evaluate univariate correlations . to assess independent association between sirt expression and clinical data , a total of 13 subjects fulfilled atp - iii criteria for diagnosis of metabolic syndrome . clinical characteristics of subjects divided into non metabolic syndrome and metabolic syndrome are presented in table 1 . upon ogtt ,41 subjects had normal glucose tolerance ( ngt ) and 13 had pre - diabetes . of these , four had impaired fasting glucose ( ifg , defined as preload plasma glucose 100 mg / dl ) ; nine had impaired glucose tolerance ( igt , defined as postload plasma glucose 140 and 200 mg / dl ) ; three had both ifg and igt ; and none had diabetes . demographic and metabolic characteristics of study subjects data are expressed as mean se . * p 0.05 versus non metabolic syndrome . glucose and ffa areas under the curve ( auc ) were calculated and stratified according to insulin sensitivity and glucose tolerance . glucose auc was significantly higher in insulin resistant versus insulin sensitive ( 10674751 vs. 16687782 mg dl min ; p 0.001 ) , in metabolic syndrome versus non metabolic syndrome ( 213891,276 vs. 17822634 ; p 0.01 ) and in ifg / igt versus ngt ( 227561,233 vs. 17388562 ; p 0.001 ) . the ffa auc was significantly greater in insulin resistant versus insulin sensitive ( 50.162.98 vs. 33.762.79 moll min ; p 0.001 ) , marginally significant in ifg / igt versus ngt ( 49.694.59 vs. 39.502.59 ; p = 0.059 ) , and similar in metabolic syndrome versus non metabolic syndrome ( 47.743.66 vs. 40.122.78 ) . the characteristics of subjects divided by insulin resistant and insulin sensitive and by glucose tolerance are shown in supplementary tables 2 and 3 . when the subjects were divided into two groups according to the presence ( n = 13 ) or absence ( n = 41 ) of metabolic syndrome , we found significantly lower levels of sirt1 gene expression in metabolic syndrome versus non metabolic syndrome subjects ( 0.670.08 vs. 1.020.06 comparative cycle threshold [ ct ] ; p = 0.003 ) , whereas expression of other sirts ( sirt2 - sirt7 ) were not significantly altered ( fig . similarly , when subjects were divided into insulin sensitive ( n = 28 ) and insulin resistant ( n = 26 ) on the basis of median value of their si , we found significantly lower sirt1 gene expression in insulin resistant compared with insulin sensitive ( 0.770.06 vs. 1.090.06 ct ; p = 0.001 ) , whereas other sirts were unaffected ( fig . to confirm this result , we analyzed the protein level of sirt1 in pbmcs from these subjects according to metabolic syndrome and insulin sensitivity . in pbmcs from metabolic syndrome and from insulin - resistant subjects , sirt1 protein expression was significantly reduced in comparison with non metabolic syndrome subjects and with insulin - sensitive subjects ( metabolic syndrome versus non metabolic syndrome : 0.370.06 vs. 0.600.06 arbitrary units ; p = 0.010 ; insulin resistant versus insulin sensitive : 0.420.04 vs. 0.670.09 ; p = 0.021 ; representative blots are reported in fig . subjects were first divided by the presence / absence of metabolic syndrome and by insulin - resistant or insulin - sensitive status . a : q - pcr analysis of sirt1 - sirt7 gene expression in pbmcs from metabolic syndrome and from non metabolic syndrome subjects . b : q - pcr analysis of sirt1 - sirt7 gene expression in pbmcs from insulin - resistant and from insulin - sensitive subjects . the relative quantification was achieved by the expression of each gene of interest by housekeeping genes according to ct formula . c and d : western blot analysis of sirt1 from pbmcs of two representative patients with and without metabolic syndrome or insulin resistance . densitometric analysis of sirt1 after normalization for glyceraldehyde -3-phosphate dehydrogenase in the whole cohort of subjects is described in the results section . e : subjects were also divided according to ogtt results into subjects with ngt and pre - diabetic subjects ( either ifg or igt ) : sirt1 expression in subjects with ngt was significantly reduced compared with pre - diabetic subjects ( * p 0.05 ) . g : subjects were also divided according to the presence ( black columns ) or absence ( white columns ) of each metabolic syndrome component , as defined by revised atp - iii criteria ( * p 0.05 ) . i : when subjects were divided according to the number of metabolic syndrome components , sirt1 expression was progressively downregulated by increasing number of components ( * p 0.05 vs. 0 components after - correction ; anova , p 0.05 ) . h : subjects divided according to metabolic syndrome and insulin sensitivity : in nine subjects without metabolic syndrome classified as insulin resistant , there was a significant sirt1 downregulation compared with insulin - sensitive subjects . * p 0.05 . data are expressed as mean se . because sex might influence sirt1 , we repeated analysis for males and females separately and found a similar trend of sirt1 reduction in both males and females with metabolic syndrome or insulin resistance , compared with non metabolic syndrome and insulin sensitivity , respectively ( supplementary fig . however caution should be paid in interpreting these results because the number of females in the non metabolic syndrome and insulin - sensitive groups was very limited ( n = 2 ) . we then looked at differences in sirt1 expression in subjects with altered glucose metabolism ( ifg or igt ) . in comparison with subjects with ngt ( n = 41 ) , subjects with pre - diabetes ( n = 13 ) had significantly lower levels of sirt1 gene ( fig .1 e ) and protein expression ( 0.390.05 vs. 0.590.06 arbitrary units ; p = 0.022 ) . this significant association between sirt1 and carbohydrate metabolism is corroborated by the observation of the direct correlation between sirt1 gene expression and si ( r = 0.47 ; p 0.001 ; fig . a quite similar trend of sirt1 reduction in pre - diabetic subjects versus subjects with ngt was found in both males and females ( supplementary fig . sirt1 gene expression was significantly correlated with all parameters that define metabolic syndrome and are linked to insulin resistance : waist circumference ( r = 0.43 ; p = 0.001 ) , hdl cholesterol ( r = 0.38 ; p = 0.007 ) , triglycerides ( r = 0.34 ; p = 0.014 ) , systolic blood pressure ( r = 0.29 ; p = 0.03 ) , and fasting plasma glucose ( r = 0.3 ; p = 0.04 ) . to better describe the relationship between sirt1 and metabolic syndrome , we first evaluated the association of individual metabolic syndrome components according to the revised atp - iii definition and sirt1 gene expression . we found that each metabolic syndrome component was associated with a significant reduction of sirt1 gene expression ( fig . furthermore , when the level of sirt1 expression was plotted against the number of metabolic syndrome components in each subject , there was a trend of sirt1 downregulation with components clustering . compared with subjects with no component , sirt1 downregulation was statistically significant after - adjusting when at least three components were present together , allowing the diagnosis of metabolic syndrome ( fig . interestingly , among patients without metabolic syndrome , those belonging to the insulin - resistant group showed a significant sirt1 downregulation compared with insulin - sensitive subjects ( fig .1 h ) . to further clarify these associations , we ran a stepwise multiple regression analysis , which showed that age and the number of metabolic syndrome components were significantly correlated with sirt1 gene expression independently of sex , of all the parameters that define metabolic syndrome components and si ( supplementary table 4 ) . finally , as metabolic syndrome components are known cardiovascular risk factor , we looked for an association between sirt1 downregulation and carotid imt , a marker of early atherosclerosis : we found a significant negative correlation between sirt1 gene expression and maximal carotid imt ( fig . insulin resistance , elevated glucose , and systemic ffa levels are significant contributors of the pathophysiological aspects associated with metabolic syndrome . furthermore , hepatic sirt1 is an important factor in the regulation of glucose and lipid metabolism ( 20 ) . based on these previous data , and in the light of our in vivo observations , we hypothesized that high glucose and ffa levels might be involved in the cellular regulation of sirt1 expression . therefore , we investigated the effects of glucose , insulin , and palmitate acid in thp - 1 cells , in vitro .2 a , gene expression of sirt1 decreased significantly after 24 h of treatment with 20 mmol / l glucose , reaching the maximal reduction after 48 h ( 20 mmol / l mannitol was used as osmotic control ) . consistently , sirt1 protein level decreased significantly after 48 h of glucose treatment ( fig . a similar effect was also induced by 10 mmol / l glucose ( not shown ) . fatty acids are potent nutrient modulators of insulin resistance . therefore , we incubated thp - 1 cells with representative saturated ( palmitate ) and unsaturated ( linolenic ) fatty acids for 3 and 24 h. treatment of thp - 1 cells for 24 h with palmitate ( 500 mol / l ) markedly reduced sirt1 gene ( fig . 2c ) and protein ( fig .2 d ) expression , whereas no effect was seen in linolenic acid ( 500 mol / l ) treated thp - 1 cells . nmol / l ) did not modify the expression of sirt1 ( data not shown ) . mmol / l ) did not produce any significant effect on sirt protein expression ( supplementary fig . a and b : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 3 , 24 , and 48 h. sirt1 gene ( a ) and protein ( b ) expression analysis was performed by q - pcr and western blot , respectively . c and d : thp - 1 cells were incubated in presence or absence of ffas ( 500 mol / l palmitic acid or 500 mol / l linoleic acid ) for 3 and 24 h. sirt1 gene ( c ) and protein ( d ) expression analysis was performed by q - pcr and western blot , respectively . data are expressed as mean of six experiments se , * p 0.05 . previous studies have demonstrated that high glucose reduced sirt1 expression leading to increased p53 acetylation ( 21 ) . therefore , we measured the effects of high glucose and palmitate on the acetylation of p53 in thp - 1 cells .3 a , high level of glucose and palmitate increased acetylated p53 in comparison with control cells . to confirm the role of sirt1 in the regulation of p53 acetylation induced by high glucose and palmitate , we knocked down sirt1 with sirna in thp - 1 cells .3 b , sirt1 protein content was reduced by 70 % , and the levels of p53 acetylation were constitutively higher in sirna sirt1 cells than in control cells ( fig . then , we treated the cells with resveratrol ( 250 mol / l ) , a known sirt1 activator , and measured the level of p53 acetylation in cells exposed to high glucose or palmitate .3 d and e , resveratrol decreased p53 acetylation in thp - 1 cells treated with high glucose or palmitate , but not in sirna sirt1 cells . these data show that increased acetylation of p53 by high glucose and palmitate can be reversed by resveratrol , and that this effect is sirt1 dependent . effect of resveratrol on glucose - and palmitate - induced p53 acetylation in thp - 1 cells with and without sirt1 knockdown . a : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 48 h or with palmitic acid ( 500 mol / l for 24 h ) . sirt1 expression was evaluated by q - pcr ( b ) and western blot analysis ( c ) . d : thp - 1 cells were also cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 48 h or with palmitic acid ( 500 mol / l ) for 24 h in presence and absence of resveratrol ( 250 mol / l ) and sirna sirt1 cells . the level of p53 acetylation was determined by immunoprecipitation followed by immunoblot against acetylated lysine residues . data are expressed as fold increase normalized to control and expressed as mean of three experiments se , * p 0.01 . it is well known that high glucose and fatty acids generate ross in various cells , including monocytes ( 22,23 ) . thus , we evaluated the effects of high glucose and palmitate on ros production in thp - 1 cells . both 20 mmol / l glucose and palmitate increased ros production and oxidative stress in thp - 1 cells , and these effects were abolished by resveratrol ( fig .4 a and b ) . to confirm that an increase of ross may regulate sirt1 protein level , we treated cells with h2o2 ( 250 mol / l for 24 h ) : sirt1 protein level was decreased and p53 acetylation dramatically increased , although resveratrol attenuated these effects ( fig . effects of resveratrol on glucose - and palmitate - induced ros production , p53 acetylation , and jnk activation in thp - 1 . a and b : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 3 , 24 , and 48 h ( a ) or with palmitate ( 500 mol / l ) for 3 and 24 h in presence and absence of resveratrol ( 250 mol / l ) ( b ) . c and d : thp - 1 cells were treated with h2o2 ( 250 mol / l for 24 h ) , in presence and absence of resveratrol . the level of p53 acetylation was performed by immunoprecipitation followed by an immunoblot against acetylated lysine residues . e : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l , 48 h ) glucose or with palmitate ( 500 mol / l for 24 h ) in presence and absence of resveratrol ( 250 mol / l ) and in sirna sirt1 cells . the level of jnk phosphorylation ( p - jnk ) was measured by western blot . f : densitometric analysis of p - jnk after normalization for total jnk in thp - 1 cells . g and h : effects of high glucose and palmitate on nampt expression and nad cellular content : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose or with palmitate ( 500mol / l ) for 3 , 6 , 24 , and 48 h. nampt expression was expressed as fold change versus the control condition ( 5.5 mmol / l glucose and no palmitate ) ( g ) . nad was quantified in thp - 1 cells exposed to high glucose ( 20 mmol / l ) or palmitate ( 500 mol / l ) for 24 h ( h ) . the values are expressed as mean fold increase of 36 experiments over control se , * p 0.01 versus basal or control . we investigated the effects of high glucose and palmitate on the activation of jun nh2 - terminal kinase ( jnk ) . this phenomenon was abolished in sirna sirt1treated cells , suggesting that it is sirt1 dependent ( fig . nicotinamide phosphoribosyltransferase ( nampt ) is the rate - limiting factor in nad biosynthesis , and sirt1 protein expression is regulated by the level of nad . therefore , we tested whether high level of glucose or palmitate modulates nampt expression in thp - 1 cells . gene expression of nampt markedly decreased after 6 - h high glucose and palmitate treatment ( fig . accordingly , high glucose and palmitic acid reduced the levels of intracellular nad in thp - 1 cells in comparison with cells grown at normal level of glucose ( fig . a total of 13 subjects fulfilled atp - iii criteria for diagnosis of metabolic syndrome . clinical characteristics of subjects divided into non metabolic syndrome and metabolic syndrome are presented in table 1 . upon ogtt ,41 subjects had normal glucose tolerance ( ngt ) and 13 had pre - diabetes . of these , four had impaired fasting glucose ( ifg , defined as preload plasma glucose 100 mg / dl ) ; nine had impaired glucose tolerance ( igt , defined as postload plasma glucose 140 and 200 mg / dl ) ; three had both ifg and igt ; and none had diabetes . demographic and metabolic characteristics of study subjects data are expressed as mean se . * p 0.05 versus non metabolic syndrome . glucose and ffa areas under the curve ( auc ) were calculated and stratified according to insulin sensitivity and glucose tolerance . glucose auc was significantly higher in insulin resistant versus insulin sensitive ( 10674751 vs. 16687782 mg dl min ; p 0.001 ) , in metabolic syndrome versus non metabolic syndrome ( 213891,276 vs. 17822634 ; p 0.01 ) and in ifg / igt versus ngt ( 227561,233 vs. 17388562 ; p 0.001 ) . the ffa auc was significantly greater in insulin resistant versus insulin sensitive ( 50.162.98 vs. 33.762.79 moll min ; p 0.001 ) , marginally significant in ifg / igt versus ngt ( 49.694.59 vs. 39.502.59 ; p = 0.059 ) , and similar in metabolic syndrome versus non metabolic syndrome ( 47.743.66 vs. 40.122.78 ) . the characteristics of subjects divided by insulin resistant and insulin sensitive and by glucose tolerance are shown in supplementary tables 2 and 3 . when the subjects were divided into two groups according to the presence ( n = 13 ) or absence ( n = 41 ) of metabolic syndrome , we found significantly lower levels of sirt1 gene expression in metabolic syndrome versus non metabolic syndrome subjects ( 0.670.08 vs. 1.020.06 comparative cycle threshold [ ct ] ; p = 0.003 ) , whereas expression of other sirts ( sirt2 - sirt7 ) were not significantly altered ( fig . similarly , when subjects were divided into insulin sensitive ( n = 28 ) and insulin resistant ( n = 26 ) on the basis of median value of their si , we found significantly lower sirt1 gene expression in insulin resistant compared with insulin sensitive ( 0.770.06 vs. 1.090.06 ct ; p = 0.001 ) , whereas other sirts were unaffected ( fig . to confirm this result , we analyzed the protein level of sirt1 in pbmcs from these subjects according to metabolic syndrome and insulin sensitivity . in pbmcs from metabolic syndrome and from insulin - resistant subjects , sirt1 protein expression was significantly reduced in comparison with non metabolic syndrome subjects and with insulin - sensitive subjects ( metabolic syndrome versus non metabolic syndrome : 0.370.06 vs. 0.600.06 arbitrary units ; p = 0.010 ; insulin resistant versus insulin sensitive : 0.420.04 vs. 0.670.09 ; p = 0.021 ; representative blots are reported in fig . subjects were first divided by the presence / absence of metabolic syndrome and by insulin - resistant or insulin - sensitive status . a : q - pcr analysis of sirt1 - sirt7 gene expression in pbmcs from metabolic syndrome and from non metabolic syndrome subjects . b : q - pcr analysis of sirt1 - sirt7 gene expression in pbmcs from insulin - resistant and from insulin - sensitive subjects . the relative quantification was achieved by the expression of each gene of interest by housekeeping genes according to ct formula . c and d : western blot analysis of sirt1 from pbmcs of two representative patients with and without metabolic syndrome or insulin resistance . densitometric analysis of sirt1 after normalization for glyceraldehyde -3-phosphate dehydrogenase in the whole cohort of subjects is described in the results section . e : subjects were also divided according to ogtt results into subjects with ngt and pre - diabetic subjects ( either ifg or igt ) : sirt1 expression in subjects with ngt was significantly reduced compared with pre - diabetic subjects ( * p 0.05 ) . g : subjects were also divided according to the presence ( black columns ) or absence ( white columns ) of each metabolic syndrome component , as defined by revised atp - iii criteria ( * p 0.05 ) . i : when subjects were divided according to the number of metabolic syndrome components , sirt1 expression was progressively downregulated by increasing number of components ( * p 0.05 vs. 0 components after - correction ; anova , p 0.05 ) . h : subjects divided according to metabolic syndrome and insulin sensitivity : in nine subjects without metabolic syndrome classified as insulin resistant , there was a significant sirt1 downregulation compared with insulin - sensitive subjects . data are expressed as mean se . because sex might influence sirt1 , we repeated analysis for males and females separately and found a similar trend of sirt1 reduction in both males and females with metabolic syndrome or insulin resistance , compared with non metabolic syndrome and insulin sensitivity , respectively ( supplementary fig . caution should be paid in interpreting these results because the number of females in the non metabolic syndrome and insulin - sensitive groups was very limited ( n = 2 ) . we then looked at differences in sirt1 expression in subjects with altered glucose metabolism ( ifg or igt ) . in comparison with subjects with ngt ( n = 41 ) , subjects with pre - diabetes ( n = 13 ) had significantly lower levels of sirt1 gene ( fig .1 e ) and protein expression ( 0.390.05 vs. 0.590.06 arbitrary units ; p = 0.022 ) . this significant association between sirt1 and carbohydrate metabolism is corroborated by the observation of the direct correlation between sirt1 gene expression and si ( r = 0.47 ; p 0.001 ; fig . a quite similar trend of sirt1 reduction in pre - diabetic subjects versus subjects with ngt was found in both males and females ( supplementary fig . sirt1 gene expression was significantly correlated with all parameters that define metabolic syndrome and are linked to insulin resistance : waist circumference ( r = 0.43 ; p = 0.001 ) , hdl cholesterol ( r = 0.38 ; p = 0.007 ) , triglycerides ( r = 0.34 ; p = 0.014 ) , systolic blood pressure ( r = 0.29 ; p = 0.03 ) , and fasting plasma glucose ( r = 0.3 ; p = 0.04 ) . to better describe the relationship between sirt1 and metabolic syndrome , we first evaluated the association of individual metabolic syndrome components according to the revised atp - iii definition and sirt1 gene expression . we found that each metabolic syndrome component was associated with a significant reduction of sirt1 gene expression ( fig . furthermore , when the level of sirt1 expression was plotted against the number of metabolic syndrome components in each subject , there was a trend of sirt1 downregulation with components clustering . compared with subjects with no component , sirt1 downregulation was statistically significant after - adjusting when at least three components were present together , allowing the diagnosis of metabolic syndrome ( fig . interestingly , among patients without metabolic syndrome , those belonging to the insulin - resistant group showed a significant sirt1 downregulation compared with insulin - sensitive subjects ( fig .1 h ) . to further clarify these associations , we ran a stepwise multiple regression analysis , which showed that age and the number of metabolic syndrome components were significantly correlated with sirt1 gene expression independently of sex , of all the parameters that define metabolic syndrome components and si ( supplementary table 4 ) . finally , as metabolic syndrome components are known cardiovascular risk factor , we looked for an association between sirt1 downregulation and carotid imt , a marker of early atherosclerosis : we found a significant negative correlation between sirt1 gene expression and maximal carotid imt ( fig . insulin resistance , elevated glucose , and systemic ffa levels are significant contributors of the pathophysiological aspects associated with metabolic syndrome . furthermore , hepatic sirt1 is an important factor in the regulation of glucose and lipid metabolism ( 20 ) . based on these previous data , and in the light of our in vivo observations , we hypothesized that high glucose and ffa levels might be involved in the cellular regulation of sirt1 expression . therefore , we investigated the effects of glucose , insulin , and palmitate acid in thp - 1 cells , in vitro . as shown in fig .2 a , gene expression of sirt1 decreased significantly after 24 h of treatment with 20 mmol / l glucose , reaching the maximal reduction after 48 h ( 20 mmol / l mannitol was used as osmotic control ) . consistently , sirt1 protein level decreased significantly after 48 h of glucose treatment ( fig . a similar effect was also induced by 10 mmol / l glucose ( not shown ) . fatty acids are potent nutrient modulators of insulin resistance . therefore , we incubated thp - 1 cells with representative saturated ( palmitate ) and unsaturated ( linolenic ) fatty acids for 3 and 24 h. treatment of thp - 1 cells for 24 h with palmitate ( 500 mol / l ) markedly reduced sirt1 gene ( fig . 2c ) and protein ( fig .2 d ) expression , whereas no effect was seen in linolenic acid ( 500 mol / l ) treated thp - 1 cells . nmol / l ) did not modify the expression of sirt1 ( data not shown ) . mmol / l ) did not produce any significant effect on sirt protein expression ( supplementary fig . a and b : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 3 , 24 , and 48 h. sirt1 gene ( a ) and protein ( b ) expression analysis was performed by q - pcr and western blot , respectively . c and d : thp - 1 cells were incubated in presence or absence of ffas ( 500 mol / l palmitic acid or 500 mol / l linoleic acid ) for 3 and 24 h. sirt1 gene ( c ) and protein ( d ) expression analysis was performed by q - pcr and western blot , respectively . data are expressed as mean of six experiments se , * p 0.05 . previous studies have demonstrated that high glucose reduced sirt1 expression leading to increased p53 acetylation ( 21 ) . therefore , we measured the effects of high glucose and palmitate on the acetylation of p53 in thp - 1 cells .3 a , high level of glucose and palmitate increased acetylated p53 in comparison with control cells . to confirm the role of sirt1 in the regulation of p53 acetylation induced by high glucose and palmitate , we knocked down sirt1 with sirna in thp - 1 cells .3 b , sirt1 protein content was reduced by 70 % , and the levels of p53 acetylation were constitutively higher in sirna sirt1 cells than in control cells ( fig . then , we treated the cells with resveratrol ( 250 mol / l ) , a known sirt1 activator , and measured the level of p53 acetylation in cells exposed to high glucose or palmitate . as shown in fig .3 d and e , resveratrol decreased p53 acetylation in thp - 1 cells treated with high glucose or palmitate , but not in sirna sirt1 cells . these data show that increased acetylation of p53 by high glucose and palmitate can be reversed by resveratrol , and that this effect is sirt1 dependent . effect of resveratrol on glucose - and palmitate - induced p53 acetylation in thp - 1 cells with and without sirt1 knockdown . a : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 48 h or with palmitic acid ( 500 mol / l for 24 h ) . sirt1 expression was evaluated by q - pcr ( b ) and western blot analysis ( c ) . d : thp - 1 cells were also cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 48 h or with palmitic acid ( 500 mol / l ) for 24 h in presence and absence of resveratrol ( 250 mol / l ) and sirna sirt1 cells . the level of p53 acetylation was determined by immunoprecipitation followed by immunoblot against acetylated lysine residues . data are expressed as fold increase normalized to control and expressed as mean of three experiments se , * p 0.01 . it is well known that high glucose and fatty acids generate ross in various cells , including monocytes ( 22,23 ) . thus , we evaluated the effects of high glucose and palmitate on ros production in thp - 1 cells . both 20 mmol / l glucose and palmitate increased ros production and oxidative stress in thp - 1 cells , and these effects were abolished by resveratrol ( fig .4 a and b ) . to confirm that an increase of ross may regulate sirt1 protein level , we treated cells with h2o2 ( 250 mol / l for 24 h ) : sirt1 protein level was decreased and p53 acetylation dramatically increased , although resveratrol attenuated these effects ( fig . effects of resveratrol on glucose - and palmitate - induced ros production , p53 acetylation , and jnk activation in thp - 1 . a and b : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose for 3 , 24 , and 48 h ( a ) or with palmitate ( 500 mol / l ) for 3 and 24 h in presence and absence of resveratrol ( 250 mol / l ) ( b ) . c and d : thp - 1 cells were treated with h2o2 ( 250 mol / l for 24 h ) , in presence and absence of resveratrol . the level of p53 acetylation was performed by immunoprecipitation followed by an immunoblot against acetylated lysine residues . e : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l , 48 h ) glucose or with palmitate ( 500mol / l for 24 h ) in presence and absence of resveratrol ( 250 mol / l ) and in sirna sirt1 cells . the level of jnk phosphorylation ( p - jnk ) was measured by western blot . f : densitometric analysis of p - jnk after normalization for total jnk in thp - 1 cells . g and h : effects of high glucose and palmitate on nampt expression and nad cellular content : thp - 1 cells were cultured under normal ( 5.5 mmol / l ) or high ( 20 mmol / l ) glucose or with palmitate ( 500 mol / l ) for 3 , 6 , 24 , and 48 h. nampt expression was expressed as fold change versus the control condition ( 5.5 mmol / l glucose and no palmitate ) ( g ) . nad was quantified in thp - 1 cells exposed to high glucose ( 20 mmol / l ) or palmitate ( 500 mol / l ) for 24 h ( h ) . the values are expressed as mean fold increase of 36 experiments over control se , * p 0.01 versus basal or control . we investigated the effects of high glucose and palmitate on the activation of jun nh2 - terminal kinase ( jnk ) . this phenomenon was abolished in sirna sirt1treated cells , suggesting that it is sirt1 dependent ( fig . nicotinamide phosphoribosyltransferase ( nampt ) is the rate - limiting factor in nad biosynthesis , and sirt1 protein expression is regulated by the level of nad . therefore , we tested whether high level of glucose or palmitate modulates nampt expression in thp - 1 cells . gene expression of nampt markedly decreased after 6 - h high glucose and palmitate treatment ( fig . accordingly , high glucose and palmitic acid reduced the levels of intracellular nad in thp - 1 cells in comparison with cells grown at normal level of glucose ( fig . this set of both in vivo and in vitro studies offers important novel insights on the relationship among sirt1 , insulin resistance , and metabolic syndrome . the major result from the in vivo study is that gene and protein expression of sirt1 in pbmcs is significantly reduced in relation to insulin resistance and metabolic syndrome . this result is corroborated by the direct correlation between sirt1 expression and a dynamic measure of insulin sensitivity , as well as by the correlation between sirt1 expression and the number of metabolic syndrome components . although there is considerable disagreement on the underlying metabolic syndrome pathophysiology , clinical and experimental data support a link between sirt1 and metabolic syndrome . interestingly , the only clinical variable related to sirt1 beyond metabolic syndrome components was age , which is physiologically related to sirt1 function as a life - span determinant gene . the link between sirt1 and glucose homeostasis is substantiated by the sirt1 downregulation observed in subjects with pre - diabetes , compared with subjects with normal glucose regulation . thus , the expression of sirt1 in pbmcs appears as a novel marker of insulin resistance , metabolic syndrome , and pre - diabetes . obviously , we can not equate that the biological regulation of sirt1 in pbmcs parallels that in insulin - sensitive tissues ; nonetheless , we anticipate that the gene and protein expression of sirt1 in pbmcs may represent a potential and novel pathogenic pathway of metabolic syndrome . in support of this , a recent study demonstrated that sirt1 gene expression in peripheral blood cells of obese subjects was modulated by caloric restriction , suggesting that sirt1 may have an important role in different types of tissue ( 24,25 ) . other data from the literature support this view , because sirt1 has been suggested to be involved in the regulation of glucose homeostasis : it controls hepatic glucose metabolism by interacting with pgc - 1 , a transcriptional coactivator that controls glucose metabolism in the liver ( 6 ) . sirt1 increases lipolysis ( 11 ) , stimulates foxo and adiponectin gene expression ( 26 ) , and is directly involved in intracellular insulin pathways by selective inhibition of insulin - induced tyrosine phosphorylation of insulin receptor substrate - 2 ( 27 ) . sirt1 also improves insulin sensitivity under insulin - resistant conditions by repressing protein tyrosine phosphatase - 1b ( 28 ) . mice overexpressing sirt1 on a high - fat diet show lower lipid - induced inflammation along with better glucose tolerance ( 29 ) . it should be noted that the systemic effects of sirt1 may be more complex than expected : for instance , liver - targeted sirt1 knockdown was shown to decrease basal hepatic glucose production and increase hepatic insulin sensitivity in type 2 diabetic rats ( 30 ) . this paradoxical result , compared with other studies ( 29 ) , is probably related to the tissue - specific versus the systemic effects of sirt1 modulation , which differ in the regulation of some soluble mediators , such as adiponectin . nonetheless , available experimental data collectively indicate that activation of sirt1 may have a potential beneficial role in humans . these findings are clinically relevant , because decreased sirt1 may be associated with a series of metabolic events predisposing to a shorter life span , as shown in experimental animal models . in zucker fa / fa rats , hyperinsulinemic - euglycemic clamp studies demonstrate that sirt1 activators improve whole - body glucose homeostasis and insulin sensitivity in adipose tissue , skeletal muscle , and liver ( 31 ) . our data suggest that sirt1 expression is decreased in subjects who are insulin resistant , specifically in those who are glucose intolerant , and particularly in those with several components of metabolic syndrome . a challenging hypothesis is that , in these subjects at risk for premature cardiovascular disease , sirt1 determines life span and disease progression . we lend indirect support to this hypothesis by showing a significant negative correlation between sirt1 gene expression and carotid imt , an index of early atherosclerosis , supporting the hypothesis that low sirt1 is proatherogenic . as recently shown by cardellini et al , sirt1 may play an important protective role in vascular biology ( 32 ) . unfortunately , in vivo observations do not allow to define cause - effect relationships : thus , it is not clear whether low sirt1 expression predisposes to metabolic syndrome and insulin resistance , plays a role in disease pathophysiology , or simply is an epiphenomenon of metabolic abnormalities . therefore , an additional aim of the present study was to test the hypothesis that excessive substrate availability , such as that present in patients with metabolic syndrome , may directly influence sirt1 in cells that may be involved in both atherosclerotic plaque formation and visceral fat inflammation . the evidence that glucose and palmitic acid induce sirt1 downregulation in thp - 1 cells supports a model whereby biochemical factors acting in the setting of metabolic syndrome , such as glucose intolerance and impaired release of free fatty acids , are responsible for sirt1 downregulation . our data demonstrate also that the mechanisms linking high glucose and palmitate to sirt1 impairment include reduction of nampt expression with consequent depletion of cellular nad ( a sirt1 activator ) , together with increased generation of ross . as a consequence of sirt1 downregulation in glucose - and palmitate - treated thp - 1 cells , acetylation of p53 increased significantly , an event that is typically followed by transcription - independent proapoptotic signals . in addition , we show that sirt1 downregulation leads to activation of the stress - sensing pathway of jnk , which has been related to macrophage infiltration into adipose tissue and to whole - body insulin sensitivity ( 33 ) . these pathways triggered in monocytes by glucose and palmitate through sirt1 downregulation may be important not only in the pathophysiology of metabolic syndrome but also in terms of cardiovascular disease . our findings testify that the interaction between fatty acids and sirt is reciprocal ; it was previously shown that sirts are important regulators of lipid oxidation through activation of the transcriptional coactivator pgc - 1 ( 6 ) , although almost unknown is the regulation of sirt expression by ffas . our in vitro study sheds light on the complex relationship between substrate availability and sirt : we specifically found that a saturated ffa ( palmitate ) significantly decreases sirt expression , whereas an unsaturated ffa ( linoleate ) did not . at present , we can not affirm that this in vitro effect takes place also in vivo . despite subjects with insulin resistance having a significantly lower suppression of ffa concentration during glucose loadhowever , we can not provide data on ffa plasma composition of our patients to test the relationship between circulating saturated fatty acids and sirt expression . glucose and palmitate activated the p53 and jnk pathways , which have been implicated in both obesity ( 34,35 ) and atherosclerosis ( 36,37 ) . even if we can not definitely rule out other pathways linking glucotoxicity and lipotoxicity to jnk and p53 activation ( fig .5 ) , sirt1 appears to act as a transducer of negative metabolic signals conveyed by excess nutrients . moreover , sirts are central modulators of signaling networks critical for maintaining vascular endothelial homeostasis , especially in the setting of diabetes ( 3840 ) . thus , our in vitro studies confirm that sirt1 could be a potential therapeutic target to improve the metabolic milieu and prevent cardiovascular complications . herein , we demonstrate that resveratrol , a phytoalexin provided with antioxidant properties that is found in red wine , is able to limit the negative effects of glucose and palmitate by counteracting sirt1 downregulation . proposed mechanism whereby glucose and palmitate downregulate sirt1 and induce activation and inflammation in monocytes . according to the data presented , high glucose and palmitate impair expression and function of nampt , thus reducing cell nad content . as sirt1 is nad dependent , this leads to reduction of expression and activity of sirt1 . in parallel , both high glucose and palmitate promote production of ross , which may themselves reduce sirt1 . sirt1 downregulation is then responsible for high p53 acetylation and jnk activation , which are related to cell activation and inflammation . we can not rule out alternative pathways by which glucose and palmitate activate jnk and p53 independently of sirt1 ( dashed lines ) . we found no alteration of sirt2 , sirt3 , sirt4 , and sirt5 in human metabolic syndrome , insulin resistance , or pre - diabetes in vivo , even if many relationships have been previously reported between these sirtuins and metabolic disorders . for instance , it was recently shown that sirt2 , the most abundant sirtuin in adipocytes , inhibits differentiation of these cells , promotes adipogenesis through modulation of foxo1 activity , and may play a role in controlling adipose tissue mass and function ( 41 ) . it has also been shown that in pbmcs , sirt2 is responsive to caloric restriction ( 42 ) . the lack of difference in sirt2 expression in our study is related to the fact that caloric restriction is possibly a major stimulus for the change in its expression : indeed , our study subjects were all assessed after at least 12 h of fasting , a period that is probably too short to detect an increase in sirt2 expression . we observed a reduction in sirt6 and sirt7 expression in metabolic syndrome , which did not reach statistical significance but deserves further investigation because sirt6 has been recently described as a critical factor in mammalian aging , as its absence creates a remarkable phenotype in rodents that includes metabolic alterations , loss of subcutaneous fat , and premature death ( 43 ) . similarly to sirt2 , cellular sirt6 levels are increased by calorie restriction as well , although it was shown that this increase appears to result from protein stabilization rather than augmented gene expression ( 44 ) . in conclusion , we provide , for the first time in humans , evidence that insulin resistance and metabolic syndrome affect sirt1 gene and protein expression in pbmcs . glucose and saturated fatty acids may be implicated in sirt1 downregulation through induction of oxidative stress and depletion of nad . although we can not translate this observation to insulin - sensitive cells , we hypothesize that this relationship may be true also in tissues that play a relevant role in determining insulin resistance . in addition , expression of sirt1 in circulating blood cells may represent a novel marker for a disturbed metabolism , as well as a pathogenic actor in monocyte - mediated atherosclerotic process , through p53 and jnk pathways .\noutput:\n" }, { "from": "agent", "value": "objectivesirtuins ( sirts ) are nad + - dependent deacetylases that regulate metabolism and life span . we used peripheral blood mononuclear cells ( pbmcs ) to determine ex vivo whether insulin resistance / metabolic syndrome influences sirts . we also assessed the potential mechanisms linking metabolic alterations to sirts in human monocytes ( thp - 1 ) in vitro.research design and methodssirt1 - sirt7 gene and protein expression was determined in pbmcs of 54 subjects ( 41 with normal glucose tolerance and 13 with metabolic syndrome ) . insulin sensitivity was assessed by the minimal model analysis . subclinical atherosclerosis was assessed by carotid intima - media thickness ( imt ) . in thp - 1 cells exposed to high glucose or fatty acids in vitro , we explored sirt1 expression , p53 acetylation , jun nh2 - terminal kinase ( jnk ) activation , nad + levels , and nicotinamide phosphoribosyltransferase ( nampt ) expression . the effects of sirt1 induction by resveratrol and of sirt1 gene silencing were also assessed.resultsin vivo , insulin resistance and metabolic syndrome were associated with low pbmc sirt1 gene and protein expression . sirt1 gene expression was negatively correlated with carotid imt . in thp - 1 cells , high glucose and palmitate reduced sirt1 and nampt expression and reduced the levels of intracellular nad + through oxidative stress . no effect was observed in cells exposed to linoleate or insulin . high glucose and palmitate increased p53 acetylation and jnk phosphorylation ; these effects were abolished in sirna sirt1treated cells . glucose - and palmitate - mediated effects on nampt and sirt1 were prevented by resveratrol in vitro.conclusionsinsulin resistance and subclinical atherosclerosis are associated with sirt1 downregulation in monocytes . glucotoxicity and lypotoxicity play a relevant role in quenching sirt1 expression ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 79 - year - old female patient with weight of 58 kg and height of 156 cm visited the hospital for lumbar pain accompanied by referred pain in the left hip and the rear thigh . she had no special past history but a thyroid isthmectomy to remove thyroid nodule in 2005 . she was normal in a blood test , a chest x - ray , and a thyroid function test but had rbbb in ecg . in a pulmonary function test , forced vital capacity ( fvc ) was 1.42 l ( 72.3 % of an expected value ) , forced expiratory volume at 1 second ( fev1 ) 1.13 l ( 71.1 % of an expected value ) , and fev1 / fvc 79.4 % ; which were mild restrictive patterns . however , arterial blood gas analysis was normal . in physical examination , we could find a 3 cm sized scar from the isthmectomy , 2 cm above the sternal notch and her breathing sound was normal at both lungs . patient did not receive any preanesthetic medication and she inhaled 100 % oxygen sufficiently after standard monitoring with ecg , non - invasive blood pressure monitor and a pulse oximetry . general anesthesia was induced with lidocaine 40 mg and propofol 80 mg , and rocuronium 40 mg was injected for muscle relaxation after eyelid reflex disappeared . ventilator was adjusted at 550 ml of tidal volume and 10 times per minute of the respiratory rate . anesthesia was maintained with sevoflurane 1.5 - 2.0 vol % in a 50 % of oxygen - nitrous oxide balance . end tidal carbon dioxide tension was maintained at 30 - 35 mmhg . to monitor invasive blood pressure , a 20 g catheter was introduced into the right radial artery and a foley catheter was inserted . for a surgery , then surgeon began disinfecting around the operation site . while arranging her head on a head rest , the peak airway pressure surged into 35 to 40 mmhg , the tidal volume reduced to 50 to 100 ml , and her breathing sounds were rarely heard from both lung fields . there was resistance when we tried to insert a suction tube to suck up the endotracheal tube into which the suction tube could not move . we observed the endotracheal tube with a flexible fiberoptic bronchoscopy and reddish soft tissue was almost obstructing the tube ( fig .1 ) . although we moved the tube back up to 19 cm while observing it with the bronchoscopy , the airway obstruction continued . when we moved it further up to 23 cm again , the obstruction reduced a little bit . as we pushed the front neck lightly with hand , the obstruction was almost eliminated but not completely . we laid down the patient on the back and inspected carefully her neck and chest areas . the skin right up the part where the right clavicle and the sternum meet together was somewhat protruded , and the pulse was felt behind the clavicle with hands . when we observed it in the supine position with the bronchoscopy , the internal lumen was maintained at the depth of 23 cm of the endotracheal tube . the tube was located above the carina and it was not one lung ventilation . at this time , the tidal volume was 500 ml and the peak airway pressure was 18 mmhg at the respiratory rate of 12 times per minute . position change to prone allowed ventilation but not as good as in the supine position . supporting the patient 's neck witha cotton roll helped to keep the tidal volume at 500 ml , the peak airway pressure at 22 mmhg and normal breathing sounds . after confirming with the fiberoptic bronchoscopy that the airway was obtained and the tip of the tube is located above the carinathe operation was completed without any special problem . after we confirmed that the patient was recovered with consciousness and spontaneous breathing , the endotracheal tube was removed . computed tomography on the neck and the chest showed that the trachea was deviated to the downward right side from the thoracic inlet at which a tortuous innominate artery contact with the trachea ( fig . the distal innominate artery was met the trachea as twisted . in the computed tomography measurement , the innominate artery contact with the trachea in the depth of 19.6 cm to 21.3 cm along the trachea from the upper central incisor . when we checked the chest x - ray backward , which was taken at the preoperative examination , it was normal without lesion in lung parenchyma but the trachea was deviated to the right side from the thoracic inlet . as the patient has had no subjective symptom related to vascular problems , she did not take any action against it . the patient was discharged after being noticed that she needs to talk about the history to an anesthesiologist in case of general anesthesia in the future . vascular malformation that obstructs the airway occurs relatively commonly in infants and children . in a serious casethus , it is rarely found in an adult . in general , it companies with symptoms like respiratory difficulty in exercise , repeated pneumonia , bronchitis , continued stridor in the upper airway , and dysphasia when the vessel compresses the esophagus together . if the innominate artery originates in the distal aortic arch , the artery should turn around the front of the trachea when going to the right upper quadrant to reach to the right thracic apex . when the artery is big and tighthowever , there is a dispute on the classification of the anterior tracheal compression by innominate artery into one of vascular malformation that causes airway obstruction . in the past , there were excessive diagnoses and treatment of innominate artery compression and tracheomalacia was regarded as a major cause of pathophysiology rather than external pressure . in addition , most normal infants had compression on anterior tracheal without respiratory symptoms when the innominate artery came across the trachea in radiologic examinations . it is relatively easy to assess whether the innominate artery compresses the trachea or not . in a simple chest posteroanterior x - ray viewmeanwhile the lower part of the trachea is narrow and a finger pressed trace is found in the tracheal anterior wall in the lateral view , the posterior wall is right and well arranged . moreover the simple x - ray helps us to distinguish whether the narrow trachea is caused by underdevelopment of tracheal cartilage by vascular malformations or by simple external compression . if it is caused by external compression , the narrow part is relatively constantly kept as narrow from the beginning to the end of a respiratory period . if the tracheal cartilage matters , a tracheal diameter increases in inspiration and decreases in expiration . computed tomography is useful to indentify the range of the narrowed area and the degree of obstruction , a change of a tracheal diameter and a location of the tracheal cartilage defect . as the magnetic resonance imaging is non - invasive and shows blood vessels , the heart , tracheobronchial tree , both systemic circulation system and the pulmonary circulation system , recently it is selected as a primary test of all types of vascular compression syndromes . it makes possible to assess functional factors of airway obstruction or intrinsic lesion such as tracheomalacia , tracheal stenosis , total tracheal cartilage ring , tracheal variation , as well as to know the location of an endotracheal tube in general anesthesia . we can determine the proper size and the depth of the endotracheal tube by evaluating the location and length of the compressed area and the degree of obstruction . in anesthesia of a patient with airway obstruction by vascular compressions , it is helpful not to use muscle relaxants while keeping self - respiration for maintaining the airway . although some forced expiration can prevent airway from being obstructed during the exhalation , excessive efforts during expiration or respiration in an unstable patient can aggravate tracheal obstruction in the dynamic intrathoracic cavity and further increase turbulent flow around the obstructed area . thus , it is important to understand a cause , a degree and a location of the damaged airway . when the trachea became too much narrow , the endotracheal tube should be located neighboring the lesion passing the narrow part to prevent the formation of edema or granulation tissue due to the tube . it is safe to insert a stent using a rigid bronchoscope or an endotracheal tube to obtain proper ventilation in a patient with serious tracheal collapse . in the case of the study , we considered correlation with a thyroid isthmectomy at the very beginning because the patient has a history of the operation . however , the operation scar at 2 cm upward from the sternal notch was distant from the area where the right clavicle and the sternum meet , at which pulse is felt . in addition , as the isthmectomy is to remove isthmus only while preserving the both thyroid lobes , it is too minimal invasive to cause complications such as adhesion or hematoma . although the tracheal cartilage defect could not be completely excluded , tracheomalacia or cartilage defect was not considered as a cause because the patient had no complaint on the respiratory system . airway obstruction by external compression is not common in adults whose trachea is completely matured . however , there is a case that adult male patient had severe tracheal obstruction due to the pseudomeningocele after induction of general anesthesia . thus we assumed that the airway obstruction in our patient was caused by external compression by blood vessels . in this case , the blood vessel does not encircle the trachea like a ring and the innominate artery is branched in the normal location of aortic arch . although the innominate artery is tortuous and goes in a bended shape , it does not compress the trachea directly and the patient has had no respiratory symptom . therefore it is reasonable to see the innominate artery as normal variation rather than malformation . when the patient changed the position into prone , the chest was compressed and thus innominate artery contact with the trachea compressed the trachea . as the endotracheal tube was inserted toward the carina , the tip of the tube might pass the compressed area and maintain the endotracheal lumen . in addition , we guess that the cotton roll supporting the patient 's neck in the prone position pushed the trachea backward and released the anterior tracheal compression by the tortuous artery at the thoracic inlet level to some extent . as the patient was old and had no respiratory problem for a life , we discharged her without special treatment . also , we recommended her to talk about the anesthesia - related history to an anesthesiologist in the future if it is necessary to intubate an endotracheal tube with general anesthesia because the tortuous innominate artery and the rightward deviated trachea can cause the tube obstruction again . as the airway obstruction by vascular malformations is rarely found , it can be misdiagnosed as a respiratory disease such as asthma when only respiratory symptoms occur . anesthesioloists should understand mechanical features of airway obstruction by vascular malformations in advance when conducting general anesthesia for a patient who has a respiratory symptom due to unidentified airway obstruction in order to make a diagnosis and treatment in a more accurate and rapid manner .\noutput:\n" }, { "from": "agent", "value": "tracheal compression by vascular anomalies in adults is uncommon and most related reports are of children . a 79 - year - old woman without any respiratory history underwent a lumbar spine surgery under general anesthesia . she suddenly developed airway obstruction after a position change from supine to prone . a fiberoptic bronchoscopy showed the obstruction of endotracheal tube . the obstruction was relieved after we changed the depth of endotracheal tube and supported the patient 's neck with a cotton roll . the surgery ended without any other event and the patient recovered safely . a computed tomography revealed the rightward tracheal deviation and tortuous innominate artery contact with trachea . the patient did n't manifest any respiratory related symptoms during postoperative period , and she was discharged without any treatment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the healthcare system has witnessed tremendous progress during the last century on several fronts . several infectious diseases , such as polio and smallpox , have been practically eradicated among humans . despite these advances , other conditions such as cancer , coronary artery diseases , hiv , and many morethis led the way to new advancements in the areas of molecular genetics , life sciences , biotechnology , and molecular biology . despite the fact that 99.9 % of human dna sequences are identical , the 0.1 % variation cascades into huge differences in disease susceptibility , disease progression , and response to intervention among individuals . since the human genome project , efforts have been underway to adopt genomic medicine in order to : ( i ) identify specific genes that are responsible for common hereditary diseases and aberrations in major pathways leading to illness , ( ii ) elucidate the underlying molecular mechanism of disease , ( iii ) identify potential therapeutic targets , ( iv ) design small - molecule drugs to intervene in the disease processes , ( v ) predict responses to treatment , and ( vi ) predict responses to drug intervention . personalized medicine is critically important and hence is increasingly favored in many areas of medicine , especially in oncology due to the complexities of the disease and lethality of the chemotherapeutics . a meta - analysis of 39 prospective studies from the us hospitals estimated the overall incidence of serious adverse drug reactions at a rate of 6.7 % . in this study , more than 2.2 million hospitalized patients had serious adverse drug reactions and ~ 106,000 patients had fatal adverse drug reactions , making it between the fourth and sixth leading cause of death in the united states . the cost of drug - related morbidity and mortality was estimated to be more than us $ 177 billion in the year 2000 . in addition to these acute adverse drug reactions , patients receiving incompatible and inordinate treatments can suffer several long - term medical and socioeconomic complications . for example , relapsed cancer , secondary neoplasms , heart disease , and many other chronic medical conditions are prevalent among long - term survivors of cancer . personalized treatment , when applied in clinical settings , helps to answer two important questions : ( i ) for a given individual , what drug or combination of drugs should be given to treat a specific disease condition ? and ( ii ) how much and when should the drug ( s ) be administered ? pharmacogenomics , a field that has evolved in the last decade , has been highly recommended for several disease conditions toward predicting the response for a planned treatment protocol on an individual basis and has been put into practice in some cases . pharmacogenomics has shown great promise in predicting the treatment response for a given patient and has demonstrated the ability to alleviate much of the morbidity that can be associated with treatment , making it an excellent tool to address the first of the two questions above . however , because the purview of pharmacogenomics is limited to genotypic variation , it has limited scope to comprehensively answer the second question , which is at least as important to personalized treatment . in addition to genetic variation , several other nongenetic molecular mechanisms interface within the human body . the manifestation of a specific gene sequence into a final disease outcome , with or without drug intervention , proceeds at various levels . first , the genes are transcribed and translated into proteins which act as enzymes in numerous metabolic reactions . if a specific gene is implicated in drug disposition , the gene expression also affects the distribution , metabolism , and elimination of the compound . the resultant phenotypes at the bio - atomic or - molecular level then exert phenotypic changes at the cellular , tissue , and organ level through their influence on the disease and response pathways . variations / aberrations , not only in gene sequence and expression , but in any of the steps mentioned above , will result in an unexpected outcome at an organismal level . figure 1 enumerates the cascade of events and validated processes contributing to the variations in these steps . the clinical implication of these events is the possibility of observing a subgroup of patients with same genotype but unique proteome , metabolome , and cellular responses , which results in completely different treatment outcomes for each individual patient . the key factors , besides gene expression , responsible for such consequences include but are not limited toepigenetic factors , nonheritable functionally induced ( extragenetic ) factors , stochasticity in biochemical reactions , interactions in signal transduction and metabolic networks , environment , nutrition / lifestyle , organ failure ( renal , hepatic ) , coadministered drugs , pregnancy , disease type , and microflora dynamics . exclusive , isolated application of pharmacogenomics has therefore come under scrutiny by some in the literature and has resulted in a few new clinical guidelines that are broadly accepted for management of patients . the foregoing discussion substantiates the need for developing procedures to accurately measure and / or predict the phenotypic outcome for a specific pharmacogenomic variant . in addition , methodologies must also be developed to determine optimal dosing of drug to realize a specific phenotypic outcome . traditionally , pharmaceutical companies prescribe the optimal dosing information based on clinical trials conducted at a population level of the general public and patients . the adoption of standard - dose - for - all approach from drug labels and trial - and - error approach to titrate the patient to maximum tolerated dose has resulted in severe toxicity in some patients and insufficient treatment in others . the so - called evidence - based medicine and the adoption of treatment standards based on large epidemiological studies or randomized controlled trials have significantly hampered the efforts to truly personalize the medical practice . a paradigm shift from evidence - based medicine to mechanism - based medicinewill ensure that each patient is treated according to his / her own mechanism and thus should be the impetus for expanding implementation and utilization of personalized medicine . in this work , we highlight some of the limitations associated with the isolated application of pharmacogenomics to personalize treatment . specific instances of biomolecular processes responsible for such outcomes are analyzed in detail with respect to each level of phenotype . finally , emerging tools and methodologies to augment the potentials of pharmacogenomics for a comprehensive realization of personalized treatment are discussed . we first provide an introduction to the concept of pharmacogenomics , its prevalence , strengths , and limitations in personalizing treatment ( see pharmacogenomics and gene expression ) . we will then appraise the complexities in the molecular and cellular level phenotypic manifestation of gene sequences , highlighting potential processes responsible for this variation . the advantages of measuring / predicting cellular responses and challenges are also discussed ( see complexities in predicting molecular phenotypes ) . finally , we highlight some of the emerging technological and quantitative tools to extend the scope of personalized treatment beyond pharmacogenomics ( see future directions and emerging technologies ) . gene sequencing and expression profiling are excellent tools for discerning variations in disease susceptibility , disease diagnosis and classification , and prognosis for a given treatment . within the realm of personalized treatment , pharmacogenetics garners prime attention in utilizing gene sequencing tools for clinical translation . pharmacogenetics aims to provide insight into the influence of genetic variants on the molecular biology of disease and response to drug intervention . the concept of genetic polymorphism in the human genome forms the core of pharmacogenomics . common sources of genetic polymorphisms include single - nucleotide polymorphisms ( snps ) , nucleotide repeats , deletions , insertions , and recombination . pharmacogenomics possesses a great potential to propel the development of new therapeutic agents and / or administer existing drugs to a targeted subgroup of the patient population who display a specific genotypic trait . gene expression analysis and pharmacogenomics are being considered as companion diagnostic tools ( tests recommended when prescribing a specific medication ) in several cases . the first conceivable utility of gene expression variation in the disease cycle is the elucidation of disease susceptibility . a case control study , conducted to demonstrate the association of nramp1 gene and susceptibility to tuberculosis , estimated that the odds of developing tuberculosis is 4.07 among subjects who are heterozygous for two nramp1 polymorphisms . genetic polymorphism has also been exploited in many studies to diagnose and classify the existing categories of many cancers . in a landmark work on molecular classification of cancer using gene expression , dna microarray technique was utilized to distinguish between acute myeloid leukemia and acute lymphoblastic leukemia . a study devoted to characterizing diffuse large b - cell lymphoma , a common form of non - hodgkin 's lymphoma , using microarray gene expression profile , revealed two molecularly distinct forms of diffuse large b - cell lymphoma . these two new subtypes , germinal center b - like diffuse large b - cell lymphoma and activated b - like diffuse large b - cell lymphoma , are representative of different stages of b - cell differentiation and predict overall prognosis . these systematic and unbiased elucidations of disease subtypes , based on global gene expression profiles , not only assist clinicians in choosing appropriate treatment strategies that maximize efficacy but also minimize unwarranted side effects . gene expression profiling also helps to direct the prediction of prognosis of the disease for a specific treatment regimen . one of the well - studied and clinically adopted examples of gene expression techniques is the demonstration of the relationship between her - 2 / neu gene and a wide variety of human cancers . amplification of her - 2 / neu gene or overexpression of her - 2 / neu protein is observed in as many as 34 % of the breast cancer patients . in these patients , abnormalities in her - 2 / neu gene and proteinher - 2 / neu gene amplification also predicts node status , tumor grade , overall survival , and time to relapse in breast cancer patients . one of the classical examples of applications of pharmacogenetics is the incidence of genetic polymorphism in thiopurine s - methyltransferase ( tpmt ) gene among humans . to date , it serves as a prototypic system for displaying the potential for the utilization of a pharmacogenomics - based approach to individualized drug dosing within clinical settings . tpmt is a cytosolic drug - metabolizing enzyme that plays a key role in the metabolism of purine antimetabolites such as 6 - mercaptopurine ( 6 - mp ) and azathioprine . thiopurine is an immunosuppressant that is used to treat childhood acute lymphoblastic leukemia , inflammatory bowel diseases , autoimmune diseases , and immunosuppression following solid organ transplantation . tpmt catalyzes the s - methylation of thiopurines and promotes pathways leading to inactive metabolites of methylated mercaptopurines . hence , tpmt activity level is inversely proportional to the amount of active cytotoxic metabolite , 6 - thioguanine nucleotide ( 6 - tgn ) , produced . a total of 21 genetic polymorphisms have been identified in the tpmt gene which correlate with decreased tpmt activity levels and hence thiopurine - induced toxicity . tpmt * 1 is the wild - type allele ; tpmt * 3a is the most common variant allele , found in ~ 5 % of caucasians , where s tpmt * 3c is the most common variant allele found in east asian population with a frequency of ~ 2 % . the presence of tpmt * 3a and * 3b results in extremely low or no tpmt enzyme activity , which leads to elevated levels of 6 - tgn . if treated with a standard dose , patients who are homozygous for these alleles will encounter life - threatening myelosuppression and , in some cases , even secondary malignancies . thus , it was suggested that patients with low tpmt expression should be treated with substantially lower doses of thiopurines . on the other hand , many clinical studies concluded that efficacy will be compromised in patients with high tpmt activity who are treated with standard dosing schedules , and therefore , treatment with higher doses is recommended . in all the above examples , pharmacogenomics provides some vital information for predicting treatment outcome , but they are limited to population - level variations . in some sense , it is equivalent to segregating the population into a few response groups and disregarding intragroup variations . to be complete and effective , following the first step of genetic personalization , individuals in each subgroup must be characterized based on the downstream response of that genotype . it is well - known that within a specific genotype , there is a distribution of phenotypes across the patient population ( figure 2 ) . for example , in the case of the tpmt gene , although there are only five important genotypes in the human , there are as many enzyme activity levels ( the manifestation of the tpmt gene ) as there are patients . no two patients with same tpmt genotype will have an identical enzyme activity level . in addition , only two - thirds of the total variance in tpmt activity is accounted through genotyping . recently , for warfarin , an important us food and drug administration approved drug to bear the pharmacogenomics information in the label , pharmacogenomic - guided treatment has been shown to have no significant difference in clinical outcome compared with the traditional treatment . other studies also point to declining scope for pharmacogenomics in guiding dose regimen , given the cost and effort involved . complex diseases such as cancer , hiv infection , and many others are invariably treated with complex treatment regimens that often involve multiple drugs . when the drugs are influenced by more than one gene independently , pharmacogenomics - based approach alone may not be sufficient to predict the drug response . consider a treatment involving a combination of three drugs and having genetic polymorphism in each of the drug - metabolizing enzymes with three different gene expression patterns ( high , intermediate , and low ) . this will produce 27 ( 3 ) unique gene expression profiles in a given patient population . if one or more drugs are also substrates for drug transporters , where genetic polymorphism and hence three different gene expressions are possible , the number surges to 81 ( 3 ) . when this is then translated into phenotypes and further into cellular response , it will produce a significant variation in the response . besides clinically relevant snps and their influence over treatment outcomes , there are several other putative genetic polymorphisms that are yet to be characterized , which may play a significant role in determining the drug response . in light of more than 150,000 validated snps , proteins , and interactions between them , this works out to be a mind - boggling diversity ! however , when phenotypes are measured , which include the drug concentrations and / or cellular response , the characterization of patients may correlate more closely with clinical observations . additional complexity surfaces when the findings of the gene expression profiles are translated to the global population of different ethnic origin due to the inherent variation in disease susceptibility , risk , incidence , and response . for example , there is a significant variation observed in vincristine - induced peripheral neuropathy among caucasian and african - american patients undergoing treatment for precursor b - cell acute lymphoblastic leukemia . pharmacogenomic studies of vincristine - metabolizing enzyme cyp3a5 revealed the polymorphic expression between different races with ~ 70 % of african - americans expressing cyp3a5 compared with 20 % of caucasians . dose interruptions and average toxicity grades are significantly lower in african - american patients as a result of elevated metabolism and clearance of vincristine . if the dosing for african patients were to be determined based on studies on caucasians , these patients will receive significantly lower exposure to vincristine . another important consideration to expand the scope of pharmacogenomics is related to its reliance on decision making under static conditions . pharmacogenomics uses gene sequence and gene expression snapshots with the assumption that deterministic evolution of molecular events leads to predictable phenotypes . it considers each genetic variation as an independent causal factor for the observed response . it fails to take into account variation in transport limitations and the spatial heterogeneity of biochemical reactions . however , human physiology is a complex , dynamical system , and often , therapeutic responses are a manifestation of the interplay between many levels of physiological processes . furthermore , human physiology is complicated by homeostatic feedback loops , molecular cross talk , and bypass mechanisms that can lead to unexpected therapeutic responses . these events might confound many physiological processes including , but not limited to , drug metabolism and disposition , drug transport , cellular targets and signaling pathways , and cellular response pathways ( e.g. , apoptosis , cell cycle control ) . thus , one must remain circumspect about the isolated assessment of pharmacogenomics ( or any other upstream biomarker ) as a stand - alone personalizing tool . the scope for controlled clinical trials , a gold standard accepted by the us food and drug administration for validating efficacy and safety of a pharmacogenomic tests , to validate and adopt to the clinical practice are also limited as the resulting number of groups make such studies an expensive and time - consuming exercise . to this end , pharmacogenomics has not realized its fullest potential in some of the drug disease applications that were deemed as a classical case for pharmacogenomics - based personalization . it therefore emerges that a more comprehensive approach to personalization , encompassing and integrating many dimensions and levels of human physiology , is needed to portray a complete picture of ongoing drug disease dynamics . from the foregoing discussion , it is clear that gene sequencing and gene expression profiling play key roles in identifying patient subgroups , but individual patients are yet to be characterized on the phenotypic distribution . there are several levels of phenotypes , and a specific one depends on the objective at hand . in this work , we classify phenotypes into two broad categories : ( i ) molecular phenotypes , an immediate effect of a specific gene sequence , and ( ii ) cellular phenotypes , the influence of molecular phenotypes on various cell populations . we define molecular phenotypes as the biomolecular manifestation of a gene sequence , which encompasses proteins , enzymes ( proteome ) , and metabolite concentrations ( metabolic phenotype ) . if a specific drug distribution and metabolism is found to be modified due to the above factors , the resulting drug concentration at various parts of the body is also considered as the molecular phenotype ( drug phenotype ) . molecular phenotypes interact with various cellular populations as drug transporters , inhibitors , and signaling molecules to produce a cellular phenotype . variations in phenotype arise due to numerous factors , including stochasticity in gene expression , transcriptional and translational noise , complexities in biochemical and signal transduction networks , nonlinearity in biochemical processes , and quasi - determinism in biological events . this leads to a nonbijective relationship ( a single gene producing more than one phenotypic trait and a specific phenotype resulting from the expression of several genes ) between genotype and phenotype . stochasticity in gene expression is one of the important factors that contributes to phenotypic variations observed in isogeneic cell populations . these stochastic events are triggered by transcriptional and translational fluctuation which , in turn , arises due to several factors such as random activation / repression of promoter , degradation of transcriptional and protein products , transcriptional and translational burst , feedback loops , etc . moreover , these gene regulatory functions fluctuate dynamically , making static gene expression profiles untenable for personalized treatment . besides quantitative variations in molecular contentsthe majority of drugs are metabolized by more than one enzyme ( e.g. , 6 - mp metabolized by tpmt , hgprt ( hypoxanthine - guanine phosphoribosyltransferase ) , and itpa ( inosine triphosphate pyrophosphatase ) and transported / eliminated by several other proteins , where gene variations and some of the above - mentioned processes are inevitable . the end result is the formation of cell populations with uniquely different proteomes and metabolomes from the same genomes . the resulting phenotype is not comprehensible through simple deductive reasoning . as such , it is not uncommon for two genetically identical persons from similar backgrounds to show significantly different clinical phenotypes in response to drug intervention . treated with 6 - mp encountered completely different clinical outcome , both in terms of efficacy and toxicity . one of the main reasons for treatment failure and variability in cellular response , despite the drug being at a therapeutically effective concentration in the plasma , is the development of multidrug resistance to therapeutic medications mediated by drug transporters . p - glycoprotein ( p - gp ) , which is a member of the atp - binding cassette ( abc ) family of proteins , is located on the plasma membrane and serves as drug efflux pumps . important members of this family include abcb1 and abcg2 ( bcrp ) . on the other hand , solute carrier super family of proteins , such as oatp family ( e.g. , oatp1b1 , oatp1b3 , and oatp2b1 ) , act as uptake transporters . together , they have the ability to uptake / efflux structurally and functionally dissimilar cytotoxic agents , thereby modulating the intracellular drug concentration . these genes display genetic polymorphism in humans which has profound impact on pharmacokinetics and clinical responses to many drugs . furthermore , stochastic and dynamic regulation of these genes result in heterogeneous population of three different types of cells intrinsically resistant , acquired resistant , and sensitive cells . intrinsically resistant cells acquire this phenotype due to a spontaneous mutation involving single or multiple random steps . acquired resistant phenotypes are initially sensitive to drugs but eventually develop drug resistance , also through random processes . recently , even sensitive cells have been shown to acquire the resistant phenotype from other resistant populations through the exchange of p - gp via microparticles and tunneling nanotubes . the evolution of these cellular fractions during treatment has the greatest impact on clinical outcomes . besides these genetic and epigenetic factors , drug resistancemay also be conferred by microenvironment characterized by poor vasculature , spatial heterogeneity with regions of hypoxia and acidity , and transport limitations . in these cases , despite abundant drug in plasma , the actual targeted site of action will lack the desired concentration of drug . given these complex factors , sophisticated models incorporating probabilistic nature of these nongenetic , random events will greatly augment the predictions based on gene expression . the final phase of drug disease cycle involves the drug or its metabolites interfering with the normal functions of one or more cell types and producing either desired outcomes ( efficacy ) or undesired outcomes ( side effects ) . the majority of these cell responses are governed by small molecules , which are the cumulative outcome of all of the processes outlined in the previous sections ( gene sequence , drug dosing , and other biochemical processes ) . at the molecular level , activation or repression of gene and enzyme activitymay not be translated into accumulation or depletion of its corresponding metabolites due to multiplicity of metabolic pathway network and robustness of metabolite profiles . in addition to these molecular contents , cellular functions are also affected by stochastic gene regulation . due to the complex and interacting nature of these regulatory networks , gene products from a specific networkultimately , this results in the disruption of the normal cellular functions and produces unintended consequences . developments in single - cell measurements and various lineage - tracing techniques have revealed a wealth of knowledge in attributing the sources of nongenetic cell - to - cell variations . even genetically identical cells in the same environment have shown varied response and sensitivity to drugs . feinerman et al . demonstrated how intraclonal differences in signaling protein levels in t cells produced distribution in response among individual cells , which ultimately leads to diverse biological functions and interferes with antigen discrimination during t - cell activation . using 10,000 cells from each of 15 different cell lines , gascoigne and taylor analyzed cellular response to three classes of antimitotic drugs . these cells , besides inter cell line variability , exhibited a significant intra cell line variation . indeed , these variations are not genetically predetermined but are driven by variations in the signaling network stability as even the sister cells were shown to have faced different fates . studied nongenetic cell - to - cell variability in response to trail - induced ( tnf - related apoptosis - inducing ligand ) apoptosis . they have shown the existence of significant differences in timing and death probability in that some cells died within 45 min of exposure , whereas others needed as much as 812 h. apart from genetic and epigenetic sources , stochastic fluctuations in biochemical reactions arising from low copy number , differences in cell cycle phase , and natural divergence of protein levels were cited as the determinant factors of time to death . dynamic studies on negative feedback loops between tumor suppressor p53 and oncogene mdm2 , with genetically identical cells in uniform environment subjected to gamma irradiation , revealed interesting features on cell - to - cell variability . significant cell - to - cell variations were observed in the amplitude of the oscillations that was attributed to the production rates of proteins . in addition , due to this variation in protein production , even sister cells lost correlation to each other within 11 h of cell division . recent studies show that despite intrinsic noise in molecular network , phenotypic cell - to - cell variability is rendered by deterministic processes , often through uncharacterized molecular regulatory mechanisms . microenvironment plays a significant role in determining the ultimate outcome to any pathophysiological stimuli . in vivo experiments in mice seeded with invasive or proliferative melanoma cell typesin addition , proliferative cell types were predominant in the outer rim of the tumor confirming the role of microenvironment in regulating the switch . studies have also illustrated the presence of small numbers of slow - cycling melanoma cells ( jarid1b + ) , within the main population of aggressive cells , evading chemotherapy and resulting in the selection of jarid1b + cells . interestingly , jarid1b expression is dynamically and temporarily regulated , thereby negating the utility of gene expression profiling . this has a profound impact on treatment planning ; a snapshot of gene expression reveals a specific cell type but the emergence of heterogeneity renders the treatment regimen largely ineffective . microenvironment also promotes genetic instability among cancer cells , specifically through deletion and transversions . despite the foregoing discussion on cell - to - cell variability , the inherent robustness in metabolic networks drive the physiological state to very few distinct modes , which results in multimodal distribution in response space . robust computational approaches are available to incorporate these multiple sources of stochasticity and heterogeneity , which enable prediction of population behavior . the relationship between cellular heterogeneity and unpredictable clinical response is less obvious but extremely critical . for example , in cancer cells , protein expression outliers allow some cells to fall outside the drug 's range of efficacy , enabling those cells to survive ongoing treatments . given sufficient time , these outliers will repopulate the full distribution of cells and render the treatment inefficient or eventually completely ineffective . the transcriptional switching in melanoma cells allows invasive cell types to escape the proliferation - targeted chemotherapy regimen . when the invasive cell types switch to a proliferative mode , the tumor cells will regrow , thus leading to refractory melanoma . chemotherapy also allows slow - cycling jarid1b + melanoma cells in the heterogeneous population to thrive in cytotoxic environments . as individual patients produce different levels of proteome dispersion and cellular heterogeneity , which in itself is difficult to predict , the prediction of clinical response for these individuals is much more complex . more likely , these cellular phenotypes are further confounded by interplay of other unknown proteins and / or mechanisms . hence , it is not so trivial to predict the cellular response intuitively or use simple correlations with gene expression alone . a more reliable quantitative prediction of these complex phenomena calls for a sophisticated modeling framework . the literature is frequented with wide range of sources producing differing evidence for correlation between genotype and their corresponding molecular phenotype and / or clinical response . continuing with the tpmt case , population genetic studies have shown that the major gene locus which regulates tpmt activity accounts for only two - thirds of the total variance in the red blood cell ( rbc ) enzyme activity . tpmt enzyme activity is affected by 6 - mp , chronic diseases , and other coadministered drugs like diuretics , nsaids , and antihypertensives . in addition , tissue - specific regulation of enzyme activity has also been reported in the literature . 6 - mpmetabolism is not only affected by variations in tpmt activity but also by other nongenetic factors . coadministered drugs like allopurinol and methotrexate also affect the first - pass clearance and metabolism of 6 - mp . hence , within a specific enzyme activity range , it is possible to observe as many 6 - tgn concentrations as there are patients . in a study involving 170 inflammatory bowel disease patients , wide variation in tpmt enzyme activity , 6 - tgn concentration , and treatment responsepatients with tpmt heterozygous had enzyme activity of 5.113.7 u / ml with mean 6 - tgn concentration of 253.5 pmol / 810 rbcs ( sd : 136.5 ) compared with homozygous - w.t . of 13.7 u / ml with 151 pmol / 810 rbcs ( sd : 84.7 ) . the range for tpmt activity and high sd for 6 - tgn concentration signifies the level of dispersion within the same genotype . in addition , there was no significant correlation existed between inflammatory bowel disease questionnaire score and 6 - tgn concentration ( r = 0.09 ; p = 0.24 ) . patient groups having similar 6 - tgn concentrations resulted in two different clinical outcomes of active disease and clinical remission . in our own modeling study on 6 - mp metabolism using nonparametric bayesian approach ( to be submitted for publication ) ,6 - tgn concentration prediction based only on tpmt genotype resulted in wide 95 % confidence region of 23743 pmol / 810 rbcs ( black region in figure 5 ) . with the measurement of tpmt enzyme activity , the confidence region is narrower ( gray region : 124386 pmol / 810 rbcs ) as the variability in enzyme level is accounted . however , with the availability of 6 - tgn measurement , the 95 % confidence region is much tighter ( red region : 234252 pmol / 810 rbcs ) . this exemplifies that the prediction of downstream response with an upstream marker will most likely yield a greater variability , which will eventually hamper the dosing decision . recently , drug transporter protein abcc4 was found to be actively transporting 6 - mp and 6 - tgn from the hematopoietic cells , thereby protecting the cells in tpmt - deficient patients . these findings demonstrate that although one can measure tpmt activity ( molecular phenotype ) precisely , there is a significant uncertainty in the level of 6 - tgn ( drug phenotype ) , the compound that is responsible for treatment response . in addition , when 6 - tgn acts on the cellular population , another level of uncertainty is added which leads to different clinical outcome for similar 6 - tgn concentration range . hence , phenotyping enzyme activity or even 6 - tgn concentration may not be sufficient ; rather , the cellular response , which is the ultimate response variable of interest should be regarded as the basis for dose individualization . figure 4 summarizes these variations observed in various clinical studies . an extensive list of different covariates and their effect on variability on molecular and clinical phenotypes are included in the supplementary materials . from the discussions in the previous sections , it is clear that dna sequencing and gene expression profiles provide some vital information on pathophysiological and clinical response for a given treatment regimen ; however , augmenting this information with downstream biomolecular and cellular responses will facilitate unequivocal , quantitative clinical decisions . the application of qualitative upstream information in decision making may lead to uninformed conclusions for a specific individual . what is needed instead is an integrative approach that takes into account different levels of potential variation in the drug disease cycle to predict the clinical outcome of interest and is adaptive in nature to each individual patient . as such , it should be an ongoing process rather than a study - and - adopt approach . in other words , after the initial detailed study and accumulation of information , a basic set of information must be obtained from each new patient in order to adapt the approach before making predictions on clinical outcomes . given the dynamic nature of physiological responses , this naturally warrants the application of dynamic modeling and in silico approaches at a suitably sophisticated level . it is not only proactive in predicting the clinical response but also alleviates the need for continuous / frequent monitoring , which will be prohibitive from physiological , logistical , and economical points of view . in recent times , there has been increasing recognition of the utility and practice of quantitative tools in medical applications . at the same time , the tremendous increase in life science research over the last several decades has resulted in a system , which publishes thousands of relevant articles every year . clearly unaided individual clinicians and healthcare practitioners are unable to process all these articles and incorporate into practice those advances that will have the greatest clinical impact . as such , there is a tremendous opportunity to develop a systematic approach to embedding scientific advances in clinical decision support tools . although these tools have been largely statistical , the time is now opportune to expand this quantitative approach to include mathematical models and systems theoretic tools that embed scientific advances toward maximizing clinical impact . mathematical models , suitably empowered by systems theoretic methodology , derive their strength from their potential to quantitatively evaluate known or conjectured mechanisms of medical cure . although engineering and mathematical personnel can provide skillful use of quantitative tools , success of such endeavors is contingent on utilizing the judgment of experienced medical personnel . for such a closely integrated effort , collaboration must occur among medical and engineering researchers over an extended period in a clinical setting . a recent report by the national academy of engineering and the institute of medicine elaborates on how a partnership between healthcare professionals and engineers could change the face of the 21st century healthcare system . a detailed road map was also laid to harness the power of systems engineering tools , information technology , and compliment knowledge across scientific disciplines to achieve what was termed thesix institute of medicine quality aims of the healthcare system that included safety , effectiveness , patient centeredness , timeliness , efficiency , and equitability . although gene expression information by itself is not ideal , systems biologists have developed methodologies to predict phenotypic outcomes for a specific gene expression pattern through the simulation of metabolic networks . these metabolic networks aid in linking pharmacogenomic variants , such as snps , to pathophysiological ( phenotypic ) outcomes . through in silico models of these metabolic networks , the effects of sequence variations , alterations in specific components , and resulting biochemical reaction kinetics can be analyzed in the context of the rest of the reactions in the entire network . application of such an approach has been demonstrated for human rbcs using a large - scale metabolic network , in which in silico models predicted pathophysiological outcomes for two established snps associated with two key enzymes . as expected , however , when evaluated in the context of other simultaneously altered enzyme kinetics within the whole network , the model predicted overall cell behavior and eventually the clinical outcome . augmenting this approach with other omics data will uniquely identify the flux modes and further enhance the predictive power . cybernetic models , which provides a framework to accommodate gene expression information and enzyme regulation and predict the system - level , dynamic metabolic profile and overall cellular outcome . the potential clinical utilities of these metabolic models are evident from their ability to identify functionally interrelated sets of reactions and metabolites that are causally related to diverse pathophysiological conditions including xenobiotic metabolism and biomarker identification . the power of such approaches lies in the automatic integration of patient - specific information , both genotypic and phenotypic , which leads to the prediction of entire metabolic flux profiles and overall cellular outcomes . these metabolic and cellular functions can readily be associated with observed efficacy and / or toxicity through statistical and mathematical tools , which will help in clinical decision making . recent advances in genome - scale computational models are also expected to provide key insights into how complex phenotypes evolve as a function of gene variants and molecular interactions . genome - scale metabolic models are large - scale extensions to traditional metabolic networks to analyze the entire cell in the light of available data and computational methods . mathematical representation of physiochemical , environmental , and regulatory constraints and computational solutions enable the identification of feasible and infeasible metabolic behavior , leading to reliable predictions even when comprehensive data is not available . using a computational model that accounted for all annotated gene functions , karr et al . have provided an understanding of several biological processes that were not feasible earlier through experimental techniques . in addition , the model has accurately predicted molecular pathologies of single gene disruption phenotypes . the reconstruction of tissue - specific , genome - scale metabolic models such as the ones describing human liver metabolism , cancer cell metabolism , along with an increased availability of extensive patient - specific omics data to refine these models , bodes well for advancing these approaches for personalized treatment . often , it is not feasible to obtain objective , quantitative cellular response frequently as in the case of neuropathic pain , cancer progression etc. , or the drug is so toxic to some patients that we can not afford to titrate the drug dose . in these cases , measuring covariates that are closely connected ( on drug disease cycle ) to the clinical response may provide acceptable surrogate information for clinical decision making . for examplerecently , a new concept of personalized treatment based on metabolomics phenotype has been proposed by nicholson et al . and termed as pharmacometabonomics . metabonomics , a special case of metabolomics , studies the systematic variation in the metabolic profiles due to external stimuli such as genetic modification , biological stimulus , and xenobiotic intervention . pharmacometabonomics , at the intersection of pharmacology and metabonomics , was defined as the prediction of the outcome , efficacy , or toxicity of a drug or xenobiotic intervention in an individual based on a mathematical model of a preintervention metabolite signature . pharmacometabonomics aims to study the global metabolic fingerprint in predose biofluids and characteristic change in the metabolic profiles due to drug dosing in the postdose biofluids . these two vital pieces of information can then be correlated to the clinical responses using chemometric tools . the key metabolites identified from this exercise are then mapped onto the relevant metabolic networks through various databases to reveal functional relationships in disease pathways . this approach , if designed carefully , promises to provide an unbiased and hypothesis - free analysis of the metabolic profile , which may help to identify unexpected biomarker combinations . these endogenous metabolites will eventually aid in identifying patient subgroups that may be cured and / or are susceptible to side effects before commencing the treatment . a recent review article provides an extensive discussion of several preclinical and clinical applications of this new emerging area . recent advancements in single - cell measurement and manipulation technologies allow multiscale and multiparametric measurement of molecular contents , thereby enabling observation of molecular events at single - cell level . elucidation of system - wide interaction of molecular and signaling events and comparison with the response of pathological cells under the influence of a therapeutic drug provide new quantitative mechanistic insights . when combined with mathematical models , this information provides further insight into underlying mechanisms and important parameters that are unable to be extracted from experimental techniques . extension of these single - cell models , accounting for deterministic and stochastic population heterogeneity , aid in prediction of overall physiological outcomes and emergence of multimodal cellular populations with distinct phenotypic features . apart from these detailed , global mechanistic approaches , several classes of semimechanistic models have been developed for various in vivo processes over the last few decades . these types of models are adequate to describe a macrolevel phenomenon within the exhaustive overall process and predict cellular outcome for treatment intervention . however , rigorous efforts for individualization of these models and effective clinical translation are lacking . integrated quantitative approaches that combine genotypic , molecular profiling , and clinical data have shown promise in predicting causal relationships between specific genotypic / molecular signatures and biological and / or clinical outcomes . unlike traditional statistical approaches , which are often restricted to correlational studies , these approaches develop causative models , purely driven by data and prior knowledge , that establishes the dependence structure among various interacting biomolecular entities and have the ability to provide causal influence . interactomics modeling has also shown promise to evaluate quantitative interactions at macromolecular level ( dna , rna , proteins , and other molecules ) and aid in understanding how local and global molecular network dynamics affect overall cellular properties and ultimately lead to human diseases . although some of these approaches have largely been in use for drug target discovery , or applied for other simpler organisms , it is now time to gain insights from them and extend to personalized treatment based on an individual patient 's omics signature . the quantitative approaches discussed here are admittedly in their infancy and require extensive validation in carefully designed , prospective clinical studies . the key conundrum in this regard would involve translating these fast burgeoning scientific findings emerging from various fronts . admittedly , it is difficult to verify each one of these findings in controlled clinical trials . an interesting option would be to integrate the detailed , mechanistic network models with pbpk - ivive ( pbpk : physiologically based pk ; ivive : in vitro , in vivo extrapolation ) approach in which adme ( absorption , distribution , metabolism , and elimination ) is managed by physiologically based pharmacokinetics - in vitro , in vivo extrapolation , whereas kinetic insights for physiologically based pharmacokinetics are governed by genetic and other omics data through metabolic network models . eventually , this approach could serve as a screener to select candidates for controlled clinical trials and design them . in addition , several other constraints surface while translating such approaches in routine clinical practice . efforts must also be diverted to effective communication of these techniques to clinicians and ensure ease of use and interpretation . social , ethical , and privacy - related risks of such personalized approaches are not insignificant . genetic minorities must be protected from discrimination by drug developers , insurance companies , and employers . unfortunately , besides these quantitative approaches , there are not many alternatives available to solve current challenges in treating critical diseases . however , we believe that a concerted and collaborative effort by various stakeholders and experts will pave the way for effective implementation of holistic personalized medicine in clinical settings .\noutput:\n" }, { "from": "agent", "value": "despite recent advancements in omic technologies , personalized medicine has not realized its fullest potential due to isolated and incomplete application of gene expression tools . in many instances , pharmacogenomics is being interchangeably used for personalized medicine , when actually it is one of the many facets of personalized medicine . herein , we highlight key issues that are hampering the advancement of personalized medicine and highlight emerging predictive tools that can serve as a decision support mechanism for physicians to personalize treatments ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: acanthosis nigricans ( an ) is a disorder characterized by skin hyperpigmentation and thickening , especially in certain regions such as the neck , axillae , and mucosa . an is well known as a clinical marker of malignancy ; however , most cases are related to metabolic or endocrinological diseases such as insulin - resistant diabetes mellitus , hypothyroidism , and obesity . in some cases , autoimmune disorders such as systemic lupus erythematosus ( sle ) and hypothyroidism complicated with type b insulin resistancewere reported to be accompanied by an . here , we report a first case of generalized an involving an area from the mucosa of the larynx to the esophagogastric junction , accompanied by autoimmune manifestations but not type b insulin resistance . a 58 - year - old japanese male had noticed a diffuse pigmentation of his face and generalized hypotrichosis 10 years before his first visit to our clinic . he had been diagnosed with an at the age of 55 years because of mucocutaneous manifestations such as diffuse papillomatosis . his height was 168.5 cm and his weight 59 kg ( body mass index 20.7 ) . he presented with dirty - looking keratosis of the umbilicus , areola , and chest wall , diffuse papillomatosis of the palms and soles in addition to numerous acrochordons of the face , neck , and axilla . hyperplastic and papillomatous changes of the lips and oral cavity accompanied by impaired taste sensation were also noted ( fig . the biopsy specimens taken from skin of the posterior neck and mucosa of the pharynx and larynx revealed slight hyperkeratosis and acanthosis undulating with dermal papillomatosis ( fig . upper endoscopy showed a diffuse papillomatosis extending from the mucosa of the larynx to the esophagogastric junction , where little normal mucosa was left ( fig . no epidermal inclusion bodies were observed and polymerase chain reaction analysis of human papilloma virus dna in the mucosal region was negative . these findings were compatible with a diagnosis of an . biochemical and serological examinations yielded the following results : serum immunoglobulin igg 2,270 mg / dl , antinuclear antibody ( ana ) titer 1/1 ,280 ( homogenous pattern ) , anti - ss / ds dna antibodies 580/60 .8 iu / ml , le test positive , antimicrosomal antibody titer 1/25 ,600 , and anticardiolipin antibodies 13.0 u / ml . although anti - ss - a / ss - b antibody and gum and schirmer 's tests showed negative results , lip biopsy and tc - 99 m scintigraphy of the salivary gland revealed chronic sialadenitis . thyroid - stimulating hormone , free thyrotropin3 ( f - t3 ) and f - t4 showed normal levels , and both insulin antibody and insulin receptor antibody were negative . based on the result of the 75 - gram oral glucose tolerance test and hba1c ( 6.1 % ) , homa - r , a useful surrogate index of insulin resistance which is calculated by using fasting serum insulin , was in the normal range ( normal range 2.5 , our case 0.96 ) . tumor markers showed a normal range , and a ct scan showed only an interstitial pattern in the bilateral lung . pet scans revealed an uptake of radioisotope from the pharynx to the stomach , but upper endoscopy did not show any carcinomatous changes . taken together , these findings resulted in a diagnosis of autoimmune an without type b insulin resistance . our patient 's former treatments included etretinate and vitamin d ointment , with poor clinical response . as we suspected that his an skin lesions were associated with autoimmune conditions , and as we could confirm that his lesions were not complicated by internal malignancy , administration of oral csa 150 mg ( 2.5 mg / kg ) was initiated , which gradually resolved the papillomatosis of the lip , keratosis of the umbilicus , papillomatous polyp of the larynx , and generalized hypotrichosis ( fig . 3aana titers decreased from 1/1 ,280 to 1/160 and anti - dna antibody from 60.4 to 24 iu / ml . csa was discontinued after 8 months because new small nodules in the lung , which could have been malignant , were detected by ct . after discontinuation of csa therapy , the an skin lesions gradually worsened , followed by the appearance of small nodules in the mesentery , which were pathologically diagnosed as benign . the term an was originally proposed by unna , although the first case was described by pollitzer and janovsky as early as 1891 . malignancy - associated an tends to be extensive and involves mucosal surfaces , mostly in elderly people . the majority of associated malignancies are intra - abdominal adenocarcinomas , most commonly gastric cancer . in our case , the results of repeated examinations over a 10 - year clinical course excluded malignancy - associated an . however , careful examinations for malignancy are needed as the patient may develop malignancy in the future . in 1981 , sturner et al . reported that some patients with an who are positive for ana or show increased immunoglobulin levels might be associated with disordered immunoreactivity not fitting any clinically recognizable syndromes . in our case , sle and sjgren 's syndrome were strongly suspected from the clinical data ; however , he did not meet the criteria of these diseases . there are no previous reports that describe csa as a treatment of generalized an . based on the speculation that some autoimmune manifestations might have induced the hyperkeratotic and proliferative symptoms , administration of csacsa gradually reduced both the papillomatous skin and mucosal lesions of an in conjunction with a decrease in ana titers , but reversal occurred , accompanied by a worsening of symptoms , after discontinuation of csa treatment . sle and related conditions accompanied by an are , at most , positive for anti - insulin receptor antibodies and often present with severe hyperglycemia and insulin resistance ( type b insulin resistance ) , which might be a cause of an - associated skin lesions . insulin - like growth factor 1 receptor ( igfr ) is expressed on the surface of human keratinocytes and fibroblasts , while excessive amounts of serum insulin interact with igfr in peripheral tissues . binding of insulin to igfr promotes proliferation of fibroblasts and keratinocytes , which subsequently lead to an . however , the generalized an in our case , with sjgren 's syndrome - and sle - like features , was not associated with type b insulin resistance , and was effectively treated with csa . we speculate that some unknown autoantibodies other than the insulin - receptor antibody might have similar effects on the generation of an mucocutaneous lesions . this may be one reason why csa was effective in treating the an lesions . in situationswhere complications of both internal malignancies and diabetes mellitus can be excluded after very careful and intensive examinations , csa can be expected to be an effective therapy for an with autoimmune manifestations . further investigation is needed to determine the pathological aspects that make csa therapy effective for an .\noutput:\n" }, { "from": "agent", "value": "acanthosis nigricans ( an ) is a hyperpigmented keratotic skin lesion known to be associated with malignant disease and endocrinopathy . we report a very rare case of generalized an with sjgren 's syndrome - and systemic lupus erythematosus - like features but without type b insulin resistance . neither internal malignancy nor other endocrinological disorders , including glucose intolerance , were detected during a 10 - year clinical course with benign diffuse papillomatosis extending from the mucosa of the larynx to the esophagogastric junction . the case was complicated with chronic thyroiditis and interstitial pneumonia , which were not treated with any medication . an skin lesions and mucosal papillomatosis regressed with oral cyclosporine a , accompanied by the lowering of autoantibody titers . this is the first report of generalized an involving an area from the mucosa of the larynx to the esophagogastric junction accompanied by autoimmune manifestations which responded to systemic immunosuppressive therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: endophthalmitis is a rare but vision - threatening complication following pars plana vitrectomy ( ppv ) with an incidence of one case per 1,730 procedures in a recent prospective study .1 a case of staphylococcus caprae endophthalmitis developing in a healthy young patient following ppv for symptomatic vitreous floaters is reported here . a healthy 24 - year - old female complained of a large floater in the right eye ( od ) for 6 months , that interfered with her graduate studies . best - corrected visual acuity was 20/30 od and 20/20 in the left eye ( os ) . examination was normal except for a prominent posterior vitreous detachment od and lattice degeneration od and os . observation was advised , but the patient requested treatment . after obtaining informed consent , a 20 - gauge three - port ppv was performed without intraoperative complications . the superior sclerotomies were closed in an x - type fashion and the inferotemporal sclerotomy was closed in a purse - string fashion using 7 - 0 vicryl sutures . subconjunctival vancomycin ( 25 mg / 0.5 ml ) and dexamethasone ( 2 mg / 0.5 ml ) were injected . on postoperative day 1 , uncorrected visual acuity od was 4/200 ; intraocular pressure was 13 mmhg . anterior segment examination revealed no eyelid edema , mild conjunctival injection , and 1 + aqueous cell with no posterior synechiae , hypopyon , or fibrin . fundus examination showed mild vitreous cells with vascular sheathing and perivascular hemorrhages ( figure 1a ) . spectral domain optical coherence tomography revealed retinal thickening and irregular intraretinal precipitates ( figure 1b ) . fluorescein angiography demonstrated areas of blockage corresponding to the intraretinal hemorrhages and leakage from retinal vessels and from the optic disc ( figure 1c and d ) . although the diagnosis of endophthalmitis was considered , it was felt that a toxic reaction to subconjunctival injections or retinal vascular occlusion were more likely based on the lack of severe intraocular inflammation and absence of fibrin or hypopyon . the patient was treated conservatively with topical ciprofloxacin 0.3 % four times daily , prednisolone acetate 1 % four times daily , and cyclopentolate 1 % twice daily . the patient returned the following morning with worsened visual loss , pain , and eyelid swelling . fibrin across the pupil and a 2 mm hypopyon in the anterior chamber were present . the patient was diagnosed with endophthalmitis and underwent emergent vitreous tap and injection with intravitreal vancomycin ( 1 mg / 0.1 ml ) , ceftazidime ( 2.25 mg / 0.1 ml ) , and dexamethasone ( 0.4 mg / 0.1 ml ) . subconjunctival vancomycin ( 50 mg / 0.5 ml ) and ceftazidime ( 50 mg / 0.5 ml ) were administered . oral moxifloxacin 400 mg twice daily and topical besifloxacin 0.6 % three times daily were added . the eye responded well . within days , the hypopyon diminished , the fibrin clot retracted ( figure 2a ) , and the choroidal detachment improved ( figure 2b ) . vitreous cultures isolated s. caprae sensitive to vancomycin and levofloxacin . by postoperative month nine , fundus examination revealed a clear vitreous cavity with mottling of the retinal pigment epithelium ( figure 3a ) . spectral domain optical coherence tomography revealed an irregular retinal surface but an intact ellipsoid layer ( figure 3b ) . symptomatic floaters are common . in a recent study with an average participant age of 30 years , 76 % reported symptomatic floaters and 33 % reported noticeable impairment in vision from floaters .2 among patients aged 7079 years , 35 % have evidence of a complete posterior vitreous detachment on echography and this number approaches 50 % among patients aged 80 years and older .3 vitreous floaters account for approximately 7 % of new patient referrals to retina specialists .4 floaters can cause considerable distress in certain patients . a utility analysis reported that patients were willing to trade away an average of 1.1 out of every 10 years of their remaining life to rid themselves of floaters , and were willing to take an 11 % risk of death and a 7 % risk of blindness to do so .5 floaters can cause a reduction in contrast sensitivity and a demonstrable floater scotoma can be identified using spectral domain optical coherence tomography in some patients .6,7 fortunately , most patients will accept observation as the symptoms are often temporary , opacities may gravitate out of the visual axis , and central opacities may move more anteriorly and out of focus . however , some patients may request definitive intervention despite surgical risks .8 various treatments , such as neodymium : yttrium aluminum garnet vitreolysis and cataract extraction with deep anterior vitrectomy , have been reported .9,10 however , ppv is associated with the highest surgical success rates , with patient satisfaction rates ranging from 85 % 94 % and resolution of floaters on ophthalmoscopy in over 95 % of cases .6,1114 using the 39 - item national eye institute visual function questionnaire , it has been reported that general vision , near activities , distance activities , mental health , and peripheral vision are significantly improved in selected patients treated with ppv for floaters .15 there is an increasing trend towards ppv for symptomatic floaters , which is sometimes referred to asfloaterectomy .6,1115 unfortunately , while satisfaction rates are high , this treatment is not risk - free and large retrospective studies have reported rare but serious complications . de nie et al retrospectively reviewed the results of 110 eyes undergoing 20 - gauge or 23 - gauge ppv for floaters and reported retinal detachment in 12 eyes ( 10.9 % ) , vitreous hemorrhage in 12 ( 10.9 % ) , cystoid macular edema in six ( 5.5 % ) , and visually significant cataract in 37/74 phakic eyes ( 50.0 % ) .11 schulz - key et al reviewed 73 eyes undergoing primarily 20 - gauge ppv for floaters and reported retinal detachment in five eyes ( 6.8 % ) , vitreous hemorrhage in seven ( 9.6 % ) , macular edema in four ( 5.5 % ) , and visually significant cataract in 23/38 phakic eyes ( 60.5 % ) .12 two recent series suggest that some complications may be fewer with 25 - gauge ppv . mason et al reviewed 168 eyes undergoing sutureless 25 - gauge ppv for floaters and reported 12 eyes ( 7.1 % ) with retinal breaks , two with vitreous hemorrhage ( 1.2 % ) , one with cystoid macular edema ( 0.6 % ) , and no eyes with retinal detachment . visually significant cataract developed in nine ( 22.5 % ) of 40 phakic eyes .14 sebag et al reviewed 60 eyes undergoing sutureless 25 - gauge ppv for floaters and reported one eye ( 1.7 % ) with macular pucker and no eyes with retinal breaks , vitreous hemorrhage , or retinal detachment . visually significant cataract developed in eight ( 23.5 % ) of 34 phakic eyes .6 the case reported here does not represent the first case of endophthalmitis following ppv for vitreous floaters in the published literature . park et al recently published two prospective , nationwide studies investigating the incidence , risk factors , clinical presentation , microbiology , management , and outcomes of patients developing endophthalmitis after ppv in the uk .1,16 in their series , 28 of 48,433 eyes undergoing ppv developed postoperative endophthalmitis .1 two patients in their series developed endophthalmitis following ppv for vitreous opacities , both of which were caused by gram - positive cocci .2 one patient regained a visual acuity of 6/9 at 6 months following presentation with endophthalmitis ; however , the other patient developed persistent cystoid macular edema and only recovered 6/96 vision . patients undergoing floaterectomy are often young , many are phakic , and nearly all have excellent preoperative best - corrected visual acuity .8 endophthalmitis remains a rare , but potentially devastating complication for patients undergoing seemingly straightforward ppv for vitreous floaters and , in the authors opinion , this risk should be explicitly addressed in the informed consent process of patients considering this intervention .\noutput:\n" }, { "from": "agent", "value": "a case of staphylococcus caprae endophthalmitis in a young patient following pars plana vitrectomy for symptomatic vitreous floaters is reported here . recent literature suggests that there is an increasing trend of performing pars plana vitrectomy for symptomatic floaters . although rare , the potential risk of endophthalmitis should be explicitly discussed with patients considering surgical intervention for vitreous floaters ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary hypertrophic osteoarthropathy ( pho ; mim 259100 and 614441 ) , also known as pachydermoperiostosis , is a rare multi - organic , disease primarily characterized by digital clubbing , periostosis and pachydermia ( 1 ) . the manifestations usually begin at puberty and progress gradually over years prior to stabilization of the disease . as the primary form of hypertrophic osteoarthropathy , pho is distinct from the more common secondary hypertrophic osteoarthropathy , which is always associated with an underlying cause , for example pulmonary or cardiac disease . in terms of the inheritance of pho , autosomal dominant with incomplete penetrance and recessive inheritancetwo genes have been reported to be associated with pho ( 5,6 ) . in 2008 , 15 - hydroxyprostaglandin dehydrogenase ( hpgd ; mim 601688 ) , which encodes 15 - pgdh , was identified as the primary causative factor of pho . zhang et al ( 6 ) demonstrated another pathogenic gene responsible for pho , solute carrier organic anion transporter family , member 2a1 ( slco2a1 ; mim 601460 ) , which is a gene encoding the prostaglandin transporter . it has been suggested that the two genes , hpgd and slco2a1 , are involved in the degradation of prostaglandin e2 ( pge2 ) . the degradation of pge2 involves two steps ( 7 ) : selective uptake across the plasma membrane by slco2a1 and degradation inside the cell by hpgd . considering these molecular findings , pho has been categorized into two types ( 1 ) : i ) hypertrophic osteoarthropathy , primary , autosomal recessive , type 1 ( phoar1 ; mim 259100 ) due to hpgd deficiency ; and ii ) hypertrophic osteoarthropathy , primary , autosomal recessive , type 2 ( phoar2 ; mim 614441 ) due to slco2a1 deficiency . when examining a patient with digital clubbing , it is important to differentiate between secondary hypertrophic osteoarthropathy due to pulmonary disease or other conditions , which is more common , and pho , which is less common . however , several clinical examinations are required to eliminate secondary causes , which is an expensive and time - consuming process . in addition , as pho is clinically rare and the disease remains to be fully understood , it can lead to a missed diagnosis or misdiagnosis and consequent suboptimal treatment . at present , the identification of slco2a1 or hpgd deficiency in patients with pho has become an efficient approach to assist in clinical diagnoses . however , the genotype / phenotype associations have not been observed , and the clinical phenotype and mutational spectrum of these pathogenic genes require further investigation in order to fully understand this disease . the study identified two novel mutations ( c. 349delc / p.l117sfsx56 and c. 1286a g / p.y429c ) in the slco2a1 gene in pho disease . to the best of our knowledge , these mutations have not been reported in a previous study , or presented in the single nucleotide polymorphism database ( dbsnp ) ( http://www.ncbi.nlm.nih.gov/projects/snp ) or the human gene mutation database ( http://www.hgmd.cf.ac.uk/ac/index.php ) . the protocol for the present study was approved by the review board of the second xiangya hospital of the central south university ( changsha , china ) , and the participants involved provided informed written consent . apparently healthy during his childhood , he reported that at 18 years of age , he noticed progressive enlargement of the terminal phalanges and pachydermia ( fig .1 a ) . after 2 years , he gradually presented with joint discomfort and action inconvenience . radiography revealed periosteal overgrowth of the tibiofibular joint and a region of the metacarpus ( fig . physical examination revealed no other secondary hypertrophic osteoarthropathy , including congenital heart disease or lung abnormities . all other laboratory investigations were within normal limits , including complete blood count , liver function test , renal profile , thyroid stimulating hormone and growth hormone . the patient had no siblings , and his parents were healthy without the features described above . informed consent was obtained from the patient and from 200 healthy volunteers ( 1954 years old ; 108 male , 92 female ; recruited from the physical examination center of the second xiangya hospital of central south hospital , changsha , china ) prior to blood sampling and dna analysis . the dna sequences of slco2a1 and hpgd were obtained from the ensembl online database ( http://asia.ensembl.org/index.html ; ensembl nos . ensg00000174640 and ensg00000164120 , respectively ) . primers for polymerase chain reaction ( pcr ) were designed using idt software ( http://www.idtdna.com/site ) and the sequences are listed in table i. the entire coding regions , including the flanking intronic sequences of slco2a1 and hpgd , were amplified by pcr . patient dna samples were amplified in 25 l reactions using 2x power taq pcr mastermix ( 12.5 l ; bioteke corporation , beijing , china ) , nuclease - free water ( 11 l ) , 10 pmol / ul forward and reverse primers ( 0.5 l each ) , and 100 ng / l template ( 0.5 l ) . thermocycling conditions were as follows : initial denaturation at 94c for 5 min , 35 cycles of denaturation at 94c ( 30 sec ) , annealing temperature ( 30 sec ) ( table i ) , extension at 72c ( 1 min ) , and final extension at 72c ( 7 min ) . sequences of the pcr products were determined using the abi 3100 genetic analyzer ( thermo fisher scientific , inc . , waltham , ma , usa ) as previously described ( 8 ) . to assess the damaging effects of variants in silico , the online databases , polyphen2 ( http://genetics.bwh.harvard.edu/pph2 ) ( 9 ) and mutationtaster ( www.mutationtaster.org ) ( 10 ) , were used to predict the possible effects of variants . the protocol for the present study was approved by the review board of the second xiangya hospital of the central south university ( changsha , china ) , and the participants involved provided informed written consent . apparently healthy during his childhood , he reported that at 18 years of age , he noticed progressive enlargement of the terminal phalanges and pachydermia ( fig .1 a ) . after 2 years , he gradually presented with joint discomfort and action inconvenience . radiography revealed periosteal overgrowth of the tibiofibular joint and a region of the metacarpus ( fig . physical examination revealed no other secondary hypertrophic osteoarthropathy , including congenital heart disease or lung abnormities . all other laboratory investigations were within normal limits , including complete blood count , liver function test , renal profile , thyroid stimulating hormone and growth hormone . the patient had no siblings , and his parents were healthy without the features described above . informed consent was obtained from the patient and from 200 healthy volunteers ( 1954 years old ; 108 male , 92 female ; recruited from the physical examination center of the second xiangya hospital of central south hospital , changsha , china ) prior to blood sampling and dna analysis . the dna sequences of slco2a1 and hpgd were obtained from the ensembl online database ( http://asia.ensembl.org/index.html ; ensembl nos . ensg00000174640 and ensg00000164120 , respectively ) . primers for polymerase chain reaction ( pcr ) were designed using idt software ( http://www.idtdna.com/site ) and the sequences are listed in table i. the entire coding regions , including the flanking intronic sequences of slco2a1 and hpgd , were amplified by pcr . patient dna samples were amplified in 25 l reactions using 2x power taq pcr mastermix ( 12.5 l ; bioteke corporation , beijing , china ) , nuclease - free water ( 11 l ) , 10 pmol / ul forward and reverse primers ( 0.5 l each ) , and 100 ng / l template ( 0.5 l ) . thermocycling conditions were as follows : initial denaturation at 94c for 5 min , 35 cycles of denaturation at 94c ( 30 sec ) , annealing temperature ( 30 sec ) ( table i ) , extension at 72c ( 1 min ) , and final extension at 72c ( 7 min ) . sequences of the pcr products were determined using the abi 3100 genetic analyzer ( thermo fisher scientific , inc . , waltham , ma , usa ) as previously described ( 8 ) . to assess the damaging effects of variants in silico , the online databases , polyphen2 ( http://genetics.bwh.harvard.edu/pph2 ) ( 9 ) and mutationtaster ( www.mutationtaster.org ) ( 10 ) , were used to predict the possible effects of variants . the protocol for the present study was approved by the review board of the second xiangya hospital of the central south university ( changsha , china ) , and the participants involved provided informed written consent . apparently healthy during his childhood , he reported that at 18 years of age , he noticed progressive enlargement of the terminal phalanges and pachydermia ( fig .1 a ) . after 2 years , he gradually presented with joint discomfort and action inconvenience . radiography revealed periosteal overgrowth of the tibiofibular joint and a region of the metacarpus ( fig . physical examination revealed no other secondary hypertrophic osteoarthropathy , including congenital heart disease or lung abnormities . all other laboratory investigations were within normal limits , including complete blood count , liver function test , renal profile , thyroid stimulating hormone and growth hormone . the patient had no siblings , and his parents were healthy without the features described above . informed consent was obtained from the patient and from 200 healthy volunteers ( 1954 years old ; 108 male , 92 female ; recruited from the physical examination center of the second xiangya hospital of central south hospital , changsha , china ) prior to blood sampling and dna analysis . the dna sequences of slco2a1 and hpgd were obtained from the ensembl online database ( http://asia.ensembl.org/index.html ; ensembl nos . ensg00000174640 and ensg00000164120 , respectively ) . primers for polymerase chain reaction ( pcr ) were designed using idt software ( http://www.idtdna.com/site ) and the sequences are listed in table i. the entire coding regions , including the flanking intronic sequences of slco2a1 and hpgd , were amplified by pcr . patient dna samples were amplified in 25 l reactions using 2x power taq pcr mastermix ( 12.5 l ; bioteke corporation , beijing , china ) , nuclease - free water ( 11 l ) , 10 pmol / ul forward and reverse primers ( 0.5 l each ) , and 100 ng / l template ( 0.5 l ) . thermocycling conditions were as follows : initial denaturation at 94c for 5 min , 35 cycles of denaturation at 94c ( 30 sec ) , annealing temperature ( 30 sec ) ( table i ) , extension at 72c ( 1 min ) , and final extension at 72c ( 7 min ) . sequences of the pcr products were determined using the abi 3100 genetic analyzer ( thermo fisher scientific , inc . , waltham , ma , usa ) as previously described ( 8 ) . to assess the damaging effects of variants in silico , the online databases , polyphen2 ( http://genetics.bwh.harvard.edu/pph2 ) ( 9 ) and mutationtaster ( www.mutationtaster.org ) ( 10 ) , were used to predict the possible effects of variants . in the present study the slco2a1 and hpgd mutations were screened for in the patient and his parents using pcr followed by direct sequence analysis ( fig .2 ) . sequencing revealed compound heterozygous mutations in the slco2a1 gene , which consisted of a novel frameshift deletion , p.l117sfsx56 ( c. 349 delc ) , in exon 3 ( fig .2 a ) and a novel missense mutation , p.y429c ( c. 1286a g ) , in exon 9 ( fig . the p.l117sfsx56 mutation resulted in a frameshift at amino acid position 117 and the introduction of a premature stop codon after 56 amino acid residues , and was predicted to be disease - causing by mutationtaster ( www.mutationtaster.org ) , with a probability value of 1 . the p.y429c mutation was identified as non - conservative , affected evolutionarily conserved amino acids in diverse species ( fig .2 i ) and was predicted in silico by all bioinformatics tools used to be of pathogenic relevance ( polyphen - 2 score , 0.999 ; mutationtaster score , 0.999 ) . based on the dna sequence analysis , the p.l117sfsx56 and p.y429c mutations were found to be inherited from the patient 's unaffected father and mother , respectively , and were not found in the cohort of 200 control individuals ( fig . neither of these mutations has been reported in a previous study , or was present in the dbsnp or human gene mutation database ( http://www.hgmd.cf.ac.uk/ac/index.php ) . as is already known , the central feature in the pathogenesis of pho is the failure of pge2 degradation . however , a number of genes are directly involved in the biosynthesis and signaling pathway of the pge2 , including hpgd , prostaglandin - endoperoxidase synthase ( ptgs ) 1 , ptgs2 , prostaglandin e synthase ( ptges ) , ptges2 , ptges3 , ptger1 , prostaglandin e receptor ( ptger ) 2 , ptger3 , ptger4 , slco2a1 , slco3a1 , slco4a1 , prostaglandin reductase ( ptgr ) 1 and ptgr2 ( 7 ) . among these , zhang et al ( 6 ) first demonstrated in 2012 that slco2a1 is a pho - pathogenic gene . the slco2a1 gene is located on chromosome 3q21 and organized into 14 exons , which encode a 643 amino acid , 12 - transmembrane - domain organic anion cell - surface transporter . to date , 45 different slco2a1 mutations , including 30 missense / nonsense mutations , eight splice sites and seven indels , have been identified in patients with pho . as shown in fig .3 , the eight splice sites were predominantly concentrated between exons 7 and 8 , and the majority of other mutations were positioned on exons 4 , 6 and 9 . in the present study , two novel mutations were identified in the slco2a1 gene in pho disease , comprising c. 349delc / p.l117sfsx56 in exon 3 and c. 1286a g / p.y429c in exon 9 . one of these mutations , c. 1286a g ( p.y429c ) , was identified within the region of a previously reported deletion ( 11 ) , c.1279_1290del12 ( p.e427_p430del ) . sasaki et al ( 11 ) reported that the amino acid sequence containing the p.e427_p430del mutation is located in the extracellular region between the 9th and 10th transmembrane domains , and this mutation may have a less severe effect on pg transport activity ( 12 ) , which may be consistent with the faint pachydermia . the patient examined in the present study was consistent with the report by sasaki et al ( 11 ) , describing an incomplete form of pho , including finger clubbing and periostosis , but lacking cutis verticis gyrate ( cvg ) . with the exception of the three major phenotypes of clubbing , periostosis and pachydermia , additional symptoms , including sebaceous hyperplasia , hyperhidrosis , blepharoptosis and arthropathyit has also been reported that , compared with the clinical spectrum of patients affected with hpgd mutations , the clinical manifestations in patients with slco2a1 mutations emerge later , beginning with clubbing of the distal phalanges during puberty and pachydermia shortly following puberty . however , the degree of arthritis , joint involvement and pachydermia in patients affected by slco2a1 mutations appear to be more pronounced , compared with that in individuals with homozygous or compound heterozygous hpgd mutations ( 7 ) . in the present study , the patient gradually presented with joint discomfort and affected activity , however , hyperhidrosis , sebaceous hyperplasia and blepharoptosis were not present . the pathogenetic mechanism of skin symptoms involve epidermal and sebaceous gland hyperplasia , and dermis hypoplasia , and these cell proliferation differences between the dermis and epidermis determine the magnitude of the affected skin in pho ( 11,15,16 ) . due to the delayed clinical manifestations in the patient with slco2a1 mutations in the present study , it is not possible to exclude the possibility of slowly emerging skin symptoms following puberty . a previous study has reported that slco2a1 - deficient patients may present with chronic anemia secondary to hypocellular myelofibrosis ( 17 ) . the incidence of anemia in caucasian patients with pho was found to be almost 50 % ( 10/19 ) . the possible mechanism may be associated with complex pleiotropic effects of pge2 on multilineage and lineage - restricted hematopoietic progenitor cells ( 18 ) , however , in the present study and other studies ( 1,6,19 ) , the incidence of anemia in chinese patients is low . common gastrointestinal involvement includes chronic gastritis , hypertrophic gastropathy , peptic ulcer , crohn 's disease and watery diarrhea ( 1 ) . the patient in the present study denied any gastrointestinal symptoms . thus , gastroscopy , gastric mucosa biopsy and associated gastrointestinal system examinations were not performed . however , considering hypertrophic gastropathy , this disease often lacks typical symptoms and the majority of patients with hypertrophic gastropathy often show no symptoms , despite the presence of gastric mucosal lesions and hypertrophy on gastroscopy observation . thus , additional specimen collection and analyses is required to analyze the incidence and prevalence of hypertrophic gastropathy in pho . in conclusion , these mutations of slco2a1 ( p.l117sfsx56 and p.y429c ) are the first , to the best of our knowledge , to be reported in pho , and the finding provides clues to phenotype - genotype associations . in addition , the findings obtained in the present study are consistent with those of other studies and suggests that p.y429c may have a less severe effect on pg transport activity , and may be consistent with the faint pachydermia . the results of the present study expand the mutant spectrum of pho , which contributes to a more rapid genetic diagnosis , and interpretation of genetic information for prenatal diagnosis and genetic counseling .\noutput:\n" }, { "from": "agent", "value": "primary hypertrophic osteoarthropathy ( pho ) , which is a rare multi - organic disease characterized by digital clubbing , pachydermia and periosteal reaction , typically begins during childhood or adolescence and progresses gradually over years prior to disease stabilization . to date , only two genes have been reported to be associated with pho , 15 - hydroxyprostaglandin dehydrogenase and solute carrier organic anion transporter family , member 2a1 ( slco2a1 ) . however , the pathogenesis and the functions of the underlying genes remain to be fully elucidated . in the present study , a 20 - year - old chinese patient with pho was investigated using sequence analysis of pho genes and bioinformatics analysis . a novel , compound heterozygous mutation in the slco2a1 gene was identified , which contained two novel mutations : c. 349delc ( p.l117sfsx56 ) in exon 3 and c. 1286a > g ( p.y429c ) in exon 9 . these two novel genotypes in pho are the first , to the best of our knowledge , to be reported in pho . this finding expands the mutation spectrum of pho , which contributes to improving genetic diagnosis and future genetic counseling , and provides clues to the phenotype - genotype associations ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: operative shoulder arthroscopy requires proper visualisation of the glenohumeral joint and the uncapsulated sub - acromial area . a large amount of saline irrigation , mechanically pumped into these spaces , may cause the fluid to escape into the arm and chest resulting in soft - tissue oedema . a rare but potentially life - threatening complication in the form of airway obstruction may be caused when this oedema extends into the neck . although several reports have documented postoperative neck oedema resulting in delayed extubation following shoulder arthroscopies , not many studies have been conducted to study the incidence of neck oedema and its effects on the airway . hence , we decided to study the incidence of increase in neck circumference in shoulder arthroscopies and its effect on the airway . over a period of 1 - year , a total of 32 patients aged between 18 and 70 years , of american society of anaesthesiologists physical status i and ii undergoing elective shoulder arthroscopy under general anaesthesia with interscalene brachial plexus block ( isbpb ) were studied after the institutional ethics committee approval . patients who refused consent or those with distorted neck anatomy were excluded from the study . after attaching standard monitors , neck circumference was measured at the level of the thyroid cartilage in the supine position ( c1 ) . an isbpb was administered using peripheral nerve stimulator with a total of 25 ml local anaesthetic ( mixture of 10 ml 2 % lignocaine and 15 ml 0.5 % bupivacaine ) for analgesia . after pre - oxygenation with 100 % oxygen , general anaesthesia was induced with thiopentone 5 mg / kg or propofol 2 mg / kg . tracheal intubation was facilitated with vecuronium ( 1 mg / kg ) and anaesthesia was maintained with 50 % nitrous oxide and oxygen in isoflurane , titrated to achieve stable haemodynamics . intraoperative hypertension was defined as systolic blood pressure more than 20 % of the baseline and was treated with additional fentanyl 1 g / kg and titrated isoflurane of 1 minimum alveolar concentration . in case high blood pressure persisted after other causes were ruled out , nitroglycerine infusion ( ntg ) was added at 0.5 g / kg / min and titrated as per response . after the procedure , patients were turned to the supine position and the neck circumference was measured again ( c3 ) . the endotracheal cuff was deflated with the patient on volume control mode and the expiratory tidal volume was noted . a drop in the expiratory volume more than 100 ml suggested leak around the tube ( positive leak test ) . in case of a positive leak test , the absence of leak around the tube ( negative leak test ) was taken as an indication of extensive airway oedema ; patients were kept intubated and observed in the post - anaesthesia care unit . next day , leak test was repeated and patients were extubated when the leak was positive indicating reduction in airway oedema . average patient age was 51.6514.0 years with an average body mass index of 25.454.84 . thirty out of 32 patients showed positive leak test and hence , were extubated uneventfully . the average increase in their neck circumference was 1.171.16 cm . only 2 out of 32 patients showed negative leak test and hence were kept intubated . both patients remained haemodynamically stable and were extubated next morning when the leak was positive indicating reduction in airway oedema . in our case series , all the patients were given a score as per the presence of known risk factors responsible for airway oedema after shoulder arthroscopy . the six risk factors that were considered were sub - acromial procedures , prolonged duration of surgery , high pump pressures ( beyond 150 mm off hg ) , intraoperative hypertension , loose connective tissue ( subjective finding ) , and lateral decubitus position . one point per risk factor , with a maximum possible score of six , was determined for each patient [ table 1 ] . table of risk factors based on 6 point score eighteen patients were rotator cuff repairs , which are a sub - acromial procedure , 12 were bankart 's surgeries while 2 were combination surgeries . the average volume of irrigating fluid used was 39.6620.8 l. irrigating pump pressures were always maintained between 30 and 65 mm of hg . multiple regression analysis for risk factors done on 32 patients showed hypertension as a single most direct predictor for an increase in the neck circumference ( p = 0.002 , r = 0.49 ) . other factors by themselves or all six factors taken together did not predict an increase in neck circumference . amongst the various complications of operative shoulder arthroscopy , soft - tissue oedema extending into the neck causing airway compromise is well - documented . hynson et al . have reported extra - articular dissection of arthroscopic irrigation solution causing complete airway obstruction and even suggested monitoring of neck circumference through the procedure . the six contributing factors responsible for airway oedema are sub - acromial procedures , prolonged duration of surgery , high pump pressures ( beyond 150 mm of hg ) , intraoperative hypertension , loose connective tissue around the neck and lateral decubitus position . administration of general anaesthesia with endotracheal intubation can facilitate uninterrupted surgery even in the event of massive extravasation of irrigation fluid but may call for reintubation if careful examination of neck and leak around the endotracheal tube is not performed prior to extubation . operations in the sub - acromial spaceare particularly susceptible to extravasation because this space is not enclosed in a capsule like the glenohumeral joint . the majority of the surgeries in our study were rotator cuff repairs ( 18 ) , a sub - acromial procedure . others were bankart 's surgery ( 12 ) , which is a stabilisation surgery in the glenohumeral joint while 2 were a combination of above . the prolonged duration , which is the next risk factor , was defined as surgical time above 150 min . previous studies have mentioned times of occurrence of airway compromise from 85 , 108 , 110 , 120 , 150 , 240 min of surgical time . the presence of visible wrinkles over neck and chest were suggestive of loose connective tissue , which is another high - risk factor for fluid extravasation . this was a subjective observation by the attending anaesthesiologist who was not participating in the study . studies indicate that modest elevation in pump pressure in combination with induced hypotension gives appropriate pressure differential for better visualisation of joint spaces . high pump pressures up to 100150 mm of hg have been associated with excessive fluid extravasation and a pressure difference of 49 mmhg between the systolic blood pressure and sub - acromial space pressure has been advocated . in our study , all the surgeries used mechanical pumps with pressures set between 30 and 65 mmhg ( much lower than the maximum permissible ) and flow rates between 50 and 150 ml / min with continuous outflow conduit . a low flow continuous outflow theoretically provides a conduit for irrigation fluid to preferentially exit rather than dissecting into soft - tissues . in our study , interscalene block given prior to induction of general anaesthesia resulted in stable haemodynamics and clear surgical field in most patients ( 26 ) . intraoperative hypertension leads to poor arthroscopic visualisation due to bleeding , which may prompt the surgeon to increase the irrigation pressure , which may lead to increased extravasation of saline and risk of airway oedema . in our study , moderate hypertension was treated with additional fentanyl 1 g / kg and titrated inhalational agent . only 3 out of 32 patients required additional ntg infusion to maintain stable haemodynamics . that lateral position may contribute to the accumulation of fluid in soft - tissue of the neck due to gravity . in our study , only 2 out of all 32 surgeries that were conducted in lateral decubitus position had extensive neck oedema making it a weak association . whether the 15 head high position that was given to all the patients to reduce the incidence of gravity - induced accumulation of oedema fluid made any difference is a moot point . almost all patients in our study had extensive soft - tissue swelling of shoulder , upper arm and chest on the operative side compared to the contralateral side with minimal change in the neck circumference ( 1.171.16 cm . ) two out of those three patients had negative leak test and hence were not extubated . they had 3 and 4 risk factors positive out of the six factors that we discussed above . multiple regression analysis done over 32 patients for risk factors showed hypertension as a single most direct predictor for an increase in the neck circumference ( p = 0.002 , r = 0.49 ) . the three patients with intraoperative hypertension had an increase in the neck circumference beyond 3 cm . other factors by themselves or all six factors taken together did not predict an increase in neck circumference . a possible weak association with a higher sample sizeedwards et al . have reported a rare case of an anatomical variant with abnormal communication amongst the shoulder joint , infraspinous fossa , thorax and neck leading to massive airway oedema and obstruction . such associations are rare and we did not encounter any of them . in our view , multiple risk factors especially hypertension may increase the risk of airway oedema after shoulder arthroscopy , although the absence of them may not eliminate its possible occurrence . air leak test , though advised by many authors in the past should be accompanied by careful examination and measurement of the neck circumference after shoulder arthroscopy . it would be an additional test to improve the negative predictability of a leak test . a future clinical study with respect to high - risk factors for the increase in the neck circumference post - shoulder arthroscopy is recommended . the measurement of neck circumference can be a clinical predictor for airway oedema following shoulder arthroscopy . amongst all the possible risk factors , intraoperative hypertension is a single most direct predictor for this increase . in patients with multiple risk factors especially with hypertension , measurement of neck circumference and cuff leak test\noutput:\n" }, { "from": "agent", "value": "background and aims : shoulder arthroscopy requires fluid irrigation , which causes soft - tissue oedema around chest , neck , and arm intraoperatively , leading to postoperative airway complications . we decided to study the incidence of increase in the neck circumference in shoulder arthroscopy and its effects on the airway.methods : we studied 32 cases of shoulder arthroscopies over a period of 1 - year , performed under general anaesthesia with interscalene block . the neck circumference of patients before and after the procedure was measured along with other parameters . the endotracheal tube cuff was deflated at the end of surgery to determine air leak around the tube . the negative leak test suggested airway oedema.results : thirty out of 32 patients showed positive air leak test . the average change in neck circumference was 1.17 1.16 cm and all could be extubated uneventfully . two showed negative leak test with an increase in neck circumference by 4.5 and 6.4 cm and were not extubated . multiple regression analysis for risk factors showed intraoperative hypertension as a single predictor for an increase in neck circumference.conclusion : change in the neck circumference beyond 4 cm may suggest airway compromise and below 4 cm , airway compromise is unlikely even in the presence of extensive soft - tissue oedema around the shoulder , upper arm and chest ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: chemotherapeutic agents play a major role as adjuvant therapy in the treatment of breast cancer . these agents in addition to the cytotoxic effects on the metastatic cells also bring adverse effects in the form of interference with metabolic phenomena in the body . the commonly used chemotherapeutic agents in breast cancer are doxorubicin , cyclophosphamide ( cy ) , paclitaxel , docetaxel , 5 - fluorouracil , epirubicin , methotrexate , trastuzumab , pertuzumab , and carboplatin . the chemotherapeutic agents used , epirubicin and cyclophosphamide ( ec ) may potentially alter immune system by reducing a number of helper t - cells and an increase in the cytotoxic t - cells number . such alteration in immune response may probably have destructive effects on the beta cells which can be irreversible and thus leads to persistence of hyperglycemia . the present case , a 51 - year - old postmenopausal female , weighing 56 kg with diagnosis of ductal invasive carcinoma of the right breast presented to us postsurgery and chemotherapy . she was being treated with oral anastrozole 1 mg and oral calcium 500 mg once a day for the past 3 months . the diagnosis of the malignancy was confirmed in the month of june 2015 for which she underwent modified radical mastectomy in july 2015 . postsurgery , she received four cycles of chemotherapy ( ec regimen ) with injection epirubicin 16 mg and injection cy 1 g once daily for consecutive 21 days . after completion of 4 cycles of chemotherapy , she had complaints of backache for the past 1 month , fever with productive cough since 45 days , and vomiting since 2 days . for her complaint , she visited a private practitioner in her locality , and her routine blood and urine investigation were done . on investigation , her random blood sugar ( rbs ) was found to be 338 mg / dl and postprandial blood glucose ( ppbg ) was 325.5 mg / dl . liver function test ( lft ) revealed raised values for serum glutamic - pyruvic transaminase ( sgpt ) ( 186iu / l ) . her complete blood count and ultrasonography abdomen were within normal limits . the following day , she presented with same complaint in the outpatient department of medicine , all india institute of medical sciences , jodhpur . on detailed history , she informed that for the last 2 months she was also having increased frequency of micturition and excessive thirst . on examination , there were no other clinically relevant observations . before first cycle of chemotherapy , her rbs ( 85.33 mg / dl ) and sgpt ( 47.3 she was diagnosed as a case of uncontrolled diabetes mellitus for which she was prescribed glycomet - gp1 ( glimepiride 1 mg + metformin 500 mg ) orally one tablet in the morning and glycomet - gp2 ( containing glimepiride 2 mg with metformin 500 mg ) one tablet in the evening . hydroxyzine 25 mg and paracetamol 500 mg were also added and were instructed to take as and when needed . a repeat request was sent for capillary blood sugar , rbs , ppbg , and lft after taking medication for 2 weeks . after 2 weeks of antidiabetic therapy in march 2016 , her blood sugar was within the euglycemic range , i.e. , fasting blood sugar and ppbg were 113 and 135 mg / dl , respectively . currently , three main groups of medications are used for breast cancer treatment , namely , hormone - blocking agents , chemotherapy , and monoclonal antibodies . they mostly work by destroying fast - growing or replicating cancer cells , either by causing dna damage or by other mechanisms . some breast cancers require estrogen ( er ) for continued growth and express positive er receptors on their surface . aromatase inhibitors are suitable for women after menopause as the enzyme is in active state mostly in the postmenopausal women . ec regimen is used for breast cancer which is given for consecutive 21 days per cycle for 48 cycles . the side effects of ec regimens are effects on the blood ( such as risk of infection , anemia , bruising , and bleeding ) , hair loss ( alopecia ) or thinning , nausea and vomiting , mouth and dental problems , tiredness ( fatigue ) , and effects on fertility . cy is a cytostatic drug widely used for the treatment of a number of neoplastic and inflammatory diseases . to the best of our understanding and after thorough literature search , we could not identify any authenticated single case report of hyperglycemia with this regimen . in autoimmune disease models such as experimental autoimmune encephalomyelitis and insulin - dependent diabetes mellitus , there is growing evidence that th2 - like cells secreting interleukin ( il - 4 ) and il - 10 provide protection , whereas pathogenic cells are th1 - like cell which secretes interferons alpha ( ifn - ) . cy has been demonstrated to increases the number of ifn - producer in the islet and renders these lymphocytes more pathogenic and capable of destroying the islets of pancreas . leukocytic infiltration of the pancreatic islets by autoimmune cells , or insulitis , can persist for long periods of time before the terminal destruction of - cells . analysis of cytokine secretion demonstrates that ifn - producers are relatively resistant to the cytostatic action of cy and that a possible mechanism for this resistance may be a shift of individual th0 clones toward the th1 pathway . on the other hand , augmentation of the diabetogenic properties of the lymphocytes may not require a direct exposure of t cells to cy , suggesting a role for accessory cells in the acceleration of diabetes mellitus . the integrity of the immune system of breast cancer patients is severely affected by chemotherapy . percentages of t - cytotoxic cells and nk cells were increased , but the percentage of b - cells was dramatically decreased . thus , it is anticipated that epirubicin might have acted synergistically with cy in altering immune system . our patient developed symptoms of diabetes mellitus soon after completing four cycles of chemotherapy with ec . although the pretreatment assessment of blood and urine sugar was within normal range , there is no family history of diabetes mellitus . therefore , it seems likely that the chemotherapy - triggered immunological changes might have led to the new onset of diabetes mellitus . in this case , the patient had improved gradually after starting the antidiabetic drugs . the patient is still continuing with her antidiabetic therapy . considering all the factors on naranjo 's causality assessment algorithm , it is concluded that possible relationship exists between ec and this new onset diabetes mellitus . caution is advised while administering these drugs in the form of repeat blood sugar examination to be done before every cycle of chemotherapy . on the other hand , alternative drug regimens may be tried that are better tolerated and are unlikely to be associated with such side effects .\noutput:\n" }, { "from": "agent", "value": "breast cancer is the leading cause of death in women . epirubicin and cyclophosphamide ( ec ) is one of the chemotherapeutic regimens used for the treatment of breast cancer . we describe a case treated with ec regimen and who presented to us with symptoms suggestive of diabetes mellitus postchemotherapy . absence of family history of diabetes and normal blood sugar level , prechemotherapy points toward drug - induced hyperglycemia . these chemotherapeutic agents capable of altering immune response and might act synergistically to cause immunological damage to the islets of pancreas which might precipitate diabetes mellitus . causality analysis on naranjo 's scale indicates a possible association with regimen ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: furan ( c4h4o ) is a colorless flammable liquid with an ethereal odor , having a low molecular weight of 68 and a high volatility with the boiling point of 31c . furan is classified as a possible human carcinogen ( group 2b ) by the international agency for research on cancer in view of its hepatotoxicity , cytotoxicity , and carcinogenicity verified in experimental animals . in 2004 , american researchers demonstrated that furan can be formed during the thermal treatment of several foods , including canned / jarred products . according to this study , levels up to 112 and 173the occurrence of furan in canned and jarred foods has been attributed to the thermal treatment carried out in hermetically sealed containers which avoids losses of the contaminant by volatilization and permits its accumulation in the products . in order to evaluate the processing parameters and mechanisms that lead to the furan formation in canned / jarred foods , pressure cooking conditions ( in general 120c for 20 min ) have been used to simulate the sterilization step employed in a typical commercial canning operation in which the generation of the contaminant is supposed to occur . these studies have confirmed that furan can be formed when model systems and retail foods are heated in sealed vials under the mentioned conditions . however , it should be emphasized that the pressure cooking is a common and widely used domestic practice which permits food to be cooked faster , as the pressure built up inside the cooker allows the liquid in the pot to rise to a temperature higher than 100c . considering that the furan formation under pressure cooking conditions has already been demonstrated in model systems and retail foods heated in sealed vials , it is important to evaluate if the contaminant can be found in home pressure - cooked foods . moreover , the influence on furan levels of other practices commonly applied after the pressure cooking , such as an additional cooking without the lid and reheating after cold storage , was also investigated . furan and [ h4 ] furan ( furan - d4 ) were obtained from sigma - aldrich ( sigma - aldrich corp . , st . methanol was of hplc - grade ( tedia company inc . , fairfield , oh , usa ) and water was purified by reverse osmosis ( gehaka , so paulo , sp , brazil ) . individual stock solutions of both standards at ca 2 mg / ml were prepared by dissolving in methanol . intermediate and work solutions at ca 20 g / ml and 0.2 g / ml , respectively , were prepared in water . several foods were considered in the present study , including beans , soy beans , whole rice , beef , pork , potato , and cassava . the samples were obtained from the local market . with exception of beans , soy beans , and whole rice , the samples were cut in cubs of approximately 22 cm prior to cooking . potato and cassava were previously peeled . a domestic aluminium pressure cooker of 4.5 litres ( clock , panex ltda , so bernardo do campo , sp , brazil ) was used in the experiments . after the addition of 400 g of the fresh sample ( prepared as mentioned above ) and 1.5 l of water at room temperature , the cooker was immediately closed and the cooking was performed during 20 min after the first release of steam from the pressure valve . the samples were cooked and reheated directly in the water in order to reproduce the domestic preparation of soups and stews . before opening , the pressure cooker was cooled under tap water for sufficient time to eliminate the pressure . then , a portion of the cooked sample was collected as quickly as possible and properly stored until homogenization and analysis . the first one was kept in the pressure cooker and was cooked for additional 10 min without the lid . the second portion was stored under refrigeration during 24 hours and reheated in an open saucepan during 5 min after boiling . all samples were stored at 4c for at least 4 hours before homogenization in order to avoid furan loss by volatilization . the furan content was determined in the fresh , cooked , refrigerated , and reheated samples by using an in - house validated method based on gas chromatography coupled to mass spectrometry preceded by headspace solid phase microextraction ( hs - spme - gc / ms ) according to arisseto et al . . briefly , a portion of 1 g of homogeneous sample was weighed in a chilled 40 ml screw - cap glass vial fitted with silicone - ptfe septum containing a 15 mm 5 mm ptfe - coated stir bar . aliquots of 125 l of furan - d4 working standard solution 0.2 g / ml and 875 l of water were added and the vial was immediately closed . the spme was carried out in a 75 m carboxen - polydimethylsiloxane ( car - pdms ) fiber ( supelco , bellefonte , pa , usa ) at 25c during 30 min , under a constant magnetic agitation rate of 1200 rpm , approximately . the analyses were performed on an hp 6890 gas chromatography equipped with an msd 5973 mass spectrometer ( agilent technologies , palo alto , ca , usa ) . helium was used as the carrier gas at a constant flow rate of 0.7 ml / min . the programmable temperature vaporizing ( ptv ) injector was operated in the splitless mode under the following temperature program : 40c ( held for 0.1 min ) , 700c / min up to 230c ( held for 23 min ) . the separation was performed on a 60 m 0.25 mm , df 0.25 m hp - innowax capillary column ( agilent technologies ) and the oven temperature program was 30c ( held for 0.1 min ) , 2c / min up to 40c ( held for 3 min ) , and 12c / min up to 200c ( held for 2 min ) . the mass spectrometer was operated in a positive electron impact ionization mode ( + ei ) with 70 ev of the electron energy . the selected ion monitoring ( sim ) was used for the detection of furan and furan - d4 , using m / z 68/39/69 for furan and m / z 72/42 for furan - d4 ( quantifier ions ) . a dwell time of 100 ms was used for all the ions . the relative retention time ( rrt ) andfor confirmatory purposes , an acceptable deviation of 0.5 % for rrt , 10 % for ionic relative abundance considering m / z 39/68 , and 50 % for ionic relative abundance considering m / z 69/68 were used by comparing the sample with a standard solution . the quantification of furan was carried out by extrapolation from a linear analytical curve , using the quantifier ions m / z 68 ( furan ) and m / z 72 ( furan - d4 , internal standard ) . although several studies have been published on furan levels in commercial products , few data is available for home - cooked foods . evaluated the formation of furan during domestic cooking such as grilling , roasting , baking , frying , and cooking in saucepan and microwave . however , the presence of furan in home - cooked foods prepared in a pressure cooker has not been investigated so far . figure 1 illustrates a typical ion chromatogram of a pressure - cooked pork sample and the levels of furan obtained for the pressure - cooked foods selected in the present study are shown in table 1 . the results also indicate that the pressure cooking did not produce quantifiable levels of the contaminant for any of the evaluated samples . several furan derivatives were already identified in pressure - cooked meats . in a study on volatile constituents of pressure - cooked pork liver isolated by simultaneous steam distillation and continuous solvent extraction , mussinan and walradt identified 23 furanic compounds . other authors found out 3 furan derivatives between the most potent aromatic constituents of pressure - cooked hen meat . however , the presence of the unsubstituted compound has not been reported in these studies , which is consistent with the results obtained in the present work . nevertheless , taking into account that the formation of furan has already been demonstrated in model systems and retail foods heated in sealed vials under pressure cooking conditions , it could be suggested that any furan possibly formed in the studied samples was lost with the steam that is released by the valve when a determined pressure is reached . this is in accordance with the observations reported by hasnip et al . that dried vegetables heated in open vials accumulated very little furan in comparison with sealed samples . it should be noted that the possible release of furan to the air kitchen during the pressure cooking could contribute for an occupational exposure to the contaminant . this should be further investigated since it has already been demonstrated that furan was found in the air kitchen as a result of some procedures , such as the addition of water to a cafetiere , the frying of chipped potatoes in an open chip pan , and baking some foods in an oven . it can be seen that no furan has also been found in quantifiable amounts in the samples cooked for additional 10 min without the lid as well as in the reheated samples after 24 hours under cold storage . data available in the literature on the furan content after the application of common warming procedures have shown conflicting results . some authors reported furan losses of 2985 % , whereas others have found that furan persists during normal heating practices . it has also been demonstrated that furan could even be formed at levels up to 29.2 g / kg during the reheating of baby foods containing potatoes after cold storage . however , no significant furan loss or formation was observed in the samples investigated here . it was very recently reported that additional amounts of furan can be formed from potential precursors such as 2 - butenal and furfural during the thermal desorption of the fiber when using spme - gc / ms . although this technique was applied in the present study , it seems that the general impact of the possible artifactual furan formation on the obtained results was negligible . furan has been reported in a variety of thermally processed foods , including canned / jarred commercial products as well as home - cooked foods obtained by grilling , roasting , baking , or frying . although the conditions of pressure cooking can lead to furan formation in model systems and retail foods heated in sealed vials , as demonstrated by several studies , it seems that this procedure as applied at a domestic level may not represent a concern in relation to the occurrence of furan in home pressure - cooked foods . this is quite important considering that , to date , the research on furan has not been successful in identifying practical and consistently effective solutions for decreasing the levels of the contaminant in foods . also , as the interventions on furan reported in the scientific literature are mostly targeted at the level of the consumer rather than industrial production methods , the identification of domestic practices that could produce foods with reduced furan levels is highly desirable .\noutput:\n" }, { "from": "agent", "value": "furan is a food processing contaminant classified as possibly carcinogenic to humans . as the occurrence of furan has been reported in a variety of foods processed in sealed containers , the objective of this work was to investigate if the contaminant can be found in home - cooked foods prepared in a pressure cooker . for that , several foods including beans , soy beans , whole rice , beef , pork , potato , and cassava were pressure - cooked and analyzed for the furan content by gas chromatography coupled to mass spectrometry preceded by a headspace solid phase microextraction ( hs - spme - gc / ms ) . furan was not found above the limit of quantification in the pressure - cooked samples . no furan has either been found in reheated samples after 24 hours under cold storage . although levels up to 173 g / kg were already reported for commercial canned / jarred foods , it seems that the cooking in a pressure cooker may not represent a concern in relation to the occurrence of furan in foods ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bronchobiliary fistula ( bbf ) is defined as an abnormal communication between the biliary tree and the bronchial tract . it is a rare complication that may appear in the natural history of liver hydatid disease or after its surgical treatment , trauma , congenital malformation , tumor , surgery , biliary lithiasis , hepatic abscess , liver transplantation , or even radiofrequency treatment . other possible symptoms and signs are cholangitis , jaundice , and cutaneous fistula . the first case of bbfwe present a case of bbf that appeared after the surgical treatment of a giant liver hydatid cyst . a 72 - year - old woman with abdominal complaints for several months was found to have a large right upper quadrant cystic mass ( 161718 cm ) , consistent with a multivesicular liver hydatid cyst that replaced the right lobe of the liver , with compensatory hypertrophy of the left lateral segment ( lls ) ( figure 1 ) . after discussing the high risk of postoperative complications , the patient agreed to undergo surgery . we performed a total open cyst pericystectomy ; after detaching the right lobe ligaments , we opened the cyst , extracted the fluid , and instilled hypertonic saline . the right lobe elements were ligated , and the entire cyst with a margin of pericystic inflammation was resected . ercp showed an obstruction at the level of the biliary confluence and a contrast leak ( figure 2 ) . the patient was taken back to surgery for exploration where we found a fibrotic and ischemic main bile duct , likely due to torsion along its longitudinal axis . we dissected the bile duct until the liver parenchyma , but there was not viable tissue . a hepatotomy was performed at the hilar plate and a bile duct of about 1 cm in diameter was dissected and opened longitudinally . a roux - en - y jejunal loop was prepared . a side - to - side biliaryfive months after the initial surgery , the patient was admitted to the hospital with ascending cholangitis . nine months after the original operation , the patient presented to the hospital with fever and productive cough . chest plain film showed right lower lobe opacity consistent with right lower lobe pneumonia . because of her persistent bilioptysis , she underwent tc mebrofenin scan ( bridatec , amersham health , gipharma , saluggia , italy ) which confirmed the diagnosis of biliobronchial fistula ( bbf ) . a fistulous tractconnected the liver and the right lower lobe ; the patient 's sputum contained enough radioisotopes to be detected by the gamma camera ( figure 3 ) . given the postsurgical anatomy , the patient underwent percutaneous transhepatic cholangiography which was notable for bile duct dilatation , stenosis of the biliojejunal anastomosis , and biliothoracic leak ( bbf ) ( figure 4 ) . the anastomotic stricture was dilated , and an external - internal catheter was left in place . there was immediate cessation of bilioptysis and marked improvement of the patient 's condition . two years later , the patient is in very good condition , asymptomatic , and enjoying good quality of life . the reason bbfs develop is not completely known . in some cases , inflammation by bile from the intra - abdominal compartment could permeate the diaphragm . in our case , anastomotic stricture at the cholangiojejunostomy increased pressure in the biliary system , resulting in a pro - inflammatory collection of bile that extended through the diaphragm to communicate with pulmonary tissue . bile in the sputum is pathognomonic of bbf , but very often the patients have respiratory and / or biliary symptoms for weeks or months before this complication is diagnosed . in our case , bbf was not suspected until the patient started to have bilioptysis , and the suspicion was confirmed with a mebrofenin scan , showing the fistulous tract and an isotope - containing sputum . the use of ida scan was suggested as early as 1983 for this indication . in the case of tran et al . , the ida scan showed not only tracer activity in the right lung field but also in the trachea and the oral cavity . a biloma can be found , as a subphrenic collection , sometimes associated to a pleural effusion . in other instances , it has limitations in the visualization of nondistended ducts and when there is pneumobilia , as is expected after cholangio - jejunostomy . treatment of bbf has traditionally been surgical repair . in 1990 , brem et al . reported the first case of successful endoscopic treatment of bbf , in a patient with biliary lithiasis . possible techniques are sphincterotomy alone , stenting , or both . octreotide can be used as an adjunct to endoscopic treatment . in our case , as the patient had a previous biliary surgery with cholangiojejunostomy , we decided to use percutaneous transhepatic cholangiography to assess the biliary tree . after the diagnosis of biliary stenosis and bbf became apparent , dilatation of the stenotic site was performed , and an internal - external catheter was left in place , with the satisfactory result .\noutput:\n" }, { "from": "agent", "value": "background . biliobronchial fistula ( bbf ) is a rare complication in the natural history of liver hydatid disease by echinococcus granulosus . we present a case of bbf after resection of a giant liver hydatid cyst in a 72 - year - old woman . case report . a total cystpericystectomy was done , leaving the left lateral section of the liver that was fixed to the diaphragm . postoperatively , the patient developed obstructive jaundice . an ercp showed an obstruction at the junction of the left biliary duct and the main biliary duct and contrast leak . at reoperation , the main duct was ischemic , likely due to torsion along its longitudinal axis . a hepatotomy was done at the hilar plate , and the biliary duct was dissected and anastomosed to a roux - en - y jejunal loop . she was discharged without complications . five months later , the patient developed cholangitis and was successfully treated with antibiotics . however , she suffered repeated respiratory infections , and four months later she was admitted to the hospital with fever , cough , bilioptysis , and right lower lobe pneumonia . the diagnosis of bbf was confirmed with 99mtc mebrofenin scintigraphy . at transhepatic cholangiography , bile duct dilation was seen , with a biliothoracic leak . she underwent dilatation of cholangiojejunostomy stricture with placement of an external - internal catheter . the catheter was removed 3.5 months later , and two years later the patient remains in very good condition . conclusion . an indirect treatment of the bbf by percutaneous transhepatic dilation of the biliary stenosis avoided a more invasive treatment , with satisfactory outcome ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cd95 ( also known as fas ) belongs to the tnf ( tumour necrosis factor ) - receptor superfamily . fifteen years ago , it has been shown that when exposed to an agonistic anti - cd95 mab ( apo13 ) , the aggregated receptor recruits the adaptor protein fadd ( fas - associated protein with death domain ) , which then binds caspase - 8 / - 10 and ultimately elicits the apoptotic signal and the death of the cell . this complex was designated the disc for death inducing signaling complex and since numerous factors have been found to modulate the implementation of this complex and thus , the transmission of death receptor - mediated apoptotic signal . the cognate cd95 ligand , cd95l ( also known as fasl or cd178 ) is a transmembrane cytokine belonging to the tnf family . cd95l exhibits a restricted expression pattern , being expressed primarily at the surface of activated t lymphocytes and nk cells , where it contributes to the elimination of infected and transformed cells . however , cd95l is also found under inflammatory conditions , at the surface of epithelial cells , macrophages or dendritic cells where its biological function remains elusive . this type ii transmembrane protein can be cleaved by metalloproteases such as mmp3 , mmp7 , mmp9 or adam - 10 ( a disintegrin and metalloproteinase 10 ) and released as a soluble ligand into the connective tissue and the bloodstream . cleaved cd95l ( cl - cd95l ) was described initially as an inert ligand competing with its membrane - bound and pro - apoptotic counterpart ( m - cd95l ) for binding to cd95 . more recent studies confirmed that the homotrimeric cl - cd95l fails to trigger cell death but more importantly , they also bring to light that this soluble ligand possesses indeed a biological function by eliciting non - apoptotic signals leading to cell migration and / or proliferation . in this regard , we and others demonstrated that the metalloprotease - processed cd95l actively participates in aggravating inflammation and auto - immunity both in mouse model and humans affected by systemic lupus erythematosus ( sle ) . overall , these findings ascribe non - apoptotic rolesto cd95 through the implementation of different signals ( i.e. , jnk , pi3k and nf - b ) . the role ( s ) of each cd95 - mediated non - apoptotic signal remains however to be finely characterized in pathophysiological contexts . calcium ions ( ca ) participate in cell signaling as a second messenger that relies on magnitude ( cytosolic concentration ) , temporal parameters ( i.e. , duration and frequency ) and spatial localization to trigger a variety of cellular responses . following membrane receptor stimulation , ca responses mainly occur through a biphasic signal caused by activation of ip3 receptors and the release of ca from the endoplasmic reticulum ( er ) followed by a ca entry across the plasma membrane . this store - operated ca entry ( soce ) , mediated in t - lymphocytes by ca release - activated ca ( crac ) channels , plays a pivotal role in both the replenishment of the er store and in cell signaling . recently , stim1 was identified as the er - stored ca sensor that links er depletion to activation of the plasma membrane crac channel formed by orai1 subunits , allowing ca to selectively enter the cell . following contact of a t cell with an antigen - presenting dendritic cell , stim1 and orai1 colocalize with t cell receptors ( tcrs ) in the immunological synapse andtissues in which infected or transformed cells are disseminated require the recruitment of immune cells to specifically eliminate these threats . based on our findings , we surmise that the first line of activated t lymphocytes infiltrating the transformed or infected area expresses high amount of membrane - bound cd95l to trigger cell death in affected cells but also to provide a pool of ligand that will be processed by metalloproteases therefore engendering a cl - cd95l gradient . this gradient would in turn recruit a second wave of activated t cells , which ultimately amplifies if necessary the immune response and leads to the total eradication of the target cells . of note , we established that the amount of cl - cd95l is dramatically increased in sera of sle patients and contributes to the endothelial transmigration of activated t cells that accumulate in the damaged organs . we also observed that cl - cd95l evokes a transient and localized soce ( fig . 1 ) , which is instrumental in enhancing pi3k activation , actin remodeling and thus migration of activated t cells . seeking for their cellular targets , these migrating t cells may encounter cd95 - expressing bystander cells in the inflamed tissue raising the question of how is prevented in these healthy cells an accidental and irreversible activation of the apoptotic signal that will lead to their deleterious elimination . our recent findings uncovered that engagement of cd95 by the membrane - bound form of cd95l ( experimentally replaced by a home - made igcd95l that mimics the membrane - bound multi - aggregated physiologic ligand ) evokes a sustained and localized ca entry ( fig . 1 ) , which freezes the initial steps of the cd95 apoptotic signal and doing so delays its delivery . although intensity and temporal parameters of the cd95 - mediated ca signal diverge between cells exposed to cl - cd95l and m - cd95l , both ligands implement soce through the co - localization of crac channel orai1 with cd95 . in addition , we observed that whereas in presence of cl - cd95l , cells undergo the formation of a caspase and fadd - independent motility - inducing signaling complex ( misc ) , m - cd95l stimulates the transient and ca - dependent recruitment of pkc - beta2 within disc that participates in delaying the multiprotein complex formation and the transduction of the apoptotic signal . figure 1 . role of the orai1 - driven ca entry in t lymphocytes challenged with the different forms of cd95l . when exposed to the two forms of cd95l , cleaved and membrane - bound , activated t lymphocytes , target cells ( infected or transformed cells ) or bystander cells undergo an orai1 - driven ca entry that modulates differently the cd95 - mediated signaling pathway . the ca traces obtained with cells exposed to cleaved - cd95l ( 1 ) or membrane - bound cd95l ( 2 ) are depicted . accordingly , these findings support the hypothesis that a non - specific t lymphocyte / bystander cell contact would transiently engage the cd95receptor and achieve a ca - dependent time - of - decision ( tod ) preventing the transmission of the cd95 - mediated apoptotic signal in the target cell . in contrast , the selective recognition of the mhc / peptide by cytotoxic t lymphocytes may provide a sustained interaction that overrides the ca - driven tod allowing the selective elimination of infected or malignant cells . first , whether cl - cd95l induces cell motility of activated t cells in general or only on specific t - cell subpopulations involved in the etiology of the autoimmune disorders is still unknown . second , how two ligands only distinguishable by their divergent stoichiometries , are able to evoke such different intracellular ca patterns and biological outcomes using the same receptor is very puzzling , and finally , the molecular ordering leading to the activation of the ca signal remain to be identified .\noutput:\n" }, { "from": "agent", "value": "our recent findings indicate that cells exposed to transmembrane ( m - cd95l ) or metalloprotease - cleaved cd95l ( cl - cd95l ) undergo a localized ca2 + entry that not only inhibits the initial steps of the cd95 - mediated apoptotic signal but also promotes cell motility . based on recent findings published on the non - apoptotic signals induced by cd95 , we discuss how m - cd95l and cl - cd95l diverging by their stoichiometry could both contribute to the immune response by first recruiting activated t lymphocytes in the inflamed area and later by eliminating infected and transformed cells ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a penetrating head injury is a head injury in which the dura mater is breached . penetrating injury can be caused by high velocity projectiles or objects of lower velocity such as knives , or bone fragments from a skull fracture that are driven into the brain . head injuries caused by penetrating trauma are serious medical emergencies and may cause permanent disability or death . this focal , or localized , damage occurs along the route the object has traveled in the brain . primary brain damage is the damage that is complete at the time of impact , which may include : skull fracture : breaking of the bony skull contusions / bruises : often occur right under the location of impact or at points where the force of the blow has driven the brain against the bony ridges inside the skull hematomas / blood clots : occur between the skull and the brain or inside the brain itself lacerations : tearing of the frontal ( front ) and temporal ( on the side ) lobes or blood vessels of the brain ( the force of the blow causes the brain to rotate across the hard ridges of the skull , causing the tears ) nerve damage ( diffuse axonal injury ) : arises from a cutting , or shearing , force from the blow that damages nerve cells in the brain 's connecting nerve fibers secondary brain damage is the damage that evolves over time after the trauma , which may include : brain swelling ( edema ) increased pressure inside of the skull ( intracranial pressure ) epilepsyintracranial infectionfeverhematomalow or high blood pressurelow sodiumanemiatoo much or too little carbon dioxideabnormal blood coagulationcardiac changeslung changesnutritional changes brain swelling ( edema ) increased pressure inside of the skull ( intracranial pressure ) intracranial infection low or high blood pressure too much or too little carbon dioxide abnormal blood coagulationa 10 - year - old male child was playing with his siblings on the terrace of his house from two floors height . he slipped off the terrace while playing and landed head - on on the fence of his house and tumbling down onto the ground unconscious with an impacted broken distal end of the fence in the parietal bone [ figure 1 ] . cut end of fence seen at skull vault on examination in the emergency room , he was conscious , cardiovascularly stable , maintaining his airway adequately with no major hemorrhage and secretion pouring through the penetration site . his vitals were stable ( pulse rate : 100 / min , blood pressure 102/64 mm hg , and respiratory rate 18 / min ) . his left pupil was dilated and the fractured end of the fence was seen jutting out through the scalp . ct scan showed a spear - like radio - opaque object penetrating the mid - parietal bone and entering the structures below to end just above the palate [ figures 2 and 3 ] . a bicoronal approach was used and a modified bifrontal craniotomy was performed and the distal fragment of the fence was removed along with the bone flap [ figures 4 and 5 ] . the tip of the fence was seen to be six inch [ figure 6 ] inside the brain parenchyma . modified bifrontal craniotomy the patient recovered uneventfully during the postoperative phase and was shifted to the ward from the neurologic icu in 4 days . patient complained of diminished vision in the left eye which could be due to injury to the optic chiasma . ct scan was taken on the 7 postoperative day [ figure 8 ] to look for intracranial hematoma or abscess formation . head trauma is exceedingly common in children due to fall , but it rarely presents as a penetrating skull injury . injuries caused by objects with an impact velocity less than 100 m / s are known as non - missile injuries . a non - missile object causing penetrating skull injury are knife ( most common ) and rarely nails , keys , pencils , and chopsticks . penetrating skull injuries represent a life - threatening emergency . immediate hospitalization and prompt treatment are keys to a favorable prognosis . a prophylactic wide - spectrum antibiotic treatment amenable to crossing the blood brain barrier should be given as soon as possible to avoid the risk of infection . the use of anticonvulsant prophylactic agents is recommended in those cases in which traumatic brain lesions are evident , such as intracerebral hemorrhage , subdural hematoma , and depressed skull fracture and neurological deficits . early diagnosis is based on clinical evaluation , x - ray skull , and ct - scan . mri can be dangerous in cases of retained ferromagnetic objects due to possible movement in response to the magnetic torque . non - missile injuries should undergo a preoperative angiogram to rule out any vascular injury . rapid removal of the foreign body and bone fragments along with focal debridement after achieving absolute hemostasis followed by meticulous dural and scalp closure are the goals of surgical treatment . penetrating trauma is likely to cause infection , cerebral contusion , intracranial hemorrhage and seizures . penetrating head trauma also presents a risk of shock due to hemorrhage . intracranial pressure is likely to increase due to swelling or bleeding , potentially crushing delicate brain tissuemost deaths from penetrating trauma are caused by damage to blood vessels , which can lead to intracranial hematomas and ischemia , which can in turn lead to a biochemical cascade called the ischemic cascade . the child was extremely fortunate to have survived such an injury which could have easily caused sagittal sinus bleeding . to conclude , penetrating skull injuries in children are a rare entity . early intervention and multidisciplinary approach following trauma is important in penetrating skull injuries for favorable prognosis .\noutput:\n" }, { "from": "agent", "value": "in this study we are describing an unusual case of the boundary fence ( 6 inch long ) penetrating through the skull vault and lodging into the middle cranial fossa . a 10 years old male child fell onto his house fence while playing on the terrace . the metal fence penetrated through the scalp , parietal bone , midbrain and the midface , fracturing the parietal and the midfacial bones . ct - scans were obtained to view the trajectory and the position of the fence . the amount of midbrain injury was also accessed . the degree of morbidity vis - - vis the type of injury was surprisingly low . safe access to the fence was made through a bicoronal incision and modified bifrontal craniectomy to retrieve the lodged portion of the fence . these kind of penetrating injuries are rare considering the thickness of the vault . proper preoperative planning and team approach is required for the safe surgical removal of the objects ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: organisms must exhibit a wide range of behaviors to respond to threatening stimuli and changes in the environment . the autonomic response is well studied in vertebrates as the fight or flight response in which the sympathetic nervous system physiologically readies the internal environment ( carpenter , 1976 ; nicholls et al . , 2001 ) . it is through physiological changes that an organism can regulate the stress response and alter behavior to react to an impending attack or environmental change . evidence shows that the cardio - vascular system is tightly connected with the respiratory system thus enabling the internal environment to respond and implement a response . it is well known that the autonomic control of the respiratory and cardiovascular systems can regulate oxygen availability and nutrients to specific target tissues needed for an impending behavioral response . in vertebrates , the autonomic and physiological response is so well evolved ; it would seem likely that complex invertebrates would similarly possess a developed response system ( schapker et al . , 2002 ; zavarzin , 1941 ) . even though vertebrates and invertebrates are very different systematically ; highly developed invertebrates require the rapid cardiovascular and respiratory response to respond in a fight or flight manner . for many invertebrates , dating back to 1927 , many of the very early studies have been conducted in invertebrates , specifically using arthropods in general ( alexandrowicz , 1932 ; orlov , 1927 ; zavarzin , 1941 ) . crayfish are known to exhibit a wide range of rapid behaviors as well as the ability to assess and respond to environmental stimuli . very early studies have noted a sympathetic - like response of an immediate and rapid response of defense posturing ( bethe , 1897 ; huxley , 1880 ; shuranova et al . , 2006 ; wiersma , 1961 ) . the adult crayfish heart is neurogenic since the beat and rhythm are controlled by the central nervous system ( alexandrowicz , 1932 ; yamagishi and hirose , 1997 ; yamagishi et al . , 1997 ; wilkens , 1999 ) . routinely , measurement of an animal 's heart rate ( hr ) provides a direct measure of excitability and readiness of the internal environment . in crayfish , an increase in hr is noted during defense posturing when presented with a perceived threatening stimulus ( listerman et al . , 2000 ) . this type of nervous system response was also shown in spiny lobsters ( yazawa and katsuyama , 2001 ) . the ventilatory system is also neuronally controlled with a ventilatory central pattern generator ( vpg ) responsible for oxygen uptake across the gills by the pumping action of two specialized appendages termed scaphognathites ( mendelson , 1971 ) . a single scaphognathite resides in each branchial chamber at the anterior ends and draws water across the gills by a rhythmic movement ( pasztor , 1968 ) . previous work in the crab , cancer magister shows cardiac and ventilatory rhythm can be altered by central control through command neurons ( wilkens et al . , 1974 ) . in addition , activity of the vpg is known to change with changes in the internal response and with social interactions or environmental changes in crustaceans ( burmistrov and shuranova , 1996 ; cuadras , 1979 , 1980 ; li et al . , 2000 ; listerman et al . , 2000 ; mcmahon and wilkens , 1983 ; schapker et al . as seen in the crayfish , ventilatory activity ( vr ) can vary depending on the internal state and changes in vr can be recorded during unexpected external stimuli ( shuranova et al . , 1993 ; shuranova et al . ,2002 ) . due to the dependability and feasibility of hr and vr measures , the future questions to be asked are endless . as noted previously , work has been done to examine the autonomic response during social interactions and environmental disturbances . interestingly , many areas are left to be explored such as examination of the autonomic response during natural hormonal changes and / or other physiological processes occurring in the organism . possible future directions may also examine sympathetic - like responses during mating and olfactory chemical reception . most importantly , physiological responses may provide greater insights into an organism response to the environment when compared to behavioral observations since animals do not always respond behaviorally when they are readying themselves internally . thus , the physiological measurement provides a biological index for assessing an organism 's internal state which may explain overall changes in an organism . electrocardiograms recording ( ecgs ) procedures for heart and ventilation rates before beginning to wire a crayfish , preparation of wires is required . cut two insulated stainless steel wires ( diameter 0.005 inches and with the coating 0.008 inches ; a - m systems , carlsburg , wa ) long enough to insert into the crayfish and adequately reach an impedance detector ( ufi , model 2991 ) . remove insulation ( ~ 0.5 mm ) by fire on the ends of both wires which will be inserted into the carapace . be careful not remove too much insulation as a bare wire on the outside of the animal must be recoated to prevent short circuiting impedance recordings . then , using forceps bend the burned ends of the wires in a 90 angle for placement into the carapace . be sure that the inserted portion of the wire is not too long because this could do damage to internal organs . for feasibility of inserting the wires into a plastic tube ( which protects the wires ) , it is best to loosely twist the wires together . if recording heart and ventilation rates , repeat the above steps a second time and the two sets of wires can be loosely braided together before placement into the plastic tubing . be sure to designate the wires for heart and ventilation rate so as to not confuse which wires attach to which impedance detector for recording . it is best to label the wires or cut one pair shorter than the other in the beginning . to feasibly andsafely wire the crayfish , it is best to wrap the claws and legs ( leaving the back and one side exposed ) in wet cloth or paper towels to eliminate injury to the person and / or crayfish ( figure 1 ) . figure 1 . the crayfish in a wet paper towel will prevent injury to the person and the crayfish . the wrapping will hinder the ability of the crayfish to move the chelipeds and legs . to begin the wiring process , it is best to begin in the gill chamber since carapace thickness varies with each crayfish and excess force can cause damage to internal organs , thus by beginning in the gill chamber , excessive pressure is less likely to kill the crayfish as compared to the thoracic chamber . the first hole is made by using a fine point scalpel and just large enough for a wire to be inserted under the cuticle in the rostral area of the gill chamber ( i.e. , prebranchial chamber to monitor ventilatory rate ; schapker et al . a large hole will have excessive hemolymph loss and will not seal properly and this will increase the probability of the wires not remaining in the designated hole . once the wire is in place , drop a small amount of glue ( cyanoacrylate ester ) and accelerator ( hobbytown usa , lexington , ky ) onto the wire . be careful to place only a small amount of accelerator onto the cuticle since this is toxic to the crayfish and will cause death . these two wires are placed to span the scaphognathite ( respiratory organ ) to insure a strong accurate impedance measure during each scaphognathite movement ( figure 2 ) . to get an accurate recording , be sure that the second wire is not placed outside the gill chamber and into the thoracic chamber . the white dots on the carapace represent points for the stainless steel wires to be placed under the cuticle . the steps for wiring heart rate in the thoracic chamber is the same as above except the wires are placed under the dorsal carapace directly over the heart and span the heart in a rostral - caudal arrangement ( figure 3 ) . this placement will ensure a strong accurate impedance measure during each heart contraction ( listerman et al . , 2001 ) . the white dots on the carapace represent points for the stainless steel wires to be placed under the cuticle . once placement of all four wires is complete , mix an instant adhesive ( eastman , 5 - min drying epoxy ) and coat the holes for each location as well as the wires . once the wires and drilled holes are adequately covered , use the remaining epoxy to hold the plastic tubing to the back of the crayfish . this will ensure that the wires will not be pulled out of the holes in future handlings . since the epoxy takes a few minutes to dry , hold or place the crayfish in a container without water until the epoxy is no longer sticky to the touch . once the epoxy is dry , wash the crayfish in water to remove excess chemicals and place them back into an aquatic environment . to ensure the health of the crayfish , it is best to change the water in approximately one hour to remove any chemicalsas noted from previous investigators , we found that prolonged handling alters the physiological measurements due stress for a time duration of 24 h to 3 days ( wilkens et al . , 1985 ) ; therefore , animals should be left for 2 to 3 days before any experimentation . the two wires spanning the heart ( measure hr ) should be attached to a single impedance detector and likewise for the two wires spanning the scaphognathite ( measure vr ) . these signals are recorded by connecting the detector on - line to a powerlab via a powerlab / 4sp interface ( ad instruments ) . all events are measured and calibrated with the powerlab chart software version 5.5.6 ( ad instruments , australia ) . to begin , set an acquisition rate at 4 khz . for ease in counting each hr / vr , a smoothing function can applied to the data set . if 100 points were smoothed ( i.e. averaged ) the resultant trace will depict only the heartbeats . the heart rates can be determined by direct counts of each beat over 10 - s intervals and then converted to beats per min ( bpm ) . organisms must exhibit a wide range of behaviors to respond to threatening stimuli and changes in the environment . the autonomic response is well studied in vertebrates as the fight or flight response in which the sympathetic nervous system physiologically readies the internal environment ( carpenter , 1976 ; nicholls et al . , 2001 ) . it is through physiological changes that an organism can regulate the stress response and alter behavior to react to an impending attack or environmental change . evidence shows that the cardio - vascular system is tightly connected with the respiratory system thus enabling the internal environment to respond and implement a response . it is well known that the autonomic control of the respiratory and cardiovascular systems can regulate oxygen availability and nutrients to specific target tissues needed for an impending behavioral response . in vertebrates , the autonomic and physiological response is so well evolved ; it would seem likely that complex invertebrates would similarly possess a developed response system ( schapker et al . , 2002 ; zavarzin , 1941 ) . even though vertebrates and invertebrates are very different systematically ; highly developed invertebrates require the rapid cardiovascular and respiratory response to respond in a fight or flight manner . for many invertebrates , dating back to 1927 , many of the very early studies have been conducted in invertebrates , specifically using arthropods in general ( alexandrowicz , 1932 ; orlov , 1927 ; zavarzin , 1941 ) . crayfish are known to exhibit a wide range of rapid behaviors as well as the ability to assess and respond to environmental stimuli . very early studies have noted a sympathetic - like response of an immediate and rapid response of defense posturing ( bethe , 1897 ; huxley , 1880 ; shuranova et al . , 2006 ; wiersma , 1961 ) . the adult crayfish heart is neurogenic since the beat and rhythm are controlled by the central nervous system ( alexandrowicz , 1932 ; yamagishi and hirose , 1997 ; yamagishi et al . , 1997 ; wilkens , 1999 ) . routinely , measurement of an animal 's heart rate ( hr ) provides a direct measure of excitability and readiness of the internal environment . in crayfish , an increase in hr is noted during defense posturing when presented with a perceived threatening stimulus ( listerman et al . , 2000 ) . this type of nervous system response was also shown in spiny lobsters ( yazawa and katsuyama , 2001 ) . the ventilatory system is also neuronally controlled with a ventilatory central pattern generator ( vpg ) responsible for oxygen uptake across the gills by the pumping action of two specialized appendages termed scaphognathites ( mendelson , 1971 ) . a single scaphognathite resides in each branchial chamber at the anterior ends and draws water across the gills by a rhythmic movement ( pasztor , 1968 ) . previous work in the crab , cancer magister shows cardiac and ventilatory rhythm can be altered by central control through command neurons ( wilkens et al . , 1974 ) . in addition , activity of the vpg is known to change with changes in the internal response and with social interactions or environmental changes in crustaceans ( burmistrov and shuranova , 1996 ; cuadras , 1979 , 1980 ; li et al . , 2000 ; listerman et al . , 2000 ; mcmahon and wilkens , 1983 ; schapker et al . as seen in the crayfish , ventilatory activity ( vr ) can vary depending on the internal state and changes in vr can be recorded during unexpected external stimuli ( shuranova et al . , 1993 ; shuranova et al . ,2002 ) . due to the dependability and feasibility of hr and vr measures , the future questions to be asked are endless . as noted previously , work has been done to examine the autonomic response during social interactions and environmental disturbances . interestingly , many areas are left to be explored such as examination of the autonomic response during natural hormonal changes and / or other physiological processes occurring in the organism . possible future directions may also examine sympathetic - like responses during mating and olfactory chemical reception . most importantly , physiological responses may provide greater insights into an organism response to the environment when compared to behavioral observations since animals do not always respond behaviorally when they are readying themselves internally . thus , the physiological measurement provides a biological index for assessing an organism 's internal state which may explain overall changes in an organism . electrocardiograms recording ( ecgs ) procedures for heart and ventilation rates before beginning to wire a crayfish , preparation of wires is required . cut two insulated stainless steel wires ( diameter 0.005 inches and with the coating 0.008 inches ; a - m systems , carlsburg , wa ) long enough to insert into the crayfish and adequately reach an impedance detector ( ufi , model 2991 ) . remove insulation ( ~ 0.5 mm ) by fire on the ends of both wires which will be inserted into the carapace . be careful not remove too much insulation as a bare wire on the outside of the animal must be recoated to prevent short circuiting impedance recordings . then , using forceps bend the burned ends of the wires in a 90 angle for placement into the carapace . be sure that the inserted portion of the wire is not too long because this could do damage to internal organs . for feasibility of inserting the wires into a plastic tube ( which protects the wires ) , it is best to loosely twist the wires together . if recording heart and ventilation rates , repeat the above steps a second time and the two sets of wires can be loosely braided together before placement into the plastic tubing . be sure to designate the wires for heart and ventilation rate so as to not confuse which wires attach to which impedance detector for recording . it is best to label the wires or cut one pair shorter than the other in the beginning . to feasibly andsafely wire the crayfish , it is best to wrap the claws and legs ( leaving the back and one side exposed ) in wet cloth or paper towels to eliminate injury to the person and / or crayfish ( figure 1 ) . wrapping the crayfish in a wet paper towel will prevent injury to the person and the crayfish . the wrapping will hinder the ability of the crayfish to move the chelipeds and legs . to begin the wiring process , it is best to begin in the gill chamber since carapace thickness varies with each crayfish and excess force can cause damage to internal organs , thus by beginning in the gill chamber , excessive pressure is less likely to kill the crayfish as compared to the thoracic chamber . the first hole is made by using a fine point scalpel and just large enough for a wire to be inserted under the cuticle in the rostral area of the gill chamber ( i.e. , prebranchial chamber to monitor ventilatory rate ; schapker et al . , 2002 ) . a large hole will have excessive hemolymph loss and will not seal properly and this will increase the probability of the wires not remaining in the designated hole . once the wire is in place , drop a small amount of glue ( cyanoacrylate ester ) and accelerator ( hobbytown usa , lexington , ky ) onto the wire . be careful to place only a small amount of accelerator onto the cuticle since this is toxic to the crayfish and will cause death . these two wires are placed to span the scaphognathite ( respiratory organ ) to insure a strong accurate impedance measure during each scaphognathite movement ( figure 2 ) . to get an accurate recording , be sure that the second wire is not placed outside the gill chamber and into the thoracic chamber . the white dots on the carapace represent points for the stainless steel wires to be placed under the cuticle . the steps for wiring heart rate in the thoracic chamber is the same as above except the wires are placed under the dorsal carapace directly over the heart and span the heart in a rostral - caudal arrangement ( figure 3 ) . this placement will ensure a strong accurate impedance measure during each heart contraction ( listerman et al . , 2001 ) . the white dots on the carapace represent points for the stainless steel wires to be placed under the cuticle . once placement of all four wires is complete , mix an instant adhesive ( eastman , 5 - min drying epoxy ) and coat the holes for each location as well as the wires . once the wires and drilled holes are adequately covered , use the remaining epoxy to hold the plastic tubing to the back of the crayfish . this will ensure that the wires will not be pulled out of the holes in future handlings . since the epoxy takes a few minutes to dry , hold or place the crayfish in a container without water until the epoxy is no longer sticky to the touch . once the epoxy is dry , wash the crayfish in water to remove excess chemicals and place them back into an aquatic environment . to ensure the health of the crayfish , it is best to change the water in approximately one hour to remove any chemicals not previously removed . as noted from previous investigators , we found that prolonged handling alters the physiological measurements due stress for a time duration of 24 h to 3 days ( wilkens et al . , 1985 ) ; therefore , animals should be left for 2 to 3 days before any experimentation . the two wires spanning the heart ( measure hr ) should be attached to a single impedance detector and likewise for the two wires spanning the scaphognathite ( measure vr ) . these signals are recorded by connecting the detector on - line to a powerlab via a powerlab / 4sp interface ( ad instruments ) . all events are measured and calibrated with the powerlab chart software version 5.5.6 ( ad instruments , australia ) . to begin , set an acquisition rate at 4 khz . for ease in counting each hr / vr , a smoothing function can applied to the data set . if 100 points were smoothed ( i.e. averaged ) the resultant trace will depict only the heartbeats . the heart rates can be determined by direct counts of each beat over 10 - s intervals and then converted to beats per min ( bpm ) .\noutput:\n" }, { "from": "agent", "value": "the fear , flight or fight response serves as the fundamental physiological basis for examining an organism 's awareness of its environment under an impending predator attack . although it is not known whether invertebrates posses an autonomic nervous system identical to that of vertebrates , evidence shows invertebrates have a sympathetic - like response to regulate the internal environment and ready the organism to act behaviorally to a given stimuli . furthermore , this physiological response can be feasibly measured and it acts as a biological index for the animal 's internal state . measurements of the physiological response can be directly related to internal and external stressors through changes in the central nervous system controlled coordination of the cardio - vascular and respiratory systems . more specifically , monitoring heart and ventilation rates provide quantifiable measures of the stress response not always behaviorally observed . crayfish are good model organisms for heart and ventilatory rate measurements due to the feasibility of recording , as well as the rich history known of the morphology of the crayfish , dating back to huxley in 1888 , and the well - studied typical behaviors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: bisphosphonates are the preferred drugs in postmenopausal and corticosteroid - induced osteoporosis .15 long term therapy with bisphosphonates results in significant rise in bone mineral density ( bmd ) of spine and hip .68 subtrochanteric and femoral shaft fractures may occur in patients who have been treated with long term bisphosphonates , but are limited reports regarding pathological fractures at other musculoskeletal sites .6912 we report a rare case report of alendronate - induced pathological metatarsal fracture . a 24 - year - old female with diagnosis of cushing 's disease ( ectopic acth syndrome ) had undergone adrenalectomy in 2000 . the patient started having pain in the left hip 2 years postadrenalectomy , for which she was given analgesics and calcium supplementation . her bmd ( t score : 3.3 ; lumbar spine and 2.6 ; proximal femur ) and radiological examination suggested severe osteoporosis . she subsequently suffered pathological fracture neck of femur for which she was operated and valgus osteotomy was done . postoperatively , she was advised alendronate 70 mg once a week with calcium supplementation along with low - dose steroid for post adrenalectomy supplementation . after 6 years , the patient again started having pain in the right hip and thigh . her bmd was found to be improving ( t score 1.1 ) and there was no radiological evidence of osteoporosis as well . she was advised analgesics , exercises , along with the previous treatment , but her pain did not subside . after 5 months , she had aggravation of pain and on radiological evaluation was found to be having pathological subtrochanteric fracture for which she was operated and internal fixation with long proximal femoral nail was done [ figure 1a ] . the fracture united at 10 months and pain in thigh and hip subsided [ figure 1b ] . the patient continued to take alendronate along with low - dose steroid for post adrenalectomy supplementation . two years later the patient started having diffuse dull ache , insidious in onset , activity related pain in the right foot which did not subside completely with analgesics and physical therapy for 3 months . the radiographic evaluation showed incomplete , transverse , diaphyseal fracture of fifth metatarsal shaft with thickening of lateral cortex [ figure 2a ] . alendronate therapy was discontinued and teriparatide therapy 20 mcg subcutaneously was started and continued for 6 months . she improved and the fracture healed , and after 5 months , she was able to walk without walking aid and was doing all her household activities [ figure 2b ] . ( a ) x - ray both hip joints with proximal half of femur ( anteroposterior view ) showing bisphosphonate induced pathological subtrochanteric fracture right hip in postadrenalectomy patient on long term bisphosphonate therapy . the x - ray also shows a healed fracture neck of femur treated by valgus osteotomy . ( b ) ten - month followup anteroposterior radiograph showing union after internal fixation with proximal femoral nail ( a ) radiograph of right foot ( anteroposterior view ) showing alendronate induced atypical fracture of fifth metatarsal which is transverse , incomplete , diaphyseal fracture with characteristic thickening of lateral cortex ( b ) radiograph at 5 month followup showing fracture unionbisphosphonates are the most widely studied and used first - line drugs in postmenopausal and corticosteroid - induced osteoporosis .351314 alendronate , risedronate , and ibandronate are currently approved by fda for use in osteoporosis .15 bisphosphonates bind avidly to mineralized bone surfaces and reduce osteoclastic bone resorption and result in increased mineral density in the dual energy x - ray absorptiometry [ dexa ] scan .12 paradoxically , this dense bone is weaker , brittle , and prone to pathological fracture . alendronate significantly increases bone density of spine and hip and reduces the incidence of osteoporotic fracture up to 50 % .7816 even when discontinued after 5 years , the physiological effect on bone resorption remains for 5 years thereafter , with no increase in fracture risk .817 parathormone ( pth ) is an anabolic agent that acts by stimulating bone formation . continuous exposure to high - dose pth increases osteoclast differentiation which leads to bone resorption . on the contrary , intermittent injections of low - dose pth produces increase in osteoblast number and function by promoting osteoblastogenesis and decreasing osteoblast apoptosis ,1820 leading to bone formation , thickening of cortices and existing trabeculae of the skeleton , and perhaps increasing trabecular numbers and their connectivity .18 teriparatide is a recombinant form of human parathyroid hormone approved by the fda for treatment of osteoporosis in postmenopausal women who are at high risk for fractures .21 this anabolic agent is especially indicated in patients with severe osteoporosis with high risk of fracture . the benefit of pth persists when antiresorptives are maintained and its use for more than 2 years is not recommended .12 in 2005 , odvina et al . identified a group of nine patients who developed spontaneous non - spinal fractures while on long term alendronate . these non - traumatic fractures involved skeletal areas rich in cortical bone , such as the femoral shaft , pubic bone , and ischium , and were considered atypical for osteoporotic fractures .22 bone biopsies in all demonstrated severe suppression of bone turnover ( ssbt ) . goh et al . reported a series of 13 patients with low - energy subtrochanteric fractures in which patients on alendronate had a higher incidence of simple transverse or short oblique fractures ( 89 % ) as opposed to the patients with osteoporosis not receiving bisphosphonates ( 0 % ) .23 approximately 5576 % of the patients with bisphosphonate - related fractures had prodromal pain prior to fracture completion , whereas none of the patients with fractures solely due to severe osteoporosis in the absence of long term alendronate had prodromal pain .7 it has been reported that the long term use of alendronate ,9152325 especially in those patients who have normal bmd , leads to severe suppression of bone turnover , resulting in bone pain and pathological fracture . in experimental studies , alendronate has been shown to inhibit normal repair of microdamage arising from ssbt , which in turn results in accumulation of microdamage . in addition to microdamage accumulation , chronic oversuppression of bone turnover by alendronate may allow secondary mineralization to continue , resulting in hypermineralized bone which has high young 's modulus of bone elasticity but low work to fragility values ( a measure of fracture toughness ) .2632 alendronate associated fractures may be bilateral ,923 have unique radiological features like transverse fracture orientation with preexisting ellipsoidal thickening of lateral femoral cortex and medial beak , and are likely to be preceded by prodromal pain and occur with no or trivial trauma . these fractures are particularly reported in subtrochanteric and diaphyseal region of femur , but our case report shows that long term alendronate therapy may result in concomitant pathological fracture at other musculoskeletal sites as well . in our casea postadrenalectomy patient with limited functional activities and history of two fractures in the past , was on long term alendronate therapy for 8 years , and was having normal bone stock with near - normal bmd ( t score 0.7 ) . this patient had fracture of fifth metatarsal with features like prodromal symptoms preceding the fracture without any history of trauma and characteristic features like incomplete , transverse diaphyseal fracture with thickening of lateral cortex at fifth metatarsal . these fractures are difficult to unite with conservative management .2325 current accepted guidelines for treatment of incomplete or complete fracture is surgical treatment along with withdrawal of bisphosphonate therapy and introduction of low - dose teriparatide 20 mcg daily subcutaneously for 36 months . there is marked improvement in bmd after long term use of alendronate , but this prolonged treatment does not appear safe as this may result in ssbt in some patients .2325 alendronate was used in our case after the onset of steroid - induced osteoporosis . after long term use of this drug , the patient started having prodromal symptoms like thigh pain and then atraumatic subtrochanteric fracture and atypical metatarsal fracture thereafter , creating a doubt on the safety of long term use of alendronate even in well - indicated patients . it would have been reasonable to stop the drug when our patient had atypical subtrochanteric fracture of the right femoral shaft . bisphosphonates are useful for the treatment of osteoporosis , but there are safety concerns about long term use of alendronate , which may lead to ssbt and unusual fractures . the patient in this case report took long term alendronate therapy for 8 years and sustained two non - traumatic alendronate - induced atypical fractures . if we had discontinued alendronate and started teriparatide at the time of atypical subtrochanteric fracture management , unusual metatarsal fracture which is rare would not have evolved . we advise clinicians should screen the patients on long term alendronate therapy for prodromal symptoms and consider the use of radiographs to detect the insufficiency stress fracture . in situations where characteristic atypical fractures have already developed , one should strongly consider discontinuing this drug .\noutput:\n" }, { "from": "agent", "value": "a 24 years old female of cushing disease had undergone adrenelectomy . she was put on alendronate and steroid . after six and a half years she developed pathological fracture subtrochanteric femur . the patient was treated with proximal femoral nailing and the fracture united . 2 years later she developed pain right foot . she was diagnosed as transverse fracture of fifth metatarsal . we report this rare case of atypical metatarsal fracture in a patient on long term bisphosphonate therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cerebral palsy ( cp ) is defined as a group of permanent disorders characterized by impaired movement and posture caused by nonprogressive damage in the motor control centers of the developing fetal or infant brain ( 1 ) . the clinical picture of cp ranges from mild monoplegia with normal intellect to severe total body spasticity and intellectual impairment ( 2 ) . in addition , cp can be associated with comorbidities such as epilepsy , gastrointestinal problems , bladder control problems , ocular abnormality , and pain ( 3 , 4 ) . muscle and joint contracture and bony deformity frequently occur in patients with cp , especially the spastic type , and therefore orthopedic interventions are often required . the two major surgical procedures used are single event multilevel surgery ( semls ) for gait improvement and hip reconstructive surgery for pain reduction and facilitation of caregiving . semls has become standard treatment to improve gait in ambulatory patients who are at gross motor function classification system ( 5 ) ( gmfcs ) level i to iii ( 6 ) . hip reconstructive surgery is usually performed for patients at gmfcs levels iv and v who have hip instability ( 7 , 8 ) . the overall medical health of patients with cp is often poorer than that of patients without cp , making them more vulnerable to perioperative complications . physicians are more focused on postoperative complications related to the procedures or treatment ( 9 , 10 , 11 ) , whereas they might be less concerned about intraoperative complications ( 12 ) . because complications are more common in patients with cp , surgeons must be aware of perioperative morbidity and prepared to recognize and treat perioperative complications . the purpose of this study was to determine the incidence of perioperative complications associated with lower extremity orthopedic intervention in patients with cp and establish the risk factors for those complications . we reviewed the medical records of consecutive patients with cp who were admitted to our hospital and underwent semls and / or hip reconstruction surgery between may 2003 and december 2012 . for statistical independence , only data from each patient 's first surgery were included in the study ( 13 ) . information obtained from medical records included patient age , sex , length of hospital stay , past medical history , involvement of cp , operation time , and surgery details . semls addresses the correction of all fixed musculoskeletal pathology in one surgical session to improve both gait and gross motor function . the procedures involve tendon lengthening , tendon transfer , rotational osteotomy , and joint stabilization ( 14 ) . hip reconstructive surgery involves reduction of the hip joint and correction of bony abnormalities in the femur and acetabulum and soft tissue abnormalities around the hip joint such as adductor release and psoas lengthening ( 15 ) . evaluation for cormack - lehane ( cl ) classification ( 16 ) and the american society of anesthesiologists physical status classification system ( asa class ) ( 17 ) was performed before initiation of anesthesia to determine if a correlation between the classification system and patient functional level exists . the cl classification is a grading system commonly used to describe the laryngeal view during direct laryngoscopy ( 18 ) . in grade 1most of the glottis can be visualized , and in grade 4 neither the glottis nor the epiglottis is visible , making tracheal intubation difficult . asa class is commonly used to describe preoperative physical status and predict perioperative anesthesia risk ( 19 ) . there are five classes ranging from completely healthy to moribund and terminally ill ( 17 ) . to determine if emergence from anesthesia was delayed , the emergence time was calculated as the time between discontinuance of administration of anesthetics and departure time from operation room to postoperative care unit . studies have reported a relationship between perioperative complications and intraoperative hypothermia ( 20 , 21 ) . intraoperative hypothermia was defined as core body temperature measured by esophageal stethoscope below 35 . hypotension and bradycardia were divided into relative and absolute with relative defined as a 20 % decrease from baseline while receiving anesthesia ( 22 ) . the baseline was the blood pressure and heart rate at midnight the day of surgery . absolute hypotension and bradycardia were determined by the patients ' age group ( table 1 ) ( 23 ) . major complications were those that resulted in a prolonged hospital stay of more than 5 days or unplanned admission to the intensive care unit ( 11 ) . six orthopedic surgeons with 28 , 12 , 9 , 8 , and 5 yr of experience and two anesthesiologists with 25 and 6 yr of experience held consensus building sessions before assessing postoperative complications . patients were stratified into two groups according to gmfcs level : ambulatory ( gmfcs i to iii ) and non - ambulatory ( gmfcs level iv and v ) . they were also divided into three age groups ( 13 , 13 - 18 , and 18 yr ) to determine patient distribution and define absolute hypotension and bradycardia . the chi - square test or fisher 's exact test was used to compare categorical variables . the cochran - mantel - haenszel ( cmh ) test was used to determine relationships between two categorical variables controlling for one or more categorical factors . an independent t - test was used to evaluate the significance of differences in anesthesia emergence time and gmfcs levels . analysis of covariance ( ancova ) was used to assess the relationship between operation time and complications , controlling for gmfcs level and hip surgery . statistical analysis was performed using spss version 20.0 ( ibm co. , chicago , il , usa ) . all statistics were two - tailed , and p values 0.05 were considered statistically significant . this retrospective study was approved by the institutional review board of seoul national university bundang hospital ( irb no . evaluation for cormack - lehane ( cl ) classification ( 16 ) and the american society of anesthesiologists physical status classification system ( asa class ) ( 17 ) was performed before initiation of anesthesia to determine if a correlation between the classification system and patient functional level exists . the cl classification is a grading system commonly used to describe the laryngeal view during direct laryngoscopy ( 18 ) . in grade 1most of the glottis can be visualized , and in grade 4 neither the glottis nor the epiglottis is visible , making tracheal intubation difficult . asa class is commonly used to describe preoperative physical status and predict perioperative anesthesia risk ( 19 ) . there are five classes ranging from completely healthy to moribund and terminally ill ( 17 ) . to determine if emergence from anesthesia was delayed , the emergence time was calculated as the time between discontinuance of administration of anesthetics and departure time from operation room to postoperative care unit . studies have reported a relationship between perioperative complications and intraoperative hypothermia ( 20 , 21 ) . intraoperative hypothermia was defined as core body temperature measured by esophageal stethoscope below 35 . hypotension and bradycardia were divided into relative and absolute with relative defined as a 20 % decrease from baseline while receiving anesthesia ( 22 ) . the baseline was the blood pressure and heart rate at midnight the day of surgery . absolute hypotension and bradycardia were determined by the patients ' age group ( table 1 ) ( 23 ) . major complications were those that resulted in a prolonged hospital stay of more than 5 days or unplanned admission to the intensive care unit ( 11 ) . six orthopedic surgeons with 28 , 12 , 9 , 8 , and 5 yr of experience and two anesthesiologists with 25 and 6 yr of experience held consensus building sessions before assessing postoperative complications . patients were stratified into two groups according to gmfcs level : ambulatory ( gmfcs i to iii ) and non - ambulatory ( gmfcs level iv and v ) . they were also divided into three age groups ( 13 , 13 - 18 , and 18 yr ) to determine patient distribution and define absolute hypotension and bradycardia . the chi - square test or fisher 's exact test was used to compare categorical variables . the cochran - mantel - haenszel ( cmh ) test was used to determine relationships between two categorical variables controlling for one or more categorical factors . an independent t - test was used to evaluate the significance of differences in anesthesia emergence time and gmfcs levels . analysis of covariance ( ancova ) was used to assess the relationship between operation time and complications , controlling for gmfcs level and hip surgery . statistical analysis was performed using spss version 20.0 ( ibm co. , chicago , il , usa ) . all statistics were two - tailed , and p values 0.05 were considered statistically significant . this retrospective study was approved by the institutional review board of seoul national university bundang hospital ( irb no . three were excluded because their first surgeries were performed under regional anesthesia , leaving a total of 868 surgeries in 868 patients in the study . the mean age of the patients at time of first surgery was 11.87.6 yr ( range , 4.0 to 61.0 yr ) . the mean hospital stay was 10.55.9 days ( range , 0 to 60 days ) . two hundred thirty - five patients underwent proximal femoral osteotomy , and 34 patients underwent pelvic osteotomy simultaneously . diplegia ( 54.3 % ) was most commonly found in involvement of cp , and the most common gmfcs level was ii ( table 2 ) . twenty patients ( 2.3 % ) had a history of pneumonia , and four patients ( 0.5 % ) had upper airway hypotonia . the majority of the patients were categorized as i and ii in cl grade and asa class ( fig .1 ) . twenty ( 2.3 % ) patients suffered major postoperative complications , and 35 ( 4.0 % ) suffered minor complications postoperatively ( table 3 ) . the patients at gmfcs level iv and v had a significantly higher perioperative complication rate compared with those at gmfcs level i to iii ( table 4 ) . because gmfcs level showed a significant association with age group ( p = 0.003 ) , hip reconstructive surgery , involvement of cp , and history of pneumonia ( p 0.001 ) ( appendix i ) , the relationships between perioperative complications and these factors were analyzed using the cmh test , adjusting for gmfcs level as a control variable . there was no statistical difference in emergence time from anesthesia according to gmfcs level of the patients ( p = 0.331 ) . older age group ( p = 0.032 ) , lower functional level ( gmfcs level iv and v ) , and hip reconstructive surgery were risk factors for hypothermia during the surgery ( p 0.001 ) . lower functional level , older age , and history of pneumonia were associated with absolute hypotension during surgery ( p 0.001 ) . older age increased the risk of relative and absolute bradycardia during surgery , and lower functional level and history of pneumonia increased the risk of major postoperative complications ( p 0.001 ) ( table 4 , appendix ii ) . after adjustment for gmfcs level and hip surgery , the operation time was longer in patients with hypothermia , relative and absolute hypotension , and relative bradycardia than in patients without these complications ( table 4 , appendix iii ) . there was no relationship between gmfcs level and cl classification , whereas asa class demonstrated a statistically significant relationship with gmfcs level ( p 0.001 ) . patients with cp have overall poor health than patients without a chronic illness , and they have a higher risk of perioperative complications from anesthesia or the surgical procedure . since most surgeons have focused on postoperative complications , we performed this study to ascertain the incidence of intra - and postoperative complications in patients with cp and to determine the risk factors for complications associated with surgery . in the present study , gmfcs level , patient age , hip reconstructive surgery , and operation time affected core body temperature during surgery . in addition , major postoperative complications occurred more frequently in patients with lower functional level and history of pneumonia . in this study , gmfcs level showed a significant relationship with age group , hip reconstructive surgery , involvement of cp , and history of pneumonia . we believed that patients at gmfcs level iv and v required hip reconstructive surgery more frequently during childhood and adolescence . their medical conditions were usually more severe compared with those of patients at gmfcs level i to iii . therefore , we used the cmh test to analyze the relationships between predisposing factors and perioperative complications adjusting for gmfcs level as a control variable . older age group , lower functional level , hip reconstructive surgery , and operation time increased the rate of hypothermia during surgery in this study . however , hypothermia can delay wound healing and predispose patients to wound infection ( 20 ) . it can result in peripheral vasoconstriction and neutrophil dysfunction ( 24 ) , which have been shown to increase the incidence of surgical wound infections by a magnitude of three , and substantially reduced the immune system response to infection ( 25 ) . furthermore , hypothermia during surgery adversely affects the coagulation system through impaired platelet function and prolonged prothrombin and clotting time ( 25 ) . maintaining body temperature during surgery can decrease the incidence of postoperative wound infection and delayed wound healing . lower functional level , older age , history of pneumonia , and operation time were associated with absolute hypotension during surgery . relative and absolute hypotension were observed in 31.6 % and 4.4 % of the study population , respectively , which is consistent with previous studies ( 26 , 12 ) . the cause of hypotension was multifactorial and may have been associated with an increased sensitivity to anesthetic drugs or decreased central adrenergic activity related to cp . although intraoperative hypotension may be associated with a higher postoperative morbidity ( 27 ) , its clinical significance has not yet been established . understanding , early recognition and management of hypotension is important in patients with cp , who have less physiological reserve and insufficient compensatory responses to maintain normal blood pressure . in the last decade , all occurred on the ward , and cardiopulmonary resuscitation was initiated immediately with return of spontaneous circulation within 5 to 17 min . the age of the patients varied ( 9 , 16 , and 20 yr old ) , as did the cause of cardiac arrest ( seizure , aspiration pneumonia , and laryngospasm ) ; however , all three patients were gmfcs level v. these patients represent 5.5 % ( 3/55 ) of all study subjects at gmfcs level v. a previous study showed that ambulatory function in patients with cp was highly correlated with the risk of complications , including life - threatening events , after orthopedic surgery ( 28 ) . two patients in the study were asa class 3 , and one patient , who arrested immediately after laryngeal suction , was asa class 2 and had suffered from a recent upper respiratory infection . patients with cp often have an impaired ability to clear pharyngeal secretions , resulting in the pooling of secretions in the oropharynx ( 12 ) . furthermore , cp patients , including those at gmfcs level i and ii , have a reduced aerobic capacity compared to patients without cp ( 29 ) . a previous study reported that spasticity in cp patients can cause local obstruction of venous return in leg muscle , leading to a reduced cardiac output and oxygen delivery ( 30 ) . this phenomenon may , in part , explain the reduced peak oxygen uptake seen in patients with cp ( 29 ) . studies show that , even prior to surgery , most cp patients and their parents focus on improving physical function rather than general overall medical condition including respiratory problems ( 31 ) . this tendency leaves patients far more vulnerable to perioperative respiratory complications , especially in patients at a lower functional level . respiratory complications are one of the life - threatening conditions for cp patients undergoing orthopedic intervention , therefore the importance of preservation and early recovery of perioperative respiratory function should be emphasized . asa class is a readily available patient assessment tool used prior to the administration of anesthesia . although no grading system can predict specific clinical complications , asa class reflects a patient 's general medical condition and can provide useful information to estimate the risk of postoperative morbidity ( 32 , 33 ) . physicians should pay careful attention to asa class , because it can help to avoid adverse postoperative outcomes , especially in patients at a lower functional level such as gmfcs level iv and v. an intra - and postoperative multidisciplinary approach encompassing the respiratory , cardiovascular , gastrointestinal , neurological , and urological systems would help improve evaluation of the overall risks other than surgical treatment prognosis and aid in optimizing medical treatment . there is a limitation in our study . because the study design was retrospective , the accuracy of the incidence calculation was dependent upon the completeness of the medical records from which the data were obtainedthis study was performed to determine the incidence of intraoperative and postoperative complications in patients with cp and establish the risk factors for these complications . our results suggest that gmfcs level , patient age , hip reconstructive surgery , history of pneumonia , and operation time are associated with adverse effects on intraoperative body temperature , the cardiovascular system , and immediate postoperative complications . recognition of risk factors for complications and careful pre - and postoperative multidisciplinary approach can help cp patients in their optimal medical condition during the perioperative period .\noutput:\n" }, { "from": "agent", "value": "because complications are more common in patients with cerebral palsy ( cp ) , surgeons and anesthesiologists must be aware of perioperative morbidity and be prepared to recognize and treat perioperative complications . this study aimed to determine the incidence of and risk factors for perioperative complications of orthopedic surgery on the lower extremities in patients with cp . we reviewed the medical records of consecutive cp patients undergoing orthopedic surgery . medical history , anesthesia emergence time , intraoperative body temperature , heart rate , blood pressure , immediate postoperative complications , gross motor function classification system ( gmfcs ) level , cormack - lehane classification , and american society of anesthesiologists physical status classification were analyzed . a total of 868 patients was included . mean age at first surgery was 11.8 ( 7.6 ) yr . the incidences of intraoperative hypothermia , absolute hypotension , and absolute bradycardia were 26.2 % , 4.4 % , and 20.0 % , respectively . twenty ( 2.3 % ) patients had major complications , and 35 ( 4.0 % ) patients had minor complications postoperatively . the incidences of intraoperative hypothermia , absolute hypotension , and major postoperative complications were significantly higher in patients at gmfcs levels iv and v compared with patients at gmfcs levels i to iii ( p < 0.001 ) . history of pneumonia was associated with intraoperative absolute hypotension and major postoperative complications ( p < 0.001 ) . these results revealed that gmfcs level , patient age , hip reconstructive surgery , and history of pneumonia are associated with adverse effects on intraoperative body temperature , the cardiovascular system , and immediate postoperative complications ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: rare earth and alkaline earth metal borides belong to the group of nonoxide type metal - like compounds and have high melting point , high chemical stability , stable specific resistance , low expansion coefficient at certain temperature ranges , diverse magnetic orders , and high neutron absorbability . they have possessed excellent corrosion and wear resistance , chemical inertness , and thermal shock resistance more than that of oxide ceramics . the alkaline earth hexaborides were long thought to be simple polar semiconductors with single particle gap energy of several tenths of an ev and the energy gap is narrow as well as indirect band gap ( eg = 0.0150 ry ) . electrochemical synthesis of mg b system from molten salts is an economic feasible and environmental friendly way for the preparation of different binary phases . b system was reported early to contain five phases , whereas serebryakova reported only four phases . borides can exist as a wide range of compositions and display structural features , which depends strongly on the metal and boron ratio . proposed formation of three phases with higher b content as the result of thermal decomposition of mgb2 : ( 1 ) mgb6 , ( 2 ) unknown , and ( 3 ) mgb12 . however , duhart reexamined these data and claimed that phase 1 corresponds to mgb4 and phase 2 to mgb6 and the formation of mgb12 ( phase 3 ) was not confirmed . mgb6 and mgb4 do not exist as individual phases and obviously are metastable with rather long equilibration times . according to somsonov et al . , mg b system has four stable borides : mgb2 , mgb4 , mgb6 , and mgb12 . b system contains the phases of mgb2 , mgb4 , mgb6 , mgb12 , and mg2b14 . the aim of the present work is to study whether the thermodynamically unstable mgb6 could be prepared as thermally stable compound by electrochemical synthesis method . the mixture of the salts lif ( 12.95 mol % ) , b2o3 ( 22.27 mol % ) , and mgcl2 ( 17.14 mol % ) ( analytical grade from merck , india ) was taken as an electrolyte in high - density graphite crucible and acts as an electrolyte cell as well as anode for the electrolytic process . the molybdenum rod of 1 cm diameter fitted to a stainless steel rod is used as cathode . the crucible was filled with the stoichiometric quantities of electrolyte salts , which were dried at 500c under argon atmosphere . the whole assembly was placed in an inconel reactor , which was kept in an electrical heating furnace with thermocouple . the experimental setup for the electrosynthesis of magnesium hexaboride is described elsewhere . the melt was equilibrated at 900c for one hour before proceeding electrolysis . the bath was preelectrolyzed at 2.0 v for one hour to remove the impurities and moisture prior to electrolysis . experiment was carried out at current density of 1.5 a / cm with the molar ratio of mg : b as 1 : 6 . after 5 hours of electrolysis the cathode was removed and the deposit was cooled in atmosphere . the deposit was then scraped off and the electrolyte adhering to it was leached with warm 5 % hcl solution . finally washing was done with distilled water for several times , the weight of the deposit was determined , and the nature of the powder was analyzed . the phase formation and the structural details of the synthesized compoundwere characterized by x - ray powder diffraction ( xrd ) using cuk ( = 1.541 ) radiation with 2 value range of 20 to 90 using panalytical x ' pert powder diffractometer . differential thermal analysis and thermogravimetric analysis ( tga / dta ) of the reaction mixture was done using rigaku thermal plus tg 8120 with heating speed 20c / min in a flow of air . the fourier transform infrared ( ftir ) spectra were recorded in the range of 400 to 4000 cm using perkin elmer uk paragon500 spectrometer . scanning electron microscopy ( sem ) uv visible spectrophotometer was employed for the absorbance study using jasco model 7800 uv visible spectrophotometer . studying the binding energy of boron and magnesium was done using x - ray photoelectron spectroscopy thermo scientific uk multilab 2000 . figure 1 presents the powder xrd pattern of the mgb6 synthesized by molten salt technique . the lattice constant value a = 4.114 is determined from the xrd data and is well matched with the reported value ( a = 4.115 ) for mgb6 ( jcpds data card number 08 - 0421 ) existing in body centered cubic crystal structure ( the space group pm3 m ) . but indexing the plans for mgb6 is difficult because the information on its lattice parameters and structure system is not available in 08 - 0421 . other than mgb6 some additional traces of mgo are also present at 2 = 43 and 62.5 due to the partial oxidation of mg . the crystalline size is found to be 42 nm calculated by using debye - scherrer equation as follows : ( 1 ) d = kcos , where k is the scherrer constant usually taken as 0.9 , is the wavelength characteristics of the cu - k radiation ( = 1.5406 ) , is the full width at half - maximum ( fwhm ) in radiations , is the reflecting angle , and d is the crystal size . the figure showed that the eutectic point of the melt is found to be 820c . the melt temperature is kept approximately 80c higher than the eutectic point to reduce the melt viscosity . a gradual weight loss observed up to 497c may be due to the removal of moisture and inbound water associated with the salts . the weight gain which is observed up to 761c from 497c , due to b2o3 , begins to turn into liquid ( melting point 450c ) in the heating process . these reactants whether in the liquid or gaseous state play a crucial role in determining the shape of the final product . further , this weight gain is mainly due to the oxidation of the reactants ( 2 ) . the formation of 2mgcl23b2o3 is due to the solid - state reaction between residual b2o3 and mgcl2 , turn into molten state ( melting point of mgcl2 : 708c ) is confirmed by an exothermic peak at 761c . further weight loss observed up to 1000c is responsible for the transformation of the reactants into desired product . in the dta curve , a sharp exothermic spike is observed at 742c which may also be verified by confirming this process . this is gratuitous to the dsc curve ( figure 3 ) at 745c ; a sharp exothermic spine is observed that the heat of decomposition of salts is about 513.3 j / g . the reaction was carried out for mgb6 in mgcl2b2o3lif system ; the main chemical reactions are ( 2 ) 2mgcl2 + 3b2o32mgcl23b2o3 ( 3 ) 2mgcl23b2o3mgb6 + mgo +4 o2 ( g ) +2 cl2 ( g ) the overall reaction is ( 4 ) 2mgcl2 + 3b2o3mgb6 + mgo +4 o2 + 2cl2 ( g ) trace amount of the unreacted intermediate mgo was present in the synthesized compound as 0.6 % and the remaining 99.4 % was mgb6 as depicted from xrd pattern . the xps spectrum for b 1s is shown in figure 4 ( a ) . the electron transfer would come from trigonal b 1s to b o orbital and from the unfilled tetrahedral b 2p orbital to b o . this b 1s resonance as expected for sp - bonded boron incorporated in the crystal . figure 4 ( b ) shows the mg 1s spectra for mgb6 at 1314 ev revealed that the auger spectral distribution over an extruded energy range far from the threshold ; there is an extra energy for mg rich compound . . this may be due to the core - hole rydberg states containing o 1s resonance . figure 4 ( d ) shows c 1s spectrum at 296 ev and reveals energy transitions between a carbon core level and an antibonding molecular orbital . the surface is contaminated due to exposure to air during the processing of the sample . the mg cations in mgb6 complex species have c6v pyramidal structures interacting with a planar hexagonal b6 dianion . h stretching vibrations of water crystallization are represent at 3743 and 3413 cm , respectively . longitudinal optic mode frequency of mg o is observed at 705 cm ; this mgo as impurity phases is also observed in the xrd pattern . the bending mode of mg b of bo4 anion is assigned to 499 cm . the asymmetric stretching vibration of mg b of bo4 anion is observed at 1021 cm . the asymmetric stretching vibration of b o bond of trigonal bo3 units is observed at 1367 cm . the frequencies observed in the spectrum are in good agreement with the reported values . the microstructure indicates that the particle diameters are in the range 48 m . from the microstructure , the molten regions are clearly visible , which give the clear indication of mgb6 formation . the white regions in sem represent the impurity phase mgo present in the sample . the mechanism of hexaboride formation was proposed by many authors . according to li and jin , the negative charged boron atoms and the positive charged alkaline earth metal atoms form complexes of m metal cation and b6 dianion due to electrostatic attraction . they also suggested that the metal cations m have definite role on stabilizing the b6 dianion . kaptay and kuznetsov reported that the boron components are dissolved in ionic form in the melt , to form boride phase on the cathode joint with metal cations . we reported earlier that the electrolytically dissociated metal and b ions deposit on the cathode as ceb6 and smb6 , respectively . we also reported in our earlier study on cab6 that the calcium and boron are reduced at the cathode to form submicron sized crystals . , the formation of mgb6 at 900c as one of the secondary phases along with mgb4 due the volatile nature of mg at this temperature resulted in mg deficiency on in situ cu doping of mgb2 . the commonly accepted mechanism of boron deposition in molten salts is a single - step three - electron electrochemical reaction . they proposed that the larger energy gain per one electron - hole pair decreases the semiconducting gap and produced intermediate phasedescribed the diffusion of mg vapour into boron creating a complex of mg b supersaturated solution , encompassing the formation of nonequilibrium mgb6 . j. q. li also authenticated with s. li and postulated that the path of the reaction of supersaturated mgb cluster complex via spinodal decomposition leads to the formation of hypothetical phase mgb6 . in summary , the electrochemical synthesis of hypothetical magnesium hexaboride by molten salt technology is presented . it is believed that the supersaturated mgb6 cluster complex is postulated for the metastable magnesium hexaboride compound .\noutput:\n" }, { "from": "agent", "value": "the present work reports electrochemical synthesis of mgb6 from molten salts using the precursor consists of lif b2o3mgcl2 . an attempt has been made to synthesize metastable phase mgb6 crystal by electrolysis method . dta / tga studies were made to determine the eutectic point of the melt and it was found to be around 900c . the electrolysis was performed at 900c under argon atmosphere , at current density of 1.5 a / cm2 . the electrodeposited crystals were examined using xrd , sem , and xps . from the above studies , the electrochemical synthesis method for hypothetical mgb6 from chloro - oxy - fluoride molten salt system is provided . mechanism for the formation of magnesium hexaboride is discussed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 49 - year - old male presented with severe nephrotic syndrome ( proteinuria 16.8 g / day , serum albumin 1 g / dl , 3 + lower extremity oedema , severe dyslipidaemia resistant to statins ) , gastrointestinal bleeding and weight loss . renal function tests were within normal limits , with blood urea of 13 mg / dl and serum creatinine of 0.9 mg / dl . serum glucose ( 71 mg / dl ) , potassium ( 4.7 mmol / l ) and sodium ( 140 mmol / l ) were within normal limits . tests for hepatitis b surface antigen and antibodies against hepatitis c virus and human immunodeficiency virus were negative . serum complement ( c ) levels were within normal range ( c3 : 159 mg / dl , c4 : 29 mg / dl ) and the serum protein electrophoresis showed no m - spike . renal sonogram revealed normal size kidneys and an unusual mass in the left flank region . abdominal magnetic resonance imaging showed a large ( 12.6 cm 11.2 cm 10.1 cm ) heterogeneous mass of the proximal jejunum . the tumour biopsy confirmed spindle cell neoplasm , composed of uniform cells arranged in poorly formed fascicles and exhibiting scattered mitotic figures . immunoperoxidase stains for cd34 and cd117 ( c - kit ) were positive in the tumour cells , while stains for smooth muscle actin , desmin and pancreatin were negative . given the histological immunostaining properties and size of the mass , the diagnosis of gastrointestinal stromal tumour ( gist ) of high malignant potential was made . periodic acid - schiff and jones methenamine silver - stained sections demonstrated uniform thickening of the glomerular capillary walls with crater and fine spike - like projections . immunofluorescence studies showed fine granular deposition of igg ( 3 + ) , c3 ( 2 + ) and c4 ( 1 + ) along the peripheral capillary loops . trace deposition of iga , igm and c1q was also noted in the same distribution . ultrastructural analysis revealed numerous fine granular subepithelial electron - dense deposits , separated from each other by basement membranesmall subendothelial electron - dense deposits were also seen in several places . the mesangium revealed normal cellular elements and a mildly expanded extracellular matrix with scattered , in some places large , electron - dense deposits ( figure 1 ) . because of the presence of subendothelial and mesangial deposits , a secondary form of mn was suggested . numerous subepithelial , and scattered subendothelial and mesangial electron - dense deposits ( magnification 2200 ) . following the biopsy results , the patient was placed on oral imatinib mesylate ( 400 mg / day ) for 8 months , and the surgical excision of the tumour was performed when the tumour became resectable . the patient had never received any specific immunosuppressive therapy for mn , but his proteinuria slowly decreased to 3.0 g / day at the time of surgery , and completely resolved at 8 months after surgery ( figure 2 ) . at that timethe patient had no oedema , his serum albumin was 4.6 g / dl , serum creatinine was 1.0 mg / dl and the dyslipidaemia had resolved as well . mn frequently occurs in its primary ( idiopathic ) form , as a renal - limited autoimmune disease . presumably , the process develops due to auto - antibodies directed against unique glomerular epithelial cell antigens , analogous to heymann nephritis in the experimental animal . in a recent report , the podocyte membrane glycoprotein m - type phospholipase a2 receptor was identified as the major target of autoimmune process in idiopathic mn . subepithelial deposits form in situ , as antibodies bind to a membrane - based antigen and complement . a significant proportion of mn cases are , however , secondary to systemic autoimmune diseases ( systemic lupus erythematosus , in particular ) , infections ( such as hepatitis b and c , and syphilis ) and drugs ( d - penicillamin , hydralazine , captopril and non - steroidal anti - inflammatory drugs ) . the mechanism by which the subepithelial deposits form in secondary mn is less clear and possibly includes the deposition of circulating immune complexes in the subepithelial space , as described with hepatitis b . the association of mn with cancer has been frequently reported in the literature . in the review of 240 patients with mn ,10 % were found to have malignancy at the time of diagnosis ; the study also showed that age , smoking and the presence of glomerular leukocytic infiltrates strongly increase the likelihood of malignancy in mn patients . the mechanism by which the cancer would cause the subepithelial immune complex deposition and mn is unclear . tumour antigens have not been demonstrated within the subepithelial deposits yet , supporting the idea of an in situ deposition process , as seen in the primary form of mn . the presence of subendothelial and mesangial deposits in some of these cases , however , argues against the concept of membrane - based antigen and circulating auto - antibodies , and suggests the deposition of pre - formed , circulating immune complexes . gastric and bronchial cancers are the most frequent cancers associated with mn , but renal cell carcinoma , thymoma , prostate and breast carcinoma have been also described . gastrointestinal stromal tumours are mesenchymal tumours of the gastrointestinal tract , with specific immunohistochemical c - kit reactivity and good therapeutic response to tyrosine kinase inhibitors . paraneoplastic syndromes are rarely reported in the setting of gist ; only isolated case reports of severe paraneoplastic hypoglycaemia and hypercalcaemia exist . the association between gist and mn in this 49 - year - old patient is unclear ; however , the patient 's proteinuria significantly declined with specific tumour chemotherapy , and the nephrotic syndrome and proteinuria completely resolved with the surgical removal of the tumour ( figure 2 ) . the patient had no specific treatment for his nephrotic syndrome and no other possible cause of mn was found in his case . complete clinical work - up in the setting of membranous glomerulopathy is warranted regardless of the patient 's age . this case is a unique example of gist - associated mn and represents the first report of nephrotic syndrome associated with gist .\noutput:\n" }, { "from": "agent", "value": "membranous nephropathy ( mn ) is a common cause of nephrotic syndrome in older adults . the association of mn with neoplasia has been controversial , but several recent studies have shown increase incidence of cancer in patients with mn [ 1 ] . we report a case of a 49 - year - old male with severe nephrotic syndrome and concomitant jejunal gastrointestinal stromal tumour ( gist ) . the combination of preoperative imatinib mesylate chemotherapy and tumour excision was followed by complete resolution of proteinuria within 19 months , without specific treatment for mn . an association between mn and gist has never previously been reported in the literature ." } ]