Datasets:

chemNLP

/

ncbi-text

like 0

Mycotoxins are fungal metabolites known to be harmful to human and animal health. To date, there are many reports of disorders caused by mycotoxins in the digestive, urinary, immune and reproduction systems, and the importance of oxidative stress through lipid peroxidation has been stressed as a trigger of mycotoxin-induced toxicity in these systems. Recently, Doi and Uetsuka reviewed the molecular mechanisms of neurotoxicity induced in rodent models by four kinds of mycotoxins, T-2 toxin, macrocyclic trichothecenes, fumonisin B1 (FB1) and ochratoxin A (OTA), from the viewpoint of oxidative stress-associated pathways. The FAO and WHO have highlighted the need for toxicological evaluation of mycotoxins through dermal exposure. This is important because the skin is the major interface between the body and surrounding environment, and there is a chance that the skin of grain handling workers as well as of domestic animals is exposed to mycotoxins. Concerning this point, it has been shown that such mycotoxins as aflatoxin B1 (AFB1) and T-2 toxin readily penetrate through human and animal skin and cause systemic toxic effects in their respective organs and also in the brain. Recently, Boonen examined the transdermal kinetics of seven kinds of mycotoxins, AFB1, OTA, FB1, citrinin (CTN), zearalenone (ZEN) and T-2 toxin, using human skin in an Franz diffusion cell setup, and they reported that except for FB1, all mycotoxins penetrate through the skin and that OTA shows the highest penetration. However, there have been few reports of toxic effects of mycotoxins on human skin. Except for skin lesions induced by T-2 toxin, only limited information on mycotoxin-induced dermal toxicity has been available even in animal models. However, during the last decade, several researchers have added more information on dermal toxicity and/or tumorigenesis induced in mice by topical application of AFB1, patulin (PAT), CTN and OTA. This paper reviews the molecular mechanisms of dermal toxicity and tumorigenesis experimentally induced in mice or rats by T-2 toxin, CTN, PAT, AFB1 and OTA especially from the viewpoint of oxidative stress-related pathways. T-2 toxin is a cytotoxic secondary fungal metabolite that belongs to the trichothecene mycotoxin family. It is produced by various species of ( and ), which can infect corn, wheat, barley and rice crops in the field or during storage. T-2 toxin is a well-known inhibitor of protein synthesis through its high binding affinity to peptidyl transferase. Subsequent inhibition of the peptidyl transferase reaction can trigger a ribotoxic stress response that activates c-Jun N-terminal kinase (JNK)/p38 mitogen-activated protein kinases (MAPKs). In addition, T-2 toxin inhibits the synthesis of DNA and RNA probably secondary to inhibition of protein synthesis, interferes with the metabolism of membrane phospholipids and increases liver lipid peroxides (LPOs). Moreover, oxidative stress is thought to be the main factor underlying the T-2 toxin-induced toxicity. As mentioned above, it has been reported that topical exposure to T-2 toxin could induce histopathological changes in the skin of several animal species, and Yarom suggested that T-2 toxin-induced epidermal degeneration might be secondary to ischemia brought about by microvessel degeneration in the dermis. In 1999, Albarenque started a series of studies to clarify the mechanisms of T-2 toxin-induced dermal toxicity using Wistar-derived hypotrichotic WBN/- rats focusing on the expression of apoptosis-related oncogenes and cytokines. In their first study, they clarified that after topical application of T-2 toxin, depression of proliferating activity starts at 3 h and that apoptosis of basal cells starts soon after and becomes prominent at 12 h in the epidermis, while capillary and small vessel endothelial degeneration develops at 6 h in the dermis; this suggests the direct toxic effect of T-2 toxin on the epidermis. This is the first report of mycotoxin-induced apoptosis in the skin. Thereafter, using the same experimental system, Albarenque . showed that the expression of oncogenes (c-jun and c-fos) as well as cytokines (TNF-α and IL-1β) mRNAs is significantly elevated prior to the peak time of apoptosis in keratinocytes after topical exposure to T-2 toxin. They also reported that the level of TGF-β1 mRNA of the whole skin tissue shows a slight elevation from 6 to 12 h and reaches a significantly higher level at 24 h and that the increase in signals of TGF-β1 mRNA detected by the hybridization method starts at 3 h in the epidermis and progresses thereafter both in the epidermis and dermis. Later, using rat keratinocyte primary cultures, they also showed that c-fos and c-jun and TNF-α and IL-1β play an important role in the development of T-2 toxin-induced apoptosis in keratinocytes. C-fos is a type of immediate-early response gene, and its activation with other factors such as c-jun occurs as an early response to cell injury, resulting in an increase in the sensitivity of keratinocytes to apoptosis, and the expression of c-fos is said to precede the initiation of apoptosis or to be concomitant with apoptosis in many systems. Keratinocytes can release pro-inflammatory cytokines such as TNF-α and IL-1β when they have been injured. There are many reports suggesting the possible role of TNF-α as an apoptosis-inducer in different kinds of cells including keratinocytes. TNF-α can interact with its receptors, and signals from the receptors are related to the induction of some genes and proteins such as c-myc, c-fos and caspase, resulting in the induction of apoptosis. TGF-β1 is a multifunctional cytokine and is known as a negative growth regulator of normal epithelial cells, and human keratinocytes can undergo apoptosis after initial growth arrest under the effect of TGF-β1. TGF-β1 may have a relation to the early depression of epidermal basal cell proliferating activity in rat skin following topical application of T-2 toxin. As mentioned above, trichothecenes mycotoxins trigger a ribotoxic stress response that activates JNK/p38, and JNK/p38 stimulates immediate-early genes, c-fos and c-jun, both of which encode components of transcription factor activator protein-1 (AP-1). In this regard, the c-fos gene plays an important role in the early phase of T-2 toxin-induced apoptosis in the lymphoid and hematopoietic tissues in mice and rats, and T-2 toxin increases expression of both oxidative stress-related genes and apoptosis-related genes (c-fos and c-jun), resulting in the induction of hepatocyte apoptosis in mice. Moreover, T-2 toxin is also reported to cause oxidative stress and subsequent activation of MAPK pathways in pregnant and fetal rat tissues, resulting in the induction of apoptosis in these tissues. To date, there have been no reports of T-2 toxin-induced skin tumorigenesis. In this regard, Lambert . reported that deoxynivalenol, one of the trichothecene mycotoxins, induces a mild diffuse squamous hyperplasia in the epidermis but shows no potential for initiation or promotion when topically applied as part of a two-stage skin tumorigenesis treatment regimen in Sencar mice. CTN is a secondary metabolite of several fungal species belonging to the genera and . It contaminates various commodities of plant origin, cereals in particular, and is usually found together with another nephrotoxic mycotoxin, OTA. CTN triggers nephropathy and hepatotoxicity as well as renal adenoma formation in various cellular and animal models. To date, the mechanisms of CTN-induced toxicity have not fully been understood, although several studies have shown the involvement of reactive oxygen species (ROS) in CTN-mediated toxicity characterized by apoptosis in certain models. Kumar were the first to investigate molecular mechanisms of CTN-induced dermal toxicity from the viewpoints of oxidative stress, DNA damage, cell cycle arrest, and apoptosis in mouse skin. They showed that CTN under condition has the ability to cause oxidative stress, which is indicated by significant depletion of glutathione (GSH) as well as inhibition of glutathione peroxidase (GPx) and catalase activities, along with an increase in LPOs and protein carbonyl content, and subsequent ROS-mediated DNA damage as evaluated by the comet assay in mouse skin upon topical exposure to CTN (25–100 μg/mouse for 12–72 h), as reported in the above-mentioned studies. ROS-mediated DNA damage in mouse skin leads to enhanced expression of p53 and p21 that causes cell cycle arrest at the G0/G1 and G2/M phases as reported by Abbas and Dutta in models, to enhanced Bax/Bcl2 ratio and cytochrome c release, and to activated caspase 9 and 3 but not caspase 8, which result in apoptosis through the mitochondria-mediated pathway. The p53 protein plays a key role in the DNA damage response pathway by transmitting a variety of stress signals associated with antiproliferative cellular responses that lead to apoptosis, and the lack of enhancement in caspase 8 activity indicates that the extrinsic or death receptor pathway of apoptosis is not activated by CTN in mouse skin. Moreover, Kumar clarified that topical treatment of bio-antioxidants such as butylated hydroxyanisole, quercetin and α-tocopherol abolishes CTN-induced oxidative stress, cell cycle arrest and apoptosis, confirming the direct involvement of ROS in CTN-induced toxicological manifestations in mouse skin. To summarize, CTN under conditions has the ability to cause oxidative stress and ROS-mediated DNA damage in mouse skin upon topical exposure, leading to enhanced expression of p53, p21 and BAX proteins that causes cell cycle arrest at the G0/G1 and G2/M phases and apoptosis in mouse keratinocytes through the mitochondria-mediated pathway. To date, there have been no reports of CTN-induced skin tumorigenesis. However, as mentioned above, CTN treatment causes prominent DNA damage, suggesting its genotoxic and mutagenic potential in the skin. Moreover, although the cell cycle arrest by CTN may permit DNA repair, if it is faulty, it may allow proliferation of mutated cells, which is generally observed in cases of tumorigenesis. PAT is a toxic chemical concomitantly produced by several species of mold, especially within and It is the most common mycotoxin found in apples and apple-derived products such as juice, cider, compotes and other food intended for young children. Exposure to this mycotoxin is associated with immunological, neurological and gastrointestinal outcome, and PAT has been classified as a group-3 carcinogen. To date, studies on the mechanisms of PAT-induced toxicity have been done using various cell lines, focusing on the immunotoxic and genotoxic effects of the toxin, and it has been reported that PAT has the potential for inducing formation of ROS, DNA damage, rapid activation of extracellular signal-regulated kinase (ERK)1/2 or of p38 and JNK and effects on cell cycle distribution responsible for overexpression of a functional p53 protein. Saxena were the first to study the mechanisms of PAT-induced dermal toxicity in mice, and they reported that dermal exposure of PAT in mice for 4 h results in a dose-dependent (40–160 μg/animal) and time-dependent (up to 6 h) enhancement of ornithine decarboxylase (ODC) activity and increase in biosynthesis of polyamines. Polyamines, cell proliferation, and apoptosis are tightly connected in a quite complex interplay, and polyamine levels within cells are regulated and modulated by the key enzymes that control polyamine biosynthesis, particularly ODC. Elevated ODC activity and increased biosynthesis of polyamines serve as a novel stimulus to induce the ataxia-telangiectasia mutated (ATM)-DNA damage signaling pathway and cell death in normal keratinocytes. Wei revealed the correlation of elevated ODC activity with apoptotic cell death in normal keratinocytes via the induced generation of reactive aldehydes and HO followed by subsequent activation of the ATM-DNA damage response pathway. Saxena also reported that topical application of PAT (160 μg/mouse) for 24–72 h causes DNA damage depicted by alkaline comet assay and significant G1- and S-phase arrest along with induction of apoptosis in skin cells. Moreover, they showed that PAT leads to overexpression of p21, Bax and p53 proteins and that PAT-induced apoptosis is mediated through the mitochondrial intrinsic pathway as revealed through the release of cytochrome c protein in cytosol, leading to enhancement of caspase 3 activity in mouse skin cells. Thus, the PAT (160 μg/mouse)-induced cascade of events in mouse skin is considered to occur as follows. Induction of ODC activity generates polyamines and HO, which cause DNA damage, resulting in enhancement of p53 expression and subsequent cell cycle arrest at the G0/G1 and S phases through enhanced p21 expression along with induction of apoptosis through enhanced BAX expression and caspase 3 activity. After that, Saxena also reported that a single topical application of PAT (400 nmol/mouse) resulted in enhanced cell proliferation as evaluated by H-thymidine uptake along with increased generation of ROS and activation of ERK, p38 and JNK MAPKs, in mouse skin. PAT exposure also results in activation of downstream target proteins, c-fos, c-jun and NF-κB transcription factors. They thought that the observed early activation of JNK and NF-κB appears to be a direct response to PAT, while later activation of ERK, p38, c-jun, c-fos and NF-κB may be due to enhanced generation of ROS as reported by Benhar . This suggests that PAT-induced ROS acts as second messengers in intracellular signaling cascades and may mediate cell proliferation by activating ERK and p38 along with activation of downstream targets, c-jun, c-fos and NF-κB. Moreover, Saxena reported that specific inhibitors of MAPK, especially p38 and JNK, pathways are able to significantly suppress H-thymidine uptake by keratinocytes in mouse skin following a single topical application of PAT (400 nmol/mouse), suggesting that p38 and JNK pathways may be involved in PAT-induced cell proliferation. In addition, as mentioned above, PAT enhances the activity of ODC in mouse skin following a single application. It is well known that ODC plays an important role in the regulation of cell proliferation, and it is stressed that ODC-related hyperproliferation and altered differentiation in skin keratinocytes have been linked with deregulation of MAPK signaling pathways. Regarding PAT-related skin tumorigenesis, Saxena have shown that a single topical application of PAT (400 nmol/mouse) followed by twice weekly application of 12-tetradecanoyl phorbol myristate acetate (TPA) results in tumor formation (squamouse cell carcinoma) after 14 weeks. In this PAT/TPA group, a significant increase in LPO activity and significant decreases in free sulfhydryls, catalase, superoxide dismutase (SOD) and glutathione reductase (GR) activities are observed. The DNA damaging ability of PAT in skin cells is in agreement with other findings in which PAT was shown to cause oxidative DNA damage in a few mammalian cells. On the other hand, Saxena described that no tumors were observed when PAT was used either as a complete carcinogen (80 nmol) or as a tumor promoter (20 nmol) (single dose of 7,12-dimethylbenz[a]anthracene (DMBA) followed by twice weekly application of PAT) for 25 weeks. However, it may be possible that prolonged exposure to PAT at a high dose may induce tumor promotion and cause further toxicological manifestations in the skin, since earlier reports have revealed that long-term exposure to PAT is tumorigenic in Wistar rats, leading to sarcoma at the injection site on subcutaneous administration, and causes benign tumors of the forestomach and glandular stomach in Sprague-Dawley rats after gavage treatment. Aflatoxins are secondary metabolites of the molds and . AFB1 is by far the most potent teratogen, mutagen and hepatocarcinogen of all aflatoxins. The carcinogenic potential of AFB1 following oral administration has been shown in several animal species, while limited knowledge is available regarding the epidermal carcinogenesis of AFB1, and therefore, the WHO has clearly highlighted the need for toxicological evaluation of aflatoxins through dermal exposure. and studies have shown that glutathione-S-transferase (GST) plays a crucial role in modulation of AFB1-DNA adduct formation, and AFB1 is said to mediate oxidative damage through generation of ROS including the hydroxyl ion. In addition, studies have also shown that AFB1 can stimulate the release of free radicals, which leads to chromosomal damage. Rastogi were the first to study the skin tumorigenic potential of AFB1 using a two-stage mouse skin tumor protocol. In their study, skin topical application of AFB1 (80 nmol) as a tumor initiator, followed by twice weekly application of TPA (4 nmol) for up to 24 weeks, resulted in tumor formation (squamous cell carcinoma) after 13 weeks, but no skin tumorigenic potential was observed when AFB1 was used either as a complete carcinogen (16 nmol) or as a tumor promoter (4 nmol). They also showed that weekly topical application of AFB1 causes significant induction of cutaneous CYP1A monooxygenases without any effect on hepatic levels, while GST activity, which detoxifies a number of LPO products, is induced more in the liver than skin; they further showed that topical application of AFB1 also results in increased hepatic and cutaneous LPO with concomitant depletion of GSH content, indicating the induction of oxidative damage. Later, Rastogi . reported the protective effect of an alcoholic extract of the leaves of on AFB1- and AFB1/TPA-induced skin tumorigenicity using the same experimental system used in their previous study. is a well-known medical plant widely distributed throughout India, and the aqueous and alcoholic extracts from the leaves of this plant have been shown to possess antioxidant, anticarcinogenic, hepatoprotective, and radioprotective properties. The skin of AFB1/TPA-treated animals demonstrated papillomatous growth comprising of proliferation of squamous cells, hyperkeratinization and keratin pearl formation while the skin of animals topically pretreated with leaf extract showed small papillomatous growth lacking pearl formation. In addition, pretreatment with leaf extract significantly decreased the number of skin tumors induced by AFB1/TPA. The expression of cutaneous γ-glutamyl transferase (GGT) and glutathione-S-transferase-P (GST-P) protein increased after AFB1 or AFB1/TPA treatment, but pretreatment with leaf extract led to a reduction in the expression of these proteins. GGT is considered to be a late marker of tumor progression, and its overexpression in hepatic and skin tumors has been well documented; GST-P expression is also said to increase in chemically induced hepatic tumors. Pretreatment with leaf extract led to the reduction of cutaneous phase I enzymes that had been elevated by AFB1 or AFB1/TPA treatment and to the elevation of cutaneous phase II enzymes, suggesting the possibility of impairment in reactive metabolites formation resulting in a reduction of skin carcinogenicity. Moreover, pretreatment with leaf extract increased the cutaneous GSH level and reduced cutaneous LPO levels that had been elevated by AFB1 or AFB1/TPA treatment. Enhanced levels of GSH resulting from treatment with leaf extract may reduce the rate of LPO as well as decrease the expression of heat shock protein (HSP) 70 protein, which has been reported to be altered during carcinogenesis. Since HSP70 is also involved in oxidative stress, it is quite likely that this protein may have a role in cancer, which is also associated with oxidative stress and inflammation. Thus, Rastogi concluded that leaf extract of provides protection against AFB1/TPA-induced skin carcinogenesis by acting as an antioxidant, by modulating phase I and II enzymes and/or by exhibiting antiproliferative activity. OTA is a fungal metabolite produced by and . OTA is found in a variety of plant food products such as cereals. Because of its long half-life, it accumulates in the food chain and is frequently detected in the human plasma at nanomolar concentrations. The main target organ for OTA toxicity is the kidney, and OTA also has immunotoxic, teratogenic, genotoxic and neurotoxic effects. In addition, there is sufficient evidence in experimental animals for the carcinogenicity of OTA, although there is still insufficient evidence in humans. Kumar were the first to investigate the OTA-induced toxicity and tumorigenesis in mouse skin. In their study, after a single topical application of OTA (20–80 μg/mouse for 12–72 h), significant DNA damage as assessed by alkaline comet assay along with an elevated γ-H2AX level, a sensitive marker of DNA damage, was detected in mouse skin. In addition, the level of nuclear factor erythroid 2-related factor (Nrf2), the master regulator for maintaining the balance of ROS, in the nucleus decreased after 24 h of OTA exposure, indicating an inhibitory effect of OTA on Nrf2 signaling. OTA-induced Nrf2 suppression may cause significant depletion of GSH content as well as inhibition of the activities of catalase, GST and GR along with enhanced production of LPOs and protein carbonyls dose- and time-dependently, and this indicates increased generation of ROS and subsequently enhanced oxidative stress in mouse skin. Kumar . also reported that OTA activates ERK1/2 in the early phase and then p38 and JNK in the later phase in mouse skin after topical exposure, and they suggested that the early activation of ERK1/2 is the result of a direct response to OTA but that later activation of p38 and JNK may be the result of OTA-induced ROS, which acts as secondary messengers in the intracellular signaling cascade in mouse skin. Moreover, they reported that exposure to OTA results in a significant increase in the proportion of cells in the G0/G1 phase with a concomitant decrease in S phase cells, followed by an increase in apoptosis through elevated expression of p53 and p21, enhancement of the Bax/Bcl-2 ratio and cytochrome c level, and increased activities of caspase 9 and 3 in mouse skin. On the other hand, Kumar . reported that a single topical application of OTA (100 nmol/mouse) causes significant enhancement of short-term markers of skin tumor promotion such as ODC activity, DNA synthesis and hyperplasia as well as expression of cyclin-G1 and cyclooxygenase-2 (COX-2) in mouse skin. The enhancement in ODC activity has been reported to occur in response to growth factors as well as promoters such as TPA, and the overexpression of cyclin-D1 and COX-2 proteins is said to play a role in cell proliferation and tumor promotion of various tissues including skin. In a two-stage mouse skin tumorigenesis protocol, Kumar reported that a a single topical application of OTA (80 μg/mouse) followed by twice weekly application of TPA for 24 weeks leads to tumor formation (squamous carcinoma with proliferation of epidermal layers). They suggested that some cells damaged by a single topical application of OTA may pass though a p53-mediated cell cycle checkpoint by faulty repair, which may introduce mutations in OTA-induced animals, and subsequent application of TPA, a tumor promoter, fixes the mutations and confers a selective advantage in those cells, which leads to tumorigenesis. They concluded that OTA has skin tumor-initiating properties under conditions, which may be related to oxidative stress, MAPK signaling and DNA damage in mouse skin. Kumar also reported that a single topical application of DMBA (120 nmol/mouse) followed by twice weekly application of OTA (50 nmol/mouse) for 24 weeks leads to tumor formation in mouse skin (squamous carcinoma with proliferation of epidermal layers), indicating the skin tumor promoting activity of OTA. Moreover, based on the results of study using primary murine keratinocytes exposed to a noncytotoxic dose of OTA (5.0 μM), they proposed that OTA-induced cell proliferation seems to be responsible for skin tumor promotion by activating epidermal growth factor receptor (EGFR), MAPKs and Akt signaling involving NF-κB, AP-1 transcription factors, cyclin-D1 and COX-2 genes. EGFR signaling leads to enhancement of phosphorylation of MAPKs as well as the activity of AP-1 and transcription factors and utilizes MAPK pathways to mediate its growth and stimulative effects, and MAPKs are said to play a crucial role in skin tumorigenesis. EGFR also acts through the Akt pathway, which plays a role in tumor promotion and progression. The transcription factor AP-1 mediates gene regulation in response to a variety of extracellular stimuli including growth factors, cytokines, oncogenes, tumor promoters and chemical carcinogens, and upon activation, both transcription factors NF-κB and AP-1 translocate to the nucleus, where they bind to promoter regions of various target genes including cyclin-D1 and COX-2. This paper reviewed the mechanisms of dermal toxicity and/or tumorigenesis induced in rodents by T-2 toxin, CTN, PAT, AFB1 and OTA. The T-2 toxin-induced cascade of events in rat skin is considered as follows. T-2 toxin brings about oxidative stress, which induces a ribotoxic stress response and subsequent activation of MAPK pathways. Then, this stimulates expression of c-fos and c-jun, resulting in keratinocyte apoptosis. In addition, TNF-α and IL-1β, which are released from keratinocytes primarily affected by ribotoxic stress, are also involved in T-2 toxin-induced keratinocyte apoptosis. CTN has the ability to cause oxidative stress and ROS-mediated DNA damage in mouse skin upon topical exposure, leading to enhanced expression of p53, p21 and Bax proteins that causes cell cycle arrest at the G0/G1 as well as G2/M phases and apoptosis in mouse keratinocytes through the mitochondria-mediated pathway. PAT (160 μg) has a potential to induce DNA damage leading to p53-mediated cell cycle arrest along with apoptosis through the mitochondria-mediated pathway in mouse skin that may also be correlated with enhanced polyamine production as shown by induction of ODC activity. On the other hand, topical application of PAT (400 nmol) to mice results in cell proliferation, which is mediated by ROS-induced MAPKs signaling pathway leading to transcriptional activation of downstream target proteins c-fos, c-jun and transcription factor NFκB, and this is related to the skin tumor-initiating ability of PAT. AFB1 acts as a skin tumor initiator through reactive metabolite formation, LPO-mediated oxidative stress, and GST-mediated AFB1-DNA adduct formation. AFB1 may also have skin tumorigenic potential as a promoter and/or a complete carcinogen in mouse skin after long-term and higher-dose application. OTA has skin tumor-initiating properties that may be related to oxidative stress, MAPKs signaling and DNA damage in mouse skin. OTA also has skin tumor-promoting properties that involve EGFR-mediated MAPKs and Akt pathways along with NF-κB and AP-1 transcription factors. Cyclin D1 and COX-2 are the target genes responsible for the tumor-promoting activity of OTA.

sub sup #text sup #text Pigs have an epitheliochorial and diffuse type of placenta (). Histologically, the surface of the allantochorion becomes complexly folded, producing ridges that fit into corresponding grooves or crypts in the endometrium (). In the interhemal area, the maternal vessels and fetal vessels are situated just below the basement membranes of the endometrium and trophectoderm without the destruction of endometrial tissue (). However, the endometrium and trophectoderm are thin and deeply indented by the blood vessels as pregnancy proceeds, resulting in shorter diffusion distances across the epitheliochorial placenta. The interhemal distance can be as little as 2 μm. The depths between the chorionic folds, the so-called areolus, are lined by tall, columnar trophoblasts (areolar trophectoderm) that are actively phagocytic (). Uteroferrin, an iron-containing glycoprotein, is released from the endometrial glands to the lumen, taken up by the areolar trophectoderm, and then transferred to the fetus, as an iron source. Many endometrial glands are observed under the endometrium (). Dogs have an endotheliochorial and zonary type of placenta (). Histologically, the placenta of dogs is composed of the labyrinth zone, the junctional zone and the glandular zone (). The labyrinth zone is composed of trophoblastic lamellae, in which cytotrophoblasts and syncytiotrophoblasts cover the maternal vessels (). The maternal vessels are surrounded by a noncellular layer, which is positive for periodic acid-Schiff (PAS) stain and Alcian blue stain. The fetal vessels deeply indent the trophoblasts. The junctional zone is an area of transition between the labyrinth zone and gland zone (). The trophoblasts, which show tall columnar cells in monolayers with microvilli on the free surface, invade into the endometrial gland cavity. Particularly, the deep part of the junctional zone is called the sponge zone (). The glandular zone is composed of the remnants of endometrial glands. These glands become distended by retained secreted function as the result of obstruction of their mouths by penetrating trophoblasts (). Marginal hemophagous zones filled with maternal blood develop at both edges of the placenta or in the middle of the placenta (). They are lined by high columnar trophectoderm showing active phagocytosis and digestion of erythrocytes, and are considered to have a relationship with placental iron transport. Rats and mice have a hemotrichorial and discoid type of placenta (). Histologically, the placenta of rats and mice is composed of the labyrinth zone, the basal zone, the decidua and the metrial glands (). In the labyrinth zone, there are three layers of trophoblasts, separating the maternal blood spaces from the fetal blood vessels (). The outer trophectoderm, which comes into direct contact with the maternal blood, is referred to as cytotrophoblasts with a microvillous surface. Under this trophectoderm, there are two layers of syncytiotrophoblasts. The basal zone is comprised of three types of differentiated cells: spongiotrophoblasts, trophoblastic giant cells and glycogen cells (). The spongiotrophoblasts are present immediately above the trophoblastic giant cell layer located at the materno-fetal placental interface. The glycogen cells form multiple small cell masses and develop into glycogen cell islands in midgestation, and then most of them disappear before parturition. The decidua is comprised of the mesometrial decidual cells ultimately, and plays essential roles in the development of the vascularized decidual-placental interface. The metrial gland is located in the mesometrial triangle of the pregnant uterus from early gestation and is fully developed in midgestation, leading to regression before parturition. It is composed of decidualized endometrial stromal cells, uterine natural killer cells, spinal-shaped arteries, trophoblasts originating from glycogen cells, and fibroblasts (). The yolk sac is composed of epithelial cells and mesodermal cells () and is divided into visceral and parietal parts. Because the parietal yolk sac ruptures in midgestation, the inside of the visceral yolk sac becomes exposed to the intrauterine cavity and is called a reversed yolk sac placenta, which functions throughout pregnancy. Rabbits have a hemodichorial and bidiscoid type of placenta (). Histologically, the placenta of rabbits is composed of the labyrinth zone, the junctional zone, the decidua·zone of necrosis, the decidua·zone of separation, and the mesometrium (). In the labyrinth zone, there are two layers of trophoblasts, an outer and inner layer separating the maternal blood spaces from the fetal blood vessels (). The outer trophectoderm, which comes into direct contact with the maternal blood, is comprised of the syncytiotrophoblasts, which are joined to the underlying cytotrophoblast layer by adhesion junctions. The inner trophectoderm is one layer of cytotrophoblasts overlying fetal blood vessels. The junctional zone is composed of glycogen cells containing PAS-positive substances (). These cells are transiently detected in midgestation, and disappear before parturition. The decidua originates from stromal cells of the mesometrial endometrium and is divided into the zone of necrosis and the zone of separation in midgestation. The zone of necrosis develops with dilated blood vessels as pregnancy advances. This zone is detected under the junctional zone and is composed of necrotic tissue. The zone of separation becomes thinner without necrosis as pregnancy advances (). The structure and functions of the yolk sac placenta are the same as those of rats and mice (). Cynomolgus monkeys have a hemomonochorial and bidiscoid type of placenta (). Histologically, the placenta of cynomolgus monkeys is composed of the placental villi, the chorionic plate, the basal plate and the decidua (). The placental villi protrude into the intervillous space and are bathed directly in maternal blood. The anchoring villi are peripheral ones that are connected to the basal zone. The placental villous surface is composed of an outer continuous layer of syncytiotrophoblasts in contact with maternal blood and an inner discontinuous layer of cytotrophoblasts (). The stroma of the placental villi is composed of fetal vessels and mesenchyme. The chorionic plate is populated with mesenchymal cells within a fibrous connective tissue, and represents the cover of the intervillous space. Tree-like arranged placental villi arise from the chorionic plate (). The basal plate is the bottom of the intervillous space and the junction of the endometrium with fetal tissues (). The basal plate is composed of extravillous cytotrophoblasts, endometrial stromal cells, decidual cells, etc. The placenta of cynomolgus monkeys is very similar to the human placenta. The fully formed placenta plays a major role in maintenance of nutrition for the fetus and in the secretory and essential regulatory functions for maintenance of pregnancy during the fetal period. As described in this brief review of the anatomical placentas in some experimental animals, the composition of intervening cells in the interhemal areas is different between animal species. Molecules cross the placenta either by diffusion or some form of active or facilitated transport. In the case of diffusion, the ability for molecules to cross the placenta in either direction is strongly influenced by the interhemal distance or the thickness of the cellular barrier between maternal and fetal blood. A small interhemal distance generally will increase the rate at which molecules can transfer between maternal and fetal blood, either by diffusion or active transport. Thus, the number of cell layers separating the maternal from the fetal blood is considered to be important in modifying the transfer of nutrients and forming the materno-fetal barrier. Actually, fatty acids and keto acids are readily transferred from dams to fetuses in the hemochorial placenta of rodents, rabbits and primates, whereas their uptake by ruminants, pigs and horses is very low. In addition, the pig is not suitable as an informative model for the study of antibody therapeutics in embryo-fetal toxicity studies, since the pig placenta is impermeable to the passage of macromolecules such as immunoglobulins. Also, it is known that there are at least three different mechanisms for iron transport, according to the structure of the maternal-fetal interface (hemochorial, penetration; endotheliochorial, phagocytosis; epitheliochorial, secretion). On the other hand, it is known that there are regions of the pig placenta where the six cell layers of the maternofetal barrier become sufficiently thinned to equal the minimal interhemal distance of the three cell layers in a human placenta, although the mean interhemal distance in the pig placenta is greater than the mean in the human placenta . There does not appear to be any difficulty in allowing for the passage of substances based simply on the number of layers separating the different blood supplies, even though there may be differences in transit times. In addition, the disadvantage of the greater difficulty in passage of materials between organisms is partially overcome by a variety of mechanisms. Therefore, it has been reported that the interspecies differences in the type of placenta do not play a dominant role in the placental transfer of most drugs, which is determined largely by placental blood flow. At any rate, it should be considered that the histological structure separating the maternal blood from the fetal blood modifies the transfer of nutrients, and that the placental structure is one of the important factors for its permeability between different animal species. In conclusion, the chorioallantoic placenta shows morphological diversity in experimental animals. In reproductive and developmental toxicity studies, careful attention should be paid to the histological structure of the interhemal area when extrapolating information concerning placental transfer characteristics to different animal species.

The standard amino acids are of the L-form, but their enantiomers, D-amino acids, are found in some proteins, such as peptidoglycan cell walls of bacteria. It has been reported that D-amino acids accumulated in different tissues, which might represent different physiological conditions. For example, accumulation of D-aspartate and D-hydroxyproline in dentin, tooth enamel and the crystalline lens can be used as aging index. Also, a large amount of D-serine accumulation was found in the frontal brain, cerebellum, cortex, hippocampus and microglia. These findings indicate that the distributions of D-amino acids are diverse and may have different physiological roles. D-serine is highly associated with neurodegenerative diseases such as schizophrenia and amyotrophic lateral sclerosis (ALS). Importantly, it was reported that D-serine could act as a potent activator of N-methyl-D-aspartate (NMDA)-type glutamate receptors, indicating that D-serine is an important neurotransmitter. In mammalians and zebrafish, blockage of NMDA receptors induces some neurological defects, such as seizures and impairment of learning and memory. This means that the biological roles of D-serine might be conserved between zebrafish and mammalians. In this regard, D-serine-induced toxicity is worthy of study. In rats, D-serine exposure resulted in changes in a number of pathways that may be associated with neuronal dysfunction. In addition, administration of D-serine induced oxidative stress and resulted in renal tubular necrosis and hyperaminoaciduria. These observations indicated that an excess of D-serine caused severe adverse effects such as neurotoxicity and nephrotoxicity in adult animals. However, the developmental toxicities of D-serine have not been fully clarified. Thus, development of an alternative model to study D-serine-induced developmental toxicities is essential. Zebrafish are a good model for toxicological experiments because they produce a large number of transparent embryos and have well-characterized developmental stages. To develop a zebrafish model for studying D-serine-induced developmental toxicities, we generated a series of time- and dose-dependent D-serine exposure experiments. By staining with specific monoclonal antibodies, subtle changes in neuronal axon formation and myofibril alignment can be easily observed. This strategy is efficient for studying D-serine-induced developmental toxicities. Mature zebrafish (AB strain) were raised at the zebrafish facility of the Life Sciences Development Center, Tamkang University. Embryos were produced using standard procedures and were staged according to standard criteria (hours post fertilization, hpf) or by days post fertilization (dpf). D-serine (Sigma) was dissolved in sterile distilled water to the desired concentrations (0, 100, 500, 1000 ppm), and was microinjected with a Nanoliter 2000 (World Precision Instruments, Sarasota, FL, USA) into the cytoplasm of one-cell stage embryos (2.3 nl/embryo). After microinjection, embryos were cultivated at 28.5°C, and survival rates were determined at 27 and 48 hpf. The spontaneous in-chorion contraction of zebrafish embryos was analyzed as previously described. Briefly, zebrafish embryos at 24 hpf without or with injection of different concentrations (100, 500 and 1000 ppm) of D-serine were collected and recorded. Spontaneous in-chorion contractions were defined based on the angle of the tail displacement relative to the body axis. Embryos with tail movements from one side to the other at any angles were classified as having in-chorion contraction. F59 monoclonal antibody (Hybridoma Bank; 1:10), Znp1 (Hybridoma Bank; 1:200) and Zn5 (Hybridoma Bank; 1:200) staining and acetylcholine receptor clustering were performed as previously described, except for the fact that 27- and 48-hpf zebrafish embryos were collected. After labeling, all embryos were observed at specific stages under a microscope (DM 2500, Leica) equipped with Nomarski differential interference contrast optics and a fluorescent module having a GFP or DsRed filter cube (Kramer Scientific). Photographs of embryos at specific stages were taken with a CCD (DFC490, Leica). All analyses in this study were carried out using the MATLAB software (version 7.7 R2008b). The two-way ANOVA (analysis of variance) was applied to test the effects of factors (exposure time, dosage level) on the mean of the outcome variable (survival rate or malformation rate). The P-value for each factor, reported by two-way ANOVA, was associated with the null hypothesis that samples at all levels of the factor are drawn from the same population. The Tukey-Kramer HSD (honestly significant difference) test was further used to compare the population marginal means for one factor, adjusted by removing the effect of other factors. The one-way ANOVA and Tukey-Kramer HSD test were employed to compare the average number of in-chorion contractions between dose groups. A significance level of 0.05 was used in all statistic analyses, and a familywise error rate of 0.05 was controlled for in the Tukey-Kramer HSD test. In order to study the exposure time and dosage effects of D-serine on zebrafish larvae, we injected zebrafish embryos with different dosages of D-serine (100, 500 and 1000 ppm) and calculated their survival rates at 27 hpf or 48 hpf. As shown in and , around 55.7–67.9% of the embryos injected with D-serine were alive at 27 hpf, and the survival rates decreased to 15.6–48.6% at 48 hpf. The two-way ANOVA revealed that the P-values for exposure time and dose effects on survival rate were 0.0754 and 0.0417, respectively. The former indicated the survival rates decreased as the time of exposure increased but not to a significant degree. The latter indicated a significant difference in survival rates between dosage groups. The Tukey-Kramer HSD test was thus used to pairwise compare the marginal mean survival rates for dosage level groups, adjusted by exposure time effect. The adjusted mean survival rates for the 0, 100, 500 and 1000 ppm dosage groups were 93.54%, 58.26%, 51.97% and 35.63% with a common standard error of 7.49%, and the difference in survival rate between the 1000 ppm D-serine-injected group and mock-treated group (0 ppm) was significant. Consequently, D-serine injection led to a reduction in the survival rates of zebrafish embryos. We further examined the phenotypic defects caused by D-serine. Compared with mock-treated embryos, D-serine-injected embryos (100–1000 ppm, 27 hpf) displayed some defective phenotypes (bent trunk phenotypes), such as a malformed somite boundary, twisted body axis and shorter body length ( vs. , , ). Similar results were also observed at 48 hpf ( vs. , , ). The D-serine-induced malformation rates were 59.9%–84.3% and 61.6–68.6% at 27 and 48 hpf, respectively ( and). Statistically, the two-way ANOVA indicated that the D-serine effect on the malformation rate was significant (P-value=0.0027). Furthermore, the Tukey-Kramer HSD test revealed that the mean malformed rates, adjusted by exposure time effect, for the 0, 100, 500 and 1000 ppm dosage groups were 0%, 60.90%, 66.00%, and 76.46% with a common standard error of 4.07% and identified that each of the D-serine injected groups (100, 500, and 1000 ppm) differed significantly from the control group (0 ppm) at a familywise error rate of 0.05, but no significant difference existed among the doses. We also noted that D-serine-injected embryos seemed to have less mobility at early larval stages. Thus, spontaneous in-chorion contractions in 27-hpf embryos were examined. The times of in-chorion contraction for each group were recorded for 3 min. As shown in , the average number (± standard error) of in-chorion contractions in the mock-treated control (0 ppm of D-serine) embryos was 21.7 ± 0.69 (3 min per embryo; n = 30). On the other hand, the average numbers of in-chorion contractions in the embryos injected with 100, 500 and 1000 ppm of D-serine were 18.3 ± 0.97, 12.7 ± 0.83 and 0.9 ± 0.23 (n = 30), respectively. The one way ANOVA test revealed a highly significant difference (P-value<0.0001) in the average number of in-chorion contractions between dose groups, and the Tukey-Kramer HSD test identified all pairwise differences as significant at a familywise error rate of 0.05. This demonstrated that D-serine treatment reduced significantly the motilities of zebrafish embryos. To further investigate the molecular mechanisms resulting in the reduced spontaneous in-chorion contraction of D-serine-injected embryos, the monoclonal antibody F59 was used to visualize the alignments of muscle fibers in mock-treated control and D-serine-injected zebrafish embryos. In the mock-treated control embryos (27 hpf), muscle fibers aligned well in the V-shaped somites (). In contrast, muscle fibers aligned disorderly after injection of 100–1000 ppm of D-serine (). Similar results were observed but were more severe at 48 hpf ( vs. ). These observations strongly indicate that injection of D-serine results in dose- and time-dependent defects of disorganized muscle fiber alignment. To address whether the projections of motor axons and the formation of neuromuscular junctions were affected by injection of D-serine, monoclonal antibody Znp1 and α-bungarotoxin labeling were carried out. The antibody Znp1 labeled the axonal bundles of primary motoneurons (pre-synapses) and revealed the common axonal path as well as the projections into ventral and dorsal somitic muscle blocks in mock-treated control embryos at 27 hpf (). In addition, α-bungarotoxin bound to acetylcholine receptors (AchRs; post-synapses) () and revealed clusters of AchRs. The merged signals suggested that axonal projections correlated well with the clusters of AchRs (C–D, yellow signals), indicating that the motor axons innerved to the muscle fiber functionally. Interestingly, we found that only 8.1% (5/61, numbers of defective embryos/total number of D-serine-injected embryos) of D-serine-injected zebrafish embryos displayed defective primary motoneuronal pre-synapses and clusters of AchRs (). These observations suggest that overdose of D-serine seems to have little effects on primary motor neuron projection. Axons of secondary motor neurons enter the common path set out by the primary neurons and complete migration as one nerve. When the development of primary motor neurons is impaired, the outgrowth of secondary motor axons is disrupted as well. We labeled secondary motor neurons with monoclonal Zn5, and the results revealed that secondary motor neurons completed their axonal migration along the common path and reached the trajectory point at 48 hpf (). However, secondary motor neuron axonal growth was impaired by injection of 100 ppm of D-serine (30.7%, 65/212; ). At higher concentrations (500 and 1000 ppm), secondary motor neuron axonal growth was nearly abandoned (C–D). Taken together, we suggest that overdose of D-serine can cause motor neuron defects, especially for secondary motor neuron axonal growth. D-serine is a coagonist of NMDA receptors and plays a significant role in neuronal activity, including learning, memory and cell-death signaling. As might be expected, increased levels of D-serine are associated with excitotoxicity of NMDA receptors. In adult rats, injection of 50–200 mg/kg D-serine induced oxidative stress, which was thought to be neurotoxic to the brain. Our data showed that zebrafish embryos injected with 100, 500 and 1000 ppm of D-serine displayed a significant decrease in in-chorion contraction () and few defects in primary motor neuron axonal growth but did not display severe impairment of secondary motor neuron projection ( and). Based on published information, we speculate that the D-serine-induced neural defects in zebrafish might be due to impairment of NMDA receptor function and that the injection concentrations described in this study are appropriate for exploration of D-serine-induced neurotoxicities. In addition to neuronal malformation, we also found that embryos injected with D-serine displayed severe muscle defects, especially myofibril misalignment (). Here, we propose two possible causes contributing to D-serine-induced muscle defects. One possibility is that such muscle malformation in D-serine-injected zebrafish embryos might result from D-serine affecting the NMDA receptors of the pre-synapse and disturbing the release of neurotransmitters from the axon terminals. Previous studies have shown that knockdown of neuronal activity led to impairment of muscle development. In this regard, D-serine-induced muscle defects might be the consequences of excitotoxicity of NMDA receptors. In other words, muscle defects are an indirect defect caused by D-serine-induced neuronal toxicity. The other possibility is that D-serine affects the muscle-type NMDA receptor or even an unknown muscle-specific receptor, and disturbs muscle development. In mouse C2C12 myoblasts, it has been demonstrated that NMDA receptors were expressed in myoblasts during muscle differentiation, and played a role in myoblasts fusion. In rats, NMDA receptors were found to be present at the neuromuscular junctions (NMJ) of the diaphragm. These observations suggested that NMDA receptors have direct effects on muscle development. Thus, whether or not NMDA receptors are present at the myoblasts of developing zebrafish embryos merits further study.

Busulfan, a bifunctional alkylating agent, has been used for the treatment of chronic myeloid leukemia and for myeloablative-conditioning regimens before stem cell transplantation. In children, there are several reports of diverse effects of busulfan treatment such as pulmonary fibrosis and acute clinical neurotoxicity (spasm). Busulfan has teratogenic and cytotoxic potentials, and it is reported that rat fetuses exposed to busulfan developed microencephaly and microphthalmia. Our previous studies clarified the systemic histopathological changes and the sequence of the central nervous system (CNS) lesions characterized by neural progenitor cell apoptosis in rat fetuses transplacentally exposed to busulfan on gestation day 13. It is also reported that busulfan induces histopathological changes in the lungs in adult humans and in gastrointestinal tissues, lymphoid tissues and gonadal tissues in adult rats. On the other hand, there are few reports of systemic histopathological changes in infant animals induced by busulfan except for our previous report of busulfan-induced CNS lesions in infant rats. In the present study, we examined the busulfan-induced systemic histopathological changes in infant rats mainly from the viewpoints of the distribution and sequence of pyknosis of component cells, except for brain and eye lesions, which will be described elsewhere in the near future. Male newborn rats were obtained in our laboratory by mating females with males of the same colony of specific pathogen-free rats of the Sprague-Dawley strain purchased from Charles River Laboratories Japan, Inc. (Kanagawa, Japan). One foster mother with 8 male newborns were housed together in plastic Econ cages (W 340 mm × D 450 mm × H 185 mm) with bedding (White flakes: Charles River Laboratories Japan, Inc.) in an environmentally controlled animal room (temperature, 23 ± 3ºC; relative humidity, 50 ± 20%; air ventilation rate, 10–15 times per hour; lighting, 12 h/12 h light/dark cycle) and fed an irradiation-sterilized pelleted diet (NMF, Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water . Finally, a total of fifty 6-day-old male rats were subjected to the experiment. The protocol of this study was reviewed and approved by the Animal Care and Use Committee of BoZo Research Center. No deaths occurred in any group until 7 DAT. Thereafter, one animal died with severe myelosuppression at 13 DAT in the busulfan group. In the control group, there were no histopathological changes observed in any tissues. On the other hand, in the busulfan group, histopathological changes mainly characterized by pyknosis of component cells were observed in many tissues as listed in . Histopathological changes other than pyknosis are shown in . Histopathological changes were also detected in the brain and eyes, but their data were excluded from the present paper as mentioned above. In the cardiopulmonary system, pyknosis was observed in a small number of cardiomyocytes () and alveolar and terminal bronchiolar epithelial cells at 2 and 4 DAT (). In the digestive system, pyknosis was found in a small number of hematopoietic cells in the liver at 2 DAT, glandular epithelial cells in the stomach () from 1 to 7 DAT, and crypt epithelial cells in the intestines from 1 to 4 DAT. Hematopoietic cells in the liver mildly decreased from 4 to 14 DAT, and glandular epithelial cells in the stomach showed vacuolation at 4 DAT. In the urogenital system, pyknosis was found in a small number of proximal and distal tubule epithelial cells in the kidneys () at 2 and 4 DAT. Pyknotic changes in spermatogonia started at 1 DAT and became moderate at 2 and 4 DAT in the testes (). Thereafter, seminiferous tubules showed atrophy with depletion of germ cells at 7 and 14 DAT, at which point only Sertoli cells were left in the germinal epithelium of markedly atrophied seminiferous tubules (). Pyknosis was also found in a small number of epithelial cells in the epididymides from 2 to 7 DAT. In the hematopoietic and lymphoid system, the thymus showed moderate cortical atrophy at 2 and 4 DAT following moderate or mild pyknotic changes in cortical lymphocytes at 1 and 2 DAT (). Similar but less severe changes were observed in mesenteric lymph nodes at 4 and 7 DAT. In the spleen, a minimal or mild decrease in the number of hematopoietic cells was detected from 2 to 14 DAT. In the bone marrow, mild or moderate pyknotic changes of hematopoietic cells were found from 1 to 7 DAT. A decrease in the number of hematopoietic cells with fat cell infiltration started at 2 DAT, progressed thereafter and became prominent at 14 DAT (). In the other tissues, pyknosis was found in a small number of hair follicle epithelial cells () in the dorsal skin and osteoblasts () in the femur at 2 and 4 DAT. Most of the pyknotic nuclei were immunohistochemically positive for cleaved caspase-3 (, inset), indicating that pyknotic cells were apoptotic. In the present study, we examined the nature and sequence of systemic histopathological changes observed in infant rats exposed to busulfan (20 mg/kg) at 6 days of age. As mentioned above, those in the CNS have been previously reported, and those in the eyes will be published elsewhere in the near future. Pyknosis of component cells was detected in many tissues (). Among them, the thymus was moderately affected by pyknosis at 1 DAT, and the bone marrow and testes were moderately affected by pyknosis at 2 and 4 DAT. Most of the pyknotic nuclei were immunohistochemically positive for cleaved caspase-3. This strongly indicates that pyknotic cells are apoptotic. In addition, moderate cortical atrophy was observed simultaneously with moderate pyknosis of cortical lymphocytes in the thymus, a moderate to marked decrease in the number of hematopoietic cells with infiltration of fat cells was found from 4 to 14 DAT in the bone marrow, and moderate or marked atrophy due to depletion of germ cells developed at 7 and 14 DAT in the testes. Thus, histopathological changes remained until 14 DAT in the bone marrow and testes, and whether or not the rats could recover from such lesions in the bone marrow and testes thereafter was not clear in the present study. On the other hand, histopathological changes observed in tissues other than the bone marrow and testes were considered to be transient in nature. Although there were no reports of cardiac lesions in fetal or adult rats following exposure to busulfan, apoptosis of cardiomyocytes was detected in infant rats in the present study, suggesting a susceptibility of the infant rat heart to busulfan. Regarding pulmonary lesions, it has been reported in humans that long-term and/or high-dose busulfan therapy brought about such pulmonary lesions as bronchopulmonary dysplasia and diffuse interstitial pulmonary fibrosis in adults and children. These lesions are known as “busulfan lungs.” In the lungs of fetal and infant rats, only transient apoptotic changes were detected in alveolar and terminal bronchiolar epithelial cells. With regard to histopathological changes in the gastrointestinal tissues, apoptotic changes were common in fetal and infant rats. Namely, they were milder in the intestine than in the stomach in fetal and infant rats, while they were reported to be milder in the stomach than in the intestine in adult rats. In humans, although there were no reports of histopathological changes in the gastrointestinal tissues, clinical signs of nonspecific gastroenteritis were reported. In the kidneys, although there were no reports of apoptosis in tubular epithelial cells in adult rats and humans, apoptosis of tubular epithelial cells was observed in fetal and infantile rats, suggesting that tubular epithelial cells of infant rats still remain susceptible to busulfan. The outline of the testicular lesions in infant rats was similar to those in adult rats, while there have been no reports of testicular lesions in humans. Histopathological changes in the thymus and mesenteric lymph nodes were similar between infant and adult rats. On the other hand, atrophy of the splenic white pulp, reported in adult rats, was not clear in infant rats. In the bone marrow of infant rats, as mentioned above, the number of hematopoietic cells decreased with time and became marked at 14 DAT with prominent infiltration of fat cells. This corresponded well to depressed bone marrow cellularity reported in adult rats. In our previous study on histopathological changes in fetal rats, we observed apoptosis of component cells in mesenchymal tissues such as craniofacial tissues, the mandible, limb buds and the tail bud. In the present study on histopathological changes in infant rats, apoptosis was found in hair follicle epithelial cells in the dorsal skin and osteoblasts in the femur, which were not reported in adult rats. In conclusion, the present study showed that busulfan-induced histopathological changes were characterized by apoptosis of component cells and that the distribution and sequence of apoptosis showed some differences, especially between infant and adult rats, probably reflecting the difference in susceptibility of component cells to busulfan between them.

AZD3783 is a potent and selective antagonist of the human 5-hydroxytryptamine 1B (serotonin, or 5-HT) receptor, with a Ki of 12.5 nM. that is involved in physiological functions including thermoregulation, modulation of neurotransmitter release, as well as anxiety and mood regulation. release of serotonin, thus 5-HT antagonists have been explored as an alternative therapy to selective serotonin re-uptake inhibitors (SSRIs) for treatment of depression. In guinea pig models, AZD3783 (0.6 µmol/kg. p.o.) was shown to increase extracellular serotonin in the brain, block hypothermia induced by 5-HT-agonists, and elicit effects indicative of anxiolytic and anti-depressant efficacy. emission tomography (PET) studies, AZD3783 was demonstrated to bind dose-dependently to brain 5-HT receptors in non-human primates and human subjects. K of 51 nM, which is approximately 4-fold lower than its affinity for the guinea pig or human 5-HT receptors. conducted with the dog receptors, however, given the receptor’s structural conservation, dogs would also be pharmacologically responsive. adrenergic α receptor and is an antagonist of the adrenergic α and α receptors in secondary pharmacology screens at 10 µM. amphiphilic drug (CAD). Many CADs have been shown to cause phospholipidosis (PLD) and in animals and man. PLD is considered an adaptive response rather than a manifestation of toxicity, questions remain as to the toxicological significance of PLD in affected tissues, since it is sometimes associated with concurrent toxicities clinically and preclinically. progresses to fibrosis, peripheral neuropathies from perhexiline, and corneal opacities from amidarone. PLD is regarded as a potential safety liability by regulatory agencies. maybe greater, because they are designed to cross the blood brain barrier, increasing the potential for PLD and associated toxicities in the brain, which are difficult to monitor. was developed to screen compounds with CAD structures for their ability to cause PLD. list of potential drug candidates based on a number of criteria - potency to cause PLD, repeat dose toxicity, and pharmacokinetic properties. clearance is moderate (18 mL/min/kg, after IV dosing), with a steady state volume of distribution of 4.3 L/kg. to be a p-glycoprotein substrate. (EC=164 µM) compared to reference compounds such as amiodarone, chloroquine, and perhexiline (EC<20 µM), and not a direct inhibitor of mitochondrial oxidative phosphorylation (unpublished data). number of tissues in a 14-day rat study, but at an incidence and severity less than the other comparison compounds (unpublished data). treatment-related pathology in a 14-day study in which limited tissues including dorsal root ganglion were examined (data not shown). pathologic changes in the nervous tissues after repeat dosing for 3 months. describe toxicologic findings in dogs after repeat dose exposure to AZD3783 for 1 or 3 months. been seen for other compounds that modulate the serotonin pharmacology. AZD3783, [(2R)-6-methoxy-8-(4-methylpiperazin-1-yl)--(4-morpholin-4-ylphenyl) chromane-2-carboxamide;MW=466.6 g/mol; for structure, see Reference ] was supplied by AstraZeneca’s Pharmaceutical Development Department in Macclesfield, UK. appearance), the identity was confirmed, and the storage condition was determined. purity of the micronized test substance was ≥ 99% in the two batches used in the studies. during the dosing period. The dosing volume was 5 mL/kg. ranged from 0.5 to 9.3 mg/mL. Control dogs received the vehicle, 0.1 M lactic acid in water (pH 3.0). used within the stability period. of AZD3783 was added to a pre-calibrated beaker. An appropriate volume of 0.1 M lactic acid (not adjusted for pH) was then added and the mixture was sonicated and stirred. mixture was then brought to volume using 0.1 M lactic acid (pH adjusted to 3), and stirred until a solution was obtained. were acceptable (± 2% of nominal). samples. pretest, end of dosing, and end of recovery in the 1-month toxicity study. toxicity study, ophthalmological examination was conducted during pretest, Weeks 6, and 13 of dosing period, as well as Weeks 3 and 5 of the recovery period. after application of a mydriatic agent (tropicamide solution, 1% Mydriacyl, Alcon), using an indirect ophthalmoscope and also a slit lamp (3 month study only). (t), maximum plasma concentration, C, area under the curve (AUC), half-life (t). No statistical analysis was performed in the 1-month toxicity study. toxicity study, numerical data were subjected to calculation of group means and standard deviations. test at the 0.05 significance level. found to be significant, a parametric two-sample -test was used to compare the group mean between the control and treated groups. Whenever Levene’s test indicated heterogeneous group variances (≤0.05), then the control group was compared to the treated group using the non-parametric Wilcoxon rank-sum test. Wilcoxon test, significance was reported at the 0.05, 0.01 and 0.001 levels. A summary of the toxicokinetic data is shown in . occurred between 0.5 and 3 h post-dose. appeared to increase with dose, especially after 3 months of dosing. longer on Day 28 than on Day 1. and t was longer on Day 91 than on Day 1 in the 15 and 30 mg/kg/day groups, while AUCs were similar between Day 1 and Day 91. saturation in absorption and a slowdown in elimination with repeat dosing. mechanisms behind these pharmacokinetic changes are not clear. t) in animals dosed at 47 mg/kg/day, but heart rate and blood pressure tended to be lower 24 h post dose in all dose groups. only consistent reductions in blood pressure were observed for systolic blood pressure in males dosed at 47 mg/kg/day and in females dosed at 14 and 47 mg/kg/day. treatment-related effect on ECG. 3-month toxicity study: Swelling and redness of the pinnas, periorbital region, cranium muzzle, lower jaw, abdominal area and/or limbs was noted in the 15 and 30 mg/kg/day groups during the first few weeks of dosing with the severity and incidences slightly higher in males than females. These clinical signs subsided as dosing continued. were observed in animals from the 15 and 30 mg/kg/day groups on most days during the study. adverse clinical signs. was slightly uncoordinated starting on Day 83. to termination revealed abnormal responses. findings from this dog is shown in . findings. No treatment-related ophthalmologic observations were recorded during Week 6 examination. findings including retinal hemorrhage (slight in one or both eyes), vitreous hemorrhage (moderate, 1 eye), or retinal detachment (both eyes, multifocal, small circular areas of retinal separation scattered throughout tapetal area). and retinal detachment improved and resolved while sequelae such as chorioretinal scar or tapetum hyperreflectivity or hyperpigmentation was observed. ophthalmologic findings is shown in . Pathological lesions in the liver and gallbladder were present prominently in those 4 dogs which had elevated liver biomarkers. inflammatory cell infiltration, degenerative and necrotic changes in the centrilobular region and moderate pigments in histiocytes (), which were confirmed as hemosiderin and lipofuscin. mucosa showed vacuolation and hypertrophy of the epithelium and inflammation ranging from minimal polymorphonuclear cell infiltration to frank cholecystitis. the liver and gallbladder tissues showed lamellar bodies consistent with PLD in hepatocytes (), intrahepatic bile duct epithelial cells and gallbladder epithelial cells. bile duct and gallbladder epithelial cells also had increased numbers and size of lipid droplets as compared to controls. 3-month toxicity study: Among dogs from the 15 and 30 mg/kg/day groups which were necropsied after 3 months of dosing, the major treatment-related microscopic findings were seen in the nervous system, including the eye, optic nerve, brain, spinal ganglia and sciatic nervous. marrow, GI tract, kidney, lung, lymph nodes, spleen, and thymus. from the decedant animal were similar in character and severity to those observed in other dogs dosed at 30 mg/kg/day. peripheral nervous tissues after 3 months of dosing is shown in . recovery evaluation but was killed preterminally on Day 86 are included in the summary with the 3 other females from the group that were necropsied on Day 91. cervical segment in 2 males and 1 female at 30 mg/kg/day. involving the thoracic and lumbar spinal cord segments was present in 2 males at 30 mg/kg/day. degeneration/necrosis, inflammation, ganglion cell vacuolation, and/or nerve fiber degeneration were present in at least one dog from all treatment groups (). male dog, which was normal in the neurologic examination. neuronal vacuolation (fine cytoplasmic vacuoles), nerve fiber degeneration, perivascular inflammation, and/or gliosis were present in all dogs dosed at 30 mg/kg/day, and in 2 females dosed at 15 mg/kg/day (). 15 mg/kg/day male had neuronal vacuolation and nerve fiber degeneration in the brain. brain regions that were typically affected with one or more microscopic findings included the visual/optical tracts/pathways (retina, optic nerve, optic tracts, and lateral geniculate body), brain stem (cochlear nuclei and superior olivary complex), and the CA2, CA3, and CA4 region of the hippocampus. dose-related and ranged from slight to moderate. dosed at 30 mg/kg/day (). eosinophilic inclusions were present in all animals dosed at 30 mg/kg/day (, insert). degeneration was present in animals dosed at 15 and 30 mg/kg/day (). still present after the 5-week recovery period. loss accompanied by marked astrogliosis in affected areas (). study. dogs dosed at 14 or 47 mg/kg/day, but not from dogs dosed at 2.3 mg/kg/day. appreciable concentrations of AZD3783 were detected in the brains of dogs from all groups, with greater than dose-proportional increases between 14 and 47 mg/kg (). the concentration detected at 2.3 mg/kg, a supra-proportional increase relative to dose. However, at each dose level, there was no difference in regional brain concentrations. brain/plasma concentration ratio appears to be constant (approximately 4) across the dose range, indicating that there is no saturation of clearance from the brain. effects on the serotonergic pathway. humans. (vacuolation) in tissues under light microscopy and by appearance of ultrastructural lamellar bodies under electron microscopy. some CADs only induce PLD in individual tissues, such as liver or lungs, others may induce generalized PLD in various tissues. be related to difference in tissue distribution, and compound lipophilicity or basicity. lamellar bodies in the liver and gallbladder of some treated dogs in the 1-month study. toxicity study, various tissues showed PLD-like vacuolation under examination by light microscopy. in the various tissues, including the nervous tissues are due to PLD. optic nerve were observed in dogs dosed at 30 mg/kg/day for 3 months. are also consistent with PLD, which with associated myeloid bodies or inclusion bodies are a common CAD-induced retinal change in the rat, and was seen in dogs administered fluoxetine. However, degeneration of optic nerve due to PLD has not been reported previously. example, amiodarone, which causes generalized PLD, did not cause any alteration in the retina or optic nerve in dogs after 11 weeks of dosing, although it did induce corneal microdeposits in 1 of 6 dogs after 6 weeks. severe than those previously reported with other CADs. not clear. the end of the dosing period. increase brain serotonin concentration, and serotonin toxicity has been reported in dogs after incidental ingestions of SSRI or hydroxytriptophan, a precursor of serotonin, we first considered whether the dog was experiencing serotonin toxicity. characterized by behavioral change (agitation, lethargy) accompanied by autonomic signs (e.g., vomiting, mydriasis, hypersalivation, hyperthermia, tachycardia), and neuromuscular signs (e.g., ataxia, tremors, myoclonus, hyperreflexia, nystagmus, and seizure). cases, coma, hyperpyrexia, and generalized seizure can be rapidly fatal. the reasons described here. the 1-month study, so as not to elicit severe liver toxicity and intolerable CNS effects. no seizure was ever noted. signs, such as emesis, hypertension, or hyperthermia. AZD3783, 17 µM, obtained prior to euthanasia on Day 86, was higher than C from other surviving females on Day 91 (which ranged from 11 to 15.7 µM), it was lower than C on Day 1 (which ranged from 23.7 to 33.7 µM). dosing progressed. adverse CNS signs were seen in any of the treated dogs during the early weeks of treatment, this suggests that the neurologic effects in the decedant developed over time with repeat dosing, and is most likely related to the pathological changes observed in the nervous tissues. dependent. dosing at 47 mg/kg/day, vacuolation plus degeneration or necrosis were seen after 3 months at 15 or 30 mg/kg/day, while only vacuolation in the spinal ganglia was observed at 7 mg/kg/day. leading event to the degeneration or necrosis. ganglia has not been reported with very many chemicals. has the highest potential to induce generalized PLD, few were reported to cause widespread PLD in the nervous system. Furthermore, most observations were made in rats. PLD in retina and DRG; citalopram (an SSRI) caused PLD in 1 sympathetic ganglion, none or very weak PLD in retinal and trigeminal ganglia, and hypothalamic neurosecretory perikarya; fluoxetine (an SSRI) caused PLD in retinas as well as PLD-like vacuolation in nerve cells in the thalamus, cerebellum, spinal cord and ganglion or rats. neuronal degeneration or neurological findings were observed. 1-year study included convulsions, tremors, transient nystagmus and slow/incomplete papillary responses. brain of dogs after chronic administration. degeneration or necrosis, nor was there any alteration in the amplitude, or latency of the auditory, visual, or somatosensory evoked potentials. between AZD3783 and these aforementioned CADs that contributed to the differences in the toxicity and pathologic findings in the nervous tissues. the study with posaconazole inflammatory changes were not observed in any tissues with PLD. In contrast, in our studies with AZD3783, inflammation and gliosis was present in the nervous tissue (eye, ganglion, and brain). on the work by Wada and assuming similarity in the pathogenesis of toxicity induced by PLD and lysosomal storage disease, one would hypothesize that the inflammatory response secondary to PLD was one of the trigger events to the neurodegeneration. Sandhoff’s disease, a lysosomal storage disorder characterized by storage of gangliosides in the CNS, showed that microglia activation and inflammation preceded the neurodegeneration. neurotoxic. apoptotic cell death was concentrated in the caudal region of the CNS, in spinal cord, brainstem, and thalamus, where microglia activation was indicated by overexpression of gene activation. exhibiting severe neuromuscular effects. in addition to neuronal vacuolation, also neuronal degeneration and necrosis accompanied by gliosis in the medulla oblongata. of dosing, and the degenerative changes in the brain tissues in this investigative study contrast with the minimum brain vacuolation observed in the 1-month toxicity study. differences between the two studies could be due to differences in dog sources and individual animal sensitivity. Nonetheless, the mean group plasma concentrations of AZD3783 after administration of various doses were comparable across studies. concentrations of AZD3783 relative to plasma were present in various brain regions. the plasma concentrations were generally dose-proportional (see ), the mean brain concentrations of AZD3783 were 38- and 460-fold higher at 14 and 47 mg/kg/day dose, respectively, relative to that at 2.3 mg/kg/day. Since CADs, e.g., amidarone, have been shown to accumulate in tissues in association with PLD, one may hypothesize that the high brain to plasma concentration ratio is due to PLD, following accumulation of AZD3783 in lysosomes. AZD3783 in the different brain regions were similar, i.e., there was no measureable preferential distribution of AZD3783 in select regions of the brain where dose-dependent PLD-like vacuolation was observed (e.g. was observed, relative to non-responding regions (e.g. frontal cortex; data not shown). cytotoxicity of AZD3783, do not rule out if it is due to differential sensitivity in different brain regions. visual/optical tracts/pathways, brain stem and the CA2, CA3, and CA4 regions of the hippocampus remain to be elucidated. vitreous hemorrhage, or retinal edema or detachment upon ophthalmologic examinations. findings are possibly related to the exaggerated pharmacologic effects of AZD3783 on serotonin and platelet function. spontaneous variant, is most frequently caused by trauma, or a systemic clotting disorder, and can occur secondary to retinal detachment, which is often associated with increased ocular pressure. the clotting mechanisms, e.g., coumarin anticoagulants and is the most common ocular lesion in dogs with systemic hypertension. serotonin and norepinephrine re-uptake inhibitors (SNRIs) drugs have effects on cardiovascular and coagulation mechanisms. been seen clinically with fluoxetine overdose. observed in the upper GI, and rare hemorrhage in retina or subjunctiva has been noted with fluoxetine, paroxetane, or venlafaxine (a SNRI) in man. ophthalmological findings have not been reported in preclinical studies with these aforementioned compounds. observed in fluoxetine dog studies, there was no change in coagulation parameters, nor was hemorrhage detected in any tissues after 13 weeks of dosing. study in dogs, AZD3783 causes modest tachycarda with decrease in blood pressure at 47 mg/kg, but no effect at 14 mg/kg/day. AZD3783 in dogs remain to be confirmed. in many visceral organs were similar to those seen in the dogs, the pathologic changes in the nervous tissues were limited and less severe. minimal neuronal vacuolation in the DRG and brain stem were observed. dosing at 100 mg/kg/day, minimal to slight neuronal vacuolation with eosinophilic deposits were seen in the DRG, brain stem, and additionally, spinal cord (unpublished results). were seen in the eyes, optic nerve, ventral root ganglion, sciatic nerve or in other brain regions. results). were 30 µM for C and 402 µM.h for AUC; the exposures at the NOEL for neuropathology, 25 mg/kg/day, were 11.4 µM for C and 84 µM.h for AUC (unpublished results). between rats and dogs, the rat had approximately 2-fold higher dose-normalized AZD3783 concentration in the brain stem or hippocampus. sensitivity and responses, e.g., inflammation or glia cell activation, to PLD may underlie some of the differences in neurotoxicity observed between dogs and rats after exposure to AZD3783. In AZD3783 Phase 1 trials in healthy volunteers, single ascending oral doses from 1 to 40 mg was well tolerated and did not elicit any severe adverse effects. 50% receptor occupancy in brain region, and is projected to be the efficacious dose, where the estimated C is 33 nM and AUC is 383 nM*h. predicted therapeutic concentration based on 50% receptor occupancy in the brain, the AUC exposure achieved in the 3-month study was 76-fold higher at 7 mg/kg/day, where only low incidences of vacuolation and inflammation were seen in the ganglion cell. where pathological changes were seen in brain, spinal ganglia, as well as sciatic and optic nerves, the exposure was 350-fold of the predicted therapeutic exposure. appeared to be large safety margins to the observed effects. findings from the 1- and 3-month studies with AZD3783 vs. raised these questions: 1) Are the more severe brain lesions (degeneration, necrosis, or inflammation) a direct or indirect consequence of PLD? 2) Is there an additional AZD3783-unique neurotoxic mechanism at play apart from PLD that lead to the severe lesions? 3) Will PLD and the neurotoxicity get progressively worse with chronic dosing, such that a NOEL will not be identified and thus no safety margin is attainable? And 4) Why and how is AZD3783 different from other SSRIs or SNRIs? These questions, together with the lack of recovery in effects in the 3-month study raised significant safety concerns and a decision to discontinue the project before multiple dose phase in man was initiated. various tissues in dogs after repeat dosing with AZD3783 from 1 to 3 months. of vacuolation in the various tissues suggests generalized PLD, which is consistent with the chemical structure of AZD3783. observed neuropathology are attributable to PLD or chemical toxicity unique to AZD3783.

Prostate cancer is the most common cancer and the second leading cause of death from cancer among men in the US. It has been estimated there will be approximately 238,590 new cases of prostate cancer and 29,720 deaths from prostate cancer in the US in 2013. In Japan, the prevalence and mortality of prostate cancer has also been increasing, along with in the so-called nutrition transition. Androgen ablation therapy is generally applied for prostate cancer because of hormone-dependent growth. However, outgrowth of androgen-independent and metastatic cancer cells is a frequent outcome, eventually leading to death of the patient. Therefore, understanding of the mechanisms of the acquisition of metastatic potential or the androgen-independent phenotype of cancer cells is urgently required. We have established a rat cancer model responding to the need for systems that adequately reproduce the spectrum of human prostate cancers. Administration of 3,2’-dimethyl-4-aminobiphenyl (DMAB) induces noninvasive and androgen-dependent adenocarcinomas in the ventral prostate, while additional long-term treatment with testosterone propionate (TP) causes development of invasive and metastasizing androgen-independent adenocarcinomas arising from the dorsolateral and anterior prostate and seminal vesicles. However, a long period of about 60 weeks is required to induce prostate cancers in both carcinogenesis models, and the incidence of lesion development is relatively low. Therefore, we have established transgenic rats bearing a probasin promoter/simian virus 40 (SV40) T antigen construct to resolve these problems. This model, the transgenic rat for adenocarcinoma of the prostate (TRAP), features development of high-grade prostatic intraepithelial neoplasia (HGPIN) from 4 weeks of age and androgen-dependent well-moderately differentiated adenocarcinomas with 100% incidences by the age of 15 weeks. These characteristics of the TRAP model have been shown to be very suitable for evaluation of strategies for chemoprevention and treatment. Microinvasive carcinomas characterized by a budding morphology from acini are observed in an age-dependent manner in TRAP rats, but these lesions are generally only 0.2–0.3 mm diameter in size and take over 35 weeks to develop. We speculated that testosterone administration might be of paramount importance in the induction of invasive carcinoma in our transgenic rats based on our experience with the DMAB combined with TP-induced prostate carcinogenesis model. In the present study, we therefore assessed whether testosterone exposure might result in a high-grade invasive phenotype or metastatic lesions in TRAP rats. TP was purchased from Sigma-Aldrich (St. Louis, MO, USA) and DMAB was obtained from Matsugaki Pharmaceutical Co. (Osaka, Japan). The purity of DMAB was >98%. Antibody for androgen receptor (AR) was obtained from Santa Cruz Biotechnology Inc (N-20, Santa Cruz, CA, USA). The antibody for Ki-67 was from Acris Antibodies GmbH (SP-6, Hiddenhausen, Germany). Male heterozygous TRAP rats with a Sprague–Dawley genetic background were obtained from Oriental BioService Inc. (Minamiyamashiro, Kyoto, Japan) and were housed in plastic cages with hardwood chips in an air-conditioned room with a 12 h light/dark cycle at 23 ± 2°C and 50 ± 10% humidity. Food (Oriental MF; Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water were available . They were acclimatized for 1 week before use. Surgical treatments, such as orchiectomy and tube implantation, were carried out under deep isoflurane anesthesia. All animal experiments were performed under protocols approved by the Institutional Animal Care and Use Committee of the Nagoya City University Graduate School of Medical Sciences. Experiment 1: A total of 24 male TRAP rats aged 6 weeks were randomly divided into four groups. Rats in groups 1 and 2 were treated with bilateral orchiectomy at day 0 of the experiment. Those in groups 1–3 underwent subcutaneous implantation of 2-cm-long silicone rubber tubes (Silascon, inner diameter, 0.2 cm; outer diameter, 0.3 cm, Kaneka Medix Corporation, Osaka, Japan) containing 40 mg TP sealed at both ends with silicone rubber sealing compound (KE-42, Shin-Etsu Chemical Co., Ltd., Tokyo, Japan) into the interscapular region from weeks 1 to 4 and from weeks 6 to 16. The TP implants were replaced at 6-week intervals. Rats in groups 1 and 3 were subcutaneously given DMAB at a dose of 50 mg/kg body weight on the second day after TP tube implantation. No treatment was performed in rats of group 4, which served as controls. Animals were euthanized at weeks 16 and 22 after the beginning of the experiment (). Experiment 2: A total of 24 heterozygous male TRAP rats aged 6 weeks were randomly divided into three groups. All were given TP implants in the same manner as in experiment 1 at day 0. The duration of TP administration was different among the groups; that is, TP was administered in experimental weeks 0–3, 5–8 and 10–15 in group 1 and in experimental weeks 0–3 and 5–15 in group 2. Group 3 was continuously administered TP by implants throughout the experiment. The experiment was terminated at week 15 (). Deparaffinized sections were incubated with diluted antibodies for AR and Ki-67. The immunohistochemical analysis was performed with a Discovery XT System (Ventana Medical Systems, Tucson, AZ, USA). Incubation with primary antibodies was carried out for 3 hours followed by a one hour incubation with biotinylated anti-rabbit secondary antibody (Vectastain ABC Kit Rabbit IgG, Vector Laboratories, Burlingame, CA, USA) and a DAB detection kit (Ventana Medical Systems) according to the manufacturer’s instructions. Sections were counterstained with hematoxylin to facilitate orientation. Deparaffinized sections were autoclaved at 120°C for 20 min in antigen retrieval solution (Nichirei Biosciences Inc.) and then allowed to cool. Sections were incubated with 1% skim milk for 1 hour at room temperature. For double staining, anti-smooth muscle actin antibodies (1A4, dilution 1:1,000, mouse monoclonal, Dako) and anti-vimentin antibodies (EPR3776, dilution 1:400, rabbit monoclonal, Abcam) were simultaneously added to the slides and incubated for 1 hour at room temperature. After washing the slides with PBS, fluorescein-labeled goat anti mouse IgG (Life Technologies Corporation.) and tetramethylrhodamine-labeled goat anti-rabbit IgG (Life Technologies Corporation.) were added followed by incubation at room temperature for 1 hour. After washing the slides with PBS, the sections were mounted with Vectashield containing DAPI (Vector Laboratories) and subjected to fluorescence microscopy. At week 16, foci of invasive adenocarcinoma with abundant collagenous stroma were found in lateral, dorsal and anterior prostates of groups 1–3 (), along with minute ventral invasive carcinomas with minimal fibrous stroma. Cancer invasion into perineural spaces was also observed (). Almost all of infiltrating carcinoma cells expressed AR (). The incidences of invasive adenocarcinoma varied among the groups, tending to be higher in group 3 in all prostatic lobes (). Similarly, the number of invasive carcinoma foci was highest in group 3 (). There were no differences in histopathological characteristics of invasive adenocarcinomas among the groups. Development of small cell carcinomas of the prostate was sporadically noted, but there were no differences in incidence among the groups. No metastasis of cancer lesions to distant organs was found in any of the groups. Noninvasive adenocarcinomas in the ventral, lateral prostates were observed in all rats of groups 1–4. A significant increase of invasive adenocarcinoma development was observed in group 1, and this correlated well with the number of TP administration/withdrawal cycles in the lateral prostates (). Multicentric development of invasive adenocarcinoma foci with abundant collagenous stroma was found (), and invasive cancer cells were observed in the stroma () and were positive for AR protein (). Some invasive lesions consisted of cells with atrophic features, but more than 50% of these cells were labeled for Ki-67, suggesting that they were high-grade adenocarcinomas (). Reactive stromal cells surrounding invasive cancers expressed both smooth muscle actin and vimentin and were therefore revealed to be cancer-associated myofibroblasts (). Noninvasive adenocarcinomas in the ventral and lateral prostates were found in all rats of groups 1–3. The TRAP rat features sequential progression from prostatic intraepithelial neoplasias (PINs) to noninvasive adenocarcinomas through prostate epithelial cell-specific expression of the SV40 T antigen regulated by the androgen-dependent probasin promoter. We have applied the TRAP rat model to validate the chemopreventive effects of a variety of chemicals, and cancer development in TRAP rats is very sensitive to chemicals that modulate the AR axis, such as flutamide, finasteride, resveratrol or angiotensin II receptor blockers . These characteristics underly its acceptability to mimic early-stage hormone naïve human prostate cancer without an invasive phenotype. In the present study, we established a novel rat model for invasive adenocarcinoma of the prostate in TRAP rats by intermittent TP administration (group 1 in experiment 2, shown in ). The invasive carcinomas induced simulate human prostate cancer in several respects, such as perineural invasion and multicentric lesion development. To investigate mechanisms of prostate cancer progression, we previously combined administration of both DMAB and TP. While several experiments were conducted with the aim of increasing the incidence of invasive cancer and shortening the experimental period, none exceeded the DMAB + TP model in terms of the cancer incidence. The new prostate carcinogenesis model documented here is characterized by invasive adenocarcinoma development at a high incidence in a short period without carcinogen administration. This rat model should enable us to investigate candidate chemopreventive agents for therapeutic effects as well as chemopreventive properties against prostate cancer. We found that invasive adenocarcinoma incidences became greater as we increased the TP administration/withdrawal cycles for the TRAP rats. In our previous studies, testosterone induced invasive prostate adenocarcinomas in a dose- or duration-dependent manner after prostatic carcinogen treatment. However, continuous administration of testosterone alone earlier proved unable to cause development of invasive cancer with abundant reactive stromal tissue in the TRAP model. The present results thus lead us to speculate that physiological destruction of the normal acinar structure with stromal cell proliferation by androgen depletion plays an important role in the induction of invasive adenocarcinomas. The process of primary cancer invasion, which initiates metastasis, is multifactorial and multistep and requires alteration of cell adherence, proteolytic degradation of extracellular matrix elements and tumor cell migration through tissue. Accumulating evidence has shown that stromal-epithelial interactions play critical roles in cancer progression. The reactive tumor stroma mainly composed of cancer-associated fibroblasts (CAFs) including myofibroblasts, which are the predominant subpopulation of CAFs, is known to contribute to cancer development and progression. Growth of myofibroblasts is reported to be stimulated by androgen. TGFβ is one of the growth factors overexpressed in the prostate of rats after androgen ablation by orchiectomy. TGFβ1 induces reactive oxygen species production via enhancement of NOX4 expression and may underly fibroblast-to-myofibroblast differentiation in the prostatic stroma, while myofibroblasts per se contribute to the production and activation of TGFβ1 and stromal cell-derived factor-1 (SDF-1)/CXCL12 by autocrine signaling loops. Phosphoglycerate kinase-1 (PGK1), a downstream molecule of CXCL12-CXCR4 signaling, is upregulated in myofibroblasts, and this is involved in the enhanced proliferation and invasion of prostate cancer cells through activation of MMP, AKT and ERK pathways. In conclusion, TP administration/withdrawal cycles appear to be of paramount importance to induction of invasive adenocarcinomas in the TRAP rat prostate. Our new rat prostate carcinogenesis model for invasive adenocarcinoma should provide opportunities to investigate molecular mechanisms of prostate cancer progression and may serve as a useful preclinical model for evaluating efficacy of preventive and therapeutic agents in terms of the tumor microenvironment. The authors have no conflicts of interest.

Atrial dilatation and fibrillation are well-known risk factors for the development of thrombosis within the atrium. Thrombosis develops easily when blood pooling occurs in the left atrium, often leading to cardio-embolic stroke (CES). Since atrial thrombosis is strongly associated with CES, clarifying the mechanism responsible for thrombus formation in the left atrium would be valuable in the development of preventive measures and treatment strategies for CES. Thrombophilia is a disorder associated with excessive thrombosis; further, familial thromboembolism results from abnormal or deficient coagulation control factors, which leads to the development of idiopathic thrombophilia. Understanding the mechanisms responsible for thrombosis in such patients would improve current treatment options, and the availability of a suitable animal model is expected to contribute greatly to current research endeavors in thrombosis. Therefore, our study aimed to establish an animal model for left atrial thrombosis. In 1996, the male Spontaneously-Running-Tokushima-Shikoku (SPORTS) rat strain was identified in Wistar rats. SPORTS rats are able to spontaneously run long distances on an exercise wheel. These animals clock over 6,000 revolutions per day on an exercise wheel; they are considered valuable in research investigating the effects of training and exercise in healthy individuals or persons with lifestyle-related diseases. In an earlier study, we found that SPORTS rats had higher blood pressures than Wistar rats, although their blood pressures were not as high as those in spontaneous hypertensive rats (SHR) or stroke-prone spontaneous hypertensive rats (SHRSP). The SHR and SHRSP rats are well-known Wistar strains used in studies on hypertension and stroke, resepectively. A related strain —the SHHF/Mcc rat— is a model for spontaneous hypertension, progressive renal dysfunction and congestive heart failure (CHF); left atrial thrombosis has been reportedly observed on necropsy of these SHHF/Mcc rats. However, thus far, no reports have described a high incidence of atrial thrombosis in SHR, SHRSP or SHHF/Mcc rats. In this study, we examined the possibility of using the previously established Wistar strain of SPORTS rats, which develop spontaneous thrombi in the left atrium, as a model for atrial thrombosis. A male rat that spontaneously ran long distances, over 6,000 revolutions per day on an excise wheel, was discovered in an outbred strain of Wistar rats purchased from Charles River, Canada, in 1996. This strain was bred into a SPORTS rat strain at the Shikoku University (Tokushima, Japan). A colony of SPORTS rats was transferred to the University of Tokushima (Tokushima, Japan) and is currently being maintained there. In this study, 28 male and 45 female SPORTS rats were used; 15 male and 16 female Wistar rats were used as controls; and 5 male SHR rats were purchased from Japan SLC, Inc. (Shizuoka, Japan). All the rats were housed in individual cages and maintained under specific pathogen-free conditions at the Tokushima University Animal Study Facilities (room temperature, 23 ± 1°C; lighting, 08:00–20:00). Rats were fed a standard non-purified diet (Oriental Yeast, Tokyo, Japan) and had access to food and tap water. At the start of experimentation, all male and female SPORTS rats as well as all control rats were between 3 and 4 weeks of age, and they were housed in individual cages equipped with an exercise wheel (1.15 m/cycle). All the SPORTS rats clocked at least 6,000 revolutions per day on the exercise wheel. At the end of the experimentation, all rats were anesthetized with sodium pentobarbital (50 mg/kg) and then sacrificed by exsanguination. We performed electrocardiography and measured the blood pressures and heart rates of 7 male and 3 female SPORTS rats, 7 male control rats and 5 male SHR rats at 10 weeks of age. Electrocardiograms (ECG) were recorded using an ECG processor analyzing system (SRV-2W, SBP-2000; Sotron, Tokyo, Japan), and we used the tail-cuff method and a noninvasive rat-mouse manometer transfer (TK-370; Neuroscience, Tokyo, Japan) to record blood pressures and heart rates. We measured the levels of triiodothyronine (T3) and thyroxine (T4) levels to assess thyroid function and the levels of thyroid-stimulating hormone (TSH) to assess pituitary function in 6 male SPORTS rats and 6 male control rats at 16 weeks of age. Blood was collected from the abdominal aorta at the time of sacrifice, and the plasma T3, T4 and TSH levels were measured by radioimmunoassay (RIA; Immunotech Inc., Czech Republic). Necropsy was performed when SPORTS rats were found dead or euthanized and terminally sacrificed at 80 weeks of age in males and at 100 weeks of age in females. The thoracic and abdominal cavities were opened; the heart, lungs, liver, kidneys, and spleen were removed; and the weight of each organ was recorded. Thereafter, the heart and lungs were fixed in 10% neutral buffered formalin, trimmed, embedded in paraffin, sectioned at a thickness of 4 µm, stained with hematoxylin and eosin (H&E) and van Gieson’s stain for elastin and examined microscopically. Data are expressed as means ± SD. We used the two-tailed Student’s -test (Microsoft Excel, version 2007) to test for significance between groups. P < 0.05 was considered statistically significant. In the male rats, the average systolic blood pressure of the SPORTS, SHR and control rats were 134.3 ± 15.5, 197.9 ± 27.3 and 115.2 ± 10.8 mmHg, respectively (P < 0.05 for SPORTS vs. control rats, P < 0.01 for SHR vs. control rats, and P < 0.05 for SHR vs. SPORTS rats; ). In the female SPORTS rats, the average systolic blood pressure was 135.8 ± 5.6 mmHg. In the male rats, the average heart rates of the SPORTS, SHR and control rats were 458.8 ± 21.3, 388.6 ± 28.1 and 385.5 ± 44.3 beats/min, respectively (P < 0.01 for SPORTS vs. control rats and P < 0.01 for SPORTS vs. SHR rats, ). In the female SPORTS rats, the average heart rate was 446.0 ± 21.6 beats/min. The average levels of TSH and T4 in 16-week-old rats did not differ significantly between the SPORTS and control rats (). The average levels of T3 in 16-week-old SPORTS rats tended to be lower than those in the control rats; however, this difference was not statistically significant (P = 0.051). The average survival periods of the male and female SPORTS rats were 79.5 ± 26.7 and 102.3 ± 28.4 weeks, respectively (). The average survival periods in the male and female SPORTS rats that developed atrial thrombosis were 71.1 ± 26.0 and 98.6 ± 22.4 weeks, respectively; further, the shortest life spans in the male and female SPORTS rats with macroscopic atrial thrombosis were 33 and 50 weeks, respectively (data not shown). The body weights and relative organ weights in the male and female SPORTS and control rats were compared (). The body and organ weights of 80-week-old male and 100-week-old female Wistar rats were used as controls. The average body weight of the male SPORTS rats was considerably lower than that of the control rats. The relative weights of the heart and lungs to the body weight in the SPORTS rats were significantly higher than those in the control rats (P < 0.01, ). The relative weight of the liver to the body weight in the SPORTS rats was significantly higher than that in the control rats (P < 0.05, ). Atrial thrombosis occurred in 57.1% and 37.8% of male and female SPORTS rats, respectively (). Atrial thrombosis in the right atrium also occurred in 7.1% of male SPORTS rats; further, in one of these rats, thrombi developed in the hepatic veins. The necropsy results for the control rats did not show any evidence of macroscopic atrial thrombosis in any of the animals (). Further, necropsy of the 5 male SHR rats also did not show macroscopic atrial thrombosis (data not shown). Hard, white thrombi were observed in the left atria of the SPORTS rats on macroscopic examination (). shows the histological findings for the organized thrombi, with dense connective tissue in the left atrium stained with H&E (panel A) and van Gieson’s stain for elastin (panel B). The organization of thrombi was clearly observed in the left atrium. Many neutrophils accumulated around each thrombus, and some neutrophils and lymphocytes were observed to infiltrate the atrial wall. No signs of degeneration, necrosis or fibrosis was observed in the valves, atria, or ventricles. The histological findings for the lungs of the SPORTS rats are shown in ; many foam cells were observed in the pulmonary alveoli. Previous studies have investigated the characteristics of male and female SPORTS rats and reported the hyperactive wheel-running ability of these rats. In the present study, we observed that SPORTS rats were predisposed to the development of atrial thrombosis. Previous studies have reported that atrial thrombosis can occur following exposure to certain chemicals. For instance, the peroxisome proliferator-activated receptor-gamma agonist troglitazone is known to induce atrial thrombosis in Wistar rats. We could not find any evidence of macroscopic thrombosis in our control Wistar rats; further, the 2-year National Toxicology Program (NTP) for rodent studies reported the incidences of atrial thrombosis in male and female F344 rats to be 4.11% and 1.01%, respectively, and those in male and female B6C3F1 mice were reported to be 0.70% and 0.68%, respectively. Thus, the incidence of atrial thrombosis was clearly higher in the SPORTS rats than in other strains. SHR, SHRSP and SHHF/Mcc rats are derived from a single Wistar strain and are useful models for studies concerning the mechanisms and complications of high blood pressure, such as stroke and CHF. Compared with SHR and SHHF/Mcc rats, SPORTS rats have a lower systolic blood pressure and a considerably higher heart rate. Atrial fibrillation is considered a cause of thromboembolism; however, the absence of arrhythmias, including atrial fibrillation, in the SPORTS rats used in the present study suggests that atrial fibrillation was not a cause of atrial thrombi in these animals. Although SPORTS, SHR, and SHHF/Mcc rats belong to the same strain of Wistar rats, thus far, the underlying cause of the faster heart rate in the SPORTS rats remains unknown. In a previous study, we observed that SPORTS rats showed a slightly higher blood pressure than other strains, although this difference was not statistically significant. This lack of significance was possibly due to the small sample size used in the study and/or the decreased ejection fraction in SPORTS rats as compared with those in other strains (data is not shown). In the present study, the average TSH, T3 and T4 levels showed no significant differences between the SPORTS and control rats. Therefore, the higher systolic pressures and faster heart rates in the SPORTS rats could not have resulted from abnormal levels of thyroid hormone. We believe that SPORTS rats have sympathetic hypertonia, which could increase the activity of coagulation factors. Moreover, we observed that the lungs and hearts of SPORTS rats weighed more than the same organs in aged-matched control Wistar rats (). We hypothesize that cardiac enlargement and the presence of thrombi in the left atria of SPORTS rats caused these differences in cardiac weight. The differences in lung weights are thought to accompany the infiltration of foam cells in the alveoli. The mechanisms underlying the development of thrombosis in SPORTS rats may be relevant for studies investigating CHF. In addition, future studies should investigate the relationship between thrombosis and circulating norepinephrine levels. The contribution of inflammation in the atria of young SPORTS rats to the development of atrial thrombosis cannot be ruled out without further studies. In order to fully understand the causes underlying atrial thrombosis in SPORTS rats, further research, including genetic analyses for the identification of the genes responsible for atrial thrombosis, is necessary. Moreover, investigation of the hormones, cytokines and metabolic anomalies that may contribute to thrombosis is also essential. In conclusion, we have established that the SPORTS rat strain is predisposed to the development of atrial thrombi. SPORTS rats may thus be a useful new animal model for clarifying the causes of atrial thrombosis and familial thrombophilia in humans; further, this model could be utilized in the development of novel antithrombotic drugs.

Trichothecene mycotoxins produced by fungi are frequent contaminants in agricultural commodities such as rice, wheat, rye, barley, oats, corn, and other cereals produced in various countries around the world. Contamination with these mycotoxins, including mycotoxins, remains a major concern for human and animal health. Nivalenol (NIV), a trichothecene mycotoxin, is produced by strains of the genus including and . Toxicities of NIV have been reported that 50 and 100 mg/ml NIV damaged the nuclear DNA of cultured CHO cells in the absence of S9 mix, and oral (20 mg/kg) or intraperitoneal (3.7 mg/kg) administration of NIV to mice resulted in DNA damage in the kidneys, bone marrow, stomach, jejunum, and colon. A low level (0.1–0.5 μM) of NIV also induced DNA damage in differentiated human enterocyte-like Caco-2 cells. On the other hand, other results have shown a negative response to NIV in the Ames test and recombination-repair (rec)-assay. The oral LD of NIV in mice was determined to be 38.9 mg/kg body weight. Significant leukopenia and growth retardation were observed in a chronic toxicity study of female mice. In a two-year feeding study of female mice, NIV was not tumorigenic, although growth retardation and leucopenia were observed. Based on these toxicological data, the lowest-observed-adverse-effect level (LOAEL) was concluded to be 0.7 mg/kg body weight/day, and the temporary tolerable daily intake (t-TDI) of NIV was set to 0 to 0.7 μg/kg body weight by the Scientific Committee on Food of the European Union. Recently, a subchronic toxicity study of NIV using F344 rats was conducted, and the no-observed-adverse-effect level (NOAEL) of NIV was less than 6.25 ppm (0.4 mg/kg body weight/day for both male and female rats) based on hematological changes showing decreased white blood cell counts. In an extension of the subchronic study, natural killer (NK) activity against YAC-1 target cells by lymphocytes from the spleen derived from the subchronic toxicity study increased in males , indicating that orally administered NIV is immunotoxic. In young pigs, oral administration of NIV for 3 weeks showed toxicities in the gastrointestinal tract and kidneys and reduced the number of splenocytes. Additionally, the same study found that 2.5 mg/kg NIV caused a time-dependent increase in the plasma IgA concentration. The kidney is known to be a major target of NIV toxicity. Mice orally administered NIV for up to 8 weeks showed increased serum IgA concentrations and histopathological changes in the renal glomeruli such as mild mesangial expansion. In another study, 24 ppm NIV administered orally for up to 8 weeks increased serum IgA levels and glomerular deposition of IgA and IgG in a dose-dependent manner in female BALB/c mice and also increased the serum IgA level in a high IgA strain (HIGA) of mice, an animal model for human IgA nephropathy. According to the previous reports, oral administration of NIV or trichothecene vomitoxin to mice increased IgA(+) B cells or IgA production from Peyer’s patches or splenocyte cultures, respectively, which might cause elevation of the serum IgA concentration and IgA deposition in the glomeruli in mice. Although many studies have reported renal toxicities of NIV, there is limited toxicological data regarding renal toxicity in children with or without renal disease. Since there are reports that NIV increases the serum IgA concentration and deposition of IgA in the glomerular mesangial areas, there is a possibility that NIV would aggravate or modify developed glomerular lesions, especially in infant animals, which might be more sensitive to toxic chemicals. ICGN mice are an inbred strain with hereditary nephrotic syndrome and they are considered a good animal model of human idiopathic nephrotic syndrome. Since early onset of glomerular alteration and proteinuria were observed in the neonatal or infant period, 3-week-old ICGN mice were selected as a model of human infant patients with renal disease to clarify whether NIV aggravated the nephritic syndrome and renal lesions observed in infant ICGN mice. In addition, infant ICR mice, the genetic background of ICGN mice, were used as a model for healthy human infants. We focused on the effect of NIV on the renal glomeruli in 3-week-old ICGN and ICR mice, and changes in serum biochemistry, histopathology, and immunohistopathology of the kidneys were analyzed and compared with non-treated control animals or 8-week-old adult ICR mice. For purification of NIV, Fusarenon X was extracted and purified from the cultured media of (Fn-2B). Purified NIV was mixed with the basal diet (CRF-1; Oriental Yeast Co., Ltd., Tokyo, Japan) for animal studies, and NIV was extracted from the basal diet and analyzed. The identity and purity of NIV was determined by liquid chromatography/mass spectrometry (LC/MS; LCMS-2010A; Shimadzu Corp., Kyoto, Japan), with an atmospheric pressure chemical ionization interface and LC system (LC-2010CHT; Shimadzu Corp.), and the purity was estimated to be >90% from the area percentage of the chromatogram (data not shown). ICGN mice were bred in the National Institute of Health Sciences, Japan. Male and female ICGN/M mice showing proteinuria were mated at the age of 8 weeks old, and their 3-week-old male offspring were used in the present study. Neonatal ICGN mice were underdeveloped due to nephritic syndrome in their dams or their own renal problems. For comparison with ICR mice at the same age or with adults, 2-week-old and 7-week-old male Slc:ICR mice were purchased from Japan SLC, Inc. (Shizuoka, Japan), and infant ICR mice were maintained with their dams until being weaned. Mice were housed 5 or 6 per polycarbonate cage with sterilized softwood chips as bedding in a barrier-sustained animal room maintained at 23–25°C and 50–60% humidity with a 12 h light/dark cycle. ICGN and young and adult ICR mice were randomly divided into 4 groups. Each group consisted of 6 ICGN mice or 10 ICR mice. Due to the difficulty of obtaining neonatal ICGN mice, the number of ICGN mice used in the present study was lower than the number of ICR mice. Animals were administered 0 (control), 4, 8, or 16 ppm NIV mixed in powdered diet for 4 weeks. The diet and drinking water were given The animals were checked daily for clinical signs and mortality. Body weights were measured weekly, and all mice were checked weekly for proteinurea using test strips (Uropaper ΙΙΙ , Eiken Chemical Co., Ltd., Tochigi, Japan). Food intake was weighed weekly, and the NIV intake was calculated. At the end of the experiment, all of the animals were deeply anesthetized, blood samples were collected from the abdominal vein, and the animals were euthanized. The serum, obtained from centrifugation of the blood at 3,000 ppm, was stored until serum biochemical analysis. The left and right kidneys were removed, weighed and sectioned to provide central slices including the pelvis, and the slices were fixed with 10% neutral buffered formalin for histopathological and immunohistochemical examination. The remainder of the kidney tissue was fresh frozen with liquid nitrogen and stored at –80˚C until used for immunofluorescent assessment. The kidney slices fixed in 10% buffered formalin were routinely embedded in paraffin and were stained with hematoxylin and eosin and Periodic acid-Schiff (PAS) stains. To detect damage of mesangial areas by NIV, the number of glomeruli showing mesangial expansion was counted in the cross sections for bilateral kidneys using PAS sections, and the percentage of affected glomeruli per animal was calculated. Since mesangial expansion was observed in the glomeruli of ICGN mice, proliferative and activated mesangial cells were evaluated by immunohistochemical analysis. Formalin-fixed, paraffin-embedded renal sections were treated with 0.3% HO in absolute methanol after heating in instant antigen-retrieval agent H (neutral) (Mitsubishi Chemical Medience Corporation, Tokyo, Japan) at 90˚C for 10 minutes. The sections were incubated with a mouse anti-human smooth muscle actin (α-SMA) monoclonal antibody (clone 1A4, ×100 dilution; Dako Japan, Tokyo, Japan), a marker of activated mesangial cells, or anti-proliferating cell nuclear antigen (PCNA) monoclonal antibody (clone PC10, ×100 dilution; Dako Japan, Tokyo, Japan) at 4°C overnight. Immunodetection was carried out with Histofine® Simple Stain MAX PO (MULTI) (Nichirei Biosciences Inc., Tokyo, Japan) and was visualized with 3,3’-diaminobenzidine as the chromogen. To evaluate activated mesangial cells, the number of glomeruli showing α-SMA-positive mesangial areas was counted in the bilateral kidneys (81–124 glomeruli in ICGN mice and 130–231 glomeruli in 8-week-old ICR mice), and the ratios of glomeruli with α-SMA-positive mesangial areas to all glomeruli were analyzed. Variances in the data for body and kidney weight, serum biochemistry, serum IgA concentration, level of proteinuria, and percentage of glomeruli with α-SMA-positive mesangial cells were checked for homogeneity by Bartlett’s procedure. If the variance was homogeneous, the data were assessed by one-way analysis of variance. If not, the Kruskal-Wallis test was applied. When statistically significant differences were indicated, the Dunnett multiple comparison test was employed for comparison between the control and treatment groups. For histopathological changes, incidences were compared using the Fisher exact probability test, and severity was analyzed with the Mann-Whitney -test. Final body and kidney weights are shown in . ICGN mice had lower final body weights and absolute kidney weights than ICR mice at the same age. For ICGN mice, no significant differences in final body weight and kidney weight between control and treated groups were observed. In the 16 ppm NIV group of ICGN mice, a tendency towards a decreased final body weight was observed. For ICR mice, there was a significant decrease in final body weight in the infant 16 ppm NIV group, while there was no significant difference between controls and NIV-treated groups in adult ICR mice. Mean food consumption and intake of NIV are shown in . Mean daily food consumption decreased in the 16 ppm NIV groups for each strain and generation. Mean daily NIV intake almost doubled within strains and generations of mice as the dose increased. In the serum biochemistry, significant decreases in blood urea nitrogen (BUN) levels in the 16 ppm group of ICGN mice and in creatinine levels (CRN) in the 16 ppm group of infant ICR mice and 8 ppm group of adult ICR mice were observed compared with the corresponding controls (). The serum biochemical data of the ICGN mice did not show significant differences from controls or infant ICR mice. Other serum biochemistry parameters did not show any significant changes except for an increase in Alb in the 16 ppm NIV group of adult ICR mice. The concentration of IgA in the serum tended to increase, but there was no significant difference between controls and NIV-treated groups in ICGN mice (). In infant ICR mice, the serum IgA concentration in the 16 ppm group increased significantly, while there were no changes after NIV treatment in adult ICR mice. In all of the ICGN mice, the levels of proteinuria were higher than in age-matched ICR mice, indicating onset of proteinuria in infant ICGN mice (). However, the levels of proteinuria did not rise with NIV treatment in any strain or generation. Histopathologically, a thickened basement membrane, mesangial expansion, and microaneurysm were observed in the glomeruli of all ICGN mice groups including controls (). The thickened glomerular basement membrane was observed diffusely in the kidneys of ICGN mice. The number of glomeruli with mesangial expansion tended to increase in NIV-treated groups, but there was no statistically significant difference (). Microaneurysms in the glomeruli and urinary casts in the distal tubules were also observed, but NIV treatment did not enhance these lesions in ICGN mice (data not shown). In ICGN mice, mesangial cells of the expanded mesangial area were positive for α-SMA (), and the number of glomeruli with α-SMA-positive mesangial cells increased in the 16 ppm NIV group without statistical significance (). In the expanded mesangial area of ICGN mice, PCNA-positive mesangial cells were not observed in any of the glomeruli (). Mild to severe mesangial expansion was observed in 1.21% of the total glomeruli of the bilateral renal tissue sections in the 16 ppm NIV group of adult ICR mice () compared to 0.23% in the control group (). No change in the mesangium was observed in lower-dose adult groups or any treated infant ICR mouse groups (a, b, and c). A small amount of granular deposition of IgA in the glomeruli was detected at the glomerular basement membrane and mesangial area in all of the ICGN mouse groups including controls. The level and localization of IgA deposition did not show any differences between the control and NIV-treated groups (). In infant and adult ICR mice, IgA deposition was observed in the glomerular basement membrane and mesangial area in all groups including controls (). The level and localization of IgA deposition were almost the same regardless of age or NIV-treatment. Compared with ICGN mice, the level of glomerular IgA deposition was lower in infant ICR mice at the same age. In the present study, the effects of NIV on the kidneys of infant mice were evaluated, and some changes were detected in ICGN mice. In adult ICGN mice, genetic glomerular lesions including a thickened glomerular basement membrane, focal or diffuse mesangial expansion without mesangial cell proliferation and microaneurysm were observed. Since 12 ppm NIV is known to induce IgA deposition in the mesangial area in normal C3H/HeN and C3H/HeJ mice, it would be expected that IgA deposition by NIV might induce additional mesangial lesions such as mesangial damage/proliferation and progressive matrix production in the mesangial area of ICGN mice. However, such noticeable effects were not detected in the glomeruli of NIV-treated infant ICGN mice in the present study, except for an increased number of glomeruli with α-SMA-positive mesangial cells. Four weeks of treatment with 24 ppm NIV was reported to increase the serum IgA level and IgA deposition in the glomeruli of female BALB/c mice, yet the same treatment did not enhance immunoglobulin deposition in the glomeruli of high IgA strain (HIGA) mice. However, NIV did not induce or enhance glomerular lesions, such as mesangial expansion, in either BALB/c or HIGA mice in the reported study. It was also reported that deoxynivalenol, another trichothecene mycotoxin, increased levels of serum IgA, circulating IgA immune complexes, mesangial IgA deposition, and hematuria without significant mesangial lesions in mice. Based on the results of the present and reported studies, treatment with NIV for 4 weeks might be insufficient to induce aggravation of genetic glomerular lesions or obvious histopathological changes in the glomeruli and other renal components in ICGN mice. In particular, the highest dose of NIV was 16 ppm in the present study, which was lower than the 24 ppm dose used in previous studies. Therefore, the doses in the present study might be insufficient to induce or exacerbate glomerular lesions in ICGN mice. In the present study (), NIV treatment with ICR mice led to increases in the serum IgA concentration in infants and mesangial expansion in adults in the 16 ppm groups. Unexpectedly, no glomerular changes were observed in infant animals compared with adult animals. This result indicates that the histopathological sensitivity to NIV might be weaker in infant mice than in adult animals. However, in adults, the percentage of glomeruli with mesangial expansion was very low (1.21%). Similar to C3H/HeN and C3H/HeJ mice, the observed effects of NIV in adult ICR mice in the present study were mild. Therefore, the effect of NIV on the kidneys of adult ICR mice might be generally mild. In addition, it was reported that the sensitivity of kidneys to toxic chemicals shows strain differences. Treatment with 10 mg/kg body weight of Adriamycin (ADR) induced severe proteinuria in BALB/c mice, while the same dose of ADR did not induce proteinuria in C57BL/6 mice. Therefore, ICR mice could potentially be a resistant strain to the effect of NIV. A further factor regarding weak NIV effects in ICR mice may be the NIV concentration in the diet. Although the cause of the decreased concentration of NIV in the prepared diet could not be identified, the variation of NIV concentration in the diet might also be a cause for reduced NIV toxicity. In humans, IgA nephropathy (IgAN) is defined as chronic glomerulonephritis accompanied with mesangial proliferation, expansion of the extracellular matrix, and granular IgA deposition in the mesangial area. Recently, it was shown that circulating immune complexes containing aberrantly glycosylated IgA1 play a pivotal role in the pathogenesis of human IgAN. Although an increase in serum IgA concentration in infant mice and deposition of IgA in the glomeruli of all treated mice were observed in the present study, mesangial lesions were not prominent. Circulating IgA without aberrant glycosylation and insufficient deposition of IgA to the mesangial area might be related to the lower incidence and severity of mesangial lesions observed in NIV-treated mice. In conclusion, detailed analyses of the glomeruli did not provide clear evidence that diseased or healthy infant mice were toxicologically sensitive to NIV under the present experimental conditions. Human infants face a risk of exposure to nephrotoxins in their daily food intake, including mycotoxins. Further studies are needed to investigate the validity of the ICGN mouse model and to develop other suitable animal models for infant renal toxicity studies.

In general, hypoxia within tumor tissues plays a significant negative role in the treatment of malignant neoplasms, because the angiogenesis, evasion of apoptosis and increased glycolytic rate are all adaptations made by tumors in the hypoxic microenvironment. To improve therapeutic efficacy, recent efforts have been concentrated on the concept of eliminating the hypoxic state of tumors in order to remove the driving force behind these adaptations. Hyperbaric oxygen (HBO) therapy has been considered to control the hypoxia of the tumor microenvironment and possibly improve treatment outcome. HBO therapy refers to breathing pure (100%) oxygen under increased atmospheric pressure. This potential capacity is believed to reflect an increase O level in tumor cells and conquer hypoxic situation by increased amount of dissolved oxygen in the tissue. HBO may elevate blood levels of active oxygen, which would generate free radicals and cause cellular DNA damage in tissues. However, the effect of utilizing HBO for cancer treatments has not been clarified yet. HBO has been reported to increase tumor radiosensitivity both in basic and clinical studies. HBO has been used as combination treatment with chemotherapy and radiation therapy for malignant tumors. In our University Hospital, HBO therapy has been used for wound healing, recovery of radiation-injured tissues and cancer treatment in neurosurgery and radiation oncology. However, many clinicians and researchers do not yet recognize HBO therapy as an effective mechanism of cancer treatment. It still remains controversial in cancer treatment. Therefore, the role and modifying mode of HBO with regard to tumors need to be analyzed. In this study, we examined the modification effects on tumors developed under an HBO environment in skin two-stage chemical carcinogenesis using 7,12-dimethylbenz[a]anthracene (DMBA) and 12-O-tetradecanoylphorbol-13-acetate (TPA). A total of 51 six-week-old inbred CD-1 female mice (Japan SLC, Hamamatsu, Japan) were housed in cages with access freely to pelleted diet (CE-2, CLEA Japan, Inc., Japan) and drinking water and exposed to a 12-hour light-dark cycle during the experimental period. Mice were divided into the following five groups: group 1, normoxia and DMBA/TPA (n=19); group 2, HBO and DMBA/TPA (n=21); group 3, HBO and DMBA/acetone (n=3); group 4, normoxia and acetone (n=3); and group 5, non-treatment group (n=5) (). Animal care and experiments were approved by the University of the Ryukyus Animal Ethics Committee and carried out in accordance with the guidelines for animal experimentation of the University of the Ryukyus. For two-stage chemical carcinogenesis, the dorsal skin of mice was shaved using surgical clippers. After a 1-week quarantine period, 25 nmol DMBA (Sigma-Aldrich, St. Louis, MO, USA) dissolved in 0.2 ml acetone per mouse was topically applied to mice once except in group 5. After 2 weeks, we began twice-weekly applications of 8.5 nmol TPA (EMD Chemicals, San Diego, CA, USA) in 0.2 ml acetone per mouse in groups 1 and 2 (), and this was continued until the end of the experiment. Acetone was applied to mice in groups 3 and 4 instead of TPA. After DMBA was applied, mice in groups 2 and 3 were placed in a hyperbaric chamber (Barotec Hanyuda Co., Ltd., Tokyo, Japan) to be exposed to HBO. HBO was administered at a pressure of 2.2 ATA (atmospheres absolute) for 90 minutes. A minimum of 15 minutes of pressurization and depressurization was allowed for animals to adjust to the changes in pressure. HBO was administered 5 days a week. Mice were euthanized under deep anesthesia at 23 weeks from the start of the experiment (). =4/3π (a)(b), where (a) is the minor and (b) is the major axis (mm) of the tumor. Histopathologically, the skin tumors in groups 1 and 2 that were larger than 3.5 mm in diameter were examined by hematoxylin and eosin (HE) staining. According to the criteria of Conti , papillomas were judged based on two categories: low-grade papilloma, which is a well-differentiated hyperplastic lesion with no atypical cells or with very few atypical cells in the basal layer, and high-grade papilloma, which is a lesion with more than two-thirds of the thickness of the epithelium occupied by atypical cells. For inflammation, the induced inflammation state was divided into persistent and active; persistent: it appears almost lymphocyte infiltration in tumoral stroma with slightly edema; active: it appears predominantly neutrophil infiltration with lymphocytes in tumoral stroma, with increased and dilated vessels. In order to measure cell proliferation in the skin tumor, the Ki-67 labeling index (LI) was determined. Immunohistochemical staining was performed as described in our previous study. The embedded tissues were cut into 4-μm sections and then stained using anti-Ki-67 antibody (Dako, Carpinteria, CA, USA) and an LSAB Kit (Dako). Five hot spots within each tumor were selected, and the number of positive cells (dense brown precipitate restricted to the nuclei) in 500 cells for each tumor was counted to determine the Ki-67 LI, which was defined as the proportion of positive cells. The histopathological diagnosis and Ki-67 LI evaluation were confirmed by multiple pathologists. Data obtained in this study are presented as means ± SEM (standard error of the mean). We used InStat (GraphPad Software, La Jolla, CA, USA) for data analysis. Welch’s test or the -test was used to determine the significance of differences between groups. values of <0.05 were considered significant. All mice survived throughout the experimental period. There were no significant differences in the initial or final body weights between mice in all groups. The appearance of tumors in group 2 occurred at 8 weeks after the beginning of the experiment, whereas they began to appear in group 1 at 9 weeks. At 12 weeks, the incidences of tumors in groups 1 and 2 were 20% and 38%, respectively (). Ten of 19 mice in group 1 and 14 of 21 mice in group 2 had macroscopic tumors on the surface of dorsal skin at the end of the experiment ( and ). Final incidences of tumors in groups 1 and 2 were 53% and 67%, respectively (). The final multiplicities of tumors in groups 1 and 2 were 3.30 ± 0.87 and 3.35 ± 0.64, respectively (). There were no significant differences in tumor incidence and multiplicity between groups 1 and 2. Although the average volume (21.75 ± 9.03 mm) of tumors in group 2 was greater than that in group 1 (13.81 ± 4.63 mm), there was no significant difference between these groups (). No effects on the skin were observed in groups 3, 4 and 5. In addition, none of the other organs were affected by HBO in any group. Histopathologically, the skin tumors larger than 3.5 mm in diameter in group 1 included 11 low-grade papillomas, 1 high-grade papilloma and 1 basal cell carcinoma (BCC), while there were 6 low-grade papillomas, 12 high-grade papillomas, 4 squamous cell carcinomas (SCCs) and 1 keratoacanthoma (KA) in group 2 (). There was the difference in the occurrence of tumors showing low-grade and high-grade papillomas and SCCs between these groups according to the -test (<0.05, ). Compared with the stromal inflammation reactions of the tumors in group 1, those in group 2 tended to be more associated with leukocyte infiltration and edema in the stroma, without statistical significance (). Concerning the effect of HBO on cell proliferation, the Ki-67 LI was analyzed in groups 1 and 2. The Ki-67 LIs for low-grade papilloma, high-grade papilloma, SCC, BCC and KA are summarized in . The Ki-67 LIs for low-grade papilloma in groups 1 and 2 were 15.27 ± 2.54% and 29.67 ± 2.82%, respectively, and there was a significant difference in Ki-67 LI for low-grade papillomas between groups 1 and 2 according to the Welch’s test (<0.01). However, there was no significant difference in the Ki-67 LI for high-grade papillomas between these two groups. To the best of our knowledge, this study is the first report to examine an effect of HBO on a mouse skin two-stage chemical carcinogenesis model . We tried to compare the tumorigenesis and proliferative state in the chemical carcinogenesis model between HBO and normoxia groups. In the past, many similar experiments were performed to culture cells but there were a few studies . In the clinical study of advanced epithelial tumors of the head and neck, treatment with HBO markedly suppressed local tumor growth and significantly suppressed remote metastasis of a tumor to the lung. HBO has been applied to clinical practice; however, the effect of HBO on tumors has not been clarified. HBO therapy has been used in clinical medicine in combination with radiotherapy or chemotherapy for cancer treatment, but no obvious answer has been reported concerning the efficacy of HBO alone against tumors. In this study, the experiment was designed to examine the effect on tumor cells actually in an environment similar to a living body in a mouse chemical carcinogenesis model. The results showed that the tumor volume in group 2 was greatly increased compared with that of group 1; that is, HBO hastened the growth of tumors, although there was no statistical difference ( and ). Pande also reported a similar result, i.e., there was accelerated growth and progression of tumors after HBO therapy. Furthermore, McMillan . reported that HBO appears to have a stimulatory effect during the proliferative phase of carcinoma in hamster cheek pouch carcinogenesis. Histopathologically, the appearance of the tumors in group 2 was more progressive or aggressive than that in group 1 (). This suggested that the HBO treatment under the present conditions had a proliferative and aggressive affect on tumor cells. We also found that the cell proliferation of low-grade papillomas in group 2 with HBO was higher than that in group 1 without HBO, although there was no statistical difference in cell proliferation of high-grade papillomas between groups 1 and 2 ( and ). It seems that HBO influences cell growth. Generally, HBO is often used in combination with radiation therapy. The combination of HBO and radiation therapy is particularly effective for local tumor control according to the results of a trial of the British Medical Research Council. The effectiveness of the combination of chemotherapy and HBO has also been reported by Stuhr and Kalns .. The results of the present study, which showed that HBO increased the Ki-67 LI in tumor cells, confirm their conclusions concerning one of mechanisms of HBO effectiveness in the combination therapy by irradiation against cancers, because irradiation is much effective to mitotic cells (Ki-67-positive cells). Additionally, HBO is known to induce DNA damage in humans and experimental animals. In the present study, there is a possibility that the oxidative stress resulting from HBO therapy influenced the initiation phase in tumorigenesis, but it is complex to distinguish the DNA damage in lesions affected with HBO from those by DMBA and TPA used in this model. Further studies are needed. In conclusion, we found that the HBO accelerated tumor development and enhanced tumor growth in a mouse skin chemical carcinogenesis model. Since there are several inconsistent reports regarding the effect of HBO, further investigations about the combined effect of HBO with radiotherapy or chemotherapy on tumor development are necessary.

Ricin, a powerful cytotoxic protein derived from the seeds of the castor oil plant, consists of two polypeptide chains named ricin toxin A chain (RTA) and ricin toxin B chain (RTB) linked via a disulfide bridge. RTB mediates the binding to glycolipids or glycoproteins on the cell surface via its lectin receptors, followed by endocytic uptake into the cell. After endocytosis, ricin is transported retrogradely from endosomes to the Golgi and further on to the endoplasmic reticulum (ER), which is its unique trafficking pathway in the cell. As a potent toxin, ricin kills eukaryotic cells by inhibiting protein synthesis, inducing serious intoxication symptoms in poisoned people. Both antibodies and competitive ligands have been used to intervene in the binding of the toxin to cells. The morbidity and mortality of ricin is dependent upon the route of exposure. When ingested, ricin causes severe gastrointestinal symptoms followed by gastrointestinal hemorrhage with hepatic, splenic and renal necrosis. There is a latent period of more than 8 hours post ingestion after oral exposure before the symptoms of poisoning are observed in animal models. Research into antitoxins against ricin poisoning has attracted wide attention, including prophylactic and therapeutic strategies. More in-depth research on the trafficking and toxicity of ricin in animals is expected to shed light on its toxic mechanism and even contribute to prophylactic agent design and prediction of the therapeutic window for specific antidotes. In this paper, we aimed to investigate the absorption and distribution process of ricin and to analyze the pathologic injury to mice during toxic symptom latency. In order to evaluate the intestinal absorption process in mice after ingestion of ricin, Caco-2 cells were used to establish a monolayer cell model to determine the absorption and transformation. For a better understanding of ricin absorption, we also used the everted intestinal sac model to validate the uptake route of ricin from the gastrointestinal tract in Wistar rats. The cytotoxicity of ricin in Caco-2, HepG 2, H1299 and MDCK cells was determined to compare their sensitivity to ricin poisoning. The distribution of ricin in different tissues of mice intoxicated at different time points was determined by immunohistochemistry. So the monolayer cell model, the isolated and reverted intestine, and the mouse ingested model were used to analyze the absorption process of ricin. It will be helpful to explain the absorption, distribution and even intoxication of animals poisoned along the alimentary tract with reference to the results of pathological changes in the liver, kidney, lung, spleen and intestine induced by ricin. The ricin used in this study was supplied by the Laboratory of Toxicant Analysis, Beijing Institute of Pharmacology and Toxicology. Human non-small lung cancer cell line H1299, human colon carcinoma cell line Caco-2, human hepatocellular liver carcinoma cell line HepG 2 and Madin-Darby canine kidney (MDCK) cells were obtained from the American Type Culture Collection (ATCC). Mouse ascites containing monoclonal antibodies (Mab 4C13 and Mab 3D74) were produced in the Beijing Institute of Basic Medical Sciences. The antibodies were purified using protein G sepharose 4 Fast Flow (Amersham), and Mab 4C13 was labeled with horseradish peroxidase (HRP) in our laboratory. Female CD1 mice and Wistar rats were supplied by Vital River Laboratory Animal Technology Co., Ltd. (SCXK [Jing] 2012-0001). They were housed in a controlled environment (21 ± 2°C; 55 ± 5% humidity; 12 h dark and light cycle with light provided between 6 am and 6 pm). Food and water were given . All the animal experiments were carried out in the Beijing Center for Drug Safety Evaluation and in accordance with a protocol approved by the Institutional Animal Care and Use Committee of the Center,which is in compliance with the guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC). Cells were cultured in a MEM/EBSS medium supplemented with fetal bovine serum (FBS, GIBCO, 20% for Caco-2 cells and 10% for HepG 2, H1299 and MDCK cells), 1% nonessential amino acids, 100 units/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in the presence of 5% CO. Cells were subcultured when they reached approximately 80% confluence. First of all, Caco-2, HepG 2, H1299 and MDCK cells were seeded in 96-well cell culture plates at a density of 1×10 cells/well in complete medium supplemented with 20% or 10% FBS. After incubation, the cells were washed with serum-free medium and cultured with different concentrations of ricin (1, 10, 100 and 1000 ng/ml) diluted with serum-free medium. Cells cultured with 0 ng/ml of ricin were used as the normal control. At the designated time point (0.5, 1, 3, 6, 24 and 48 h), 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was added to each well. After 4 hours of incubation at 37°C, 150 µL dimethyl sulfoxide (DMSO) was added to dissolve formazan crystals completely for about 15 minutes at room temperature after the medium was removed. Absorbance at 490 nm was measured with a micro-ELISA reader (Varioskan Flash version 2.4.3, Thermo Scientific, Waltham, MA, USA). The optical density of samples without ricin (cells only) was set at 100%. The viability ratio of cells treated with ricin was calculated as: Viability ratio = A490/A490. Caco-2 cells were seeded in polycarbonate inserts with a pore diameter of 0.4 μm (24-well Millicell® Hanging Cell Culture Inserts, Millipore, Darmstadt, Germany) at a density of 3×10 cells/well in complete medium supplemented with 20% FBS. The media volumes were 0.45 ml and 0.6 ml in the apical (AP) and basolateral (BL) compartments, respectively. The media on both sides was replaced every other day. The cells were cultured in an incubator at 37°C with 5% CO and allowed to differentiate for 21 days. The baseline transepithelial electrical resistance (TEER) value of the inserts was more than 550 Ω/cm, representing good monolayer integrity. Media on both sides of the compartments were aspirated, and the compartments were washed twice with Hanks balanced salt solution (HBSS, NaCl 136.9 mM; KCl 5.4 mM; NaHPO·HO 0.3 mM; Hepes Free Acid 25.2 mM; pH 7.2–7.4). The cells were incubated in HBSS at 37°C for 20 min in order to balance their internal environment, and 0.35 ml aliquots of 0, 1, 10, 100, 1000 and 10,000 ng/ml of ricin in HBSS were added to AP compartments; 1.4 ml HBSS aliquots were added to BL compartments. We also added 0, 100 and 10,000 ng/ml of ricin in HBSS into AP compartments without Caco-2 cell culturing to see whether ricin could permeate the well base directly. At different time points (15, 30, 60, 90, 120 and 180 min) after ricin administration, 120 µL samples from the BL compartment were transferred to conical centrifuge tubes, and the same volume of fresh HBSS buffer was added to the compartment. At the end of the experiment, all the remaining samples were removed. All samples collected were stored at –20°C until they were analyzed by sandwich enzyme-linked immunosorbent assay (ELISA). After 12 h of fasting, female rats weighing 200–250 g were anesthetized with an overdose of ether and euthanized. The duodenum, jejunum, ileum and colon segments were removed and washed with Kreb’s solution (118.0 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl, 25.0 mM NaHCO, 1.2 mM KHPO, 1.2 mM MgSO, 11.1 mM glucose). The soft end of a homemade silicone casing tied around the end of a plastic cannula was put into the intestine with silk thread ligaturing, and the intestine was flipped carefully before the inside intestine was washed with the Kreb’s solution. The everted part was cut into 5 cm segments. The other end of the intestine was closed by ligature. The intestinal sac was then immersed into a Maxwell bath tube filled with 60 ml of 10 μg/ml ricin in Kreb’s solution at 37°C and supplied with mixed gas containing 95% O and 5% CO. Two milliliters of Kreb’s solution was injected into the intestine to balance for 5 min. Sample aliquots (22 μl) were removed from the intestinal sac at the time points of 15, 30, 45, 60, 90, 120, 150 and 180 min, respectively, and an equal volume of Kreb’s solution was replenished after each sampling. The removed samples were stored at –20°C until measurement by ELISA. ELISA was performed as described previously. Different epitopes could be recognized by Mab 3D74 and Mab 4C13. We used Mab 3D74 and Mab 4C13 labeled with HRP to establish the ELISA for ricin detection. Ricin could be captured by Mab 3D74 coated on enzyme immunoassay (EIA) plates (96-well, Costar) and then detected by HRP-labeled Mab 4C13 with the sensitivity limit of 2.5 ng/ml ricin in PBST, serum and water. Briefly, the plates (96-well, Costar) were coated with Mab 3D74 (400 ng/well) and then incubated with samples before HRP-labeled 4C13 was added. Ricin was detected by measuring the activity of HRP conjugated to 4C13 colorized with tetramethylbenzidine (TMB) substrate. Female CD1 mice (body weight 20 to 22 g) were used for the experiment. After 12 h of fasting, animals were intragastrically administered ricin at a dose of 0.1 mg/kg of body weight. The ricin was diluted with saline to a concentration of 0.01 mg/ml. The intoxicated mice received 0.1 ml of ricin/10 g body weight. Mice in the control group (n=4) were intragastrically administered saline. At the designated time points (1, 3 and 6 h) postexposure, the plasma samples were separated, and the nephrotoxicity and hepatotoxicity related to biochemical indicators were detected by a biochemical analyzer (Hitachi 7180) at the National Beijing Center for Drug Safety Evaluation and Research. Proximal small intestine, liver, spleen, lung, and kidney samples were dissected out and fixed in 10% formalin. The proximal small intestine, liver, spleen, lung and kidney were fixed in 10% formalin for 24 h prior to processing and paraffin embedding. Sections 3 μm thick were prepared and analyzed by immunohistochemistry. Monoclonal antibody 4C13 has been used to immunoprecipitate ricin or RTA in the tissues of poisoned mice and to analyze the toxin in detoxified meal of castor beans by Western blotting. For analysis of ricin, sections were prepared and analyzed by immunohistochemistry using Histostain-Plus Kits (Zymed Laboratories, San Francisco, CA, USA), Mab 4C13 (1 μg/ml) and the peroxidase-conjugated goat anti-mouse IgG (1/1000, Wuhan Boster Biological Technology, Ltd., Wuhan, China). Tissue processing, embedding, sectioning and staining were performed at SOONBIO Technology Corporation. Tissue samples of the proximal small intestine, liver, spleen, lungs and kidneys were dissected out and fixed in 10% formalin. Sections 3 μm thick were prepared and stained with hematoxylin and eosin. Microscopic observation was performed under a Leica DMI3000 B fluorescence microscope, and photographs were taken using Leica Application Suite V3. The cytotoxicity induced by ricin in Caco-2, HepG 2, H1299 and MDCK cells was determined by MTT assay (). Cells were treated with serial dilutions of ricin for different lengths of time. The results indicated that there was little change in the survival rate of Caco-2 cells when they were treated with ricin for 0.5 to 6 h. However, the survival rate decreased significantly when cells were treated with the toxin for 24 h and 48 h. The survival rate decreased to between 60% and 70% when cells were treated with 1 μg/ml of ricin for 24 h and 48 h. The cells treated with 1 to 1000 ng/ml of ricin exhibited almost the same survival levels, indicating that 1 ng/ml ricin could reach the highest level of cytotoxicity. Compared with Caco-2 cells, HepG 2, H1299 and MDCK cells exhibited high sensitivities to ricin. After treatment with 10 ng/ml of ricin for 48 h, 60% of Caco-2 cells, 50% of HepG 2 cells, 25% of H1299 cells and 13% of MDCK cells survived. Ricin can be taken up by endocytosis. It is unknown whether ricin can transfer through the intestinal epithelium via the paracellular route. We used Caco-2 monolayers to represent the intestinal epithelium and collected the samples from the BL compartments for ricin determination by ELISA. When 100 ng/ml of ricin was directly loaded into a cell-free insert, about 1 ng/ml of ricin, which was lower than the limit of detection, was detected in samples from the BL compartments. However, when 10 μg/ml of ricin was loaded, the signal of ricin transportation across the insert base was significantly increased (). These data indicated that ricin could be well absorbed by the polycarbonate insert, which would decrease the concentration of ricin in the BL compartment, especially when a low concentration of ricin was loaded. However, when we loaded 10 μg/ml of ricin on Caco-2 cell monolayers, no ricin was measured in the BL compartment even at 180 minutes postexposure (). The everted intestine sac model has been well used in the research of drug absorption and metabolism. We established an intestine sac model to determine the ricin in the internal sac after the everted intestine was immersed in a high concentration of ricin for different lengths of time. The results in showed that ricin could pass through the everted intestine within 1 h. The main sections were the jejunum and ileum. We have mentioned that ricin could not pass through monolayer Caco-2 cells even at the high concentration of 10 μg/ml (). In this experiment, when the intestine sac was immersed in the same concentration of ricin, the toxin could be detected in the opposite part of the intestine wall, indicating that the toxin could not be transferred through the intestine wall through cells directly but could be transferred through the blood vessels, which was not distributed in the monolayer cell model. When ricin is administrated intragastrically, it should be absorbed into the blood circulation and then distributed in different tissues of organs. The intestine must be the main tissue for its absorption along the alimentary tract, but what we need to find out is whether it is the main section for toxin distribution and how fast it accumulates in important organs. We gave mice a lethal dose of ricin and collected the lungs, liver, kidneys, spleen and proximal small intestine to examine the toxin with a specific antibody against ricin by immunohistochemistry (). The results showed that ricin could penetrate into the lung, liver, kidney and spleen quickly through the blood circulation. Ricin could be colorized in these tissues at even 1 h after intoxication. In the intestine samples of mice intoxicated for 1, 3 or 6 h, only slightly tinted brown spots were found, and at 24 h, a large number of dark brown spots appeared. It seems that ricin enters intestine cells slowly even if the intestine is the major tissue exposed to ricin via alimentary intoxication. As shown in , apparent injury to the liver and kidneys of poisoned mice was observed as early as 1 h after toxin treatment. The liver cells were considerably swollen, with their structures damaged and the density different from normal after poisoning for 1, 3, 6 or 24 h. The renal glomerulus showed hemorrhage, and some endothelial cells of vessels of the kidneys were absent. The renal pelvis was bleeding, and edema was observed in renal tubule cells. These symptoms deteriorated with the passage of time. In the spleen, widespread hemorrhage was found. However, there were few lesions in the proximal small intestine compared with the toxic changes in the kidneys. We have mentioned that kidney cells might be more sensitive to ricin than intestine cells. This result was also concordant with the distribution of ricin in different tissues of mice after ricin poisoning. At 24 h after poisoning, the mice developed a mild to moderate necrotizing pneumonia, with slight interstitial edema and diffuse perivascular inflammation. At 3 h after ricin intoxication, the serum samples of mice were examined to evaluate nephrotoxicity and hepatotoxicity. The results in summarize some of the related parameters in blood. At 3 h after ricin treatment, the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher than those of the control, being consistent with the results of rats poisoned with ricin reported by Balint. His results indicated that the serum ALT and AST values were significantly increased compared with the control after 24 h ricin exposure by the i.p. route. The elevated creatinine (CREA) level indicated the decline of the glomerular filtration rate, and the high creatine kinase activity (CK) suggested the possibility of myocardiolysis induced by ricin poisoning. A preliminary study of Kumar . revealed the same hepatotoxicity and nephrotoxicity in mice at 24 h post ricin via i.p. treatment. Whether the decreased level of BUN was related to the inhibition of protein synthesis and metabolism requires the further investigation. Ricin has the potential to be one of the most used toxins by terrorists. Basically, the clinical syndrome resulting from ricin poisoning is dependent on the route of exposure. It is generally believed that aerosolized ricin is the most lethal route of exposure. Certainly the oral and injection routes can also pose a significant risk to humans. The obvious symptoms of ricin poisoning do not appear for hours, but gastrointestinal bleeding, liver necrosis, diffuse nephritis and diffuse splenitis would be likely to emerge systemically after the latency period. In this study, we determined the cytotoxicity of ricin in Caco-2, HepG 2, H1299 and MDCK cells. The results indicated that MDCK and H1299 cells were more sensitive to ricin exposure, and this could be due to the glycoprotein or glycolipids on the surface of cells, which facilitate the entry of ricin, and the P-glycoprotein expression on the cell membrane, which could pump ricin out of cells. Our results showed that ricin could pass through the everted intestinal sac and be quickly transmitted to the liver, kidneys, spleen and lungs of mice intoxicated by gastric gavage . However, no ricin transmission was determined through Caco-2 cell monolayers. Previous research showed that the major disadvantage of Caco-2 cells was their low transportation rate. This research showed that Caco-2 cells were generally 20–40 times less permeable than cells of the normal human colon and 6–100 times less permeable than cells from the rat intestine. We presumed that the ricin transported through tight junctions and exocytosis from cells was absorbed by the basement membrane of the polycarbonate insert. Although the Caco-2 cell monolayer has been widely used to evaluate the transport of small molecules across the intestinal barrier, the absorption of compounds by the insert should be taken into consideration when bigger molecules, like proteins, are evaluated. Mantis . determined the effect of reducing RTA with IgA Mabs on the transepithelial transportation of ricin. In their research, MDCK II cells were used to establish monolayers, and the transport of biotinylated ricin was measured at 18 h after intoxication. In our research, we observed that after being cultured in serum-free medium for more than 4 h, the tight junction of Caco-2 cells became noncohesive, providing a pathway for ricin transport. In order to examine the ricin transportation through the normal intestine, the experiments were carried out within 3 h of ricin treatment. It was interesting that ricin could quickly pass through the everted intestinal sac, indicating that the internalized ricin could be secreted by exocytosis because the cell junctions are very tight and represent only 0.1% of the surface area of the intestine. The results of the test in vivo also exposed the slow accumulation of ricin in the intestine compared with the ricin distribution in the liver, lungs and kidneys. The pathological assay showed that the liver and kidney were most damaged in the initial period of intoxication. This result could be partly evaluated by their abundant blood supply and responsibilities for metabolism and excretion of ricin. The sensitivity of different cells to ricin exposure should be considered. Previous research showed that ricin exerts its toxicity on many different cell types, making it impossible to pinpoint the exact cause of death. Our experiment indicated that intestine cells were not as sensitive as other tissue cells to ricin poisoning even though they were treated with the same concentration of toxin. This was also found in the experiment . Although the intestine was the first tissue intoxicated with ricin, by gastric gavage, the kidney exhibited injury at 1 h after intoxication, which appeared much faster than the damage to the intestine. It was previously reported that it took at least 6 h to traffic a significant amount of ricin from the mouse stomach to the blood stream. Indeed, the absorption and distribution of ricin depend on many factors. Some physiological factors, such as gastric emptying and intestinal transit, also influence absorption. Our results of immunohistochemistry showed that ricin began to accumulate in the liver, spleen, kidneys and lungs at only 1 h post exposure in accordance with the pathological damage observed. This result indicated that although there were no significant toxic symptoms within several hours post intoxication, some important tissues were being injured and that the injuries were progressing; these injuries appeared much earlier than diarrhea induced by the injury to the intestine. Attention must be paid to the impairment of the liver and kidneys even in the initial stage of poisoning, and necessary symptomatic treatment needs to be provided to humans afflicted with ricin intoxication.

G-quadruplexes (GQs) are noncanonical secondary structures formed from G-rich sequences of nucleic acids, and play important roles in the regulation of gene transcription and translation. Formation of GQs in a telomere region causes inhibition of telomerase activity with subsequent obsolescence and cell death.[] GQ structures are found in some promoters of oncogenes, such as c-MYC,[] BCL-2,[] c-KIT,[] K-ras,[] VEGF.[] Therefore, GQs could be a key therapeutic target for anticancer drugs. Quarfloxin, a GQ-stabilizing drug for the treatment of neuroendocrine/carcinoid tumors has reached phase II clinical trials.[] Recently, a novel translation activation function of GQs in 3′-untranslated regions (3’-UTR) of messenger RNAs was also presented.[] While the idea of GQ-stabilizing/-destabilizing compounds looks promising for switching genes on and off, it is critical to measure kinetics of GQ folding in solution for efficient drug design and high-throughput screening of drug candidates. Finding kinetic parameters can relate the GQ folding time scale with biological processes like replication and transcription. Up to now, the most common techniques for studying of GQ conformations include circular dichroism (CD),[] UV absorption at 295/297 nm,[] non-denaturing gel electrophoresis,[] fluorescence-based single molecule methods,[] nuclear magnetic resonance (NMR),[] surface plasmon resonance (SPR)[] and X-ray crystallography (XRC).[] However, standalone CD studies the conformational changes in anisotropic molecules and chiral super assemblies in equilibrium, and for fast interactions it measures thermodynamic constants only. NMR shows the DNAs conformational dynamic in solution with atomic resolution. XRC provides a static picture of a DNA conformation. Alternatively, fluorescence resonance energy transfer (FRET)[], [] measures the relative distance between fluorescent residues or labels and requires fluorescent labeling that may interfere with DNA dynamics and ligand binding. The main disadvantages of NMR techniques are a requirement for the high concentration of a sample (around millimolar range) and difficulties in performing a multiplex study. Other solution-based techniques do not provide direct information about the structure of a GQ, making it challenging to interpret the data. The main methods for measuring kinetics of DNA folding and affinity binding are stopped-flow (SF)[] and SPR,[] both of which have the capability of calculating rate and thermodynamic constants of DNA binding to big biomolecules. They have restrictions due to mixing dead-time and re-dissociation of reagents for SF as well as mass transport to and heterogeneity of the surface of a SPR chip. In this article, we demonstrate the power of kinetic capillary electrophoresis coupled on-line with mass spectrometry (KCE-MS) to monitor individual DNA conformers and revealing rate and equilibrium constants of GQ DNA folding upon the binding to potassium ions. This represents an important step in deciphering fast kinetics of DNA folding, in addition to establishing KCE-MS as a real-time method for studying DNA dynamics and screening DNA binding ligands. Conceptually, KCE-MS is defined as an electrophoretic separation of compounds, which interact inside a capillary column during electrophoresis and are detected by mass spectrometry. Usually, separated analytes are detected by UV-VIS absorption or laser-induced fluorescence (LIF). These detection modes can be problematic for screening of complex mixtures with multiple targets and ligands. Therefore, the ability to acquire accurate molecular mass and structural information about the analytes is highly desirable. Capillary electrophoresis was coupled with mass spectrometry (CE-MS) over twenty years ago, which significantly advanced the field of nucleic acid and bioanalytical chemistry.[] Here, we connect KCE with MS on-line by electrospray ionization (ESI), a soft ionization technique, which keeps noncovalent complexes intact. It combines in one system the separation and kinetic capability of KCE together with molecular weight and structural elucidation of MS. The advantages of KCE-MS are that 1) DNA interacts with a ligand and folds at near physiological conditions, and all kinetic and thermodynamic parameters are measured in solution but not a gas phase; 2) DNA and ligands don′t need special labeling for the MS detection; and 3) interactions/foldings of several DNAs and ligands can be studied simultaneously in one capillary microreactor. KCE-MS implicates the benefits of both ion mobility, mass spectrometry and KCE-UV(LIF), where ion intensities, masses, electrophoretic mobilities and affinity of interacting compounds are determined. Ion mobility (IM) spectrometry separates ions on the basis of their collision cross section with a buffer gas. IM is fast and simple, and requires only a MS instrument with a drift cell. Nevertheless, the competitive binding, ion suppression during ionization and formation of nonspecific complexes in a gas phase could cause problems in interpretation of IM results. Fortunately, KCE can be coupled with IM directly, so that KCE separates interacting molecules based on their affinities and size-to-charge ratios in solution inside a capillary prior to the electrospray ionization (ESI), followed by IM separation in a gas phase and MS detection. KCE-based separation of GQ DNA involves two major processes. First, it includes the noncovalent interaction of an unfolded DNA (DNA) with a coordinating metal ion (M) leading to formation of a folded GQ complex (GQ-M) and dissociation of the complex regulated by a rate constant of complex formation () and a decay constant () []: Second, there is simultaneous separation of DNA, M, and GQ-M based on differences in their electrophoretic velocities in solution. These velocities are directly proportional to a size/charge ratio of DNA, M, and GQ-M. These two processes are described by the reaction scheme shown in and general system of partial differential : where [DNA], [M] and [GQ-M] are the concentrations of a unfolded DNA, metal ion, and a folded GQ–metal complex, respectively, , and are the migration velocities, , and are the diffusion coefficients, is the time, is the spatial coordinate along a capillary. Practically, a plug of an equilibrium mixture (EM) that consists of DNA, M, and GQ-M is injected into the capillary prefilled with the run buffer containing the metal ion with a total concentration identical to EM. Components of EM are separated by capillary electrophoresis while quasi-equilibrium is maintained between DNA, M and GQ-M complex inside the capillary (). This method is called equilibrium capillary electrophoresis of equilibrium mixtures (ECEEM).[] It is a mode of kinetic capillary electrophoresis (KCE), a platform for kinetic homogeneous affinity methods in which molecules interact with each other during electrophoretic separation.[] The unfolded DNA and folded GQ migrate with different velocities due to different shapes—GQ is more compact than unfolded DNA (), and thus migrates later than the unfolded DNA. There are three unique features of this separation: 1) DNA and GQ migrate as a single EM peak due to fast exchange between them, 2) the migration time of the EM peak depends on the concentration of M in the run buffer, so DNA sequences with different equilibrium folding constants, =/, migrate with different velocities and are separated from each other, and 3) EM peak broadening is dependent on the concentration of M, rate constants and characteristic separation time (). The characteristic separation time is the time required for DNA and GQ-M to separate from each other inside EM plug and is defined as []: where is the width of the initial EM peak. The general analytical solution of these nonlinear differential in partial derivatives is not known. In some cases like 1) the formation or decay rate constants are negligible or zero,[], [] 2) = or =, become linear directly or after the Cole–Hopf substitution.[], [] In our case, the molecular exchange between an unfolded DNA and a folded GQ-M complex is very fast. The relaxation time () to equilibrium for weak (>1 μ) and fast reactions depends on rate constants, DNA and M concentrations []: If >, the zones of DNA and GQ-M are separated before the re-equilibration in proceeds to a significant extent. Thus, unfolded DNA and folded GQ-M are moving as individual peaks. If ≈, re-equilibration in and separation proceed with comparable rates. Therefore, DNA and GQ-M are moving as two overlapping peaks. Finally, if <, the re-equilibration in occurs much faster than peak separation (our case), and, as a result, DNA and GQ-M will be moving as a single peak. The last case of fast molecular interactions is experimentally illustrated in . For the fast molecular exchange, when ≪ and [DNA]≪[M], the approximated is used: where is the velocity of the EM peak, is a physical diffusion coefficient for the EM peak and is a chemical induced coefficient of diffusion. They can be described as []: can be found from the expression: is well known in mathematics as Burgers’ equation and can be solved analytically if the injected EM plug is narrow (≪the length of capillary).[] The detailed mathematical solution is described in the Supporting Information. , , , are known, is found from . Afterward, is determined from , and =/. Interesting to note, ECEEM has a unique “accumulation” property. It accumulates the effect of molecular interactions in extra-long capillaries; it could reveal rates of extremely fast reactions, if >. We mixed 10 μ of GQ, forming a 15-nucleotide (nt) thrombin-binding aptamer (TBA) sequence (5′-d[GGTT GGTGTGGTTGG]-3′) with three mutated sequences (10 μ each, the flipped bases are italic), GM1 (d[GGTTGGTGTGGTG]), GM2 (d[GGTTGGTGGTGTG]), GM3 (d[GTGGGTG]) (equimolar mixture of GM1, GM2 and GM3 is labeled as GM), and separated in varying K concentrations from 10 μ to 2.5 m KCl in 12.5 m tris-acetate (TA) run buffer, pH 7.8. All DNA sequences have the same number of nucleotides and molecular mass (MW=4726.1 Da). As shown in , the GQ sequence is separated well from a mixture of mutated sequences upon increasing K concentration and visualized by UV () and MS detections (). Broadening of GQ peak has a bell-shaped curve, with a maximum width at approx. 150 μ of KCl, when fractions of unfolded DNA and GQ are equal (). Experiments carried out in the range of 15–450 μ of KCl, (0.1–3)×, provide the most confident results for finding rate and equilibrium constants. In this range, the EM contains both DNA and GQ in comparable amounts. Molecular diffusion can contribute to peak widening in a similar way as dynamic equilibrium between different DNA conformers. Moreover, in our case, the GQ peak became narrower with increasing migration time in experiments when [KCl]>500 μ—the phenomenon opposite to that could be caused by diffusion. Nevertheless, we found diffusion coefficients for GQ and GM by a CE method as described elsewhere.[] Briefly, we measured the change of GQ and GM peak widths with and without KCl. This was achieved by first moving an analyte in one direction to pass the UV detector and record the initial peak width. The analyte was then stopped to allow for its diffusion for 40 min. Finally, the analyte was moved back passing the detector for the second time and recording the final peak width. Diffusion coefficients for GQ and GM sequences were the same and equal to (1.4±0.1)×10 cm sec without KCl, and (4.5±0.2)×10 and (1.8±0.2)×10 cm sec in presence of 2 m KCl, respectively. The folding of DNA to a compact GQ structure decreases molecular cross section and a diffusion coefficient accordingly. The apparent folding constant () for GQ is (147±8) μ; is (1.70±0.41)×10 s ; for unfolding is (0.25±0.06) s. Half-life time of the complex is 2.8 s; relaxation time () equals 2.0 s in 150 μ KCl and 6.5 ms in 90 m KCl. To the best of our knowledge, this is the first report on kinetic parameters for fast DNA folding/unfolding in solution measured on-line by a separation technique and mass spectrometry. To confirm the value of measured by KCE-MS, we performed independent circular dichroism (CD) titration experiments and found equaled (126±4) μ for GQ–potassium complex (see the CD section in the Supporting Information). Our results are consistent as well with that reported by Zhang and Balasubramanian[] for the hTelo sequence (d[GGGTTAGGGTTAGGGTTAGGG]): =(120±20) μ, =(0.28±0.04)×10 s  and =40 ms in 90 m KCl using UV titration and stopped-flow techniques. The hTelo sequence is 21-nt long, has 3-quartet DNA G-quadruplexes and folds with a stronger positive cooperativity than TBA with 2 quartets only; therefore, hTelo has smaller and values and longer relaxation time. The challenge for MS detection is that molecular weights and / rations of all GM and GQ DNA sequences are the same due to the same nucleotide constitution. It makes these molecules unresolvable by means of MS only. Nevertheless, the differential affinity of DNA to K can be observed by direct injection mass spectrometry (DIMS). The main ions in DIMS are (GQ−4 H) for free GQ and (GM−4 H) for free GM (). Mixing with 2 m KCl eliminates free GQ as well as the Na adduct (), but brings several complexes of GQ with K where (GQ+K−5 H) and (GQ+2 K−6 H) are the main ions. The high concentration of KCl does not significantly change the amount of free GM (), which confirms the absence of specific affinity of GM to K. In DIMS experiments, the first and second dissociation constants for GQ–1 K and K for GQ–2 K have been previously found to be 119 μ and 556 μ, respectively.[] The apparent folding constant obtained in solution by KCE is inherently different from the consecutive dissociation constants and determined by mass spectrometry in a gas phase, because KCE does not resolve 1:1 and 1:2 GQ–metal complexes in solution. Complexation of GQ with two potassium ions causes GQ folding in a compact structure with smaller collision cross section (CCS) that is detectable by ion mobility spectrometry (IMS). GQ has shorter migration in CE and drift time in IMS experiments than GM sequences (). Addition of K ions to GM sequences increases a cross section and drift time as opposed to the GQ strand (). We also observed that Na and NH ions possessed weaker GQ stabilizing activity than K, as was previously shown.[] Important to note, NH-based buffers (popular in mass spectrometry) should be avoided in studying coordinating effects of nucleic acids with different ligands due to the fact that NH would compete with the ligands to bind to GQ making it harder to interpret experimental results. Balthasart et al.[] studied complexation of TBA (GQ sequence) with NH using IMS and found that the loss of NH from the complex does not change the CCS of nucleic acids, meaning that free TBA and TBA–NH complex have identical CCSs. These findings also support our conclusion that K is a stronger G-quadruplex stabilizing agent. Since GQ structures can regulate a broad spectrum of different biological processes and cancer development, it is of a great importance to search for compounds altering its stability. We tested a set of compounds that could possibly stabilize/destabilize GQ. These include nucleic acid binding dyes: SYTO, BOBO-1 iodide, BOBO-3 iodide. POPO-1 iodide, POPO-3 iodide, TOTO-1 iodide, TOTO-3 iodide, YOYO-1 iodide, YOYO-3 iodide; and an anticancer drug called cisplatin or -diamminedichloroplatinum(II). The dyes were supplemented into the run buffer as well as into samples of GQ, GM1, GM2, and GM3 sequences and were subjected to KCE-MS analysis. We did not observe any migration time shifts and peak widening in KCE, and did not detect GQ–dye complexes by MS in the range of dye concentrations from 50 n to 1.6 μ. We concluded that aforementioned DNA binding dyes did not possess any GQ stabilizing/destabilizing activity. Usually these dyes bind well to long double-stranded DNA. Unlike the dyes cisplatin demonstrated strong GQ destabilizing activity. Cisplatin coordinates to the N7 atoms of the purine (guanine and adenine) bases and forms a covalent adduct with two adjacent bases on the same strand of DNA. In this experiment, GM and GQ strands were derivatized with cisplatin with and without the presence of K ions (see Figure S1.2 in the Supporting Information). After derivatization, free DNA as well as monoderivatized strands were detected. Important to note, in cisplatin–DNA complexes both available bonds of cisplatin were used, which indicates intra-strand cross-linking. After cisplatin derivatization, DNA was no longer able to fold into GQ structure (see Figure S1.2 D in the Supporting Information). Therefore, cisplatin could be used as a strong and nonspecific GQ-destabilizing agent. Whitesides and co-authors were the first to apply CE for finding rate and equilibrium constants through a numerical approach of fitting reactant-propagation profiles.[], [] Most kinetic capillary electrophoresis (KCE) methods (non-equilibrium capillary electrophoresis of equilibrium mixtures (NECEEM), sweeping capillary electrophoresis (SweepCE), plug–plug KCE) cause irreversible perturbations in binding equilibrium and are not suitable for measuring reactions with fast re-equilibration (<). For example, in NECEEM, if the dissociation of a complex happens quickly, it is almost impossible to measure >0.1 s. In contrast, equilibrium capillary electrophoresis of equilibrium mixtures (ECEEM) considers both the forward and reverse process in the reaction. In this study, we coupled on-line kinetic capillary electrophoresis with mass spectrometry (KCE-MS) for the study of fast DNA conformations and dynamics in solution. We showed that peaks shift in CE and its widening can be used for the precise determination of rate and equilibrium constants for DNA–metal affinity interactions and DNA folding. We confirmed DNA folding by ion mobility (IM) spectroscopy and presented two-dimensional separation (KCE versus IM) of conformers in solution and a gas phase. In conclusion, KCE-MS establishes a new paradigm that separation methods together with MS detection can be used as comprehensive kinetic tools with mass and structure elucidation of nucleic acids. Most previous attempts to use chromatography and electrophoresis for studying nucleic acid interactions were restricted to assuming slow or no equilibrium between reactants. KCE shows that non-zero kinetics and structural dynamics must be taken into account when separation happens. KCE-MS could be a valuable supplement to IM-MS due to the separation of ions in solution according to their size-to-charge ratio. We believe that KCE-MS will be used in parallel with circular dichroism (CD), stopped-flow (SF), and surface plasmon resonance (SPR) techniques for studying nucleic acid structures and functions, screening DNA/RNA binding compounds and selecting aptamers. : All DNA sequences were purchased from IDT DNA Technologies (USA). For all experiments, 12.5 m tris-acetate, pH 7.85, was used as an incubation/run buffer. The buffer was prepared by dilution from 200 m tris-acetate stock buffer. The stock buffer was made by dissolving 12.11 g of tris-base (Bio Basic Inc., Canada, cat.# 77–86–1) and 2.86 mL of acetic acid (Bio Basic Inc., Canada, cat.# C1000) in 500 mL of ddHO. 100 m solutions of NHCl (Sigma–Aldrich, USA, cat.# 254134), NaCl (Sigma–Aldrich, USA, cat.# S7653) and KCl (Sigma–Aldrich, USA, cat.# P9541) were prepared in ddHO. 1 m 4,4′-(propane-1,3-diyl)dibenzoic acid (PDDA; Sigma–Aldrich, USA, cat.# S499455) was prepared in run buffer and used as internal standard in CE separation to normalize electrophoretic mobilities. Equilibrium mixtures of DNA and chlorides were prepared in the incubation buffer with 10 μ concentration of all DNA sequences. Concentrations of KCl were in the range of 10 μ–2.5 m. All solutions were filtered through 0.22 μm pore size nylon membrane filters (Millipore, Nepean, ON, Canada). The bare-silica capillary was purchased from Polymicro (Phoenix, AZ, USA). : The sample storage and capillary temperature was maintained at 25±0.5 °C. The electric field in KCE separation was 290 V cm with a positive electrode at the injection end. The run buffer was with one of the coordinating ions in the inlet reservoir. The concentration of the coordinating ions in the equilibrium mixture and the run buffer was the same for individual KCE experiments. For all experiments, the capillary was 89 cm long (30 cm in KCE-UV experiment, 20 cm to window) with an inner diameter of 50 μm and an outer diameter of 360 μm. The equilibrium mixture was injected into the capillary from the inlet end by a pressure pulse of 10 s×1 psi (0.3 psi for 3 sec in KCE-UV experiment). Before each experiment, the capillary was rinsed by 75 psi pressure with: 0.1  HCl for 3 min, 0.1  NaOH for 3 min, ddHO for 3 min, 12.5 m tris-acetate buffer for 5 min, and the incubation/run buffer with coordinating ions for 2 min. A Synapt G2 HDMS mass spectrometer from Waters (UK) was coupled with a PA800plus Pharmaceutical Analysis CE system having a PDA detector (Beckman Coulter, USA) through a CE-ESI sprayer from Micromass (UK) and used in all KCE-MS experiments. Electrospray ionization conditions were as follows: capillary voltage 3 kV, negative mode, sampling cone voltage 45 V, extraction cone voltage 3 V, source temperature 100 °C, cone gas 0 L h, nanoflow gas 0.5 Bar, purge gas 3 L h, mobility cell bias voltage 3 V. Sheath liquid (80:20 isopropanol/ddHO, 5 m triethanolamine) was delivered with a flow rate of 1.5 μL min.

The octapeptide angiotensin II (Ang II) is the major effector peptide of the renin-angiotensin system (RAS). It acts via two receptors, the AT and the AT receptor (ATR and ATR). The effects mediated by ATR are well known and include regulation of blood pressure and fluid/electrolyte balance.[] When ATR is expressed together with ATR, its activation results in several effects that oppose those mediated by the latter. Thus, stimulation induces vasodilatation, antiproliferation and apoptosis. Conversely, when expressed alone in undifferentiated cells, ATR stimulation is involved in cell differentiation.[–] In fact, ATR is abundant in fetal tissues but its expression drops rapidly after birth, an observation in agreement with its role in cell differentiation. In the healthy adult, aside from a few specific tissues, the expression is at barely detectable levels.[, ] However, a re-expression of the receptor occurs in some pathological states, such as heart and renal failure, myocardial infarction, hypertension, brain disorders or obesity disorders.[] There is piling evidence that ATR is involved in tissue repair. Therefore, ATR has attracted special interest in connection with cardiac remodeling, and has now been addressed as a new target for drug intervention.[] We have conducted two projects in parallel with the common objective to identify selective drug-like agonists to ATR. The first project commenced with the endogenous peptide ligand Ang II () and subsequent stepwise modifications, including minimizations/truncations, rigidifications and incorporation of turn mimetics resulted in series of ATR-selective analogues, for example ().[] This approach has led us to a new unique lead structure () that we anticipated could serve as a starting point for a new class of selective ATR agonists ().[] A parallel project focused on transforming the nonpeptidic but nonselective ATR agonist L-162,313, disclosed by Merck, into a nonpeptidic ATR-selective agonists.[] We demonstrated that L-162,313 acts as an agonist also at the ATR, and stepwise structural modifications of L-162,313 led to the identification of the first selective drug-like nonpeptide ATR agonist C21/M024 () that has been extensively studied in various in vitro and in vivo models ().[] When comparing the two lead structures  and , the structural similarities seem obvious, despite the different origins of the molecules. Hence, we hypothesize that both of the leads, and , mimic the C terminus of Ang II () and the truncated analogues  (Ang IV) and ().[] As indicated in , the imidazole group would thus correspond to the histidine side chain, the sulfonyl carbamate would provide an acidic proton corresponding to the C-terminal carboxylic acid, and either the isobutyl or the -butyl chain in C21/M024 would be able to mimic the hydrophobic Phe/Ile side chain of the C terminus of the peptide analogues. Both lead structures comprise an imidazole group, which is frequently associated with undesired interactions with cytochrome P450 (CYP) enzymes. This issue was addressed, and CYP inhibition could successfully be minimized be replacement of the imidazole in C21/M024 () with various amide groups, providing ligands with retained activity and function.[] With the ambition to assess the potential of lead , as an entry to a new class of selective ATR agonists, we aimed at replacing the imidazole with a substituent less prone to bind to CYP enzymes, for example various amide groups. We decided to evaluate this new class of ligands towards the human ATR using transfected HEK-293 cells (HEK293-hATR)[] rather than ATR in pig myometrial membranes, which had been used previously. Herein we report a convenient synthesis and pharmacological evaluation of a series of benzamides derived from , comprising an isoleucine residue at the C terminus and with the generic structure depicted in . We further conclude that the amides synthesized as well as exhibit only a weak affinity towards human ATR, while C21/M024 () binds with high affinity. The synthesis of the new potential ATR ligands was performed by palladium-catalyzed aminocarbonylation reactions starting from the corresponding iodo compounds under microwave heating. To allow this reaction to be conducted in sealed vials under CO gas-free conditions, molybdenum hexacarbonyl (Mo(CO)) was chosen as the carbon monoxide source.[] This rather recent method allows an efficient, fast and straightforward benzamide synthesis in air, and it has previously been used for the synthesis of biologically active compounds.[] Although gaseous CO is advantageous for aminocarbonylations in large scale,[] solid CO sources[] such as Mo(CO)[] are safer and more convenient for lab-scale chemistry since no gas tubes and high pressure equipment are required. The aryl iodides – were converted by a standard coupling with isoleucine--butyl ester to afford – (). After purification, moderate to excellent yields of 38–98 % were achieved. The aryl iodides coupled with the isoleucine--butyl ester residue were subsequently MW irradiated for 15 min at 100 °C in the presence of palladium catalyst with Mo(CO) and a selection of primary and secondary amines bearing aliphatic, aromatic, cyclic as well as heterocyclic groups with diverse steric and lipophilic properties (– and –, Table ). The yields of the aminocarbonylation step varied much depending on the steric hindrance of the nucleophilic amine and its electronic properties and ranged from 14 % (; Table , entry 11) to 85 % ( and ; entries 9 and 14). After hydrolysis with trifluoroacetic acid (TFA), target compounds – and – were afforded in mostly good to very good isolated yields, between 52 % (, Table , entry 27) and 96 % (, entry 11). In a few cases the hydrolysis resulted in yields below 50 % (entries 1, 14, 26, 28). All free acids shown in Table  (– and –) were evaluated in a first radioligand binding assay relying on the displacement of [I]CGP-42112A (CGP-42112A; -nicotinoyl-Tyr-(-Cbz-Arg)-Lys-His-Pro-Ile), a selective but peptidic AT receptor agonist[] from human ATR expressed in HEK-293 cells (HEK293-hATR). Ang II was used as the reference substance.[] The majority of the new benzamides shown in Table  (20 compounds) were also evaluated for binding toward human ATR.[] None of the evaluated compounds showed any affinity toward ATR, and therefore the remaining compounds were evaluated only towards ATR. In this first assay, the compounds were initially screened for binding activity (% inhibition of [I]CGP-42112 A binding) at a concentration of 1 μ and 10 μ. The results from the initial compound screen indicated that noncyclic disubstituted benzamides (CONRR) showed better interaction with ATR. More lipophilic substituents on the benzamide function led to higher affinity towards ATR, and all compounds with activity in the initial screen had at least one benzyl group as substituent, except the diethyl benzamide, and . Based on the activities found in the screen, compounds were selected for value determinations. The ligands bearing a methyl substituent in position showing a displacement of more than 30 % in the affinity screen [Table , entries 17 (), 19 () and 22 ()] were selected for determinations. Additionally, the -unsubstituted derivatives [Table , entries 6 (), 8 () and 11 ()] were also included to evaluate the influence of substitution in this position of the aromatic ring, even though they did not fully reach the same displacement. For the same reason, the -ethyl derivatives [Table , entries 25 (), 26 (), 28 ()] and the derivatives with the benzamides in the position [Table , entries 29 (), 30 (), 31 ()] were submitted directly for determination, despite not being included in the initial screen. Furthermore, it was decided to include the benzylethyl benzamides (, , ) based on the preliminary results of the diethyl (, ) and dibenzyl compounds (, ). The values were determined from at least six data points with test concentrations ranging from 30 p to 1 m. The concentration range was adjusted to be appropriate for the expected values. The results are summarized in Table . The -H and -methyl benzamide analogues, compounds /, /, / and /, were also evaluated in a second radioligand binding assay, relying on the displacement of the ATR/ATR balanced peptide [I]Sarile (Sarile; [Sar, Ile]Ang II) instead of the ATR selective [I]CGP-42112 A from human ATR (HEK293-hATR) as well as human ATR (HEK293-hATR).[, ] No binding to the ATR was observed, and the values towards ATR are summarized and compared with values from the first HEK-293 binding assay in Table . As can be seen, the values from these two assays correspond very well. When comparing the affinity results given in Table , two trends become apparent. First, within each of the three sets of compounds differing only in the substituent in position (i.e., H, Me, Et), the methyl substituted ligands show the highest affinities. The second trend is that the larger the substituents on the benzamide, the smaller the difference in value within each group. In the case of the diethyl substituted compounds, the values are 22.0 μ ([I]CGP-42112A) for as compared to 2.4 μ ([I]CGP-42112A) for , and in the case of the dibenzyl substituted compounds, the difference is as low as 5 μ between the -methylated ligand and the unsubstituted compound . Moving the benzamide group to the position leads to a significant loss in affinity. Only compound  still shows some affinity towards the ATR with a value of 35.0 μ, but the compound is inferior to its analogues (, and ). The dibenzyl substituted benzamides were the most consistent in affinity in all sets of analogues. The benzamides showing the best values correlate partly to the most potent benzamide analogues of C21/M024. The diethyl substituted analogues are among the compounds with highest affinities in both series, which could suggest that the amide functions of the two classes of compounds interact with the same environment in the receptor.[] To be able to correlate the results from these new ligands targeting the human ATR to our previous studies performed with ATR in membranes from pig uterus, a few reference compounds were selected and included in the determination. To our surprise, lead compound (Table , entry 32) only exhibited a value of 110.0 μ. In our previous studies using the pig ATR, the value was found to be 16.6 n.[] Furthermore, reduced binding affinities were encountered also for the other peptide analogues, that is, with 63.0 μ (pig ATR 37.0 n),[] with 25 n (pig ATR 0.5 n),[] and Ang IV () with a value of 35 n (pig ATR 7.7 n; see Table , entries 3335). The nonpeptide agonist C21/M024 () displayed a reduced binding but not to the same extent ( human ATR 9.8 n versus pig ATR 0.4 n). The values were verified by the second binding assay, also targeting the human ATR, but with displacement of [I]Sarile instead of [I]CGP-42112A. In this assay, lead compound  exhibited a value of 47.0 μ, C21 M024 () showed a value of 7.6 n, while Ang II () showed a 60 times higher value (2.8 n; see Table ). C21/M024 () has also been evaluated for binding towards the human ATR by Bosnyak et al. with a reported IC=2.29 n (Ang II (); IC=0.522 n).[] Thus, while the drug-like C21/M024 () binds with high affinity to ATR both from human and pig, the lead exhibits a remarkable difference in affinity in the two species. The data suggest a species difference in the interaction of the peptide analogues and the nonpeptidic substances, respectively, with regard to their binding to ATR, and emphasizes the importance of performing affinity studies on human ATR. The differences could of course be due to experimental conditions, in addition to species variations, for example, cell and receptor origin (endogenous membranes from uterus versus transfected kidney cells) and/or differences in the experimental design to measure ligand binding. However, the assays seem comparable, as the reference compounds exhibit the same relative order of affinity in both assays (Table , entries 3237). A comparison of the sequence of ATR from human and pig reveals that the receptors are very similar (95 % homology in the amino acid sequence),[] and very fine-tuned receptor models on a molecular level or mutation studies are required to investigate whether the observed discrepancy in binding data originates from species differences at the receptor level. It is conceivable that binding could be modulated by various levels of interferences in the two assays with partner proteins as ATR-interacting proteins (ATIP), the promyelocytic zinc finger protein (PLZF), the phosphatase SHP-1 or alpha subunit of G proteins. Such interactions might account for the incongruity reported herein.[] Functional diversity of highly homologous proteins is rare (>90 % amino acid identity), although it has been shown for ATR orthologues when comparing rabbit and human ATR.[] To verify if our results originates from functional diversity (i.e., species differences) much more studies must be performed that are outside of the scope of this report. The ATR exists as a single copy, localized on the X chromosome and contains no intron in its coding region, and we hypothesize that it is more likely that the different binding data obtained are related to variations in tissues rather than species. Georgsson et al. described the possibility to reduce the ligand size from to the structures and without a major loss of affinity ().[] Interestingly, these smaller ligands showed much higher values when tested towards the human AT receptor. The herein presented new ligands are of comparable size as and but show improved affinity towards the human receptor. Thus, these new compounds will serve as a new starting point for further improvement of this new class of ATR-selective ligands. italic bold #text : The microwave heating was performed in a Biotage Initiator single mode reactor, which produces controlled irradiation at 2450 MHz. The reaction temperature was determined using the built-in online IR sensor. Microwave mediated reactions were performed in sealed Smith process vials designed for 2–5 mL reaction volumes. Analytical TLC was performed using Merck aluminium-backed 0.2 mm silica gel 60 F-254 plates, and visualization was performed with UV light (=254 nm). Silica gel 60 was purchased from Merck. NMR spectra were recorded on a Varian Mercury plus at 25 °C and 400 MHz for H NMR and 100 MHz for C NMR. Chemical shifts () are reported in ppm and referenced indirectly to TMS via the solvent (or residual solvent) signals. Analytical RP-HPLC–MS was performed on a Gilson-Finnigan ThermoQuest AQA system (Onyx monolithic C18 column, 50×4.6 mm) and a Dionex Ultimate 3000 (C18 column, 50×3 mm) using a MeCN/HO gradient with 0.05 % HCOOH. Detection was performed using UV (=214 nm and 254 nm) and MS detection in ESI mode. Preparative RP-HPLC was performed on a Dionex Ultimate 3000 system (SB-C8 column, 21.2×150 mm; MeCN/HO gradient with 0.05 % HCOOH) using UV detection (=214 nm and 254 nm). Molecular masses were determined on a mass spectrometer equipped with an electrospray ion source (ESI-HRMS; 7-T hybrid linear ion trap (LTQ) FT mass spectrometer modified with a nanoelectrospray ion source). The optical rotation was determined using a PerkinElmer 241 polarimeter. Specific rotations ([]) are reported in 10×deg×cm g, and the samples were prepared at a concentration of 1.0 g/100 mL in CHCl. All starting materials, reagents and solvents are commercially available and were used as received. –: The iodo benzoic acid (–; 1 equiv), -isoleucine -butyl ester hydrochloride (IleOBu⋅HCl; 1.1 equiv) and 1-[bis(dimethylamino)methylene]-1-1,2,3-triazolo[4,5-]pyridinium 3-oxid hexafluorophosphate (HATU; 1.1 equiv) were dissolved in ,-dimethylformamide (DMF; 4 mL mmol). ,-Diisopropylethylamine (DIEA; 3.3 equiv) was added, and the reaction mixture was stirred at RT overnight. The mixture was poured into HO and extracted with EtOAc (4×40 mL mmol). The combined organic layers were washed with saturated NHCl (1×40 mL mmol), HO (4×40 mL mmol) and brine (2×40 mL mmol). After drying over NaSO, the solvent was evaporated in vacuo. Purification by column chromatography provided the pure products in moderate to excellent yields (: 94 %, : 98 %, : 38 %, : 88 %). : According to general procedure A, 3-iodo benzoic acid (, 1.24 g, 5.0 mmol) was reacted with IleOBu (1.23 g, 5.5 mmol), HATU (2.09 g, 5.5 mmol) and DIEA (2.9 mL, 16.5 mmol) in DMF (20 mL). Purification by column chromatography (-hexane/EtOAc, 0–100 %) afforded as a white semi-solid (1.96 g, 94 %): H NMR (CDCl): =0.96 (d, =6.9 Hz, 3 H), 0.95–1.00 (m, 3 H), 1.22–1.31 (m, 1 H), 1.45–1.58 (m, 1 H), 1.49 (s, 9 H), 1.94–2.02 (m, 1 H), 4.68 (dd, =8.2 Hz, 4.4 Hz, 1 H), 6.68 (d, =8.1 Hz, 1 H), 7.16 (t, =7.8 Hz, 1 H), 7.74 (ddd, =7.8 Hz, 1.6 Hz, 1.1 Hz, 1 H), 7.82 (ddd, =7.9 Hz, 1.7 Hz, 1.1 Hz, 1 H), 8.12 ppm (t, =1.6 Hz, 1 H); C NMR (CDCl): =11.8, 15.4, 25.5, 28.1, 38.5, 57.1, 82.4, 94.2, 126.1, 130.2, 136.1, 136.3, 140.5, 165.3, 171.1 ppm. : According to general procedure A, 3-iodo-4-methyl-benzoic acid (, 1.31 g, 5.00 mmol) was reacted with IleOBu (1.23 g, 5.50 mmol), HATU (2.09 g, 5.50 mmol) and DIEA (2.90 mL, 16.50 mmol) in DMF (20 mL). Purification by column chromatography (-hexane/EtOAc, 0–100 %) afforded as a white semi-solid (2.12 g, 98 %): H NMR (CDCl): =0.93 (d, =6.9 Hz, 3 H), 0.93 (t, =7.3 Hz, 3 H), 1.18–1.32 (m, 1 H), 1.46 (s, 9 H), 1.47–1.55 (m, 1 H), 1.95 (ddd, =9.0 Hz, 4.5 Hz, 2.1 Hz, 1 H), 2.41 (s, 3 H), 4.66 (dd, =8.3 Hz, 4.6 Hz, 1 H), 6.79 (d, =7.8 Hz, 1 H), 7.21 (d, =7.9 Hz, 1 H), 7.61 (dd, =7.9 Hz, 1.8 Hz, 1 H), 8.18 ppm (d, =1.8 Hz, 1 H); C NMR (CDCl): =11.6, 15.3, 25.5, 27.98, 28.02, 38.3, 57.0, 82.2, 100.8, 126.6, 129.4, 133.3, 137.5, 145.1, 165.0, 171.2 ppm. : According to general procedure A, 3-iodo-4-ethyl-benzoic acid (, 2.00 g, 7.25 mmol) was reacted with IleOBu (1.78 g, 7.97 mmol), HATU (3.03 g, 7.97 mmol) and DIEA (4.20 mL, 23.91 mmol) in DMF (25 mL). Purification by column chromatography (-hexane/EtOAc, 0–100 %) afforded as a white semi-solid (1.20 g; 38 %): H NMR (CDCl): =0.98 (t, =7.3 Hz, 6 H), 1.22–1.34 (m, 1 H), 1.29 (t, =7.5 Hz, 3 H), 1.49 (s, 9 H), 1.54 (ddd, =13.1 Hz, 7.6 Hz, 3.7 Hz, 1 H), 1.99 (dddd, =11.4 Hz, 6.8 Hz, 4.5 Hz, 2.3 Hz, 1 H), 2.95 (q, =7.5 Hz, 2 H), 4.70 (dd, =8.2 Hz, 4.4 Hz, 1 H), 6.79 (d, =7.9 Hz, 1 H), 7.43 (dd, =8.1 Hz, 2.1 Hz, 1 H), 7.94 (dt, =8.0 Hz, 1.7 Hz, 1 H), 8.27 ppm (d, =1.8 Hz, 1 H); C NMR (CDCl): =11.8, 14.7, 15.4, 25.6, 26.1, 28.1, 38.4, 57.2, 82.6, 110.0, 123.2, 131.1, 131.6, 133.3, 142.3, 164.5, 171.0 ppm. : According to general procedure A, 4-iodo-benzoic acid (, 2.48 g, 10.0 mmol) was reacted with IleOBu (2.46 g, 10.0 mmol), HATU (4.18 g, 10.0 mmol) and DIEA (5.75 mL, 33.0 mmol) in DMF (30 mL). Purification by column chromatography (-hexane/EtOAc, 0–100 %) afforded as a white semi-solid (3.69 g, 88 %): H NMR (CDCl): =0.94 (d, =7.4 Hz, 3 H), 0.95 (t, =7.5 Hz, 3 H), 1.20–1.32 (m, 1 H), 1.47 (s, 9 H), 1.49–1.57 (m, 1 H), 1.92–2.01 (m, 1 H), 4.66 (dd, =8.2 Hz, 4.5 Hz, 1 H), 6.74 (d, =8.1 Hz, 1 H), 7.48–7.52 (m, 2 H), 7.73–7.77 ppm (m, 2 H); C NMR (CDCl): =11.8, 15.3, 25.6, 28.1, 38.4, 57.1, 82.3, 98.5, 128.6, 133.7, 137.7, 166.1, 171.1 ppm. : Iodoaryl OBu-Ile derivative (–; 1 equiv, 0.5–1.0 mmol), amine (3 equiv), Pd(OAc) (0.1 equiv) and Mo(CO) (1 equiv) were dissolved in tetrahydrofuran (THF; 2.5 mL mmol) in a 2–5 mL Smith process vial. The mixture was stirred for 2 min at RT. Diazabicycloundecene (DBU; 3 equiv) was added, and the vial was immediately sealed and irradiated in a microwave reactor at 100 °C for 15 min. After cooling to RT, MeOH was added, and the suspension was filtered through a short plug of Celite®. The solvent was evaporated, and the crude mixture was purified by column chromatography (-hexane/EtOAc, 0–100 %), giving the desired products in yields between 14 % and 85 %. : According to general procedure B, reaction of derivative afforded as a colorless oil (45 mg, 24 %): H NMR (CDCl): =0.93 (d, =6.9 Hz, 3 H), 0.94 (t, =7.4 Hz, 3 H), 1.02–1.15 (m, 3 H), 1.16–1.30 (m, 4 H), 1.45 (s, 9 H), 1.43–1.56 (m, 1 H), 1.95 (ddt, =11.4 Hz, 6.8 Hz, 2.2 Hz, 1 H), 3.20 (s, 2 H), 3.51 (s, 2 H), 4.65 (dd, =8.2 Hz, 4.5 Hz, 1 H), 6.73 (d, =8.2 Hz, 1 H), 7.43 (t, =7.5 Hz, 1 H, ), 7.47 (ddd, =7.6 Hz, 1.6 Hz, 1.1 Hz, 1 H, ), 7.76 (t, =1.6 Hz, 1 H, ), 7.80 ppm (dt, =7.3 Hz, 1.6 Hz, 1 H); C NMR (CDCl): =11.7, 12.7, 14.1, 15.3, 25.5, 28.0, 38.3, 39.3, 43.3, 57.1, 82.2, 124.9, 127.7, 128.7, 129.2, 134.6, 137.6, 166.2, 170.2, 170.9 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (165 mg, 75 %): H NMR (CDCl): =0.90–1.00 (m, 6 H), 1.18–1.32 (m, 1 H), 1.48 (s, 9 H), 1.46–1.58 (m, 1 H), 1.93–2.04 (m, 1 H), 2.84–3.08 (m, 3 H), 4.43–4.73 (m, 2 H), 4.76 (s br, 1 H), 6.63–6.78 (m, 1 H), 7.13–7.22 (m, 1 H), 7.27–7.32 (m, 1 H), 7.35 (s br, 3 H), 7.41–7.53 (m, 1 H), 7.58 (d, =7.5, 1 H), 7.82–7.87 (m, 1 H), 7.89 ppm (s br, 1 H); C NMR (CDCl): =11.8, 15.4, 25.5, 28.1, 33.3, 37.0, 38.4, 50.8, 55.1, 57.1, 82.3, 125.7, 126.6, 127.6, 128.0, 128.2, 128.4, 128.7, 128.9, 130.0, 134.8, 136.8, 138.8, 166.1, 168.3, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (72 mg, 14 %): H NMR (CDCl): =0.94 (d, =7.0 Hz, 3 H), 0.95–1.00 (m, 3 H), 1.17–1.30 (m, 1 H), 1.46–1.58 (m, 1 H), 1.49 (s, 9 H), 1.92–2.02 (m, 1 H), 4.39 (s br, 2 H), 4.67 (dd, =8.3 Hz, 4.5 Hz, 1 H), 4.68–4.82 (m, 2 H), 6.67 (d, =8.2 Hz, 1 H), 7.08–7.18 (m, 2 H), 7.26–7.39 (m, 8 H), 7.45 (t, =7.8 Hz, 1 H), 7.59–7.64 (m, 1 H), 7.83 (ddd, =7.8 Hz, 1.7 Hz, 1.2 Hz, 1 H), 7.92 ppm (t, =1.5 Hz, 1 H); C NMR (CDCl): =11.8, 15.4, 25.5, 28.1, 38.4, 47.1, 51.5, 57.1, 82.3, 125.4, 126.9, 127.7, 128.2, 128.4, 128.7, 128.9, 129.6, 134.8, 136.1, 136.7, 166.0, 170.9, 171.3 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (97 mg, 43 %): H NMR (CDCl): =0.92–1.00 (m, 6 H), 1.02–1.15 (m, 1 H), 1.15–1.27 (m, 3 H), 1.44–1.56 (m, 1 H), 1.47 (s, 9 H), 1.91–2.01 (m, 1 H), 3.18 (s br, 1 H), 3.51 (s br, 1 H), 4.46 (s, 1 H), 4.66 (s br, 1 H), 4.76 (s, 1 H), 6.70 (d, =33.1 Hz, 1 H), 7.10–7.38 (m, 5 H), 7.50–7.38 (m, 1 H), 7.54 (s, 1 H), 7.79–7.89 ppm (m, 2 H); C NMR (CDCl): =11.7, 12.1, 13.6, 15.3, 25.5, 28.0, 38.4, 40.0, 42.9, 46.9, 52.1, 57.1, 82.2, 125.1, 126.6, 127.4, 127.9, 128.1, 128.4, 128.6, 128.8, 129.4, 133.1, 134.7, 137.1, 162.5, 166.1, 170.9 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (43 mg, 22 %): H NMR (CDCl): =0.94 (d, =6.8 Hz, 3 H), 0.95 (t, =7.2 Hz, 3 H), 1.02 (t, =7.1 Hz, 3 H), 1.17–1.23 (m, 1 H), 1.25 (t, =7.1 Hz, 3 H), 1.47 (s, 9 H), 1.49–1.56 (m, 1 H), 1.96 (ddt, =9.2 Hz, 6.8 Hz, 4.6 Hz, 1 H), 2.32 (s, 3 H), 3.06–3.14 (m, 2 H), 3.22–3.81 (m, 2 H), 4.66 (dd, =8.3 Hz, 4.5 Hz, 1 H), 6.65 (d, =8.2 Hz, 1 H), 7.26 (dd, =8.0 Hz, 0.4 Hz, 1 H), 7.59 (d, =1.7 Hz, 1 H), 7.68 ppm (dd, =8.0 Hz, 1.1 Hz, 1 H); C NMR (CDCl): =11.7, 12.8, 14.0, 15.3, 18.9, 25.5, 28.0, 38.4, 38.8, 42.7, 57.0, 82.2, 124.2, 127.1, 130.6, 132.1, 137.4, 138.0, 166.2, 169.8, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (102 mg, 45 %): H NMR (CDCl): =0.91–1.00 (m, 6 H), 1.18–1.34 (m, 1 H), 1.49 (s, 9 H), 1.51–1.58 (m, 1 H), 1.92–2.03 (m, 1 H), 2.36 (s, 3 H), 2.70 (s, 2 H), 3.08 (s, 1 H), 4.35 (s, 1 H), 4.68 (dd, =8.3 Hz, 4.5 Hz, 1 H), 4.78 (s, 1 H), 6.67 (d, =8.3 Hz, 1 H), 7.09 (d, =7.6 Hz, 1 H), 7.25–7.36 (m, 3 H), 7.36–7.39 (m, 2 H), 7.66 (d, =1.7 Hz, 1 H), 7.71 ppm (t, =7.2 Hz, 1 H); C NMR (CDCl): =11.8, 15.4, 19.0, 25.5, 28.1, 32.6, 35.7, 38.5, 50.2, 54.6, 57.0, 82.3, 124.6, 127.0, 127.6, 128.4, 128.7, 128.8, 130.9, 132.3, 136.0, 136.7, 138.0, 166.2, 170.5, 171.1 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (115 mg, 22 %): H NMR (CDCl): =0.93 (d, =6.9 Hz, 3 H), 0.97 (t, =7.4 Hz, 3 H), 1.16–1.29 (m, 1 H), 1.49 (s, 9 H), 1.50–1.56 (m, 1 H), 1.91–1.99 (m, 1 H), 2.36 (s, 3 H), 4.22 (s, 2 H), 4.29–4.57 (m, 1 H), 4.64 (dd, =8.3 Hz, 4.5 Hz, 1 H), 4.87–5.34 (m, 1 H), 6.59 (d, =8.2 Hz, 1 H), 7.05–7.10 (m, 2 H), 7.26–7.39 (m, 9 H), 7.67–7.71 ppm (m, 2 H); C NMR (CDCl): =11.8, 15.3, 19.2, 25.5, 28.1, 38.4, 46.7, 50.9, 57.0, 82.2, 124.6, 127.2, 127.5, 127.7, 127.8, 128.7, 128.8, 128.8, 130.9, 132.1, 135.8, 136.4, 136.7, 138.5, 166.0, 170.96, 170.99 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (101 mg; 45 %): H NMR (CDCl): =0.90–1.00 (m, 7 H), 1.12–1.33 (m, 3 H), 1.48 (s, 9 H), 1.50–1.58 (m, 1 H), 1.92–2.02 (m, 1 H), 2.36 (s, 3 H), 3.01–3.10 (m, =7.0 Hz, 2 H), 4.31–4.55 (m, 2 H), 4.68 (dd, =8.2 Hz, 4.4 Hz, 1 H), 6.67 (d, =8.2 Hz, 1 H), 7.10 (d, =7.9 Hz, 1 H), 7.21–7.41 (m, 5 H), 7.60–7.70 ppm (m, 2 H); C NMR (CDCl): =11.7, 12.2, 13.4, 15.3, 19.1, 25.5, 28.0, 38.4, 42.1, 51.5, 57.0, 82.2, 124.3, 127.0, 127.4, 127.7, 128.1, 128.6, 128.7, 130.6, 132.2, 136.3, 137.2, 138.1, 162.5, 166.0, 170.4 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (100 mg, 48 %): H NMR (CDCl): =0.99–0.93 (m, 6 H), 1.04 (t, =7.1 Hz, 3 H), 1.29–1.20 (m, 7 H), 1.48 (s, 9 H), 1.59–1.49 (m, 1 H), 2.02–1.92 (m, 1 H), 2.65 (q, =7.6 Hz, 2 H), 3.11 (q, =6.7 Hz, 2 H), 3.83–3.29 (m, 2 H), 4.67 (dd, =8.3 Hz, 4.5 Hz, 1 H), 6.64 (d, =8.2 Hz, 1 H), 7.33 (d, =8.1 Hz, 1 H), 7.58 (s, 1 H), 7.73 ppm (d, =6.7 Hz, 1 H); C NMR (CDCl): =11.8, 12.8, 14.0, 14.8, 15.4, 25.5, 25.9, 28.1, 38.5, 38.8, 42.9, 57.0, 82.2, 124.0, 127.0, 129.0, 132.1, 136.9, 144.1, 166.2, 169.8, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (155 mg, 66 %): H NMR (CDCl): =0.89–0.99 (m, 6 H), 1.16–1.28 (m, 4 H), 1.47 (s, 9 H), 1.49–1.56 (m, 1 H), 1.89–2.02 (m, 1 H), 2.65 (q, =7.5 Hz, 3 H), 2.68 (s, 2 H), 3.06 (s, 1 H), 4.20–4.53 (m, 1 H), 4.67 (dd, =8.2 Hz, 4.5 Hz, 1 H), 4.71–4.88 (m, 1 H), 6.69 (d, =7.8 Hz, 1 H), 7.09 (d, =7.9 Hz, 1 H), 7.32 (m, 5 H), 7.63 (d, =1.8 Hz, 1 H), 7.70–7.78 ppm (m, 1 H); C NMR (CDCl): =11.7, 14.8, 15.3, 25.5, 25.9, 28.0, 32.6, 35.9, 38.4, 50.2, 54.7, 57.0, 82.2, 124.4, 126.9, 127.6, 127.7, 128.3, 128.6, 128.8, 129.0, 132.2, 136.0, 136.7, 144.2, 166.0, 170.4, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (120 mg, 50 %): H NMR (CDCl): =0.93–1.04 (m, 9 H), 1.19–1.33 (m, 4 H), 1.49 (s, 9 H), 1.54 (ddd, =13.0 Hz, 7.5 Hz, 5.1 Hz, 1 H), 1.93–2.02 (m, 1 H), 2.68 (q, =7.5 Hz, 2 H), 3.05 (q, =7.1 Hz, 2 H), 4.32 (d, =7.9 Hz, 2 H), 4.68 (dd, =8.3 Hz, 4.5 Hz, 1 H), 6.67 (d, =8.3 Hz, 1 H), 7.11 (d, =7.3 Hz, 1 H), 7.21–7.41 (m, 7 H), 7.59–7.67 (m, 1 H), 7.75 ppm (d, =7.8 Hz, 1 H); C NMR (CDCl): =11.8, 13.3, 15.0, 15.4, 25.5, 26.0, 28.1, 38.4, 42.2, 51.7, 57.0, 82.2, 124.2, 127.0, 127.5, 127.7, 128.3, 128.6, 128.8, 129.1, 132.1, 136.3, 137.3, 144.2, 166.0, 170.4, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (339 mg, 62 %): H NMR (CDCl): =0.89–0.94 (m, 3 H), 0.96 (t, =7.4 Hz, 3 H), 1.15–1.27 (m, 1 H), 1.23 (t, =7.6 Hz, 3 H), 1.47–1.55 (m, 1 H), 1.49 (s, 9 H), 1.94 (s, 1 H), 2.61–2.75 (m, 2 H), 4.10–4.27 (m, 2 H), 4.27–4.45 (m, 1 H), 4.64 (dd, =8.3 Hz, 4.5 Hz, 1 H), 5.04–5.27 (m, 1 H), 6.57 (d, =8.0 Hz, 1 H), 7.07–7.11 (m, 2 H), 7.24–7.39 (m, 9 H), 7.68 (d, =1.9 Hz, 1 H), 7.75 ppm (dd, =8.0 Hz, 1.9 Hz, 1 H); C NMR (CDCl): =11.8, 15.0, 15.4, 25.5, 26.1, 28.1, 38.4, 46.6, 51.0, 57.0, 82.2, 124.5, 127.1, 127.7, 127.8, 128.7, 128.8, 128.9, 129.2, 132.1, 135.8, 136.0, 136.7, 144.5, 166.0, 170.9, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (133 mg, 68 %): H NMR (CDCl): =0.94–0.99 (m, 6 H), 1.05–1.14 (m, 3 H), 1.22–1.27 (m, 3 H), 1.28–1.35 (m, 1 H), 1.48 (s, 9 H), 1.49–1.61 (m, 1 H), 1.94–2.02 (m, 1 H), 3.14–3.26 (m, 2 H), 3.49–3.58 (m, 2 H), 4.69 (dd, =8.2 Hz, 4.4 Hz, 1 H), 6.71 (d, =7.6 Hz, 1 H), 7.40–7.46 (m, 2 H), 7.80–7.85 ppm (m, 2 H); C NMR (CDCl): =11.8, 14.2, 15.4, 25.5, 28.1, 38.5, 39.4, 43.2, 57.1, 82.4, 126.5, 127.2, 134.9, 140.4, 166.3, 170.3, 171.1 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (160 mg, 73 %): H NMR (CDCl): =0.94 (s br, 6 H), 1.18–1.32 (m, 1 H), 1.46 (s, 9 H), 1.49–1.63 (m, 1 H), 1.91–2.02 (m, 1 H), 2.80 (s, 2 H), 3.02 (s, 1 H), 4.44 (s, 1 H), 4.68 (s br, 1 H), 4.73 (s, 1 H), 6.78 (s br, 1 H), 7.12 (d, =6.6 Hz, 1 H), 7.37–7.25 (m, 4 H), 7.48 (t, =6.4 Hz, 2 H), 7.74–7.85 ppm (m, 2 H); C NMR (CDCl): =11.7, 15.3, 25.5, 28.0, 33.2, 36.8, 38.4, 50.7, 54.9, 57.1, 82.3, 126.5, 126.9, 127.2, 127.7, 128.2, 128.7, 128.8, 135.3, 136.1, 139.1, 166.1, 170.5, 171.0 ppm. : According to general procedure B, reaction of derivative afforded as a white semi-solid (40 mg, 16 %): H NMR (CDCl): =0.96 (d, =7.0 Hz, 3 H), 0.97 (t, =7.6 Hz, 3 H), 1.21–1.30 (m, 1 H), 1.48 (s, 9 H), 1.50–1.58 (m, 1 H), 1.98 (ddt, =9.2 Hz, 4.7 Hz, 2.4 Hz, 1 H), 4.72 (s, 2 H), 4.36 (s, 2 H), 4.68 (dd, =8.2 Hz, 4.4 Hz, 1 H), 6.71 (d, =8.2 Hz, 1 H), 7.12 (d, =6.6 Hz, 2 H), 7.27–7.39 (m, 8 H), 7.53–7.57 (m, 2 H), 7.79–7.83 ppm (m, 2 H); C NMR (CDCl): =11.8, 15.4, 25.5, 28.1, 38.5, 47.0, 51.4, 57.1, 82.4, 126.8, 126.9, 127.3, 127.7, 127.8, 128.5, 128.7, 128.9, 135.4, 136.0, 136.7, 139.2, 166.0, 171.1, 171.3 ppm. ­ : The ester (1 equiv, 0.08–0.6 mmol) was dissolved in CHCl (15 μL/μmol). Trifluoroacetic acid (TFA; 7.7 μL/μmol) added and the mixture was stirred at RT for 3 h. The solvent was evaporated, and the crude mixture was purified using HPLC (MeCN/HO, 0–100%). The pure products were isolated in 46–96 % yield. : According to general procedure C, reaction of ester gave as a white semi-solid (31 mg; 73 %): []=+10.3; H NMR (CDOD): =0.97 (t, 7.4 Hz, 3 H), 1.03 (d, 6.8 Hz, 3 H), 1.14 (t, 6.4 Hz, 3 H), 1.27 (t, 6.4 Hz, 3 H), 1.30–1.41 (m, 1 H), 1.56–1.68 (m, 1 H), 1.98–2.10 (m, 1 H), 3.25–3.37 (m, 2 H), 3.57 (d, 6.8 Hz, 2 H), 4.57 (d, 6.3 Hz, 1 H), 7.56 (dt, 5.8 Hz, 3.2 Hz, 2 H), 7.86 (s, 1 H), 7.91–7.97 ppm (m, 1 H); C NMR (CDOD): =11.7, 13.1, 14.4, 16.1, 26.6, 38.1, 41.0, 45.0, 59.0, 126.5, 129.6, 130.0, 130.4, 135.9, 138.3, 169.4, 172.6, 174.9 ppm; HRMS (ESI): / [+H] calcd for CHNO: 335.1971, found: 335.1972. : According to general procedure C, reaction of ester gave as a white semi-solid (51 mg, 65 %): []=+8.0; H NMR (CDOD): =0.96 (t, =7.3 Hz, 3 H), 1.03 (d, =6.9 Hz, 3 H), 1.25–1.40 (m, 1 H), 1.54–1.68 (m, 1 H), 1.97–2.08 (m, 1 H), 2.89 (s, 2 H), 3.02 (s, 1 H), 4.52 (s br, 1 H), 4.57 (d, =6.0 Hz, 1 H), 4.76 (s br, 1 H), 7.17 (d, =6.8 Hz, 1 H), 7.25–7.42 (m, 4 H), 7.49–7.59 (m, 1 H), 7.62 (d, =6.5 Hz, 1 H), 7.89–7.98 ppm (m, 2 H); C NMR (CDOD): =11.8, 16.3, 26.7, 33.9, 37.7, 38.3, 52.0, 56.3, 59.1, 127.2, 128.1, 128.8, 129.3, 129.8, 130.0, 130.1, 131.1, 136.1, 137.8, 138.2, 169.6, 173.0, 175.0 ppm; HRMS (ESI): / [+H] calcd for CHNO: 383.1971, found: 383.1974. : According to general procedure C, reaction of ester gave as a white semi-solid (37 mg, 96 %): []=+5.5; H NMR (CDOD): =0.95 (t, =7.4 Hz, 3 H), 1.00 (d, =6.9 Hz, 3 H), 1.23–1.37 (m, 1 H), 1.59 (dqd, =14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.95-2.08 (m, 1 H), 4.44 (s br, 2 H), 4.55 (d, =6.3 Hz, 1 H), 4.63–4.77 (m, 2 H), 7.14 (s, 2 H), 7.29–7.44 (m, 8 H), 7.52 (t, =7.7 Hz, 1 H), 7.64 (dt, =7.7 Hz, 1.4 Hz, 1 H), 7.89–7.93 ppm (m, 1 H), 7.94 (t, =1.5 Hz, 1 H); C NMR (CDOD): =11.8, 16.3, 26.7, 38.3, 48.7, 53.3, 59.1, 127.0, 128.3, 128.9, 129.0, 129.5, 130.0, 130.1, 130.16, 130.21, 130.8, 136.2, 137.5, 137.7, 138.1, 169.6, 173.8, 175.0 ppm; HRMS (ESI): / [+H] calcd for CHNO: 459.2284; found: 459.2287. : According to general procedure C, reaction of ester gave as a white semi-solid (47 mg, 64 %): []=+6.4; H NMR (CDOD): =0.97 (t, =7.4 Hz, 3 H), 1.03 (d, =6.7 Hz, 3 H), 1.06–1.25 (m, 2 H), 1.27–1.39 (m, 1 H), 1.54–1.69 (m, 1 H), 1.97–2.09 (m, 1 H), 3.22–3.29 (m, 1 H), 3.45–3.60 (m, 1 H), 4.54 (s br, 1 H), 4.56 (d, =6.4 Hz, 1 H), 4.80 (s, 1 H), 7.16–7.43 (m, 5 H), 7.49–7.65 (m, 2 H), 7.88–7.98 ppm (m, 2 H); C NMR (CDOD): =11.8, 12.7, 14.1, 16.3, 26.8, 38.3, 41.8, 44.9, 48.9, 53.7, 59.2, 126.7, 128.2, 128.7, 128.9, 129.2, 129.9, 130.1, 130.2, 130.6, 136.2, 138.1, 138.7, 169.6, 173.4, 175.1 ppm; HRMS (ESI): / [+H] calcd for CHNO: 397.2122, found: 397.2122. : According to general procedure C, reaction of ester gave as a white semi-solid (30 mg, 72 %): []=+9.7; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 1.02 (d, =6.8 Hz, 3 H), 1.07 (t, =7.1 Hz, 3 H), 1.29 (t, =7.1 Hz, 3 H), 1.31–1.39 (m, 1 H), 1.56–1.68 (m, 1 H), 1.08–2.08 (m, 1 H), 2.34 (s, 3 H), 3.08–3.28 (m, 2 H), 3.44–3.77 (m, 2 H), 4.55 (d, =6.5 Hz, 1 H), 7.39 (d, =8.0 Hz, 1 H), 7.70 (s, 1 H), 7.83 ppm (dd, =8.0 Hz, 1.8 Hz, 1 H); C NMR (CDOD): =11.8, 13.2, 14.3, 16.3, 19.1, 26.8, 38.2, 40.7, 44.7, 59.0, 126.0, 129.3, 131.9, 133.3, 138.2, 139.5, 169.5, 172.4, 175.1 ppm; HRMS (ESI): / [+H] calcd for CHNO: 349.2127, found: 349.2136. : According to general procedure C, reaction of ester gave as a white semi-solid (46 mg, 68 %): []=+7.3; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 1.02 (d, =6.9 Hz, 3 H), 1.24–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.97–2.07 (m, 1 H), 2.32 (s, 3 H), 2.75 (s, 2 H), 3.08 (s, 1 H), 4.39 (s br, 1 H), 4.56 (d, =6.7 Hz, 1 H), 4.66–4.87 (m, 1 H), 7.12 (d, =7.1 Hz, 1 H), 7.23–7.35 (m, 2 H), 7.35–7.44 (m, 3 H), 7.71–7.78 (m, 1 H), 7.80–7.86 ppm (m, 1 H); C NMR (CDOD): =11.8, 16.3, 19.2, 26.8, 33.5, 36.6, 38.2, 51.4, 55.8, 59.1, 126.2, 128.5, 129.0, 129.4, 129.5, 130.0, 130.1, 131.9, 133.6, 137.6, 138.2, 139.5, 169.5, 173.0, 175.1 ppm; HRMS (ESI): / [+H] calcd for CHNO: 397.2127; found: 397.2117. : According to general procedure C, reaction of ester gave as a white semi-solid (67 mg, 82 %): []=+5.5; H NMR (CDOD): =0.95 (t, =7.4 Hz, 3 H), 0.99 (d, =6.8 Hz, 3 H), 1.23–1.35 (m, 1 H), 1.58 (ddt, =11.7 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.96–2.05 (m, 1 H), 2.29 (s, 3 H), 4.28 (s, 2 H), 4.54 (d, =6.4 Hz, 1 H), 4.92 (s br, 2 H), 7.04–7.07 (m, 2 H), 7.20–7.44 (m, 9 H), 7.78 (s, 1 H), 7.81 ppm (dd, =7.9 Hz, 1.9 Hz, 1 H); C NMR (CDOD): =11.8, 16.3, 19.4, 26.7, 38.3, 48.8, 52.8, 59.0, 126.4, 128.7, 129.0, 129.1, 129.5, 129.8, 129.95, 130.02, 132.1, 133.3, 137.2, 137.5, 138.1, 134.0, 169.3, 173.5, 175.0 ppm; HRMS (ESI): / [+H] calcd for CHNO: 473.2440; found: 473.2445. : According to general procedure C, reaction of ester gave as a white semi-solid (48 mg, 71 %): []=+6.4; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 0.99 (d, =6.9 Hz, 3 H), 1.01–1.26 (m, 3 H), 1.26–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.95–2.07 (m, 1 H), 4.40 (s br, 1 H), 4.55 (d, =6.5 Hz, 1 H), 2.34 (s, 3 H), 3.07–3.40 (m, 2 H), 4.69–4.96 (m, 1 H), 7.11–7.16 (m, 1 H), 7.25–7.46 (m, 5 H), 7.69–7.77 (m, 1 H), 7.82 ppm (ddd, =13.8 Hz, 8.0 Hz, 1.9 Hz, 1 H); C NMR (CDOD): =11.8, 12.7, 13.8, 16.3, 19.3, 26.8, 38.4, 41.4, 44.3, 48.3, 53.2, 59.3, 126.1, 128.6, 128.9, 129.0, 129.3, 129.5, 129.9, 130.0, 132.0, 133.5, 137.9, 138.8, 139.7, 169.3, 173.0, 175.3 ppm; HRMS (ESI): / [+H] calcd for CHNO: 411.2278, found: 411.2289. : According to general procedure C, reaction of ester gave as a white semi-solid (31 mg, 58 %): []=+9.7; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 1.02 (d, =6.9 Hz, 3 H), 1.08 (t, =7.1 Hz, 3 H), 1.25 (t, =7.6 Hz, 3 H), 1.28 (t, =7.1 Hz, 3 H), 1.31–1.39 (m, 1 H), 1.62 (ddq, =14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.97–2.08 (m, 1 H), 2.61–2.72 (m, 2 H), 3.09–3.27 (m, 2 H), 3.39–3.56 (m, 1 H), 3.71 (s br, 1 H), 4.56 (d, =6.5 Hz, 1 H), 7.45 (d, =8.1 Hz, 1 H), 7.69 (s, 1 H), 7.88 ppm (dd, =8.1 Hz, 2.0 Hz, 1 H); C NMR (CDOD): =11.8, 13.1, 14.3, 15.4, 16.3, 26.8, 27.1, 38.3, 40.6, 44.8, 59.1, 126.1, 129.5, 130.4, 133.3, 137.7, 145.6, 169.4, 172.4, 175.0 ppm; HRMS (ESI): / [+H] calcd for CHNO: 363.2278, found: 363.2278. : According to general procedure C, reaction of ester gave as a white semi-solid (45 mg, 49 %): []=+4.2; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 1.02 (d, =6.9 Hz, 3 H), 1.18–1.28 (m, 3 H), 1.28–1.39 (m, 1 H), 1.54–1.67 (m, 1 H), 1.97–2.08 (m, 1 H), 2.60–2.73 (m, 2 H), 2.76 (s, 2 H), 3.08 (s, 1 H), 4.38 (s, 1 H), 4.55 (d, =6.5 Hz, 1 H), 4.60–4.80 (m, 1 H), 7.11–7.16 (m, 1 H), 7.23–7.36 (m, 2 H), 7.37–7.47 (m, 3 H), 7.72 (t, =7.5 Hz, 1 H), 7.87 ppm (dt, =8.1 Hz, 1.8 Hz, 1 H); C NMR (CDOD): =11.8, 15.5, 16.3, 26.8, 27.1, 33.5, 37.0, 38.2, 51.5, 56.0, 59.1, 126.4, 128.5, 129.0, 129.6, 129.8, 130.0, 130.1, 130.5, 133.6, 137.4, 138.2, 145.7, 169.6, 173.0, 175.1 ppm; HRMS (ESI): / [+H] calcd for CHNO: 411.2284; found: 411.2276. : According to general procedure C, reaction of ester gave as a white semi-solid (46 mg, 52 %): []=+5.7; H NMR (CDOD): =0.95 (t, =7.4 Hz, 3 H), 1.02 (t, =7.1 Hz, 3 H), 1.20 (t, =7.6 Hz, 3 H), 1.24 (t, =7.6 Hz, 3 H), 1.27–1.38 (m, 1 H), 1.51–1.66 (m, 1 H), 1.93–2.08 (m, 1 H), 2.59–2.70 (m, 2 H), 3.04–3.17 (m, 1 H), 3.61–3.86 (m, 1 H), 4.36 (d, =4.6 Hz, 1 H), 4.54 (d, =6.5 Hz, 1 H), 4.57–5.03 (m, 1 H), 7.10–7.16 (m, 1 H), 7.21–7.33 (m, 2 H), 7.34–7.45 (m, 3 H), 7.67–7.75 (m, 1 H), 7.86 ppm (dd, =8.1 Hz, 2.0 Hz, 1 H); C NMR (CDOD): =11.8, 12.6, 15.5, 16.3, 26.8, 27.2, 38.3, 41.3, 44.4, 48.1, 53.4, 59.1, 126.2, 128.6, 128.9, 129.0, 129.5, 129.9, 130.0, 130.5, 133.4, 137.4, 138.8, 145.7, 169.3, 173.0, 175.1 ppm; HRMS (ESI): / [+H] calcd for CHNO: 425.2440; found: 425.2442. : According to general procedure C, reaction of ester gave as a white semi-solid (138 mg, 46 %): []=+5.5; H NMR (CDOD): =0.96 (t, =7.4 Hz, 3 H), 0.98–1.03 (m, 3 H), 1.20 (t, =7.6 Hz, 3 H), 1.23–1.36 (m, 1 H), 1.53–1.65 (m, 1 H), 1.95–2.06 (m, 1 H), 2.63 (q, =7.4 Hz, 2 H), 4.29 (s, 2 H), 4.33–4.49 (m, 1 H), 4.52 (d, =6.3 Hz, 1 H), 4.90–5.22 (m, 1 H), 7.10 (d, =7.2 Hz, 2 H), 7.22–7.41 (m, 8 H), 7.43 (d, =8.1 Hz, 1 H), 7.76 (s br, 1 H), 7.85 ppm (dd, =8.1 Hz, 1.9 Hz, 1 H); C NMR (CDOD): =11.9, 15.5, 16.3, 26.7, 27.2, 38.5, 48.7, 53.0, 59.3, 126.2, 128.7, 129.05, 129.09, 129.7, 129.9, 130.0, 130.1, 130.6, 133.5, 137.0, 137.2, 138.2, 146.0, 169.2, 173.5, 175.5 ppm; HRMS (ESI): / [+H] calcd for CHNO: 487.2591, found: 487.2606. : According to general procedure C, reaction of ester gave as a white semi-solid (70 mg, 74 %): []=+15.4; H NMR (CDOD): =0.97 (t, =7.4 Hz, 3 H), 1.04 (d, =6.9 Hz, 3 H), 1.12 (t, =7.0 Hz, 3 H), 1.26 (t, =7.0 Hz, 3 H), 1.30–1.41 (m, 1 H), 1.63 (ddq, =14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.98–2.11 (m, 1 H), 3.27 (q, =7.0 Hz, 2 H), 3.56 (q, =6.9 Hz, 2 H), 4.58 (d, =6.4 Hz, 1 H), 7.44–7.49 (m, 2 H), 7.90–7.94 ppm (m, 2 H); C NMR (CDOD): =11.9, 13.2, 14.5, 16.3, 26.7, 38.3, 41.0, 45.0, 59.0, 127.5, 129.1, 136.6, 141.2, 169.7, 172.7, 174.9 ppm; HRMS (ESI): / [+H] calcd for CHNO: 335.1965, found: 335.1967. : According to general procedure C, reaction of ester gave as a white semi-solid (42 mg, 88 %): []=+13.2; H NMR (CDOD): =0.90–0.98 (m, 3 H), 0.98–1.05 (m, 3 H), 1.25–1.38 (m, 1 H), 1.60 (dt, =12.4 Hz, 7.5 Hz, 1 H), 1.96–2.06 (m, 1 H), 2.87 (s, 2 H), 3.02 (s, 1 H), 4.49–4.53 (m, 1 H), 4.55 (d, =6.5 Hz, 1 H), 4.75 (s br, 1 H), 7.16 (d, =7.4 Hz, 1 H), 7.24–7.39 (m, 4 H), 7.53 (d, =8.1 Hz, 2 H), 7.86 (d, =7.9 Hz, 1 H), 7.92 ppm (d, =8.1 Hz, 1 H); C NMR (CDOD): =11.8, 16.3, 26.7, 33.8, 37.7, 38.3, 51.9, 56.2, 59.1, 128.1, 128.2, 128.9, 129.0, 129.1, 129.3, 130.0, 130.1, 137.0, 137.7, 138.2, 140.5, 169.8, 173.0, 175.0 ppm; HRMS (ESI): / [+H] calcd for CHNO: 383.1965, found: 383.1968. : According to general procedure C, reaction of ester gave as a white semi-solid (20 mg, 57 %): []=+11.9; H NMR (CDOD): =0.95 (t, =7.4 Hz, 3 H), 1.01 (d, =6.9 Hz, 3 H), 1.25–1.38 (m, 1 H), 1.60 (ddq, =14.9 Hz, 7.5 Hz, 4.3 Hz, 1 H), 1.95–2.07 (m, 1 H), 4.43 (s br, 2 H), 4.54 (d, =6.3 Hz, 1 H), 4.71 (s br, 2 H), 7.14 (d, =6.9 Hz, 2 H), 7.26–7.40 (m, 8 H), 7.54–7.59 (m, 2 H), 7.86–7.91 ppm (m, 2 H); C NMR (CDOD): =11.9, 16.3, 26.7, 38.4, 48.7, 53.2, 59.2, 127.9, 128.3, 128.9, 129.2, 129.4, 130.0, 130.1, 137.1, 137.5, 138.1, 140.4, 169.7, 173.8, 175.2 ppm; HRMS (ESI): / [+H] calcd for CHNO: 459.2278, found: 459.2289. : The human embryonic kidney 293 (HEK-293) cell line stably expressing human Flag-AT receptor was a generous gift from Dr. Richard Leduc (Department of Pharmacology, Université de Sherbrooke, Sherbrooke, Quebec, Canada) and prepared as previously described.[] The native 293/FRT cell line (HEK-293 cell line with single genome-integrated recombinase target site (FRT)) was maintained in high-glucose DMEM with 7 % FBS, 2 m GlutaMAX and 100 μg mL zeocin. The stable cell line stably expressing the human AT receptor was established as described previously.[] First, the forward primer containing a III restriction site and a Myc epitope (ttaaacttaagcttaccatggaacaaaaactcatctcagaagaggatctgatgaagggcaactccacc) was used with a reverse primer containing a I site (agcaagcaagacacatgtcgacttaagacacaaaggtctcc) with the Expand High Fidelity PCR System (Roche) to create a III-Myc-AT receptor-I fragment, which was cloned into pcDNA5/FRT between its III and I sites, thus creating the pcDNA5/FRT/Myc-AT R vector. Then, the cell line stably expressing Myc-human AT receptor (293/FRT/Myc-hATR) was generated by recombinase-mediated homologous recombination system (Flp-In™) and was maintained with 100 μg mL hygromycin B.[] : This study was performed at Cerep (France) according to literature.[–] The assays were performed in HEK-293 cells transfected with recombinant human ATR or ATR and relying on the displacement of [I]CGP-42112 A (ATR)[] and [I][Sar, Ile]Ang II (ATR)[] with radiolabeled Ang II as reference compound in the ATR assay and radiolabeled saralasin [Sar, Val, Ile]Ang II in the ATR assay. Unlabeled Ang II was used for nonspecific binding in both the ATR (1 μ) and ATR (10 μ) assay. In the initial screen the % inhibition of [I]CGP-42112 A (ATR) or [I][Sar, Ile]Ang II (ATR) binding was measured at 1 and 10 μ of the compounds. The values were determined from at least six data points with test concentrations ranging from 30 p to 1 m. The concentration range was adjusted to be appropriate for the expected values. : Binding studies were conducted in HEK-293 transfected cells with human ATR or ATR and were performed as recently described.[] Briefly, the analogue [Sar, Ile]Ang II was iodinated by the Iodogen method, and binding assays were performed on cultured cells. The hormone binding reaction was initiated by addition of 0.1 n of [I][Sar, Ile]Ang II (1000 Ci mmol) to each Petri dish (1.0×10 cells/Petri dish) either alone (total binding) or in the presence of increasing concentrations of Ang II or the ligands under investigation, including 10 μ Ang II for nonspecific binding (which represents less than 10 % of total binding). Incubations were performed in duplicate for 30 min at RT (22 °C). After incubation, cells were rapidly detached from the substratum with a rubber policeman; cells and media were filtered through Whatman GF/C filters (presoaked overnight in 2 % BSA), rinsed three times and counted in a Beckman γ-counter. The endogenous ligand Ang II, the selective nonpeptide AT antagonist losartan, the selective AT agonist CGP42112 A, and the selective nonpeptide AT antagonist PD 123,319 were used as reference compounds for the binding studies. In radioligand binding experiments, IC values were obtained by fitting radioligand competition data to a sigmoidal function by use of a nonlinear least-squares program (GraphPad Software Inc., San Diego, CA). values were determined using the Cheng–Prusoff equation: =IC/(1+/) where is the radioligand concentration and is the value for the radioligand.

Physical appearance plays a central role in social interactions. “What is beautiful is good” wrote the Greek poet Sappho almost three millennia ago, and this affirmation still holds true in our society. Tangible proof of the prominent role of beauty in our society is the $220 billion (worldwide annual US dollars) in revenues that was obtained in 2012 by the companies in the cosmetics sector. There is a tight connection between external appearance and age: young looks are associated with beauty, and that is why people try to keep hold of their youth. When dealing with aging and appearance, however, clear terminology is required. “Chronological age” is typically defined as a person’s lifespan, that is, the amount of years that have passed since that person was born. Because tissues deteriorate at different rates depending on the individual, this concept fails to provide a clear indicator of the aging process. Therefore, the term “biological age” has been coined to describe the functional status of an individual in reference to others possessing the same chronological age. Among the collection of changes that accompany the aging process, the progressive deterioration of external appearance is probably the most notorious one. Accounting for this, the term “perceived age” comes into play, defined as the age that a person is visually estimated to be on the basis of physical appearance. In all cases, years and months thereof are used as standard measurement units. A close link between biological and perceived age has been identified, because people who retain their functional capabilities usually show a younger appearance. So, perceived age is a good estimate of health in elderly populations, and hence it was recently shown to be a clinical marker for assessment of “healthy” aging. Subjects looking old for their age had a greater risk of both morbidity and mortality. Also, higher perceived age has been associated with high serum glucose levels, cortisol levels, and depression., More importantly, neither perceived age nor biological age are strictly dependent on chronological age, a fact that has profound implications for the cosmetic industry. Some people display an astonishingly young look in relation to their appearance, whereas others – sometimes, one of two twins – deteriorate much more rapidly. These differences can be a result of various intrinsic and extrinsic factors including, but not limited to, exposure to sunlight, pollution, nicotine, and diet or sleeping habits. Nongenetic factors have a great contribution to perceived age: changes in facial features, as skin wrinkling, skin color homogeneity,, lip size, and sag have all been linked to perceived age. The cosmetic industry uses perceived age assessment to determine the efficacy of treatments – for example, to quantify the efficacy of multisyringe hyaluronic acid treatment or plastic surgery. Perceived age is measured by clinical assessment, conventionally through photographic images., Still, as the Irish novelist Margaret Wolfe Hungerford immortalized in her classic , “beauty is in the eye of the beholder”: despite the use of accepted grading scales, estimation of age relies on subjective human assignments. In addition, hiring an entire team of experts is expensive and time consuming, and hence not feasible for large-scale assessments. Therefore, there is a need for an objective method to determine the perceived age of a person in a faster, cheaper, and standardized manner. The diagnosis of a person’s perceived age could be applied as an easy and noninvasive method to estimate a person’s health in the same way that abdominal girth is a marker of metabolic syndrome or cardiovascular events, as well as to evaluate the efficacy of cosmetic treatments such as contact thermography, morphometric measures of thigh circumference, and microcirculation evaluation of cellulite. In the present article, a new and standardized method for diagnosing perceived age is described and subsequently applied to a group of volunteers. This method consists of a mathematical algorithm that measures phenotypic features of individuals and classifies them to evaluate a person’s skin aging. The measurement of a person’s perceived age over time could be useful for the validation of treatments such as cosmetic treatment, aesthetic surgery, exercise, nutritional complements, diets, and alternative therapies including relaxation, laughter therapy, personal growth therapy, and nutritional complements. d e s i g n e d a n a r t i f i c i a l n e u r a l n e t w o r k ( A N N ) a l g o r i t h m t h a t p r o v i d e s a n o b j e c t i v e e s t i m a t i o n o f a n i n d i v i d u a l ’ s p e r c e i v e d a g e o n t h e b a s i s o f p h e n o t y p i c f e a t u r e s . T h u s , p h e n o t y p i c d a t a i s t h e i n p u t v a l u e o f t h e a l g o r i t h m , w h e r e a s p e r c e i v e d a g e i s t h e o u t p u t . I n o r d e r t o t e s t t h e v a l i d i t y o f t h e m e t h o d a n d c h e c k i t s a c c u r a c y , i t w a s a p p l i e d t o a g r o u p o f v o l u n t e e r s o f a g e s r a n g i n g f r o m 4 1 t o 4 9 y e a r s o l d . A new and standardized method for diagnosing perceived age has been developed to replicate the clinical assessment performed by an expert panel. The method learns from the combination of two sets of data: phenotypic, objective and quantifiable variables, and expert assignments by qualified dermatologists. We selected 22 variables as main contributors to perceived age estimation (). For example, our results indicate that the length of the nasogenian groove (11.67%) contributes to perceived age in a much more significant manner than depth of wrinkles (1.61%) or melanin concentration (0.10%). Considering the individual relevance of each variable in accordance with these values, we have developed an algorithm able to make an estimation of perceived age. The algorithm was able to correctly classify the samples with an accuracy of 92.04%, where the accuracy is the capability to predict the perceived age estimated by the experts, having as input variables the 22 selected ones. Therefore, we have demonstrated that the suggested method is valid for determining perceived age of a subject in a standardized, consistent manner. There is an urgent need for objective, quantitative, and standardized rating methods capable of performing an accurate diagnosis of perceived age. In this paper, we propose a novel artificial intelligence-based method that successfully emulates and improves the clinical assessment performed by an expert panel. With an accuracy of 92%, it can represent a valid substitute for traditional approaches, which are costly, time-consuming, and potentially unreliable. Expert assessments rely on human subjective assignments exposed to individual bias. That is, there may be differences in judgment between experts, and also the criteria of one individual might change with time. Furthermore, the recruitment of a panel of dermatologists is time-consuming and entails considerable cost. In comparison, a computerized method is free from these shortcomings. The ability to quantify the aesthetic signs of aging on the basis of a given set of parameters is highly appealing for the cosmetics industry. Potential applications include the design of a personalized treatment for an individual depending on his or her apparent age, or keeping track of the response to anti-aging treatment. Also, it could be used as a validation criterion for treatments comprising cosmetics, aesthetic surgery, alternative medicine, exercise, or diets. Going even further, as there is a clear relationship between perceived age and biological age, our method could be employed to evaluate the overall health status of an individual in an age group (41–49 years old) where the most cost-effective interventions (therapeutic or of lifestyle changes) can be applied.

Psoriasis (PsO) is an immune-mediated chronic disease that can affect both the skin and joints. It is characterized by well demarcated, erythematous plaques with an overlying silvery scale classically distributed on the extensor surfaces, scalp, and trunk, although it can affect any area of the skin (). Approximately 1% to 3% of the population suffers from PsO. Plaque PsO is the most common clinical form affecting approximately 80% of PsO patients. Other forms of PsO include guttate, pustular (generalized and localized), erythrodermic, and palmoplantar disease. PsO has been associated with a number of comorbid conditions including the metabolic syndrome, cardiovascular disease, inflammatory bowel disease, anxiety, depression, and of course psoriatic arthritis (PsA). PsA is a seronegative arthritis affecting up to 30% of patients with plaque PsO and has multiple clinical presentations., It is typically classified into five subtypes: asymmetric oligoarticular arthritis, symmetric polyarthritis, distal interphalangeal arthritis, spondylitis with or without sacroiliitis, and arthritis mutilans. Physical findings in patients with PsA can also include enthesitis and dactylitis (). The most common form of PsA is asymmetric, although any of these types of PsA can erode and destroy affected joints leading to loss of functional abilities and a considerable decline in quality of life. Treatment of psoriatic skin disease is based on disease severity and includes topical therapies for milder patients, phototherapy for mild to moderate disease, and oral systemic and biological agents in patients with moderate to severe skin disease. These therapeutic strategies can be used as monotherapy or in various combinations. Similarly, PsA treatment is based on disease severity and response to therapy and includes nonsteroidal anti-inflammatory drugs for milder cases and disease modifying antirheumatic drugs, such as methotrexate and other immunosuppressants, and anti-tumor necrosis factor (TNF)-α as well as the newer anti-interleukin (IL)-12/23p40 agents (ustekinumab) for more severe forms. Biological therapies have revolutionized the management of PsO and PsA. In 1984, Köhler, Milstein, and Jerne were given the Nobel Prize in Physiology or Medicine for developing this novel technology (nobelprize.org). Since then, a myriad of biological therapies have been created to treat a number of inflammatory, immune-mediated diseases. Biological therapies include monoclonal antibodies as well as recombinant fusion receptor proteins, such as etanercept. TNF-α plays a major role in the pathophysiology of both PsO and PsA. TNF-α levels are elevated in psoriatic skin lesions, serum samples, and synovial fluid. Anti-TNF-α therapy has shown efficacy in treating psoriatic skin lesions, joint pain and swelling, enthesitis, and dactylitis plus the ability to improve mobility, reduce radiographic progression of disease, and influence quality of life parameters. TNF-α inhibitors which are currently approved to treat PsO and PsA include etanercept, adalimumab, and infliximab while two additional anti-TNF-α agents, golimumab and certolizumab, are only approved for use in PsA. Etanercept was the first TNF-α inhibitor to be approved for use in PsO and PsA. It is a dimeric, soluble fusion protein consisting of the extracellular ligand binding portion of the TNF receptor linked to the Fc portion of human IgG1 (). It is capable of binding and neutralizing soluble TNF and transmembrane TNF. Furthermore, it alters neutrophil migration and dendritic cell and T-cell maturation and migration, thus decreasing the local and systemic production of pro-inflammatory cytokines and their subsequent effects., Etanercept was synthesized in the early 1990s and first tested in humans in 1992. In 2002 and 2004, etanercept was approved by the United States Food and Drug Administration for the treatment of PsA and in adult PsO patients, respectively. The recommended regimen for etanercept for patients with PsO is 50 mg twice weekly for 3 months, followed by a maintenance dose of 50 mg weekly. In children, doses of 0.8 mg/kg are used (up to a maximum of 50 mg) weekly. For PsA the recommended dose of etanercept is 50 mg weekly. This article will review available data on long term efficacy and safety of etanercept in PsO and PsA. The first multicenter, double-blind, placebo-controlled Phase III study took place in 652 patients with moderate to severe PsO who were randomized to either 25 mg weekly (QW), 25 mg twice weekly (BIW), or 50 mg BIW of etanercept or placebo. At week 12, 49%, 34%, and 14% of patients on 50 mg BIW, 25 mg BIW, and 25 mg QW, respectively, achieved a 75% decrease in Psoriasis Area and Severity Index (PASI) 75 scores as opposed to 4% of patients receiving placebo (<0.001 for all three comparisons). At week 24, the percentage of patients achieving PASI 75 increased to 59%, 44%, and 25% of patients in the 50 mg BIW, 25 mg BIW, and 25 mg QW groups, respectively. Twenty-eight percent of the 652 randomized study subjects did not reach PASI 50 at any point during the trial (PASI 50 nonresponders) and were enrolled in a 36-week open label extension receiving 50 mg QW. During the 36-week open label extension, 72% and 38% of subjects received treatment through to at least week 48 (week 24 of open label extension) and week 60 (week 36 of open label extension), respectively. At week 36 (week 12 of open label extension), 43% of the PASI 50 nonresponders achieved PASI 50 or better response, and at week 60 (week 36 of open label extension), 55% and 23% of subjects achieved PASI 50 and PASI 75 responses, respectively. The mean percentage improvement for this group of PASI 50 nonresponders increased from 26.6% at week 24 (open label baseline) to 49.3% at week 60 (open label week 36). The quality of life, assessed by the Dermatology Life Quality Index (DLQI) showed a mean improvement of 38.8% from the initial baseline (). In 2007, Tyring et al published data on the 84-week open label extension of a Phase III, randomized, double-blind, placebo-controlled, multicenter study evaluating the efficacy and safety of 50 mg BIW of etanercept versus placebo at 12 weeks. In the open label extension, 591 of the original 618 subjects received etanercept 50 mg BIW for an additional 84 weeks, regardless of their treatment group prior to week 13. At week 24 (week 12 of open label extension) in the placebo/etanercept group, subjects achieved clinical improvement comparable to those patients in the original etanercept group at week 12. By week 96, PASI 50, PASI 75, and PASI 90 response rates were 79.1%, 51.6%, and 22.8%, respectively, for the placebo/etanercept group and 82.6%, 51.1%, and 23.2%, respectively, for the etanercept/etanercept group. PASI 75 responses reached a plateau at week 48 and of the subjects who achieved a PASI 75 response at week 48 and were reevaluated at week 96, 74.4% maintained a PASI 75 response. Among the reasons for the observed loss of efficacy was lack of patients’ adherence to the therapeutic regimen. In patients who were less than 90% adherent to therapy, responses declined by more than 20% from week 48 to 96, in comparison with a decrease of only 10% in patients with at least 90% adherence. Of the subjects who did not achieve a PASI 75 at week 48, 17.4% were PASI 75 responders at week 96. Mean baseline DLQI scores for the placebo/etanercept and etanercept/etanercept groups were 12.5 and 12.1, respectively, and at week 96 those values had decreased to 3.7 and 3.5, respectively, with the only statistically significant DLQI response rates occurring at week 12 between the treatment and placebo groups (77% versus 40%, <0.001). Of note, during the initial 12 week study, fatigue and depression were assessed with the functional assessment of chronic illness therapy fatigue (FACIT-F) scale, the Hamilton Depression Rating Scale (Ham-D), and the Beck depression inventory (BDI). BDI and Ham-D improvement rates were 55% for the etanercept group versus 39% for the placebo group (=0.001) and 43% for the etanercept group versus 32% for the placebo group (=0.0048), respectively. Furthermore, fatigue scores also improved showing at week 12 that patients receiving etanercept had an improvement in FACIT-F of 58% compared with 43% in those receiving placebo (=0.0001). Interestingly, 18.3% of patients in this long term study were found to have anti-etanercept antibodies. However, these antibodies were determined to be nonneutralizing and did not appear to affect efficacy of treatment. Although this figure of 18.3% of subjects was higher than previously reported proportions (approximately 6% of adult patients with rheumatoid arthritis, PsA, ankylosing spondylitis, or plaque PsO), all prior studies also indicated that these antibodies had no effect on efficacy or safety profiles. Two randomized, double-blind, placebo-controlled, multicenter American and global Phase III trials,, were followed by an open label extension study published in 2010 by Leonardi et al. In this study, subjects initially received 50 mg etanercept QW for the first 12 weeks. Thereafter, eligible patients could maintain the 50 mg QW dose or escalate to 50 mg BIW based on a lack of clinical response (inability to achieve of PASI 75, significant residual disease, or residual disease in highly aesthetic or functional areas of significance) and continue the chosen therapy for up to 72 weeks. Of the 912 subjects enrolled in the extension study, 818 (89.7%) completed 48 weeks of treatment, and 485 subjects (53.2%) completed 72 weeks of treatment. Five hundred ninety-one subjects (64.8%) increased their dose to 50 mg BIW at some point after week 12 while the remaining 321 subjects (35.2%) maintained their dose at 50 mg QW. The mean weights were higher in the increased dose versus maintained dose groups (93.2 kg versus 87.6 kg). Similarly, baseline mean PASI scores of the parent (19.5 versus 17.7) and extension studies (6.3 versus 8.8–8.9) were higher in the increased dose group compared to the maintained dose group. In the maintained dose group, the percentage improvement in the mean PASI score was 65% at baseline of the extension and 75%, 77%, and 75% at weeks 12, 48, and 72, respectively, while mean percentage of improvement in the mean PASI score for the increased dose group was 54% at baseline and 60%, 67%, and 67% at weeks 12, 48, and 72, respectively. Furthermore, a Physician’s Global Assessment (PGA) score of 0 or 1 remained stable during the extension and was achieved by 54% and 51% of subjects at weeks 48 and 72, respectively, in the maintained dose group. In the increased dose group, a PGA score of 0 or 1 was achieved by 28% of subjects who increased their dose at week 48 and 27% at week 72. In subjects without dose escalation, PASI 50, 75, and 90 were observed in 90%, 60%, and 27%, respectively, at week 72. In the increased dose group, PASI 50, 75, and 90 responses were observed in 83%, 43%, and 10% of subjects, respectively, at week 72. Mean DLQI scores were improved by 55% at baseline of the extension, by 76% at 48 weeks in the maintained dose group, and by 45% and 64% at baseline and week 48, respectively, in the increased dose group. In 2012 Papp et al performed a post hoc analysis on prospective efficacy and safety data for up to 4 years of etanercept use in PsO from a cohort of 506 Canadian patients who had participated in at least one of four previous studies.,,,, Subjects had received either etanercept 25 mg BIW, 50 mg QW, or 50 mg BIW, based on the trial with which they had commenced therapy. This study represents the longest published experience to date as previously published data did not extend beyond 2.5 years. Effectiveness endpoints were changes from baseline DLQI and static PGA scores completed at 3 month intervals throughout the course of the studies. Across all studies, 29.1% of subjects discontinued therapy prematurely. The most common reasons for premature discontinuation were withdrawal of consent and disease progression (11.3% and 5.5%, respectively). At baseline, the mean DLQI score for subjects included in the cohort was 11.1±6.5 and the mean static PGA score was 3.2±0.7, with 86.8% of subjects scoring 3 to 5 points (moderate to very severe) and only one (0.2%) subject scoring 1 (almost clear). In the as-treated analysis, 74.3% were DLQI responders at 3 months and 75.9% achieved DLQI responses through 48 months. The proportion of subjects scoring clear or almost clear on the static PGA scale was 45.3% and 41.6% at 3 and 12 weeks, respectively. However, by 24 months, the proportion of patients had dropped to 28.6% and was maintained at 29.2% and 27.8% at months 36 and 48, respectively. In addition, over the entire 48-month period, 141 (27.9%) subjects had treatment gaps of greater than 8 weeks between study protocols. At 12 weeks after restarting therapy, DLQI response improved to a level similar to that seen before stopping therapy. Mean DLQI prior to stopping therapy was 3.0 with 73% of subjects as responders. At restart of therapy, mean DLQI and proportion responders were 8.6% and 29.8%, respectively, and 12 weeks after restarting therapy, mean DLQI and proportion responders were 2.6% and 77.9%, respectively. Static PGA response followed a similar trend after a treatment gap, as patients recovered static PGA response at 12 weeks after restarting therapy and maintained response through 24 weeks after a treatment gap. This study was the first of its kind and showed that etanercept is effective in long term treatment of PsO, sustaining treatment response for up to 4 years. It is worth noting that PsO has several associated comorbidities, including cardiovascular disease and metabolic syndrome. A retrospective study found that etanercept was associated with a significant reduction of myocardial infarction (MI) risk (hazard ratio, 0.53; 95% confidence interval [CI] 0.31–0.92). There were no statistically significant changes of MI risk associated with the length of the treatment. A separate Italian cohort followed 210 patients for 24 months to assess response in metabolic parameters. Patients were assigned into three groups and treated with etanercept, adalimumab, or methotrexate. The number of PsA patients affected by metabolic syndrome did not change significantly in the different treatment groups. However, there was a trend toward a reduction in the metabolic syndrome prevalence in the etanercept and adalimumab groups at 24 months of therapy. #text The long term safety profile of etanercept has been examined in patients with moderate to severe plaque PsO for up to 4 years in a series of connected trials, reviews of the literature, and a registry of patients. Krueger et al performed an open label extension study with PsO patients (n=157) who did not achieve PASI 50 during the initial clinical trial. Etanercept 50 mg QW was well tolerated in the PASI 50 nonresponders for up to 60 weeks. Exposure-adjusted rates (EARs) of all AEs and infections were similar to those observed during the initial 12-week double-blind portion of the study. During the 60 week extension, most AEs were of mild to moderate intensity. Four patients had injection site reactions (3, mild intensity; 1, moderate). Seven patients discontinued the open label study because of AEs. One patient had a serious infection (cellulitis), and one patient died approximately 1 month after the last dose of the study drug. The death was not considered to be related to study treatment (–). In a study by Tyring et al, subjects were treated for the first 96 weeks with 50 mg of etanercept BIW totaling 908.9 patient-years (PY) of exposure over the course of the study. Injection site reactions occurred more frequently in patients treated with etanercept. Although overall EARs were similar among the two groups, EARs of noninfectious AEs for placebo and etanercept exposures were 418.8 and 158.0 events per 100 PY, respectively, and the EARs for serious noninfectious AEs were 6.1 and 7.7 events per 100 PY, respectively. The most common serious noninfectious AEs reported for etanercept exposure were MI (0.4 events per 100 PY), basal cell carcinoma (BCC) (0.3 events per 100 PY), and depression (0.3 events per 100 PY) (). None of these common, serious noninfectious AEs were reported after placebo exposure. The EARs of infections and serious infections were similar between placebo and etanercept exposures (130.5 and 103.9 events per 100 PY and1.5 and 1.2 events per 100 PY, respectively). The most frequent type of infection was upper respiratory tract infection at 24.3 and 20.2 events per 100 PY for placebo and etanercept exposures, respectively. Ten patients reported serious infections during the open label period, including two patients with cellulitis. Viral meningitis was the only serious infection considered possibly related to the study drug by the investigator. The EARs of AEs did not increase with longer term exposure to etanercept. Two deaths occurred during the study. One patient died of cardiac arrest 11 months after initiating etanercept therapy. The second patient died of a suspected MI approximately 10 months after initiating etanercept therapy. The latter event was reported as having a reasonable possibility to be related to the investigational product. The observed number of malignancies in this study did not significantly differ (standardized incidence ratio 0.88; 95% CI 0.56–1.33) from the expected number seen in the psoriatic population who had severe disease and who were receiving systemic therapy. Two patients experienced worsening of heart failure, one of which was considered to be possibly related to the investigational product. No events of demyelination, tuberculosis, or opportunistic infection were reported. In the Leonardi et al open label extension study, etanercept was generally well tolerated. The study showed serious infections rates of 1.9 and 0.9 events per 100 PY in the 50 mg BIW and in the 50 mg QW group, respectively. Nevertheless, no significant differences in EARs of AEs, severe adverse events (SAEs), or infections were observed between patients who increased their dose of etanercept to 50 mg BIW versus those who maintained their dose at 50 mg QW. Seventeen serious infections occurred in 12 patients during the extension study. The most common serious infections were three events of pneumonia in the 50 mg QW group and two events of cellulitis in the group that increased the dose. Fifty-nine serious noninfectious AEs occurred in 46 patients during the extension study. The most common serious noninfectious events were two events of subdural hematoma in the QW group and two events of MI and nephrolithiasis in the 50 mg BIW group. No cases of tuberculosis, opportunistic infection, demyelinating diseases, or lymphoma were reported during the extension study. The rate of all malignancies in this study was 1.5 events per 100 PY and a comparable rate of malignancies was reported in the Medicaid program (1.9 events per 100 PY for patients with less severe PsO and 2.9 events per 100 PY for patients with severe PsO). The number of observed squamous cell carcinomas (SCCs) was not significantly different from the expected number in the Arizona-based data (a highly sun-exposed population), but it was significantly higher than the expected number in the Minnesota-based data (a less sun-exposed population). The number of observed BCCs was significantly lower than the expected number in the Arizona-based study. Nonneutralizing antibodies to etanercept were detected in 15.2% of patients. The safety of etanercept appeared to be similar in patients who tested positive for antibodies to etanercept when compared with those who tested negative. In a long term review, Pariser et al analyzed short and long term safety of etanercept to determine the associated risk with higher doses or extended exposure. The study involved 4,410 patients and the total number of years of exposure was 4,775.1. The rates of noninfectious and infectious AEs did not increase as the dose of etanercept increased. Moreover, the rates of AEs did not increase over time. The rates of serious noninfectious and infectious AEs were similar between the etanercept treatment groups analyzed; they were also stable over time and the AE rates reported in the long term analyses are consistent with those reported in the short term analyses. The most commonly reported noninfectious AEs were headache, arthralgia, injection site hemorrhage, and back pain. The most commonly reported infectious AEs were upper respiratory tract infection, nasopharyngitis, sinusitis, and influenza. Data analysis with respect to malignancies showed an increased risk for developing SCC. The Papp et al post hoc study analyzed a total of 1305.4 PY of etanercept exposure. The EARs for all AEs and SAEs were 243.5 and 7.8 events per 100 PY, respectively. The EAR for all AEs was decreased for every year on therapy, although the rates of SAEs were sustained. The most common SAE included MI (0.6 events per 100 PY) and BCC (0.3 events per 100 PY). The rate of SAE occurred at a rate smaller than 1.0 event per 100 PY of exposure. The EAR for all infectious and serious infectious AE at study completion was 96.9 and 0.9 events per 100 PY, respectively. Infection rates were similar while on etanercept therapy, regardless of the dose received. No cases of tuberculosis or opportunistic infections were reported. Nineteen malignancies (EAR of 1.5 per 100 PY) were reported at study completion and were not considered to be related to etanercept. The incidence rate of all malignancies, excluding nonmelanoma skin cancer (NMSC), observed at study completion was consistent with the expected rate in the general population. No statistically significant difference was seen between the observed and expected rates of BCC and SCC with either comparator database. EARs for all reported cardiovascular events (n=37) and serious cardiovascular events (n=22) were 2.8 and 1.7 events per 100 PY, respectively. There was no apparent association of MI or cerebrovascular accident with respect to length of exposure to etanercept. Two other deaths were reported in the cohort. The OBSERVE-5 interim analysis evaluated data from 2,511 patients initially enrolled in a registry for up to 3 years. A total of 145 patients discontinued etanercept because of one or more AEs; the most common of these events were cellulitis (n=8), pneumonia (n=8), hypoesthesia (n=6), paresthesia (n=5), dyspnea (n=4), and worsening PsO (n=4). Thirty patients died during the follow-up period. However, the relationship of these deaths to etanercept was thought to be unrelated to etanercept. A total of 290 patients had one or more SAEs, including 82 patients with one or more serious infectious events and 61 patients with one or more serious infectious events requiring hospitalization. A total of 459 patients had one or more events of medical interest. The number of events of NMSC, lymphoma, and all cancers combined excluding NMSC and serious infectious events requiring hospitalization in this registry was not higher than that expected for patients with PsO using nonbiologic systemic therapies when compared to data from a large administrative health claims database. Four-year data from this registry is pending publication. Several studies have also evaluated safety and efficacy of retreating patients after discontinuing etanercept. One study with 2,546 patients evaluated continuous versus interrupted treatment with etanercept 50 mg weekly after 12 weeks of treatment with etanercept 50 mg BIW. The primary endpoint was a PGA ≤2, and loss of response was defined at PGA >2. In the interrupted treatment group, patients were restarted after loss of response. The proportion of responders was higher in the continuous treatment group (71.0% versus 59.5%, <0.0001) with a similar rate of AEs and SAEs in both groups. A separated trial evaluated interruption of etanercept therapy after 24 weeks and showed that after 12 weeks of retreatment, severity scores were similar to those initially obtained in the first 12 weeks of treatment. Treatment was restarted after loss of 50% of PASI response seen previously at week 24. A post hoc analysis evaluated the retreatment response of 226 moderate to severe PsO patients. Patients were treated with etanercept 50 mg BIW and discontinued treatment after 12 weeks or upon achieving PGA ≤2. Treatment with etanercept 25 mg BIW was restarted for up to 24 weeks or after achieving a PGA score of ≥3. Eighty-three percent of the patients recaptured a clinical response of a PGA ≤2 after retreatment. No safety concerns appeared to be associated with retreatment and no events of special medical interest (eg, tuberculosis, histoplasmosis, or demyelinating disease) were reported (). In two large PsA trials,, subjects showed AEs and infections at similar rates in both the etanercept and placebo groups during the initial 24 week period. Most events were of mild or moderate intensity. SAEs occurred in four patients in the etanercept group and included chest pain, renal calculus, syncope, and multiple sclerosis. In the placebo group, four patients experienced SAEs, including one patient who died. Laboratory abnormalities were of mild or moderate intensity during the study. During the 24-week open label extension, AEs and infections occurred at comparable or lower rates than those observed during the initial 24 weeks, with no deaths reported. No anti-etanercept antibodies were detected in any patient in the study. During the 48 weeks of the extension study, there were also no deaths. SAEs were reported in 19 patients. All were considered unrelated to etanercept except for one patient who developed pneumonia. Rates per PY of upper respiratory infection, sinusitis, urinary tract infection, flu syndrome, pharyngitis, and bronchitis were similar to those observed during the randomized phase of the study. Injection site reactions occurred in 10% of patients in the original etanercept group, compared with 27% of patients in the original placebo group. All were mild or moderate in severity. Overall, rates of AEs during the maintenance and open label periods were similar to or lower than those observed during the first 24-week double-blind treatment. Among the AEs reported in several studies, new onset or paradoxical exacerbations of PsO have been reported with all TNF-α inhibitors, including etanercept., In patients without PsO (eg, rheumatoid arthritis), one study reported that etanercept had the lowest rate of new onset PsO of all of the anti-TNF therapies. It is important to notice that despite these results, medically important events that have been reported with anti-TNF therapies, include, among others, demyelinating diseases, opportunistic infections, and tuberculosis (). Over the past decade, several registries across the world have gathered long term safety data on the use of biologics in different diseases. The British Society for Rheumatology Biologics Register reported data about the efficacy and safety of TNF-α inhibitors (etanercept, infliximab, and adalimumab) in PsA. Patients treated with etanercept 50 mg/week (n=333) had an improvement of mean Disease Activity Score (DAS) 28 from 6.1 at baseline to 3.3 at 18 months. SAEs in this cohort were not separated by specific treatment. The incidence rate ratios of the TNF-α group when compared with controls was not increased (0.9; 95% CI 0.8–1.3). The Spanish registry of biological therapies in rheumatic diseases (BIOBADASER) reported safety findings concerning the use of biologics in several publications., Their findings showed that AEs related to administration (ARR) of TNF-α antagonists are more common with infliximab (ARR rate of 28 per 1,000 PY) when compared to etanercept or adalimumab (ARR rate of 0.2 per 1,000 PY). Up until 2008, there were three reported cases of demyelinating disease in PsA patients treated with TNF-α inhibitors, none of which was related to etanercept. According to BIOBADASER 2.0, PsA did not increase the risk of developing cancer in patients exposed to TNF-α inhibitors (n=727 patients, bivariate incidence rate ratio 0.97; 95% CI 0.49–1.92). The use of etanercept in combination with ultraviolet B (UVB) phototherapy for treating PsO has been evaluated in several short term trials.– A 12-week open label study evaluated the efficacy of etanercept 50 mg BIW in combination with narrow band UVB (NBUVB) phototherapy in 86 patients. At week 12, 58.1% of subjects achieved PASI 90 response and 84.9% of subjects achieved PASI 75. A separate trial comparing the response to etanercept monotherapy versus etanercept plus NBUVB in 13 patients found the reduction in the modified PASI was significantly higher in the etanercept plus NBUVB group (=0.011, 95% CI −19% to −3%) over a 6 week period. In addition, a retrospective study comparing the efficacy of psoralen plus ultraviolet A (PUVA) light versus etanercept found PUVA responses to be higher than those of etanercept (PASI 90: 69% and 29%, PASI 75: 86% and 39%, and PASI 50: 89% and 84% for PUVA and etanercept, respectively). The limitations of this study include the number of patients (PUVA n=118 and etanercept n=38), the retrospective design, and treatment length (12 weeks for etanercept and treatment completion for PUVA). It has been previously established that long term PUVA therapy (>250–300 treatments) increases the risk of NMSC (adjusted relative risk 8.6, 95% CI 4.9–15.2) and melanoma (relative risk 5.4, 95% CI 2.2–11.1). As such, although the combination of phototherapy and etanercept can be clinically useful, this combination should be recommended only for short term use to avoid increasing the risk of skin malignancies. Methotrexate is the most widely used systemic treatment for PsO. Several studies have evaluated its use in conjunction with etanercept. A 24-week randomized, controlled trial assessed the combination of etanercept plus methotrexate to treat PsO. At week 24, PASI 75 was achieved in 77.3% versus 60.3% (<0.0001) of patients in the etanercept plus methotrexate versus the etanercept monotherapy group, respectively. Although the AE rate was higher in the combination group, the combination therapy proved to be safe and more effective than monotherapy. A separate trial of 440 subjects with PsA evaluated the efficacy of the combination of anti-TNF agents (etanercept, infliximab, and adalimumab) and methotrexate. Of the 440 subjects, 170 received anti-TNF monotherapy while 270 received an anti-TNF therapy plus methotrexate. The study did not show a significant clinical difference (DAS 28 and ACR) between the two groups after 12 months. This study also showed drug survival was significantly better in the anti-TNF plus methotrexate (MTX) group during the first 2 years of treatment and did not show statistical significance at year 3 (=0.07). A stratified analysis of the three anti-TNF agents used in the study showed statistically significant differences between the monotherapy and the MTX comedication groups in patients receiving infliximab and adalimumab, favoring comedication. These differences in drug survival were not seen in both groups treated with etanercept alone or when combined with MTX. A second study in subjects with PsA compared radiographic progression between patients treated with anti-TNF-α agents versus methotrexate monotherapy. A total of 65 patients were treated with TNF-α inhibitors, of which 46 received etanercept compared to 70 patients who were treated with methotrexate. TNF-α inhibitors were more efficacious than methotrexate in the inhibition of radiographic joint damage progression (88% versus 61%, =0.005). In a clinical study from 2010, seven patients with recalcitrant PsO were treated with a combination of etanercept and cyclosporine 200 mg daily with a 93.2% PASI improvement (mean time 56.5 weeks). There were no reports of SAEs during this trial. A separate 24-week open label study added concomitant cyclosporine 3 mg/kg/day in PsA patients whose joint symptoms had improved on etanercept monotherapy but whose PASI scores were still greater than 10. After 24 weeks of combined treatment, nine of these eleven patients achieved PASI 75. Another study in subjects with PsA evaluated etanercept plus cyclosporine versus etanercept plus methotrexate for maintaining clinical control. After 6 months, the study showed no significant difference in the mean decrease of DAS 28 with the two associations (etanercept plus cyclosporine 2.64±0.66 versus etanercept plus methotrexate 2.32±0.74, =0.22). Also, no significant difference in SAEs between the two treatment groups was found, except, not surprisingly, for hypertension, which was statistically more frequent in the etanercept plus cyclosporine group. A 24-week randomized, controlled, investigator-blinded trial compared the efficacy of etanercept 25 mg BIW, acitretin 0.4 mg/kg daily, or etanercept 25 mg QW plus acitretin 0.4 mg/kg daily for PsO treatment in 62 patients. At 24 weeks, PASI 75 response was achieved in 45%, 44%, and 30% of patients in the etanercept, etanercept plus acitretin, and the acitretin groups, respectively (=0.001 for both etanercept groups when compared with acitretin alone). No SAEs were reported. Several comparative studies have analyzed short term efficacy of different biological agents compared to etanercept in the treatment of PsO.,– A 2011 meta-analysis evaluated randomized controlled trials published up to 2008 comparing the efficacy of infliximab, ustekinumab, adalimumab, etanercept, and efalizumab in the treatment of moderate to severe PsO. Based on an indirect comparison, predicted mean probability of achieving a PASI 75 of infliximab was 80%, ustekinumab 90 mg was 74%, ustekinumab 45 mg was 69%, adalimumab was 58%, etanercept 50 mg BIW was 52%, etanercept 25 mg BIW was 39%, efalizumab was 26%, and placebo was 4%. A 2010 study in 903 moderate to severe PsO patients showed that at week 12, PASI 75 was achieved by 73.8% of patients who received ustekinumab 90 mg and by 67.5% of patients who received ustekinumab 45 mg when compared with 56.8% of those who received etanercept (=0.01 and <0.001, respectively). In the PsA literature, a comparative review evaluated etanercept, adalimumab, infliximab, and golimumab efficacy in PsA treatment. No significant differences were found in ACR 20 responses to the four drugs after 24 weeks. In addition, a large multicenter observational study evaluated the survival rate of anti-TNF-α treatments for PsO. From a total of 650 patients, etanercept showed a longer survival (mean 51.4 months, <0.001) as compared to infliximab (36.8 months) and adalimumab (34.7 months). Treatment discontinuation due to primary and secondary inefficacy was observed in 5.2% and 14.5% of patients, respectively, whereas discontinuation due to AEs was reported in 29 subjects (4.5%). These results differ from those found in the Danish study from the Danish nationwide database DERMBIO, in which infliximab held the longest survival rate compared to adalimumab and etanercept. Lastly, at the recent Congress of the European Academy of Dermatology and Venereology, results were presented from the FIXTURE study, a randomized, double-blind, placebo-controlled, global multicenter study involving 1,306 patients with moderate to severe PsO who were randomized to receive either secukinumab (an IL-17A inhibitor) 300 mg or 150 mg versus etanercept 50 mg versus placebo. At week 12, 54% and 24% of patients taking secukinumab 300 mg had achieved PASI 90 and PASI 100, respectively, as compared with 21% and 4% of etanercept patients. In addition, at week 52, 65% of patients on secukinumab 300 mg had a PASI 90 response as opposed to 33% of etanercept patients. AEs and SAEs were similar between treatment groups throughout the 52-week study, although full data have yet to be published. Fleischmann et al assessed safety of etanercept in subjects 65 years of age or older compared with those younger than 65 utilizing data from 18 clinical trials of rheumatoid arthritis, two PsA trials, and two ankylosing spondylitis trials. After gender and exposure adjustments, no significant difference was observed between groups for AEs, SAEs, or serious infections. Militello et al analyzed data from two Phase III trials of etanercept treatment for patients with PsO, of whom 77 patients were aged 65 years or older. The study found no statistical differences in rates of PASI 75 and DLQI changes between patients in the older and the younger groups. Rates of SAEs in this study were higher in the older group, but this difference was considered unrelated to etanercept treatment. Furthermore, Esposito et al retrospectively evaluated long term efficacy of etanercept in PsO patients older than 65 years. At week 156, PASI 75 was achieved in 84% of the 61 study subjects. The mean score used to asses rheumatologic disease activity in 44 joints plus the erythrocyte sedimentation rate decreased from 5.80 to 0.89 at 156 weeks of treatment. Etanercept was well tolerated during the study. Paller et al evaluated long term safety and efficacy of etanercept in pediatric patients (ages 4–17 years) with moderate to severe PsO in an open label extension from a previous 48 week etanercept study., Patients were dosed by weight and received etanercept 0.8 mg/kg QW. One hundred and eighty two subjects participated in the study and 140 (76.9%) completed the study through to week 96. PASI 50, 75, and 90 at week 96 were 89%, 61%, and 30%, respectively, figures that were superior to those previously discussed in the adult population study. Thus, in our obese PsO population (both adolescents and adults) weight-based dosing would be of value., After 96 weeks, etanercept was generally well tolerated. The most common AE was upper respiratory tract infections (24.9%), nasopharyngitis (17.1%), streptococcal pharyngitis (12.7%), headache (11.6%), and sinusitis (10.5%). No deaths, severe or opportunistic infections, or malignancies were observed. The number of SAEs was similar to that reported in the initial 48-week study. Etanercept is labeled as category B by the US Food and Drug Administration ranking of drug use in pregnancy. There are no studies in pregnant or breastfeeding women. Data from a registry of patients with rheumatic diseases and PsO showed that out of 144 pregnant patients, the percentage of infants with major birth defects among all births was 8% for the etanercept exposed patients and 5.7% for the controls. In a case report, fetal serum from of a pregnant patient treated with etanercept 25 mg BIW was approximately one thirtieth of the maternal levels. With respect to breastfeeding, serum concentrations of etanercept were recorded immediately after delivery and at weeks 1 and 3 postpartum. The infants’ serum etanercept concentrations were 81, 21, and 2 ng/mL immediately after delivery and at weeks 1 and 3, respectively. These data suggest that there are low levels of etanercept transferred to the fetus during pregnancy. However, because etanercept is a relatively large molecule, it would not be expected to be absorbed by a neonate’s immature gastrointestinal system during breastfeeding. Nevertheless, given the observed mild increase in the rate of birth defects, etanercept should be used in pregnancy only if no other options are available. It is important to realize that PsO pregnancies do have a higher risk of side effects versus the normal population. O a n d P s A a r e c h r o n i c , i m m u n e - m e d i a t e d i n f l a m m a t o r y d i s e a s e s a s s o c i a t e d w i t h s e v e r a l c o m o r b i d i t i e s . T h e e v i d e n c e o f t h e i r i m p a c t i n o t h e r o r g a n s h a s l e d t o a m a j o r c h a n g e i n t h e d e f i n i t i o n o f t h e s e d i s e a s e s , o n c e c o n s i d e r e d o n l y l i m i t e d t o s k i n a n d / o r j o i n t s . N o w , b o t h a r e c o n s i d e r e d s y s t e m i c d i s e a s e s . I n t h e p a s t t w o d e c a d e s , o u r u n d e r s t a n d i n g o f t h e p a t h o p h y s i o l o g y o f P s O h a s a d v a n c e d e n o r m o u s l y . T h e s e a d v a n c e s h a v e b e e n p a r a l l e l e d b y t h e d e v e l o p m e n t o f n e w , h i g h l y e f f i c a c i o u s t h e r a p e u t i c o p t i o n s . E t a n e r c e p t i s o n e e x a m p l e o f t h e n e w e r a i n P s O t h e r a p e u t i c s . A s w i t h a n y m a j o r a d v a n c e i n m e d i c i n e , t h e a d v e n t o f b i o l o g i c a l a g e n t s h a s c o m e t o f r u i t i o n b e c a u s e o f n u m e r o u s l a r g e s c a l e , m u l t i c e n t e r r a n d o m i z e d c o n t r o l l e d t r i a l s t o e v a l u a t e t h e i r e f f i c a c y a n d s a f e t y . O v e r t h e p a s t d e c a d e , e t a n e r c e p t h a s p r o v e n t o b e e f f i c a c i o u s a s m o n o t h e r a p y o r w h e n u s e d i n c o m b i n a t i o n w i t h o t h e r P s O t r e a t m e n t s . W i t h a n y n e w m e d i c a t i o n , p a r t i c u l a r l y o n e s p e c i f i c a l l y t a r g e t i n g t h e i m m u n e s y s t e m , r i g o r o u s a t t a i n m e n t o f s a f e t y d a t a h a s b e e n c r u c i a l i n p r o v i d i n g m o r e a p p r o p r i a t e g u i d e l i n e s f o r t r e a t m e n t . S p e c i f i c a l l y , v a r i o u s b i o l o g i c a l l y a g e n t s h a v e b e e n a s s o c i a t e d w i t h s e r i o u s i n f e c t i o n s s u c h a s , t u b e r c u l o s i s a n d h e p a t i t i s B r e a c t i v a t i o n , d e m y e l i n a t i n g d i s e a s e s , l y m p h o m a s , l e u k e m i a , a n d N M S C a n d s h o u l d b e u s e d w i t h c a u t i o n t a k i n g e v e r y p a t i e n t ’ s s p e c i f i c n e e d s i n t o a c c o u n t . N e v e r t h e l e s s , m a n y o f t h e s e a s s o c i a t i o n s o c c u r r e d a t r a t e s s i m i l a r t o t h o s e o b s e r v e d i n t h e g e n e r a l p o p u l a t i o n o r a t s u c h s m a l l r a t e s t h a t t h e b e n e f i t o f t r e a t i n g P s O p a t i e n t s c l e a r l y o u t w e i g h s t h e r i s k s m e n t i o n e d . I t h a s b e e n t w o d e c a d e s s i n c e e t a n e r c e p t ’ s f i r s t h u m a n t r i a l s i n 1 9 9 3 , a n d a f t e r a l m o s t a d e c a d e s i n c e i t s F o o d a n d D r u g A d m i n i s t r a t i o n a p p r o v a l , e t a n e r c e p t i s s t i l l a n i m p o r t a n t a n d v a l u a b l e o p t i o n i n a n y p h y s i c i a n ’ s a r s e n a l f o r t h e t r e a t m e n t o f m o d e r a t e t o s e v e r e P s O a n d / o r P s A .

Visual function is important for optimal orientation in functional and social life, and has an effect on physical and emotional well-being. Man is primarily visually motivated for survival, and sight is thought to account for about 80% of the function of all the five senses combined. Therefore, visual impairment leads to restriction in all areas of life and in particular quality of life. “Visual impairment” refers to all degrees of reduction in vision, and could be further defined as “a vision loss that constitutes a significant limitation of visual capability resulting from disease, trauma, or a congenital or degenerative condition”. In the primary care setting, most visual impairment can be corrected by conventional means, including refractive error correction and medication., The degree of impairment, personality, intelligence, background, and coexistence with other disabilities all have varying effects on the individual, and therefore people are affected differently by visual impairment. For many, loss of visual function can be devastating. The term “quality of life” is popularly used to describe an individual’s overall sense of well-being, and includes aspects such as happiness and satisfaction with life as a whole. The World Health Organization defines quality of life as “the individual’s perception of their position in life in the context of the culture and value system in which they live and in relation to their goals, standards, expectations, and concerns”. Quality of life may be the most important outcome to assess when considering the effectiveness of treatment in patients, especially those with chronic or incurable diseases, and has become a central outcome for treatment, prevention, and support. The theory of quality of life explains it as consisting of a range of subjective and objective aspects. The subjective aspects of quality of life deal with well-being, satisfaction, happiness, and meaning of life, while the objective aspects can be assessed using factors such as conformity to cultural norms, fulfillment of needs, realization of life’s potential, and maintaining biological order, ie, the ability to function within a societal norm. Efforts to measure health expectancy have increased in parallel with increased life expectancy, leading to patient-based assessment of health-related quality of life and with a focus on the impact of a perceived health state on the ability to live a fulfilling life., Understanding the magnitude of the physical and psychosocial aspects of visual impairment requires a careful exploration of vision-related quality of life using a standardized instrument. Disability arising from visual impairment represents a major social, emotional, and economic burden for patients, their families, communities, and the nation overall. The outcome of this study identifies a need to improve quality of life in patients with visual impairment. Our study was designed to conform to the tenets of the Declaration of Helsinki and good clinical standards. Ethical approval was obtained from the Joint University of Ibadan/University College Hospital Ibadan institutional review committee before commencement of the study. Written informed consent was obtained from all participating patients. The study was designed to be cross-sectional and descriptive, and was carried out in the general outpatient department at University College Hospital, Ibadan, Nigeria, from July to September, 2009. The sample size required was calculated using the Kish and Leslie formula, citing the existing prevalence rate of visual impairment as documented in a previous similar study. A minimum sample size of 375 was estimated. Inclusion criteria included new and review patients 18 years and older presenting with visual complaints to the general outpatient department. Pretested quality of life questionnaires were administered by the family physician. The study instrument was the standardized Visual Function and Quality of Life questionnaire designed to measure the impact of impaired vision on the patient’s ability to perform activities of daily living. Each patient’s presenting visual acuity was assessed using a Snellen chart placed 6 meters away from the participant in a well illuminated area. The tumbling E chart was used for illiterate patients. Slit-lamp examination, tonometry, and funduscopy were used by the ophthalmologist to confirm the diagnosis. #text The common causes of visual impairment in this study were cataract and refractive errors (), which is consistent with the findings of previous studies., Overall quality of life scores were good, which is again in line with previous research on this subject., Quality of life scores were low for those with severe visual impairment and blindness, which is understandable. However, some patients with poor vision still had high scores, reflecting the fact that visual impairment alone may not explain low quality of life scores. Visual impairment is indeed a global health burden.,, Its impact on the social and psychological self is very evident, hence the quality of life of the affected individual. Inequalities in health mirror inequalities in the socioeconomic status of countries globally, and this is reflected in the global distribution of the prevalence of visual impairment. The majority of the millions of people affected by visual impairment reside in Asia and sub-Saharan Africa, with causes that are largely preventable and treatable., Visual impairment is the consequence of a functional loss of vision rather than being an eye disorder in itself. It has been estimated that loss of one eye equates to 25% impairment of the visual system and 24% impairment of the whole person, and that total loss of vision in both eyes equates to 100% visual impairment and 85% impairment of the whole person. Severe visual impairment (ie, being legally or totally blind) occurs at a rate of 0.06 per 1,000., Visual impairments have considerable economic impact, even in developed countries,,, and have been shown to have a negative effect on total health-related quality of life in various studies., Patients may not be aware of the connection between vision impairment and their other symptoms, or may not think their family physician is the appropriate person to address vision problems., Age has been found to be a significant factor in relation to visual impairment. The proportion of respondents with visual impairment increased from just a few in the group younger than 20 years to more than two thirds in those aged 60 years and older. The self-reported quality of life score containing all the domains, ie, visual function, self-care, social interaction, mobility, and mental status, as recorded in the Vision-Related Quality of Life questionnaire, showed overall good quality of life among the respondents. However, quality of life was particularly poor in those with perceived severe visual impairment, and was associated with reduced functioning and social interaction. However, in spite of their handicap, almost all could care for themselves adequately. More than half of those in the sample reported good quality of life in terms of mental well-being and mobility. Therefore, it is clear that although the respondents may have reported good quality of life overall, their quality of life differed in specific domains. The Proyecto VER study observed that visual acuity impairment, in both better-seeing and worse-seeing eyes, was associated with a decrease in quality of life domains, and the steepness of that decrease was associated with the level of visual impairment. A study that evaluated the effect of impaired vision on health-related quality of life in 1,361 elderly Taiwanese subjects reported that impaired vision was associated with significantly lower scores on the physical and social functioning scales. This is similar to the results of our study. Family physicians have an essential role in assessing, identifying, treating, and preventing or delaying vision loss in the elderly. With our rapidly aging population, the number of people with visual impairment in the USA and worldwide is expected to increase, placing more demand on the family physician as the primary caregiver. Loss of vision is associated with depression, social isolation, falls, and medication errors., The vision-related adverse effects of commonly used medications, such as atropine and amitriptyline, should be considered when evaluating vision problems in elderly patients. Van Nispen et al have reported that musculoskeletal conditions, chronic obstructive pulmonary disease/asthma, and stroke predict a relatively rapid decline in health-related quality of life in the visually impaired. Adults, especially the elderly should be screened for vision problems every one to two years.

Psoriasis is a chronic inflammatory skin disease with a complex etiology involving genetic and environmental factors. The relationship between psoriasis and other diseases has drawn increasing interest in recent years. Growing evidence suggests that cardiovascular disease, obesity, diabetes, hypertension, dyslipidemia, metabolic syndrome, nonalcoholic fatty liver disease (NAFLD), cancer, anxiety and depression, and inflammatory bowel disease are found at a higher prevalence in psoriasis patients compared to the general population. These disease associations may be due to the systemic inflammatory mediators generated in psoriasis, shared risk factors (ie, smoking, alcohol consumption), or treatment. Early detection and treatment of the many comorbid conditions associated with psoriasis is important. An integrated approach should be taken to ensure that treatment of psoriasis does not interfere with the management of comorbid conditions and vice versa. There has been increasing awareness of the link between psoriasis, cardiovascular risk factors (hypertension, type 2 diabetes, dyslipidemia, metabolic syndrome), and cardiovascular disease. Patients with severe psoriasis were found to have a 5-year shorter life expectancy, with cardiovascular disease contributing significantly to this discrepancy. When cardiovascular risk factors were adjusted for, psoriasis patients still had an increased risk of stroke, atherosclerosis, myocardial infarction (MI), coronary artery disease (CAD), and endothelial dysfunction. Psoriasis, along with other chronic inflammatory systemic diseases, such as rheumatoid arthritis and systemic lupus erythematosus, may be linked to increased cardiovascular disease risk because of common pathogenic mechanisms. Inflammatory cells and proinflammatory cytokines contribute both to the development of psoriatic lesions and to the breakdown of atherosclerotic plaques. Psoriasis and atherosclerosis share a common pattern of Th1 and Th17 cytokine upregulation, T-cell activation, and local and systemic expression of adhesion molecules and endothelins. Activated T-cells near areas of inflammation produce type 1 cytokines such as interferon (IFN)-alpha, interleukin (IL)-2, and tumor necrosis factor (TNF)-alpha. IFN-alpha inhibits apoptosis, thus contributing to the hyperproliferation of keratinocytes. IL-2 stimulates T-cell proliferation., TNF-alpha is an inflammatory cytokine that is involved in the pathogenesis of both psoriasis and atherosclerosis. In psoriasis, TNF-alpha activates and increases keratinocyte proliferation. TNF-alpha has also been found to induce neutrophil chemotaxis, macrophage cytokine and chemokine production, and superoxide production, which can result in endothelial inflammation and dysfunction., C-reactive protein (CRP) is a marker of systemic inflammation that has been associated with atherosclerosis and cardiovascular disease. Elevated CRP is a result of interactions between proinflammatory cytokines IL-6, IL-1, and TNF-alpha. CRP is elevated with cardiovascular risk factors such as smoking, obesity, and diabetes. Multiple studies have shown that CRP can be used as a predictor of the risk of adverse cardiovascular events in both healthy individuals and those with a previous history of MI. Patients with psoriasis have been shown to have higher baseline levels of CRP than healthy controls in two studies (<0.004 and <0.001)., In another study, CRP levels were found to correlate with the severity of disease. Patients with mild and severe psoriasis had higher levels of CRP when compared with controls (mean ± standard deviation: 0.31±0.02 mg/dL versus 0.90±0.27 mg/dL; <0.001). Furthermore, patients with severe psoriasis had higher levels of CRP than those with mild psoriasis (mean ± standard deviation: 1.16±0.07 versus 0.63±0.03 mg/dL). Another possible mechanism of atherosclerosis-associated psoriasis is the production of vascular endothelial growth factor (VEGF) produced by keratinocytes, which are increased in psoriasis.– VEGF is a mitogen for endothelial cells and has been linked to intimal hyperplasia. VEGF is also positively associated with the severity of psoriasis and increased intimal media thickness (IMT).– As rapid skin turnover and increased keratinocyte activity occur in psoriasis, folate is consumed excessively in order to methylate DNA of rapidly dividing cells. Psoriasis patients have been found to have lower folate and, subsequently, higher homocysteine levels than normal controls., Hyperhomocysteinemia is an independent risk factor for cardiovascular disease, peripheral vascular disease, and cerebrovascular disease., High levels of homocysteine damage endothelial cells, promote clot formation, decrease blood vessel flexibility, and thus increase aortic stiffness. Elevated homocysteine may be yet another aspect of psoriasis that contributes to the increased risk of cardiovascular disease; however, the data on whether or not higher homocysteine levels correspond to the severity of psoriasis are conflicting.,, In a cohort study, patients with severe psoriasis (n=3,603) were found to have a greater absolute risk for major cardiac events (MI, stroke, and cardiovascular mortality) compared with normal controls (n=14,330). The frequency of major cardiac events was higher in psoriasis patients (4.9% versus 2.9%; <0.01). After adjusting for cardiovascular risk factors, severe psoriasis was still a risk factor for major adverse cardiac events (hazard ratio [HR] 1.53; 95% confidence interval [CI]: 1.26–1.85). Furthermore, severe psoriasis was found to confer an additional 6.2% attributable risk on a 10-year incidence of major adverse cardiac events. A systematic review and meta-analysis reviewed cardiovascular risk in patients with mild (n=201,239) and severe (n=17,415) psoriasis. Mild psoriasis was associated with a significantly increased risk of MI (relative risk [RR] 1.29; 95% CI: 1.02–1.63) and stroke (RR 1.12; 95% CI: 1.08–1.16). Severe psoriasis was associated with a significantly increased risk of cardiovascular mortality (RR 1.39; 95% CI: 1.11–1.74), MI (RR 1.70; 95% CI: 1.32–2.18), and stroke (RR 1.56; 95% CI: 1.32–1.84). Taking these risk ratios and background population event rates into account, psoriasis is associated with an estimated excess of 11,500 (95% CI: 1,169–24,407) major adverse cardiovascular events each year. An observational study of 3,236 psoriasis patients and 2,500 controls found a higher prevalence of ischemic heart disease (odds ratio [OR] 1.78; 95% CI: 1.51–2.11), cerebrovascular (OR 1.70; 95% CI: 1.33–2.17) and peripheral vascular (OR 1.98; 95% CI: 1.32–2.82) diseases, and arteriosclerosis (OR 2.18; 95% CI: 1.59–3.01) after cardiovascular risk factors were controlled for. Psoriasis was also found to be an independent risk factor for mortality (OR 1.86; 95% CI: 1.56–2.21). In a Danish study of 36,765 mild psoriasis patients, 2,793 severe psoriasis patients, and 4,478,926 other individuals, atrial fibrillation and ischemic stroke incidence rates were increased in the psoriasis population. Atrial fibrillation rates were found to be 3.03 per 1,000 observational years for normal controls, 4.67 for mild psoriasis patients, and 5.96 for severe psoriasis patients (<0.05). Ischemic stroke incidence rates were 3.06, 4.54, and 6.82 per 1,000 observational years for reference patients, mild psoriasis patients, and severe psoriasis patients, respectively (<0.05). Increased IMT and carotid plaque are intermediate risk factors for subclinical atherosclerosis and a predictor of stroke and MI. One recent study found a significant association between psoriasis and increased common carotid artery IMT (beta 0.016; CI: 0.004–0.028; <0.008) after controlling for cardiovascular risk factors. However, carotid plaque’s association with psoriasis was not significantly significant (OR 1.12; 95% CI: 0.85–1.47). Three other case-control studies detected a similar increase in IMT and no significant atherosclerotic plaque difference when psoriasis patients were compared to controls.– Increased arterial stiffness is also associated with psoriasis. One study found a significantly higher pulse wave velocity (a marker for arterial stiffness) in psoriasis patients versus normal controls (8.78±1.98 versus 7.78±2.0 m/second; =0.03) after controlling for cardiovascular risk factors. Another study by Balta et al reported a pulse wave velocity of 7.63 versus 6.96 (<0.01) for psoriasis versus control patients. Balta et al also found increased levels of CRP in psoriasis patients versus controls (2.54±2.6 versus 1.22±0.94; <0.01). CRP levels were found to be independently predictive of increased arterial stiffness., In a study by Ludwig et al, there was an increased prevalence (59.4% versus 28.1%, =0.015) of coronary artery calcification in 32 psoriasis patients compared to controls. Other studies have found that coronary artery calcification scores predict atherosclerotic cardiovascular disease events independently of standard risk factors and CRP levels., A study by Osto et al found that, in young patients with severe psoriasis and no heart disease, coronary flow rate was reduced, suggesting early coronary microvascular dysfunction. The risk of coronary microvascular dysfunction correlated with Psoriasis Area Severity Index (PASI) scores independently of other cardiovascular risk factors. Because cardiovascular disease represents an important comorbidity in psoriasis, it is important to screen patients for cardiovascular risk factors and refer patients to the appropriate specialists if cardiovascular disease is suspected. Recent surveys indicate that most physicians are unaware of the connection between psoriasis and cardiovascular disease., Dermatologists should also ask psoriasis patients with cardiovascular disease about their treatment, as it could influence the course of their psoriasis therapy. Counseling patients on healthy lifestyle habits (diet, exercise, and smoking cessation) is also warranted to reduce cardiovascular risk factors. Methotrexate is used in the treatment of psoriasis and has been found to decrease the risk of cardiovascular disease in certain chronic inflammatory diseases. However, long-term methotrexate use was also found to cause hyperhomocysteinemia, which is an independent risk factor for vascular disease. In a retrospective study of US veterans with psoriasis or rheumatoid arthritis, methotrexate was found to significantly reduce the risk of vascular disease (psoriasis: RR 0.73; 95% CI: 0.55–0.98). When folic acid was taken concurrently with methotrexate to lower homocysteine levels, the incidence of vascular disease in psoriasis patients decreased even further (psoriasis: RR 0.56; 95% CI: 0.39–0.80). In a meta-analysis of ten studies, methotrexate was associated with a 21% lower risk of total cardiovascular disease (n=10 studies; 95% CI: 0.73–0.87; <0.001) and an 18% lower risk of MI (n=5; 95% CI: 0.71–0.96; =0.01), without evidence for statistical between-study heterogeneity (=0.30 and =0.33, respectively). TNF inhibitors have been associated with a reduced incidence of MI to a greater degree than methotrexate. A retrospective cohort study of 8,845 psoriasis patients found that treatment with TNF inhibitors resulted in a 55% reduction in MI incidence when compared to the topical therapy group (<0.001). A literature review of TNF inhibitors in the treatment of psoriasis concluded that TNF inhibitors have beneficial effects on cardiovascular biomarkers (CRP and erythrocyte sedimentation rate [ESR]) and may prevent MI. A combination of methotrexate and TNF inhibitors is thought to provide the largest cardioprotective effect. In a study by Piaserico et al, biologics were found to be more effective than traditional treatments (methotrexate, acitretin, cyclosporine, and psoralen ultraviolet A [PUVA]) in the elderly population. #text xref #text Patients should be counseled on weight loss and leading healthy, active lifestyles. In a randomized clinical study, 60 mild-to-moderate psoriasis patients with body mass indices (BMIs) between 27 and 40 kg/m were allocated to either an intensive weight-loss therapy group or a standard routine dietary guidance group. After 16 weeks, there was a statistically different weight loss between the two groups of 15.4 kg (95% CI: 12.3–18.5 kg; <0.001). Dieting patients experienced a greater mean reduction in their PASI score compared to controls (−2.3 versus 0.3), although this difference was not statistically significant (=0.06). Several studies have found that TNF inhibitors such as adalimumab, etanercept, and infliximab can cause weight gain.– The mechanism of weight gain among patients treated with TNF inhibitors is still unclear, although TNF-alpha is known to be involved in body weight homeostasis and is purported to influence appetite by modulating leptin release from adipocytes. Furthermore, psoriasis patient weights can affect the dosing of certain therapeutics. For example, weight-dosed biologics (such as infliximab) demonstrate consistent clinical responses in overweight and obese patient populations, while fixed-dosed biologics (such as etanercept) may not. #text xref italic #text There have been multiple case reports of hypoglycemia associated with etanercept, an anti-TNF treatment, in patients with psoriasis and type 2 DM.– TNF-mediated inflammation has been shown to mediate insulin resistance. Because of their higher TNF levels, diabetic patients may need higher insulin doses. When anti-TNF therapy is started, insulin sensitivity is thought to improve and insulin requirements are lowered. Dermatologists should be aware that diabetic patients on both anti-TNF and insulin therapy may experience hypoglycemia.– Thiazolidinediones (eg, pioglitazone and rosiglitazone) are antidiabetic drugs that improve insulin sensitivity and have anti-inflammatory effects., They activate peroxisome proliferator-activated receptor-gamma, which leads to inhibition of proliferation of psoriatic keratinocytes. A meta-analysis of the efficacy of thiazolidinediones on psoriasis found a significant decrease in mean PASI scores of people on pioglitazone, whereas the improvement on rosiglitazone was not significant. Although psoriasis and hypertension share common risk factors, such as smoking and obesity, psoriasis has been found to be independently associated with hypertension. The exact mechanism underlying the relationship between psoriasis and hypertension is unknown, but there are a number of hypotheses about this association. Alterations to the renin–angiotensin system in psoriasis may contribute to poor blood pressure control. Psoriasis patients have elevated plasma renin activity and elevated angiotensin-converting enzyme (ACE) activity.– High ACE levels may play a role in altering cytokine regulation in vasculature. Certain ACE gene polymorphisms have also been associated with increased susceptibility to psoriasis, but these results are controversial. Endothelin-1, which is a potent vasoconstrictor, was also found to be elevated in the serum and lesional skin of psoriasis patients. Increased oxidative stress in psoriasis patients is also hypothesized to impair the vasodilatory mechanism of the endothelium., Some investigators hypothesized that psoriasis patients were less physically active due to potential embarrassment, but psoriasis was found to be independently associated with hypertension even after controlling for physical activity level. italic #text Dermatologists should encourage patients to monitor their blood pressure and stress the importance of healthy lifestyle habits. Patients who are hypertensive should follow up with their primary care provider and adhere to treatment. Hypertension is a commonly reported side effect of the anti-psoriasis drug cyclosporine. Cyclosporine has been found to significantly increase blood pressure in a dose-dependent fashion. A meta-analysis of 17 trials found that lower doses (1–4 mg/kg/day) increased mean blood pressure by an average of 5 mmHg, and higher doses (>10 mg/kg/day) increased mean blood pressure by an average of 11 mmHg. Therefore, care must be taken to monitor patient blood pressure when using cyclosporine in psoriasis patients. Beta blockers have been reported to exacerbate psoriasis. Beta blockers reduce intracellular concentrations of calcium, which may lead to an accelerated proliferation of keratinocytes and polymorphonuclear leukocytes. However, a case-control study in the UK did not find a significant association between antihypertensive medications and psoriasis. Dyslipidemia is a broad term encompassing abnormalities of plasma lipid levels or composition. Dyslipidemia is a well-established cardiovascular risk factor for CAD, stroke, MI, and cardiovascular mortality.– Typically, it presents as increased low-density lipoprotein (LDL), very low-density lipoprotein (VLDL), and triglyceride levels and decreased high-density lipoprotein (HDL) levels. Several purported mechanisms underlying the association between dyslipidemia and psoriasis are the activation of Th1 cells, autoantibodies recognizing oxidized LDL, and psoriasis medications such as oral retinoids and cyclosporine. Specifically, the cytokines IL-1, IL-6, and TNF-alpha that mediate psoriasis may alter the function of hepatocytes and arterial smooth muscle cells, resulting in altered lipoprotein compositions, enhanced expression of cellular adhesion molecules, and increased lipid deposition on arterial walls. These processes ultimately lead to the development of arterial plaques. Cytokines increase the expression of matrix metalloproteinases, which degrade the plaque’s fibrous cap. Eventually, the plaque may rupture and life-threatening thrombi may form., IL-1, IL-6, and TNF-alpha are also involved in the inhibition of lipoprotein lipase activity, which results in decreased triglyceride clearance and increased plasma triglyceride levels.– Some studies suggest that these cytokines may elevate lipid levels by augmenting lipolysis and stimulating hepatic de novo fatty acid synthesis., Psoriasis is associated with an increased production of reactive oxygen species that overwhelm the body’s antioxidant capacity. Levels of lipid peroxidation products can indirectly measure the production of reactive oxygen species. Lipid peroxidation markers such as malondialdehyde, oxidized LDL (ox-LDL), thiobarbituric acid, and anti-ox-LDL autoantibody were found to be elevated in patients with severe psoriasis compared to those with mild psoriasis. Ox-LDL, which is found in the upper epidermis of psoriatic skin, is also an initiator of inflammation and influences the adhesion and oxidant status of endothelial cells. This mechanism is thought to implicate ox-LDL in early atherogenesis. #text Treatment with the anti-TNF drugs etanercept, infliximab, and adalimumab has been shown to reduce the levels of inflammatory markers (CRP) and lipid peroxidation products while increasing serum antioxidant capacity. These effects are associated with an increase in the level of paraoxonase 1 (PON1), an antioxidant enzyme and anti-inflammatory enzyme associated with HDL. HDL levels also increased after treatment. Anti-TNF drugs have also been found to induce structural changes in the HDL protein composition. During inflammation, the HDL protein composition changes so that it is unable to protect LDL from oxidation. Anti-TNF drugs were found to restore HDL’s protein composition back to an atheroprotective state in patients with rheumatoid arthritis. However, other studies have found no favorable change in lipid profiles of psoriasis patients with TNF inhibitors.– Drugs that have an unfavorable effect on lipid profile include retinoids and cyclosporine. Retinoids increase triglyceride levels and total, LDL, and VLDL cholesterol and decrease HDL levels.– Cyclosporine has also been linked to hypertriglyceridemia, although the mechanism of this association is unclear. Eighty percent of plasma cyclosporine is bound to VLDL, and cyclosporine is hypothesized to either increase hepatic output of VLDL or interfere with the clearance of VLDL. Statins, which lower LDL and maintain plaque stability, also modulate the inflammatory response and are thus of interest in psoriasis. Statins lower CRP and TNF-alpha levels while downregulating adhesion molecules on leukocytes and endothelial cells and inhibiting major histocompatibility complex II expression and chemokine receptors on Th1 cells. Statins can differ by ninefold in their ability to block nuclear factor kappa B, a transcription factor needed for proinflammatory cytokine production. This may explain why there have been conflicting reports on whether statins help or hurt in psoriasis., One small pilot study evaluated the efficacy of simvastatin in treating plaque psoriasis and found a significant reduction in PASI scores of 47.34%. Fibrates, another class of lipid-lowering drugs, may exacerbate psoriasis., Metabolic syndrome is a cluster of risk factors for cardiovascular disease, such as hypertension, central obesity, glucose intolerance, and dyslipidemia. A diagnosis of metabolic syndrome is made when a person has at least three of the following five conditions, as defined by the National Cholesterol Education Program’s Adult Treatment Panel III (NCEP ATP III): 1) fasting glucose 100 mg/dL or greater (or receiving drug therapy for hyperglycemia); 2) blood pressure 130/85 mmHg or higher (or receiving drug therapy for hypertension); 3) triglycerides 150 mg/dL or higher (or receiving drug therapy for hypertriglyceridemia); 4) HDL cholesterol (high density lipoprotein cholesterol) less than 40 mg/dL in men or less than 50 mg/dL in women (or receiving drug therapy for reduced HDL-C); and 5) waist circumference 102 cm (40 inches) or greater in men or 88 cm (35 inches) or greater in women; if Asian American, 90 cm (35 inches) or greater in men or 80 cm (32 inches) or greater in women. Metabolic syndrome confers double the risk for CAD and increases the risks of stroke, fatty liver disease, and cancer. The prevalence of metabolic syndrome in the general population has been estimated to be between 15% and 24%., Psoriasis patients have an increased prevalence of metabolic syndrome. #text P a t i e n t s w i t h s u s p e c t e d m e t a b o l i c s y n d r o m e s h o u l d b e r e f e r r e d t o a s p e c i a l i s t f o r m a n a g e m e n t . O b e s i t y , d y s l i p i d e m i a , d i a b e t e s , a n d h y p e r t e n s i o n s h o u l d a l s o b e s c r e e n e d f o r . NAFLD is defined as an excessive accumulation of triglycerides in hepatocytes of patients without a history of excessive alcohol consumption. NAFLD is classified according to severity: simple NAFLD only consists of fatty infiltration; NASH (nonalcoholic steatohepatitis) is characterized by fatty infiltration and lobular inflammation; NAFLD with fibrosis or cirrhosis is the most severe stage and can progress to hepatocellular carcinoma. NAFLD is considered the hepatic expression of metabolic syndrome and is also associated with type 2 DM and dyslipidemia., The pathophysiology behind the association of NAFLD with psoriasis is thought to be related to chronic inflammation – proinflammatory adipokines and skin-derived cytokines may increase insulin resistance, which promotes hepatic lipid accumulation. A cross-sectional study of 142 Italian patients found a significant association between psoriasis and NAFLD. Fifty-nine percent of patients received a clinical diagnosis of NAFLD, 21% had factors associated with NAFLD (viral hepatitis, significant ethanol and methotrexate use), and 19% had normal livers. NAFLD in psoriasis patients was significantly correlated with metabolic syndrome, hypercholesterolemia, hypertriglyceridemia, and psoriatic arthritis. A case-control study found a 47% prevalence of NAFLD in 130 psoriasis patients. This association was present after controlling for BMI, suggesting that NAFLD is linked to psoriasis independently of obesity. Methotrexate is known to be hepatotoxic and has been linked to the development of fatty liver disease, fibrosis, and cirrhosis. Patients on methotrexate may develop elevations of serum aspartate aminotransferase and alanine aminotransferase; however, these are usually mild and self-limiting, and disappear with dose modification of methotrexate., Methotrexate depletes hepatic folate stores. Although a relationship between hepatic toxicity and folate depletion has not been established, oral folic acid supplements were found to reduce serum transaminase levels in patients on low-dose, long-term methotrexate therapy., In the past, the American Academy of Dermatology and National Psoriasis Foundation recommended that all patients with psoriasis undergo liver biopsies after every 1–1.5 g of cumulative methotrexate. In 2009, these recommendations were updated. The American Academy of Dermatology now recommends liver biopsies only for patients with risk factors for hepatotoxicity., These include a history of more than moderate alcohol consumption, persistently abnormal liver chemistry studies, a history of liver disease, DM, obesity, history of exposure to hepatotoxic drugs, absence of folate supplementation, and hyperlipidemia. Psoriasis patients without risk factors can be considered for liver biopsy after 3.5–4 g of cumulative methotrexate. A number of studies have investigated the link between psoriasis and cancer; the data have been inconsistent, however.– The chronic, inflammatory state induced by psoriasis is thought to initiate certain neoplastic diseases. As psoriasis is an immune-mediated disease, its pathophysiology is associated with an increased risk of lymphoma., This association is seen in other Th1-mediated diseases as well, such as rheumatoid arthritis., Patients with more severe psoriasis may also be receiving drugs such as cyclosporine, methotrexate, or PUVA therapy, which have all been associated with malignancies. A higher prevalence of alcohol or cigarette abuse, risk factors for cancer, is also seen in psoriasis patients., A large population-based study found an association between duration and severity of psoriasis and specific cancers. Patients with a long duration of psoriasis were at an increased risk of colorectal, bladder, kidney, pancreatic, and lymphohematopoietic cancers. Patients with more severe psoriasis who were receiving oral therapy were also at an increased risk of developing cancer (OR 10.17; 95% CI: 3.24–31.94). An analysis of patients without oral treatment yielded adjusted ORs of 1.59 (95% CI: 1.01–2.50) for patients with psoriasis of under 2 years duration and 2.12 (95% CI: 1.45–3.10) for those with psoriasis of greater than 2 years duration for lymphohematopoietic cancers. A cohort study of 7,061 Taiwanese psoriasis patients found that psoriasis patients were more likely to develop non-melanoma skin cancer and lymphoma. Patients who had never received systemic therapy were also more likely to develop non-melanoma skin cancer and lymphoma, suggesting that psoriasis could be an independent risk factor for these malignancies. Systemic treatments such as PUVA, methotrexate, and cyclosporine have been linked to increased risk of cancer. The PUVA Follow-Up Study, which tracked 1,380 psoriasis patients for 30 years, found a dose-dependent increase in the risk of squamous cell carcinoma (SCC) and a moderate increase in the risk of basal cell carcinoma after PUVA therapy. More than one-half of patients who received 350 or more PUVA treatments developed SCC, and a significant risk was noted after 150 treatments. The risk of malignant melanoma also increased about 15 years after initiation of PUVA treatment, especially among patients who underwent more than 250 treatments. Physicians should weigh the benefits and risks for each patient, taking into account their baseline risk for skin cancer and the number of PUVA treatments needed. The PUVA Follow-Up Study also found an increased incidence of lymphoma in patients who were taking high doses of methotrexate in addition to receiving PUVA therapy (incidence rate ratio 4.39; 95% CI: 1.59–12.06). Patients who were on PUVA therapy only had rates of lymphoma comparable to those of the general population (incidence rate ratio 0.85; 95% CI: 0.37–1.67). A cohort study of 1,252 severe psoriasis patients found that low-dose cyclosporine (2.7–3.1 mg/kg/day) was associated with a sixfold increase in the risk of SCC within a 5-year follow-up. Patients at greatest risk were those who were treated with cyclosporine for more than 2 years or previously exposed to PUVA, immunosuppressants, or methotrexate. Cyclosporine should not be used together with phototherapy, before or after PUVA, or in patients with a history of SCC or melanoma. Some meta-analyses and observational studies have found that TNF-alpha inhibitors are associated with an increased risk of malignancy in rheumatoid arthritis patients, although the evidence is conflicting.– Because rheumatoid arthritis patients are usually on concomitant systemic immunosuppressants while psoriasis patients are typically treated with monotherapy, it is unclear if safety data from rheumatoid arthritis studies can be generalized to psoriasis., One meta-analysis of data from 20 randomized clinical trials of adult patients with plaque psoriasis and psoriatic arthritis treated with anti-TNF-alpha agents did not find a statistically significant increase in the risk of malignancies. Psoriasis can have profound psychosocial effects and negatively impact many aspects of quality of life. Patients with psoriasis often report suffering from high levels of stress, social stigmatization, and physical limitations from their disease. The visibility of psoriatic lesions can often result in feelings of embarrassment, social withdrawal, and lack of self-esteem. Using the Psoriasis Life Stress Inventory, Gupta and Gupta surveyed 217 patients with a range of psoriasis severity. The most commonly reported stressor was due to disfigurement. Over one-half of patients reported feeling self-conscious around strangers. In a study by Gupta et al, 26% of patients noted that they had experienced an episode in which people “made a conscious effort not to touch them” in the previous month. Another study found that 83% of patients with moderate-to severe psoriasis felt they “often” or “always” needed to hide their psoriasis. Seventy-four percent reported that their self-confidence was “often” or “always” affected by their psoriasis, and 83% would “often” or “always” avoid social activities such as swimming. In a self-perpetuating cycle, psoriasis causes stress and stress exacerbates psoriasis. Psychological stress is shown to play a role in the onset and exacerbation of psoriasis. In one study, 88% of patients attributed psychological stress to exacerbation of their psoriasis and 68% of patients reported experiencing a psychologically stressful life event in the 3 months before the onset of psoriasis. A further analysis of the Psoriasis Life Stress Inventory revealed that psoriasis patients experienced stress from anticipating the reaction and avoidance of others and stress from fear of being evaluated exclusively on the basis of their skin. Psoriasis patients also had significantly higher levels of experiences of stigmatization compared to other dermatology patients. Depression and anxiety are important psychological comorbidities of psoriasis. Increased levels of proinflammatory cytokines such as IL-1, TNF-alpha, and IFN-gamma that are seen in psoriasis are purported to act as neuromodulators and may mediate depressive disorders. Administration of proinflammatory cytokines in cancer and hepatitis C therapies, and other chronic inflammatory diseases such as rheumatoid arthritis, have been associated with depression. Researchers have generally found higher levels of depression in patients with a greater percentage of their skin affected by psoriasis. Higher rates of suicidal ideation that correlate with higher self-ratings of disease severity have also been reported. Physicians should screen for anxiety and depression and explore patients’ perceptions of their disease. Various psychosocial interventions have been demonstrated to help patients. In a large study, pharmacotherapy plus a 6-week program of cognitive behavioral therapy led to significantly greater decreases in psoriasis severity, self-reported disability, and psychological distress, than pharmacotherapy only. These improvements were maintained for more than 6 months after the completion of cognitive behavioral therapy. Effective treatment for psoriasis should involve a multidimensional approach that integrates psychosocial well-being and patients’ perceptions of their disease. Systemic inflammation plays an important role in psoriasis, Crohn’s disease, and ulcerative colitis. Th17 cells in psoriatic skin produce IL-23, which is an essential cytokine for intestinal inflammation. Polymorphisms in IL-23 and IL-12B receptor genes are also thought to play a role in all three disease processes.– The susceptibility loci of psoriasis, Crohn’s disease, and ulcerative colitis all lie in the 6p21 locus, which encompasses the major histocompatibility complex. The IBD3 locus associated with Crohn’s disease and ulcerative colitis and the PSORS1 locus of psoriasis lie here as well.,, A case-control study of 12,502 psoriasis patients in the Clalit Health Services database found a significantly higher prevalence of both Crohn’s disease (0.5% and 0.2%, respectively; <0.001) and ulcerative colitis (0.5% and 0.3%, respectively; =0.002) compared with the control group. Crohn’s disease and ulcerative colitis were both associated with psoriasis (ORs 2.49 and 1.64, respectively). In a Nurses’ Health Study (NHS) of 174,476 women with psoriasis or psoriatic arthritis, psoriasis was associated with an increased risk of developing Crohn’s disease during both NHS I (1996–2008) (RR 4.00; 95% CI: 1.72–9.27) and NHS II (1991–2007) (RR 3.76; 95% CI: 1.82–7.74). The risk of Crohn’s disease was highest among women with concomitant psoriatic arthritis (RR 6.43; 95% CI: 2.04–20.32). A retrospective cohort study using US health care claims data investigated concurrent autoimmune diseases in patients with psoriasis and psoriatic arthritis. The psoriatic arthritis group had higher prevalence ratios of Crohn’s disease, ulcerative colitis, and inflammatory bowel disease compared to the psoriasis-only group. Other digestive diseases, such as celiac disease, also show a higher prevalence in the psoriasis population. In a case-control study by Birkenfeld et al, the prevalence of celiac disease in patients from Israel with psoriasis was 0.29%, compared to 0.11% in controls (<0.001). Psoriasis was associated with celiac disease with an OR of 2.73 (95% CI: 1.65–4.53). Wu et al also found an association between psoriasis and celiac disease, with an OR of 2.2 (95% CI: 1.5–3.2) in a population of 25,341 Southern California Kaiser Permanente psoriasis patients. Systemic drugs used to treat moderate-to-severe psoriasis are also indicated in some inflammatory bowel diseases. Methotrexate is used for treating active Crohn’s disease in steroid-dependent patients. TNF-alpha inhibitors such as infliximab and adalimumab have been employed for severe active Crohn’s disease that has not responded to conventional treatment. Paradoxically, TNF-alpha inhibitors have been shown to induce psoriasis in certain studies.,– All three TNF-alpha inhibitors that are US Food and Drug Administration-approved for psoriasis (infliximab, etanercept, and adalimumab) were associated with the induction of psoriasiform lesions, with a mean time of 9.5 months for the appearance of the lesions.,– It is thought that TNF-alpha inhibitors could favor the recruitment of activated T-cells in the skin of patients genetically predisposed to an enhancement of the chemokine receptor CXCR3. c a u s e o f t h e w i d e r a n g e o f c o m o r b i d c o n d i t i o n s a s s o c i a t e d w i t h p s o r i a s i s , t h e n e e d f o r c o m p r e h e n s i v e s c r e e n i n g a n d t r e a t m e n t m u s t b e r e c o g n i z e d a n d a d d r e s s e d . T h e c o n c e p t o f p s o r i a s i s a s a s y s t e m i c i n f l a m m a t o r y d i s o r d e r p r o v i d e s t h e p a t h o p h y s i o l o g i c l i n k w i t h m a n y a s s o c i a t e d d i s e a s e s . T h e r a p e u t i c i n t e r v e n t i o n s f o r p s o r i a s i s m a y e x a c e r b a t e c o m o r b i d c o n d i t i o n s , a n d v i c e v e r s a . T h e r e f o r e , a p p r o p r i a t e m a n a g e m e n t o f p s o r i a s i s m u s t i n v o l v e a n i n t e g r a t e d a p p r o a c h .

Pediatric primary care professionals and specialty providers sometimes find themselves unable to arrive at a clear diagnosis for patients with atypical symptom presentations. In such circumstances, providers may consider offering a diagnosis of Conversion Disorder (CD),– believing that, in the absence of a sound physical diagnosis, the child’s symptoms are probably the result of some psychological process, and that such a diagnosis may help the child to get necessary psychiatric care. As part of making an educational video regarding problems with making a diagnosis of CD in children with complex, obscure, multisystem physical complaints, the author (a practicing child and adolescent psychiatrist who works with a number of children and teens with persistent complex medical problems) interviewed about half a dozen children (and parents) attending a national meeting of the Ehlers-Danlos National Foundation. This article stems from those interviews, and offers commentary and opinion, based on the experiences that these patients reported. CD is one of a number of conditions in which, it is thought, the child’s symptoms are not the result of a physical process, but instead have a psychological cause. This is distinct from malingering, which is simply a deliberate process of faking or exaggerating symptoms, in order to achieve a specific, targeted goal (such as disability benefits, civil damage claim awards, or to be excused from certain responsibilities). CD is a diagnosis of exclusion, requiring that physical causes of symptoms have been ruled out. The key criterion is the following: “Clinical findings provide evidence of incompatibility between the symptom and recognized neurological or medical conditions.” Until recently, the diagnosis of CD also required establishing that some unresolved and unconscious psychological conflict is present, providing the psychic energy for the development of symptoms. This requirement posed insurmountable problems for diagnostic validity, and has been dropped. However, an unconscious process is still implicit in CD, which is one factor distinguishing it from malingering. In CD, it is understood that the patient is not aware of the conversion of psychological difficulty into physical symptoms, and thus (perhaps) may not be considered responsible for the phenomenon, and may be (theoretically at least) amenable to psychological intervention. CD is most commonly (and properly) diagnosed when a patient presents with neurological symptoms that do not make sense in light of what is known about the anatomy and physiology of the nervous system. CD may be offered also as a diagnosis in other, less clearly-defined circumstances, in which a patient’s symptoms may be hard to diagnose. Such circumstances often include pain as a significant aspect of the child’s presentation. Pain is, of course, an entirely subjective symptom, typically reported by patients on a 1 to 10 scale of severity, along with subjective descriptions of pain quality, duration, and mitigating and exacerbating factors. Despite this subjectivity, pain does tend to be reported in relatively standard ways in typical conditions. Furthermore, pain is typically associated with certain objective signs (eg, guarding, facial expressions of distress, weeping, moaning), on which providers may tend to rely in forming their impressions of the severity and nature of the pain. When a child’s report of pain characteristics and severity does not match the provider’s expectations (based on how patients ordinarily experience pain in typical conditions), the provider may doubt the validity of the child’s report. If a child who is sitting calmly in the doctor’s office, with unremarkable behavior and facial expression, complains of pain rating 8 of out 10, this presentation may bring to mind the classic sign, “la belle indifference,” which was ascribed to patients diagnosed with hysteria during the late nineteenth and early twentieth centuries. The provider may think that the child cannot possibly be experiencing as much pain as she is describing, and may tend to consider a diagnosis of CD on that basis. In addition to neurological symptoms and pain, a number of complex medical conditions lend themselves to CD diagnoses; they may present with vague, non-specific, and unstable symptoms that do not conform to any widely-held understanding of any medical condition. Ehlers-Danlos Syndrome (EDS) and mitochondrial diseases are prominent among these problems. Mitochondrial diseases include a broad range of (primarily genetic) abnormalities that were formerly thought to be mostly fatal in early childhood, but which are now understood to lead to a variety of metabolic abnormalities, which may not present early, and which persist into adulthood.– All body systems may be affected; problems with pain, fatigue, and multiple dysautonomias are especially troublesome. EDS is best known for presenting problems with joint hypermobility and skin abnormalities. However, as a profound disorder of connective tissue, EDS can present with symptoms relating to any organ system. Especially prominent are gastrointestinal symptoms, which can contribute to overall poor nutrition and general ill-health, and neurological problems, including spinal abnormalities with significant pain, and dysfunction of the autonomic nervous system. Dysautonomias manifest especially as wild fluctuations in heart rate and blood pressure associated with postural changes (postural orthostatic tachycardia syndrome [POTS]), as well as low body temperature, generally poor temperature regulation, and vulnerability to heat stroke. Other neurological problems include headaches, disturbed sleep architecture with unrestful sleep, profound fatigue, and pain. When children with EDS experience pain, it can often be quite severe; but these children tend to be accustomed to it, and to be functioning at a level higher than one might ordinarily expect. As a result, the pain may appear to be less severe than it truly is. When these symptoms present without the cardinal signs of joint hypermobility, they can be difficult to diagnose specifically. Patients are often treated purely symptomatically, without definitive success. Symptoms may tend to be seen either as “functional” or as explicit psychiatric symptoms – especially POTS symptoms (which can mimic panic attacks) and fatigue (often seen as a sign of depression). When patients’ problems persist, or clearly relate to multiple body systems in ways that do not make obvious sense, medical providers may be challenged to arrive at a specific diagnosis. When no diagnosis is apparent, providers may hope that offering a diagnosis of CD will reassure both patient and family that the problem is not medically more serious, also that it will facilitate the patient’s access to psychiatric care. In fact, making a diagnosis of CD usually accomplishes neither of these goals. Instead, it leads to many new and more serious problems, including stigmatization, undermining of personal identity, and worsening of symptoms. In general, a useful rule is: “If you are thinking about CD, think harder.” Emily was a third grade girl who had been suffering from pain that was consistent with Complex Regional Pain Syndrome. She also had unstable joints, which was consistent with EDS (although, initially, she did not have that diagnosis). For a period of a year or longer, her medical providers were suspicious that she was purposely dislocating her joints, demonstrating an atypical spasmodic tremor, and altering her gait (as manifestations of CD). Over time, she also developed POTS and some other dysautonomias, and was referred as an outpatient to a local hospital for cognitive behavioral therapy with a psychologist. It was hoped that this treatment could help her to develop improvements in her ability to cope with stress, and thereby to have fewer symptoms. The psychologist was clearly a bright and sophisticated clinician, who made the point that some of Emily’s symptoms were not what one might expect, medically. Emily experienced this effort at treatment as the therapist accusing her of “having it all in her head,” and was trying to hypnotize her, to “fix something”. Emily proved to be very guarded, and unresponsive to this treatment. Later, during one of multiple medical hospitalizations, Emily developed seizures. Since there was no electroencephalographic evidence of epilepsy, she was more seriously considered as having CD. Hospital medical and psychiatric staff recommended she be transferred to their inpatient psychiatric service for treatment. Her mother was very upset at this recommendation. It did not feel right; but she did not want to deny her daughter any treatment that might help. The mother was unable to gain explanation, from anyone who recommended this plan, as to how it would help Emily to get over her CD, to spend time in an inpatient psychiatric unit, with depressed and suicidal teenagers. As a result of this, Emily did not enter the psychiatric unit. The psychiatrist responsible for Emily’s outpatient care (the author) wrote a long, detailed, carefully-reasoned assessment report, reviewing Emily’s symptoms and addressing explicitly the issue of whether she should be understood to suffer from CD. At that point, there was no medical explanation for the seizures. The report acknowledged that CD was a possibility, though it did not offer that diagnosis conclusively. The psychiatrist continued to be curious, and supportive, in meeting with Emily and learning about her symptoms. Even though Emily enjoyed these meetings, and was generally comfortable with the psychiatrist, she remained very defensive about any suggestion that she might have any kind of psychological problems; she agreed to meet only a few times a year. The psychiatrist’s rationale for this treatment was, essentially, to protect Emily from the effects of medical professionals, disregarding her symptoms by accusing her of having CD; she was comfortable with this formulation, and grateful to receive this help. In fact, the psychiatrist had many phone conversations, and went to more than a few meetings, in order to make it clear to others on her treatment team that Emily’s psychological health was being taken care of. Although others on the team continued to have doubts about Emily’s symptoms, they continued to look for a physical diagnosis and to provide her with appropriate medical care. Over time, Emily’s problems with EDS and dysautonomia became somewhat worse, as they tend to do; her diagnoses were no longer in doubt. Her seizures were understood to be secondary to dysautonomia. Recurrence was prevented by maintaining adequate hydration and electrolyte balance. As the unfortunate reality of her medical problems became better recognized, she began to feel less vulnerable to possibly being mislabeled. However, she began to feel increasingly angry about how hurt she had felt in the past at being mislabeled, and by her subsequent involvement in psychological treatments that did not help her, which were provided by people who did not believe her. As it happened, her increasing POTS symptoms suggested that she might benefit from taking stimulant medication, to help stabilize her hemodynamic function. She did have a history of psychological test results that were consistent with a diagnosis of ADHD and nonverbal learning disorder and so she began a careful trial of slowly increasing doses of short-acting mixed amphetamine salts (Adderall), to see what effect it might have on her POTS symptoms of dizziness and fainting. The amphetamine worked very well for those symptoms, and also brought enormous benefit for her school functioning, helping her to go from being a slightly-above-average student, to being a truly outstanding one. Emily is now an early adolescent, and is successful in school and with friends. She continues to meet with the psychiatrist every month, to renew her amphetamine prescription and to talk about her life. Unfortunately, her life continues to include a lot of difficult medical and surgical problems associated with EDS, but she has been strong and resilient in coping with these problems; she has a good time talking about the unfairness of it all, how angry she is, and how she copes. It appears that she benefits from this support and has been maintaining an overall positive adaptation to her illness. The most obvious problem with making a diagnosis of CD is that doing so leaves unrecognized and untreated whatever underlying medical conditions may exist. As a result, the presenting symptoms persist and (usually) get worse, often with significant morbidity and deterioration in overall function. Another problem is that once the child has a diagnosis of CD in his or her medical record, it can be hard to expunge it, even after a more accurate physical diagnosis may have been established. A lingering CD diagnosis still further compromises the child’s chances of getting good medical care – even for genuine physical problems – by engendering doubt in the minds of successive providers as to the reality of the child’s continuing (or new) symptoms. More profoundly, the diagnosis represents (especially to children) an accusation by the diagnosing doctor of either dishonesty or craziness. Children tend to be naïve and trusting of “authority figures” (including doctors); many children who have the types of complex, multisystem medical problems described here also tend to be concrete, literal, and “black and white” in their psychological functioning., This characteristic contributes to children’s intense distress at having their own very real experience of being sick undermined. They feel a truly traumatic sense of unhappiness at the disruption of trust between doctor and patient, in response to the accusation of their “making up” an illness. Many children do not easily get over this trauma, and become intensely defensive with doctors generally. It can then be especially challenging to engage them in any kind of mental health care. As a result, not only does the CD diagnosis leave the child without treatment for whatever may be the underlying medical problem, it also makes it much harder for them to get the psychiatric treatment that the medical care provider, in making the diagnosis, presumably intended for them to receive. Providers may try to soften the “making it up” diagnosis by underscoring the unconscious nature of CD. Telling children and families that the child’s “brain is playing tricks”, that it is “not the child’s fault”, or that it is “out of the child’s control” are some common efforts in this regard. Although in some respects, this approach seems more forgiving, and might be expected to lead to less defensiveness, it is not actually comforting to most patients. Most of the children interviewed for this project said that they “just knew” they had a genuine illness that was not recognized; they responded with compelling anger and skepticism to such blandishments. s u m m a r y , i t i s i m p o r t a n t f o r p e d i a t r i c p r o v i d e r s t o u n d e r s t a n d h o w d e s t r u c t i v e m a k i n g a C D d i a g n o s i s c a n b e , e s p e c i a l l y f o r t h o s e m e n t a l h e a l t h p r o b l e m s f o r w h i c h m a k i n g t h i s d i a g n o s i s i s p r e s u m a b l y m e a n t t o b e h e l p f u l . T h e f o l l o w i n g s u g g e s t i o n s a r e o f f e r e d :

The use of polymeric nanomaterials such as dendrimers in the development and delivery of therapeutic compounds has emerged as a promising field of biomedical engineering. Dendrimers have a well-defined branching architecture consisting of an initiator core, a radiating interior structural layer composed of repeating generations (G0-G10), and terminal functional groups attached to the outermost generation ()., Subsequent generations increase in diameter, the number of terminal functional groups, and the number of vacancies available to carry therapeutics.– The low polydispersity index and the ability to precisely control their surface chemistry make dendrimers useful for medical imaging, enhancing the solubility and/or bioavailability of drugs, brain-target drug therapy, and specific targeting mechanism for anti-cancer therapeutics and gene therapy.– The stability, precise size, and defined chemistry of dendrimers also make them ideal for the development of structure-property relationships. Despite the myriad of potential biomedical applications of dendrimers, previous research exploring the toxicity and biocompatibility of dendritic therapeutics suggests some dendrimers may display inherent toxicity attributed to a combination of generation and charge.– Although the mechanism explaining generational effects is still unclear, higher generation dendrimers have been observed to cause nanoscale holes in the lipid bilayer, resulting in more toxicity while other authors have found that increasing generation attenuates toxicity;– especially for very high generation dendrimers, perhaps due to conformational changes.,– Regardless of dendrimer generation, some cationic dendrimers have been shown to interact with negatively charged cell membranes. An increasing number of studies in diverse cell lines have shown that exposure to cationic dendrimers results in cell membrane permeability, cellular lysis, and cytotoxicity.,– Recent studies in mice and zebrafish () have also shown polyamidoamine (PAMAM) dendrimers with amine terminated groups affected blood-clot formation when administered intravenously, while neutral and anionic dendrimers of the same generation demonstrated no observable vascular complications., The authors suggest that these effects are driven by the high affinity amine for platelets or vascular endothelium. The observed toxicity with dendrimers however, is likely due to a combination of generation and charge, as the net charge is dependent on the generation., In contrast with PAMAM dendrimers, the limited research on thiophosphoryl dendrimers has demonstrated minimal inherent toxicity in vitro. The majority of studies to date have focused on dendrimer toxicity in cell culture, with fewer studies investigating the toxicity in vivo. Dendrimer toxicity was explored using several PAMAM () and thiophosphoryl () dendrimers that varied in generation and charge in embryonic zebrafish (). Due to both the generational and cationic toxicity observed at the cellular level, higher generation cationic dendrimers were hypothesized to be more reactive and thus more toxic than lower generation anionic or neutral dendrimers with the same core composition.,– Zebrafish were selected as a model organism due to their similarities in anatomy and physiology, cell structure, and signaling process to other vertebrates and their tissue clarity which allows for visual inspection of most systems during development. In addition, the rapid development of zebrafish from a few cells to fully functioning juveniles by 120 hours post-fertilization (hpf) allows for high-throughput experimental designs at relatively low cost. – The nature of biomedical applications associated with dendrimers makes understanding how their biological interactions relate to structural features, such as generation and charge, an important step in designing safer and more efficient nanopharmaceuticals. Thiophosphoryl-phenoxymethyl(methylhydrazono) 0.5 Generation (G) and 1.5G dendrimers were purchased from Fisher Scientific (Fair Lawn, NJ, USA). The 2.5G, 3.5G, and 5G were purchased from Sigma-Aldrich (St Louis, MO, USA). All PAMAM dendrimers were commercially purchased through Dendritic Nanotechnologies Inc. (Mount Pleasant, MI, USA). Dry dendrimers were stored as shipped at 25°C while PAMAM G5-succinamic acid was shipped and stored in solution at −20°C; all dendrimers were tested without further modification or purification. Detailed core composition, generation, surface chemistry, and surface charges of the dendrimers used in this study are listed in . Dendrimer stock solutions were prepared at 1,000 mg/L in embryo media on the day of the exposure and vortexed for 1–2 minutes to ensure uniform dispersion. An hour prior to exposures, 5-fold serial dilutions were conducted with embryo media to make exposure concentrations from 0.016 to 250 mg/L. Concentrations above 250 mg/L were considered outside the realistic exposure dose. Dilutions were stored in an incubator at 26.9°C until the exposure. Zebrafish ( embryos were collected from group spawns of wild-type D5 fish housed at the Sinnhuber Aquatic Research Laboratory (Oregon State University, Corvallis, OR, USA) and staged such that the chorion surrounding the embryo could be removed enzymatically at 6 hpf. Dechorionation removes the barrier provided by the chorion in an effort to increase the bioavailability of the particle interacting with the embryo. A 0.6% Instant Ocean salt solution (Aquatic Ecosystems, Apopka, FL, USA) was added to deionized water to make embryo media. Embryo media was prepared and adjusted with sodium bicarbonate until a pH of 7.0–7.4 and a conductivity of 480–600 μs/cm was obtained. Newly fertilized embryos were collected and staged to ensure the zebrafish were treated at the same developmental stage. Zebrafish were kept at 26.9°C on a 14 hour(hr)/10 hr light/dark cycle. At 8 hpf, a total of 24 embryos per treatment were exposed individually in 96 well plates to 5-fold serial dilutions of dendrimers (0.016, 0.08, 0.4, 2, 10, 50, 250 ppm) or embryo media alone (control). At 24 hpf, embryos were assessed for mortality, developmental progression, notochord malformation, and spontaneous movement. At 120 hpf, embryos were assessed for mortality, as well as behavioral, and physical malformations such as: axis, brain, circulation, eye, caudal fin, pectoral fin, jaw, otic, pigment, pericardial edema, yolk sac edema, snout, swim bladder, trunk, somite, and a touch response according to previously published methods., Data for individual endpoints analyzed here are freely available on the open-source Nanomaterial-Biological Interactions Knowledgebase (). Experimental replicates were analyzed using one way analysis of variance (ANOVA) to ensure replicates were not statistically different from one another. ANOVA was also used to compare mortality between the PAMAM and thiophosphoryl dendrimer groups. The Fisher’s exact test was used to determine if individual sublethal responses differed significantly from control. Spearman’s rank order was used to correlate percent mortality with dosages. All statistical analysis was performed using Sigmaplot version 12.3 (San Jose, CA, USA) with a significance threshold of ≤0.05. Identical dendrimers of different generations were compared to explore the role of generation on toxicity. PAMAM and thiophosphoryl dendrimers contained a generational series of four dendrimers each. PAMAM dendrimers elicited significant morbidity and mortality as generation decreased. In order to compare the PAMAM generations, the median lethal concentration (LC) was estimated through linear interpolation (). As shown in , the LC of cationic PAMAM dendrimers increased from 2 ppm for G3 PAMAM-amine to 18 ppm for G6 PAMAM-amine dendrimers. Thiophosphoryl dendrimers induced no significant morbidity or mortality at any concentration tested (LC > 250 ppm). The toxicity of PAMAM dendrimers was assessed at 24 and 120 hpf by evaluating concentration effects on embryonic zebrafish mortality, development, and malformations. Neutral thiophosphoryl dendrimers exhibited no observable malformations at any dose throughout the exposure. Exposure to ≥50 ppm cationic PAMAM dendrimers G3-amine, G4-amine, G5-amine, and G6-amine caused 100% mortality by 24 hpf. Significant cardiac impacts (pericardial edema) were observed at 10 ppm for cationic PAMAM G4-amine and neutral PAMAM G6-amidoethanol (<0.05). However, negatively charged succinamic acid G5 and G6 dendrimers did not elicit any significant adverse effects even at the highest concentration tested. No other assessed endpoints were significant for either type of dendrimer at any dose or generation. G6 PAMAM dendrimers that differed in surface chemistry and charge were compared for total mortality at 250 ppm. Cationic PAMAM G6-amine at 250 ppm was statistically more toxic than both neutral PAMAM G6-amidoethanol and anionic PAMAM G6-succinamic acid at the same concentration () (<0.05). At 250 ppm, 100% mortality was observed in the PAMAM G6-amine at 250 ppm, compared to less than 25% mortality in the neutral and anionic dendrimers. PAMAM dendrimers as a class were found to be significantly more toxic than thiophosphoryl dendrimers (<0.05) (). In addition, all PAMAM except G5-succinamic acid dendrimer were found to have a statistically significant correlation between the percent mortality and dose (). PAMAM G6-amidoethanol was found to be statistically more toxic than thiophosphoryl G0.5, G1.5, and G3.5 (<0.05). Dendrimers demonstrate generation and charge-dependent toxicity in multiple cell lines;– yet little work has been done to investigate effects in vivo. The suite of dendrimers investigated in this study allowed for comparative toxicological analysis between generation, charge, and dendrimer class as possible factors driving toxicity in an in vivo embryo model. Mortality and cardiac impacts (pericardial edema) were significantly increased by higher generation PAMAM dendrimers (). Pericardial edema is not necessarily a predicator of any specific pathway being triggered but rather an early stage stressor. Pericardial edema in zebrafish has been associated with exposure to a wide variety of toxicants including polycyclic aromatic hydrocarbons (PAHs), dioxins, and gasoline oxygenates. The PAMAM dendrimers had relatively high toxicity in comparison to the thiophosphoryl dendrimers, indicating higher risk for the combination of surface chemistry and generation studied here. Significant toxicity was only observed with the PAMAM dendrimers, while thiophosphoryl dendrimers induced very little morbidity or mortality at the concentrations tested (0.016–250 ppm). The results observed for PAMAM and thiophosphoryl dendrimers do not follow the trends previously observed in cell culture studies.,– Although some in vitro studies found an increase in dendrimer generation to be associated with an increase in toxicity, the data presented in this study did not corroborate these findings in an in vivo model at generations tested. A potential explanation is that the largest dendrimers tested in this study were PAMAM G6 and thiophosphoryl G5. In another study, it was found that only PAMAM dendrimers at the G7 level induced 15–40 nm holes in the lipid bilayer. The proposed mechanism was through the removal and formation of dendrimer filled lipid vesicles. Smaller generation PAMAM dendrimers; however, did not display similar membrane disruptive potential. Within the suite of five thiophosphoryl dendrimers, increasing generation resulted in no observable increase in toxicity up to the highest dose tested (). While PAMAM dendrimers demonstrated a generational effect, an increase in generation correlated to a decrease in toxicity () similar to previously published studies. This is perhaps due to a lower bioavailability to the whole organism compared to cells in culture or the stability of higher generation dendrimers in embryo media. The steric hindrance of higher generation dendrimers is thought to make them more likely to change conformation and thus become less stable., In vitro studies ensure the nanoparticle interacts with the cell membrane of a specific cell type. In contrast, the waterborne exposures used in the embryonic zebrafish assay do not indicate a direct dose, rather an exposure concentration, and the impact of surface chemistry and generational size on bioavailability is still unknown. Cellular uptake of nanoparticles is influenced by their size, shape, surface charge, and hydrophobicity. Differential cellular uptake between neutral and anionic surface chemistry is unclear. In similar studies, it was found that anionic dendrimers were more toxic than neutral particles, but no significant difference between the two were observed here. Despite these contradictions, cationic dendrimers were consistently more toxic than anionic or neutral particles in this study () and other studies.,, The positive charge associated with PAMAM dendrimers allows for interactions with important biomolecules such as DNA, lipid membranes, and mitochondria. Considerable research has demonstrated that cationic nanoparticles induce cellular uptake, indicating cellular uptake may be the driving force behind the toxicity associated with cationic dendrimers. Manipulation of the terminal amine to another functional group or methylation of the terminal amine has been shown to decrease toxicity, likely due to a shielding of the cationic charge on the surface. The toxicity observed among the suite of PAMAM dendrimers supports the hypothesis that surface charge drives the uptake and thus toxicity of dendrimers in vivo. Future studies should focus on quantifying uptake and understanding how changes to the inherent features of dendrimers affects their biodistribution within organisms. Dendrimer class also plays a role in toxicity with PAMAM and thiophosphoryl dendrimers displaying significant differences in toxicity. Neutral PAMAM G6-amindoethanol exhibited significantly higher toxicity than three of the thiophosphoryl dendrimers, thereby, demonstrating the inherent toxicity of PAMAM dendrimers. PAMAM dendrimers have been shown to cause instability in lipid bilayers,, mitochondria,, and proteins. Visual evidence showed that PAMAM dendrimers were transported into cells through endocytosis. Furthermore, evidence suggests cationic PAMAM dendrimers induce lyosomal instability through alkalinization. The instability is likely due to a combination of both an increase in pH as well as a lipid bilayer instability through nanoscale hole formation. Smaller PAMAM dendrimers (G1-G5) have been shown to prefer water (plasma), whereas higher generation (G6 and G8) dendrimers were demonstrated to partition at the octanol/water interface. In combination with multiple studies demonstrating the lipid altering capacity of dendrimers,– PAMAM dendrimers are anticipated to enter the plasma and result in cardiac malformations. In contrast, the surface groups of thiophosphoryl dendrimers are aldehydes, which have been shown to increase erythrocyte membrane stability and thermal durability, potentially leading to hepatic toxicity. PAMAM degradation is an area with limited research that could potentially help elucidate one mechanism of toxicity. PAMAM dendrimers contained multiple amide bonds, which are subject to degradation into subunits of ethylenediamine (EDA). If metabolism of PAMAM plays any role in driving the toxicity of this class, then an increase in generation would result in an EDA increase, suggesting generation is still an important variable to consider in dendrimer toxicity. Future studies should investigate the toxicity of dendrons versus parent dendrimers as well as studying transformations of dendrimer platforms associated with in vivo metabolism and excretion. The clearly defined structure and amenability of dendrimers makes them ideal for looking at structure-activity relationships. These relationships can then be used in lieu of empirical data for predicting nanomaterial hazards. Principle characteristics that contribute to the inherent toxicity must be revealed in order to minimize the exposure and potential adverse impacts on living organisms. One way to elucidate these characteristics is through rapid, high-throughput assays. Rapid assays such as the one used in this study allow for accurate reliable data that can test a wide range of materials. The rapid assay allowed for a thorough quick assessment of a wide range of dendrimers and to the best of our knowledge, this is the first in vivo study to address such a broad range of dendrimers. The mechanisms by which dendrimers interact with biological systems are still not fully understood; however, it has been clearly demonstrated that minor alterations in surface chemistry can be used to modify dendrimer toxicity. Due to the inability to isolate size (generation) from surface charge in this study, generational toxicity is still under investigation. Surface charge was found to be the most effective indicator of relative toxicity in this study; however, core composition also clearly plays a role. Even though it is important to understand how surface chemistry modifications alter dendrimer toxicity, understanding the inherent features of the various dendrimer platforms that drive toxicity provides information on which we can base the safe biological and therapeutic development of future dendrimers. The results presented herein help to elucidate the important role of dendrimer charge and class for understanding and mitigating the toxicity of dendrimers for biomedical applications.

In the last decade, many nanoparticle-based therapeutics have entered the pharmaceutical pipeline to improve the efficacy and reduce the systemic toxicity of a wide range of drugs. In fact, nanoparticle chemical and physical properties, such as shape, size, magnetic behavior, surface charge, and functionalization can be engineered to modulate pharmacokinetics, biodistribution, diffusivity through the extracellular matrix, and interaction at cellular and subcellular levels. Therefore, nanotherapeutics are being exploited to potentially overcome biological barriers, deliver hydrophobic drugs at preferential target sites of disease, or prepare formulations of unstable (eg, small interfering ribonucleic acid) and/or highly toxic drugs.– Superparamagnetic iron oxide nanoparticles offer attractive possibilities for the improvement of site-specific drug delivery, thanks to their transportation to targeted areas by an external magnetic field.– They have also been proposed for the enhancement of magnetic resonance imaging contrast in cancer detection, which could be coupled with localized hyperthermia treatments in the so-called theragnostic approach., Despite these potential advantages, only a relatively small number of nanoparticles with iron cores have been approved for clinical use., In 1996, the US Food and Drug Administration approved ferumoxides as the first nanoparticle-based iron oxide imaging agents for the detection of liver lesions. Ferucarbotran was the second clinically approved superparamagnetic iron oxide developed for contrast-enhanced magnetic resonance imaging of the liver. Ferumoxtran-10 has been used to image occult prostate cancer lymph-node metastases in humans. Ferumoxytol has been approved to treat iron-deficiency anemia in adult patients with chronic kidney disease, and is under clinical investigation for the detection of central nervous system inflammation, brain tumors, and cerebral metastases from lung or breast cancer. New magnetic particles and methods of synthesis and coating, with potentially improved performance, are continuously being developed., Superparamagnetic manganese ferrite (MnFeO) nanoparticles are particularly attractive as candidate contrast agents for magnetic resonance imaging, because of a very high magnetization due to their large magnetic spin., Since a fundamental aspect of drug development is the trade-off evaluation of risks and benefits, a parallel toxicological assessment of these new medical devices is in progress, especially in view of the possible specific biological reactivity of nanosized materials that has recently been emerging. Until now, few data have been published. No significant induction of cytotoxicity was shown on HeLa cells treated with tetraethylene glycol stabilized nanoparticles up to a concentration of 200 μg/mL. The surface charge of water-soluble manganese ferrite nanoparticles was shown to influence their uptake and toxicity on murine macrophages, with cationic particles being more biologically reactive. Recently, we proposed a high-yield, low-cost mechanochemical process to synthesize manganese ferrite (MnFeO) nanoparticles, which were subsequently functionalized with citric acid and stabilized in ferrofluid form. Transmission electron microscopy (TEM) micrographs of manganese iron oxide nanoparticles show a powder constituted of unisolated particles having a mean diameter of 7.6 nm. Scanning electron microscopy analysis of the nanoparticles functionalized with citric acid shows significant agglomeration phenomena, and when dispersed in ferrofluid form, the average particle hydrodynamic diameter is about 60 nm. Complete characterization of the developed ferrofluid was reported in a previously published article. To explore the ferrofluid prospects for biomedical application, we set up the study described in the present paper to investigate its biodistribution and organ-specific toxicity in vivo after intravenous administration in mice. In addition, the induction of cytotoxicity was evaluated in vitro as a function of dose and time of treatment. A stable aqueous ferrofluid consisting of manganese ferrite nanoparticles functionalized with citric acid was prepared as previously reported. In brief, hydrated manganese ferrite nanoparticles with a mean particle size of about 8 nm were prepared by an unconventional bottom-up high-energy ball-milling method starting from manganese chloride tetrahydrate (MnCl · 4HO), ferric chloride hexahydrate (FeCl · 6HO), and sodium hydroxide (NaOH) in the presence of sodium chloride (NaCl), which was used as a dispersing agent. The produced nanoparticles were functionalized with citric acid, stirring (90 minutes at 80°C under argon flow) an aqueous suspension of manganese ferrite powder in citric acid water solution at pH 5.2. The resulting oxide–citric acid nanocomposite contained 19±2 wt% of bounded organic compound, and had an equivalent diameter of ~52 nm. The functionalized nanopowder was dispersed in water at pH 7.4, obtaining a final concentration of ~3.8 mg/mL, a hydrodynamic diameter of 59±5 nm and a ζ-value of −37 mV. Physical and chemical characterization of the produced samples was performed according to methods reported in a previous article. Structural characterization of the obtained materials was performed by powder diffractometry. A Seifert X3000 diffractometer (GE Measurement and Control, Billerica, MA, USA), equipped with CuKα radiation, was utilized to collect X-ray diffraction data. The organic fraction of the nanoparticles after functionalization was estimated by elemental analysis, measuring C, N, and H content (EA 1110 analyzer; Carlo Erba Reagents, Milan, Italy). Particle morphology was examined by electron microscopy (JEOL [Tokyo, Japan] 200X TEM and LEO 130 HRSEM [LEO Electron Microscopy, Oberkochen, Germany]) and surface area was obtained by N adsorption at 77 K (Nova 2200 surface-area analyzer; Quantachrome Instruments, Boynton Beach, FL, USA). Zeta potential and average hydrodynamic radius were measured on liquid dispersions by using a Zetasizer Nano ZS (Malvern Instruments, Malvern, UK) dynamic light-scattering and zeta-potential analyzer. The cytotoxic potential of the ferrofluid was investigated in the murine Balb/3T3 fibroblast cell line (American Type Culture Collection, Rockville, MD, USA), which is a validated cell-type model for in vitro cytotoxicity assessment, and is sensitive to metal compounds and nanoparticles.– Intracellular nanoparticle uptake was investigated by flow-cytometry light-scatter measurements and microscopy imaging after Prussian blue staining. In brief, cells resuspended in medium were analyzed by a FACScalibur equipped with an air-cooled argon ion-excitation laser (488 nm) (BD Biosciences, San Jose, CA, USA). The side and forward light-scatter parameters were logarithmically and linearly set up, respectively. The amounts of particles taken up by the cells were estimated by side-scatter geometric mean peak-intensity changes measuring intracellular optical density variation, ie, cytoplasm refractive index., Data were analyzed by FlowJo software (TreeStar, Ashland, OR, USA). For Prussian blue staining, cells were fixed in 70% cold ethanol and stored overnight at −20°C. The following day, they were cytospun (Shandon CytoSpin 2; Thermo Fisher Scientific, Waltham, MA, USA) onto microscope slides and stained with Prussian blue (5% potassium ferrocyanide: 5% hydrochloric acid, 1:1) at room temperature for 30 minutes. The MTT assay allows the assessment of cytotoxic effects by impairment of the metabolic capability of the treated cell population relative to untreated controls. In metabolically active cells, the yellow MTT is reduced by dehydrogenase enzymes to insoluble purple formazan dye crystals. After cell lysing, the intracellular crystals are solubilized, and the absorbance is quantified using a spectrophotometer microplate reader. Subconfluent Balb/3T3 fibroblasts were cultured in 75 mL flasks in a humidified atmosphere of 5% CO at 37°C in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM; Sigma-Aldrich, St Louis, MO, USA) supplemented with 10% calf serum (Sigma-Aldrich), 1% L-glutamine (200 mM), 1% penicillin (10,000 IU/mL), and 1% streptomycin (10 mg/mL). For the MTT assay, Balb/3T3 cells were seeded into a 96-well plate, and cultured for 24 hours (20×10 cells in 200 μL DMEM per well) before treatment. After sonication of the ferrofluid for 20 minutes, the cells were incubated with nanoparticles at defined concentrations for 24 or 48 hours. Four replicate wells were incubated for each concentration. In addition, six replicate wells were seeded with untreated control and six with 0.75 mM HO-exposed cells to serve as negative and positive controls, respectively. The CFA is an in vitro cell-viability assay based on the ability of cells to survive after treatment with chemical or physical agents, retaining the ability to proliferate until the production of a visible colony. This assay has been especially endorsed for testing nanoparticle toxicity, since it is not based on the detection of a colored reaction product, which in some cases has been demonstrated to interact with the nanomaterials tested, thus leading to invalid results., Cells from an exponentially growing culture were harvested by trypsin, counted, and then seeded in 60 mm petri dishes with 3 mL of culture medium at a density of 200 cells/dish. This cell number was sufficient to yield at least 100 colonies in the unexposed controls based on Balb/3T3 cell line-plating efficiency. The culture dishes were incubated at 37°C in humidified 95% air at 5% CO atmosphere. The cells were allowed to attach for about 20 hours, shorter than the 24-hour doubling time, which led us to assume that predominantly single cells were present at the time of exposure. Thereafter, culture medium was replaced with the ferrofluid solution at defined concentrations, and cells were exposed for 72 hours. After this time, the medium was replaced with complete fresh culture medium, and the plates were incubated at 37°C for an additional 6 days. Unexposed control cultures were processed in parallel. Cells were then fixed with methanol:acetic acid 3:1 and stained with 7% Giemsa solution. Colonies (>50 cells/colony) were manually counted under a stereomicroscope. The cytotoxic effect was measured as a decrease in the number of colonies formed after treatment compared to that of untreated controls. Three independent experiments were performed in triplicate for each control and concentration point. The results were normalized to the untreated control and expressed in terms of surviving fraction ([average number of treated colonies/average number of control colonies] ×100). We administered the ferrofluid at the highest achievable dose considering the upper-limit nanocomposite concentration and the maximum tolerated volume for intravenous injection in mice (~200 μL). The tested dose (150 μmol/kg of Fe) was ten times higher than that used in clinical practice for magnetic resonance imaging (ie, 15 μmol/kg of Fe for Endorem, Guerbet, Paris, France). All mouse experimental procedures were carried out according to the Italian legislation on animal experimentation and reviewed by the internal Institutional Animal Care and Use Committee (IACUC). The issue of sex influence on the biodistribution and toxicity of nanoparticles is debated, with some papers showing and some others not showing differences between males and females., In accordance with the IACUC, taking into account the “3-R” principles of animal welfare (reduction, refinement, replacement), it was decided to conduct the experiments on one sex only. CD1 female mice (8 weeks old, n=24) were injected through the tail vein with 150 μmol/kg Fe/kg body weight of the ferrofluid suspension; a group of age-matched mice was injected with vehicle (HO) and used as controls. Possible extravenous injection of the ferrofluid was checked by careful monitoring of the mice at the injection site immediately after injection and in the following days to exclude local blanching or tissue necrosis. At 6 hours, 24 hours, 7 days, and 21 days after the treatment (n=6 for each point) mice were deeply anesthetized with an intraperitoneal injection of 65 mg/kg pentobarbital, then allocated to two different groups (n=3 for each experimental time), in order to investigate: 1) the ferrofluid biodistribution by measurement of the manganese levels in various organs (liver, spleen, kidneys, brain), and 2) the possible histopathological changes in the same organs. Statistical analysis of the differences between values of treated and untreated samples was performed by unpaired Student’s -test. Differences were considered statistically significant when their probability was less than 0.05. The nanoparticle-uptake capability of Balb/3T3 cells has been demonstrated, among others, for amorphous silica nanoparticles and cobalt nanoparticles, likely by an endocytosis mechanism, suggesting that the cell line is a suitable model for nanotoxicology evaluations. The observations after Prussian blue staining () showed that Balb/3T3 fibroblasts internalized the iron oxide nanoparticles and the flow-cytometric light-scatter data (), confirming a trend of increased uptake at increasing exposure concentrations. Only at the highest-tested concentration did the uptake appear to increase between 24 and 48 hours of exposure, suggesting that mechanisms of uptake could be dynamic and influenced by the ferrofluid concentration itself. The results of the MTT assay () showed that cell viability was significantly decreased at the ferrofluid concentrations of 50 and 100 μg/mL, with a dose-dependent response, not significantly different between 24- and 48-hour exposures. Therefore, apparently, the further nanoparticle uptake detected between 24- and 48-hour exposures to 100 μg/mL did not aggravate the cytotoxicity induced by 24-hour exposure. As expected, the positive control treatment with HO induced a marked reduction of cell viability at both treatment times. The CFA () showed that cell proliferation was significantly and dose-dependently impaired starting from the 20 μg/mL concentration. The higher CFA sensitivity could be partly due to longer exposure (72 hour), but it should be noted that even when the treatment time was the same, the CFA was shown to be more sensitive than the MTT assay. The use of a battery of tests to evaluate the in vitro cytotoxicity of engineered nanoparticles has been endorsed. The combination of MTT and CFA, which evaluate cell survival by different endpoints, namely metabolic competence and proliferating capacity, is particularly suitable. In the liver (), manganese levels peaked at 6 hours, showing a fivefold average increase compared to vehicle-treated mice (<0.0001). After 24 hours, a reduction of the peak down to 50% of the level measured at 6 hours was observed; then, the manganese levels gradually declined over the next 3 weeks. However, at all data points analyzed, manganese levels remained significantly higher than in the vehicle-treated mice, suggesting that more than 3 weeks is required for the liver to completely get rid of the nanoparticles. Prussian blue staining of histological sections was used to visually confirm ICP-MS data and to observe the tissue distribution of nanoparticles within a given organ. Prussian blue-stained liver sections () indicated that at 6 hours, the manganese ferrite nanoparticles were located in the liver sinusoids and the greatest quantity had already passed through the layer of endothelial cells. After 24 hours, virtually the totality of iron particles were phagocytosed by Kupffer cells inside the sinusoids. At longer experimental times (7 and 21 days), only a small number of Kupffer cells still retained iron particles, in agreement with the kinetics based on manganese quantitative ICP-MS data. As expected, Prussian blue staining was undetectable in liver sections of vehicle-treated mice. From a histological point of view, liver sections from mice killed 6 hours after treatment with ferrofluid solution showed hydropic swelling of hepatocytes compared with their vehicle-treated counterparts. As shown in , hepatocytes, particularly around the central vein, were characterized by a large pale cytoplasm, containing small clear vacuoles, and a normally located nucleus. After 24 hours, the cellular swelling was already almost completely resolved, and at both the 7- and 21-day experimental points, no differences were observed between treated and vehicle-treated mouse livers. No change in cell morphology reflecting cell death (ie, apoptosis or necrosis) was observed at any examined experimental time. This pattern is typical of an acute, entirely reversible nonlethal cell injury. In , the biodistribution of manganese in the kidneys shows comparable kinetics to that observed in the liver, with a maximum peak measured after 6 hours and a halving of the amount after 24 hours. At longer experimental times, no statistically significant difference was observed in the manganese levels compared to the vehicle-treated mice. The Prussian blue staining of kidney sections () showed an expected absence of iron in the control group. On the contrary, cells were clearly labeled at both 6 and 24 hours after injection. Of note, despite the absence of iron labeling in the glomeruli at both experimental times, translocation phenomena were observed, with iron loading cortical tubules at 6 hours and exclusively medullary tubules at 24 hours. This biodistribution strongly supports the hypothesis of a rapid renal clearance, although it cannot be excluded that a quantity of nanoparticles may have undergone proximal tubule reabsorption. Microscopic examination of kidney sections did not show any apparent change in the cellular and tissue architecture compared to tissue from vehicle-treated mice. The quantitative analyses of manganese levels carried out in the spleen and brain showed a statistically significant increase of this metal after 6 and 24 hours after injection, with complete recovery of basal levels at the longer experimental times ( and ). Due to the high quantity of iron normally present in the spleen and the very low levels of metal in the brain after injection, no information was extrapolated after Prussian blue staining in either organ. Anyway, from the histopathological point of view, no significant change was observed at any experimental time. Representative images of spleen and brain sections from mice killed 6 hours after treatment with ferrofluid solution compared to vehicle-treated mice are shown in –. sub #text

Due to their unique physicochemical properties, carbon nanotubes (CNTs) have applications in a wide variety of industries. One major area of application is in the manufacture of biomaterials and devices, which include biosensors and drug and vaccine delivery vehicles., CNTs have the advantage of superior mechanical strength, and carbon materials in general are considered inert and therefore biocompatible., However, before CNTs can be incorporated into new and existing biomedical devices, their toxicity and biocompatibility need to be thoroughly investigated. Mice injected intraperitoneally with CNTs exhibited toxicological changes similar to those induced by exposure to asbestos,, and CNTs have been linked to the induction of mesotheliomas., Although some in vivo studies have been conducted on the safety of CNT exposure by inhalation or intratracheal administration, their findings have been indeterminate.– Results from in vitro studies have also been ambiguous, with some studies reporting that CNTs induce cytotoxicity and cytokine production,– and others showing that no significant biological responses are elicited., Many reasons have been proposed for these contradictory findings. First, CNTs can be single-walled, multi-walled (MWCNTs), as well as cup-stacked (CSCNTs), and can differ in terms of length and diameter as well as physiochemical properties such as shape, agglomeration, surface structure, and carbon defects, any of which can influence the toxicological evaluation.– Moreover, impurities in CNTs have been shown to induce oxidative stress, resulting in cellular damage., Other factors besides the CNT itself, such as experimental conditions, have also been suggested to contribute to a misleading toxicity evaluation.,, Two recent studies by our group examined the possible factors contributing to the variable cytotoxicity of CNTs in vitro. In one study, it was found that cytotoxicity differed according to the dispersant that is used. CNTs dispersed with gelatin or 1,2-dipalmitoyl-sn-glycero-3-phosphocholine were endocytosed and induced concentration-dependent cytotoxicity and cytokine secretion, while the same was not observed when carboxymethyl cellulose was used instead. Varying degrees of cytotoxicity were also observed in different cell lines. MWCNTs were endocytosed by, and were toxic to, malignant pleural mesothelioma, bronchial epithelial, and macrophage-like cells, but not neuroblastoma and monoblastic cells. Endocytosed MWCNTs accumulated in the lysosome, causing injury to the membrane. However, endocytosed carbon black, a carbon allotrope, had no cytotoxic effects despite settling in the lysosome. This indicates that the toxicity associated with CNTs, which are internalized due to their nanosize, is not an inherent property of the constituent carbon (which is considered inert), but is actually due to other factors. In the present study, we investigated whether the physical dimensions and type of CNTs influence cellular response. MWCNTs (Showa Denko KK, Tokyo, Japan) and CSCNTs (GSI Creos, Tokyo, Japan) of various diameters and lengths were tested in two different epithelial cell lines, in which responses were evaluated based on several biological parameters. The findings indicate that the cellular response to CNTs is dependent on multiple factors, which should be considered while developing CNTs that have optimal biocompatibility. The properties of the MWCNTs are listed in , and those of the CSCNTs are listed in . Three types of MWCNTs – VGCF-X, VGCF-S, and VGCF (vapor grown carbon fibers; with diameters of 15, 80, and 150 nm, respectively) – and three CSCNTs of different lengths (CS-L, 20–80 μm; CS-S, 0.5–20 μm; and CS-M, of intermediate length) were tested. The CNTs were sterilized by autoclaving at 121°C for 15 minutes, then dispersed in 0.1% gelatin in phosphate-buffered saline (PBS) and sonicated in a water bath for 30 minutes. The BEAS-2B human bronchial epithelial cell line was purchased from the American Type Culture Collection (ATCC), (Manassas, VA, USA). The ACC-MESO-1 human malignant pleural mesothelioma cell line was purchased from RIKEN (Wako, Ibaraki, Japan). BEAS-2B cells were cultured in Ham’s Nutrient Mixture F-12 (Nacalai Tesque) with 10% fetal bovine serum ([FBS] Life Technologies, Carlsbad, CA, USA), and MESO-1 cells were cultured in RPMI1640 supplemented with 10% FBS. Both cell lines were cultured at 37°C in a 5% CO humidified incubator and passaged twice a week. For each study, cells were seeded at a density of 2×10 or 5×10 cells/mL and adhered for 24 hours. To determine plasma membrane permeability of cells exposed to CNTs, cells grown in 24-well plates were incubated for 24 hours at 37°C with or without CNT (10 μg/mL). LDH activity in the culture medium was measured using an LDH Cytotoxicity Assay Kit (Cayman Chemical Co, Ann Arbor, MI, USA) according to the manufacturer’s instructions. The red formazan product was measured at 490 nm using a multiplate reader (VERSA max; Molecular Devices LLC, Sunnyvale, CA, USA). Positive control cells were cultured in medium containing 0.01% Triton X-100 and permeability was defined as 100%. Experiments were performed in triplicate. Cells were treated with CellLight Lysosomes-RFP and Early Endosomes-GFP (Life Technologies) according to the manufacturer’s instructions, and cultured on μ-Slide 8-well chambered slides with an ibiTreat surface (ibidi GmbH, Martinsried, Germany) for 24 hours in a 5% CO incubator. After the cells were treated, they were incubated with or without CNTs (1 μg/mL in BEAS-2B and 10 μg/mL in MESO-1 cells) for 24 hours. Before observation, the cells were stained with bisbenzimide H33342 fluorochrome trihydrochloride ([H33342] 1 μg/mL) for 30 minutes. Cells were visualized with differential interference contrast optics and by fluorescence using an LSM510 NLO confocal microscope (Carl Zeiss Meditec AG, Jena, Germany) equipped with blue diode (360 nm), argon (488 nm), and helium–neon (543 nm) lasers for excitation of H33342, GFP, and RFP, respectively. Cells grown on cover slips in a 3.5 cm culture dish were exposed to CNTs (1 μg/mL in BEAS-2B and 10 μg/mL in MESO-1 cells) for 24 hours. Cells were washed twice in PBS, fixed with 2.5% glutaraldehyde, postfixed with 1% osmic acid, and embedded in Epon. Sections were cut at 60 nm, stained with uranyl acetate and lead citrate, and visualized under a JEM1400 transmission electron microscope (JEOL, Tokyo, Japan) at 80 keV. Total ROS/superoxide production in cells exposed to CNTs was determined using a total ROS/superoxide detection kit (Enzo Life Sciences, Inc., Farmingdale, NY, USA) according to the manufacturer’s instructions. After the cells had adhered for 24 hours in 12-well plates, they were pretreated with oxidative stress detection reagent and superoxide detection reagent for 30 minutes before CNT solution (1 μg/mL in BEAS-2B and 10 μg/mL in MESO-1 cells) was added. Pyocyanin (100 μM) was used to induce ROS production. After 60 minutes, the cells were washed once with 1× wash buffer and harvested with trypsin–ethylenediaminetetraacetic acid. Cells were resuspended in 0.3 mL 1× wash buffer with 10% FBS and passed through a nylon mesh; then, they were subjected to flow cytometry (FACSCalibur™; BD Biosciences, San Jose, CA, USA) using the FL1 and FL2 channels for oxidative stress detection reagent and superoxide detection reagent signals, respectively, until 10,000 cells were recorded. Cell suspensions were assayed in triplicate for each treatment condition. To assess lysosomal acidity, cells were adhered in a 12-well plate for 24 hours and exposed to CNTs (1 or 10 μg/mL in BEAS-2B and 1, 10, or 50 μg/mL in MESO-1 cells) for 24 hours. Cells were washed twice with PBS, and then incubated for 30 minutes under growth conditions in prewarmed medium containing 1 μM LysoSensor™ Green DND-189 dye (Life Technologies). After washing with PBS, cells were resuspended in PBS containing 10% FBS and subjected to flow cytometry until 10,000 cells were recorded. Cell suspensions were assayed in quadruplicate for each treatment condition and the LysoSensor intensity (%) was calculated. Since CNTs may interfere with the fluorescence signal during flow cytometry, control cells that were not exposed to CNTs prior to incubation with LysoSensor were prepared as a CNT blank, and CNTs were added before resuspension. CNT blank samples were assayed and the CNT inhibition intensity (%) was calculated. The change in % intensity was calculated as follows: All data are presented as mean ± standard error. Values were obtained from at least three independent experiments. The Student’s -test was used to compare means, and <0.05 was considered statistically significant. The cytotoxicity of CNTs was assessed using the AB assay (). The toxicity of MWCNTs in BEAS-2B cells was concentration dependent, but did not vary as a function of length or diameter. The toxicity of CSCNTs in BEAS-2B cells was dependent on concentration and length (). In MESO-1 cells, MWCNT toxicity varied by concentration and was consistently lower than in BEAS-2B cells (). CSCNTs were not toxic to MESO-1 cells, except at the highest concentrations (50 μg/mL) of CS-L and CS-M (). MWCNTs were more toxic than CSCNTs in both cell lines. The LDH assay was used to evaluate plasma membrane permeability. BEAS-2B cells were more permeable to MWCNTs (>50%) than CSCNTs (<50%) at a CNT concentration of 10 μg/mL (). Among MWCNTs, permeability to VGCF-X was highest at 77%, followed by VGCF-S and VGCF; for CSCNTs, permeability was CS-M ≥ CS-L > CS-S. The permeability of MESO-1 cells to both types of CNT was <30%, with cells being most permeable to VGCF at 29% (). In general, permeability followed a trend that was similar, but not identical, to cytotoxicity in both cell types, with membrane permeability at 10 μg/mL reflecting the trend for cytotoxicity at 50 μg/mL. BEAS-2B cells that had endocytosed CNTs were observed by LSM and TEM ( and ). Cells were treated with fluorescent protein-signal peptide fusion molecules to visualize the lysosome (RFP) and early endosome (GFP). GCF, VGCF-S, and CS-L were visible as multiple long fiber bundles adjacent to the nucleus and were seen protruding from the lysosome (, , and ). Although a similar distribution of the fibers was observed with VGCF-X and CS-S, for the former, only a portion of the agglomerate was inside the lysosome while the majority of fibers penetrated the plasma membrane, as opposed to CS-S fibers, which were mostly in the lysosomal compartment ( and ). CS-Ms were observed as both single fibers and aggregates and appeared as a mixture of CS-Ls and CS-Ss (). There was no overlap in the signals of early endosomes and CNTs in the cytoplasm of BEAS-2B and MESO-1 cells. The lysosomal distribution of VGCF, VGCF-S, and CS-L was more clearly visible by TEM (, and ). Two pits were observed in the process of endocytosis of VGCF-X aggregates (). Although MESO-1 cells were exposed to MWCNTs and CSCNTs at a tenfold higher concentration than BEAS-2B cells (), CNT fibers and agglomerates were not specifically associated with the lysosome and were instead distributed throughout the cytoplasm while being excluded from the nucleus, with no obvious effects on adhesion or viability. In TEM images, a few isolated VGCF and VGCF-S fibers were observed adjacent to nuclei ( and ), while the other CNTs were present as aggregates (–). The total ROS production in BEAS-2B cells exposed to MWCNTs and CSCNTs is shown in . Oxidative stress was significantly upregulated, and superoxide dismutase activity was slightly increased by VGCF-X compared to that for the positive control pyocyanin. An increase in oxidative stress level was observed in MESO-1 cells exposed to VGCF-X (). An acidotropic probe, which accumulates in acidic organelles and exhibits pH-dependent increases in fluorescence intensity upon acidification, was used to evaluate changes in intracellular acidity upon exposure to CNTs. Cells that had internalized CNTs were isolated by flow cytometry ( and ). BEAS-2B cells exposed to 50 μg/mL MWCNTs were not analyzed because a sufficient number of living cells could not be obtained for analysis due to the toxicity of MWCNTs at this concentration. Increases in intensity upon exposure of BEAS-2B cells to 1 μg/mL VGCF, VGCF-S, and VGCF-X were 10.8%, 7.5%, and 17.5%, respectively, while, for CSCNTs at the same concentration, the values were <5% (). However, at 10 μg/mL, all CNTs induced increases in intensity of >10% in BEAS-2B cells. In contrast, in MESO-1 cells, changes were mostly ≤10%, with VGCF and VGCF-S (at 50 μg/mL) accounting for more than 30% of the total increase (). To determine whether acidification was due to CNT uptake, the lysosomes of BEAS-2B cells exposed to 10 μg/mL CNT and treated with the acidotropic probe were visualized, while control cells were double-stained with Lysosomes-RFP dye and emitted orange fluorescence (). Small vacuoles were observed in CNT-exposed cells, but CNT aggregates were visible only in lysosomes, confirming that the observed increases in intensity were due to lysosomal CNT uptake. A major concern for the use of CNTs is their safety, since their shape is similar to that of asbestos. Although CNTs need to be internalized by cells in order to be useful as carriers, intracellular accumulation can be cytotoxic. A number of studies have investigated the biodegradability of CNTs in an attempt to address this issue.– However, CNTs are inherently stable, and degradation by chemical modification has yet to be developed. Therefore, the present study examined the optimal CNT shape and size that can maximize biocompatibility using two different types of CNT. Both BEAS-2B and MESO-1 cells internalized MWCNTs, but different cytotoxic effects were observed in each cell line. In BEAS-2B cells, toxicity varied as a function of diameter, such that the toxicity was VGCF > VGCF-X > VGCF-S, while for MESO-1 cells, the order was VGCF > VGCF-S ≥ VGCF-X (). In another study, macrophages, but not mesothelial or epithelial cells, were shown to take up MWCNTs, whereas cytotoxicity was comparable to what was observed in BEAS-2B cells or MESO-1 cells in the present study. The discordance between those results and ours may be the difference in internalization time. The previous study evaluated CNT uptake after 3 hours of MWCNT exposure, and evaluated cytotoxicity on the fourth day. Cellular uptake is dependent on time and cell type, and therefore a 3-hour exposure may be too short to evaluate the full extent of endocytosis., In contrast, CSCNTs were not toxic to MESO-1 cells; however, in BEAS-2B cells, toxicity was also dependent on size (in this case, length), with toxicity values of CS-L ≥ CS-M > CS-S (). These results are consistent with reports that have demonstrated a positive association between CNT length and cytotoxicity.,, Although the cytotoxicity of CSCNTs of a given diameter was comparable between cell lines, VGCF-X, which is shorter than VGCF-S, was more toxic to BEAS-2B cells. VGCF-X had the shortest length and smallest diameter among the CNTs tested in this study. However, VGCF-X agglomerates had the largest diameter, and, as such, were not taken up by BEAS-2B cells, nor did they fully penetrate the cell membrane ( and ). We previously reported that the volume of BEAS-2B cells is less than half of that of MESO-1 cells. Smaller cells may be more susceptible to cytotoxicity because of incomplete endocytosis of a CNT aggregate. This is supported by the observation that LDH activity was highest in BEAS-2B cells exposed to VGCF-X. Moreover, the fact that CS-L and CS-M induced cytotoxicity to a comparable or lesser degree than VGCF despite their greater lengths could indicate that cytotoxicity is related to CNT rigidity, which has been previously suggested. Although CSCNTs were similar in diameter to VGCF-S, they have greater flexibility, which predisposes them to becoming more easily tangled. Indeed, CS-M and CS-S appeared to be tangled inside lysosomes in the TEM and LSM images ( and ). Furthermore, CS-L and VGCF-S aggregates have similar shape () and comparable cytotoxicity values. These results demonstrate that CNT toxicity is a function not only of tube length and rigidity, but also cell and aggregate sizes, and it is therefore imprudent to make generalizations about toxicity without considering multiple parameters. VGCF-X was the only CNT that caused an increase in total ROS (). This indicates that CNTs are not, in general, inducers of oxidative stress in cells. It was recently shown that CNTs can act as OH radical scavengers.,– However, VGCF-X has a higher iron content than VGCF or VGCF-S, since it was not subjected to iron removal heat treatment, and iron is a potential source of ROS. Nonetheless, stimulation of intracellular total ROS production did not directly contribute to cytotoxicity in MESO-1 cells. We speculated that damage to the lysosome could be the cause of cytotoxicity. In fact, non-aggregated VGCF and VGCF-S penetrated the lysosomal membrane, as seen in the TEM images ( and and and ). Despite this, the signal intensity of injured, fluorescently labeled lysosomes remained unchanged. We recently reported that highly purified MWCNTs induced the expression of the autophagic marker light chain 3B, and 3-MA – a widely used inhibitor of autophagosome formation – reduced MWCNT-induced cytotoxicity in BEAS-2B cells. This was further validated by the present observation that cells exposed to CNTs showed increased acidification as a result of autophagy. Intracellular acidification was observed in MESO-1 cells only when exposed to VGCF and VGCF-S at a concentration of 50 μg/mL, whereas VGCF-X used at the same concentration did not have this effect while inducing a comparable degree of cytotoxicity as VGCF-S. This study was unable to clarify how autophagy was triggered. However, since acidification was unlikely to occur in lysosomes that had endocytosed CS-S, as in the case of carbon black (reported in our previous study), it is probable that the shape and size of CNTs are involved in promoting autophagy. #text

Pancreatic cancer is the fourth leading cause of cancer-related death in the US, with an overall 5-year survival rate of 5%. Even localized disease has a 5-year survival rate of only 18%–24%. According to the American Cancer Society’s estimates, 45,220 pancreatic cancers will be diagnosed in 2013 and 38,460 patients will die of pancreatic cancer. In spite of significant improvements in operative techniques and postoperative mortality rates, the overall survival for these patients has not changed significantly over the past four decades. Borderline resectable pancreatic cancers exemplify a subset of locally advanced pancreatic cancer (LAPC). Up to 30% of patients present with LAPC. National Comprehensive Cancer Network (NCCN) guidelines v2.2012 have laid out the criteria for borderline resectable pancreatic tumor. The guidelines clearly emphasize the need to delineating the tumor from superior mesenteric vein (SMV), portal vein, gastrodudenal artery, hepatic artery and superior mesenteric artery (SMA). The guidelines also highlighted characterizing the involvement of these vessels in terms of impingement, abutment, narrowing, occlusion and encasement. The tumor is considered to be borderline resectable if it fulfills these criteria and shows no evidence of distant metastasis. This category carries higher risk of margin-positive resection. Currently, preoperative neoadjuvant therapy is often used for patients with borderline resectable tumors. Anatomic staging is performed both before and after chemotherapy and/or chemoradiation with the use of multidetector computed tomography (CT). With such therapy, a large number of cancer cells are destroyed and thereafter replaced by fibrosis. In the pancreas, the acinar epithelium is more sensitive to radiation compared to the islet cells and post-radiation therapy appearance may simulate pancreatitis., The post-treatment response is usually seen as soft tissue on restaging CT scan, leaving the nature of this soft tissue open to speculation of post-neoadjuvant morphologic change or tumor progression. Moreover, because of the overlapping soft tissue attenuation, CT can not reliably distinguish between the two. This soft tissue often tends to make the tumor margin indistinct, posing an additional challenge to the operating surgeon who aims for achieving disease-free margin. Thus, there is a need for a non-invasive imaging tool that allows the accurate delineation of treatment response from an adjacent viable tumor., Conventional magnetic resonance imaging (MRI) with gadolinium depicts enhancement patterns and provides no information at the cellular level. Ferumoxytol, by virtue of its cellular uptake, is more relevant than conventional MRI, which cannot provide information on the tumor margin of aggressive tumors like pancreatic carcinoma. With this background, we sought to evaluate the role of ferumoxytol-enhanced MRI in delineating primary tumors in pancreatic adenocarcinoma patients undergoing preoperative neoadjuvant therapy. The objective of our study was to investigate if “functional” imaging with ferumoxytol can provide more precise tumor margin delineation than conventional “structural” imaging in patients undergoing neoadjuvant therapy for pancreatic carcinoma. Ferumoxytol (AMAG Pharmaceuticals, Lexington, MA, USA) is an USPIO nanoparticle with an average colloidal particle size of 30 nm by light scattering and a molecular weight of 750 kDa. It is comprised of a nonstoichiometric magnetite core covered by a semisynthetic carbohydrate coating of polyglucose sorbitol carboxymethylether designed to minimize immunological sensitivity. Ferumoxytol is available as a sterile, neutral pH liquid containing 30 mg of elemental iron per mL. The blood half-life is dose dependent and is approximately 14.5 hours at a dose of 4 mg/kg. All patients received ferumoxytol intravenously at a dose of 6 mg/kg of body weight to a maximum dose of 510 mg (17 mL) of elemental iron. Ferumoxytol was administered by hand injection at the rate of 1 mL/second, which was chased by a saline bolus of 10 mL. Each patient was monitored for the development of adverse effects of ferumoxytol. Group A patients underwent MRI scans after completing the preoperative neoadjuvant therapy and before the scheduled Whipple’s surgery. Group B patients underwent MRI scans before their scheduled Whipple’s surgery. The MRI images were loaded onto the OsiriX DICOM viewer (; 64-bit version Pixmeo SARL) for image viewing and post-processing. These scans were reviewed by two radiologists (with 5 and 20 years of experience in reading abdominal MRI scans, respectively) and the T2 value* of primary tumor and adjacent disease-free parenchyma at the 48 hour time point were measured as consensus by drawing equal sized, non-overlapping, oval-shaped, operator-dependent regions of interest (ROI). After the Whipple’s procedure, the resected surgical specimens were fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned, and stained with hematoxylin-eosin (HE). Two patients who did not undergo Whipple’s procedure were excluded. Histopathologic analysis was performed by a gastrointestinal (GI) pathologist specialized in the field with over 10 years of experience. The tumor margins (transection, uncinate, and posterior) were assessed along with the tumor/fibrosis ratio. Of the eight patients, four each were part of group A and group B. Each group comprised two women and two men. The average age was 68.6 years in group A and 70.8 years in group B. No adverse events were noted following ferumoxytol injection. All images were considered of diagnostic quality. The average area of the region of interest (ROI) was 0.5 cm. The mean T2* of the tumor and adjacent parenchyma at 48 hours in group A were 22.11 ms (SD: 12.3) and 16.34 (SD: 2.3) ms, respectively. In group B, these values were 23.96 ms for the tumor (SD: 10.6) and 23.26 ms for the adjacent parenchyma (SD: 8.5). While T2* values of the tumor did not differ greatly, the T2* values of the adjacent parenchyma between the two groups were strikingly different. The T2* difference (ΔT2*) between the tumor and adjacent parenchyma in patients who received neoadjuvant therapy was more pronounced compared to the difference in patients who did not receive neoadjuvant therapy (5.77 ms in group A [SD: 9.5] vs 0.70 ms in group B [SD: 7]; ). The tumor margins were subjectively more distinct in group A compared to perceptible margins in group B. The margins were better appreciated on the T2*-weighted images compared to the conventional T1- or T2-weighted images. Even in the group A patients, the margins were better delineated on post-ferumoxytol–enhanced scans at the 48 hour time point compared to the baseline scan. The interface between the tumor and SMV portal vein, gastroduodenal artery, and SMA was clearly identified by both reviewers (). The mean duration between the scan and surgery was 7.3 days and the mean duration between the last day of neoadjuvant therapy and surgery in group A was 18 days. Histopathologic evaluation showed prominent fibrosis with scattered residual tumor glands within the lesion (therapeutic effect) resulting in a low tumor/fibrosis ratio, and a rim of dense fibrosis around the tumor (that is, well demarcated from the intact parenchyma at its periphery) in group A. Conversely, the majority of the lesion consisted of intact tumor cells/glands, and the tumor/fibrosis ratio was significantly higher in group B (). The tumor margins were disease free in all eight patients. Two patients (one in each group) did not undergo Whipple’s procedure due to hepatic metastasis detected on preoperative imaging. Strategies to improve the prognosis of pancreatic cancer are constantly evolving. A well-performed pancreatic protocol CT is a popular approach in staging pancreatic cancer and has been validated well in the literature.– MRI has also been proved equally efficacious in predicting vascular and nodal involvement., CT, however, has limited capacity to characterize the nature of post-radiation soft tissue attenuation. In fact, Katz et al, in their study of 129 patients with borderline resectable pancreatic carcinoma, concluded that radiographic downstaging was a rarity following neoadjuvant therapy. One of the reasons for the inaccurate delineation of the tumor margin is ill-defined boundaries, which is typical for pancreatic cancer, causing difficulty in identifying the full volume of the tumor mass. Sohn et al showed that there is a >50% increase in 5-year mortality following a margin-positive resection. The significance of margin-negative resection was also studied by Howard et al, who reported a similar outcome, where the 5-year mortality was 39% higher in patients with a margin-positive resection compared to those with negative margins. Thus, it is not surprising that it is the main cause of local disease recurrence and grim prognosis. Hence, there is a need to develop alternative imaging methods in this regard. Iron oxide-based USPIOs have been widely used for the characterization of nodal metastasis in various abdomino-pelvic malignancies., Ferumoxytol is a newer USPIO, which is FDA-approved for the treatment of iron deficiency anemia in patients with chronic renal disease and has also been utilized to image inflammation in animal studies.– Another super paramagnetic iron oxide-ferucarbotran was recently studied by Kakite et al in animal models to evaluate ablated liver parenchyma. This observation was further validated in human studies, which demonstrated the use of impaired clearance of ferucarbotran to assess ablative margin and predict residual or recurrent tumor in patients undergoing radiofrequency ablation for hepatocellular carcinoma., Ferumoxytol has been used for tumor imaging before by Muldoon et al for intracerebral tumors in animal models. They assessed the antiangiogenic response of chemotherapeutic agents with the use of ferumoxytol. The utility of iron oxide nanoparticles selectively targeting mammary cancer cells for the detection of micrometastasis was recently demonstrated in vivo and in vitro in a study by Kievit et al. However, to the best of our knowledge, USPIOs have not been used for the delineation of the tumor margin in pancreatic carcinomas. We observed the T2* gradient between the tumor and adjacent disease-free parenchyma in our study, with higher T2* values in the tumor and lower values in adjacent parenchyma in group A. Considering the neoadjuvant therapy directed at the tumor site, the inflammatory response triggered by neoadjuvant therapy explains the higher T2* values, conveying a higher amount of intracellular ferumoxytol in the tumor region compared to the adjacent parenchyma and subsequent lower tumor-to-fibrosis ratio on histopathologic analysis. As this driving force in the form of neoadjuvant therapy was not present in group B, this group did not have the same degree of inflammation sequel and iron accumulation, thereby showing a narrow gradient in T2* and a higher tumor/fibrosis ratio. The remarkable difference in the T2* of adjacent parenchyma between the two groups can also be attributed to the neoadjuvant therapy, as such therapy also affects normal pancreatic cells, leading to cyanosis secondary to impairment of blood flow. This apparent T2* gradient seen in our study may be used for better tumor delineation of the pancreatic cancer, thereby affecting surgical planning. The delineation of the tumor margin was better in patients with preoperative neoadjuvant therapy (Group A) in our study. T2*-weighted images acquired 48 hours after ferumoxytol injection can offer an added advantage over the conventional T2-weighted image. This is supported by our observation of enhanced tumor margin delineation on the T2*-weighted post-ferumoxytol scan at the 48 hour time point in comparison with conventional T1- and T2-weighted images, even in group A. Our study is limited by the small sample size and the fewer number of patients who underwent preoperative neoadjuvant therapy. We could not analyze the primary tumor on histopathology in two patients. We also restricted our sample size to resectable/borderline resectable pancreatic cancer patients. We assessed the tumor to fibrosis ratio subjectively and did not quantify iron accumulation histopathologically using special stains. However, we hope to highlight a potential application of ferumoxytol-enhanced MRI in enhanced delineation of pancreatic primary tumor margin with our preliminary data and to warrant the development of ferumoxytol-enhanced MRI as a diagnostic tool for pancreatic cancer. This observation can also be used to predict the status of the tumor margin on histopathology in future studies. Additionally, this observation may be applied to image other primary tumors following neoadjuvant therapy. To conclude, by better delineation of pancreatic cancer on ferumoxytol-enhanced MRI scans in patients receiving preoperative neoadjuvant therapy, imaging may contribute a roadmap for the surgeons and can aid in achieving disease-free margin at the time of surgery, thus improving the prognosis of pancreatic carcinoma.

Nano technology has been widely used in biomedical research in recent years. Gold nanorods (AuNRs) are a nontoxic nonmaterial and are thought to be a promising tool for use in clinical diagnosis and treatment of diseases., AuNRs have a characteristic surface plasmon resonance,– with two distinctive absorption peaks: a longitudinal plasmon absorption peak and transverse plasmon peak (at around 520 nm). The longitudinal plasmon peak locates in the far-red and near-infrared (NIR) region of the electromagnetic spectrum. In these regions, living tissues could be well penetrated by light located in far-red and near-infrared (NIR) region of the electromagnetic spectrum. In addition, the longitudinal plasmon peak can be altered by modifying the structure of the AuNRs, without changing the transverse plasmon peak. Due to the phenomenon of surface plasmon resonance, AuNRs have a higher light absorption in the NIR region than do conventional laser phototherapy agents. High light absorption in the NIR region is very important in photothermal therapy as it has the deepest penetration in tissue (known as “tissue optical window”). The gold nanospheres and gold nanoshells have shown a strong absorption in NIR, when their size and thickness, respectively, were controlled., Spheres with a diameter of 30 nm were found to be optimal for intracellular uptake. Therefore, the AuNRs (49.81 nm at length and 12.70 nm in diameter) described in this study are better than gold nanospheres and gold nanoshells with a larger size, as the bigger size of the nanospheres/nanoshells will reduce intracellular uptake of gold nanospheres or gold nanoshells. The light absorbed by AuNRs can subsequently convert into heat., Therefore, AuNRs have a great potential to be used in plasmonic photothermal therapy. In the descriptions by Wang et al, AuNRs had a quick clearance in blood, and long-term retention of AuNRs were found in the reticuloendothelial system, in tissues such as liver, spleen, and kidney. In contrast, AuNRs in brain, muscle, and bone were drastically decreased 30 minutes after injection. AuNRs can be functionally modified with specific tumor-targeting molecules, such as antibodies.,, AuNRs conjugated with tumor-targeting antibody have been shown to selectively target cancer cells but not normal cells., Epidermal growth factor receptor (EGFR) is overexpressed in many cancer cells.– Anti-EGFR antibodies have been used in targeting cancer cells with overexpression of EGFR.– It is conceivable that anti-EGFR monoclonal antibody (EGFRmAb) conjugated with AuNRs (EGFRmAb-AuNRs) could specifically target cancer cells and improve the selectivity and efficiency of AuNR-mediated photothermal cancer therapy. AuNRs enter into cells by diffusion. The entry of EGFRmAb-AuNRs into cells is mainly dependent on endocytosis, mediated by the binding between the conjugated EGFR antibody and EGFR on the cell membrane. EGFR expression varies among different cellular types. The method used to conjugate EGFRmAb onto the AuNRs influences the binding efficiency between the EGFRmAb-AuNR and EGFR. Thus, the effects of EGFRmAb-AuNRs might vary in different studies due to the above factors. Laryngeal cancer is one of the most malignant tumors of the head and neck., Laryngeal squamous cell cancer (LSCC) is the most common type of laryngeal cancer. Lymph node metastasis and distant metastasis have been observed in patients with laryngeal squamous cell cancer,, leading to a poor survival. Chemotherapy, surgery, and radiotherapy are now used to treat laryngeal cancer.– These therapies are proved to be effective for laryngeal cancer, but they also bring several side effects for patients. LSCC cases mostly have high levels of EGFR expression. High EGFR expression has been shown to be associated with poor survival in patients with LSCC.– Therefore, the targeted killing of LSCC cells with high expression of EGFR might be an effective way to treat LSCC. Intracellular hyperthermia mediated by AuNRs has been proved to effectively kill cancer cells. More recent studies have showed, that AuNRs can be modified with specific tumor-targeting antibodies to enhance their specificity in therapy. AuNRs modified with EGFRmAb specifically target the cells with EGFR expression. With development of nanotechnology, photothermal therapy using EGFRmAb-AuNR may be a new effective therapy for the treatment of LSCC. Since EGFR is overexpressed in LSCC cells,, in this study, EGFRmAb-AuNR was synthesized and used to induce Hep-2 cell (human LSCC cells) apoptosis in vitro and in vivo, and the possible apoptotic mechanism was investigated at the cellular level. AuNRs were provided by the Kunming Institute of Precious Metals (Kunming, People’s Republic of China). AuNRs were prepared using seeded growth conditions, described elsewhere.– The longitudinal plasmon resonances of AuNRs centered at 800 nm. To prepare the EGFRmAb-AuNRs conjugates, a 250 μL colloidal solution (0.4 nmol/L) of poly(sodium 4-styrenesulfonate)-modified AuNRs and 1 μL (25.7 mg/mL) EGFRmAb (Sigma-Aldrich, St Louis, MO, USA) were mixed and oscillated for 30 minutes. Then, the solution was centrifuged for 10 minutes at 12,000 rpm, and the sediments of EGFRmAb-AuNR conjugate were dissolved with phosphate-buffered saline (PBS). The synthetic AuNRs (0.1 nmol/L) were observed under transmission electron microscope (TEM) (JEM 1010; JEOL Ltd, Tokyo, Japan) to determine the mean value of the long and transverse diameter of the AuNRs. The absorption spectra of the AuNRs and EGFRmAb-AuNRs were determined by using ultraviolet-visible (UV-vis)-NIR spectrometer (Lambda 900; PerkinElmer Inc., Waltham, MA, USA). A diode laser K81S09F (WT Beijing Ltd, Beijing, People’s Republic China), at 808 nm, was used for the laser irradiation experiment. The red laser, at 808 nm, was focused to a 1 mm diameter spot on the sample. Hep-2 cells were cultured in Dulbecco’s Modified Eagle’s Medium containing 10% fetal bovine serum and 1% penicillin-streptomycin (Life Technologies, Carlsbad, CA, USA), at 37°C with a humidified atmosphere containing 5% CO. For the TEM analysis, Hep-2 cells were incubated with 0.1 nmol/L AuNRs or 0.1 nmol/L EGFRmAb-AuNRs for 6 hours before collection. Hep-2 cells were also treated with the combination of AuNRs plus laser (AuNRs+Laser) or EGFRmAb-AuNRs plus laser (EGFRmAb-AuNRs+Laser), and at 24 hours after the laser treatment, the irradiated cells were collected for the analysis. Cells were collected by 800 rpm centrifugation and fixed with 3.5% glutaraldehyde. The fixed cells were examined under TEM (JEM-1010, JEOL Company, Japan). Similarly, cells were incubated with 0.1 nmol/L AuNRs or 0.1 nmol/L EGFRmAb-AuNRs for 6 hours before the element analysis using inductively coupled plasma atomic emission spectroscopy (ICP-AES) (Lambda900). A 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to analyze Hep-2 cell proliferation under different stimuli. The EGFR-expression of Hep-2 cells and LSCC patient samples were examined by western blot. The samples (n=36) of LSCC and adjacent tissue, and of normal laryngeal tissues (n=13) were collected from the First and the Third Affiliated Hospital of Kunming Medical University. The ethics committee of Kunming Medical University approved this study in using human and mouse tissues. The whole-cell or whole-tissue lysate were prepared using protein lysis buffer (Beyotime, P0013). Briefly, equal protein/lane was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and then blotted onto a polyvinylidene difluoride immobilon membrane (EMD Millipore, Billerica, MA, USA). The membrane was incubated with the solution of diluted primary antibodies (1:000 v/v) overnight at 4°C. Subsequently, the membrane was incubated with the peroxidase-conjugated anti-rabbit (KPL, 474-1506, 1:5000) immunoglobulin G for 1 hour at room temperature. The enhanced chemiluminescence western blot detection kit (Millipore, WBKLS0500) was used to detect the epitope. Hep-2 cells were cultured in 24-well plates and treated with 0.1 nmol/L AuNRs or 0.1 nmol/L EGFRmAb-AuNRs for 6 hours before the irradiation. The irradiated cells were collected at 0 hours, 24 hours, 48 hours, and 72 hours postirradiation. The collected cells were fixed with 3.5% glutaraldehyde. Apoptosis was analyzed using two methods: TEM and flow cytometry (FCM). TEM was used to observe the ultrastructure of the tumor cells. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)/Propidium Iodide (PI) FCM was the method used to determine the apoptosis and cell cycle distribution of the treated Hep-2 cells. Cells were harvested using a trypsin/ethylenediaminetetraacetic acid mixture, and then, cells (1 × 10) were fixed with 4% paraformaldehyde for 30 minutes at 4°C. After that, cells were washed twice with PBS and then, fixed with 70% ethanol overnight at −20°C. Cells were then rehydrated and stained with TUNEL Label Mix (F. Hoffman-La Roche Ltd, Basel, Switzerland) for 60 minutes at 37°C in a humidified atmosphere, in darkness. Cells were then washed with PBS and treated with 100 U/mL RNase (R6148, Sigma-Aldrich) containing 0.002% Triton™ X 100 (Sigma-Aldrich) for 15 minutes before staining with PI (final concentration 50 μg/mL) (cIEF pI Marker Kit; Beckman Coulter Inc., Brea, CA, USA) for 20 minutes. The treated cells were then analyzed by FACScan (Coulter Epics XL™ Flow Cytometer; Beckman Coulter Inc.). For the FACScan analysis of xenograft tumor cells, tumors in nude mice were excised and homogenized in lysis buffer (RIPA Lysis Buffer System/sc-24948; Santa Cruz Biotechnology Inc., Dallas, TX, USA) by grinding with a pestle. The homogenates were then passed through a 70 μM cell strainer to get single-cell suspensions, which were then analyzed by the previously described TUNEL/PI FCM method. Meanwhile, FCM was used to analyze other apoptotic molecules, including cytochrome c (Cyt-c) (CBA077 InnoCyte™ Flow Cytometric Cytochrome c Release Kit/CBA077-1KIT; EMD Millipore), change in mitochondrial membrane potential (ΔΨm) (Mitochondria staining kit (JC-1)/125T; MultiSciences Biotech Company, People’s Republic of China), B-cell lymphoma 2 protein (Bcl-2) (Bcl2 Mouse Anti-Human mAb [clone Bcl2/100]), FITC conjugate/A15764; Life Technologies), Bcl-2-associated X protein (Bax) (LifeSpan BioSciences Inc.), Ca (Calcium Green™-1/C-3012; Life Technologies), reactive oxygen species (ROS) (Reactive Oxygen Species Assay Kit/S0033; Beyotime Co, Jiangsu, People’s Republic of China) and caspase-3 (BD Biosciences, Franklin Lakes, NJ, USA). BALB/C nude mice (average weight 17–22 g, age 5–6 weeks) were purchased from Vital River Laboratories (Beijing, People’s Republic of China) and housed with sterile food and water. Nude mice received subcutaneous injection with tumor cells (2 × 10/mL). The palpable tumors were typically observed about 1 week after the injection of Hep-2 tumor cells. When the mean tumor volumes were 100∼200 mm, treatments were initiated. This consisted of 0.9% NaCl, AuNRs, or EGFRmAb-AuNRs injected through the tail vein. The injected dose of AuNRs in the AuNR group or EGFRmAb-AuNR group was 560 μg/kg. The dosage for the in vivo study was fixed by referring to the description by Wang et al. In that study, Sprague Dawley rats were injected intravenously with AuNRs at a dose of 560 μg/kg. The dosages were nontoxic to the mice used in this study. The combination of 0.9% NaCl+Laser served as a negative control, and cisplatin served as a positive control for analyzing the treatment effects of AuNRs+Laser or EGFRmAb-AuNRs+Laser on mouse tumor xenografts. Cisplatin (5 mg/kg) was administered by intraperitoneal injection twice a week (day 1 and day 3). An NIR laser was used to irradiate the tumor with a wavelength of 808 nm. The irradiation power was 3.0 W/cm, and the irradiation time was 8 minutes. After 2 weeks, mice in different treatment groups were euthanized, and tumor tissues were collected. Tumor size was measured with a vernier caliper every 1 to 2 days (by investigators Yingying Zhang and Shiwen Zhang) after the irradiation. The volume was calculated using the formula: Tumors in nude mice were excised and sectioned to 8 μm thickness. In vivo apoptosis detection was performed using hematoxylin and eosin (H&E staining and TACS 2 TdT-DAB In Situ Apoptosis Detection Kit (Trevigen, Inc., Gaithersburg, MD, USA). Apoptotic cells were detected by brown staining, with the TACS 2 TdT-DAB In Situ Apoptosis Detection Kit. Apoptotic cells in tumors were recorded under a light microscope (×400 magnification) (Olympus CH30; Olympus, Tokyo, Japan). Ten randomly selected fields of entire tumor tissue were examined in the EGFRmAb-AuNRs+Laser treatment group. To characterize the AuNRs, TEM analysis was used. The results of the TEM analysis showed that 0.1 nmol/L AuNRs had good stability and dispersion (). The particle size of the AuNRs was uniform (49.81 nm in length and 12.70 nm in diameter), the aspect ratio was 3.92. UV-vis-NIR spectrometer analysis showed that 0.1 nmol/L AuNRs had two resonance absorption peaks: a transverse peak at 510 nm and a longitudinal peak at 800 nm (). After being modified by EGFRmAb, the longitudinal resonance absorption peaks of AuNRs had a red shift of 7–9 nm, which did not change the original optical properties (). The same amounts, 0.1 nmol/L AuNRs and 0.1 nmol/L EGFRmAb-AuNRs, were used in all in vitro experiments as in this concentration, AuNRs and EGFRmAb-AuNRs had good absorbance and stability. EGFR was expressed in Hep-2 cells (). Meanwhile, EGFR was found to be highly expressed in the LSCC tissues (n=36) but not in the normal laryngeal tissues (n=13). A representative image of EGFR expression in the LSCC patients is shown in . Therefore, Hep-2 cell was suitable for studying EGFR-targeted LSCC therapy. The results from the TEM observation showed that AuNRs entered into Hep-2 cells after being treated with AuNRs for 6 hours (). In the experiments described below, Hep-2 cells were treated with AuNRs or EGFRmAb-AuNRs for 6 hours before subsequent treatments. The treatment with AuNRs did not obviously change cellular shape and cellular structure. ICP-AES element analysis showed that the number of AuNRs in cells modified by EFGRmAb was more than that with nonmodification (). We also found that EGFRmAb-AuNRs accumulated on the membrane of Hep-2 cells (). The result indicated that the EGFRmAb-AuNRs targeted the EGFR-expressing tumor cells. Generally, the EGFRmAb modification allowed more AuNRs to enter Hep-2 cells. The room temperature in our lab was maintained at 23°C in this study. We irradiated 0.1 nmol/L AuNRs with a diode laser (808 nm) at various power densities (0–5 W/cm). During the continuous irradiation, the solutions’ temperature quickly rose at the beginning and then became stable. We found 3 W/cm laser irradiation resulted in a solution temperature that rose and stabilized at 46°C. In our experiment, cells treated with AuNRs or EGFRmAb-AuNRs were also irradiated with 3 W/cm laser for 8 minutes (46°C). The irradiated cells were stained with 0.4% trypan blue, and about 70%~80% cells were stained blue (indicating they were dead). After irradiation with NIR laser, AuNRs or EGFRmAb-AuNRs leads to Hep-2 cell growth inhibition and apoptosis (). NIR laser irradiation caused a quick temperature rise in the solution of AuNRs or EGFRmAb-AuNRs (). The cytotoxic effect of EGFRmAb-AuNRs was evaluated in Beas-2B cells (human bronchial epithelial cells) and Hep-2 cells. The Beas-2B cells and Hep-2 cells were treated with various doses of EGFR-AuNRs or 0.1 AuNRs for 72 hours. The results of the MTT assay () showed that 0.1 nmol/L EGFRmAb-AuNRs or AuNRs had little cytotoxicity to Beas-2B cells and Hep-2 cells. To determine whether the Hep-2 cells growth inhibition mediated by AuNRs or EGFRmAb-AuNRs was associated with apoptosis, TEM and FCM were used. The results of the TEM showed obvious Hep-2 cell apoptosis after irradiation for 48 hours in the AuNRs+Laser group and EGFRmAb-AuNRs+Laser group (). In the AuNRs+Laser group, cell shrinkage, chromatin condensation along the nuclear membrane, membrane blebbing, and formations of apoptotic bodies could be found (, left panel). In the EGFRmAb-AuNRs+Laser group, cell shrinkage, nuclear fragmentation, and chromatin condensation along the nuclear membrane could be found (, right panel). TEM images from both groups () showed the characteristic morphological and ultrastructural changes of apoptosis. In the FCM analysis, the apoptosis rate of the EGFRmAb-AuNRs+Laser group (~50% at 48 hours and ~73% at 72 hours) was higher than that of the AuNRs+Laser group (~32% at 48 hours and ~52% at 72 hours) (). In the cell cycle distribution analysis by FCM, the proportion of G0/G1 cells significantly increased to ~70% and ~80%, respectively, after treatment with AuNRs+Laser or EGFRmAb-AuNRs+Laser for 48 (). The alteration of several apoptotic markers (caspase-3, Bax, ROS, Ca, ΔΨm, and Bcl-2) was shown in the EGFRmAb-AuNRs+Laser group (). Xenograft tumor models of nude mice were used to analyze the treatment effects of AuNRs+Laser and EGFRmAb-AuNRs+Laser. The growth of tumor was suppressed in both treatment groups (). However, treatment with low-dose NIR laser irradiation did not suppress the tumor growth. Treatment with cisplatin served as a positive control; after treatment with cisplatin for 2 weeks, the tumor growth in nude mice was significantly suppressed. In each treatment group, six mice were used. The photos of tumor xenografts in were all taken at 14 days after the laser irradiation or cisplatin treatment. FCM analysis showed that the apoptosis rate in the EGFRmAb-AuNRs group (~32%) was higher than that in the AuNRs group (~10%) (). FCM analysis of transplanted tumors in mice further confirmed that the apoptosis was induced by phototherm is of AuNRs or EGFRmAb-AuNRs in vitro. We also detected the expression of active caspase-3, Bax, and Bcl-2 in all the vitro tumors (n=6) that were collected at 14 days postirradiation. The expression alteration of active caspase-3, Bax, and Bcl-2 in the in vitro tumors showed a similar trend to that of the in vitro cellular studies (), as shown in . The H&E staining and TUNEL staining () also supported the conclusion that EGFRmAb-AuNRs+Laser treatment induced apoptosis in transplanted Hep-2 cell tumors. AuNR-mediated photothermia has been shown to kill tumor cells. The therapeutic effects mediated by AuNRs are associated with size, shape, surface charge, and surface modification, which influence the effects of AuNR-intake by cells. Increasing intake of AuNRs can improve the efficiency of AuNR-mediated killing effects in tumor cells. In this study, AuNRs were modified with EGFRmAb. The EGFRmAb-AuNRs entered tumor cells to a greater extent than did AuNRs alone. Meanwhile, the possible mechanism of AuNR-mediated killing of Hep-2 cells was investigated in vitro and in vivo. The EGFRmAb-AuNRs were characterized in our study (). TEM showed that the AuNRs could easily enter Hep-2 cells and that AuNRs was mostly found in cellular organelles, such as lysosomes (). Based on these preliminary observations, it is possible that AuNRs have a tendency to locate in particular cellular organelles but are not randomly distributed. ICP-AES element analysis showed that a greater number of EGFRmAb-AuNRs than AuNRs, entered the Hep-2 cells. Therefore, the modification of AuNRs with EGFRmAb improved the efficiency of AuNRs, entry into Hep-2 cells, which might be associated with endocytosis. Only tumor tissues were collected from the mice injected with AuNRs or EGFRmAb-AuNRs. This was a weakness of our study. The distribution of AuNRs or EGFRmAb-AuNRs is very important for the future study of their mechanisms. The size of AuNRs in this study was 49.81 nm in length and 12.70 nm in diameter. Their aspect ratio was 3.92. The AuNRs absorbed strongly in the NIR (). The EGFRmAb-AuNRs showed a red shift of 7–9 nm (). The red shift was caused by the preferential assembly of the EGFRmAb-AuNRs, and these results are consistent with other studies, in which conjugation of AuNRs with antibodies resulted in a red shift compared with nonmodified AuNRs. EGFRmAb-AuNRs also had a strong absorption in the NIR. The EGFRmAb-AuNRs in this study are suitable for phototherapy. Cell death mediated by EGFRmAb-AuNRs+Laser treatment is closely associated with thermal production after NIR laser irradiation. In our study, the thermal production with EGFRmAb-AuNRs+Laser treatment was measured by the temperature change during the NIR laser irradiation. It is noted that the temperature of the EGFRmAb-AuNRs+Laser solution stabilized after continuous NIR irradiation for a certain time (). The apoptotic characteristics of Hep-2 cells treated with AuNRs+Laser or EGFRmAb-AuNRs+Laser are shown in . The results should be further validated by other in vivo experiments. This will provide more details of the apoptosis induced by AuNRs+Laser or EGFRmAb-AuNRs+Laser. Levels of caspase-3, Bax, ROS, Ca, ΔΨm, and Bcl-2 were found to be altered in EGFRmAb-AuNRs+Laser-mediated cell death (). Caspase-3 is an important executioner of apoptosis., Active caspase-3 expression increased with EGFRmAb-AuNRs+Laser treatment (). This result suggested that the EGFRmAb-AuNRs+Laser treatment induced Hep-2 cell apoptosis. ΔΨm decrease, Bax-expression increase, Bcl-2-expression decrease, and ROS increase were all detected in the EGFRmAb-AuNRs+Laser treatment group (). The result suggested that the apoptosis with EGFRmAb-AuNRs+Laser was mitochondria-dependent. In the study by Rejiya et al, the combination of EGFRmAb-AuNRs with laser induced A431 cell apoptosis accompanied with ROS increase, ΔΨm decrease, and activation of caspase-3. Our findings are consistent with their results. ROS production has been found to be an “inducer” that can activate the subsequent apoptotic and antiapoptotic factors. ROS production was seen earlier than alterations of the other apoptotic markers (). The data suggested that the apoptosis induced by EGFRmAb-AuNRs was ROS-dependent, and that ROS generation might be required for subsequent activations of apoptotic factors, like caspase-3. In , active caspase-3-expression started at 24 hours after laser irradiation, which was generally consistent with the increase of Bcl-2 expression. In vivo experiments showed that EGFRmAb-AuNRs had therapeutic effects on Hep-2 transplant tumor in vivo, and this therapeutic effect was dependent on apoptosis (). Furthermore, the apoptosis mediated by EGFRmAb-AuNRs+Laser was greater than that by the AuNRs in vitro and in vivo (). In , there was not a significant difference in growth inhibition between the bare AuNR group and the EGFRmAb-AuNR group. However, in , the overall cell death (ie, apoptosis plus necrosis [~75%]) induced by EGFRmAb-AuNRs was higher than that induced by the AuNRs (~55%). From the data, it is likely that the cell death modes induced by AuNRs or EGFRmAb-AuNRs were different between the groups of AuNRs and EGFRmAb-AuNRs. Recent studies have demonstrated that autophagy is associated with hyperthermia.– Some TEM images showed that there were a higher number of autophagic structures (vacuolar components and secondary lysosomes) in the AuNRs+Laser group than in the EGFRmAb-AuNRs+Laser group (). Therefore, it is possible that the low overall cell death (apoptosis plus necrosis) in the AuNRs group was related to other modes of cell death, such as autophagy. The above speculations need further examination as our data is too limited to draw firm conclusions. Since the photothermolysis with AuNRs or EGFRmAb-AuNRs in our study was shown to be effective in killing Hep-2 cells, understanding the exact cellular location of AuNRs or EGFRmAb-AuNRs will be very important for the investigation of the mechanism of cell death induced by AuNRs or EGFRmAb-AuNRs. Therefore, in future study, the cellular location of AuNRs or EGFRmAb-AuNRs should be determined by various techniques, like fluorescence microscopy, with ICP determination of the gold content in cellular organelles. The Hep-2 cell is a human LSCC line that expresses EGFR (). In our study, the cellular uptake of AuNRs with the EGFRmAb-AuNRs group was significantly higher than that with AuNRs group (). The result suggested that EGFRmAb-AuNRs specifically targeted Hep-2 cells that expressed EGFR. Our results from the xenograft model of Hep-2 cells showed that tumor growth suppression or apoptosis induced by treatment with EGFRmAb-AuNRs+Laser was significantly higher than that induced by AuNRs+Laser (). Therefore, EGFRmAb-AuNRs have the potential to be used in LSCC-targeted therapy, especially for the LSCC patients that have high levels of EGFR expression. The results also suggested that EGFRmAb-AuNRs could possibly be given through intravenous injection in clinical trials before giving laser treatment. It should be noted that the long- and short-term toxicity of EGFRmAb-AuNRs is still unclear and should be carefully examined before using clinically. Generally, our study showed the possibility of treating LSCC using EGFRmAb-AuNRs. Further studies are needed to give more guidance on how to use appropriately in the clinical treatment of LSCC. Traditional chemotherapy (eg, cisplatin) has been found clinically to have therapeutic effects on tumors. However, chemotherapy drugs do not only kill cancer cells but also kill normal cells. Therefore, chemotherapy can cause side effects, such as renal toxicity. Radiotherapy can cause damage to the tumor. At the same time, it also damages the surrounding normal tissue. In this regard, photothermal therapy mediated by EGFRmAb-AuNRs is better than the traditional chemotherapy or radiotherapy. EGFRmAb-AuNRs can specifically target Hep-2 cells (cancer cells), yet will only kill Hep-2 cells and has no influence on normal cells. Furthermore, EGFRmAb-AuNRs showed little toxicity in vitro and in vivo. In this study, the potential of EGFRmAb-AuNRs in cancer treatment was evaluated using Hep-2 cells. The in vitro and in vivo results showed that the photothermolysis mediated by combination of EGFRmAb-AuNRs and NIR irradiation could effectively kill Hep-2 cells, and the cell death was mainly caused by apoptosis. Generally, EGFRmAb-AuNRs have the potential to be used in cancer treatment, and more studies are needed.

Although interprofessional care of patients is only now gaining momentum among Accountable Care Organizations and health systems, the Veteran’s Affairs (VA) Medical Center (VAMC) system has been incorporating this concept for decades. The goal of all outpatient VA Geriatric Evaluation and Management (GEM) programs is to provide comprehensive interprofessional geriatric assessments of veterans, targeting the medical, psychological, and social issues that affect the function and well-being of older veterans. GEM programs incorporate a range of specialties – including but not limited to, medicine, nursing, social work, physical therapy, and pharmacy – to collaboratively evaluate veterans. The GEM visit culminates in a cohesive patient care plan shared by all disciplines. Although they provide a valuable evaluation for veterans, GEM programs are faced with significant cut-backs, including closure, among VA hospitals nationally. The survival of these interprofessional programs within and outside the VA system is challenging due to the balance of other clinical commitments and the significant time commitments. Within the VA this type of interdisciplinary comprehensive geriatric assessment is mandated by the Veterans Millennium Health Care and Benefits Act (H.R.2116 ENR) of 1999. This Act includes a number of provisions for the care of older veterans in the VA health care system, including provisions for homecare services, palliative care, and respite care services, as well as geriatric assessments. Despite this mandate there is a struggle to maintain these programs because of competing budgetary demands. Each VA medical center must use its budget to fulfill all needed services and this balance of services is determined at each local facility. Additionally, programs may close because of attrition of staff – especially those with geriatric training – and the overall time commitment for this type of team-based intervention; low productivity because of missed patient appointments is another factor. The primary goal of this project was to systematically assess how the GEM model could be optimized to allow for the long-term sustainability of this important interprofessional practice (IPP) assessment. Part 1 of the study evaluated the IPP process using a national GEM forum, a patient/family satisfaction survey, and patient absentee data. Part 2 used a prediction tool to determine how well the GEM geriatrician matched patients to specialists in an IPP model. Although the interprofessional approach to medical care has recently been gaining momentum in the health care arena, the VAMC recognized its importance many years ago. Formal geriatric assessment programs were first developed in Great Britain in the 1930s based on the work of Dr Marjory Warren and began in the United States in the 1970s. The VA had an early interest in the care of geriatric patients, which led to the establishment of Geriatric Research Education and Clinical Centers (GRECC). The first VA GEM was an inpatient model and opened in 1976 in Little Rock, Arkansas; subsequent outpatient GEM programs have since been developed and studied extensively., More recently, in 2010 a report by the “Study Group on Interprofessional Education and Collaborative Practice” of the World Health Organization affirmed “collaborative health education and practice as an effective and necessary approach to strengthening health care systems, both locally and globally.” In addition, the Institute of Medicine identified the ability “to work in interdisciplinary teams – cooperate, collaborate, communicate, and integrate care in teams to ensure that care is continuous and reliable” as one of three core competencies needed by health care professions. The important components of the GEM assessment include the following: 1) incorporating a team of physician and non-physician clinicians to assess each patient, discuss their findings, and develop an interprofessional care plan together; 2) targeting the most complicated patients to receive the GEM assessment; and 3) providing communication to the patient, family, and care providers to ensure that common goals are met. Currently, in the VA there are approximately 34 active inpatient GEM units and 49 active outpatient GEM programs. These programs vary in the way that they are designed. Some outpatient GEM clinics provide pure consultative service to primary care providers (PCPs), while others are integrated into geriatric primary care clinics. Inpatient GEM units are most often designated as Nursing Home Care Units (NHCU) but can also be acute or intermediate care units. The specific make-up of each GEM team also varies and is dependent on the local expertise and resources available at different VA medical centers. However, the underlying concept of comprehensive geriatric assessment using an interprofessional approach is constant. The primary goal of our GEM IPP improvement project was to be accomplished with three strategies. First, we wanted to establish baseline data by surveying GEM’s around the country, determine how they were structured (outpatient versus inpatient, consultative versus continuity care, one visit versus multiple visits) and what services they provided. We wanted to find successful strategies and challenges specific to each GEM, with the hopes of establishing a forum where constructive ideas could be freely exchanged between GEM programs to improve overall efficiency, patient care, and communication. After collecting this data, the investigators chose the Pittsburgh, Pennsylvania GEM program as an intervention site. This program was chosen to target IPP improvement because it was the only outpatient VA GEM program where all patients saw all specialists on the initial evaluation; it was an outpatient, consultative, 3-day evaluation. The program had up to nine specialists working with the team: a geriatrician, nurse practitioner, psychologist, geriatric psychiatrist, physical therapist, occupational therapist, chaplain, pharmacist, and a social worker. Four or five of these specialists saw each patient on the first day of the evaluation and the remaining specialists saw each patient on the second day of the evaluation. These two evaluation days were generally 1 week apart (by patient and family preference). The GEM interprofessional team met to develop an interdisciplinary plan of care which was followed by a family meeting on the third day. At the family meeting, the patient and family were given a verbal and written summary of the individualized recommendations from the team of specialists. The primary care physician (PCP) also received a copy of the recommendations for follow-up, and the summary of recommendations was entered into the Computerized Patient Record System (CPRS). Patients did not continue their primary care at the Pittsburgh VA GEM Clinic; therefore, all care recommendations were directed to the PCP and/or subspecialists for follow-up. The patients returned to the GEM team annually for a condensed 1-day visit with one or two specialists to review progress from the initial evaluation. We hypothesized that the length and complexity of the Pittsburgh GEM evaluation would cause decreased patient and family satisfaction and lead to an increase in absenteeism. Therefore, interventions targeted to their model would likely help their IPP and also be helpful for other GEM’s for utilization at their respective sites. The second strategy was to assess veteran and family satisfaction at the Pittsburgh GEM program to determine the direction for improvement from the patient’s perspective and to give the investigators guidance as to where changes could be made. The third strategy was to conduct a patient absentee assessment to investigate the prime reasons patients didn’t complete their scheduled appointment time at the Pittsburgh GEM. By understanding why patients hadn’t come to their appointments, one could learn what strategies to employ to maintain patient volume. By using data from the three sources above, our goal was to identify specific system tools to improve efficiency and satisfaction in the interprofessional GEM practice that could potentially be implemented throughout all VA Medical Centers. As an important early model of IPP, GEM has been well studied and its benefits demonstrated in numerous past investigations. The investigative team reviewed eleven outpatient GEM studies closely when this project began. Mortality, care satisfaction, function, financial impact and utility of services were the major outcomes in these studies. Although each study had different primary endpoints and the inclusion criteria varied, all studies were in community dwelling adults and compared outcomes between a veteran GEM patient cohort and a non-GEM cohort. The inclusion criteria for age differed slightly in the eleven studies; five recruited subjects over 70,– four over age 65,– and two over age 55., With regards to mortality, five displayed no difference in mortality rates between the two groups,,,,, two had decreased mortality,, and four did not assess mortality.,,, Since function is defined as the ability to perform the activities of daily living and is an important component of overall health, a common goal in geriatric care is to minimize the rate of functional decline. Seven studies had function as an outcome; five showed less decline in the GEM cohort,,,– and two had the same rate of decline between the two groups., Although patients followed by an outpatient geriatric team showed less decline than their counterparts, it is important to note that the GEM design varied with each program; some received longitudinal care led by a geriatrician while others had one or two GEM visits with follow-up by a non-geriatrician. Nine studies examined patient and provider care satisfaction using participant assessments and caregiver surveys as their tools. Eight showed an improvement in care satisfaction with the GEM cohort;–,,– and one found the satisfaction to be equivocal. The final outcome, cost analysis, was examined by four studies. One study found GEM programs to have decreased overall Medicare payments. Another study found a 34% increase in expenditures in the first 8 months, followed by a 37% decrease in the last 8 months of the study. This is logical since the bulk of the consultations are performed within the first 2 months of a geriatric evaluation for most GEM programs. One study found equivocal expenditures between groups and one study found an increase in outpatient costs. The wide difference in financial outcomes is likely due to differing regional health care costs and different GEM protocols requiring subjects to have varying numbers of consultations. The challenge in comparing these eleven studies was that they each measured different outcomes and had subject populations with varying ages, levels of dementia, and physical function. Mortality and cost savings have not shown a clear advantage among the GEM cohort and further research needs to be performed to assess this relationship. Despite the varying protocols, the analysis does show that outpatients followed by a GEM team generally have improved care satisfaction and function. Both positive outcomes are important to quality care and need to be sustained when deciding on appropriate care for older adults. In 2004, according to the VA database, there were 92 GEM programs around the country. To elicit strategies that other GEM programs used to conduct their programs, all 92 programs were contacted three times by email in the fall of 2004 by a single investigator to respond to four questions asking 1) their location, 2) how their GEM clinic is structured, 3) their allocation of time between patients and specialists, and 4) their common problems and solutions. Participation was encouraged, but not mandatory, and there were no material incentives for participating. Patient satisfaction was assessed from April 2004 to May 2005 by a patient and family quality improvement survey distributed on a rolling basis after each of the three Pittsburgh GEM IPP visits. The investigators and consultants, using a Likert format for ease of use, clarity and language, created the surveys. Nine questions were designed using a Likert scale or a yes/no multiple choice answer. The tenth question allowed for an area for written comments. The investigators attempted to survey everyone – surveys were given to each patient and one family member after each visit. Surveys were completed by the patients or their family members, in the office or at home, without GEM staff supervision. Participation was encouraged, but not mandatory, and there were no material incentives for participating. The only identifiable element was their age and their status as either the patient or family member. The ten-question survey inquired about how well the GEM clinic addressed their concerns, flow issues such as visit length, ease of appointment scheduling, their time with the specialists, and general feedback issues such as perceived problems and whether they would refer their friends to the GEM clinic. The survey that was distributed after the GEM team and family meeting also asked for feedback about the utility of the GEM recommendations and the team meeting. Upon completion, the patients and families were asked to anonymously return the surveys at a central location or by mail. To assess reasons for missed appointments, a single investigator personally phoned each absent patient from April to November 2004 within 14 days of their scheduled appointment at the Pittsburgh GEM. If the patient was unavailable, the next of kin was asked to provide information. Their answers were tabulated under the following categories: transportation issues; patient forgot, family conflicts, or other. All data were analyzed using basic statistical methods. Although each outpatient clinic had its unique circumstances, consistently reported problems included a high absentee rate, poor compliance with GEM recommendations by the PCPs, and the lengthy duration of the visit. These challenges were solved as follows by a variety of interventions shared by the GEM programs (): Missing values were not included in the analysis. The tabular results are shown in . Regarding the length of the visit, although three people stated the evaluation was too long, after the team meeting there were not any respondents who stated their GEM evaluation was too long. Ninety-three percent of the respondents did not have any problems during their visit; however, many wrote comments to improve the process. Comments included the need to have easier parking, a snack break, a lunch break longer than 30 minutes, allowing family members to participate with each specialist visit, and fewer forms to complete. One respondent wrote that they had four of the same “memory tests” to complete. Forty-six percent found the visit to be “very enjoyable”. The patients’ PCPs referred 60% of the patients while family, friends, nurses and social workers referred the remainder. Nineteen percent of the respondents didn’t know if their PCP knew they were getting evaluated. Our project was designed to collect baseline data from various GEM programs around the country and implement the information to improve the sustainability of the IPP GEM clinic model in Pittsburgh, and potentially other GEM clinics nationwide. In particular, reducing the overall GEM visit duration, assessing patient and family satisfaction, and improving attendance rates were the domains chosen to investigate in the Pittsburgh GEM program. The GEM forum was intended to begin communication between the GEM clinics to improve viability. Despite receiving responses from 26 of 92 clinics, valuable information was gained that could be shared and utilized by many GEMs immediately. Having feedback forms that are read and implemented, an automated phone reminder system, a VA van for transportation, and a phone triage system were tools that every GEM can consider implementing to maintain their viability. While some GEMs are part of larger VA medical centers with many resources and academic affiliations, others are in less resource-rich areas. These types of forums can be especially useful to share ideas and improve care in smaller centers or in those that are just getting started. Limited implementation of recommendations by the PCP’s counterparts in the geriatric team was a consistent challenge noted by GEM clinics. This is a chronic issue noted in studies of consultant care. Improved implementation of recommendations has been shown to occur in settings where a geriatric team assumes primary care or there is a strong link between the geriatric team and the PCP. In general, this is likely due to limited communication between the two entities. Having the computerized medical record system is an asset within the VA system, yet the PCP team may not consistently access the GEM visit recommendations. In addition, without the GEM teams following up with the PCP teams, there are no consequences for not implementing the recommendations. The forum results are limited by response bias, since only 28% of the GEM programs responded. The GEM patient and family satisfaction survey found that most patients and families were happy with the intervention despite its length. Limitations to this study include the possibility of reporting bias. Although all patients and families were contacted to complete the surveys, the 34 people who completed the surveys may have been those who had a primarily positive experience and were willing to complete the questionnaire; if this is the case, there was no feedback from those with negative experiences. In addition, the surveys were completed by respondents during different points of the GEM process and this could have changed their opinion of the process. Our numbers were small, which limits the power of this study. The concern that the 3-day assessment was too long was voiced by only a minority of patients. By the time they reached the team meeting, no one stated that the visit was too long or too short. This project did refute our theory that patients were unhappy with the length of the GEM intervention; overall, patients and families reported a positive experience and found the evaluation to be the right length. Regarding the absentee data, the high prevalence of dementia in our clinic population likely contributed to the incidence of patients forgetting or being unaware of their appointments despite written and telephone reminders. As expected, transportation issues were a frequent cause of absence. To compensate, when GEM staff suspected patients with significant dementia had poor social support and transportation difficulties, they were often referred to Home Based Primary Care (HBPC) for continuing care and case management in their home. A high percentage missed their appointment due to medical illness, emphasizing the degree of medically complex patients referred to the GEM clinic. Our absentee rate improved significantly (by 22%) by incorporating the phone reminder technique shared by the GEM forum; this may be reflected in the survey results showing that 17% missed their appointment due to “not knowing about it” and 4% missed their appointment due to “forgetfulness”. It is important to note that the improvement may have also been due to multiple external factors unrelated to the phone call reminder, for instance, weather, vacation, or time of year. The next steps for the Pittsburgh GEM are to continue implementing the reminder phone system, improve communication to the PCP teams, and maintain the current protocol of 2 days of interviewing and 1 day of family/team discussion. The need to continue to find ways to care for our older adults was reiterated in the April 2008 Institute of Medicine report, “Retooling for an Aging America: Building the Health Care Workforce.” This report concluded that the future workforce “will be woefully inadequate in its capacity to meet the large demand for health services for older adults if current patterns of care and of the training of providers continue.” The number of older Americans will nearly double to 70 million by 2030, the report notes, at which point the youngest of the baby boomers will have reached retirement age. It is critical that GEM programs serve older veterans in the most effective way possible. Interprofessional GEM programs can improve the care of older adults but also require extra time and personnel to assess older veterans. With diminishing budgets, support for these programs is at risk. With the escalating geriatric cohort and the relative paucity of geriatricians, outpatient consultative interprofessional geriatric evaluations are a vital tool that has the potential to not only help PCPs better manage their geriatric patients, but also to teach them about management of geriatric syndromes. Multiple studies have shown the benefits of an outpatient interprofessional GEM program. Morishita et al found a 9% increase in patient mean satisfaction with GEM programs when compared to usual outpatient care, as well as a concomitant rise in satisfaction from primary physicians of GEM recipients. Toseland et al found that although cost reduction may not be achieved with GEM evaluations, the multidisciplinary aspect of outpatient GEMs are “an efficient and effective means of improving the care and well-being of frail elders.” Further research needs to be done to determine cost effective methods to maintain comprehensive geriatric evaluation programs at VA and non-VA facilities. With the geriatric sector approaching 20% by 2020 and with health care reform on the current legislative agenda, this service will need to be offered in a financially sound manner. By incorporating the recommendations described in this paper and with further research, outpatient GEMs can be a cost-effective geriatric assessment tool appealing to the patient, provider, and payer.

Falls in older adults are a significant public health problem because the prevalence of falls is elevated among older adults and the consequences are severe. Approximately 95% of all hip fractures each year are attributed to falls, and 20%–30% of those who fall and suffer a hip fracture die within 1 year. The rapid growth in the number of older adults coupled with the high costs associated with non-fatal falls demands that effective fall prevention strategies are identified and tested. Muscular strength and power are important for the maintenance of balance.– Therefore, it has been suggested that lower limb muscle power (product of muscle force and velocity) may be more influential than lower limb strength when stepping to recover balance and avert a fall after a large postural perturbation., In fact, fallers have less lower limb muscle power than non-fallers. To our knowledge, no study has investigated the effects of muscle strength training (ST) or power training (PT) on balance recovery following a large postural perturbation. A commonly used method of testing balance recovery after a large postural perturbation is to release an individual from a static forward leaning position and have them attempt recovery with a single step.– Madigan reported that muscle power generated during single-step recovery on the forward leaning task was lower in older compared to younger men. He speculated that increasing peak muscle power may lead to an increase in the maximum lean angle from which a person could recover in a single step. Additionally, Carty et al compared balance recovery between males and females and found that an inability to generate sufficient power in the stepping limb was a limiting factor in a single-step recovery from a forward loss of balance. Similarly, knee extensor joint torques during single step balance recovery are also lower in older compared to younger subjects during single-step recovery,, and lower limb weakness is negatively correlated with performance on forward leaning tasks., Therefore, strength training may also be an effective intervention that prevents buckling of the knee during the support phase of balance recovery, leading to improved balance recovery performance.,– Examining balance recovery after a forward loss of balance is important due to the high prevalence of falls after tripping. However, descriptors of medial–lateral stability in older adults are also associated with falls and future risk of falling.– Deficits in lateral stability prospectively predict falls, and older adults are less efficient at recovering from a lateral perturbation compared to younger adults. In addition, lateral falls increase the likelihood of impacting the hip. Only one study, to our knowledge, has examined single-step recovery in a lateral direction, reporting that older adults had smaller maximal lateral lean angles compared to young adults. Currently, there are no data on the influence of resistance exercise on lateral leaning performance in older persons. Therefore, the purpose of this 6-week pilot study was to add unique information to the literature by 1) examining the short-term effects of PT and ST on single-step balance recovery in older men and women in a forward direction and 2) to examine the effects of these interventions on balance recovery in the lateral direction. Our goal was to obtain estimates of variances to inform a future randomized trial. Participants completed the screening questionnaires on demographics, medical history, American Heart Association/American College of Sports Medicine Health/Fitness Pre-participation Screening Questionnaire, and Mini-Mental State Exam. They also completed measurements of height and body mass and the Short Physical Performance Battery (SPPB), a measurement of lower extremity physical function. All participants completed a baseline assessment of lower extremity muscle strength and power followed by single-step balance recovery in the forward and lateral directions, presented in random order. Following baseline testing, participants were randomized to ST or PT for 6 weeks, followed by repeated assessments of muscle strength and power and balance recovery. Members of the research team (DNP, ECH, JAZ) completed all balance recovery assessments and were trained by two investigators (APM and MLM) who have experience in testing older individuals and forward leaning tasks.,, Assessors (DNP and ECH) were trained by an investigator (APM) and completed all strength and power testing procedures. Outcome assessors were not blinded to group assignment; they followed a detailed protocol document for all outcomes assessment designed to mitigate bias in outcomes assessment. The criteria for determining a failed trial were adopted from Madigan and Lloyd: 1) taking more than one step with the right leg; 2) moving the left leg from its starting position by more than 30% of the participant’s height; 3) falling into the harness or using the harness to regain balance; and 4) being unable to maintain the forward lean angle position prior to cable release. The starting lean angle was 5°. After a successful recovery with a single step, the lean angle was increased by 2.5°. After a failed recovery, participants were given a second attempt at the same angle. If the participant failed twice at a given angle, they were given a 1- to 2-minute rest, the angle was reduced by 1.25°, and the test was repeated. If this attempt was successful, the angle was increased by increments of 1.25° until the participant failed to regain their balance. After a 1- to 2-minute rest period, the angle was repeated. The angle at which two failures occurred was deemed the failure angle. The largest angle from which the participant could successfully recover their balance (FLean) was used to quantify forward balance recovery ability. For the lateral leaning assessment, the participant was positioned standing with both feet together and leaning to their right. The position of the safety belt was adjusted so that the lean control cable was positioned in line with the left greater trochanter of the femur. Lateral leaning angle was measured from the vertical using the inclinometer aligned with the sternal notch and umbilicus and a midpoint between the feet. The starting angle was 2.5°, and the lateral leaning angle was adjusted after each trial as previously described in this paper, for forward leaning trials. Participants were instructed to recover their balance with one step to the right with their right foot. The criteria for failure and angle advancement were the same as those for the forward leaning assessment. The largest angle from which the participant could successfully recover their balance (LLean) was used to quantify lateral balance recovery ability. Lower limb muscle strength and power were measured bilaterally using pneumatic leg extension ([LE] AIR250) and leg press ([LP] AIR300) machines (Keiser Corporation, Fresno, CA, USA), using the protocol of Marsh et al. Subjects completed a 5-minute aerobic warm-up (walking or cycling) and completed a series of lower limb stretches for the quadriceps, hamstrings, calves, and gluteal muscles. The LE and LP machines were adjusted so that the hips and knees were flexed to 90°. Strength was quantified as the maximum resistance (kg) that could be lifted one time using correct form (one repetition maximum [1RM]). Subjects made repeated attempts to lift progressively heavier loads with 2 minutes of rest between efforts until 1RM was achieved. To assess peak power for LE/LP, the resistance was adjusted to 70% of the 1RM test. The participant was instructed to perform the LE/LP exercise, doing the concentric phase as quickly as possible while controlling the eccentric phase. LE/LP power was quantified as the maximum power (W) of five individual repetitions. Both groups completed two sets of eight to ten repetitions at 50% of 1RM based on their baseline measurements. Fifty percent of 1RM was chosen because there is some evidence that lower resistance is best for improving contraction velocity, which is a component of muscle power., During the third set, the participants were instructed to complete as many repetitions as possible with good form as judged by the interventionist. If the participant completed more than ten repetitions on the third set, their resistance was increased 5%–10% for the next session. The ST group was instructed to complete the concentric phase of the exercises in 2–3 seconds, whereas the PT group was instructed to complete the concentric phase of contraction “as fast as possible”. Both groups were instructed to complete the eccentric phase of contraction in 2–3 seconds. Participants rested for 2–3 minutes between sets and between machines. Baseline characteristics were summarized by ST and PT groups using means and percentages. The primary outcomes in this study were change in FLean and LLean from baseline to follow-up. Analysis of covariance (ANCOVA) was used to obtain adjusted estimates of change and to test the difference between the ST group and PT group in the change in outcomes. We used the baseline value of the outcome as a covariate and also included sex as a covariate since randomization was stratified on this characteristic. Residuals from all models were examined for normality of the distribution and outliers, and least squares means and 95% confidence intervals, adjusting for these covariates, are reported. All analyses were done using SAS software (v 9.3; SAS Institute Inc., Cary, NC, USA). Nominal significance levels are reported; however, as this pilot study was designed to obtain estimates of variances and experience with the protocols, these tests are generally only powered to detect very large differences. This study cohort was an ostensibly healthy group of older adults who exhibited some lower extremity mobility dysfunction as evidenced by the SPPB score (). The ST group was an average 5.3 years younger than the PT group and other characteristics were generally balanced between groups at baseline. Five participants (ST: three, PT: two) dropped out of the study and were lost to follow-up. The reasons for drop out were lower extremity injuries not related to the study (n=3) and knee and muscle soreness during training (n=2). Adherence was assessed by the number of sessions attended divided by the number of possible sessions that could be attended (18 sessions). For all 15 participants who completed baseline and follow-up testing, adherence (mean ± standard deviation) was 89.0%±11.1%. Adherence was 93.0%±7.9% for the ST group and 85.0%±12.5% for the PT group. LE and LP strength tended to improve in both groups after 6 weeks of training but did not differ between the groups ([] =0.134 and =0.585, respectively). LE and LP power tended to improve in both groups; there was no statistically significant difference in the change in LE and LP power between groups (=0.602 and =0.989, respectively). FLean improved in the ST group (+4.1° [0.7, 7.5]) but the change in FLean was not different between the groups (=0.127). LLean improved in the ST group (+2.2 [0.4, 4.1]) and the PT group (+2.6 [0.9, 4.4]), but the change in LLean was not different between groups (=0.765). Since the magnitude of the changes in FLean and LLean between groups was similar, and given the preliminary nature of this pilot study, we combined participants into a single group to examine differences pre- to post-intervention. FLean increased by 2.4° (15% improvement; =0.044) and LLean increased by 2.4° (26% improvement; =0.001). In , we provide the detectable differences associated with 80% power (assuming eight per group) and the standard deviations (root mean squared error) that we obtained from the ANCOVAs. The purpose of this 6-week pilot study was to gain information on the feasibility of these interventions and to obtain estimates of the variances resulting from a short-term intervention of either PT or ST on single-step balance recovery among older adults in both a forward and lateral direction. While it has been hypothesized that muscle power may be more important than muscle strength in recovery from a slip or trip,,,,, there are no studies in the literature that have attempted to increase muscle strength and power directly and then measure balance recovery performance. The main result from this study was that resistance training in general may be a suitable method of improving balance recovery with a single step, and that short-term ST and PT do not differ in their effect on single-step recovery in the forward or lateral direction. The FLean of 15.5°–16° at baseline for our older male and female sample was comparable to data previously reported. A number of cross-sectional studies have examined the role that muscle strength plays in the single-step balance recovery performance, with mixed results.,, Given the proposed importance of muscle power in situations in which rapid movement is required to recover,,, we were interested to see if there was any evidence that the PT group would exhibit larger changes in FLean and LLean compared to the ST group. There were no statistically significant differences in change scores of FLean and LLean between the ST group and the PT group following 6 weeks of ST or PT. There are several possible explanations for this result. Although muscle power increased following the intervention, these changes were comparable between the groups. Our intervention was only 6 weeks in length and produced relatively modest increases (20%–30%) in muscle strength and power. Previous research suggests that interventions of 8–12 weeks may produce greater changes in muscle strength and power, in the order of 30%–40%. A longer intervention may better differentiate the ST and PT groups with respect to changes in muscle strength and power. Participants in the PT group completed their exercises at 50% of their baseline 1RM and resistance was increased for the following session if they performed more than ten repetitions in the final set. However, some research indicates that a lower resistance of 20%–40% 1RM during PT may lead to greater improvements in contraction velocity – a component of muscle power – compared to higher resistances. Recently, Arampatzis et al reported that a training program consisting of exercises for dynamic stability and neuromuscular control improved performance on a forward leaning task. Recovering balance from a large postural perturbation requires a dynamic response involving different movement patterns and strategies, where speed of movement and lower extremity coordination are important determinants of recovery success. Future work should consider the addition of dynamic stability in combination with ST or PT. The exercises we selected for the ST and PT interventions were based on typical lower extremity resistance training tasks, although we did include the hip flexor exercise since it is important in initiating the forward movement of the stepping leg. Interestingly, recent work by Graham et al showed that the hip abductors generated the largest muscle force relative to other muscles in the lower extremity during single-step recovery in old and young adults. They suggest that muscle weakness of the hip abductors could be a factor limiting recovery from a forward loss of balance. Therefore, the hip abductors may be a muscle group to specifically target for intervention in future work. The results of this preliminary study are best interpreted within the context of its strength and limitations. Although the single-step balance recovery method employed here is well accepted, the relationship between it and risk of falls has not been established. Also, our recovery failure criteria did not allow for multiple-step recoveries, and older adults report greater difficulty recovering balance with a single step. It may be that a single step is not a natural strategy for some participants, which may have negatively influenced their performance on the leaning tasks. Although participants were randomly assigned to ST or PT, the ST group was an average 5.3 years younger than the PT group (=0.004), which may have biased our results in favor of the ST group. Attrition (n=5) diminished our power to detect differences between the ST and PT groups. Although two participants dropped out as a result of joint and muscle soreness attributed to the intervention, resistance exercise is generally very well tolerated by older adults and has been shown to be safe in a large number of studies.– Our sample exhibited some degree of lower extremity functional limitations as evidenced by the mean SPPB score of 9.2, but the sample were not considered high-fall-risk participants. For example, our sample did not have a history of falling, and participants were excluded if they were at high risk for falls (eg, due to neurologic disorders, sedative medications, inability to walk, etc). This was a precautionary decision on our part. It is unclear if the effects of PT and ST estimated here would differ among high-fall-risk participants. Our study did not employ a control group that received no intervention. Since we were primarily interested in estimating variances and gaining experience in the feasibility of our testing and PT and ST training protocols, we chose not to use a control group and treated ST as standard care since it is recommended as part of a complete physical activity regimen by the American College of Sports Medicine and American Heart Association. While we were interested in comparing the effectiveness of ST and PT, it is possible that participants experienced a learning effect from repeating the leaning tasks, and future studies should incorporate a control group into the study design. Likewise, it would be ideal if all assessment staff were blinded to intervention group to minimize the potential for bias. To follow up on this issue in our sample, we performed Wilcoxon two-sample tests, which showed that there was no statistically significant difference in the number of trials needed to reach FLean or LLean between pre- and posttest measures (FLean: 10.3 versus 10.3; =0.259. LLean: 7.1 versus 9.9; =0.730). Also, the length of time before the perturbation during the leaning tasks was random and we did not observe anticipation by the participants. Recently, Arampatzis et al observed no change in balance recovery performance in a control group over a 14-week follow-up. To our knowledge, learning effects from repeated trials of single-step recovery tasks have only been identified within single sessions,, and our testing sessions were separated by 6 weeks. #text

Critical-size bone defects remain a major health care issue due to the difficulties in reconstructing large bone segments, and are caused by various diseases, such as trauma, abnormalities, congenital deficiency, or carcinological resection., The recent gold standard for treatment remains bone grafting with autologous or allogeneic bone graft. The number of bone graft procedures in the US has been estimated to be over 1.5 million every year, making bone second only to blood on the list of transplanted materials. Available quantities are limited, however, and the harvesting procedure is burdened by comorbidities., With an increasing demand for and decreasing supply of traditional bone graft tissue, tissue engineering techniques are being developed and applied in clinical use as alternatives.– Recently, combined cells with fibrous scaffolds have been shown to be an effective way to treat bone defects and promote bone regeneration., The extracellular matrix (ECM) is a complex interconnected nano- and micro-ranged fibrous network, which could regulate various cellular functions such as adhesion, migration, proliferation, differentiation, and tissue morphogenesis. As such, the natural ECM is a multifunctional nanocomposite that has motivated researchers to design synthetic ECM substitutes. A number of different materials and methods have been used for developing scaffolds for ECM mimicking, with nano- or microfiber scaffolds used frequently. A variety of techniques have been developed for polymer nano- or microfiber fabrication in recent years, which include electrospinning, drawing, template synthesis, phase separation, and self-assembly.– Electrospinning technology is a simple method by which to generate nonwoven fibrous articles, with fiber diameters ranging from tens of nanometers to microns.,, This method of scaffold fabrication has gained importance in many specific targets, such as tissue engineering,, wound dressing, and drug delivery systems. The high surface-to-volume ratio of the scaffolds, which created by ultrafine and continuous micron to nanofiber structures, contributes significantly to improve the level of protein adsorption and subsequent cell attachment. In selecting different parameters, it is desirable to control not only the fiber diameter, but also the internal morphology. Nanoporous fibers are of interest for applications such as filtration or the preparation of functional tissue engineering substitutes by fiber templates. In general, a candidate of biodegradable and biocompatible polymer for biomaterials should possess appropriately mechanical properties, which are suitable for target applications and guarantee inherent nontoxicity. In recent years, hydrolysable and biocompatible coploymers of polylactide (PLA), poly(glycolic acid), poly(ε-caprolactone) (PCL), poly(lactide-co-glycolide), poly(vinyl alcohol), and poly(butylene succinate) have been used for biomedical scaffolds. They have been gradually approved by the US Food and Drug Administration for internal use in the human body. PLA is one of the most widely used biocompatible and biodegradable biomedical materials. However, due to its strong hydrophobicity, inherent brittle nature and low heat distortion temperature. PLA has been restricted its further applications in tissue engineering., As such, different strategies have been developed to improve PLA. Some reports in the literature have stated that improvement of the properties is attributed to microphase structure difference generated as a result of formation of many stereocomplex crystallites, which acted as intermolecular crosslinks., The physical method of modifying the properties is to blend the PLA with different kinds of polymers and/or other fillers of complementary property features, such as hydroxyapatite, PCL,, poly(butylene succinate) and poly(ethylene glycol) (PEG). Recently, a paper reported that ABA triblock copolymer of poly (D-lactide)-mid-block-poly (D-lactide) was used as a toughening agent for PLA through a blending method. These PLA/triblock copolymer blends form a morphology that can be described as stereocomplex crystallites serving as nanoreinforcements dispersed in a continuous amorphous phase matrix. In our laboratory, we obtained an amphiphilic triblock copolymer, Poly(ε-caprolactone)-poly(ethylene glycol)-poly(ε-caprolactone) (PCL-PEG-PCL, PCEC) by incorporating PEG into the PCL main chain. Earlier literature has reported that PCEC exhibited good potential in forming cell scaffold complexes because of its high biodegradation rate, amphiphilic nature, and biocompatibility. Here, our hypothesis was that this ABA triblock copolymer could also be used in improving PLA by the blending method. Mesenchymal stem cells (MSCs), originating from various sources, are capable of differentiating into cells of different lineages under specific permissive conditions.,– MSCs have attracted a great deal of interest because they are one of the potential cell sources for tissue engineering and regenerative medicine, can be transplanted across major histocompatibility complex barriers without the need for immune suppression, and are not subject to the ethical considerations of embryonic stem cells., In order to search for easily accessible sources of multipotent MSCs, various groups have looked into cells from different tissues, including bone marrow, umbilical cord blood, mobilized peripheral blood, and adipose tissues.,, MSCs derived from such tissues have many disadvantages however, including insufficient supply of stem cells, decreased proliferation and differentiation capacity with age, and development of tumors after stem cell transplantation. Recently, human placenta-derived MSCs (hPMSCs) have been discovered as a new source of stem cells., Obtaining the organ is not an invasive procedure, as the placenta is expelled after the birth of the neonate. Cells of the placenta are fetal. Therefore, preservation of placenta at birth would provide a once-in-a-lifetime opportunity to preserve “young” autologous stem cells. Literature has shown that hPMSCs could remain viable and reproducible during proliferation in vitro and could be differentiated in vitro into neuron-like cells (ectoderm), adipocytes, osteo- blasts, endothelial-like cells (mesoderm), and hepatocytes (endoderm) when cultured in specific induction medium.,– In the present study, novel PLA/PCEC hybrid electrospinning fibrous membranes with a nanoporous surface were obtained, and the chemical and physical properties of the PLA/PCEC hybrid scaffolds were investigated by Fourier transform infrared (FT-IR) spectroscopy, X-ray diffraction (XRD), differential scanning calorimetry (DSC), and scanning electron microscopy (SEM), among other methods. The aim of this study was to develop this osteogenic biodegradable composite graft consisting of hPMSC material for site-specific repair of bone defects and attenuation of clinical symptoms. Semicrystalline-grade PLA 4032D (M =160,000) with approximately 2% of D-lactic acid monomer was purchased from NatureWorks LLC (Minnetonka, MN, USA). PEG (M=4,000), ε-caprolactone, and stannous octoate (Sn[Oct]) were supplied by Sigma-Aldrich (St Louis, MO, USA). Dichloromethane (CHCl) was purchased from KeLong Chemicals (Chengdu, People’s Republic of China). All the chemicals used in this experiment were analytical reagent grade. PCEC copolymer was synthesized in our laboratory. Briefly, PCEC copolymer was synthesized by introducing a known amount of ε-caprolactone and PEG (weight ratio =8:1) into a dry glass ampoule under N atmosphere, with Sn(Oct) (0.5% w/w of total feed stock) added as catalyst. During reaction, the system was stirred slowly, with the reaction temperature kept at 135°C. After 8 hours, the system was rapidly heated to 180°C under vacuum within 30 minutes. After being cooled to room temperature under N atmosphere, the mixtures were first dissolved in methylene chloride and then precipitated from the filtrate using excess analytical reagent-grade cold petroleum ether. Finally, the mixtures were filtered and vacuum-dried to constant weight, and kept in air-tight bags in desiccators before use. Gel permeation chromatography ([GPC] 1100 series; Agilent, Santa Clara, CA, USA) was used to explore the molecular weights and distribution of PCEC copolymers. PCEC copolymer samples were dissolved in tetrahydrofuran (freshly distilled before use) at a concentration of 1–2 mg/mL. The mobile phase was tetrahydrofuran using a regularity elution at a flow rate of 1.0 mg/mL. The external and column temperatures were kept at 35°C. Proton nuclear magnetic resonance (H-NMR) spectra (in CDCl) were recorded on a Varian 400 spectrometer (Varian Medical Systems, Palo Alto, CA, USA) at 400 MHz, using tetramethylsilane as internal reference standard. illustrates the setup of the electrospinning apparatus, which consisted of a high-voltage power generator (High Voltage Technology Institute, Beijing, People’s Republic of China), an infusion pump (Smith Medical Instrument Company, Zhejiang, People’s Republic of China), and a 20 mL plastic syringe (BD, Franklin Lakes, NJ, USA) equipped with a stainless-steel blunt-ended needle with an inner diameter of 0.5 mm. Electrospun PLA/PCEC fibers were deposited onto rolling collector (0.5 m/second) for 60 minutes. A silicone tube was used to connect the syringe and a blunt-end needle, which was set up vertically. The concentration of PLA/PCEC solution was set at 8% (w/v), and PCEC content was 0, 25, 50, 75, and 100 wt%. For each PLA/PCEC suspension, 20 mL was fed into a plastic syringe, which was injected by the syringe pump at a flow rate of 7 mL/hour. The distance between the nozzle and the aluminum foil collector was adjusted to 12 cm. A voltage of 18 kV was applied to generate the PLA/PCEC jet. All experiments were carried out at 20°C±3°C and the environmental humidity was controlled to between 45% and 60%. The obtained PLA/PCEC membranes were left in a vacuum oven at 35°C for 48 hours to eliminate the solvent residue then kept in a desiccator for further characterization and treatment. #text sub #text T h e s t r u c t u r a l m o r p h o l o g y o f t h e e l e c t r o s p u n P L A / P C E C h y b r i d s c a f f o l d s w a s i n v e s t i g a t e d b y S E M ( J S M - 5 9 0 0 L U ; J E O L , T o k y o , J a p a n ) a n d t h e d i a m e t e r s o f t h e e l e c t r o s p u n f i b e r s i n t h e c o m p o s i t e s w e r e d e t e r m i n e d f r o m S E M m i c r o g r a p h s . T h e s a m p l e s w e r e c o a t e d w i t h g o l d u s i n g a s p u t t e r c o a t e r ( K Y K Y S B C - 1 2 ; K Y K Y T e c h n o l o g y D e v e l o p m e n t L t d B e i j i n g , P e o p l e ’ s R e p u b l i c o f C h i n a ) i n a d v a n c e . Water contact angles of PLA/PCEC hybrid membranes were investigated by drop shape analysis (DAS100; KRÜSS, Hamburg, Germany) at room temperature. A drop of 3 μL of deionized water was dropped on the surface of fibrous membranes and photographed immediately. The contact angle (θ) was obtained from the height (h) and breadth (b) of the drop according to the following equation: Each scaffold was measured at least three times at different positions and the results were averaged. #text sub #text To investigate cell attachment on the surfaces of PLA/PCEC hybrid membranes, the samples were fixed on the bottom of each well and sterilized using ethylene oxide steam for 24 hours at room temperature. hPMSCs were then seeded onto PLA/PCEC hybrid scaffolds containing 50 wt% PCEC at a density of 5×10/mL and cultured with proliferation medium at 37°C under an atmosphere of 5% CO in humidified air. After incubation for 48 hours, hPMSCs were stained with the fluorescent dyes fluorescein isothiocyanate (FITC) (Sigma-Aldrich) and Dil Life Technologies and then observed by fluorescence microscopy. The viability of hPMSCs cultured on the PLA/PCEC hybrid scaffolds with different PCEC concentration was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium-bromide (MTT) assay (Roche Diagnostics, Mannheim, Germany). hPMSCs were cultured on the electrospun fibrous scaffolds, which were fixed on the bottom of 24-well plates in advance, at 37°C under an atmosphere of 5% CO for 2, 4, and 6 days. Subsequently, 100 μL of 5 mg/mL MTT was added to each well and incubated at 37°C under an atmosphere of 5% CO. After 4 hours, supernatant was removed, and 650 μL of dimethyl sulfoxide was added to each well for dissolving the blue formazan crystal, then the solution was transferred to 96-well plates. The absorbance of the contents of each well was measured at 570 nm using an enzyme-linked immunosorbent assay microplate reader (Bio-Rad Laboratories, Hercules, CA, USA). #text xref sub sup #text shows the FT-IR spectra of pure PLA fiber (), PLA/PCEC hybrid fiber (50 wt% PCEC) (), and pure PCEC fiber (). In the spectrum of the pure PCEC copolymer, the strong peaks at 1180 and 1240 cm were assigned to the characteristic of C–O–C stretching vibrations of repeated –OCHCH units of PEG block and the –COO– band stretching vibrations, respectively. The characteristic band at 1,727 cm corresponded to –C=O stretching vibrations of the ester carbonyl group. Two weak peaks at 2,870 cm and 2,940 cm represented vibration of carbon hydrogen (–CH–) in PCL block main-chain, which also can be seen in . In , the peaks at 1,762 cm belonged to ester carbonyl –C=O. The main characteristic bands of PLA and PCEC copolymer could be seen in the hybrid membranes. A typical H-NMR spectrum of PCEC copolymer as well as the detailed assignment of the different peaks is shown in . Peaks at approximately 1.40 ppm, 1.65 ppm, 2.30 ppm, and 4.06 ppm were assigned methylene protons of –(CH)–, –OCCH–, and –CHOOC– in PCL blocks, respectively. The spectrum shows that two weak peaks, “a” and “c,” were attributed to methylene proton of PEG end units, while peak “d” was attributed to methylene protons of PEG oxyethylene units, and x and y were, respectively, the corresponding block number of PCL and PEG in PCEC copolymers, as shown in . The actual weight ratio of PCL/PEG of PCEC copolymers was 6.2:1, calculated from H-NMR spectra according to Equations–: where I, I, and I were integral intensities of methylene protons of –O–CH– in PEG end unit at 4.23 ppm, methylene protons of –CHOOC– in PCL units at 4.06 ppm, and methylene hydrogen of homosequences of PEG oxyethylene units at 3.65 ppm, respectively. #text xref sub #text xref #text xref #text xref #text To test the usefulness of PLA/PCEC membranes as a porous scaffold to support cell growth, the hPMSCs were cultured on the PLA/PCEC membranes. After culture for 48 hours, the cell morphology was observed by fluorescence micrographs. As shown in and , hPMSCs could attach and grow well on the scaffolds after 2 days of culture. hPMSC proliferation on the five hybrid scaffolds were analyzed by MTT assay at days 2, 4, and 6 after seeding. As shown in , hPMSCs proliferated well on all the substrates compared with control. After 4 and 6 days of culture, hPMSCs seeded on PLA/PCEC hybrid membranes with 0, 25, and 50 wt% PCEC showed almost the same absorbance values compared with control; however, samples containing 75 and 100 wt% PCEC still showed higher absorbance values than control. It should be noted that cell counts after 6 days’ incubation had not dramatically increased compared with those of 4 days’ incubation. #text The placenta is believed to be a large reservoir of MSCs for therapeutic-scale manufacture. Stem cell lines obtained from the chorion of human placenta have been found to be similar to other MSCs,,– such as bone marrow MSCs and adipose MSCs, which could remain viable and reproducible in vitro, could express markers of pluripotent stem cells (NANOG, OCT-4, SSA-3, etc) and surface markers of mesenchymal cells (CD73, CD90, CD105, etc), and could be differentiated in vitro into osteoblasts, adipocytes (mesoderm), neuron-like cells (ectoderm), and hepatocytes (endoderm) with culturing in differential media., Nazarov et al reported that human chorionic mesenchymal stem cell could remain viable and reproducible for more than 100 doublings (55 passages), which is better than other MSCs. In this study, we successfully prepared PLA/PCEC hybrid membranes by electrostatic spinning technique, and hPMSCs cultured on PLA/PCEC nanofibers showed good cell attachment and robust proliferation and could be induced into osteoblasts when treated with osteogenic differential media, as per a previous study. The design and fabrication of scaffolds are essential tasks for a functional vital engineered tissue.,, Electrospinning has been proven to be an effective method of fabricating a provisional biomimetic scaffold composed of nano- to microscale fibrous meshes.,– Due to the biomimetic ECMs of a nanofiber scaffold, it might have significant effects on cell behavior.,,, In addition to the topographical features of a scaffold, the mechanical properties of a scaffold are also an important aspect, which could be regulated by the design of the structure and the material itself. A designed scaffold should not only provide a surface for cell proliferation but also maintain sufficient biomechanical support during tissue regeneration and structure degradation. This article presents a novel strategy for bone tissue engineering by culturing hPMSCs on PLA electrospun nanofibers modified by ABA triblock copolymer PCEC. Biodegradable PCEC triblock copolymers were synthesized by ring-opening copolymerization of PCL initiated by PEG using stannous octoate as catalyst. The H-NMR and GPC results indicate that the PCEC block copolymers were prepared successfully, with a controlled macromolecular weight ( and ). The results presented in reveal that PCEC copolymer exhibited characteristic bands of both PCL and PEG segments, which confirmed the formation of PCEC copolymer. PLA/PCEC hybrid scaffolds exhibited characteristic bands of PLA and PCEC that indicated that the two polymers were blended together when dissolve in dichloromethane together. In , PLA is seen to be a type of semi-crystalline polyester polymer; however, in the process of forming the pattern of pure PLA membrane, no characteristic diffraction peaks occurred, which confirmed that the polymer matrix kept an amorphous structure, while the pattern of pure PCEC membrane revealed that PCEC had a crystalline pattern. Moreover, in the pattern of hybrid membranes ( and ), peaks at 17.1° and 16.7° could be detected, which indicate that the PLA of PLA/PCEC hybrid membranes were no longer in an amorphous state, but converted into crystalline material. As seen in and , the two melting temperatures of PLA/PCEC fibrous scaffolds were higher than those of pure PCEC. The reason might be that interactions between PLA and PCEC after incorporation of PCEC into PLA polymer when electrospun into fibers; however, the sample containing 25 wt% PCEC had a higher crystallization temperature, at 30.5°C, probably because of the homogeneous nucleation effect of PCEC on the cold crystallization of PLA matrix. From the thermogravimetric analysis ( and ), the temperature at which 5% decomposition increase might have been because of the increasing of crystallinity when PCEC concentration was increased. All of those results have proved that thermal stability of PLA/PCEC hybrid membrane was better than that of pure PLA and pure PCEC membrane. Morphology of the scaffolds was examined by SEM, and images are presented in . For pure PLA, there were some spindle-shaped structures among the fibers, and the electrospinning process was not very smooth. This might be due to the intrinsic properties of PLA solution, such as surface tension and viscosity. Interestingly, the electrospun fiber surface of PLA exhibited nanoscale pores, as also reported by Bognitzki et al, who rationalized that the rapid phase separation induced by the evaporation of the solvent and the subsequent rapid solidification during electrospinning might have accounted for this surface structure. With increasing PCEC concentration, the process of electrospinning became smooth, with no spindle-shaped structures formed. We suspected that the low molecular weight (compared with the PLA) might affect the intrinsic properties of the hybrid solution, and PCEC might play the role of lubricant in the mixed solutions, which could reduce the solution viscosity. However, PLA/PCEC with 75 wt% concentration of PCEC could not turn into homogeneous fiber, and numerous beaded structures formed through electrospinning. We speculated that phase separation might be the main reason, which led to formation of amorphous PLA-rich and PCEC-rich phases. The water contact angle of PLA/PCEC hybrid scaffolds was found to gradually decrease from 126.5° to 93.9° with increasing PCEC concentration (), which might have been due to the increasing number of hydrophilic phases of PEG and good distribution of fibers. Mechanical properties, as importance factor of three-dimensional nanoporous scaffolds, were investigated in this study. Based on the results ( and ), the sample containing 25 wt% PCEC showed the highest elongation rate at break, while the sample containing 50 wt% PCEC displayed highest tensile strength of all the samples. The results of tensile testing demonstrated that PCEC concentration had a great effect on mechanical properties of the samples. Some reports in the literature have reported that ABA triblock copolymer, such as PCEC used in this study, could modify the mechanical properties. The reason might be ABA triblock copolymer show capable of forming a stereocomplex with the PLA matrix, which was used as the sole strengthening agent to modify the physical strength of PLA., On the other hand, we speculated that the increase of fiber crystallinity might play an effective role in improvement of mechanical properties of PLA/PCEC hybrid scaffolds. To validate the cell response of PLA/PCEC hybrid scaffolds, the behavior of hPMSCs cultured on the scaffolds was observed. We evaluated cells’ metabolic activity and viability by MTT assay (), cell morphology and cell interaction with the hybrid scaffolds by fluorescent microscopic images (–), and cell differential ability by SEM and alizarin red staining (). The results revealed that hPMSCs interacted and integrated well with surrounding fibers, and could proliferate and spread well on the membranes. Moreover, after 2 weeks’ incubation in osteogenic differential medium, the hPMSCs cultured on PLA/PCEC fibrous scaffolds clearly showed matrix mineralization with alizarin red staining. On the whole, the PLA/PCEC electrospun scaffolds showed good cellular compatibility and favorable osteogenic potential in vitro, thus should be suitable candidates for application in bone tissue engineering. t h i s s t u d y , P L A b l e n d i n g w i t h d i f f e r e n t c o n c e n t r a t i o n s o f A B A t r i b l o c k c o p o l y m e r P C E C w e r e e l e c t r o s p u n i n t o n a n o - t o m i c r o f i b e r s , w i t h n u m e r o u s n a n o p o r e s o n t h e s u r f a c e o f a s i n g l e f i b e r , a n d t h e y e x h i b i t e d i m p r o v e m e n t o f m o r p h o l o g y a n d m e c h a n i c a l p r o p e r t i e s c o m p a r e d t o n e a t P L A f i b e r m e m b r a n e . W i t h t h e r a t i o o f P C E C i n c r e a s i n g f r o m 0 % t o 5 0 % , a v e r a g e d i a m e t e r o f f i b e r a n d w a t e r c o n t a c t a n g l e o f m e m b r a n e d e c r e a s e d , w h i l e m e c h a n i c a l p r o p e r t i e s a n d t h e r m a l c h a r a c t e r i s t i c s c l e a r l y i m p r o v e d . T h e b i o c o m p a t i b i l i t y o f t h e s c a f f o l d s t o h P M S C s w a s d e m o n s t r a t e d b y M T T . F a v o r a b l e i n t e r a c t i o n s b e t w e e n h P M S C s o n t h e s c a f f o l d s w e r e d e m o n s t r a t e d b y c e l l m o r p h o l o g y , p r o l i f e r a t i o n , a n d d i f f e r e n t i a t i o n s t u d i e s . T h e s e r e s u l t s d e f i n i t e l y p r o v e t h e p o t e n t i a l o f t h e s e s c a f f o l d s f o r b o n e t i s s u e e n g i n e e r i n g . I n o u r f u r t h e r r e s e a r c h , t h e m e c h a n i s m o f t r i b l o c k c o p o l y m e r i m p r o v i n g P L A m e c h a n i c a l p r o p e r t i e s w i l l b e s t u d i e d , a n d t h i s t y p e o f b o n e t i s s u e s u b s t i t u t e w i l l b e e x p l o r e d i n v i v o .

Dysregulation of the phosphatidylinositol-3-kinase/protein kinase B/mammalian target of rapamycin (PI3K-AKT-mTOR) pathway is frequently observed in tumors, including breast cancer. This pathway plays an important role in the regulation of cell proliferation, metabolism, motility, angiogenesis, and survival. Pathway hyperactivation has been linked to cancer pathogenesis, progression, and treatment resistance. mTOR is a serine-threonine kinase which plays a key role in cell regulation, including responses to multiple stimuli such as amino acid availability, energy and oxygen stresses, and growth factor receptor signaling.– Alterations in receptor tyrosine kinases can constitutively activate the PI3K-AKT pathway upstream in breast cancer, leading to increased activity of the mTOR pathway. Aberrant activation of insulin-like growth factor-1, the fibroblast growth factor receptor family, and the epidermal growth factor/HER family, in particular human epidermal growth factor receptor 2 (HER2) have all been observed in breast cancer. Abnormalities in the PI3K-AKT pathway itself including loss of phosphatase and tensin homolog (PTEN) function, PI3K mutations, and aberrant activation of AKT are other possibilities of mTOR pathway activation. The liver kinase B1 (LKB1)/adenosine monophosphate-activated protein kinase (AMPK) pathway is the other major pathway regulating mTOR. Hyperactivation of this pathway, known as the metabolic pathway, can also be responsible for mTOR pathway activation. A close interaction between the mTOR pathway and estrogen receptor (ER) signaling has been reported. A substrate of the mTOR complex 1, S6 kinase 1 phosphorylates the activation function domain 1 of the ER, leading to ligand-independent receptor activation., Many drugs in development target the PI3K-AKT-mTOR pathway, but only the mTOR inhibitor, everolimus, is currently approved for use in breast cancer in combination with the aromatase inhibitor exemestane in patients with ER-positive, HER2-negative advanced breast cancer who have previously failed a nonsteroidal aromatase inhibitor. This review focuses on first-generation mTOR inhibitors, their clinical results (), their common side effects () including the impact on quality of life in Phase III trials, and perspectives of mTOR inhibitors in the treatment of advanced or early-stage breast cancer. Dysregulation of the mTOR pathway leading to hyperactivation of the pathway is associated with a poor outcome in breast cancer. Cancer cells develop resistance to endocrine, cytotoxic, and HER2-targeted therapy through activation of the PI3K-AKT-mTOR pathway. This is the rationale for addition of mTOR inhibitors to endocrine therapy, chemotherapy, and antiHER2 therapy with the aim of enhancing efficacy and/or delaying resistance. Sirolimus was the first rapalog used as an immunosuppressant agent to prevent rejection in organ transplantation. Rapalogs also have proven clinical benefit in eluting stents to prevent coronary artery reocclusion. Three first-generation rapalogs, ie, temsirolimus, everolimus, and ridaforolimus, have been evaluated in inhibition of cancer growth. They differ from the structure of the parent drug, sirolimus, at position C-42 and have more favorable pharmacokinetics. They all bind to FK506-binding protein 12 (FKBP12) and all preferentially inhibit the functions of mTOR complex 1 (mTORC-1). These drugs seem to have similar clinical activity and toxic effects, but with some differences in metabolism, formulation, and schedule of administration. The class-specific side effects are well known, and include stomatitis, noninfectious pneumonitis, infection, hyperglycemia, and dyslipidemia. Everolimus has been approved to overcome resistance to endocrine therapy, but there are a lot of clinical trials in progress combining mTOR inhibitors with various endocrine, targeted, or cytotoxic drugs trying to overcome resistance to therapy. Ridaforolimus is an analog of sirolimus and has been administered orally in breast cancer trials at a dose of 40 mg/day for 5 days per week. This drug is still investigational. In sarcoma, the drug offers moderate benefit as maintenance therapy after chemotherapy, but it has not yet been approved by the US Food and Drug Administration or European Medicines Agency in this indication. No randomized Phase II or III data are available in breast cancer. Two nonrandomized Phase II trials have finished recruitment, but the results are not yet available (oral deforolimus with trastuzumab for patients with HER2-positive, trastuzumab-refractory metastatic breast cancer, NCT00736970; and a study of ridaforolimus in combination with dalotuzumab compared with standard of care treatment in ER-positive breast cancer patients, NCT01234857). Temsirolimus weekly as a 30-minute intravenous infusion at a dose of 75 mg or 250 mg was evaluated in a randomized, open-label trial in 109 patients presenting with locally advanced or metastatic breast cancer. An objective response rate of 9.2% was reported in these heavily pretreated patients. The median time to progression was 12 weeks. Similar efficacy was observed independent of the dose, but side effects were more frequent at the higher 250 mg dose. A three-arm randomized Phase II trial evaluated the safety and activity of oral temsirolimus in combination with letrozole, a nonsteroidal aromatase inhibitor. The analysis was restricted to 92 patients included after amendment implementing a lower dose at treatment initiation (letrozole alone, 29 patients; letrozole + temsirolimus daily 10 mg, 33 patients; letrozole + intermittent temsirolimus 30 mg daily during 5 days every 14 days, 30 patients) and suggested that both combined treatment arms had better median progression-free survival (not reached at time of reporting in the abstract) compared with the median progression-free survival of 9.2 months in the letrozole alone arm. Based on these encouraging results, a Phase III trial evaluating intermittent temsirolimus combined with letrozole has been initiated. An ongoing Phase I–II trial is evaluating temsirolimus in combined treatment for metastatic HER2-positive or triple-negative breast cancer (Temsirolimus plus neratinib for patients with metastatic HER2-amplified or triple-negative breast cancer, NCT01111825). italic #text Although these proof-of-concept trials are very important, the practice of oncology can only be changed based on randomized Phase III trials. Everolimus is now approved for the treatment of ER-positive, HER2-negative advanced breast cancer in combination with exemestane in patients resistant to nonsteroidal aromatase inhibitors by health authorities in Europe and the USA based on the BOLERO-2 trial ()., This was a randomized, placebo-controlled Phase III trial comparing exemestane 25 mg/day + everolimus 10 mg/day with exemestane and placebo in 724 patients previously treated with a nonsteroidal aromatase inhibitor in the adjuvant or advanced setting. All patients suffered from recurrence of breast cancer during or within 12 months after the end of adjuvant treatment or progression during or within 1 month after the end of treatment for advanced disease. It is important to point out that patients who fail treatment with a nonsteroidal aromatase inhibitor have a very poor prognosis with standard endocrine therapy alone. This has been shown in the EFECT (Evaluation of Faslodex versus Exemestane Clinical Trial) and SoFEA (Study Of Faslodex with or without concomitant arimidex vs Exemestane following progression on non-steroidal Aromatase inhibitors) trials., The median progression-free survival was less than 5 months with fulvestrant (250 mg every 4 weeks) or exemestane in both trials. Combined endocrine therapy of anastrozole + fulvestrant (at the 250 mg dose) does not perform better compared with exemestane or fulvestrant monotherapy. These disappointing results illustrate well the unmet medical need in this patient population. The BOLERO-2 trial met its primary endpoint of median progression-free survival according to local assessment performed every 6 weeks. At the interim analysis, median progression-free survival was 6.9 months in the everolimus + exemestane arm compared with only 2.8 months in the placebo + exemestane arm. These results were confirmed when the final progression-free survival results were presented (median progression-free survival 7.8 and 3.2 months, respectively). Randomization was stratified according to the presence of visceral metastasis and previous sensitivity to endocrine therapy. Endocrine-sensitive patients were defined as having received at least 24 months of endocrine therapy before recurrence in the adjuvant setting or having presented a response or stabilization for at least 24 weeks of endocrine therapy for advanced disease. Visceral involvement was present in 56% of all patients and hormone-sensitive disease in 84%. Importantly, the improvement in median progression-free survival was consistent among all predefined subgroups including (but not limited to) age, race, baseline performance status, progesterone receptor status, prior chemotherapy for advanced disease, prior endocrine therapy other than a nonsteroidal aromatase inhibitor, presence of visceral disease, bone only disease, and sensitivity to prior endocrine therapy. Of course, the absolute benefit was less pronounced in poor prognostic subgroups but the relative benefit was very similar in all subgroups. For example, median progression-free survival according to local assessment increases from 2.76 months to 6.83 months in patients with visceral disease, from 4.21 months to 9.86 months in patients without visceral disease, and from 5.29 months to 12.88 months in patients with bone only disease. Very interestingly, the median progression-free survival increases from 4.17 months to 11.7 months in patients having received nonsteroidal aromatase inhibitor therapy in the adjuvant setting but having not yet received any treatment for advanced disease. This important absolute benefit is observed in patients who just failed one line of endocrine therapy. Patients do not need to be heavily pretreated before benefiting from the combined treatment approach. BOLERO-2 has shown that everolimus + exemestane offers an important alternative to chemotherapy for the large subset of patients who do not have life-threatening visceral metastatic disease. The use of chemotherapy can be postponed in most patients with visceral metastases. Concerning the secondary endpoint, analysis of progression-free survival based on central radiologic assessment, a 6.9-month prolongation in median progression-free survival from 4.1 months in the placebo + exemestane arm to 11 months in the everolimus + exemestane arm was observed. We are eagerly awaiting the results for overall survival. Mature data are expected to be presented in 2014. The absolute difference in deaths was increasing progressively since the first interim analysis of median progression-free survival, and was 6.8% (25.4% versus 32.2%) at last update at time of final progression-free survival analysis, indicating a better outcome in the everolimus + exemestane arm, but this difference is not yet statistically significant. Two investigator-initiated studies will evaluate the role of everolimus in the adjuvant setting (Safety study of adding everolimus to adjuvant hormone therapy in women with poor prognosis, ER-positive and HER2-negative primary breast cancer, free of disease after receiving 3 years of adjuvant hormone therapy, NCT01805271; S1207 hormone therapy with or without everolimus in treating patients with breast cancer, NCT01674140). In Europe, the UNICANCER group in France has started a large placebo-controlled Phase III trial expected to recruit 2,010 premenopausal or postmenopausal women suffering from ER-positive, HER2-negative breast cancer presenting at least four lymph nodes involved at diagnosis. Patients initially receive routine standard adjuvant therapy for 2–3 years. Only patients still relapse-free after 2–3 years of adjuvant therapy can enter the trial. Patients then receive everolimus or placebo for 2 years in addition to tamoxifen or aromatase inhibitor therapy. The primary endpoint is disease-free survival at 2 years post-randomization, and secondary endpoints include overall survival, biomarker assessments, and safety. The investigators have chosen this design with everolimus treatment starting only after some years of endocrine therapy because their previous TAMRAD study has shown in an exploratory analysis that patients with secondary endocrine resistance had a much more pronounced benefit compared with patients with primary resistance when everolimus is added to tamoxifen (see above). The other large placebo-controlled Phase III trial is organized by the Southwest Oncology Group and National Surgical Adjuvant Breast and Bowel Project. In this trial, everolimus or placebo is given in combination with standard endocrine therapy as soon as the patient starts endocrine therapy for a total duration of 1 year. A total of 3,500 high-risk patients are expected to be recruited into this trial. High risk is defined as an Oncotype DX recurrence score over 25 or at least four lymph nodes involved. Use of chemotherapy in the adjuvant or neoadjuvant setting is mandatory in this study in contrast with the European study. The primary endpoint is invasive disease-free survival. Secondary endpoints include overall survival, distant recurrence-free survival, biomarker assessments, and safety. Compliance with the experimental treatment arm in both studies may be an issue because combined treatment with everolimus is more toxic than endocrine therapy alone. Everolimus has never been evaluated in the adjuvant setting in any tumor type. Consequently, no data concerning the acceptance rate in the adjuvant setting are available. In the neoadjuvant setting, twice as many patients discontinued everolimus + letrozole compared with placebo + letrozole (18.8% versus 9.1%). If a significant number of patients, for personal reasons, stop all adjuvant treatment including standard endocrine therapy in the case of poor tolerance of everolimus this may have a significant impact on the results in the experimental arm, in particular in the trial performed in the USA where everolimus or placebo is given as soon as endocrine therapy starts. BOLERO-4 (Open-label, Phase II, study of everolimus plus letrozole in postmenopausal women with ER-positive, HER2-negative metastatic or locally advanced breast cancer, NCT01698918) is a nonrandomized trial evaluating the first-line effectiveness of everolimus 10 mg/day in combination with letrozole 2.5 mg/day in endocrine therapy-naïve patients presenting advanced breast cancer. The first-line use of everolimus in endocrine-naïve patients is still the subject of major debate after the negative first-line temsirolimus trial. At the time of disease progression, patients have the option to continue everolimus at the same dose combined with exemestane 25 mg/day instead of letrozole. Given that this is a nonrandomized trial, the results can only be hypothesis-generating, but the usefulness of continuing mTOR inhibition after progression during mTOR therapy in particular is a very relevant clinical question. In HER2-positive disease, we give several lines of trastuzumab-based treatment. It is worthwhile to evaluate if this kind of approach is also of interest for agents blocking the PI3K-AKT-mTOR pathway. This concept has also been validated in colorectal cancer, where antiangiogenic drugs are continued beyond progression although a different antiangiogenic drug is used after progression. The administration of subsequent lines of endocrine therapy in metastatic ER-positive breast cancer is also standard of care. Another important question is whether, in the event of progressive disease, the optimal treatment should be continuation of the same mTOR inhibitor or if another drug targeting the PI3K-AKT-mTOR pathway should be administered in addition to a modified endocrine therapy. The latter strategy is being evaluated for example in the BELLE-3 trial (A Phase III study of BKM120 with fulvestrant in patients with hormone receptor-positive, HER2-negative, aromatase inhibitor treated locally advanced or metastatic breast cancer who progressed on or after mTOR inhibitor, NCT01633060) where patients who have failed everolimus + exemestane are randomized to receive fulvestrant ± BKM120, a PI3K inhibitor. Another question is whether administration of everolimus should be considered again in a later line of therapy after use of other drugs targeting the PI3K-AKT-mTOR pathway rather than at the time of progressive disease during treatment with everolimus. #text Nonrandomized Phase I/II trials have shown everolimus to have promising activity when combined with other agents, ie, either trastuzumab alone or combined with trastuzumab and chemotherapy (paclitaxel or vinorelbine) in HER2-positive disease.– O’Regan et al presented the final progression-free survival analysis of the BOLERO-3 study at the 2013 American Society of Clinical Oncology meeting. This randomized, double-blind, placebo-controlled, multicenter Phase III trial compared weekly trastuzumab + vinorelbine and everolimus at the dose of 5 mg with weekly trastuzumab + vinorelbine and placebo. A total of 569 patients with advanced breast cancer who had previously failed trastuzumab and a taxane were recruited into this trial. Progressive disease was either observed during treatment with trastuzumab in the adjuvant or metastatic setting or during the 12 months following completion of trastuzumab therapy in the adjuvant setting (). The trial met its primary endpoint progression-free survival. Indeed, the median progression-free survival increases from 5.78 months to 7 months in the experimental arm. More stomatitis and neutropenic fever were observed in the experimental arm. Stomatitis was also the reason why in the Phase I/II trial the everolimus dose had not been increased to the standard 10 mg dose which allows optimal inhibition of the mTOR pathway. Subgroup analysis revealed a more pronounced benefit in patients who previously received trastuzumab in the adjuvant or neoadjuvant setting (HR 0.65), in those without visceral involvement (HR 0.48), and in those with ER-negative disease (HR 0.65). Neither the objective response rate nor the clinical benefit rate have been improved by addition of everolimus. However, very interestingly, only 36.3% in the everolimus arm compared with 41.1% in the placebo arm had died at the time of the interim overall survival analysis. We are now waiting for the mature overall survival data in order to determine if this trend will result in a statistically significant survival benefit. #text xref italic #text xref sup #text In the HORIZON trial (letrozole + intermittent temsirolimus versus letrozole + placebo), treatment-emergent adverse events were more frequently seen in the temsirolimus arm (91% versus 79%). All grade side effects included asthenia (27% versus 21%), mucositis/stomatitis (26% versus 4%), diarrhea (21% versus 9%), headache (19% versus 12%), anorexia (15% versus 7%), and rash (15% versus 4%). Grade 3 or 4 toxicities were also more frequent in the temsirolimus arm (37% versus 24%), and included hyperglycemia (4% versus 1%), diarrhea (2% versus 1%), mucositis/stomatitis (2% versus 1%), and hyperlipidemia (2% versus 1%). Permanent dose reduction (4% versus 1%) and therapy discontinuation were also more frequent in the experimental arm. No increase in noninfectious pneumonitis was reported in the experimental arm. The authors suggested that the overall much lower frequency of toxicities in HORIZON compared with BOLERO-2 can be related to a less heavily pretreated patient population. However, less effective inhibition of the mTOR pathway, in particular with intermittent administration, should be considered as an alternative explanation. The mean relative dose intensity of temsirolimus was very high (0.96). The impact of side effects on quality of life was not reported in this trial. In the BOLERO-2 (exemestane + everolimus versus exemestane + placebo), serious adverse events related to study treatment were much more frequent in the everolimus arm (12% versus 1%). Also, a higher percentage of patients discontinued everolimus compared with placebo in the control group because of adverse events (19% versus 4%) or withdrawal of consent (5% versus 2%). Seven deaths were attributed to treatment in the everolimus arm. The most common grade 3 or 4 adverse events were stomatitis (8% versus 1%), anemia (6% versus <1%), dyspnea (4% versus 1%), hyperglycemia (4% versus <1%), fatigue (4% versus 1%), and pneumonitis (3% versus 0%). All grade adverse events independent of relationship to study treatment were also in general more frequent in the everolimus arm, ie, stomatitis (56% versus 11%), rash (36% versus 6%), fatigue (36% versus 29%), diarrhea (30% versus 16%), decreased appetite (29% versus 10%), cough (22% versus 11%), and dyspnea (18% versus 9%). Quality of life was an important secondary endpoint in BOLERO-2 and was assessed by the European Organisation for Research and Treatment of Cancer Quality of Life Questionnaire-Core 30 (EORTC QLQ-C30) done at baseline and thereafter every 6 weeks until disease progression and/or discontinuation of treatment. Time to definitive deterioration analysis at a 5% decrease in the quality of life score versus baseline, with no subsequent increase above this threshold, was evaluated prospectively. The median time to definitive deterioration in quality of life was 8.3 months in the combined treatment arm versus 5.8 months in the control arm (HR 0.74; =0.0084). The authors reported an additional sensitivity analysis using a 10-point minimal important difference decrease in the global health status score versus baseline. The median time to definitive deterioration in the combined treatment arm was 11.7 months versus 8.4 months in the control arm (HR 0.80; =0.1017). These results show that quality of life was at least maintained in the experimental arm and that side effects were largely compensated by a better antitumoral effect in patients receiving everolimus in addition to exemestane. In the BOLERO-3 trial (trastuzumab + vinorelbine + everolimus versus trastuzumab + vinorelbine + placebo), more patients discontinued treatment because of adverse events (10% versus 5%) and because of withdrawal of consent (6% versus 5%) in the everolimus arm. The median relative dose intensity was 0.77 for everolimus and 0.96 for placebo. The median relative dose intensity for vinorelbine was lower in the experimental arm (0.64 versus 0.73). More frequent all grade adverse events in the everolimus arm included stomatitis (63% versus 28%), pyrexia (39% versus 23%), decreased appetite (33% versus 17%), and febrile neutrope-nia (17% versus 4%). Several grade 3 toxicities were also more frequent in the everolimus arm, and included stomatitis (13% versus 1%), fatigue (12% versus 4%), diarrhea (4% versus 1%), hyperglycemia (grade 3, 4% versus 2%; grade 4, 2% versus 1%), and nausea (3% versus 1%), but not noninfectious pneumonitis (<1% versus 1%). The incremental toxicity observed in the everolimus arm compared with the placebo arm did not impact quality of life. The time to definitive deterioration of global health status score based on the EORTC QLQ-C30 questionnaire and defined as at least a 10% change from baseline was 8.31 months in the everolimus arm and 7.29 months in the placebo arm. sec The objective response rates achieved with everolimus and other first-generation mTOR inhibitors are modest. mTOR forms at least two functional multiprotein complexes, ie, mTORC1 and mTORC2. First-generation mTOR inhibitors inhibit mTORC1 but not mTORC2, which also plays an important role in cancer growth and survival (). Furthermore, treatment with first-generation mTOR inhibitors may also cause activation of AKT via a negative feedback loop, resulting in increased cancer cell survival., Consequently, PI3K/mTOR or mTORC1/2 dual inhibitors are currently under evaluation because these drugs can prevent elevated AKT activity and provide more complete inhibition of mTOR activity. We are living in an exciting time for breast cancer specialists (). In particular, in HER2-negative, ER-positive breast cancer, many targeted drugs (including PI3K-AKT-mTOR, cyclin-dependent-kinase, histone deacetylase, and Src inhibitors) in combination with endocrine therapy are under development. The mTORC1 inhibitor everolimus is the first targeted therapy approved in HER2-negative, ER-positive advanced breast cancer resistant to nonsteroidal aromatase inhibitors based on the results of the BOLERO-2 study. The magnitude of benefit has never been seen in this breast cancer subtype since the introduction of tamoxifen. The median progression-free survival has more than doubled when everolimus is added to exemestane compared with exemestane alone. Ongoing research is evaluating if more potent inhibition of the PI3K-AKT-mTOR pathway will lead to improved outcomes. The BOLERO-3 trial evaluating everolimus in heavily pretreated patients presenting HER2-positive advanced breast cancer also met its primary endpoint. Median progression-free survival is significantly improved when everolimus is added to trastuzumab and vinorelbine compared with placebo, trastuzumab, and vinorelbine. However, the benefit was only observed in HER2-positive, ER-negative tumors. This and other trials in the neoadjuvant and metastatic setting clearly indicate that new approaches are needed for HER2-positive, ER-positive breast cancer. The addition of an endocrine therapy to a drug combination targeting the PI3K-AKT-mTOR pathway and the HER2 receptor should be evaluated. The role of mTOR inhibitors in triple-negative breast cancer also warrants further evaluation.

Panic disorder is characterized by the presence of recurrent panic attacks along with the following symptoms: persistent thoughts about the possibility of future attacks; worry about the implications and consequences of an attack; and changes in behavior because of previous attacks. Unexpected paroxysmal bursts of severe anxiety, especially when complicated by agoraphobia, affect an individual’s functioning in a progressive, disabling pattern and reduce quality of life. Several psychological factors such as anxiety sensitivity, conditioned fear of internal cues, and catastrophic misappraisals of bodily sensations seem to play an important role in the onset and maintenance of panic disorder. Two broad categories of treatment have been accepted because of their effectiveness in treating panic disorder: pharmacotherapy and cognitive behavioral therapy (CBT). Pharmacotherapy is a very effective treatment modality for panic disorder. Selective serotonin reuptake inhibitors (SSRIs) are now considered to be the first-line drug, and benzodiazepines such as alprazolam and clonazepam have also proved effective for the treatment of panic disorder in controlled trials.– However, pharmacotherapy alone seems to result in considerable relapse, regardless of the maintenance of an adequate dose,, and may be related to significant problems with long-term medication use, such as dependence and withdrawal symptoms. CBT is also an effective treatment in panic disorder, with 75% of patients achieving panic-free end states. In contrast to pharmacotherapy, CBT maintains its effect after the end of treatment and has a distinct advantage over pharmacotherapy in preventing relapse., Various hypotheses of neural mechanisms underlying panic disorder have been proposed to understand the effectiveness of treatments. Patients with panic disorder have a sensitive fear network that is centered in the amygdala, which is modulated by both thalamic input and prefrontal projections, and itself projects to several areas that are related to autonomic and behavioral responses. Serotonergic drugs would act by desensitization of the fear network via projection from the raphe nuclei to various brain areas, such as the locus coeruleus for arousal, brain stem for respiratory activation, hypothalamus for activation of the HPA axis, periaqueductal gray region for freeze/flight response, and possibly directly to the amygdala, inhibiting the excitatory pathway from both the thalamus and prefrontal cortex. CBT is thought to reduce phobic avoidance by deconditioning the contextual fear learned at the level of the hippocampus and decreasing cognitive misattributions by strengthening the ability of the medial prefrontal cortex to inhibit the amygdala. Although many studies have been performed to further understanding of the neurobiology of panic disorder,– only three studies investigated the neural correlates of CBT in patients with panic disorder.– Possible interpretation of these findings is that panic disorder is associated with hyper-reactivity in emotion-generative regions, possibly because of an overgeneralization of fearful stimuli, and hypo-reactivity in emotion-regulatory regions, reflecting a failure to control learned fear. From this perspective, CBT might be normalizing both emotion-generative and emotion-regulatory responses. However, the finding from each study provides only modest support for this hypothesis, and neural mechanism underlying the effects of CBT still remains unclear. The present study was an uncontrolled investigation to examine changes in regional cerebral blood flow (rCBF) associated with the alleviation of anxiety symptoms by CBT using single photon emission computed tomography (SPECT) in patients with panic disorder. We hypothesized that there would be increases of activity in regions of the upstream circuitry from the amygdala, including the prefrontal cortex, as an adaptive modification after CBT. It was also hypothesized that the activity would decrease in any area of “panic neurocircuitry” (amygdala, insulae, thalamu, pons, etc), which may be soothed during recovery after CBT. In addition, we expected to find significant correlations between changes in the psychometric measures and the rCBF in these brain regions. The eligible subjects were patients between the ages of 18 and 65 who met DSM-IV criteria for panic disorder on the Mini International Neuropsychiatric Interview (MINI)., The exclusion criteria were as follows: any comorbidity of the current psychiatric disorder, including major depressive disorder, bipolar disorder, schizophrenia, social phobia, obsessive-compulsive disorder, post-traumatic stress disorder, or generalized anxiety disorder; current suicide ideation or suicide attempt history; serious trauma history; any neurological disorder such as stroke, epilepsy, or brain tumor; current serious or unstable medical disease such as ischemic heart disease or cancer, or use of prescribed medication for more than 6 months; alcohol and other substance abuse within 6 months prior to the baseline; pregnancy or breast-feeding; and left handedness. Nineteen participants fulfilling inclusion and exclusion criteria were enrolled from the Mettaa Institute, located in Seoul, South Korea, which specializes in CBT for anxiety disorder. Of a total of 19 participants, 5 subjects dropped out of the study (2 with withdrawal of informed consent and 3 with follow-up loss), and finally 14 participants completed the study protocol and were included in the analysis (). Ten of them were women (71.4%), and the mean (standard deviation) age and duration of illness was 32.4 (9.0) years and 16.4 (15.4) months, respectively. Eleven subjects were being treated with medication, including SSRIs and benzodiazepine, prior to enrollment, and their medication was maintained without change during the study period. Subject assessments were performed at baseline and at the end of CBT by a psychology staff member who was blinded to the study and trained in use of the scale. The severity of the panic disorder was measured using the Panic and Agoraphobic Scale (PAS). The PAS is a 13-item scale that was developed to assess the severity of panic disorder and agoraphobia. It consists of five divisions of symptoms to determine the severity of the panic disorder: 1) frequency of panic attacks; 2) agoraphobic avoidance; 3) anticipatory anxiety; 4) family, social, and employment impairments; and 5) health worries. Each item is rated on a five-point scale (0–4), with higher scores representing greater severity. A total score (0–52) representing the panic severity is obtained by adding all of the item scores. The PAS and the Korean version of the PAS showed good psychometric reliability and validity., The Cronbach’s alpha for the Korean version of the PAS was 0.86. The Anxiety Sensitivity Index-Revised (ASI-R) was used to assess the fear of anxiety related with the sensation that arises from the belief that these symptoms have harmful physical, psychological, or social consequences. The ASI-R was developed by Taylor et al and retains the same instructions and response format as the ASI. The ASI-R has 36 items to measure fear of cardiovascular, respiratory, gastrointestinal, publicly observable, dissociative, neurological, and cognitive dyscontrol anxiety symptoms. Each item is rated on a five-point scale (0–4) and the total score ranges from 0–144. The ASI-R and the Korean version of the ASI-R have demonstrated good psychometric properties., The internal consistency coefficient for the Korean version of the ASI-R was 0.92. The Brief Bodily Sensations Interpretations Questionnaire (BBSIQ) is a shortened version of the Bodily Sensations Interpretation Questionnaire that was developed to evaluate the catastrophic misinterpretation of sensations by patients with panic disorder. The BBSIQ consists of two subscales that contain seven ambiguous event items of panic body sensations and external events, respectively. The BBSIQ has two scales that yield a ranking and belief score for each item. The ranking scores are established from the order of negative responses among the three alternative response items: one reflects the catastrophic misinterpretation of patients, and the other two are either both neutral or they are neutral or positive. The belief scores represent the likelihood that interpretations are true for the patients on a scale from zero (not likely at all) to eight (extremely likely). The BBSIQ and the Korean version of the BBSIQ have shown good psychometric reliability and validity., The Cronbach’s alpha for the Korean version of the BBSIQ was within the range of 0.78 and 0.89, excluding the ranking score for the external event (Cronbach’s α =0.56). The Anxiety Control Questionnaire (ACQ) is a 30-item self-report instrument that is designed to assess perceived control over emotional reactions and external threats. Participants are instructed to respond to a six-point Likert-type scale (0= “strongly disagree” to 5= “strongly agree”) by indicating the degree of agreement with a particular statement (eg, “I am usually able to avoid a threat quite easily”). The ACQ score is the sum of all responses, with the total score (0–150) representing perceived control. The ACQ and the Korean version of the ACQ have shown good psychometric properties., The internal consistency coefficient for the Korean version of the ACQ is 0.83. The CBT provided to subjects was manual-guided group therapy which was based on the work of Barlow et al. The CBT was given to groups of 8–12 patients for approximately 3 months in a 2 hours/week format. It consisted of several components that included psychoeducation (sessions 1–2), breathing retraining and muscle relaxation training (sessions 3–5), cognitive restructuring (sessions 6–8), and interoceptive and in vivo exposure (sessions 9–12). The CBT was provided, with the assistance of one or two other psychologists, by a psychiatrist specialized in CBT and internationally certified by the Academy of Cognitive Therapy. The SPECT was scheduled to be performed within the week before the beginning of CBT and within the week after the ending of CBT. Images were taken using a dual-head gamma camera (E-CAM, Siemens AG, Munich, Germany) with a low-energy fan-beam collimator 40 minutes after 740 MBq of technetium-99m-ethyl cysteinate dimer (Tc-99m-ECD) was infused intravenously. Post-CBT treatment brain perfusion SPECTs were performed under the same conditions. The software for image manipulation included Matlab version 6.5 (Mathworks, Inc., Natick, MA, USA) and Statistical Parametric Mapping 2 (SPM2: Institute of Neurology, University College of London, London, UK). Each SPECT scan was then spatially normalized using a 12-parameter affine warp and sinc-linear interpolation to the SPECT template brain from the Montreal Neurological Institute (reformatted to a 16-bit image having 79 × 95 × 68 voxels, each 2 × 2 × 2 mm in size). These images were spatially smoothed using a Gaussian filter of 16 mm full width at half maximum. Normalized rCBF values were calculated by dividing the CBF at each voxel by the global CBF in each individual. As no comparisons reached significance when the corrected -value (family-wised error) for multiple comparisons was made, the uncorrected -value threshold and voxel of interest (VOI) analysis were applied. A paired -test model was fitted, and a -statistic image was constructed and then thresholded at >3.14, corresponding to an uncorrected <0.01 in conjunction with a cluster filter of 100 voxels in the reformatted template imaging space. In the exploratory analyses, a statistical probabilistic anatomic map (SPAM) of the International Consortium for Brain Mapping was applied to objectively draw VOIs. A SPAM consists of 98 VOIs in a single image, in which each voxel has the probability of belonging to a specific VOI. After spatial normalization, the counts of each SPECT image were normalized using proportional scaling, with the mean counts of the cerebellum set at 50. The normalized counts were multiplied by the probability of the SPAM and were determined as the count of each VOI. The cerebral lobar counts were then calculated by averaging the counts of the VOIs that had been reclassified into each lobe. We assessed the intercorrelations between the clinical measures and the rCBF for regions that differed significantly. To compare the scores from each psychometric measure before and after CBT, the data were analyzed using a paired -test. Statistical significance was defined at a level less than 0.05 using two-tailed tests. A significant reduction of symptoms was observed in patients who completed the full sessions of CBT (n=14) (). The total and several subscale scores for the PAS, including panic attack, anticipatory anxiety, disability, and worries about health, were significantly improved after CBT. The total, as well as all subscale scores of ASI-R and BBSIQ, except the external event belief scores for BBSIQ, decreased significantly, whereas the ACQ scores increased significantly after CBT. When the rCBF of the subjects before and after CBT were compared, significant increases in the rCBF were detected in the left postcentral gyrus (Brodmann’s area [BA] 43), left precentral gyrus (BA 4), and inferior frontal gyrus (BA 9, BA 47). Significant decreases were detected in the left pons ( and ). When correlation analysis was performed between changes in rCBF and clinical measures, no significant correlation was found between the changes in rCBF in VOIs and changes in total and subscale scores on the clinical measures. This study was performed to investigate neural correlates of the effects of CBT in patients with panic disorder. In the current study, we observed increased rCBF in the left inferior frontal gyrus, left postcentral gyrus, and left precentral gyrus, and decreased rCBF in the left pons after CBT. However, no significant correlation was found between changes in rCBF and in scores on the clinical measures. Surprisingly, only a few studies using functional neuroimaging have been performed to investigate neural mechanisms underlying the effects of CBT in patients with panic disorder. Prasko et al found that patients with panic disorder demonstrated metabolic increases in F-fluorodeoxyglucose (FDG) PET (positron emission topography) after CBT in the right middle frontal gyrus, left inferior frontal gyrus, middle temporal gyrus, and insula, as well as metabolic decreases in the right inferior temporal gyrus, right inferior and superior frontal gyri, and left medial frontal gyrus. Sakai et al investigated metabolic changes using FDG PET in 11 patients with panic disorder who showed improvement after the completion of CBT. They found decreases in glucose utilization in the right hippocampus, left anterior cingulate, left cerebellum, and the pons, and increases in the bilateral medial prefrontal cortices (mPFC). Recently, Kircher et al tested this issue in a randomized controlled trial in 42 medication-free patients with panic disorder using fMRI (functional magnetic resonance imaging). They found reduced activation for the conditioned response in the left inferior frontal gyrus after CBT, and this activation reduction was correlated with reduction in agoraphobic symptoms. They also found increased connectivity between the inferior frontal gyrus and other regions including amygdalae, insulae, and the anterior cingulate cortex. Similar to previous findings, we found increased activity in the left inferior frontal gyrus (BA 9 and BA 47) after CBT. Lesions in this area are suggested to enhance fear reactivity to both the conditioned and contextual stimuli, and the efferent projections from this area are suggested to target the periaqueductal gray matter and hypothalamus, to attenuate related autonomic responses and emotional behaviors. This region is also associated with perceptive changes in motivational value of stimuli, and activation of this region is found when participants must inhibit or select from among competing responses. The insular cortex, which has bidirectional connections to the amygdala and prefrontal cortex and which relays information on interoceptive states to the prefrontal cortex, serves as an internal alarm center that alerts the individual to potentially distressing stimuli. Functional neuroimaging studies have shown that activity changes develop in the insula during panic attacks induced by lactate or CCK-4., It has been suggested that panic disorder develops partly because panic attacks cause the conditioning of anxiety to exteroceptive and interoceptive cues. Some portion of CBT for panic disorder focuses on eliminating this conditioning by desensitizing somatic and physical cues for panic attack. Therefore, the increased activation in inferior frontal gyrus in the current study might reflect continuous attempts to reverse previous learning of a reinforced response to stimuli and the down-regulation of negative emotions from these exteroceptive and interoceptive cues via cognitive reappraisal. However, there were negative findings, such as the lack of rCBF change in regions of “fear network” (amygdalae, insulae, thalamus, etc) and correlations between rCBF and symptom severity. The reason for these negative findings is not clear. Eleven of the 14 subjects in the current study were being treated with medications prior to the onset of CBT, although their medication was maintained without change during the study period. Medications, especially SSRIs, change the activity of various brain stem nuclei such as the locus ceruleus, periaqueductal gary, and hypothalamus with their treatment effects. Besides, SSRIs may affect the central nucleus of the amygdala itself and modulate excitatory input from the thalamic and cortical pathway. Gorman et al suggested that there could be distinct pathways through which medication and psychotherapy can exert their therapeutic effects in panic disorder. They hypothesized that medications could reduce panic attacks by decreasing the activity of the amygdala and its ability to stimulate projection sites in the hypothalamus and brainstem. On the other hand, psychotherapy such as CBT might operate upstream from the amygdala, reducing phobic avoidance by deconditioning contextual fear learned at the level of the hippocampus and decreasing cognitive misattribution and abnormal emotional reactions by strengthening the ability to inhibit the amygdala. Prior use of medication in the current study may have influenced the limbic area independently of CBT, and may have affected the finding of no significant activity change in these areas. This result also suggests that CBT might be effective through inducing adaptive consolidation of the prefrontal cortex which exerts inhibitory control over the amygdala, rather than affecting it directly.,, CBT is a multicomponential intervention, but because clinical presentations vary considerably between patients, it is difficult to determine which component may be responsible for observed effects. Previous findings from intervention studies have shown the difficulty of directly linking their findings to prevailing models of underlying neural mechanisms. Prasko et al found no significant changes in brain metabolism in limbic regions after symptom alleviations by CBT and failed to detect different neural correlates between the treatment with CBT and with antidepressants. In the study by Kircher et al, there was a negative correlation between symptom severity and connectivity of the inferior frontal gyrus to the medial frontal cortex and anterior cingulated cortex after CBT. There was no significant interaction of group and time, suggesting that CBT might not have a specific impact on connectivity. These findings suggested that behavioral effects of treatment do not always correspond to neural findings. This study also has other limitations. The sample size was small, which restricts the statistical power and generality of the results. The results could not be confirmed as exact treatment effects of CBT because of the lack of proper control subjects such as a waiting list and/or nonspecific nonpharmacological treatment group. Lack of a control group could further limit the interpretation of the current negative findings for the correlation analysis between rCBF and each clinical measure. Because many subjects had been treated with medication prior to the CBT sessions, and although their medication was maintained without change during the study period, our results might represent not only the added effects of medication, but also novel results arising from the combination of both treatments. Although all subjects were in a resting state and tolerated the SPECT scanning well, anxiety during scanning was not assessed, and anticipatory anxiety may have affected the results of rCBF in the current study. The uncorrected -value threshold of 0.01 was applied in the present study. When the -value of 0.005 was tried, no significant rCBF change was found. Fundamental limitations, such as small sample size, maintenance of medication, imaging data acquisition during resting state but not during fear conditioning paradigm, and the lower resolution power of SPECT compared to MRI or PET are suggested to limit the detectability of the current study for the impact of CBT. Although threshold <0.01 uncorrected has been applied in several SPECT studies,, the low statistical power might increase the risk of false positive results. Future imaging studies should investigate functional changes in a placebo group, subjects treated only with medication, and subjects treated only with CBT, along with subjects receiving both treatments with high statistical power. Additionally, any correlations between the functional changes in the brain and different clinical measures for each treatment group and the changes by CBT for each of the drug-naïve subjects and the drug-discontinued subjects should be investigated.

Glaucoma is a leading cause of blindness globally, and reducing intraocular pressure (IOP) is the key to glaucoma management according to several large-scale clinical trials. Among the known IOP-lowering treatments, trabeculectomy is regarded as the standard surgical modality in cases refractory to medical and/or laser treatments. Reducing the IOP is related to the formation and maintenance of filtration blebs, and filtration blebs have been assessed clinically, using many imaging methods, such as slit-lamp examination, ultrasound biomicroscopy, and anterior segment photography.– Newer imaging technologies include optical coherence tomography (OCT), which is a useful tool for investigating the characteristics of filtration blebs.– Among the clinically applied OCT devices, three-dimensional anterior segment OCT (3D AS-OCT) is useful for identifying aqueous outflow channels and determining the morphology of the entire bleb (internal and external).– In our previous case series of patients who underwent bleb revision, we found that filtration openings could be identified using preoperative 3D AS-OCT. Therefore, we believe that 3D AS-OCT is useful for devising a strategy for postoperative management of filtration blebs created by trabeculectomy. In our investigation of the characteristics of filtration bleb surfaces and walls, we observed minor tear-fluid-like findings in 3D AS-OCT images related to the surface on or along filtration blebs. However, these findings were not identical to those of the known tear meniscus in terms of their length and localization, and differentiating tear fluid signs from the thin epithelium (and subepithelial connective tissue) on filtration blebs is important in clinical practice. In this study, we report the clinical characteristics of tear fluid signs on or along filtration blebs, as demonstrated by 3D AS-OCT and newly developed custom software. The ocular surface and the internal structures of the filtration blebs were assessed by 3D AS-OCT (Casia; Tomey, Nagoya, Japan): ≤10 μm (in tissue) axial resolution, ≤30 μm (in tissue) transverse resolution, 8 × 8 mm (scan type: Bleb) imaging field size, and 30,000 scans/second at an A-scan rate. For this assessment, a patient was asked to look down and the examiner used a finger to gently elevate the upper lid to expose the filtration bleb. The scan area was chosen to include the entire scleral flap and bleb. At least two scanning directions were used for each bleb, as horizontal and vertical rasters, and each raster consisted of 512 scans. We obtained a full 3D image of the filtration bleb using this method (). We used slit-lamp examinations and color photography of the anterior ocular segment to evaluate the appearance of blebs and then used 3D AS-OCT to assess internal bleb structures. On the basis of the appearance of blebs in color photographs of the anterior ocular segments, bleb wall transparencies were classified as high, moderate, or low when the scleral flap margin was clearly visible, partially visible, and invisible, respectively (). We used 3D AS-OCT and the associated software (Casia bleb assessment software, version 4.0L; Tomey) to measure bleb height, fluid-filled cavity height, bleb wall thickness, and intensity (optical density) of the bleb wall. We identified filtration openings by the presence of pits and/or troughs in fluid-filled cavities in both horizontal and vertical rasters, using the corresponding C-scan image of the scleral flap margins in the bleb, as described in our previous study. We selected a single cross-sectional image for each tear fluid sign, in which we observed the deepest fluid, from complete 3D images consisting of 512 scans. With the aid of the installed software, we measured the characteristics of the tear fluid signs: the thickness of the surface boundary signal, length of the cross-sectional surface, cross-sectional area, cross-sectional circumference, and depth of fluid (). We also assessed the lower tear meniscus of eight healthy volunteers by measuring the fluid characteristics with the aid of custom software as described earlier (). Last, we compared tear fluid signs associated with filtration blebs with lower tear meniscus signs. Numerical data are presented as means ± standard deviations (SD). Statistical analyses were performed using Student’s -test or the test. -values lower than 0.05 were considered to indicate a significant difference. We conducted a comparative study of the clinical backgrounds of the patients having eyes with tear fluid signs and those without the signs. In 45 eyes with tear fluid signs, the mean (±SD) IOP value was 11.0±4.9 mmHg, which was significantly lower than that in the remaining 107 eyes without tear fluid signs associated with filtration blebs (16.0±6.6 mmHg; <0.001). A significant difference was observed for sex of the patients in the two groups (=0.038). In contrast, the two groups showed no significant differences in age, laterality, etiology of glaucoma, previous cataract surgery, or design of conjunctival incision (). Color photograph assessments showed that 45 eyes with tear fluid signs had significantly more transparent filtration bleb walls compared with eyes without these signs (<0.001). In addition, filtration openings on the scleral flap were identified by 3D AS-OCT more frequently in eyes with tear fluid signs than in eyes without tear fluid signs (=0.010). Our quantitative analyses of the internal structures of filtration blebs showed that eyes with the tear fluid sign had more total bleb height (=0.005), more fluid-filled cavity height (=0.046), and lower intensity of the bleb wall (<0.001) compared with eyes without tear fluid signs. In contrast, no significant difference was observed in bleb wall thickness between the two groups (). Thus, our qualitative and quantitative studies suggest that bleb appearance is associated with the presence of tear fluid signs. In addition, the highly transparent blebs (15 eyes) in the photo-based classification had bleb walls of lower intensity, as measured by AS-OCT, compared with the other blebs (118.0 versus 148.5 optical density; =0.028), whereas other bleb parameters in AS-OCT images were not different between the groups. Our 3D AS-OCT measurements in eight healthy volunteers showed that the thickness of the surface boundary signal, depth of fluid, length of cross-sectional surface, cross-sectional circumference, and cross-sectional area of the tear meniscus sign in the lower eyelid (mean ± SD) were 41.4±1.2 μm, 351.5±107.3 μm, 178.8±56.3 μm, 1092.1±395.3 μm, and 39.0±22.1 × 10 μm, respectively. From these observations, we believe these signals to be tear fluid signs with the following criteria: thickness of the surface boundary signal of about 40 μm; smooth and curved (to the tissue side) surface line, similar to a suspension bridge with underlying empty dark space; and localization of the sign on or near the dents and steep skirt on the ocular surface (). The mean ± SD thickness of the surface boundary signal of tear fluid signs was 42.3±3.1 μm, which was similar to that of the tear meniscus signs in the eight healthy volunteers (41.4±1.2 μm; ). In addition, the ranges of the values were similar in the two groups (33–48 and 39–43 μm). In contrast, the depth of the fluid, length of the cross-sectional surface, cross-sectional circumference, and cross-sectional area of the tear fluid signs differed among the participants. Statistical analyses showed significant differences only in the length of cross-sectional surface of the tear fluid signs compared with the tear meniscus signs (=0.013), but not for other dimensions, probably because of the large SDs (). It is well known that maintenance and turnover of tear fluid on the ocular surface are quite important for protecting the cornea and conjunctiva while the eye is open.– This information seems to agree with our clinical experience with glaucomatous eyes that have functional filtration blebs. In addition, Soong and Quigley reported that the most important factor predisposing to dellen formation was poor tear film integrity adjacent to the bleb. Because vulnerability of the ocular surface to inflammatory disorders has been demonstrated in eyes with tear film dysfunction,, tear film integrity is hypothesized to also be important for the conjunctiva in glaucomatous eyes with functional filtration blebs because serious visual loss may result from bleb infection and subsequent endophthalmitis., Thus, developing a safe and noninvasive method of assessing tear film integrity in eyes with functional filtration blebs is important. The recent development of AS-OCT has enabled information on internal bleb morphology to be obtained in a noninvasive and safe manner., In the present study, our observations showed that 3D AS-OCT is a safe and useful tool for examining the ocular surface and internal structures in eyes with functional filtration blebs. We initiated this study because we had some cases with tear meniscus-like AS-OCT findings on and along filtration blebs. Wang et al reported detailed information on tear film and meniscus in human eyes obtained by AS-OCT., They demonstrated a mean tear film thickness of 4.9–6.8 μm that depended on blinking status. Because the resolution of OCT imaging is 10 μm, determining the exact tear film thickness in this narrow range on the central corneal surface is presumably difficult. In fact, to identify tear film on the central cornea by separating signals between the tear film and the corneal surface, Wang et al intentionally increased tear film thickness by means of topical administration of artificial tear fluid. In addition, the mean area of the lower tear meniscus in eyes with normal blinking was 26 × 10–31 × 10 μ, which is in agreement with our measurements immediately after eye opening (39.0±22.1 × 10 μm). When we compared the tear fluid signs in eyes with filtration blebs with the tear meniscus signs in healthy volunteers, the OCT images showed a similar surface boundary signal thickness of 33–48 μm. This similarity was expected because the surface boundary signal of the tear meniscus and tear fluid signs on the ocular surface are thought of as an artificial line indicating the transition phase of the emission light from the air to the fluid. In other words, we can measure the thickness of the surface boundary signal, but indeed no “thickness” is found in the transition phase on the actual ocular surface. In contrast, other measurements, such as the length of the cross-sectional surface, cross-sectional area, cross-sectional circumference, and depth of tear fluid varied depending on the morphology of the ocular surface. Our statistical analyses showed significant differences in IOP levels, transparency of the bleb walls, total bleb height, fluid-filled cavity height, and bleb wall intensity in the filtration blebs. These findings also support our hypothesis that the morphology of the bleb is an important factor for determining the characteristics of the tear fluid signs on the conjunctival surface in eyes with elevated and functional filtration blebs. Because bleb appearance is reportedly associated with filtration function in eyes after trabeculectomy, our results in this study were in good agreement with those of previous clinical studies of the surgical outcome of trabeculectomy.– The existence of the tear fluid sign on or along a filtration bleb may simply indicate retention of the tear on the bleb, depending on the bumpy structure of the filtration bleb. In this model, good IOP control is related to a bleb with bumpy structures, although the precise mechanism is unknown. In contrast, our recent study showed that the presence of transconjunctival oozing phenomena accompanied with a bleb wall of low intensity was associated with a reduction in IOP after trabeculectomy (unpublished data). Conceivably, the tear fluid sign may indicate the occurrence of transconjunctival oozing phenomena on the surface of the filtration bleb, and the existence of the tear fluid sign might relate to reduced postoperative IOP. Interestingly, a highly transparent bleb was observed more frequently in eyes with the tear fluid sign. Presumably, the high transparency reflected a thin and/or low-density bleb wall. Indeed the bleb wall intensity measured by AS-OCT was lower in highly transparent blebs in the present study. f o u n d t e a r f l u i d s i g n s o n o r a l o n g f i l t r a t i o n b l e b s i n A S - O C T i m a g e s , a n d t h e s e s i g n s d e p e n d e d o n b l e b m o r p h o l o g y . I n a d d i t i o n , t h e o c c u r r e n c e o f t e a r f l u i d s i g n s m a y b e r e l a t e d t o t h e p r e s e n c e o f f u n c t i o n a l b l e b s , w h i c h m a y t h e r e b y c o n t r o l t h e I O P .

xref #text A 15-year-old girl, accompanied by her parents, visited our outpatient clinic presenting with symptoms of suicidal behavior, irritability, and impulsivity. She was in her first year of high school and an only child. Her premorbid personality was calm and introspective. She underwent normal development, fulfilled her school responsibilities, and fulfilled her work obligations in a satisfactory manner. She had a fair relationship with her parents, and had neither a previous medicosurgical nor a neuropsychiatric history. One year previously, she had demonstrated hostility toward her parents because they had refused to let her study abroad. At that time, she developed suicidal impulsivity, such as attempting to jump from the twelfth floor apartment veranda. Eight months earlier, she began to argue frequently with a friend at her school. She became increasingly more irritable, and impulsive. After her private tutor criticized her inattentive behavior, she cut her wrist with a knife. After hospitalization, the patient was irritable, hostile, and impulsive. She was started on buspirone at 20 mg daily to decrease her symptoms. Physical examination, blood testing including a complete blood cell count, and an electroencephalogram were normal. However, she had subclinical hyperthyroidism as evidenced by a normal free T4 (fT4) (1.410 ng/dL), normal T3 (1.390 ng/mL), and low TSH (0.006 μIU/mL) in a serum thyroid function test (TFT). After 3 days, she demonstrated sweating and weight loss of about 4 kg. On the tenth day after admission, follow-up TFT revealed high fT4 (2.040 ng/dL) and low TSH (0.005 μIU/mL). These findings confirmed the clinical diagnosis of hyperthyroidism. We consulted with the endocrinology department, and an additional serum assay and thyroid scan were performed. This testing revealed elevated T3 (2.010 ng/mL), antimicrosomal antibody (79.400 IU/mL; normal range, <30.000 IU/mL), and thyrotrophin-binding inhibiting immunoglobulin (TBII) levels (8.410 IU/L; normal range, <1.750 IU/L) and a normal thyroglobulin Ab level (<20 IU/mL; normal range, <40 IU/mL) (). A Tc-99m thyroid scan showed mildly and diffusely enlarged thyroid glands with inhomogeneous uptake and warm or hot nodules at both lobes, suggesting nodular toxic goiter. The patient was started on methimazole at a dose of 10 mg daily while the buspirone (20 mg daily) was continued. About 7 days after starting the methimazole, the patient showed less irritability, improved impulse control, decreased distractibility, and exhibited no suicidal behavior. Follow-up TFT after 4 weeks of hospitalization revealed a decreased fT4 level (1.560 ng/dL), but it was still abnormal compared with the most recent test (). After 4 weeks of hospitalization, the patient was discharged. After discharge, she visited our psychiatric and endocrinological clinic routinely. She continued to be treated with 20 mg/day of buspirone and 10 mg/day of methimazole, and showed no irritability, impulsivity or suicidal behavior. This report describes a patient with irritability, impulsivity, and suicidal behavior with no physical symptoms. She was admitted to the psychiatric inpatient unit. After physical examination, she was initially diagnosed with subclinical hyperthyroidism that subsequently progressed to overt hyperthyroidism. Hyperthyroidism enhances the β-adrenergic receptor-mediated effects of catecholamines by increasing the density and sensitivity of the receptors in peripheral tissues as well as in the brain. Our findings are inconsistent with those of a relatively recent large cohort study in Sweden, which concluded that patients treated for hyperthyroidism did not have an increased risk of suicide. Overactivity of the adrenergic system may explain the similarity between the clinical presentations of hyperthyroidism and manic episodes or anxiety disorder. A notable feature of this case is that, despite the fact that her hyperthyroidism was subclinical, the patient had psychiatric symptoms of hyperthyroidism such as irritability, impulsivity, and suicidal behavior. These findings are consistent with reports showing that patients with subclinical hyperthyroidism have symptoms resembling those of patients with overt hyperthyroidism, with depression, anxiety, and physical symptoms., Therefore, although this patient’s serum TFT revealed subclinical hyperthyroidism, her psychiatric symptoms and thyroid function appeared to be closely correlated. The major antithyroid drugs are methimazole, carbimazole, and propylthiouracil. Their principal action is to inhibit the organification of iodide and coupling of iodothyronines, finally inhibiting the synthesis of thyroid hormones. Psychiatric medications such as lithium, antipsychotics, and anxiolytics can be used symptomatically and situationally. In the present case, we administered the anxiolytic buspirone to control the patient’s symptoms such as nervousness and irritability, and we added the antithyroid drug, methimazole after diagnosing the patient with overt hyperthyroidism. After 3 weeks of methimazole treatment, her serum thyroid hormones did not show remarkable change, with the exception of a mildly decreased fT4. However, the patient’s irritability, impulsivity, and suicidal behavior decreased along with the buspirone use. In conclusion we have reported a case of subclinical hyperthyroidism-related suicidal behavior. Based on our report and a literature review, subclinical hyperthyroidism should be considered as a possible cause of suicidal behavior.

sup xref #text Great expectations are pinned on the ongoing interventional trials aimed to demonstrate that CTCs might be of value for guiding treatment of patients and predicting cancer progression. The results of the SWOG S0500 trial were recently presented at the 2013 San Antonio Breast Cancer Symposium. This randomized Phase III trial was designed to test whether persistently high CTC levels after the first cycle of therapy could be used as an early indicator of disease progression and to determine whether switching at that early point to an alternate chemotherapy regimen would result in improved survival and time to progression among patients with metastatic breast cancer. The study confirmed the significant prognostic value of CTCs in the setting of metastatic breast cancer but failed to demonstrate the clinical utility of counting CTCs to evaluate the effectiveness of frontline chemotherapy in metastatic breast cancer patients. Consistently with previously published data, in this trial, patients could be separated into three groups with significantly different prognosis according to levels of CTCs at baseline and after the first cycle of therapy. The study revealed that patients with low baseline levels of CTC had a favorable prognosis, with an overall survival (OS) of 35 months, while an elevated baseline CTC count was associated with a poorer prognosis. Particularly, patients with continued elevated CTCs after one cycle of chemotherapy had the worst prognosis, with a median OS of 13 months, and patients with elevated CTCs at baseline that dropped below the threshold after the first cycle of therapy had an intermediate OS of 23 months. To test the initial hypothesis, patients who maintained elevated CTC levels 21 days after initiating therapy were randomized either to continue their chemotherapy or to switch to a different, potentially more effective, regimen chosen by the physician. Prior hormonal therapy, bisphosphonate therapy, and targeted therapies for metastatic disease were allowed and were unchanged regardless of CTC levels. One could argue that the design of the study, as previously summarized, might have jeopardized the benefit that switching chemotherapy based on CTC levels might have provided. Furthermore, as the classification of breast cancer has evolved from a single disease to well established molecular subgroups, stratification of patients and therapy selection according to breast cancer subtypes would have been advisable. The idea that the number of CTCs, serially assessed under treatment, might reflect the effectiveness of chemotherapy and predict disease progression early before clinical and radiological evidence is undoubtedly appealing. Although previous studies have demonstrated that CTC assay is indicative of disease progression earlier than conventional imaging, the ability of CTC values at the time point of 3 weeks after starting therapy to assess treatment response has never been explored before. The effect of the type of anticancer therapy on the prognostic and predictive value of CTCs has not been directly evaluated in the published studies assessing the clinical utility of CTC counting. Particularly, data are not conclusive on the ability of targeted therapies to modify the predictive value of CTC count during therapy. The heterogeneity of first-line treatments allowed in the SWOG S0500 trial might thus have variably influenced CTC behavior. Fluctuations in CTC levels over the course of different therapies prompt caution in interpreting the changes in CTC number soon after (3 weeks) the start of therapy as a biological marker for response to treatment. To fill the gap between theory and practice with regards to the clinical utility of CTC, a bridge is needed, taking into account a number of strategies, as hereunder reported. The assessment of CTC changes as early markers for resistance to treatment is currently being investigated in the CirCe01 trial, where patients with high CTC count before the start of the third line of chemotherapy will be randomized between the CTC-driven arm and the standard arm. In the latter, CTC count will be performed after each first cycle, and patients whose CTC count will not drop under the cutoff value will be taken off the therapy and eventually given a further line of treatment, which will be again evaluated by CTC changes after the first cycle of therapy. The trial is based on the assumption that CTC count might detect earlier chemoresistance and promote early chemotherapy changes. To demonstrate the clinical utility of CTCs in driving therapeutic decisions for metastatic breast cancer patients, one could anticipate that results from the CirCe01 trial should be moved from a very palliative to a frontline setting. From a theoretical point of view, it is reasonable that in the first-line setting, the discontinuation of a targeted therapy inhibiting an oncogenic pathway may enhance biological activity in a significant fraction of malignant cells. This suggests caution in considering repeated early discontinuation of therapy as a strategy to improve patient outcome, supporting the idea that this approach might offer a modest improvement in the treatment of resistant breast cancer. Insights into tumor biology and, particularly, into the mechanisms underlying sensitivity and resistance to anticancer treatments, come from the molecular characterization of CTCs. The availability of a readily accessible source of biological material might allow the monitoring of the dynamic clonal evolution of cancer and to guide the selection of therapy towards the dominant target. The difference between CTCs and their corresponding primary tumor with respect to human epidermal growth factor receptor 2 (HER2) status has been previously reported. In particular, the occurrence of HER2-positive CTCs in patients with HER2-negative primary breast cancer might be of potential clinical value. The DETECT III trial is the first study where treatment choice is made according to the phenotypic characterization of CTCs. This ongoing trial has been designed with the aim to evaluate the clinical efficacy of lapatinib, a dual inhibitor of ErbB1 (EGFR [epidermal growth factor receptor]) and ErbB2 (HER2) receptor tyrosine kinases, in HER2-negative metastatic breast cancer patients with at least one HER2-positive CTC. To enroll the predefined sample of patients, more than 1,000 patients will be tested for the presence of HER2-positive CTCs. This will prevent the disappointing results obtained from a previously published Phase II similar trial that reported inconclusive efficacy results due to the limited number of eligible patients. A critical analysis of the study design might raise the question whether the selected cutoff of at least one HER2 positive CTC is appropriate in the metastatic setting in order to accurately identify a subgroup of HER2-negative breast cancer patients who may derive benefit from anti-HER2 therapies. A further approach to demonstrate the clinical relevance of CTCs to guide the management of metastatic breast cancer patients is to combine the prognostic information derived from the counting of CTCs with their molecular characterization for tumor markers that predict endocrine sensitivity and resistance. A multi-parameter assay, the CTC-Endocrine Therapy Index (CTC-ETI), has been recently developed that may identify patients with estrogen receptor (ER)-positive metastatic breast cancer who are unlikely to benefit from endocrine therapy. Using the fourth empty filter in the CellSearch system, ER, BCL-2, HER-2, and Ki-67 as markers for endocrine responsiveness/resistance can be accurately determined and combined with the number of CTCs to calculate the CTC-ETI. A multicenter trial has been recently opened in an attempt to demonstrate that CTC-ETI at baseline predicts response to endocrine therapy in metastatic breast cancer patients starting a new endocrine therapy. The idea of generating a therapeutic algorithm that combines the well-established prognostic value of the CTC count and the expression of predictive markers on CTCs for endocrine resistance seems intriguing and might provide, if validated, a new valuable criterion for choosing between endocrine therapy and chemotherapy for ER-positive metastatic breast cancer patients. CTC characterization may also accelerate the drug development process. The COU-AA-301 trial is the first Phase III study aimed to prospectively evaluate CTC counting as an outcome measure for regulatory approval of a new therapeutic option for metastatic castration-resistant prostate cancer patients previously treated with docetaxel. The COU-AA-301 Phase III trial demonstrated that abiraterone acetate, an irreversible inhibitor of the CYP17 enzyme for androgen synthesis, significantly prolongs OS in metastatic castration-resistant prostate cancer patients progressing after docetaxel therapy. CTC conversion from an unfavorable to favorable count (using the standard cutoff definition of ≥5 CTCs per 7.5 mL) demonstrated a statistically significant impact on OS, suggesting a key role of CTC serial assessment as predictor of survival outcome. According to the first CellSearch training book, a CTC is characterized by positivity for epithelial cell adhesion molecule (EpCAM), cytokeratins (CKs), and nuclear dye (DAPI [4′,6-diamidino-2-phenylindole]); all objects with delineated nuclear image but speckled CK, as well as objects with cytoplasm area which does not surround the nucleus, are defined as “suspicious objects” and are not counted by the operator as CTCs. To date, the significance of these cells is not clear. The predictive values of all types of suspicious objects were first evaluated in a report by Coumans et al in a follow-up study performed on 179 patients with castration-resistant prostate cancer. In that study, to evaluate the relationship between different classes of objects and OS, the authors imported the images into the Linux-based software for the CellTracks Analyzer II (Janssen Diagnostics) and used the automated algorithm to identify and reanalyze all objects EpCAM+, CK+, and/or DAPI+. On the basis of morphological and size criteria, the authors established four classes of objects: intact CTCs, granular CTCs, large and small tumor cell fragments (which required the presence of a nucleus or DNA [deoxyribonucleic acid] staining), and large and small microparticles without DNA. The standard size of CK stain was 4×4 μm as applied in the CellSearch CTC definition, and consequently, the definitions of small and large suspicious objects were adopted. The authors found that all EpCAM+, CK+, and CD45− objects predicted OS in this cohort of patients. In 2011, our group performed the CellSearch analysis on blood from 25 patients with metastatic renal cell carcinoma and found CTCs in only 16% of patients. In most CTC-negative patients, we found images of CD45−/CK speckled nucleated objects, or images of CD45− objects with CK signal not surrounding the nucleus, corresponding to the “suspicious objects” described in the CellSearch instruction book. This report was the first to suggest that the low number of CTCs detected through CellSearch in renal cell carcinoma may be due to the presence of a CTC population with atypical characteristics and a peculiar gene expression profile, mainly due to the presence of a speckled CK signal. It has become clear that, by looking only at EpCAM, tumor cells from other major cancers, like melanoma or pancreatic cancer, as well as cells with stemness characteristics, will escape detection through CellSearch. Besides EpCAM downregulation, the absence or low expression of CKs should be also taken into account as contributing to CTC underestimation using CellSearch. Studies performed in breast cancer patients further suggest that the inability of CellSearch to detect cells which have undergone epithelial mesenchymal transition may explain the absence of CTCs in a subset of patients with metastatic breast cancer with documented progression of the disease. To overcome these pitfalls, Veridex, LLC (Raritan, NJ, USA) in 2011 started working, in collaboration with Massachusetts General Hospital, on next-generation CTC technology which could enhance specificity and sensitivity and enable more extensive characterization of captured cells. In 2013, Ozkumur et al described an inertial focusing–enhanced microfluidic CTC capture platform, termed “CTC-iChip”, capable of sorting, from large volumes of whole blood, rare CTCs with both epithelial and non-epithelial characteristics. The new technology combines the strengths of microfluidics for rare cell handling while incorporating the benefits of magnetic-based cell sorting. The new system can be run in either a positive selection or a negative depletion mode. The posCTC-iChip was tested in patients with prostate, breast, colon, pancreatic, and lung cancer, showing a very high sensitivity, particularly critical in patients with a lower CTC burden. Furthermore, the iChip isolates cells in suspension, enabling their immobilization on a standard glass slide for high-resolution imaging and standard clinical cytopathological examination as well as simultaneous staining for multiple biomarkers. The negCTC-iChip allowed for isolation of CTCs from a non-epithelial cancer, such as melanoma, and from cancer that has undergone epithelial mesenchymal transition and lost virtually all detectable EpCAM, such as triple-negative breast cancer, providing a comprehensive and unbiased view of non-hematological cells in the bloodstream of cancer patients. In the direct comparison between the posCTC-iChip and the CellSearch system, the microflu-idic device was significantly more sensitive at low CTC numbers, suggesting that a subpopulation of EpCAM-low cells was missed by the CellSearch bulk-processing approach. The integrated microfluidic technology platform enables the isolation of CTCs, regardless of tumor surface epitopes, and provides an end product that is compatible with both standardized clinical diagnostics and advanced molecular analyses. The future integration of such an economical chip into a fully automated device would potentially allow broad dissemination of this technology. There is an additional channel in the standard Veridex CTC kit which may allow the examination of a fourth molecule of interest. To date, this channel has been extensively used to study the apoptotic status of CTCs; for this purpose, CTC assay was integrated with a monoclonal antibody, anti-M30, to recognize a neoepitope in CK-18 that becomes available at a caspase cleavage event during apoptosis and is not detectable in vital epithelial cells. The M30 neoepitope is generally regarded as a stable biomarker, specific for epithelial cell apoptosis. Rossi et al analyzed M30 expression in breast, colorectal, and renal cancer patients; furthermore, in a small series of breast cancer patients, the change in the number of M30-negative/positive CTC balance was found to correlate with radiologic findings of disease status (progressive versus stable disease/partial response). Recently, Smerage et al reported the integration of two potentially important cellular markers of breast cancer outcome, M30 and Bcl-2, to detect CTC. They demonstrated that these markers can be monitored at baseline in patients with metastatic breast cancer, within a few days of initiation, and at first clinical follow-up after initiation of a new systemic therapy. The authors reported that 40% and 60% of CTC were apoptotic and expressed Bcl-2 at baseline, respectively, and that CTC levels at baseline were inversely related to the degree of apoptosis; they concluded that CTC-phenotyping through the fourth CellSearch channel may predict clinical outcome beyond the mere counting of CTCs. Hou et al reported the behavior of an integrated panel of cell death biomarkers (M30, M65, and nucleosomal DNA), using the fourth channel of CellSearch in patients undergoing standard chemotherapy for small cell lung cancer, and concluded that both blood-borne cell death biomarkers and CTCs have the potential to enhance drug development as pharmacodynamic biomarkers in this tumor type. Robust biological evidence on disseminated and CTC as surrogate for micrometastatic disease led to the introduction for the first time in the AJCC (American Joint Committee on Cancer) breast cancer staging manual (7th edition) of the cM0(i+) category, formally defined as deposits of molecularly or microscopically detected tumor cells in circulating blood, bone marrow, or other non-regional nodal tissue in the absence of clinical or radiographic evidence of distant metastasis. Therefore, after substantial confirmation of the prognostic and predictive value of CTCs in the metastatic setting, the detection and characterization in the early stage of cancer have become a major focus of translational cancer research. Detection of CTCs as a surrogate marker of early dissemination of cancer might have future application in early stage cancer patients for refining prognoses, monitoring response to treatment, and providing molecular characterization of residual disease after systemic therapy. Few studies have investigated the clinical significance of CTC in non-metastatic colorectal cancer.– Although preliminary results seem promising, no clear conclusion can be drawn from the published data due to the heterogeneity of study designs and CTC detection methods. The reported number of detectable CTCs in patients with stage I–III colo-rectal cancer is greatly variable, most likely due to the different detection methods (mainly immunological techniques and PCR [polymerase chain reaction]-based techniques) used in the studies. A prospective single-institution study published in 2008 by Sastre et al investigated whether a significant correlation exists between the presence of CTCs and clinic-pathological variables in colorectal cancer. A mixed population of 94 patients with early stage and metastatic colorectal cancer was enrolled. Blood samples were collected postoperatively, immediately before starting any adjuvant or palliative chemotherapy. The overall detection rate of CTC was 36.2%, and a significant correlation was demonstrated between the presence of CTC and the stage of disease, independently of the threshold used (≥2 CTCs per 7.5 mL of blood and ≥3 CTCs per 7.5 mL of blood). Particularly, the presence of at least 2 CTCs in 7.5 mL of blood could be detected in almost a quarter of patients with stage II or III colorectal cancer, without significant differences between the two groups (20.7% in stage II, and 24.1% in stage III). In a second prospective study published in 2009 by the same research group, a heterogeneous large population of breast, colorectal, and prostate cancer patients at any stage was evaluated for the presence of CTCs. Blood samples were collected again before the administration of any systemic therapy. Overall, 31.5% of patients had ≥2 CTCs per 7.5 mL of blood. The number of CTCs detected by the CellSearch analysis was significantly higher (62.3% versus 14.0%) in metastatic patients compared with earlier stages of disease, and no differences were found among the three tumor types included in the analysis. A single-center study aimed to detect CTCs in the peripheral blood of patients with stage I–III colon cancer reported a 5% detection rate of ≥2 CTCs per 7.5 mL in preoperative samples from non-metastatic colorectal cancer patients. The authors further reported that none of the postoperative blood samples had CTC levels above the cutoff value. In a short report recently published by our own research group, a homogeneous population of high risk stage II or stage III colorectal cancer patients was prospectively evaluated for the presence of CTCs prior to adjuvant therapy. In this highly selected population of patients, CTCs were detected in 8 out of 37 (22%) patients. The study confirmed the significant correlation between the presence of CTCs and the stage of disease, and for the first time, to our knowledge, demonstrated a higher CTC detection rate in high-risk stage II colorectal cancer compared with low-risk stage II, suggesting that the detection of CTCs through CellSearch in the non-metastatic setting of disease may allow the identification of stage II candidates for adjuvant chemotherapy and the selection of stage III patients for more- or less-aggressive approaches. Globally, a relevant number of patients with early or locally advanced breast cancer were evaluated for the presence of CTCs in different studies. More than 2,000 patients were enrolled in the randomized Phase III SUCCESS study. Nearly 22% of patients presented ≥1 CTCs per 23 mL of blood before the start of systemic treatment. The presence of CTCs before systemic treatment was an independent predictor of poor disease-free survival (DFS) and OS. Furthermore, the persistence of ≥1 CTC after adjuvant chemotherapy resulted in a decreased DFS, and the persistence of ≥5 CTCs was associated with decreased OS. Two recent studies reported the prognostic value of the presence of CTCs at the time of primary surgery in stage I–III breast cancer patients in a series of 404 patients. Franken et al reported the presence of ≥1 CTC in 30 mL before curative surgery in less than 20% of patients and demonstrated that the detection of CTCs preoperatively is associated with an increased risk for breast cancer-related death and DFS. Similarly, Lucci et al reported that the presence of ≥1 CTC per 7.5 mL of blood, which was demonstrated in 73 of 302 (24%) patients, predicts early recurrence and decreased OS in chemo naïve patients with non-metastatic breast cancer. The prognostic impact of CTC detection in non-metastatic breast cancer patients has been extensively evaluated in the neoadjuvant setting. Two neoadjuvant Phase III German trials included the analysis of CTCs in their experimental design. In the GeparQuattro trial, the presence of ≥1 CTC per 7.5 mL was detected in 21.6% of patients. CTC detection did not correlate with primary tumor characteristics, and the decrease of CTC during treatment was not correlated with tumor response to neoadjuvant therapy. A similar detection rate (≥1 CTC per 15 mL of blood in 22.5% of patients) was demonstrated in a subanalysis of the Phase III neoadjuvant therapy GeparQuinto trial including 419 patients. Significant decreases in CTC incidence and number per patient were observed during therapy, inversely to changes observed in circulating endothelial cell count, performed in parallel to CTC. The authors further confirmed the previously reported significant discrepancy between the HER2 status of CTCs compared with the corresponding primary tumor. The recently published updated results from the French REMAGUS02 study confirmed that the pre-chemotherapy detection of ≥1 CTC per 7.5 mL is associated with shorter distant metastasis-free survival and OS in breast cancer patients receiving neoadjuvant chemotherapy and that CTC detection has a negative impact on survival, even though this seems to be limited mainly to the first 3–4 years after the primary treatment. Preliminary studies have aimed to investigate the potential prognostic value of CTCs in patients with early bladder cancer. Naoe et al, who first investigated CTCs in urothelial cancer using CellSearch, reported CTC presence in 57.1% of patients with distant metastasis but no CTCs in patients with localized disease. More recently, Rink et al published a prospective study aimed to investigate the biologic and clinical significance of CTCs in patients with clinically non-metastatic bladder cancer using CellSearch. The authors found CTCs in 23% of patients and demonstrated that the presence of even a single CTC conferred a worse prognosis in terms of disease recurrence and cancer-specific and overall mortality. Similar results were obtained by our group in a selected population of non-muscle invasive bladder cancer patients, suggesting that in this very early setting of disease, CTC counting through CellSearch may allow the selection of patients with high risk of progression, and the identification of candidates for more aggressive treatments. To date, small sample size is one of the major drawbacks of the studies aimed at investigating the prognostic and predictive significance of CTC counting in early stage cancer as well as in tumor types other than metastatic breast, colon, and prostate, where CellSearch has not been validated for use in diagnostic procedure. So far, many clinical studies have focused on CTC counting in guiding prognosis in metastatic cancer patients. Nevertheless, much effort is still needed to answer the question of whether CTCs represent a potential surrogate marker for clinical endpoints. Since the CellSearch system was cleared by the FDA for CTC-based cancer diagnosis, its potential clinical utility is still to be fully demonstrated. So far, no large prospective studies have shown any predictive value for CTCs, and their clinical utility is therefore limited. The effect of the type of treatment on the prognostic and predictive value of CTCs has not been directly evaluated, and the ability of targeted therapies to modify the predictive value of CTC count has not yet been demonstrated. Furthermore, it is questionable whether results from trials lacking stratification of patients on the basis of molecular subtypes will be able to influence routine clinical practice specifically referring to the management of metastatic breast cancer patients. On the other hand, the prognostic significance of CTC counting cannot be neglected. Bidard et al recently published the first European pooled analysis on clinical validity of CTC in 1,944 metastatic breast cancer patients treated between 2003 and mid-2012 in 17 centers. To date, this is the largest pooled analysis to assess the clinical validity of CTC count by the standardized CellSearch technique. More than five CTCs per 7.5 mL at baseline were found in 47% of patients and were associated with shorter progression-free survival and OS. CTC changes after 3–5 and 6–8 weeks were also associated with progression-free survival and OS. Survival prognostications were significantly improved by adding CTC count at baseline to the clinicopathological models, while CEA (carcinoembryonic antigen) and CA15-3 (cancer antigen 15-3) levels at baseline and during therapy did not add further significant information. These results indicate that CTC counting may now be considered as having reached the highest level of evidence for clinical validity in metastatic breast cancer patients for prognostic purposes. Until CTCs are demonstrated as markers of early resistance to medical treatments, thus allowing an early switch of therapy with a demonstrated improved OS or DFS of patients, Heaven can wait.

xref italic #text The methodology consisted of a retrospective case review of idiopathic AA cases seen in the Department of Hematology (by two of us: JWL, SAY), The Catholic University of Korea from 1981 to 2011. Idiopathic AA is a diagnosis by exclusion, after ruling out secondary bone marrow aplasia from various entities (neoplasms, chemotherapy, and others). AA was diagnosed based on bone marrow findings (hematopoietic cells <30% of residual cells) and blood count with at least two of the following: hemoglobin <10 g/dL, platelet count <50×10/L, and neutrophil count <1.5×10/L. Correlation was done using Student’s -test or nonparametric tests for small sample sizes with a -value <0.05 being considered significant. The -value was computed from a 2×2 contingency table using two-tailed Fisher’s tests. Of the 719 AA patients, 269 patients had eye examinations and 37 patients of the 156 patients who underwent funduscopy by one of us (KSK) had retinal abnormalities (retinal hemorrhages: 23.7%; –). There was no protocol to perform ocular examination during the study period. We tried to correlate the presence of retinal hemorrhage with age, lowest hemoglobin, lowest platelet, concomitant low hemoglobin and low platelets, and other variables (). The lowest hematocrit or hemoglobin refers to the lowest value on record in case of negative retinal finding or to the value of the blood parameter at the first detection of retinal hemorrhage. In these 37 patients, median initial visual acuity was 6/9.5 in the right eye and 6/10 in the left eye (range: counting finger 30 cm –6/6). Median final visual acuity was 6/6 in either eye on last follow-up (range: 6/300–6/6). Follow-up varied from 2–146 months with a mean of 64 months (median 59 months). These 37 patients were studied in detail (): seven had unilateral retinal hemorrhages and 30 had bilateral retinal hemorrhages; the mean age was 34.5 years (range: 16–69) with 25 men and 12 women; the mean lowest hemoglobin level was 6.6 g/dL (range: 2.7–12.6 g/dL); and the mean lowest platelet count was 18.8×10/L (range: 4×10/L– 157×10/L); central retinal vein occlusion-like picture occurred in nine patients and these had similar rheology to the remaining 28 subjects (hemoglobin level 6.8 g/dL versus [vs] 6.5 g/dL, =0.8; platelet count 32×10/L vs 14,300×10/L, =0.3); optic disc edema, cotton wool spots, macular edema, and dry eyes occurred in two, three, five, and three patients, respectively; seven patients died and these had low hemoglobin levels (hemoglobin level 5.4 g/dL vs 6.8 g/dL, =0.1), significantly low platelet count (platelet count 8.3×10/L vs 21.2×10/L, =0.03), and significantly low hemoglobin level times platelet count (470,400 g/mL vs 1,850,700 g/mL, =0.04). In this group of subjects with retinal hemorrhage, the etiology of AA was idiopathic (34 cases), autoimmune (one case), virus-induced (one case), and syndromic (one case of paroxysmal nocturnal hemoglobinmuria [PNH]). Systemic diseases included diabetes mellitus (four cases), hypertension (two cases), rheumatic disease (one case), autoimmune disease (one case), hepatitis B (two cases), IgA nephropathy (one case), goiter (one case), and PNH (one case). The mean heart rate was 85.5 bpm (50–124). Systemic bleeding occurred in five patients (13.5%), including gingival hemorrhage in four patients. Superinfection occurred in four patients (10.8%). A single patient with central retinal vein occlusion-like picture underwent surgical intervention (intravitreal injection of tissue plasminogen activator combined with perfluoropropane gas injection). Therapies included blood immunotherapy based on antithymocyte globulin (ATG) regimen in combination with cyclosporine in 33 cases. The variables in 104 consecutive AA patients who had “normal” funduscopy (no retinal hemorrhages) were analyzed (). Unrelated findings included: diabetic retinopathy, glaucoma, cytomegalovirus retinitis, or exotropia (three cases each), preeclampsia, or epiretinal membranes (two cases each), central serous retinopathy, epiretinal membranes, uveitis, hypertensive retinopathy, or retinal macroaneurysms (one case each). Follow-up varied from 3–367 months with a mean of 125 months (median 123 months). The mean age was 30.3 years (range 1–76 years). The mean lowest hemoglobin level was 6.7 g/dL (range: 2.3–12.9 g/dL) (similar to the group of 37 patients with retinal hemorrhage) and the mean lowest platelet count was 25.3×10/L (range 1–287×10/L). Thirteen deaths occurred in the series. In these subjects without retinal hemorrhage, the etiology of AA was idiopathic (96 cases), drug-induced (three cases), virus-induced (three cases), and genetic or syndromic (two cases). Systemic diseases included diabetes mellitus (nine cases), hypertension (one case), rheumatic disease (three cases), chronic renal failure (two cases), angina, congestive heart failure, subacute thyroiditis, paroxysmal supraventricular tachycardia, hepatitis B, and hepatitis C in one case each. Systemic bleeding occurred in 30 patients (28.8%) with gingival hemorrhage in eight patients. Superinfection occurred in 22 patients (21.2%), including one case of sepsis. Therapies included blood transfusions (13 cases) and immunotherapy based on ATG (80 cases) (). The two groups (with and without retinal hemorrhage) did not differ in terms of rheology and immunotherapy (ATG intake). Superinfections were more commonly encountered in the group without retinal hemorrhage (). In the total of 141 patients with funduscopy (and complete clinical data), 35 (24.8%) had systemic bleeding, 37 (26.2%) had retinal hemorrhage, and a total of 67 (47.5%) had any bleeding in the retina or elsewhere. Systemic bleeding occurred in 30 patients with combined anemia and thrombocytopenia and five patients not belonging to this group, but this was not significant compared to the group who did not experience systemic bleeding (=0.17). Patients with either retinal hemorrhage or systemic bleeding did not differ from patients without any bleeding regarding platelet and hemoglobin status (=0.55). Also, bleeding can also occur in the context of PNH (rare syndrome of aplastic anemia, hemolysis, and thrombosis) and a single case was found in the current study (a 27-year-old man with bilateral retinal hemorrhages, 6/6 vision, no sign of retinal venous stasis, perianal abscess, hemoglobin of 6.6 g/dL, and platelet count of 11×10/L). A literature review ()– is also presented from 1958 to 2010 of cases with AA not receiving any surgical therapy (such as bone marrow transplant). We searched Medline and Scopus from 1958 to 2010 for cases written in English, French, or Spanish with aplastic anemia (excluding secondary to chemotherapy or leukemia or metastatic carcinoma) that received medical therapy (excluding bone marrow transplant) and had one of the following ocular findings: dry eye, conjunctival hemorrhage, lid hematoma, orbital hemorrhage, retinal hemorrhage, central retinal vein occlusion, vitreous hemorrhage, subhyaloid hemorrhage, cotton-wool spots, and optic neuropathy. We also present in a table form the clinical findings collected in eight unreported cases from the four collaborating medical centers outside Korea () (after Institutional Review Board approval). A literature review of ocular findings in 200 patients with idiopathic AA that did not receive surgical treatment (bone marrow transplant) emphasizes the most common reported manifestations: retinal hemorrhages in 56%, subhyaloid or vitreous hemorrhage in 9%, peripheral retinal vasculopathy in 5.5%, cotton-wool spots, Sjögren’s syndrome, and optic disc edema in 4% each. The prevalence of retinopathy among reported series (not case reports) of AA patients varied from 20% to 28.3% (these figures are consistent with the finding of 23.7% of retinal hemorrhages in the Korean series). The current series involves one subtype of anemia (idiopathic AA prior to surgical intervention), while the literature is a mixture of anemias of various etiologies (malaria, hookworm, nutritional, cirrhosis, leukemia, cancer, postpartum hemorrhage, duodenal ulcer rupture, tuberculosis, cyanotic heart disease, sickle cell anemia, thalassemia, lupus, and chronic renal disease)– and the confounding pathology severely limits the conclusions of these studies. Concomitant severe anemia and thrombocytopenia in a mixture of hematologic entities was found to be important risk factors for developing retinopathy.– Merin and Freund found a 22% prevalence of retinopathy among anemic patients, similar to the 20% prevalence found by Aisen et al and 28.3% prevalence published by Carraro et al. Rubenstein et al found a 44% prevalence of retinopathy in 67 patients with concomitant anemia and thrombocytopenia. In the series by Carraro et al involving 33 subjects, retinopathy was observed in 28.3% of the patients as a whole, with the presence of fundus lesions being closely associated with severe anemia (hemoglobin <8 g/dL) and severe thrombocytopenia (platelet count <50×10/L). Among the patients with concomitant anemia and thrombocytopenia, the incidence of retinopathy was 38%. A prospective study was conducted to evaluate the prevalence and severity of ocular lesions in dogs with anemia (packed cell volume≤20%) and/or thrombocytopenia (platelet count <150×10/L). The dogs were divided into four groups: 1) anemic (n=17); 2) thrombocytopenic (n=36); 3) anemic and thrombocytopenic (n=24); and 4) healthy controls (n=26). The prevalence of ophthalmic lesions in these four groups was 12%, 42%, 42%, and 0%, respectively. Anemia was not associated with the presence of ocular lesions or their severity. Thrombocytopenia was significantly associated with the presence of ocular lesions and with their severity. #text The main physiologic role of red blood cells is to deliver oxygen to the tissues. Physiologic adjustments to compensate for the lack of oxygen delivery in AA include: 1) increased cardiac output; 2) shunting of blood to vital organs; and 3) increased 2,3-diphosphoglycerate in the red blood cells, which causes reduced oxygen affinity, shifting the oxygen dissociation curve to the right and thereby enhancing oxygen release to the tissues. The clinical effects of anemia depend on its duration and severity. When anemia is acute, the body does not have enough time to make the necessary physiologic adjustments, and the symptoms are more likely to be pronounced and dramatic like cotton-wool spots or non-arteritic anterior ischemic optic neuropathy. In contrast, when anemia develops gradually, the body is able to adjust, ameliorating the symptoms relative to the degree of the anemia. In order to compensate for the low oxygen carrying capacity, there is elongation and dilatation of the retinal venous system with turbulent and enhanced flow. This places the endothelium under stress: ischemia, dilatation, and turbulence, leading to bleeding diathesis inside the eye. Valsalva maneuvers and ocular rubbing enhance intraocular bleeding. The occurrence of macular edema in AA may be related to ischemia, venous impedance (central retinal vein occlusion-like picture), and increased vascular endothelial growth factor in AA. The occurrence of opportunistic infections relates to the immunocompromised status of subjects with AA, with reports of nocardial choroidal infiltration, cytomegalovirus retinitis, and orbital infiltration from adjacent sinus aspergillosis.– Disc edema is multifactorial in AA. Besides cerebral vascular thrombosis, raised intracranial pressure may result from cerebral hypoxia and cerebral edema, both secondary to low hemoglobin levels and inadequate oxygen-carrying capacity associated with decreased iron-dependent enzymes. It is also possible that low hemoglobin levels may result in increased cerebral blood volume, thereby producing intracranial hypertension. Severe anemia is occasionally accompanied by a hypercoagulable state and has been associated with venous and arterial cerebral thrombosis in numerous reports. There is a decrease in blood viscosity in AA, and hence it is expected that this state is protective against hypercoagulability. However, there is paradoxical hypercoagulability in some severe AA cases in the context of associated infections, acute bleeding, intravascular hemolysis, or use of cyclosporine, often resulting in a disseminated intravascular coagulopathy state., This paradox is similar to the paradox of bleeding tendency in some patients with thrombocythemia. Hence, the mechanism of coagulation activation in some cases of AA is likely to be multifactorial as described in the Russian literature., The increased cardiac output, increased turbulence of flow, and stretch of the blood vessel lumen in AA lead to vascular endothelial activation, increased proinflammatory cytokines, increased thrombin and fibrin generation, increased tissue factor activity, and increased platelet activation. Some of these AA patients appeared to have disseminated intravascular coagulation syndrome with serious rheological shifts and hemorrhagic diathesis. Additional causes for disseminated intravascular coagulopathy include the use of ATG (the standard medical therapy for AA), as well as severe infections or sepsis often seen in AA. Also, PNH can be associated with disseminated intravascular coagulopathy (DIC). Around fifty percent of patients with AA have expanded populations of PNH cells, as detected by flow cytometry, hence the theoretical increased risk for thrombosis and DIC in AA. Acute control of severe bilateral visual loss necessitates red blood cell and or platelet transfusion with all the known risks. Visual recovery occurs after blood transfusion.,,– Gupta et al presented a 20-year-old pregnant woman at 20 weeks of gestation who had sudden visual loss to the level of hand motion in the right eye. The right eye had subhyaloid hemorrhage and disc edema. She received multiple blood transfusions. Upon delivery, the ocular findings were found to have regressed and there was visual recovery to the level of 6/15. In the long-term management of AA patients, immunosuppressive therapy with anti-thymocyte globulins (ATG) and cyclosporine or stem cell transplantation has enhanced the survival of patients with AA. Immunosuppressive therapies are most widely used because of a lack of histocompatible sibling donors and immediate cost of surgery. Although small preretinal hemorrhages improve spontaneously, the presence of a large amount of blood may cause permanent macular changes before it resolves. Posterior hyaloidotomy enabled rapid resolution of premacular subhyaloid hemorrhage, thereby restoring vision (especially in bilateral involvement) and preventing the need for vitreoretinal surgery. Pars plana vitrectomy can be performed in eyes of patients for non-clearing vitreous hemorrhage after receiving immunosuppressive therapy, including cyclosporine and anti-thymocyte globulin, and platelet and blood transfusions. Pars plana vitrectomy resulted in functional and anatomic success in the majority of eyes operated on by Agarwal et al. Coordination of medical and surgical care with the hematology service is strongly advisable to stabilize hematologic parameters prior to undertaking a vitreoretinal procedure. The role of antivascular endothelial growth factor agents is promising due to the markedly increased blood vascular endothelial growth factor in AA and the likely increase in intraocular vascular endothelial growth factor with the setting of retinal ischemia. Finally, we need to mention the prophylactic role of avoiding Valsalva and ocular trauma, although mild aerobic exercises in mild AA cases can be tolerated. e c u r r e n t r e t r o s p e c t i v e r e v i e w o f a K o r e a n s e r i e s a n d c o l l e c t i v e c a s e r e p o r t s h a s i t s l i m i t a t i o n s . M o r e o v e r , r e v i e w o f t h e l i t e r a t u r e i s a l s o l i m i t e d b y a s e l e c t i o n b i a s t o w a r d s s e v e r e c a s e s , o f t e n w i t h u n u s u a l o u t c o m e . P r o s p e c t i v e s t u d i e s a r e n o t f e a s i b l e d u e t o t h e e x t r e m e r a r i t y o f t h e d i s e a s e u n d e r s t u d y . H e n c e , w e n e e d t o a n a l y z e t h e d a t a a t h a n d w i t h c a u t i o n . I n c o n c l u s i o n , r e t i n a l h e m o r r h a g e i s t h e m o s t c o m m o n o c u l a r f i n d i n g a s i t o c c u r r e d i n 2 3 . 7 % o f A A p a t i e n t s i n o n e s e r i e s . C e n t r a l r e t i n a l v e i n o c c l u s i o n - l i k e p i c t u r e i s t h e s e c o n d m o s t f r e q u e n t f i n d i n g , o c c u r r i n g i n 5 . 8 % o f A A p a t i e n t s ; i t s o c c u r r e n c e d o e s n o t s e e m r e l a t e d t o a m o r e s e v e r e r h e o l o g y . T h e o c c u r r e n c e o f o c u l a r a b n o r m a l i t i e s i n A A p a t i e n t s i s a s s o c i a t e d w i t h t h e s e v e r i t y a n d c o n c o m i t a n c e o f a n e m i a a n d t h r o m b o c y t o p e n i a . S m a l l p r e r e t i n a l h e m o r r h a g e s r e s p o n d t o b l o o d t r a n s f u s i o n s w h i l e l a r g e h e m o r r h a g e s r e q u i r e p o s t e r i o r h y a l o i d o t o m y o r v i t r e c t o m y t o p r e v e n t p e r m a n e n t m a c u l a r d a m a g e . A A p a t i e n t s s h o u l d b e a d v i s e d t o r e f r a i n f r o m V a l s a l v a m a n e u v e r s , o c u l a r r u b b i n g , a n d v i g o r o u s e x e r c i s e t o p r e v e n t o c u l a r m o r b i d i t y . A A i s a l i f e - t h r e a t e n i n g a n d a p o t e n t i a l l y b l i n d i n g d i s e a s e i f n o t t r e a t e d p r o m p t l y a n d o p h t h a l m o l o g i s t s m a y b e t h e f i r s t p h y s i c i a n s t o d i a g n o s i s t h i s r a r e c o n d i t i o n . W e a l s o e m p h a s i z e t h e i m p o r t a n c e o f c o o r d i n a t i o n o f t h e m e d i c a l a n d s u r g i c a l c a r e o f A A w i t h t h e h e m a t o l o g y s e r v i c e a n d t h e n e e d f o r p e r i o d i c r e t i n a l e x a m .

xref #text xref #text xref #text Systemic GPA often presents with symptoms of weight loss, fever, fatigue, arthralgia, and myalgia., GPA is characterized by granulomatous upper airways involvement in about 90% of patients. Upper respiratory tract symptoms include epistaxis, sinusitis, otitis media, deafness, hoarseness, stridor, and proptosis due to orbital involvement. The granulomatous inflammation can lead to local damage, including nasal septal perforation, saddle nose, and tracheal stenosis. Lung involvement occurs in 85% of patients with GPA at some stage, and includes pulmonary nodules and cavities, pulmonary infiltrates, pleural effusion, and pulmonary fibrosis. Alveolar hemorrhage occurs in approximately 20% of patients with active GPA. Renal involvement is a common feature of GPA, with necrotizing and crescentic glomerulonephritis occurring in 75% of patients at some point in their disease. Renal replacement therapy is required in 20%–30% of patients, either due to rapidly progressive glomerulonephritis, or to gradual loss of kidney function over time. Almost any organ in the body can be involved, but in particular vasculitic skin lesions, peripheral neuropathy, mononeuritis multiplex, granulomatous meningeal involvement, cardiac disease, and gut involvement are well recognized in GPA. Localized GPA refers to granulomatous vasculitis limited to the upper airways, sinuses and orbits, or lungs, without systemic involvement or constitutional symptoms, and occurs in about 5% of patients with GPA., However, as stated above, about 90% of patients with systemic GPA have granulomatous disease of the upper airways. Localized GPA has a high propensity for relapse, and can cause significant local damage over time, as well as treatment-associated morbidity if recurrent courses of induction treatment are required. By contrast, MPA is characterized by systemic vasculitis without granulomatous disease. Pauci-immune glomerulonephritis is very common in MPA; however, upper airways granulomata and pulmonary nodules are not a feature, and chronic lung damage in MPA tends to present with a more fibrosing, restrictive pattern. Pulmonary hemorrhage can occur in both active GPA and active MPA. #text xref #text xref #text AAV are believed to be autoimmune diseases and are treated by immunosuppression. Treatment of AAV is divided into two phases, ie, an induction phase and a remission maintenance phase. The aim of induction treatment is to rapidly reduce inflammation to control signs and symptoms of disease and prevent permanent tissue damage. In the remission maintenance phase, lower-dose immunosuppression is used to prevent relapse. Of course, these aims should be achieved with the minimum of toxicity. As a guide, lists the induction and maintenance strategies that are commonly in use for different severities of GPA, with reference to the evidence supporting them. lists the short-term and long-term side effects that have been associated with the drugs most commonly used to treat GPA. In this review, we have chosen to discuss particular challenges in managing GPA, namely: reducing the toxicity of induction therapy for GPA; the development of predictive tools to determine who can safely stop maintenance immunosuppression; improving the efficacy of remission maintenance strategies in GPA; managing localized GPA; and management of disease and treatment-related comorbidity. Finally, we discuss the possible future therapeutics in the management of AAV. The results of randomized trials of induction therapy for AAV discussed below have enabled a reduction in the intensity and duration of induction immunosuppression for GPA, and evidence would suggest that this has led to improvements in outcome over the past 30 years., Several of the trials have been carried out by the European Vasculitis Study Group (EUVAS). In their trials, EUVAS decided to subgroup vasculitis according to severity, to give high-intensity treatment to induce remission and low-intensity immunosuppression to prevent relapse, to agree on a standard regimen by consensus, to test against current best practice by randomized controlled trials, and to use standardized scoring systems for measuring outcome. #text Disease relapse remains a problem in GPA, with a 50% relapse rate over the course of 5 years. Minor relapses may be managed with an increase in oral glucocorticoids or optimization of maintenance immunosuppression dosing, but major relapses require repeated induction therapy. The risk of relapse of GPA and PR3-ANCA-positive vasculitis is higher than for other forms of vasculitis such as MPA, and previous relapse is also predictive of future flares.,, Lung and upper airways involvement in GPA are associated with higher relapse rates. Reduced intensity induction therapy, or early withdrawal of immunosuppression or glucocorticoids has been associated with an increased risk of relapse. However, although risk factors of relapse can be defined at a population level, we are unable to predict with any great degree of certainty the outcome for any one particular patient with GPA. Therefore, close clinical monitoring of symptoms, signs, and inflammatory markers is required to detect relapses at an early stage, and it is likely that many patients are immunosuppressed for longer than necessary, due to uncertainty about their risk of relapse. ANCA positivity is a good diagnostic marker for GPA. However, a meta-analysis of available studies showed that a rise in ANCA titers during remission was only weakly associated with relapse, and therefore not very useful for predicting the disease course in individual patients. It is our practice not to modify treatment based on changes in ANCA status alone, but to monitor patients with rising ANCA titers carefully for clinical signs of relapse, along with monitoring inflammatory markers such as C-reactive protein. There is a need for more reliable biomarkers to predict relapse in AAV patients. McKinney et al have discovered a CD8 T cell messenger RNA signature detectable at diagnosis, which was associated with relapse in patients with AAV and a range of autoimmune conditions. This signature was only discernible in isolated leukocyte subsets and not in whole blood. If a clinically applicable test could be devised based on these findings it could have some utility in predicting relapse in GPA. Calprotectin (S100A8/S100A9) is a damage associated molecular pattern produced by neutrophils and monocytes, and is commonly raised in inflammatory conditions. In a subset of 27 patients with early systemic AAV recruited into the NORAM study, levels of calprotectin over 626 ng/mL at one month after treatment was initiated were associated with future relapse, with a sensitivity of 72.6% and a specificity of 92.3%, and similarly higher calprotectin levels at 6 months were also significantly associated with relapse. Serum calprotectin levels are now being prospectively assessed as biomarkers for relapse in AAV. Urinary monocyte chemoattractant protein 1 levels were associated with active renal vasculitis; however, it has not yet been determined whether these changes occur earlier than other clinical evidence of renal vasculitis, and therefore whether they have value in predicting relapse. #text italic xref #text Compared with age-matched and sex-matched controls in the general population, a study of 535 patients with AAV enrolled into four EUVAS trials showed a mortality rate of 2.6. Forty-four percent of the deaths during the 5-year follow-up of this study occurred within the first year after induction therapy, and the main causes of death in the first year were infection (48%) and active vasculitis (19%). It is not currently clear which component of induction therapy contributes most to the risk of infection. Half of the infections occurring in the first year were observed during the first 2 months of induction treatment, and unspecified septicemia and bacterial infections of the respiratory tract accounted for half of the cases. Cumulative adverse events during induction therapy are significantly associated with mortality. Elderly patients and those with severe renal impairment are particularly susceptible to treatment- associated complications., Cotrimoxazole is routinely given to patients receiving cyclophosphamide as prophylaxis against pneumonia. After the first year, the major causes of death in the EUVAS cohorts were cardiovascular disease (26%), malignancy (22%), and infection (20%). Long-term follow-up data from these trials after 7.3 years of follow-up showed a significant burden of morbidity, with 34.4% of patients having more than five items of damage on the Vasculitis Damage Index at long-term follow-up. In patients with GPA, the commonest items of damage were nasal blockage/crusting (44.3%), hypertension (39.5%), hearing loss (32.3%), and a glomerular filtration rate <50 mL per minute (31.7%). Impaired pulmonary function (13.8%) and peripheral neuropathy (22.2%) were also prominent features. Cardiovascular endpoints of angina/coronary artery bypass, stroke, and myocardial infarction were also significantly increased., In view of this, attention must be drawn to management of cardiovascular risk factors, including smoking, exercise, hypertension, weight management, lipids, and management of diabetes, where present. End-stage renal disease occurs in up to 25% of patients with AAV. Dialysis and renal transplantation are options for these patients, and patients with AAV have good outcomes of transplantation when it is performed after disease activity is controlled. More difficult to manage is permanent lung scarring due to pulmonary fibrosis and respiratory compromise due to tracheal and bronchial stenosis, which can also predispose to recurrent chest infections. Damage in GPA is not only related to the disease itself, but also to treatment. Short-term and long-term toxicities associated with treatments commonly used for GPA are listed in . In the EUVAS trials, potential treatment-related damage items were reported for two thirds of patients. Cohorts of GPA patients exposed to high cumulative doses of cyclophosphamide have been shown to be at an increased risk of bladder malignancy (standardized incidence ratio [SIR] 3.6–4.8),– acute myeloid leukemia, (SIR 19.6), and nonmelanoma skin cancer (SIR 4.7). The risk is known to be dose-dependent, and increase substantially with cumulative doses of cyclophosphamide over 25 g,, but a safe threshold dose for cyclophosphamide has not been established. However, the risks of bladder malignancy, leukemia, and non-melanoma skin cancer in the recent EUVAS trials were lower than in previous cohorts (SIR 2.4, 3.2, and 2.8, respectively), probably due to reduced cyclophosphamide exposure. Azathioprine has been associated with nonmelanoma skin cancer in other conditions;, however, in AAV, it is rarely used alone and so its contribution to skin cancer in GPA is difficult to quantify. Recommendations for treatment of AAV, including prophylaxis for the prevention of treatment-associated complications have been produced., xref #text M a n a g e m e n t o f G P A r e q u i r e s a m u l t i d i s c i p l i n a r y a p p r o a c h , a i m i n g n o t o n l y t o t r e a t t h e d i s e a s e a n d p r e v e n t r e l a p s e , b u t a l s o t o m a n a g e l o n g - t e r m c a r d i o v a s c u l a r r i s k , o r g a n d a m a g e , a n d s i d e e f f e c t s o f t h e r a p y . T r e a t m e n t s h a v e b e e n r e f i n e d a s a r e s u l t o f l a r g e m u l t i c e n t e r r a n d o m i z e d c o n t r o l l e d t r i a l s i n A A V ; h o w e v e r , t h e r e a r e u n m e t n e e d s t o r e s o l v e g r a n u l o m a t o u s i n f l a m m a t i o n m o r e r a p i d l y , t o r e d u c e s t e r o i d e x p o s u r e , a n d t o i m p r o v e t h e e f f i c a c y o f r e m i s s i o n m a i n t e n a n c e s t r a t e g i e s i n G P A . T h e r e a r e a l a r g e n u m b e r o f p o t e n t i a l l y p r o m i s i n g a g e n t s f o r t h e t r e a t m e n t o f A A V i n d e v e l o p m e n t , a n d c l i n i c a l t r i a l s w i l l b e r e q u i r e d t o d e t e r m i n e w h e t h e r t h e s e c a n m e e t u n m e t n e e d s f o r p a t i e n t s w i t h G P A .

Major depressive disorder is a common condition usually associated with substantial symptom severity and role impairment. It is a significant public health concern across all regions of the world, with both prevalence and impairment severity slightly higher in high-income countries than in low-income to middle-income countries. The 12-month prevalence of major depression across 30 European countries has been estimated at 6.9%, and the lifetime prevalence in the USA was estimated as 16.2% in the National Comorbidity Survey Replication. However, data obtained prospectively indicate that recall bias leads to substantial underestimation of the lifetime prevalence of depression in cross-sectional studies.– Prospective estimates of prevalence during 7–13 years of follow-up in Canada were 24.2% in women and 14.2% in men, and it has been suggested that approximately half the population of the developed world can expect one or more episodes of depression in their lifetime. In a recent cross-national study, the average age of onset of a major depressive episode was approximately 25 years. The fact that many people are affected at an early age means that depression can impose a severe burden in terms of employment and role performance. Role impairment was rated as severe or very severe in 59% of 12-month cases of depression in the National Comorbidity Survey Replication, and major depressive episodes more than double the risk of transition from working to nonworking status. Persistent depressive symptoms, particularly in older people, are associated with a steep trajectory of worsening functional disability. An often quoted result published in 1997 was that depression was projected to rise to become the second greatest cause of disability worldwide, measured in terms of disability-adjusted life years, by 2020 (after ischemic heart disease). In fact, in the European Union, depression has already become by far the most burdensome of all diseases in terms of disability. The economic cost of major depression in Europe is very large, and was estimated at 92 billion Euros during 2010, and is predicted to increase. Agomelatine is a recently introduced antidepressant. It possesses both melatonergic agonist and 5-hydroxytryptamine antagonist properties. It has shown efficacy in both the acute and continuation phases of the treatment of depression in randomized, double-blind trials against placebo, and has shown efficacy at least comparable with that of established drugs such as sertraline, fluoxetine, escitalopram, and venlafaxine in active comparator studies., However, it is widely accepted that the benefits of treatment observed in randomized studies do not always translate into clinical practice. Therefore, it is of the utmost importance to evaluate the antidepressant efficacy and tolerability of agomelatine in clinical practice. Here we present the results of the multicenter observational CHRONOS study, in which a large sample of depressed patients were treated as inpatients or outpatients with a flexible-dosing regimen of agomelatine in everyday medical practice in the Russian Federation. The Student’s -test for paired samples was used for within-group comparisons of continuous variables that were normally distributed, and Wilcoxon’s test for those that were not normally distributed. The Student’s -test for independent samples was used for between-group comparisons of continuous variables, and the Mann–Whitney test for those not normally distributed. The χ test was used for categorical variables. All tests were two-sided, and the type I error rate was 5%. A total of 6,276 patients were included in the study by 1,910 participating psychiatrists. The majority of patients (80.2%) were treated initially as outpatients and 19.8% as inpatients in psychiatric facilities. The average patient age was 44.4 years, and the majority (72.6%) were female (). Most patients had major depressive disorder (91.4%), either as a first episode (44.7%) or in the context of recurrent depressive disorder (42.7%); 17.2% had experienced three or more previous depressive episodes. A minority of patients had a depressive episode in the context of bipolar affective disorder (5.1%). Considering all patients, 86.6% of depressive episodes were diagnosed as moderate and 9.9% as severe. The mean HAMD-17 total score at baseline was 22.4, and a majority of patients (68.5%) had a baseline CGI-S score of 4, corresponding to moderate illness severity. The duration of the current depressive episode ranged widely, from 0.1 to 96 months, with a mean of 3.2 months. The duration of depressive illness prior to inclusion in the study also ranged widely, from 0.05 years to 41 years, with a mean of 3.2 years. The HAMD-17 total score decreased substantially and progressively throughout the treatment period, from 22.5±6.9 at baseline to 4.7±4.7 at 8 weeks (<0.0001; ). The improvement was significant at the week 1 study visit (<0.0001) and at all subsequent visits. The proportion of patients showing a response to treatment (HAMD-17 total score decreased by ≥50% from baseline) increased slightly between baseline and the second week of treatment, and rapidly thereafter, reaching 90.1% by week 8 (). The proportion of patients showing remission from depression (HAMD-17 total score <7) increased progressively throughout the treatment period, reaching 25.3% at week 3 and 79.1% at week 8 (). When the single HAMD-17 item scores were considered individually, it was found that every item score decreased substantially during the treatment period (<0.0001 in every case). Notable among these were concomitant improvements in both symptoms relating to daytime activities and those relating to sleep. Thus, HAMD-17 items “work and activities” (item 7) and “psychomotor retardation” (item 8) improved from 2.0±0.86 to 0.49±0.63 and from 1.19±0.84 to 0.22±0.47, respectively, between baseline and week 8 (). Similarly, items 4, 5, and 6, relating to early, middle-of-the-night, and late insomnia, respectively, improved from 1.45±0.69, 1.39±0.67, and 1.27±0.76 at baseline to 0.21±0.43, 0.15±0.39, and 0.21±0.45, respectively, at week 8. There were also marked improvements in symptoms of anxiety in depression, with “psychic anxiety” (item 10) and “somatic anxiety” (item 11) improving from 1.88±0.94 and 1.70±0.87 at baseline to 0.41±0.60 and 0.43±0.59 at week 8, respectively. A notable feature was that the onset of improvement was rapid for every HAMD-17 item, and the improvement relative to baseline was significant at one week of treatment (<0.0001 in every case) and at every visit thereafter. Severity of depressive illness, as evaluated by the CGI-S score, decreased markedly throughout the treatment period. At baseline, the mean CGI-S score was 3.93, and a majority of patients (68.9%) had a CGI-S score of 4, indicating moderate illness severity. At the end of the treatment period (week 8), the mean CGI-S score was 2.02; the modal CGI-S score was 1, indicating normal (not at all ill), and this category accounted for 34.8% of patients (). A further 24.7% of patients had a CGI-S score of 2, indicating only borderline illness at the end of the study. Marked improvements were also seen in patients who were markedly or severely ill at baseline (CGI-S scores 5 or 6); the proportion of patients in these categories decreased from 13.2% at baseline to 0.42% at 8 weeks. A notable feature was the rapidity of improvement in these patients: the proportion of markedly or severely ill patients fell from 13.2% to 2.4% after only 3 weeks of treatment (, lower panel). The efficacy of agomelatine was also high in the subgroup of more severely depressed patients (HAMD-17 total score ≥21 at baseline; n=3,478). By week 8, the proportions of responders and remitters in this subgroup according to HAMD-17 total scores were 92.4% and 72.8%, respectively (). The onset of antidepressant efficacy was also rapid in this subgroup, with 4.0% of patients being responders at the week 1 visit and 17.6% at the week 2 visit. Remission was apparent throughout the treatment period (). Adverse events were reported in 1,321 (21.1%) of patients. The most frequent adverse events were nausea (4.0%), dizziness (3.1%), and headache (3.0%, ). Most adverse events were typical symptoms of depressive episodes or those frequently observed in studies of psychotropic drugs. Serious adverse events were reported in 51 patients (0.81%). These included eleven cases (0.18%) of hospitalization for exacerbation of existing nonpsychiatric chronic diseases, three severe injuries (motor vehicle accident, arm fracture, and hip fracture due to a fall), two cases of diagnosis of serious disease (brain tumor, temporal lobe epilepsy), and two instances in which patients called for an ambulance (abrupt increase in blood pressure, tongue numbness, swelling, and edema). There were 22 instances (0.35%) of exacerbation of mental illness and admission to a psychiatric hospital, including three (0.05%) unsuccessful suicide attempts and two (0.03%) cases of inversion of affect. The principal findings of the observational CHRONOS study in 6,276 depressed patients without psychotic symptoms were that treatment with a flexible-dose regimen of agomelatine resulted in a reduction in HAMD-17 total score from a mean of 22.5±6.9 at baseline to 4.7±4.7 at the end of the 8-week treatment period. Marked and significant improvements were observed in each item of the HAMD-17 when considered separately, and improvements were rapid in onset, being detectable and significant after only one week of treatment. The proportion of patients showing response to treatment (≥50% decrease in HAMD-17 score) was 90.1% at week 8, by which time 79.1% had achieved remission (HAMD-17 total score <7). Results were similar in the subgroup of patients with more severe depression (HAMD-17 total score ≥21 at baseline; n=3,478), with 92.4% and 72.8% of patients achieving response and remission, respectively, at week 8. The efficacy of agomelatine in the treatment of major depressive disorder has been evaluated in several randomized, double-blind trials, both against placebo and against active comparator drugs. In particular, the flexible-dose regimen used in the present study has shown antidepressant efficacy that was superior to placebo in terms of HAMD-17 total score in two trials,, and efficacy similar to that of venlafaxine and escitalopram and superior to sertraline. The efficacy of agomelatine was also shown to be superior to that of fluoxetine in a trial in patients with major depressive disorder of severe intensity. The CHRONOS study complements the recent observational VIVALDI (Valdoxan Improves depressiVe symptoms And normaLizes circaDIan rhythms) study of agomelatine, which was performed in 3,356 depressed inpatients treated in everyday medical practice in Germany. In CHRONOS, the treatment period was shorter than in VIVALDI (8 weeks versus 12 weeks) and assessment visits were more frequent (six versus three follow-up visits), with the first visit only one week after treatment initiation. Direct comparison of efficacy results between the two studies is complicated by the fact that a modified Montgomery-Asberg Depression Rating Scale (MADRS) was used for detailed assessment of depressive symptom severity in VIVALDI, rather than the HAMD-17 instrument used in CHRONOS, and because patients in the VIVALDI study had more severe depressive symptoms at baseline. In VIVALDI, the mean CGI-S score decreased from 4.7 to 3.2 during the 12-week treatment period, compared with a decrease from 3.9 to 2.0 over 8 weeks in CHRONOS. In VIVALDI, 66% of patients showed response to treatment (≥50% reduction in MADRS total score) and 55% achieved remission (MADRS total score ≤12). In CHRONOS, the corresponding values (by HAMD-17 criteria) were 90% for response and 79% for remission at 8 weeks. The efficacy results from the present CHRONOS study can be compared with those from two other large trials of antidepressant treatment in everyday medical practice which involved patients with similar depressive symptom severity at baseline. In a recent naturalistic study in 1,014 patients treated in psychiatric hospitals in Germany, the mean HAMD-17 total score decreased from 22.3 to 8.8 during the acute treatment phase (mean duration 53.6 days), compared with the decrease from 22.5 to 4.7 at 8 weeks in CHRONOS. In the STAR*D (Sequenced Treatment Alternatives to Relieve Depression) study of 2,876 depressed outpatients without psychotic symptoms in the “real world” setting, the mean HAMD-17 total score was 21.8 at baseline, and treatment with a flexible-dosing regimen of citalopram for an average of 10 weeks produced a remission rate of 27.5%, which was similar regardless of whether patients were treated in primary (26.6%) or psychiatric (28.0%) care. In our study, the large sample size and frequent follow-up assessments allowed changes in individual HAMD-17 item scores and scores at individual time points during treatment to be evaluated reliably and their significance assessed. Two important findings emerged from this analysis. Firstly, there were significant improvements in every HAMD-17 item. The efficacy of agomelatine in improving the daytime condition in depressed patients has been demonstrated in randomized studies, including objective assessments of reaction time and subjective assessments of daytime alertness., In CHRONOS, HAMD-17 items relating to work and activities (item 7) and psychomotor retardation (assessing concentration, motor activity and speed of thought and speech; item 8) were also markedly improved. These improvements are of particular importance in light of the frequently severe impact of depression in terms of functioning and role impairment. Improvements in the sleep–wake cycle during depressive episodes have been evaluated specifically in randomized, double-blind trials,,, and were confirmed in a naturalistic setting by the marked improvements in all three insomnia-related HAMD-17 items in the present study. Agomelatine also improved the HAMD-17 items relating to agitation (item 9) and psychological and somatic anxiety (items 10 and 11), indicating that agomelatine treatment was effective in both the “anxiety–agitation” and the “depression–retardation” components of depression, which may be somewhat opposed. Secondly, the improvements in HAMD-17 total and individual item scores were detectable and statistically significant as early as one week after commencement of treatment. Relatively slow onset of efficacy has been identified as an important limitation of most current antidepressant drugs., Perceived improvement early in treatment may be important in maintaining patient confidence in the prescribed treatment, leading to greater adherence and persistence with treatment and improved outcome while minimizing work and role impairments. A further important result was that agomelatine showed substantial and rapid efficacy in patients with more severe depressive symptoms. In the subgroup with HAMD-17 total score ≥21 at baseline, rates of response were similar to and remission only slightly lower than in the full study population. Additionally, the proportion of patients with CGI-S scores of 5 or 6, indicating they were markedly or severely ill, decreased rapidly from 13.2% at baseline to 2.4% at 3 weeks and to 0.42% at week 8. These results suggest that the efficacy of agomelatine is high and rapid in onset in patients with any level of depression severity. The tolerability profile of agomelatine in the present CHRONOS study was very similar to that in the previous VIVALDI study and in the randomized trials of the flexible-dose regimen for agomelatine. The most frequent adverse events in CHRONOS were nausea, dizziness, and headache, and these were also the three most frequent adverse events in the VIVALDI study. The overall incidence of adverse events reported was lower in CHRONOS (21.1%) than in the randomized trials (42%–66%). In the randomized studies, the incidences with agomelatine were similar to those with placebo (agomelatine 42.4% versus placebo 42.5%) and with the comparator antidepressant sertraline (agomelatine 48.0% versus sertraline 49.1%), and lower than with the comparators venlafaxine (agomelatine 51.2% versus venlafaxine 57.1%) and escitalopram (agomelatine 66.2% versus escitalopram 81.8%). During CHRONOS, 108 patients (1.7%) discontinued agomelatine due to adverse events, compared with 8.6% during first step treatment with citalopram in the STAR*D trial. The proportion of patients admitted to hospital for psychiatric reasons during CHRONOS (22 patients, 0.35%) also compared favorably with citalopram in STAR*D (2%). It should be noted that no cases of a clinically significant increase in transaminases was reported. As mentioned above, no specific liver function monitoring was performed in the study since this was not required at the time by the Russian Federation Agency. However, our data are at least partly in line with the results of liver toxicity assessments for agomelatine in the observational VIVALDI study. In VIVALDI, an increase to a value >3 times the upper limit of the normal range for alanine aminotransferase and aspartate aminotransferase was less frequently observed than in controlled clinical trials. The authors mentioned that this might be due to the difference between spontaneous reporting of adverse drug reactions in a naturalistic setting and systematic evaluation of adverse events in controlled clinical studies, where intensive monitoring is standard. This explanation is probably true for the CHRONOS study. Antidepressant monotherapy for bipolar disorder is not the rule in clinical practice today. It is well known that monoaminergic antidepressants have been associated with high rates of affect inversion in bipolar patients, and are often used in combination with mood stabilizing drugs. In CHRONOS, mood stabilizers were forbidden by the protocol, and were taken by only a very small number of patients (eleven, 0.18%). Unfortunately, we do not have more detailed information about the reasons for monotherapy with agomelatine in patients with bipolar depression in the CHRONOS study. Anyway, these preliminary data suggest that agomelatine may be less likely to trigger mania switch in patients with bipolar depression compared with monoaminergic antidepressants, probably due to the atypical mode of action, and this issue should be addressed in future randomized controlled trials. The main strengths of the CHRONOS trial were its very large sample size of over 6,000 patients and the frequent follow-up visits, starting at week 1. Its main limitations were those also highlighted by the authors of the STAR*D study, namely its open treatment design and the lack of a placebo control group. However, such observational studies document the course of the depressive episode with treatment as experienced by the patient, and also provide information that complements the results of randomized studies in at least two areas. First, observational studies give information on the effectiveness of treatments when administered in everyday clinical practice. Second, they generally involve a more representative patient population, often with more comorbidities and taking a wider range of concomitant medications than is usual in randomized studies. Further limitations of the CHRONOS study were the short-term nature of the treatment and the fact that there were no follow-up visits after the end of the treatment period. However, it should be pointed out that previous randomized, double-blind trials have demonstrated the efficacy of long-term treatment with agomelatine in prevention of relapse and the absence of discontinuation symptoms following abrupt cessation of treatment with agomelatine. Another limitation of the CHRONOS study was the small number of appropriate scales addressing important characteristics of depressed patients, such as mania scales and functional outcome. This was due to providing the least time-consuming protocol to encourage practitioners to make out of routine assessments needed for study data collection. Overall, the CHRONOS study confirmed the effectiveness of a flexible agomelatine dosing regimen in the acute treatment of depressive episodes in a large sample of patients in a naturalistic setting. Rates of response and remission were high in both the overall population and in the subgroup of more severely depressed patients. Notable features were the rapidity of onset of benefits (significant at one week) and the significant improvements observed in each of the HAMD-17 items. Agomelatine was well tolerated, with a low rate of withdrawals from treatment due to adverse events. These results suggest that agomelatine can be highly effective in the treatment of a depressive episode in the “real world” clinical setting.

Schizophrenia is a common mental disorder effected by the mutual influence of multiple genetic and environmental factors, and its heritability is up to 80%. In order to clarify the pathological mechanisms, many studies have been carried out over the years, but a consistent conclusion has still not been achieved. To date, dysregulation of dopaminergic neurotransmission has been implicated in the pathogenesis of schizophrenia., The reduction of prefrontal cortical dopamine neurotransmission likely leads to schizophrenia. Dopamine is an important endogenous neurotransmitter that plays a significant role in modulating cognitive, mood, and motor functions of the brain. It plays a regulatory function by binding to the dopamine receptors of the postsynaptic membrane. The sequence of the dopamine D receptor gene () has been identified and mapped to chromosome 5q35.1. Linkage between and schizophrenia has been reported in Chinese, American, and Portuguese populations. As we all know, a remarkable symptom of schizophrenia patients is cognitive dysfunction (such as attention-deficit and memory disorders)., Interestingly, an optimal amount of stimulation is essential in maintaining normal prefrontal cognitive function., Studies– show that deficits in transmission are associated with cognitive and negative symptoms of schizophrenia, and there is a significant decrease in expression in the basal ganglia of schizophrenic patients. gene polymorphisms likely play a role in the occurrence of schizophrenia by affecting the expression of the D receptor. The rs1799914 genetic polymorphism is associated with schizophrenia in a Korean population. A study of five single-nucleotide polymorphisms (SNPs; rs11746641, rs11749676, rs251937, rs12518222, rs4867798) has reported that rs11746641 and rs11749676 are associated with schizophrenia in males, and the haplotype T-A-T-C-T can reduce the risk of schizophrenia. The genetic polymorphism of rs4532 is likely associated with deficits in executive function and performance on the Wisconsin Card Sorting Test. However, no association between rs4532 and schizophrenia has been reported,, and a consistent conclusion has still not been achieved. Many previous studies analyzed a few loci (one to five SNPs) or selected several tag SNPs as a substitute for the entire gene region. However, the limitation of several loci could not completely pinpoint the true susceptible SNPs, owing to the weak linkage disequilibrium in the gene. Most likely, the basis of inconsistent results was due to this factor. We analyzed eleven SNPs in the 5′-flanking and untranslated regions of the gene by deoxyribonucleic acid (DNA) sequencing, and carried out a case-control study between 173 paranoid schizophrenia patients and 213 unrelated healthy controls. Blood samples from 213 healthy, unrelated, northern Han Chinese volunteers (112 males and 101 females, average age 40.1±14.7 years) were provided by China Medical University’s Department of Blood Serum in the School of Forensic Medicine. Questionnaires confirmed there was no history of mental disease going back three generations. Blood samples from 173 northern Han Chinese patients with paranoid schizophrenia (88 males and 85 females, average age 43.7±13.5 years) were provided by the Third People’s Hospital of Liaoning Province. Each patient was diagnosed by at least two senior psychiatrists. Diagnostic criteria for paranoid schizophrenia were in line with the (fourth edition) on the basis of unstructured interviews and information from medical records. The study protocol and process was assessed and approved by the ethics committee at China Medical University. In the present study, all subjects signed the informed consent form. Polymerase chain reaction (PCR) was used to amplify fragment length, including 5′-flanking and untranslated regions. The nucleotide position of one fragment amplified was from –3,052 to –1,483 (primer sequence [forward] – ctgatatggtgcatggctgtt, [reverse] – acctgcgttgtctccaagtgt). The nucleotide position of the other fragment amplified was from –1,505 to +100 (primer sequence [forward] – ggacacttggagacaacgcag, [reverse] – atgagcagcgacaggaaacag). The amplified fragment included 45 SNP loci that had been reported in the National Center for Biotechnology Information database (), and were genotyped by DNA sequencing. The frequencies of the SNP loci (>1%) were screened. Eleven polymorphic loci were detected in the northern Han Chinese population, including one newly discovered SNP loci: ss492961114/rs201089398 in the 5′ regulatory region. A schematic diagram for is shown in . Genomic DNA was extracted by the traditional phenol-chloroform method and quantified with ultraviolet (UV) spectrophotometry. An ABI9700 amplifier (Applied Biosystems, Foster City, CA, USA) was used to amplify the target band. Beijing Genomics Institute (ABI3730XL) was commissioned for sequencing. SPSS 18.0 software (IBM, Armonk, NY, USA) was used to calculate genotype frequency and allele frequency, and Haploview 4.1 software (Broad Institute, Cambridge, MA, USA) was used for the Hardy–Weinberg equilibrium test, the confirmation of haplotypes, and analysis of intergroup differences. The test was used to measure the association of paranoid schizophrenic risk with genotypes, alleles, and haplotypes between control and disease groups. Unconditional logistic regression models were used to obtain maximum-likelihood estimates of odds ratios (ORs) and their 95% confidence intervals (CIs) between each locus and the presence of paranoid schizophrenia. The Bonferroni correction was used in multiple testing, and -values were divided by the total number of loci or haplotypes. Haploview 4.1 was used to test genotype fitness for the control and paranoid schizophrenic groups. The results showed that the distribution of no genotype frequencies at all loci deviated from the Hardy–Weinberg equilibrium in either group or in the male and female subgroups (>0.05). Results of linkage analysis for control and disease groups are shown in . Genotype and allele frequencies of eleven SNP loci in are shown in . The test was used to measure the association of paranoid schizophrenic risk with genotypes. Among them, the genotype distribution of rs5326 was statistically different between paranoid schizophrenia patients and controls (=0.036), though the difference was lost after Bonferroni correction. Compared with the AA genotype, the AG + GG genotype reduced the disease risk (OR 0.358, 95% CI 0.151–0.851). In addition, a lower risk of paranoid schizophrenia was associated with the AG + GG genotype of rs4532 (OR 0.592, 95% CI 0.350–1.001) compared with the AA genotype. No remaining loci exhibited significant differences in allele or genotype frequencies between the patients and controls. A comparison of the frequencies of haplotypes formed by the seven SNPs in the block was analyzed between the patients and controls. The results are shown in . The remaining four SNPs outside the block formed the haplotypes, and the result is shown in . All-haplotype analysis found that there was no association with the occurrence of paranoid schizophrenia between patients and controls. A study reported that sexually dimorphic SNPs impacted on the risk of schizophrenia. Therefore, we stratified the observed association of rs5326 and rs4532 with the risk of paranoid schizophrenia based on sex by the test (results shown in ). In males, the genotype distribution of rs5326 was statistically different between cases and controls (=0.048). In females, the genotype distribution of rs4532 was statistically different between cases and controls (=0.029). However, these significant differences disappeared after Bonferroni correction. In the present study, we investigated eleven SNPs in the gene in a northern Chinese Han population by DNA sequencing. There were no significant differences in allele, genotype, or haplotype frequencies between paranoid schizophrenia patients and controls after Bonferroni correction. Consistent with our results, some studies reported no significant association between the gene and schizophrenia., However, several previous studies have reported that the gene is associated with bipolar disorder, attention deficit with hyperactivity disorders, nicotine dependence, alcohol dependence, and others. Compared with these diseases, schizophrenic patients have the same or similar symptoms. Our results found that the AG + GG genotype of rs5326, as a protective factor for schizophrenia, could reduce the risk of paranoid schizophrenia, as assessed by the test. Zhu et al reported that rs5326 was not associated with schizophrenia in the Chinese Han population, which was consistent with previous studies., The interaction between the and genes significantly increased the risk of schizophrenia after analysis with multifactor dimensionality reduction software. This also shows that the incidence of schizophrenia is affected by the interaction of multiple genes, and studies of only one gene cannot clearly explain the pathogenesis. Although some studies,, found no association between rs4532 and schizophrenia, a meta-analysis indicated that might contain a genuine susceptibility allele, and the OR of rs4532 reached 1.18 (95% CI 1.01–1.38). In addition, rs4532 was associated with antipsychotic treatment in schizophrenia, and working memory and cognitive behavior related to the prefrontal cortex., This shows that rs4532 likely has a potential link with the etiology of schizophrenia. Furthermore, the inconsistency of association studied between and schizophrenia may result from genetic heterogeneity, which is an important challenge in the genetic study of schizophrenia. In our study, we reported rs201089398 for the first time. However, this new locus had a slightly lower frequency, and we failed to reveal its potential association with schizophrenia in the Chinese Han population. The pathogenesis of schizophrenia is the participation of a variety of risk factors, and sex is an important factor., Our study showed that rs5326 was statistically different between cases and controls in males and rs4532 was statistically different between cases and controls in females by the test. Unfortunately, the impact of sex-specific mechanisms in schizophrenia is unclear, and needs further exploration in the future. In addition, there was another limitation in our study in that we did not analyze positive and negative symptoms or cognitive performance of the patients, owing to the lack of original information. What can we learn from these results? First, the analysis of just one gene is far from enough, because may result in schizophrenia by interacting with other dopaminergic-related genes, such as synthase genes, metabolic genes, transporter genes, and others. Additionally, other neurotransmitters are also involved in the pathogenesis of schizophrenia. We cannot definitively rule out a role for any of these genes in schizophrenia. Therefore, further studies should be focused on genome-wide SNP analysis and gene–gene interactions to determine their possible roles in the etiology of schizophrenia. Second, multiethnic studies with large samples are essential. Many of the ORs for association are in a plausible range (1.10–1.23) for small susceptibility effects, but below what would produce significant -values in smaller samples. The larger ORs in some previous reports may either be false positives or inflated estimates of genetic effects, while association studies of large samples provide more power. In the present study, we reported rs201089398 for the first time. With regard to the limited samples, the slightly lower frequency of this new locus might not reveal the potential association with schizophrenia in the Chinese Han population. Besides, our results demonstrated that the genotype frequencies of are variable in different ethnic groups. Therefore, through multiethnic studies, it will likely be easier to find a genetic effect for susceptibility to schizophrenia. Third, genetic heterogeneity is a significant challenge in the study of schizophrenia, and family-based studies could overcome this problem effectively. Our results need to be clarified through analysis of extensive family studies. Additionally, paranoid schizophrenia, as a subtype of schizophrenia, includes positive and negative symptoms, which show different clinical manifestations. Unfortunately, due to the limited data, we did not do a more detailed analysis. Overall, the shortcomings of our study could partially inform future researchers. In summary, although our study did not find a genetic association between and paranoid schizophrenia, its possible role in the risk of schizophrenia cannot be definitively excluded. Further and larger studies are necessary to evaluate the effect of polymorphisms on the etiology of schizophrenia, and our data may provide a reference.

Medication-related weight gain is common among patients with bipolar disorder (BD). This affects treatment satisfaction and may lead to reduced adherence. Patient-centered care, as defined by the Institute of Medicine (IOM), is “care that is respectful of and responsive to individual patient preferences, needs, and values”. Ideally, care that is both patient-centered and evidence-based can lead to active patient engagement and good outcomes. Ziprasidone is a second-generation antipsychotic medication approved by the US Food and Drug Administration (FDA) for acute treatment of BD manic and mixed episodes and for BD maintenance as an adjunct treatment. Ziprasidone may have a minimal potential for weight gain and dyslipidemia.– This was a 12-week, uncontrolled prospective trial of patient-facilitated medication-switching among poorly adherent BD patients who self-identified medication-related weight concerns as their reason for non-adherence. Patients were asked to self-select the BD medication which they believed was causing weight problems. We anticipated that patient-choice–driven switching would lead to improved adherence. We also evaluated effects of patient-choice–driven switching on medication attitudes and clinical outcomes. We enrolled individuals ≥18 years of age with type I or II BD confirmed with the Mini International Neuropsychiatric Inventory (MINI). The study was approved by the institutional review board, all participants provided informed consent, and oversight included an external Data and Safety Monitoring Board (DSMB). All individuals were on maintenance BD medication (lithium, antipsychotic, anticonvulsant), had medication weight gain concerns, and poor adherence defined as missing ≥20% of prescribed BD medications as measured by the Tablet Routines Questionnaire (TRQ),, which was related to weight concerns. Individuals were excluded if they had a contraindication to ziprasidone, eating disorder, substance dependence, clozapine treatment, financial reasons for non-adherence, medical conditions that could interfere with protocol participation, or were at risk of harm to themselves or others. Pregnant and breastfeeding women were excluded. The study was conducted from January 2011 to July 2012. Participants completed assessments at baseline and at 2-, 4-, 8-, and 12-week follow-up. Treatment satisfaction was assessed at study endpoint, and post-study at 16 weeks. Descriptive statistics were calculated for baseline characteristics. We conducted a modified intent-to-treat analysis for subjects who received at least one dose of study medication. Separate longitudinal mixed models were fit with first-order autoregressive, AR covariance matrix, for the primary adherence and for the symptom measures with TRQ weekly and monthly, with YMRS, and with MADRS as the dependent variable. Fifty-five individuals were screened, 32 fit eligibility criteria and consented, and 30 were eventually enrolled. Age, sex, and race did not differ significantly between screened and enrolled patients. One consented individual did not complete baseline assessments and another had elevated liver function tests that were a contraindication to ziprasidone. illustrates baseline demographic and clinical variables. The mean endpoint dose of ziprasidone was 61.3 mg/day (standard deviation [SD]: 31.9, range: 20–120 mg/day). illustrates BD agents replaced in patient-choice–driven switching. The most common weight concern agents were quetiapine (N=7, 23%), aripiprazole (N=4, 13%), and olanzapine, lithium, and divalproex (all N=3, 10%). Nearly all (29/30) individuals readily identified the medication they perceived as most problematic for weight gain. In addition to ziprasidone, individuals were on other BD treatments including antidepressants (22/30, 73%), anticonvulsants (10/30, 33%), lithium (2/30, 7%), stimulants (1/30, 3%), and one individual on long-acting injectable risperidone (3%). Including ziprasidone, there was a mean of 2.2 BD medications (SD: 0.889, mode: 2, range: 1–4). Seven individuals (23%) received ziprasidone monotherapy. Six subjects (20%) terminated the study prematurely. Four (13%) were lost to follow up, one (3%) dropped out due to hospitalization, and one (3%) due to ziprasidone side effects (gastrointestinal [GI] distress). includes univariate analysis of TRQ change. Adherence improved from missing 48.6% of medication in the past week to missing 25.3%. and illustrate estimated TRQ weekly and monthly means with respect to time period using longitudinal mixed models. Time periods and sex were viewed as factor levels, and age was included as a covariate. Subject-level random intercepts were fitted as well. Time period factor -values for both TRQ weekly and monthly were <0.001, indicating that TRQ was significantly changed while sex and age were not significant. illustrates univariate analyses that show improvement in symptoms, attitudes, global psychopathology, mental component of the SF-12, and functioning. The physical component of the SF-12 was unchanged. Both depressive and manic symptoms improved. Time periods and sex were viewed as factor levels, and age was included as a covariate. Subject-level random intercepts were fit as well. Time period factor was significant for YMRS (=0.010) and MADRS (<0.001), while sex and age were not significant. As noted in , there were no changes in physical parameters, including BMI. Side effects that occurred in more than 5% of patients were sedation (N=20, 67%), GI disturbance (N=11, 37%), mild-to-moderate muscle twitching or contraction (N=6, 20%), restless/akathisia (N=3, 10%), and sexual dysfunction (N=2, 7%). There were six serious adverse events (SAEs), none of which were deemed by the DSMB to be study related. Four of the SAEs were hospitalizations due to suicidal thinking or suicide attempts in which ziprasidone was continued in three cases and stopped in one case. One SAE was a non-related car accident and one SAE was an emergency room visit for acute bronchitis. Treatment satisfaction information was available for 26 individuals. Of these, 24 (92%) strongly agreed or agreed that they were satisfied with ziprasidone, and 22 (81%) strongly agreed or agreed that they had less weight concerns compared to the previous offending agent. Twenty-three individuals (89%) agreed or strongly agreed that the benefits of ziprasidone outweighed the side effects. Among 17 individuals for whom post-study status was available, 16 individuals (94%) were still on ziprasidone. This open-label, uncontrolled trial of patient-driven medication-switching suggested that BD patients with poor adherence and medication-related weight gain concerns had improvements in adherence, medication attitudes, symptoms, and functioning. In spite of less weight concern, there were no differences in body weight. More than half of people with BD are poorly adherent and poor adherence is related to negative outcomes. Patient-driven medication-switching may help in engaging individuals to a greater extent in their own care. This is consistent with the importance of shared decision-making in psychiatric practice. In this study we allowed patients to make the choice as to which of their medications should be replaced. Atypical antipsychotics, lithium, and antidepressants were all sources of weight concerns. Patients welcomed the opportunity to provide input on pharmacotherapy decision-making and valued the consideration of relative burdens and benefits of their therapeutic regimen. Perhaps adherence and attitude improvement were related to individuals feeling that they had an active involvement in treatment. Symptom and functional status improvement may have been due to better adherence. Most individuals were satisfied with patient-facilitated drug-switching. In contrast to our initial expectation, we did not find a change in BMI. It is possible that because patients were poorly adherent to begin with, any weight change related to formally discontinuing a drug causing weight gain was obscured. Alternatively, since BMI is a difficult factor to change in people with serious mental illness, and our study did not include a diet or exercise component, it is perhaps not surprising that BMI was unchanged. In conclusion, actively involving BD patients with medication-related weight concerns in prescribing decisions improved adherence and weight concerns, but did not change actual body weight. The interpretation of the study findings must be tempered with the methodological limitations, including small sample and the uncontrolled open-label design. Additional studies involving patient-driven medication-switching in BD are needed.

In most cases, Alzheimer’s disease (AD) is preceded by a prodromal stage and amnestic mild cognitive impairment (aMCI) in which an individual’s memory is impaired to a greater degree than expected given the individual’s age, sex, and educational background, while the individual’s ability to perform the activities of daily living is preserved and the criteria for dementia are not met. A previous study reported that the conversion rate of aMCI to AD is 10%–15% annually, compared with 1%–2% among normal elderly individuals. Structural and functional abnormalities in the hippocampus have been documented in patients with aMCI and AD., Atrophy of hippocampal formation is a strong risk factor of AD progress. As the hippocampus plays a crucial role in spatial memory and navigation, it is generally accepted that patients with aMCI or AD show impairments in spatial orientation, navigation, and visuospatial short-term memory. Such deficits may lead to failure in navigating and remembering places. However, it is difficult to measure spatial memory deficits in real situations with a classic neuropsychological battery. Several studies utilized virtual reality systems to assess cognitive impairments related to degenerative changes to improve ecological validity.,– Previous studies reported that virtual navigation performance was impaired in aMCI and AD and that virtual environments provide valid assessments of navigation skills that are comparable to those required in real world navigation., Moreover, examination of spatial memory can be effectively performed using virtual systems, resulting in enhanced diagnostic power compared with classic neuropsychological testing. The virtual radial arm maze (VRAM), virtual Morris water maze, and virtual route learning are tools commonly used in assessments of spatial memory.– The VRAM, a human analogue of the radial arm maze (RAM) test used extensively to test spatial memory in small animals such as rodents,, has two merits to examine spatial working memory and reference memory simultaneously when compared to the virtual Morris water maze and virtual route learning. The current VRAM design uses a computer–human interface, and human subjects use monitors and joysticks to control their movements inside the virtual reality in which the classic design of RAM is implemented. The VRAM has been successfully used in human studies on sex differences in these two types of spatial memory, on working memory load in elderly patients, and on hippocampal activity. The hippocampus and prefrontal cortex of rodents and humans are involved in spatial navigation., Evidence from experiments with rodents indicates that memory functions involve information processing in the hippocampus and prefrontal cortex., However, spatial reference and working memory systems use different neuronal networks; the prefrontal cortex is involved in working memory, whereas the hippocampal region is involved in reference memory. A study in rodents also reported that deficits in the two types of spatial function have different patterns; reference memory deficits are common as a function of aging, but working memory deficits are not. As in rodents, spatial reference memory in humans is mediated by the hippocampus, whereas spatial working memory is more closely related to the frontal cortex., This study aimed to identify spatial memory impairment in patients with aMCI and AD using the VRAM and to determine whether the VRAM can differentiate between the two types of memory deficits. Beginning with the onset of aMCI, patients with AD typically show early changes in the hippocampus. Thus, we expected that both aMCI and AD patients would have reference memory deficits attributable to hippocampal atrophy. AD pathology is also associated with spatial working memory problems as measured by the Spatial Span Backward test. This may be related to the fact that prefrontal cortical atrophy is more prominent in AD than in aMCI. Therefore, we expected that spatial reference memory deficits would appear in both aMCI and AD patients and working memory loss would be found only in patients with AD. We also followed aMCI participants for 5 years to find a virtual navigation predictor of progression from aMCI to AD. Sixty older adults were recruited from the local community. The Institutional Review Board at Boramae Hospital approved the study protocol. All procedures in this study were in accordance with the ethical standards of the responsible committee on human experimentation and with the Helsinki Declaration of 1975, as revised in 1983. Eligibility criteria for participation were 1) age 60 years or older and 2) no known history of head trauma, brain tumor, stroke, mental retardation, or any severe medical, neurological, or psychiatric illness affecting cognitive functioning other than AD. Patients with mild depression were included only if their scores on the short form of the Geriatric Depression Scale were lower than 10. All participants were assigned to one of three groups: normal control (NC) (n=20), aMCI (n=20), or mild AD (n=20). The demographic characteristics of each group are presented in . The NC group had no memory complaints, scored in the normal range on standardized neuropsychological tests, and had no neurological abnormalities. aMCI patients met the criteria for aMCI initially proposed by Petersen: 1) memory complaints, preferably corroborated by an informant; 2) memory impairment relative to age- and education-matched healthy individuals (below 1.0 standard deviation); 3) intact general cognitive functioning; 4) largely intact activities of daily living; and 5) absence of dementia. AD was diagnosed according to the National Institute of Neurological and Communicative Diseases and Stroke/Alzheimer’s Disease and Related Disorders Association criteria for probable AD, and subjects were mildly demented, scoring 0.5 or 1 on the Clinical Dementia Rating (CDR) global scale. A trained psychologist administered the Korean Mini-Mental State Examination (MMSE),, CDR, and neuropsychological memory and visuospatial tests to the subjects. Visuospatial construction and memory were assessed with the simplified Rey figure test (SRFT). Working memory was examined using the Spatial Span Forward and Backward tasks to validate the VRAM. A trained psychiatrist made the clinical diagnoses in consultation with a consensus conference at which the clinical and neuropsychological data were reviewed. An original virtual maze program, which included a maze with six arms and “treasures” at the distal end of three arms, was used as the VRAM test tool (). Participants were told that they were in a virtual room with six arms extending from a middle area. The virtual room had various colored objects and visual cues to indicate the relative directions, and the room remained unchanged throughout each trial. Although participants were instructed to find the three treasures as quickly as possible, no time limit was imposed. After discovering all three treasures, the trial ended, and participants returned to the center of the maze to begin the next trial. Five trials were conducted, and the intertrial interval was 10 seconds. The same configuration of rewarded arms was used for all participants. This test measured working memory errors by the number of times a subject reentered the same arm; reference memory errors were measured by the number of times a subject reentered the arms with no rewards. Distance traveled and time required to find all rewards during each trial were also recorded. Differences in sex in the three groups were analyzed with chi-square tests. The mean age, years of education, and MMSE scores were compared using analysis of variance (ANOVA) of the three groups. Time latency, distance, number of working memory errors, and number of reference memory errors in the five trials of the VRAM test were compared using repeated measures ANOVA with the Bonferroni adjustment for multiple testing. We used Kendall’s tau-b to analyze the correlation between the VRAM results (working and reference memory errors, time, and distance traveled) and other neuropsychological memory tests to examine the concurrent validity of the VRAM. SPSS for Windows, version 16 (SPSS Inc., Chicago, IL, USA) was used for data analyses. -values below 0.05 were considered statistically significant. The sample consisted of 60 elderly individuals: 20 with AD, 20 with aMCI, and 20 NC subjects. Demographic data and mean MMSE scores are presented in . The groups had similar mean ages (=0.6, =0.53) and sex distributions (=0.81), but they differed significantly in years of education (=5.8, <0.05) and MMSE scores (=38.6, <0.05). Post hoc analysis revealed that those in the AD group were less educated and had lower MMSE scores compared with those in the NC and aMCI groups (<0.05). Repeated measures ANOVAs () revealed a significant main effect of number of trials on working (=8.0, =4, partial =0.37, <0.05) and reference (=20.0, =4, partial =0.60, <0.05) memory errors. All three groups committed fewer working and reference memory errors as the trials proceeded. Additionally, we found a significant effect of group on working (=12.0, =2, partial =0.30, <0.05) and reference (=17.7, =2, partial =0.38, <0.05) memory errors. According to the post hoc analysis, aMCI and NC participants committed a comparable number of working memory errors (=0.1), but both groups committed fewer working memory errors (<0.05) than the AD subjects. aMCI subjects committed more reference memory errors than NC subjects (<0.05) and committed a similar number of reference memory errors (=0.4) to AD subjects. We observed a significant main effect of trial on distance traveled to find the rewards (=20.3, =4, partial =0.60, <0.05); hence, all three groups traveled shorter distances to find the rewards as the trials progressed. A significant main effect of group on distance traveled to find the rewards (=17.8, =2, partial =0.39, <0.05) was also observed. Specifically, NC subjects found the rewards after traveling shorter distances than aMCI subjects (<0.05), and aMCI subjects found the rewards after traveling shorter distances than AD subjects (<0.05). Finally, the data reflected a significant main effect of trial on time latency to find the rewards (=20.0, =4, partial =0.60, <0.05). All participants spent less time finding the rewards as the trials proceeded. Moreover, we found a significant group effect of latency (=15.8, =2, partial =0.36, <0.05), revealing that NC subjects found the rewards more quickly than aMCI subjects (<0.05), whereas the time to find the rewards did not differ between aMCI and AD subjects (=0.18). After following patients who were tested 5 years ago, values of the latency, travel distance, and number of working and reference memory errors were compared between the aMCI converter and aMCI nonconverter groups. Despite the small sample, the aMCI converter group made significantly more reference memory errors on the VRAM than the aMCI nonconverter group (, <0.05). However, the groups did not significantly differ regarding latency (=0.08), travel distance (=0.53), and working memory errors (=0.1). shows the correlations between number of working and reference memory errors in VRAM trials, and neuropsychological test results of Spatial Span Forward and Backward, SRFT copy, SRFT immediate recall, and SRFT delayed recall. The numbers of working and reference memory errors on the VRAM had significant linear correlations with each other and with scores on all neuropsychological tests except the Spatial Span Forward. The present study found differences in the spatial memory abilities of NC, aMCI, and AD groups. Participants with aMCI made more spatial reference memory errors than NC subjects, but their spatial working memory seemed intact. AD subjects made more errors in both spatial working and reference memory than did NC subjects. The 5-year follow-up analysis showed that the aMCI converter group made more spatial reference memory errors before developing dementia than the aMCI nonconverter group. aMCI subjects traveled shorter distances on the VRAM to find the rewards than AD subjects, and were as slow as AD subjects in finding the rewards. presents the results of the VRAM. Unlike AD, aMCI seems to significantly affect reference memory, but not working memory. Spatial working memory functions have been found to be controlled by the prefrontal cortical area, which is damaged in the progress of AD,, and that spatial reference memory functions are affected by hippocampal atrophy that emerges early in the prodromal aMCI stage., A Y-maze study showed that spatial working memory may be preserved longer than spatial reference memory in transgenic mice expressing AD pathology. Therefore, our results suggest that the loss in spatial reference memory may happen earlier during the aMCI stage, before the spatial significant working memory loss associated with the progress of AD appears. In addition, the current results () indicate that spatial reference memory is significantly more impaired in aMCI patients who develop AD within 5 years than in those who do not. VRAM test results may be used to detect aMCI which can progress on to AD. aMCI and AD subjects took significantly longer than NC subjects to find the rewards. This impairment in locomotion is reportedly caused by a general deterioration in visual attention and visual processing speed, as well as by deficits in global cognitive ability and perceptual speed. Patients with aMCI also show attention deficits and process visual stimuli more slowly, although these impairments are less severe in aMCI than in AD. AD and aMCI patients are unable to disengage attention and use a visual cue to produce an alerting effect. Consistent with previous studies, aMCI and AD subjects showed increased time latency, reflecting a decline in visual stimulus processing and attention. Interestingly, aMCI subjects traveled shorter distances, but with a similar latency when compared to AD patients. This may be indicative of intact spatial working memory in aMCI which helped to prevent reentry into previously entered rooms despite decline in the ability to process visually the landmarks in the VRAM. The results of the VRAM had linear correlations with those of the Spatial Span Backward and SRFT tests. The statistical significance suggests that the VRAM’s ability to detect spatial memory deficits may be comparable to that of neuropsychological tests. However, the spatial working and reference memory errors in the VRAM tests were not significantly correlated with those in the Spatial Span Forward task (>0.05), which assesses passive short-term memory. Whereas the Spatial Span Backward test involves more active attention processes, the Spatial Span Forward test assesses only passive attention processes. Previous studies have indicated that passive short-term memories are more resilient and are less likely to be impaired in aMCI and mild AD, which is why the Spatial Span Forward test cannot examine spatial impairments in aMCI and AD, and it was not correlated with the VRAM results. This study has several limitations. Due to the small number of aMCI patients available for follow-up, significant differences in other spatial memory functions between AD converters and nonconverters may not be observed. In addition, although statistically significant, the linear correlations between VRAM results and the neuropsychological tests () were not strong. A larger sample size will improve the quality of statistical data in future investigations. We also assumed that we could completely separate the two different types of spatial memories by counting the number of reentries into emptied arms and selections of wrong arms. However, to test this hypothesis, future research should provide brain imaging analyses to find different brain activation during the occurrence of reference memory and working memory errors. u b j e c t s d i f f e r e d f r o m A D s u b j e c t s i n t h e i r i n t a c t s p a t i a l w o r k i n g m e m o r y , w h e r e a s b o t h a M C I a n d A D s u b j e c t s d e m o n s t r a t e d i m p a i r e d s p a t i a l r e f e r e n c e m e m o r y , s u g g e s t i n g t h a t t h e V R A M c a n h e l p t o d i s t i n g u i s h a m o n g d e f i c i t s a s s o c i a t e d w i t h n o r m a l a g i n g , a M C I , a n d A D . A d d i t i o n a l l y , t h e V R A M r e s u l t s r e g a r d i n g r e f e r e n c e m e m o r y e r r o r s m a y b e u s e f u l a s a c l i n i c a l m a r k e r o f p o s s i b l e f u t u r e d e v e l o p m e n t o f A D a m o n g c u r r e n t a M C I s u b j e c t s , a s s h o w n i n t h e 5 - y e a r f o l l o w - u p . O u r s t u d y s h o w s t h a t t h e V R A M c a n b e u s e d t o e x a m i n e i m p a i r m e n t s i n s p a t i a l w o r k i n g a n d r e f e r e n c e m e m o r i e s i n t h e e a r l y s t a g e o f A D .

C a n c e r p a i n i s a s e r i o u s h e a l t h p r o b l e m , a n d i m p o s e s a g r e a t b u r d e n o n t h e l i v e s o f p a t i e n t s a n d t h e i r f a m i l i e s . P a i n c a n b e e n c o u n t e r e d i n e v e r y s t a g e o f c a n c e r u n t i l t h e e n d o f l i f e , a n d m a y i n t e r f e r e w i t h t h e p a t i e n t ’ s t r e a t m e n t p r o c e s s , l e a d t o t r e a t m e n t r e f u s a l , a n d s u b s t a n t i a l l y i m p a i r q u a l i t y o f l i f e . T o d a y , a l t h o u g h m a n y t r e a t m e n t o p t i o n s f o r c a n c e r a r e a v a i l a b l e , t h e r e i s s t i l l n o c u r e f o r s o m e m a l i g n a n c i e s ; t h e r e f o r e , a p e a c e f u l e n d o f l i f e i s a p r i v i l e g e . A l l p r a c t i c i n g o n c o l o g i s t s m u s t b e c a p a b l e o f a s s e s s i n g p a i n , k n o w t h e p o s s i b l e u n d e r l y i n g p a t h o p h y s i o l o g y , a n d m a n a g e i t a p p r o p r i a t e l y . i t e r a t u r e s e a r c h w a s c o n d u c t e d o n N o v e m b e r 3 , 2 0 1 3 o n t h e P u b M e d a n d C o c h r a n e d a t a b a s e s u s i n g t h e f o l l o w i n g k e y w o r d s : n e u r o p a t h y , p a i n , c a n c e r , n e u r o p a t h i c p a i n ( N P ) , c a n c e r p a i n , o n c o l o g y , c h e m o t h e r a p y , p h a r m a c o l o g y , n o n - p h a r m a c o l o g i c t r e a t m e n t , g e n e t i c m e c h a n i s m s , r e s i s t a n c e , o p i o i d , c o a n a l g e s i c . A r t i c l e s r e p o r t i n g d a t a f o r c a n c e r a n d n o n c a n c e r p a t i e n t s a n d n e u r o p a t h y a n d N P w e r e c h o s e n t o b e e l i g i b l e f o r o u r r e v i e w . A b s t r a c t s o f t h e a r t i c l e s w e r e r e v i e w e d i n d e p e n d e n t l y b y t h e t w o a u t h o r s ( E E a n d S Y ) . T h e o r i g i n a l a r t i c l e s a n d r e v i e w s f o r w h i c h w e c o u l d o b t a i n f u l l t e x t s w e r e c h o s e n . A l l o f t h e r e f e r e n c e s c i t e d w e r e a g r e e d u p o n b y t h e t w o a u t h o r s . The International Association for the Study of Pain (IASP) defines NP as an unpleasant, multidimensional, sensory, and emotional experience associated with actual or potential tissue damage or described in relation to such damage., Pain can be described in two major categories: adaptive pain and maladaptive pain. Adaptive pain is a protective mechanism that provides survival benefit or contributes to the healing process. In contrast, maladaptive or chronic pain is a disorder that represents pathology of neural structures. Chronic pain has been defined as a pain that lasts beyond the duration of insult to the body or beyond the duration of the healing process.,, Pain can be categorized as two main types: nociceptive pain, which is developed by a noxious stimulus to a tissue (somatic nociceptive pain) or to a visceral organ (visceral nociceptive pain), and N P, which arises from abnormal neural function as a result of direct damage or indirect insult to a neural tissue involved in pain processing. Pain can be also be described according to the response given to underlying altered sensation. This terminology is summarized in . Neuropathy is the result of pathological change or functional disturbance in nerves. If only one nerve is affected, it is called mononeuropathy. When only a few nerves are affected, this is described as mononeuropathy multiplex; if nerves are affected diffusely and bilaterally, than it is called polyneuropathy., Although the IASP first published its pain terminology in 1979, neuropathy was included in this list only after 1994., The original definition of NP involves both lesion and dysfunction. In a broader sense, this could easily define the neuropathy, but the term “dysfunction” created some arguments in the literature in 2002 and 2004. The definition was narrowed by the IASP so that neuropathy consists of a lesion either in the peripheral nervous system (PNS) or the central nervous system (CNS) or both. As the nature of this type of pain is studied further, the excitability and plasticity of the nervous system become increasingly important, so treatment approaches have focused on pathophysiology rather than etiology. The Neurology and Pain Community introduced a new definition in 2008 in order to clarify the issue, which defines neuropathy as a pain arising as a consequence of either a lesion or disease affecting the somatosensory system. This definition is good in terms of classification of neurological diseases, but NP is a condition that involves multiple specialties. Generally speaking, NP can be subdivided into three categories: sympathetically mediated pain, peripheral NP pain, and central pain. Sympathetically mediated pain arises in a PNS tissue, but is associated with autonomic changes (formerly known as reflex sympathetic dystrophy). Peripheral NP occurs due to damage to PNS components without the involvement of the autonomic system. Central pain stems from abnormal CNS activity. The current National Comprehensive Cancer Network (NCCN) Clinical Practice Guidelines for Adult Cancer Pain (version 1.2013) follows the IASP definition, but also broadens and specifies the assessment of cancer patients, since this category may include more pathophysiologic pathways than others. The NCCN guidelines describe a detailed assessment regarding to both etiology and pathophysiology, as well as specific cancer-related syndromes. These guidelines are also important in that they draw attention to NP as a medical emergency. Still, there is no consensus on the definition and assessment strategies of NP. Future studies are thus needed to find a better definition to standardize language in the literature. italic #text Pain can be the presenting symptom of cancer in an otherwise healthy patient or emerge as disease progresses. It may also develop as a treatment complication. It is estimated that 50%–90% of cancer patients encounter pain in their lifetime., In a recent study from Europe, 670 of 1,051 patients were recorded as having pain. Pain in cancer patients can result from the tumor itself invading or destroying bodily structures, from side effects of treatment modalities, and from comorbid diseases. Cancer pain syndromes can be either acute or chronic. Acute pain is most frequently associated with diagnostic or therapeutic interventions related to cancer. Diagnostic approaches directly harm tissues, especially nerves, resulting in pain. Chemotherapy/radiotherapy induces acute pain at the beginning of treatment or as a side effect (). Chronic pain in cancer can be directly tumor-related or due to treatment strategies. Chronic cancer pain syndromes are summarized in . In the acute setting, cancer pain is troublesome but easier to handle. Pain becomes more disturbing and disappointing for patients and physicians as time passes. Whether cancer pain is either acute or chronic, it must be identified, assessed, and treated dynamically. Bennett et al estimated that 18.7%–21.4% of cancer patients have neuropathic cancer pain (NCP). According to their systematic review, the prevalence of pain syndromes associated with NCP is 19%–39.1%. Recognition of NCP is especially important, since different treatment strategies may be required to successfully overcome it. NCP is characterized by patients as a spontaneous burning-like sensation and/or intermittent sharp, stabbing-like pain mostly felt at night. Also, patients report burning-like pain sensations in a stocking-and-glove pattern. NCP can be seen in conjunction with motor deficits, deep sensory loss, loss of proprioception and also with dysmotility of enteric organs, bladder dysfunction, pupillomotor abnormalities and orthostatic hypotension. These additional symptoms worsen the quality of life more, since daily life requirements like dressing and combing hair are affected in addition to functionality. The relationship between the etiology and type/pattern/symptomatology of pain is complex and not well understood. NCP is a multistep process, which explains the presence of diverse clinical presentations. This is why combination-treatment options are necessary for effective pain relief. Besides cancer-related pathologies, disorders like diabetes that already exist can lead to NP or worsen the situation. Psychological conditions, mood disorders, and personality type may influence pain perception and intensity.– NCP arises from physical or chemical damage to peripheral or central neurons or in the neural conduction system. Direct nerve damage by tumor pressure, invasion of nerve structure and resulting entrapment, hypoxia, or chemical changes in the tumor microenvironment like inflammatory signaling, proinflammatory cytokine production, and release of tumor algogens can result in NCP. There is a growing body of information on the subject of inflammation in relation to cancer. Inflammatory cells and cytokines are accused of having a role in the development of cancer complications, in addition to carcinogenesis, tumor progression, and metastasis. The neuropathic process and NCP is the intersection of complications of cancer and inflammation. Macrophages and microglia were investigated in the plasticity of visceral neural plexuses, dorsal root ganglion, spinal cord and CNS broadly.,,, Mast cells were found to be increased in pancreatic cancer with NP. Autonomic and enteric neuropathies (eg, in gastric paresis or NCP in pancreatic cancer) have an association with inflammatory signals and neuritis. Neural plasticity could have a role in the CNS and PNS, and may interact with other carcinogenetic mechanisms., These changes are more unique to NCP than noncancer NP.,, Bone metastasis is an important part of NCP. Bone is a prevalent metastasis site, and related pain mechanisms are diverse. NCP related to bone metastasis is time- and energy-consuming for patients and physicians. The afferent sensory fibers of bone, periosteum, osteoclasts, and bone-remodeling balance are important in the development of NCP. Metastatic cancer cells can invade the sensory fibers and initiate pain. Increased osteoclastic activity diminishes bone strength, and thus pathological microfractures can happen, resulting in pain. Mechanical distortion and pressure to the periosteum is the third factor that leads to pain.– NCP can be broadly categorized as peripheral (tumor infiltration/pressure, pain due to treatment complication) or central (spinal cord or CNS involvement or treatment-complication pain). NCP can also be divided into subgroups, such as pain directly related to tumor involvement, pain associated with chemotherapy, neuropathic syndromes associated with paraneoplastic syndromes, and pain associated with radiotherapy or surgery related NCP. Surgery results in physical damage to afferent neurons, and may cause phantom pain. Radiotherapy creates a hypoxic environment, and hypoxic nerves are more vulnerable. In the long term, chronic hypoxia leads to fibrosis in perineural tissues and causes late onset NP and NCP even in cancer-free survivors., Paraneoplastic neuropathies can be encountered during various malignancies, such as small-cell lung cancer, thymoma, and hematological malignancies, ie, lymphomas. Although the classical feature of paraneoplastic neuropathy is a subacute sensory neuropathy, it can present as sensorimotor neuropathy, brachial plexopathy, vasculitic neuropathies, and autonomic neuropathies also. These paraneoplastic neuropathies may be related to onconeural antibodies, a term used to describe the antibody secreted from neoplasm or its metastasis that reacts to normal nervous tissue components. Voltage-gated potassium and calcium channels and the collapsin response-mediator protein 5 can be potential targets, and anti-Hu antibodies are responsible most of the time. However, most of the time, none of the known antibodies can be identified. The diversity of symptoms of paraneoplastic neuropathy ranges from paresthesias, pain, and muscle weakness to limbic encephalitis, dysautonomic motility problems (gastric or enteric pseudo-obstruction), and orthostatic hypotension., These paraneoplastic neuropathies may be associated with pain. Paraneoplastic neuropathies can be confused with other types of malignancy-associated NP syndromes and complicate the treatment process. These definitions make NCP easier to understand and recognize in the clinical setting, but generally they do not differ in relation to treatment. Common NCP syndromes are summarized in . Pain associated with infectious neuropathies is a main concern during cancer treatment. Infectious neuropathies are a group of disorders mainly encountered with leprosy, hepatitis C virus, and human immunodeficiency virus (HIV) infections, Lyme disease, and varicella zoster virus (VZV) infections. VZV reactivation is the most common infectious disease associated with increased risk of neuropathy. It poses a 10%–20% lifetime risk of ganglioneuritis in the general population. VZV is a neurotropic virus of the human α-herpes virus family. It can cause chickenpox as a primary disease, and can stay latent in neurons of autonomic ganglia, dorsal root ganglia, and ganglia of cranial nerves. Also, the inactivated viruses in VZV vaccine can become dormant. The latent viruses become important as cellular immunity decreases naturally (ie, the aging process) or as a complication of treatment (ie, cancer patients). Reactivation of viruses results in the development of a maculopapular pruritic rush and dermatomal distributed pain. VZV infection may be followed by multiple neurological complications (encephalitis, meningitis, vasculitis, motor radiculopathies, necrotizing ocular disease, and most commonly postherpetic neuralgia [PHN]).– PHN is an NP syndrome that is persistent after 30–90 days of the healing of a zoster-infection rash. The replication process of viruses destroys the neurons in ganglia and causes the pain syndrome in diverse clinical presentations from allodynia to dysestesia. PHN risk can be estimated from the intensity of pain in the acute zoster-infection period. However, antiviral therapy to slow down the pathophysiologic mechanism of ganglia injury has not yet been proven., The latent zoster infection and the PHN associated with VZV pose a great burden, especially in immunocompromised patients (hematological malignancies, solid-tumor patients treated with chemotherapy, solid-organ transplant patients, and HIV patients), who have higher reactivation rates.,,– The VZV-reactivation rate is as high as 50% in hematopoietic stem cell transplant patients without a prophylactic regimen, and is also higher in patients treated with purine analogs and novel agents like proteasome inhibitors or alemtuzumab. PHN can be treated with tricyclic antidepressants (TCAs), gabapentin, pregabalin, long-acting opioids, or tramadol; moderate evidence supports the use of capsaicin cream or a lidocaine patch as a second-line agent. The details of treatment options will be discussed later. Among all mechanisms, it is estimated that a greater proportion of NCP will be caused by cancer chemotherapy., In a recent European survey, the proportion of chemotherapy-induced NP (CINP) pain among other NCP types was 32.6%. There are several reports showing that CP and NCP were diagnosed and treated inefficiently.,, Special attention should be given to common mechanisms of NCP in order to understand better and treat accordingly. The development of more sophisticated chemotherapeutics and optimal-use older drugs enables cancer patients to have excellent outcomes, with more cure potential, and a longer survival chance even if no cure is possible. On the other hand, this improvement may result in serious acute or chronic side effects for “survivors”. Neuropathy is one of those side effects that is encountered frequently. The vague symptomatology, indeterminate terminology to define it, and lack of really adjustable and applicable diagnostic criteria lead to underreported NCP by patients and physicians., Still, CINP is the main syndrome among the NCP types. Chemotherapy-induced neuropathy and CINP depend on the agent used, duration and dosage of treatment and also coexisting other neuropathic disorders. Although the risk of NP complication is specific to the drug itself, the clinical symptoms and signs of neuropathy and NP are very similar between drugs. Sometimes, the effects are seen as acute or subacute onset, but insidious development is more frequent. The main chemotherapeutic drugs responsible for NCP and CINP are shown in .,,, Cisplatin is a mainstay of many chemotherapy regimens for diverse cancer types, such as lymphoid malignancies, lung cancer, and genitourinary cancer. When utilized, the rate of curing testicular cancer rapidly increased. However, neuropathy is the dose-limiting adverse effect of treatment in some of these patients. Cisplatin causes axonal neuropathy, which mostly affects large sensory fibers. Although the primary involved site is the dorsal root ganglion, the peripheral nerve may be involved. Patients complain of paresthesias and some degree of motor loss. Temperature sensation is spared, although proprioception and reflexes are lost. Autonomic neuropathy is encountered less often than sensory and motor neuropathies. The onset can be subacute or chronic; usually, NP and NCP occur months later (3–6 months), or sometimes the symptoms become evident after the chemotherapy cycles have finished. Although cisplatin neurotoxicity is dose-related, NP is more common with increasing dosages, and there is substantial variability among individuals for sensitivity. Cisplatin-associated electrolyte imbalance can contribute to the neurotoxic process. On pathological examination, both demyelination and axonal loss can be evident. Symptoms may continue with decreasing intensity after months or even years.,, Although there are some data about the prevention of cisplatin neurotoxicity with utilization of vitamin E and amifostine, a Cochrane meta-analysis could not find any beneficial effects of preventive strategies. Oxaliplatin is a new type of platinum-class drug. It is effective mainly in colon cancer as well as in other gastrointestinal malignancies. It has a different NP profile than cisplatin. It can cause acute dysesthesia within hours, even during infusion and/or painful abdominal pain. Similar to cisplatin, it can cause cumulative sensory NP in a chronic setting. The acute symptomatology consists of painful muscle cramps, paresthesias in distal extremities and the perioral region and rarely priapism. These symptoms can be aggravated by cold exposure. Acute toxicity is believed to be the result of calcium chelation, leading to activation of low-calcium voltage-gated channels in peripheral nerves. The dose-limiting neurotoxicity is the late onset, cumulative, sensory, symmetric distal axonal neuropathy. There is no motor involvement. Similar to cisplatin, oxaliplatin forms deoxyribonucleic acid adducts, especially in the neurons of dorsal root ganglia. The main problem with oxaliplatin NP is that it also affects proprioception and can cause urinary retention. Therefore, quality of life is further decreased., In contrast to cisplatin, oxaliplatin neurotoxicity may be reversible after discontinuation of treatment. Gemcitabine is a purine analog used for treatment of pancreatic cancer, lung cancer, and bladder cancer. Neuropathies in a wide spectrum can be encountered with gemcitabine therapy, from mild paresthesias to severe peripheral and autonomic neuropathies. Taxanes as microtubule inhibitors are another major group of drugs responsible for NCP, but their role in oncology practice is also incontrovertible. They are used mainly in breast cancer, lung cancer, and ovarian neoplasms. They give patients the chance to survive longer and remain mostly disease-free. However, NP and NCP significantly decrease their quality of life. In general, taxanes affect sensory neurons related to vibration sensation and proprioception. The symptomatology of neuropathy associated with taxanes includes peripheral burning-like sensations and numbness, paclitaxel-associated acute pain syndrome (which is characterized by arthralgias, myalgias, and numbness that begins within 1–2 days following treatment and lasts 4–5 days), motor neuropathies, and rarely autonomic neuropathy., Neurotoxicity is dose-related. Coexisting neurotoxic diseases and chemotherapeutic agents that are used in combination are also important in the NCP process. Taxane and platinum compound neurotoxicity is synergistic. Both taxanes and platinum-group drugs can cause axonopathy and neuronopathy (damage to neurons in dorsal root ganglia). The difference between them is important for NP prognosis. Neuronopathy is accepted as a more progressive, irreversible process compared to axonopathy. Docetaxel causes both sensory and motor neuropathy, though these are less frequent. Nab-paclitaxel is a new member of the taxane group of drugs for which clinical experience is low. There are studies showing that its neurotoxicity profile is similar to docetaxel both in prevalence and intensity. The acute painful neuropathy syndrome can be observed more frequently with nab-paclitaxel. Cabazitaxel is another new drug that is approved for the treatment of castration-resistant prostate cancer. NP was reported as 13%–17%, with severe NP less frequent. Vinca alkaloids are effective anticancer agents due to their antimicrotubule activities. Vincristine is the most neurotoxic drug of the available drugs in the vinca alkaloid class. Both sensory and motor neuropathies can be encountered. It can cause NCP, painful paresthesias in hands and feet, and muscle cramps. The onset of NP can be acute or subacute, and NP can last even after discontinuation of the drug. Comorbid neuropathic diseases and concurrent use of hematopoietic colony-stimulating factors can increase the NP and NCP. It is important to note that autonomic neuropathies can be encountered with vincristine. Abdominal pain, constipation, and even paralytic ileus may develop. Impotence, atonic bladder, and postural hypotension may develop, but are far less common. Vincristine can cause focal cranial mononeuropathies, as seen in oculomotor neuropathy, or in the optic nerve and facial nerve. Patients with mild neuropathy may continue with standard doses of treatment, but if symptoms increase in intensity, the dose should be reduced or the drug must be totally canceled from the regimen. The recovery process takes more time. There are data suggesting glutamic acid use for prophylaxis of vincristine NP, but the evidence level is not strong enough to apply in clinical practice. Although there is a risk of NCP with vinblastine and vinorelbine, the severity is less than compared to vincristine. Ixabepilone (an epothilone-class microtubule inhibitor) and eribulin (derived from a marine sponge) are two new drugs with antimicrotubule inhibitor effects., Both of them were reported to be associated with NP. Ixabepilone may cause autonomic NP in addition to sensory NP. Grade 3–4 NP with ixabepilone occurs in 6%–24% of cases, and dose reductions are advised in such cases. Thalidomide is a potent antiangiogenic agent that is used especially for multiple myeloma. It has a cumulative, dose-dependent NP side effect. The neuropathy of thalidomide presents as symmetrical distal sensory NP and motor NP. The underlying pathology is suggested to be toxic axonopathy. The dose-limiting toxicity is the NP, but NP is only partially reversible, even after the discontinuation of therapy. Autonomic NP is also common, especially in senior adults. This can complicate the treatment process of myeloma in the elderly, since NP may present as bradycardia and also constipation and impotence. Lenalidomide is a second-generation drug with more potency but less neurotoxicity. Bortezomib is a member of a new class of chemotherapeutics called proteasome inhibitors. It is a reversible 20S proteasome-complex inhibitor, acting by disrupting the cell-signaling process, leading to cell-cycle arrest, apoptosis, and inhibition of angiogenesis. In 2003, it was approved by the US Food and Drug Administration for refractory multiple myeloma. Later, bortezomib gained importance in the treatment of early stages of myeloma and other hematologic malignancies (ie, mantle-cell lymphoma). There are ongoing investigations in the treatment of solid malignancies with bortezomib in combination with other chemotherapeutic agents., Peripheral neuropathy is a dose-limiting toxicity of bortezomib, usually presenting as length-dependent axonal neuropathy distributed in a stocking-and-glove pattern. In addition, patients may develop demyelinating polyneuropathy and sensory ganglionopathy. The effects on neurons or axons are dose-dependent, usually evident with the first cycle of chemotherapy, and increase in severity as treatment continues., Reversibility of neuropathy has been shown to be up to 80% in various trials.,– Ixazomib, marizomib, and carfilzomib were developed as irreversible proteasome inhibitors. In clinical trials, they are associated with less neuropathy risk than observed with bortezomib., The diverse heterogeneity of pain syndromes in cancer patients makes them also difficult to assess, score, and handle. Therefore, a detailed patient history and a meticulous clinical examination are necessary steps to confirm the diagnosis of NP and NCP. Past history with particular attention to comorbidities and family history of any neurological diseases are important in terms of the risk of developing NP. Medication history should always be kept in mind, as drug interactions and cumulative neurotoxicities are common in NCP treatment. It is important to assess the severity of pain by a pain-assessment scale (visual analog scale, brief pain inventory or its short form [BPI-SF], memorial pain assessment). Particular attention should be given to location, radiation, frequency, and aggravating factors of pain. Standardized screening tools, such as the NP questionnaire, PainDetect, and ID-Pain have been developed. Although these screening tools cannot identify 10%–20% of patients with NCP, they offer guidance to clinicians. Moreover, the impact of pain on patients’ daily living, functional status, emotions, social functions, and sleep should be assessed. A bedside examination should include the examination of components that include touch, pinprick, pressure, temperature, vibration sensation, and temporal summation. Touch can be assessed by gently applying cotton wool to the skin, pinprick sensation by the response to sharp pinprick stimuli, deep pain by gentle pressure on muscle and joints, and cold and heat sensation by measuring the response to a thermal stimulus (eg, by burettes filled with hot and ice-cold water). Vibration can be assessed via a tuning fork. Abnormal temporal summation is the clinical presentation of neuronal activity after repetitive noxious stimuli, which can be evoked by mechanical and thermal stimuli. There are several different electrophysiological methods to quantify neurologic dysfunction that can help to identify patients with NP and NCP. Nerve-conduction and electromyography studies, provocative nerve testing, functional brain imaging, and skin biopsy for nerve-ending pathologies are tests that are beneficial., However, none of these modalities has been validated in cancer patients, and they are not in widespread use. Their use needs physician expertise and special resources, and they are not practical to use in everyday practice. The first approach for a patient at risk of NP is the prevention of NP. However, there is no strong evidence in favor of agents that are used for prevention of NCP.,, Since the pathophysiology of NCP is complex, long-term management of NCP is challenging for physicians dealing with cancer patients., Decades after the publication of the World Health Organization (WHO) analgesic ladder, cancer pain is still a burdensome symptom for patients. NCP is even more complicated, since the pain mechanisms are complex and integrated with one another. Today, many of the guidelines accept data extrapolated from nononcological pain studies as evidence for treatment of oncological patients with pain and NCP.,, European and NCCN guidelines follow the revised WHO orders to treat pain in cancer. The WHO recommends starting the treatment in a stepwise manner and following the patient for symptom relief and side effects., There are opioid and nonopioid treatment options for pain relief in cancer patients. In the following section, pharmacological treatment options will be briefly discussed, and detailed information of adjuvant analgesics will be provided. Mild cancer pain (eg, pain-intensity rating as 1–3) is treated with nonopioid analgesics. Paracetamol and/or non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs of choice., They are beneficial for bone and soft-tissue pain. Hepatic toxicity should be kept in mind for paracetamol, while cardiac, gastric, and renal side effects and thrombocytopenia/platelet dysfunction are important considerations in the use of NSAIDs. There is no evidence to support a particular NSAID over any other in terms of safety and efficacy. Even if the pain is not alleviated with NSAIDs, these drugs should be continued with opioids. Opioids are the mainstay of therapy in cancer patients. Treatment of pain beyond mild intensity needs the implementation of opioids to treatment. Weak or short-acting opioids (eg, codeine, dihydrocodeine, and dextropropoxyphene), drugs with mixed effects (tramadol, tapentadol), and partial opioid agonists (transdermal buprenorphine) are advised if the result with nonopioid analgesics was not satisfactory., There are some controversies about this approach. To start, there is not enough evidence that adding a short-acting opioid is better than a nonopioid treatment. Second, the use of low-dose strong opioids or low-dose morphine can be more effective than short-acting opioids., Codeine is a prodrug, and has to be changed into morphine-6-glucorinide in order to show its effect. Due to genetic polymorphism in the metabolism of this drug, it may not be effective in 10%–30% of the population. Regarding drugs used for moderate-intensity pain, tramadol deserves special interest. It is a centrally acting drug, with both opioid activity and monoaminergic properties. Tramadol has good bioavailability and has been proven effective in the treatment of strong pain and NP. The risk of serotonin syndrome prevents its use in combination with monoamine-oxidase inhibitors. The side-effect profile is similar to other opioids, except constipation incidence is less. Even at maximum doses, its effects are less than other opioids. Tapentadol is a μ-opioid analgesic with a norepinephrine reuptake-inhibitory effect. Although most of the data about the efficacy of tapentadol comes from nononcological trials, it has been shown to have a moderate analgesic effect. The gastrointestinal side effects of tapentadol may be lessened. Once the pain cannot be modified any further, rather than combining short-acting or weak opioids with each another, it is recommended that longer-acting and strong opioids be used. In each step of pain treatment, coanalgesics may be added to treatment, as will be discussed further in detail. The strong opioids are used in severe pain syndromes alone or in combination with nonopioid analgesics and/or coanalgesics. These drugs include morphine, hydromorphone, methadone, and fentanyl. Pethidine was used for this intent, but is no longer recommended, because of the accumulation of a neurotoxic metabolite. Morphine, oxycodone, and hydromorphone are effective drugs for pain management. Each of these could be the first choice of drug in personalized treatment of cancer pain. Morphine used to be the standard choice for pain treatment in cancer patients for decades. It is available in a wide variety of formulations, and can be used via oral, rectal, and intravenous routes. There is a risk of active metabolite accumulation in patients with renal failure. Oxycodone is a synthetic opioid that can be used orally or parenterally. It has no active metabolite, and is therefore safe to use in comorbid kidney disorders. Additionally, it has clinical efficiency in NCP and visceral pain. Naloxone is a peripheral μ-receptor antagonist used in combination with oxycodone to overcome constipation, one of the most common and refractory side effect of opioids. Safety and efficacy of this combination was shown in a recent trial. Hydromorphone is a semisynthetic opioid with three- to fivefold the potency of morphine. Similar to morphine, it has an active metabolite that is dialyzable, allowing its use in patients on dialysis. Transdermal fentanyl is a potent, effective alternative to oral, slow-release opioids that is preferred by oncologic patients incrementally. The bioavailability depends on absorbance through the skin, since cachexia can reduce its efficacy. Transdermal fentanyl should not be used as a first line drug in patients, for whom their pain may be clinically stabilized with other opioids. It is typically the treatment of choice when a patient has difficulty in swallowing or poor compliance, and it should be used in caution in patients with risk of sedation. Methadone is an NMDA antagonist. Although it has a bad reputation for being used in drug abuse, it is a useful drug when applied by experienced pain physicians. Its unpredictable half-life and risk of accumulation and toxicity prevents the use of methadone in everyday practice. One of the main barriers to effective pain management for oncologic patients is the fear of drug addiction and/or common and worrisome side effects. Although most of the mentioned opioid drugs proved to be addictive in an otherwise painless individual, that fear was shown to be unfounded in oncologic patients suffering from moderate-to-severe pain. The classical side effects of opioids vary, and are listed in . Constipation is the most common continuing adverse effect, and is related to blockage of peripheral μ-receptors. Laxatives should be applied with the first few days of opioid institution. Stimulating laxatives are necessary to prevent and overcome the constipation. Naloxone in combination with oxycodone is effective in this setting. Mild drowsiness is also common, but generally dissipates or decreases in severity with the development of tolerance. If treatment is prolonged, an opioid switch should be considered. Emesis is a side effect of opioids to which tolerance develops within first few days of opioid initiation. Emesis can be managed with antiemetics. If the emesis continues, a change of route of administration can help or an opioid switch can be considered. Opioid-dose reduction and combination with coanalgesics may improve the adverse effects. Guidelines recommend use of the opioids with nonopioid analgesics and adjuvant analgesic or coanalgesics.,, The term “coanalgesic” means that a drug is intended to play another role in the pharmaceutical market but potentially useful when added to opioids in pain management. Coanalgesics should be utilized when opioid response is poor or no more titration of the dose is possible because of inevitable side effects. The addition of a second analgesic makes the control of both the pain and side effects easier. Coanalgesics can be used at every step of the WHO ladder, but are generally added by physicians when difficulties occur during pain management concurrent with increased severity or side effects. Management of NP is a challenge. Control of NCP usually requires higher doses of opioids then what is tolerable, thus the need for adjuvant analgesics or coanalgesics. The coanalgesic drug group include gabapentinoids (gabapentin, pregabalin), antidepressants (TCAs, duloxetine, and venlafaxine), corticosteroids, bisphosphonates, NMDA antagonists, and cannabinoids.,,, Although it is criticized frequently, the most common approach to compare clinical trials is to compare the number-needed-to-treat and number-needed-to-harm values of drugs. These coanalgesic drugs have number-needed-to-treat values of 3–5, which are within the therapeutic interval., In the following section, coanalgesic drugs will be described in detail. #text The analgesic effects of selective serotonin-reuptake inhibitors are not well established, as there is not enough clinical evidence., The selective serotonin–norepinephrine inhibitors (SNRIs) venlafaxine and duloxetine are the drugs of choice in NCP, although the main evidence of their effectiveness in NP was established in studies on diabetic neuropathy. Venlafaxine is the first SNRI to be effective in NP. In a well-designed study comparing venlafaxine and imipramine, both were found to be equally effective. The dosage is important, since lower dosages (<75 mg) are ineffective in NCP, and higher doses are required (>150 mg). Acute oxaliplatin toxicity can be successfully treated with venlafaxine. Elevation of blood pressure is a risk during venlafaxine treatment, and regular monitoring is necessary. The main side effects are gastrointestinal disturbances, but rarely result in drug discontinuation. Venlafaxine dose should be reduced in severe hepatic and renal insufficiency. In comparison with duloxetine, venlafaxine was found to be more effective but with more side effects. Duloxetine is a relatively new agent in the SNRI family. It has been found to be more effective than placebo., Dose titration of duloxetine should be done in no less than 2 weeks, as the effect of drug begins in that period. It is a better agent, since no cardiotoxicity has been reported yet. Doses of 60–120 mg are efficient, but lower doses are not. Venlafaxine has been found to be effective in postmastectomy pain syndrome after breast cancer surgery. In respect to CINP, duloxetine is more effective than placebo, and can be considered in first-line therapy. Bupropion is an antidepressant with norepinephrine and dopamine reuptake-inhibitory effect. It acts both centrally and peripherally. Bupropion is distinguished from other antidepressants in its efficacy for stimulation in the CNS. It can be used as a first-line drug in patients who are suffering from fatigue or somnolence in addition to NCP. This drug should be used with caution in patients prone to seizures. Bupropion can have a negative effect on cancer patients who are already prone to cancer cachexia.,, Nowadays, physicians dealing with pain focus on disease-modifying therapies rather than simply modifying the symptoms. One of the main pathophysiologic mechanisms of NP is hyperexcitability Understanding of the importance of hyperexcitability enabled the use of antiepileptic drugs in NCP. The main antiepileptic drugs employed in NCP are gabapentinoids (gabapentin and pregabalin). They act by inhibiting calcium channels on terminals of afferent nociceptors. Both drugs have established efficacy, mainly in diabetic NP and PHN, but pregabalin trials are more focused on central mechanisms. NMDA is an excitatory neurotransmitter. Its role is significant in chronic NP, since the balance is disrupted between excitation and inhibition. Ketamine is a potent NMDA antagonist among the family, and acts by inhibiting dorsal root ganglia. It is also known to have anti-inflammatory effects; theoretically, it should be a good agent for NCP relief. Its analgesic effect is at subanesthetic doses. However, at lower doses, its serious side effects limit its use., In two recent prospective trials, it was not found to be effective as an adjunct analgesic to opioids, although some controversies exist.– The use of ketamine should be reserved for resistant NCP patients, and only applied by pain professionals. There are insufficient data regarding the efficacy and safety of other NMDA antagonists. Magnesium is an economical and effective approach for the prevention of CINP of oxaliplatin. Especially when infused with calcium, it may decrease resulting numbness, cramps, and difficulty in swallowing. In a recent review, magnesium and calcium infusions were found to be effective in the prevention of CINP. Topical analgesia has the potential to be a useful adjunct to treatment of NCP with opioids and/or coanalgesics. The main two groups of drugs that are in use for NP are lidocaine and capsaicin., Lidocaine relieves pain through nonspecific blocking of sodium channels on afferent fibers. Its use is convenient, since no systemic absorption occurs, and only local side effects are seen. Topical lidocaine is available as a 5% patch or gel. Topical lidocaine is effective in peripheral neuropathy syndromes with allodynia.– It has been used in CINP and postsurgery in breast cancer patients. Topical lidocaine treatment achieved a sufficient level of analgesia in 50% of patients in a 2-month to 4 year-period. Although absorption is minimal, it should not be used with oral class I antiar-rhythmic drugs. Capsaicin is a natural product found in chili peppers, and is a special ligand of transient receptor potential vanilloid 1 (TRPV1). When capsaicin binds to TRPV1 receptors, calcium influx occurs on heat-receptor membranes and leads to desensitization, and in the long term results in depletion of substance P. There are topical low–moderate dose (0.075%–0.04%) capsaicin preparations, but insufficient data and inconsistent results. The high-dose patch contains 8% capsaicin. The benefits of high-dose preparations have been shown in NP and HIV neuropathy. Common side effects include local erythema, edema, itching, and initial pain necessitating opioids. High blood pressure can be the result of intense pain associated with the drug, and it should be monitored closely. Tapentadol is a new synthetic opioid drug that has an inhibitory effect both on μ-opioid receptors and central norepinephrine uptake. It has a lower affinity for μ-receptors than strong opioids have. In Phase II and III studies, the efficacy of tapentadol has been proved in comparison to placebo and oxycodone., Regarding safety, it has been hypothesized that due to low μ-receptor affinity, the drug could have fewer opioid side effects. In 2012, Merker et al published a meta-analysis of reported adverse effects in tapentadol in randomized clinical trials. Typical gastrointestinal side effects (emesis and constipation) were found to be significantly lower, although xerostomia was higher in the tapentadol-received group of patients (relative risk 1.79, 95% confidence interval 1.40–2.29). Those randomized controlled trials were all nononcological trials. Mercadante et al conducted a tapentadol trial in opioid-naïve cancer patients. At the end of the study, patients all had a response, with decreases in pain intensity and with no increment of adverse effects. Although the evidence regarding tapentadol is not conclusive yet, its use holds promise. Cannabinoids are compounds that are effective for pain relief, appetite enhancement, and suppression of emesis via acting on endogenous cannabinoid receptors by imitation of endogenous ligands., There are two types of endogenous cannabinoid receptors (CBs): CB is active on the CNS, and CB is prevalent in the periphery. δ-9-Tetrahydrocannabinol is a partial CB and CB agonist. The therapeutic potential of cannabinoids has been investigated in chronic pain extensively. In animal models, cannabinoids and opioids were shown to be synergistically effective., The oromucosal cannabinoid form is effective in NP associated with multiple sclerosis and peripheral nononcological NP.,, In 2012, a novel cannabinoid agent, nabiximols, was studied in a double-blind study of cancer patients. Although the effect on pain intensity was better, the effect size was small, and the incidence of adverse effects and dropout rate were high. Despite the promising results of previous studies, the use of cannabinoids in NCP is not established yet. Mainstream “natural living” is a popular topic regarding the prevention and treatment of cancer and its related adverse effects. Many studies have examined the roles of vitamin E, vitamin C and α-lipoic acid.,,, There are controversies concerning the results of those studies: although a particular decrease in incidence of NP with the use of vitamin E was shown,, the results could not be replicated in a large Phase III randomized controlled trial. The WHO recommends managing pain in a stepwise manner to achieve better pain relief with fewer side effects. However, the efficacy of a single agent is limited due to both complicated pain mechanisms and dose-limiting adverse effects. There have been many efforts to develop better drugs or favorable combinations of available drugs. Ideally, combination treatment should focus on maximum efficiency with less toxicity and minimum drug interaction, and synergistically different mechanisms of action. Nowadays, although there are scarce data, the most common prescribed combinations of analgesics are fixed-dose combinations of NSAID + opioids, NSAID + tramadol, antidepressants + anticonvulsants, and antidepressants + opioids. Chaparro et al analyzed 21 randomized controlled trials (gabapentin + nortriptyline, opioid + TCA, fluphenazine + TCA, opioid + gabapentin/pregabalin) in a Cochrane review. They concluded that many good-quality trials showed the superiority of combination therapy to monotherapy, but a particular combination was not specified. They emphasized the intensification of adverse effects with combinations, particularly sedation. After this Cochrane review, a few promising studies have been published. The combination of pregabalin and oxycodone has been shown to be operative and safe in previous studies.,, Garassino et al conducted a study to investigate the practical dose escalation of a pregabalin–oxycodone combination. They showed that the pregabalin dose can be escalated safely, in contrast to recent applications in clinical practice. They showed that if the pregabalin dose is increased slowly, higher doses can be achieved. In 2013, Nishihara et al investigated the impact of mirtazapine on pain in combination with pregabalin in a refractory NP syndrome. Although mirtazapine did not relieve pain when used alone, based on the results of this study, the combination had additive/synergistic effects compared to a doubled dose of pregabalin. One of the interesting points of this study was that the onset of action of the combination was as early as 1 week. A third study from Lazzari et al showed that the addition of low-dose oxycodone–naloxone to the gabapentin–pregabalin combination treated patients successfully, with fewer gastrointestinal side effects. #text According to the new definition of the IASP, neuropathic pain is defined as “pain arising as a direct consequence of a lesion or disease affecting the somatosensory system”. Although this definition narrows and simplifies NP for physicians, NCP is still underreported, underdiagnosed, and not treated efficiently. Therefore, NCP remains an open area where new treatment approaches are needed urgently. Several treatment options have been studied in randomized controlled trials– to shift the paradigm of NP treatment towards more targeted and multimodal agents, and may contribute to treatment of NCP in the future. Recently, there has been a dramatic increase in efforts to reveal a genetic contribution to the mechanism of perception of pain and a genetic impact on the efficacy and safety of drugs. Genetic polymorphisms that are linked to alterations of pain perception are generally single-nucleotide polymorphisms of genes coding for receptors, ion channels, transcription factors, cytokines, and enzymes. Personal variations in opioid requirements and toxicity have been investigated heavily. The strongest link was found to be the p450 cytochrome 2D6 gene variations., However, there are associations of the catechol--methyl transferase, melonocortin-1 receptor, and μ-1 opioid receptor genes in the response to analgesics., Another contribution to pain treatment by genetic mechanisms is targeted drug delivery to the PNS using gene therapy. Preclinical studies have been done with nonreplicating virus vectors injected into skin to transduce neurons in the dorsal root ganglion in animal models with neuropathic pain and NCP. Wolfe et al conducted a Phase I trial of gene therapy with herpes simplex virus vectors expressing human preproenkephalin. The primary outcome was safety; pain modulatory effects were shown in moderate–higher doses. A Phase II trial is now underway. In the future, better outcomes will be achieved by the application of further understanding of genetics and molecular biology of pain. Animals have evolutionary mechanisms for defense and hunting via assorted small molecules. These have attracted the attention of investigators for a long time. One of these is cobratoxin, a nicotinic acetylcholine receptor antagonist, which is analgesic at lower doses, although lethal in higher doses. This molecule in combination with opioids and NSAIDs was investigated in 230 cancer patients with severe pain, and was found to be superior to NSAIDs or analgesic monotherapy Cone snails have natural substances called conopeptides, and one of these is ziconotide, which was found to be effective in chronic pain.– It acts via blocking N-type voltage-sensitive calcium channels in the dorsal horn. In 2004, the US Food and Drug Administration approved the intrathecal application of ziconotide in refractory pain conditions. Tetrodotoxin is a sodium-channel antagonist derived from puffer fish. In animal models and in cancer clinical trials, it was found to be beneficial in pain relief.– In the future, results of these and further studies will have had an impact on pain-management strategies. CINP is detrimental, besides decreasing the quality of life of cancer patients it interferes with the treatment process and may lead to drug cessations. There is emerging information indicating that proinflammatory cytokines are important in the pathogenesis of CINP., Macrophages are accused of being involved in the neuroinflammatory process of the axons and neurons of dorsal root ganglion (DRG) in CINP In response to chemotherapy-induced hypoxic injury, macrophages secrete or organize other inflammatory cells to product cytokines (tumor necrosis factor-α, interleukin [IL]-1β, IL-6, IL-8), chemokines (CCL2, CXC family), growth factors, and inflammatory mediators, such as bradykinin, prostaglandins, serotonin, and nitric oxide.,, These small molecules have been investigated both as potential targets for treatment and as potential biomarkers of estimation or early diagnosis of NP. Further elucidation of underlying mechanisms of CINP may yield a new vision for targeted therapy of NCP. There is a rapidly growing body of evidence demonstrating that spinal microglia play an important role in the NP process. Under normal circumstances, microglia are resident macrophages derived from yolk-sac macrophages, and responsible for monitoring of the local environment and protection., After a peripheral nerve injury, they transform into active states by hypertrophy, new gene expression (purinergic cell-surface receptors), and proinflammatory cytokines in DRG., There are growing numbers of studies trying to elucidate the role of microglial activation and also the astrocyte role in the NP mechanism., Inhibition of microglia suppresses hypersensitivity to pain to innocuous stimuli (allodynia), which is one of the hallmarks of NP. In animal models, microglia–neuronal interaction was tested in CINP. It was shown that in rats treated with oxaliplatin, microglia reactivation occurred in the CNS; additionally, astrocytes proliferated and migrated to certain areas of the brain, supporting the hypothesis of astrocyte-related long-term pain persistence. Spinal microglia might be a promising target for treating NCP and CINP. Ceramide is a proinflammatory and proapoptotic molecule derived from sphingomyelin and by de novo synthesis from serine palmitodyltransferase. In addition to established roles in inflammation and cancer, there are emerging data of their modulatory role in the peripheral and central sensitization of pain processing. Preclinical and clinical pharmacological studies will provide fundamental information about the role of ceramide in pain, and may offer a multilevel approach for the development of analgesics. Cancer pain includes both the nociceptive and NP components. Cancer itself may be the cause of pain, or treatment processes and pharmaceuticals may lead to pain. NCP is resistant to treatment, and may continue to be present in patients even when the cancer is cured. WHO guidance is still valid for cancer pain, and there is a growing body of evidence for the addition of coanalgesics to treatment. Diagnosis of NCP is burdensome, since most of the time, pain is underreported by patients unless they are asked, and NCP is underrecognized by physicians. Doctors other than pain specialists are afraid of pain and NCP as an esoteric topic. There are no well-established diagnostic tools that can be used by practitioners easily to make the differential diagnosis of NP in everyday practice. Once a diagnosis of NCP is made, opioids, antidepressants, and anticonvulsants should be prescribed. The clinical beneficence of opioids and coanalgesics outweighs the adverse effects. The armory of NP is broad and is getting broader as interest in pain mechanisms increases. In accordance with WHO guidelines, appropriate induction of coanalgesics should be recommended. Combination therapies with different pathophysiologic mechanisms are especially supported. This kind of polypharmacy may effectively relieve pain with acceptable side effects. Basic scientific developments and findings have shown new pathophysiologic pathways in NP and NCP. More clinical studies are needed to understand NCP and treat patients accordingly. In the future, new specific disease-modifying agents are expected.

Adipose triglyceride lipase (ATGL) has been identified as key enzyme of mammalian lipolysis, the hydrolytic cleavage of triglycerides into free fatty acids and diacylglycerols. ATGL is predominantly expressed in adipose tissue but found to a lesser extent in a variety of other tissues and organs, including kidney, skeletal muscle, and heart. Studies with ATGL knockout (AKO) mice revealed the systemic importance of this lipase. Deletion of the gene encoding for ATGL resulted in a phenotype with massive neutral lipid accumulation in multiple tissues and cell types. ATGL-deficient mice suffer from an overall defect in energy homeostasis, defective thermogenesis, and severe cardiomyopathy, the latter leading to premature death of the animals . In the myocardium ATGL deficiency has been shown to cause age-dependent increase of myocyte lipid droplets in number and size and, in parallel, progressive development of ventricular hypertrophy . Langendorff perfusion experiments of isolated hearts extended these findings, showing that contractile and microvascular responses to ß-adrenergic stimulation by norepinephrine are drastically impaired in ATGL-deficient hearts . Chronic treatment of AKO mice with the peroxisome proliferator receptor α (PPARα) agonist Wy14,643 restored cardiac contractility and several PPARα target genes were markedly downregulated in ATGL-deficient hearts , suggesting that impaired PPARα signaling essentially contributes to the observed cardiac phenotype. A close relationship between chronic heart failure and endothelial dysfunction has been established in laboratory animals and humans (for review, see ), and the severity of endothelial dysfunction has been proposed as prognostic factor for the long-term outcome of patients suffering from heart failure . It is assumed that impaired left-ventricular function in heart failure significantly reduces shear stress-induced formation of endothelium-derived NO and consequent NO-dependent dilation of vascular smooth muscle cells. Conversely, impaired peripheral vasodilation leads to higher systemic vascular resistance and consequent increased cardiac workload, which aggravates cardiac dysfunction. In addition, reduced myocardial perfusion due to compromised vasodilator capacity of coronary arteries partially contributes to ventricular dysfunction. Recently, Hirano and colleagues reported about a male patient homozygous for a point mutation in the ATGL gene suffering from severe congestive heart failure and undergoing cardiac transplantation . Biopsies of the explanted heart showed triglycerides accumulating in atherosclerotic lesions of coronary arteries. In addition, cytoplasmatic lipid storage was observed within endothelial cells and foam cells of the intima as well as within smooth muscle cells of the media. In view of this human correlate and concerning the severe cardiac impairments in murine ATGL deficiency we aimed to study micro- and macrovascular function in this animal model. #text Homozygous AKO mice on a C57BL/6 background and age-matched WT littermates were used for this study. After weaning, animals received standard laboratory mouse chow and water . Animals subjected to the PPARα agonist treatment protocol were fed control diet mixed with 0.1% Wy14,643 (Cayman Chemical, Ann Arbor, MI, USA) for 3 weeks starting at ~ 7 weeks of age, as previously described . Mice were housed in approved cages and kept on a regular 12 h dark/light cycle. Animals were sacrificed at ~ 10 weeks of age. All animals received care in accordance with the Austrian law on experimentation with laboratory animals (last amendment, 2012), which is based on the US National Institutes of Health guidelines. The protocol was approved by the Austrian Federal Ministry for Science and Research (BMWF-66.007/0001-ll/3b/2014). In a first series of vasomotor studies, the response of aortic vessels to endothelium-dependent and -independent relaxing agents was tested in the absence of perivascular adipose tissue (PVAT). Therefore, descending aortas were removed, carefully cleaned from surrounding PVAT and cut into rings of ~ 3 mm width and mounted in 5 ml-organ baths filled with oxygenated Krebs–Henseleit solution (118.4 mM NaCl, 25 mM NaHCO, 4.7 mM KCl, 1.2 mM KHPO, 2.5 mM CaCl, 1.2 mM MgCl, 10.1 mM -glucose; pH 7.4). Care was taken to retain the endothelium for relaxation experiments. Tissues were equilibrated for 60 min by repeatedly adjusting tension to 0.5 g and changing the bath solution. Then, maximal contractile activity was determined with a depolarizing solution of 100 mM K. Rings that did not elicit adequate and stable contraction to high K were considered to be damaged and omitted from the study. After washout, tissues were precontracted with the thromboxane mimetic 9,11-dideoxy-9α,11α-epoxy-methanoprostaglandin F2α (U 46619) to an equivalent level of ~ 1.2 g total tone ( ~ 90% contracture obtained with high K). After reaching a stable contraction, cumulative concentration–response curves were established with acetylcholine (ACh; 1 nM–10 μM) or 2,2-diethyl-1-nitroso-oxyhydrazine (DEA/NO; 1 nM–10 μM; Enzo Life Sciences AG, Lausen, Switzerland). The contractile force corresponding to each agonist concentration was recorded and expressed as percent of precontraction (= baseline). To test for the role of NADPH oxidase-derived superoxide, aortic rings were incubated for 30 min in the presence of either gp91ds- (50 μM; piChem, Graz, Austria) or a combination of cell-permeable superoxide dismutase (PEG-SOD; 100 U/ml) and catalase (PEG-cat; 500 U/ml) prior to addition of ACh or DEA/NO. In a second series of experiments, the role of PVAT was investigated in paired aortic rings prepared either with or without PVAT. Removal of PVAT from one half of the aorta was randomly assigned to avoid any systematic effects due to the repeated use of similar aortic segments. The equilibration period was followed by repeated challenge with 100 mM K solution until the contractile response became reproducible. After determination of the contractile response to increasing isotonic K solutions (15, 30, 60, 100 mM), cumulative concentration–response curves to U46619 (1 nM–300 nM) were established. The response of each agonist dose was normalized to the effect of 100 mM K. In a third series of experiments, relaxation to ACh (1 nM–10 μM) or DEA/NO (1 nM–10 μM) was measured in precontracted aortic rings in the absence and presence of PVAT using the protocol described above. Mice were euthanized by inhalation of CO as recommended by the Austrian law on experimentation with laboratory animals. Hearts were rapidly excised and arrested in ice-cold Krebs–Henseleit buffer. After cannulation of the aorta with a 20 gauge needle, retrograde perfusion was established at a constant flow of 20 ml/min/g wet weight with a modified Krebs–Henseleit bicarbonate buffer, pH 7.4 (118 mM NaCl, 25 mM NaHCO, 1.2 mM KHPO, 4.8 mM KCl, 1.2 mM MgSO, 1.25 mM CaCl, 11 mM -glucose) using the ISO-HEART perfusion system (Hugo Sachs Elektronik, March-Hugstetten, Germany) as previously described . The perfusate was filtered through a 5 μm filter before infusion and continuously gassed with carbogen (95% O, 5% CO). Heart temperature, measured with a physitemp probe (Physitemp Instruments, Clifton, NJ), was maintained at 37 °C throughout the experiment. After removal of the left auricle, a tiny fluid-filled balloon, made of a small square of a polyethylene film, was inserted into the left ventricle and connected to a pressure transducer a 4 F biluminal monitoring catheter (Vygon, Aachen, Germany). The following cardiac parameters were monitored using the PLUGSYS data acquisition and control setup for circulatory studies (Hugo Sachs Elektronik, March-Hugstetten, Germany) and recorded using a PowerLab system (ADInstruments Ldt, Hastings, UK): left-ventricular end-diastolic pressure, peak left-ventricular systolic pressure, left-ventricular developed pressure, maximum rate of rise and fall of left ventricular pressure, heart rate (obtained from the pressure signal using a differentiator and heart rate module, respectively) and, as a measure for coronary vessel function, coronary perfusion pressure (CPP; a second pressure transducer attached to the aortic cannula). After establishing stable perfusion conditions (30 min equilibration), bradykinin (BK; 1 nM–3 μM) was added a sideline to the perfusion medium and changes in CPP recorded. The microvascular endothelial cell line (MyEnd) was established from mouse hearts by immortalization with polyoma middle T oncogene as described previously . The retrovirus packing cell line GP + E − 86 was kindly provided by B. Engelhardt (Theodor Kocher Institute, Bern, Switzerland). MyEnd cells were immunopositive for the endothelial markers vascular endothelial cadherin and cluster of differentiation 31 (CD31). Cells were grown in Dulbecco's Modified Eagle Medium (DMEM; Life Technologies, Karlsruhe, Germany) supplemented with 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1.25 μg/ml amphotericin B, and 10% (v/v) heat-inactivated fetal calf serum (PPA Laboratories GmbH, Vienna, Austria) in humidified atmosphere (95% O/5% CO) at 37 °C. Passages 1–5 were used for experiments. MyEnd cells formed monolayers of highly elongated cells frequently organized into whirl-like formations. The overall cell shape and growth pattern resembled that of primary cultures of microvascular endothelial cells from brain and skin and differed significantly from the typical cobblestone pattern formed by macrovascular endothelial cells from various sources . MyEnd cells seeded on 12-well plates were incubated for 20 h in DMEM (low glucose), containing 400 μM oleic acid complexed with fatty acid-free bovine serum albumin (BSA) and esterified [H]oleic acid (~ 5 ∗ 10 cpm; Hartmann Analytic GmbH, Braunschweig, Germany) as radiolabeled tracer. After removal of medium, cells were washed with phosphate-buffered saline (PBS). Lipids were extracted with ice-cold hexane/isopropanol (3:2) and the solvent was evaporated under a gentle stream of nitrogen. Lipids were resuspended in chloroform, transferred onto TLC silica gel 60 plates (Merck, Darmstadt, Germany) and separated using hexane/diethylether/acetic acid (70:29:1) as solvent. Plates were stained with iodine and mono-, di-, and triglycerides were identified by comparison with an analytical lipid standard mix (Sigma, Vienna, Austria). Radioactive spots containing triglycerides were excised and radioactivity determined by liquid scintillation counting. Results were expressed as cpm/mg protein. In another series of experiments, release of [H]oleic acid, which had been incorporated into intracellular triglycerides, was induced by addition of 2% fatty acid-free BSA. After incubation for 4 h, extraction and separation of lipid products and quantification of [H]oleic acid were performed as described above. To measure incorporation of glucose-derived carbon into the cellular triglyceride pool MyEnd cells were challenged with [C]glucose (0.1 μCi/ml) in the absence and presence of 400 μM non-labeled oleic acid for 20 h. Extraction, separation, and quantification of triglycerides were performed as described above. Total RNA was isolated from cells and homogenized tissues using the GenElute™ Mammalian Total RNA Miniprep Kit (Sigma, Vienna, Austria) including DNAse (Sigma, Vienna, Austria) treatment of samples. RNA was transcribed to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Vienna, Austria). Real-time PCR analysis was performed with ~ 30 ng cDNA using TaqMan® Universal PCR Master Mix and pre-designed TaqMan® Gene Expression Assays for endothelial NO synthase (eNOS; Mm00435204_m1), NADPH oxidase 2 subunit (NOX2; Mm00432775_m1), tumor necrosis factor α (TNFα; Mm00443258_m1), monocyte chemotactic protein-1 (MCP-1; Mm00441243_g1), interleukin 6; (IL-6; Mm00446190_m1), heme oxygenase-1 (HO-1; Mm00516005_m1_F), and SOD-1 (Mm01700393_g1). Reactions were carried out on a 7300 Real-Time PCR System (Applied Biosystems, Vienna, Austria). Cycling conditions were as follows: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C and for 1 min at 60 °C. Data were analyzed according to the 2 method using cyclophilin (Mm00835365_g1) as reference gene. Lack of amplification was verified in no-template controls. Splicing of XBP1 mRNA was analyzed by conventional PCR using the following primers TTACGAGAGAAAACTCATGGCC (fwd); GGGTCCAAGTTGTCCAGAATGC (rev) . Amplification products were separated by agarose gel electrophoresis (3%). Tissues were homogenized in 5–10 volumes of RIPA lysis buffer (Sigma, Vienna, Austria) containing 0.5 mM ethylenediaminetetraacetic acid (EDTA), protease and phosphatase inhibitors (Complete™; PhosSTOP™; Roche, Vienna, Austria) using a glass potter Elvehjem homogenizer. Homogenates prepared from PVAT were centrifuged for 10 min at 1000  (4 °C) and lipid-free infranatants were collected and used for Western blot analysis. Endothelial cells were harvested and homogenized by repeated sonication on ice. Denatured samples (10–30 μg) were separated by SDS-PAGE (8% or 10% gels) and transferred onto nitrocellulose membranes. After blocking with Tris-buffered saline containing 0.1% (v/v) Tween-20 and 5% nonfat dry milk or 5% BSA for 1 h (ambient temperature) membranes were incubated overnight at 4 °C with antibodies against ATGL (1:1000; Cell Signaling through New England Biolabs, Frankfurt, Germany), eNOS (1:2000; BD Transduction Laboratories, Heidelberg, Germany), Serphospho-eNOS (1:1000; BD Transduction Laboratories), vasodilator-stimulated phosphoprotein (VASP; 1:1000; Cell Signaling), Serphospho-VASP (1:1000; Calbiochem through VWR, Vienna, Austria), NOX2 (1:5000; BD Transduction Laboratories), p67 (1:5000; BD Transduction Laboratories), p47 (1:1000; Novus Biologicals, Cambridge, UK), NOX4 (1:1000; Abcam, Cambridge, UK), SOD-1 (1:1000; Santa Cruz Biotechnology, Inc., Heidelberg, Germany), ubiquitin (1:4000; Dako, Vienna, Austria), proteasome 20S core subunit (1:1000; Enzo Life Sciences AG, Lausen, Switzerland), galectin-3 (Mac-2; 1:10,000; Cedarlane through Szabo-Scandic, Vienna, Austria), α-tubulin (1:10,000; Sigma, Vienna, Austria), binding immunglobulin protein (BIP; 1:1000; Cell Signaling), heat shock protein 90 (Hsp90; 1:1000; Cell Signaling), inositol-requiring enzyme 1α (IRE-1α; 1:1000; Cell Signaling), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:50,000; Sigma). After incubation of membranes with respective horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG (1:5000) immunoreactive bands were visualized by chemiluminescence using ChemiGlow™ (Biozym, Vienna, Austria) and quantified densitometrically using the E.A.S.Y. Win 32 software (Herolab, Vienna, Austria). Purified human eNOS expressed in was used as standard . Aortas were homogenized in 0.15 ml of a 50 mM triethanolamine/HCl buffer (pH 7.4) containing 1% (v/v) ß-mercaptoethanol, 10 mM 3-[(3-cholamidopropyl)dimethyl-ammonio]-1-propanesulfonate, 0.5 mM EDTA and Complete™ using a glass potter Elvehjem homogenizer. Homogenates were centrifuged at 10,000  for 10 min at 4 °C. Supernatants were assayed for NOS activity as conversion of [H]-arginine (~ 10 cpm; Perkin Elmer, Vienna, Austria) to [H]-citrulline as previously described . Results were corrected for enzyme-deficient blanks and recovery of -citrulline. NOS activity of intact MyEnd cells was determined as previously described . Cells were incubated for 10 min at 37 °C in 1 ml of 50 mM Tris–HCl (pH 7.4) containing 100 mM NaCl, 5 mM KCl, 3 mM CaCl, and 1 mM MgCl with [H]-arginine (~ 10 cpm) in the absence and presence of ACh (10 μM) or ionomycin (1 μM). Thereafter, cells were washed with 1 ml chilled nominally Ca-free incubation buffer and lysed in 10 mM HCl for 1 h at per ambient temperature. Aliquots of 0.1 ml were removed for determination of incorporated radioactivity. Samples were adjusted to pH 5.0 with 0.2 M sodium acetate buffer, containing 10 mM -citrulline (pH 13.0). [H]-citrulline was separated from [H]-arginine by cation exchange chromatography, and radioactivity measured by liquid scintillation counting. Cellular NOS activity is expressed as % of [H]-citrulline formed from incorporated [H]-arginine. MyEnd cells seeded on 6-well plates were homogenized in 0.5 ml PBS containing Complete™ by repeated sonication on ice. Homogenates containing 50–100 μg of protein were incubated in PBS, containing diethylenetriamine pentaacetic acid (0.1 mM) at 37 °C for 30 min in the absence or presence of the NADPH oxidase inhibitor gp91ds- (50 μM) . Subsequently, NADPH (0.3 mM) and lucigenin (5 μM) were added and lucigenin-derived chemiluminescence (CL) was measured every 10 s for 5 min using a TriCarb® 2100TR Liquid Scintillation Counter (Perkin Elmer, Vienna, Austria). Results were corrected for protein-deficient blanks and expressed as cpm/mg protein. Lipolytic activities of aorta and white adipose tissue (WAT) were determined using the triglyceride hydrolase assay as described recently . Tissues were homogenized in a solution containing 0.25 M sucrose, 1 mM EDTA, 1 mM dithiothreitol, and Complete™ (pH 7.0) using a glass potter Elvehjem homogenizer, and homogenates were centrifuged at 20,000  for 30 min at 4 °C. Infranatants were collected and aliquots (~ 30 μg) incubated with 0.15 mM [H]triolein (~ 10 cpm; Perkin Elmer, Vienna, Austria) as radioactive tracer. Samples were incubated in a total volume of 0.2 ml for 1 h at 37 °C and reactions terminated by addition of 3.25 ml methanol/chloroform/heptane (10:9:7) and 1 ml of 0.1 M KCO/0.1 M HBO (pH 10.5). Samples were centrifuged at 800  for 20 min at an ambient temperature and 1 ml aliquots of the upper phase were collected. Radioactivity was determined by liquid scintillation counting. HO release from PVAT was measured using 10-acetyl-3,7-dihydroxyphenoxazine (Ampliflu) according to the manufacturer's protocol of Amplex® Red Hydrogen Peroxide/Peroxidase Assay Kit (Life Technologies, Vienna, Austria). Freshly isolated PVAT from WT and AKO mice was cut into two pieces of 5–15 mg. Tissue was incubated in a mixture of 750 μl Krebs–Ringer buffer (145 mM NaCl, 4.86 mM KCl, 5.70 mM NaHPO, 0.54 mM CaCl, 1.22 mM MgCl, 5.5 mM glucose; pH 7.4) and 150 μl reaction buffer (10 mM Ampliflu and 10 U/ml horseradish peroxidase in Krebs–Ringer buffer) for 1 h at 37 °C in the absence and presence of catalase (250 U/ml). HO release into the incubation buffer was quantified by the horseradish peroxidase-catalyzed oxidation of 10-acetyl-3,7-dihydroxy-phenoxazine to the fluorescent product resorufin at excitation and emission maxima of 571 nm and 585 nm, respectively. PVAT was homogenized in Krebs–Ringer buffer using a glass potter Elvehjem homogenizer and protein concentrations were measured with the Thermo Scientific Pierce BCA™ Protein Assay Kit. Anesthetized mice were pinned in supine position onto a wax plate, the chest was opened by sternotomy, the ascending aorta was exposed and a ligature from thread was placed around its proximal portion. Thereafter, a hole was punched into the apex of the left ventricle and a bluntly grinded veinflow catheter G21 was introduced the hole into the ascending aorta under stereomicroscopic control using a micromanipulator. The cannula was placed slightly distally to the ligature, the latter was closed, the left atrium was incised and rinsing of the circulatory system with 0.9% NaCl solution was started (flow rates: 70–99 ml/h; volume of perfusate: 7.5–10 ml; duration of rinsing: 6–8 min). When clear efflux escaped the left atrium, perfusion with buffered 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.35) was started the same route (flow rates: 70–99 ml/h; volume perfused: 10 ml; duration of fixation: 4–7 min). Then, thoracic aortas were excised under binocular control and immersed under fresh fixative for 2 h at room temperature. After two washes for 30 min aortas were transferred into 70% ethanol and stored overnight at 4 °C. Then, aortas were cut into three segments which were cut longitudinally into two halves with razor blades while submerged in 70% ethanol. Specimens were dehydrated in a graded series of ethanol (80%, 90%, and 96% for 30 min each; 100I, 100II, and 100III for 20 min each) and critical point dried carbon dioxide. Dry specimens were mounted onto specimen stubs by colloidal silver, evaporated with carbon and gold, sputtered with gold, and examined in the scanning electron microscope XL-30 (FEI, Eindhoven, The Netherlands) at an accelerating voltage of 20 kV. If necessary, brightness and contrast of micrographs taken were adjusted by the Adobe Photoshop 7.0 software. Thoracic aortas were formalin-fixed, paraffin-embedded, and sectioned. Sections were either stained with hematoxylin and eosin (H&E) according to a standard protocol or labeled for immunohistochemistry by incubating with anti-mouse CD31 (1:50; Thermo Scientific, Vienna, Austria) or anti-mouse α-smooth muscle actin (α-SMA; 1:50; Abcam, Cambridge, UK) for 1 h at ambient temperature. Subsequently, specimens were incubated with HRP Polymers (TL-060-HL; Thermo Scientific, Vienna, Austria) or the AEC system (Dako, Vienna, Austria) for visualization of CD31 and α-SMA, respectively. Analysis was performed with a Nikon Eclipse 80i microscope supplied with camera and using the NIS-Elements D software. Protein concentrations were either measured by the method of Bradford or with the Thermo Scientific Pierce BCA™ Protein Assay Kit (Fisher Scientific Austria GmbH, Vienna, Austria) using BSA as standard. Concentration–response curves established in aortic ring experiments were fitted to a Hill-type model giving estimates of agonist potency (EC) and efficacy (E). Concentration–response curves of different ring segments from a single animal were averaged and counted as individual experiment. ANOVA with post hoc Bonferroni–Dunne test was used for comparison between groups using StatView® (Version 5.0). Experiments performed with aortas, WAT and MyEnd cells were, unless otherwise indicated, analyzed using the unpaired Student's -test. Significance was assumed at P < 0.05. Data are presented as mean values ± SEM of n experiments. The vasodilatory potency of the endothelium-dependent agonist ACh was studied with precontracted aortic rings isolated from WT and AKO mice. As shown in A, ACh relaxed WT vessels in a concentration-dependent manner with an EC of 240 ± 70 nM and a maximal effect of 67 ± 5% relaxation. The effect of ACh was completely inhibited by the NO synthase (NOS) inhibitor N-nitro--arginine (data not shown). In contrast to WT vessels, AKO aortas responded only marginally to ACh (17 ± 3% relaxation). Chronic treatment of AKO mice with the PPARα agonist Wy14,643 (which restores cardiac contractility ) led to a ~ 50% improved ACh response (42 ± 2% maximal relaxation). None of the interventions significantly affected the potency of ACh. As indicated by a preserved response of the rings to the NO donor DEA/NO (B) and adequate contraction to K and to a thromboxane receptor agonist (see below), impaired relaxation to ACh did not involve dysfunction of vascular smooth muscle cells. Preincubation of aortic rings with either a combination of cell-permeable PEG-SOD and PEG-cat or the selective peptide inhibitor of NADPH oxidases, gp91ds-, failed to restore the effect of ACh in ATGL deficiency (C). These agents neither affected relaxation to DEA/NO (D), excluding a significant role of superoxide-mediated inactivation of endothelium-derived NO in this experimental setup. The function of microvascular endothelial cells was tested by measuring CPP of isolated hearts in response to the endothelium-dependent vasodilator BK. While the compound decreased CPP in WT hearts in a concentration-dependent manner (EC = 12 ± 1 nM), the agonist was ineffective in AKO hearts (E). As observed with aortic rings, ATGL deficiency did not affect microvascular relaxation to the NO donor DEA/NO (F). ATGL has been identified and characterized in a variety of tissues and cell types (for review, see ), but there is sparse knowledge about ATGL expression in blood vessels. As shown in A, functionally active ATGL was detected in aortic homogenates of WT mice. Protein expression levels and triglyceride hydrolase activity were ~ 25% and ~ 5%, respectively, of the values measured in WAT of WT mice. Various biochemical parameters of NO signaling were measured in aortas from WT and genetically modified mice. Protein expression of eNOS was decreased to less than 40% in AKO aortas (B). ATGL deficiency had similar effects on the levels of eNOS phosphorylation at Ser (B) and enzyme activity measured as -arginine to -citrulline conversion (C). Representative Western blots are shown in H. Treatment of AKO mice with the PPARα agonist Wy14,643 completely restored NOS activity in vascular preparations (C) indicating that the observed effect on eNOS is due to cardiac dysfunction. Aortic eNOS mRNA levels were only marginally affected. Albeit there was a tendency towards increased levels in ATGL deficiency, results did not reach statistical significance (D). Phosphorylation of cytoskeleton-associated VASP at Ser, which represents a reliable biochemical marker for the function of the NO/cGMP pathway , was abolished in AKO aortas (E, H). Surprisingly, expression of VASP protein was also significantly reduced in ATGL-deficient vessels (E, H). Decreased eNOS protein expression despite of unchanged mRNA levels suggested that protein stability was affected in ATGL-deficient vessels. Therefore, we tested for activation of the proteasome by measuring levels of ubiquitinated proteins in aortic homogenates . As shown in F, the total amount of ubiquitinated proteins was significantly reduced in ATGL-deficient aortas. Additionally, aortic protein expression of the 20S core protein (which comprises the protease-like catalytic sites of the 26S proteasome) was increased more than 4-fold in ATGL deficiency (G, H), corroborating the hypothesis of enhanced proteasomal degradation. Aortic mRNA levels of the inflammation marker TNFα were increased nearly 4-fold in ATGL deficiency (I). To test if vascular ER stress is involved in activation of the proteasome we measured key determinants of the UPR (). The IRE-1/XBP-1s branch of the vascular UPR was not significantly affected in ATGL deficiency. Similarly, protein levels of ER-resident chaperons BIP, PDI, Hsp90 were not significantly altered in aortas of AKO mice. To investigate the endothelial defect on a cellular level, a model of microvascular ATGL-deficient endothelial cells was created from AKO hearts (A) and characterized in terms of NO signaling and related signaling pathways. Cellular ATGL deficiency was confirmed as lack of mRNA (data not shown) and protein expression (see J for a representative Western blot). In ATGL-deficient endothelial cells ~ 12-fold higher incorporation of [H]oleate into triglycerides was observed as compared to WT cells (B). Moreover, lipolytic breakdown of [H]oleate-containing triglycerides was not detected in ATGL-deficient cells, whereas more than 60% of [H]oleate-containing triglycerides were catabolized in WT cells (B). Challenging of cells with [C]glucose resulted in significantly increased incorporation of glucose-derived carbon matrix into the cellular triglyceride pool under both basal (C) and oleate-loaded (data not shown) conditions. In marked contrast to the effects observed in isolated aortas, expression of eNOS mRNA (D) and protein (E) as well as basal and stimulated enzyme activity (F) were not affected by ATGL deficiency. To test whether NO availability is compromised in those cells due to increased formation of reactive oxygen species, cellular superoxide production was measured as lucigenin chemiluminescence and expression levels of the most abundant endothelial NADPH oxidase isoforms. Neither protein expression of NOX2 and NOX4 (G) nor superoxide production (H) was affected. Finally, ubiquitinated protein levels were identical in WT and ATGL-deficient endothelial cells (I). These results clearly indicate that at the level of isolated AKO endothelial cells the major characteristics of endothelial dysfunction are no longer evident. There is increasing evidence suggesting that PVAT modulates blood vessel function by production and release of various vasoactive substances (for reviews, see ). Therefore, we characterized PVAT associated with thoracic aortas of WT and AKO mice and analyzed for mRNA and protein expression of different inflammatory and oxidative markers. PVAT wet weight was increased nearly 7-fold in AKO mice (A, B). Adipose mRNA levels of the inflammation markers TNFα (C), IL-6 (D), and MCP-1 (E) were raised 3.3 ± 1.0, 4.8 ± 1.0, and 7.9 ± 4.3-fold in ATGL deficiency, respectively. NOX2 was upregulated at both mRNA and protein level (F). Additionally, protein expression of cytosolic NADPH oxidase subunits p67 and p47 (G) which initiate NOX2 activation, was significantly increased. Expression of Mac-2 protein was potently upregulated in PVAT of AKO mice (H), indicating massive infiltration of macrophages into PVAT. SOD-1 was significantly reduced at both mRNA (data not shown) and protein level (I) and HO release from PVAT showed a tendency to increase in ATGL deficiency, but results did not reach statistical significance (J). mRNA expression of the stress response marker HO-1 was increased 5.6 ± 1.2-fold in PVAT of AKO mice (K). Similar to the results obtained with isolated aortas, protein expression and phosphorylation of eNOS were significantly reduced in PVAT of AKO mice (L). Representative Western blots are shown in M and N. To test if the observed phenotype is related to cardiac dysfunction, PVAT of Wy 14,643-fed WT and AKO mice was analyzed for selected parameters of oxidative and inflammatory stress. Treatment of animals with the PPARα agonist failed to reverse Mac-2, SOD-1, and p67phox protein expression (), suggesting that heart-independent pathological processes are operative in PVAT of AKO mice. There is increasing evidence suggesting that PVAT modulates blood vessel function by production and release of various vasoactive substances (for reviews, see ). Therefore, we characterized PVAT associated with thoracic aortas of WT and AKO mice and analyzed for mRNA and protein expression of different inflammatory and oxidative markers. PVAT wet weight was increased nearly 7-fold in AKO mice (A, B). Adipose mRNA levels of the inflammation markers TNFα (C), IL-6 (D), and MCP-1 (E) were raised 3.3 ± 1.0, 4.8 ± 1.0, and 7.9 ± 4.3-fold in ATGL deficiency, respectively. NOX2 was upregulated at both mRNA and protein level (F). Additionally, protein expression of cytosolic NADPH oxidase subunits p67 and p47 (G) which initiate NOX2 activation, was significantly increased. Expression of Mac-2 protein was potently upregulated in PVAT of AKO mice (H), indicating massive infiltration of macrophages into PVAT. SOD-1 was significantly reduced at both mRNA (data not shown) and protein level (I) and HO release from PVAT showed a tendency to increase in ATGL deficiency, but results did not reach statistical significance (J). mRNA expression of the stress response marker HO-1 was increased 5.6 ± 1.2-fold in PVAT of AKO mice (K). Similar to the results obtained with isolated aortas, protein expression and phosphorylation of eNOS were significantly reduced in PVAT of AKO mice (L). Representative Western blots are shown in M and N. To test if the observed phenotype is related to cardiac dysfunction, PVAT of Wy 14,643-fed WT and AKO mice was analyzed for selected parameters of oxidative and inflammatory stress. Treatment of animals with the PPARα agonist failed to reverse Mac-2, SOD-1, and p67phox protein expression (Fig. S2), suggesting that heart-independent pathological processes are operative in PVAT of AKO mice. To judge potential functional consequences of PVAT-derived inflammatory oxidative stress we measured contractile and relaxant responses of aortas isolated from WT and AKO mice in the absence and presence of PVAT. As shown in A, vascular contractility to K was similar for all experimental groups. B illustrates the contractile responses of WT and AKO aortas to the thromboxane mimetic U46619. In PVAT-denuded vessels, contractility was identical for both experimental groups. Presence of PVAT, however, significantly reduced the contractile efficacy of U46619 in WT aortas (from 155.1 ± 5.7% to 125.6 ± 9.4%). An even more pronounced effect of PVAT was observed in AKO aortas, with PVAT reducing maximal contractility from 162.9 ± 5.5% to 90.4 ± 9.6%. In contrast to its effects on vascular contractility, PVAT did not affect relaxation to ACh or DEA/NO under any experimental condition (C, D). Histological analysis of aortic sections obtained from WT and AKO mice that were stained with H&E showed no microscopic changes in vessel structure or layer morphology (). Labeling of aortic specimens for the endothelial and smooth muscle cell markers CD31 and α-SMA, respectively, revealed similar staining distribution and intensity, excluding prominent histological differences of endothelial and smooth muscle cell layers (). To test for integrity of the vascular endothelium, the luminal morphology of aortas was studied by scanning electron microscopy. In , aortic endothelia of WT (A) and AKO (B) mice are shown in smaller (left panel) and larger (right panel) magnification. Layers of both experimental groups exhibited slightly undulating longitudinal endothelial folds. Endothelial cells of WT aortas showed rhomboid to slender longish shapes with a length of 45–60 μm and a width of 7–12 μm (A, right panel). Cell borders were rather straight with no prominent overlapping of neighboring cells. The endothelial luminal surface of AKO aortas is illustrated in B. Most of endothelial cells were rather stout with a length of 25 μm and a width of 15 μm, but locally also spindle-shaped cells of 60 μm length were observed. Endothelia of both experimental groups revealed endothelial fenestrae with variations in number and size. Based on these results, we have no experimental evidence for disturbances in the microstructural integrity of the endothelial cell barrier. This study demonstrates that AKO mice, a rodent model of NLSDM, suffer from severe micro- and macrovascular endothelial dysfunction. Loss of vascular reactivity was partially rescued in AKO mice chronically treated with a PPARα agonist, that restored cardiac function of these animals without exerting direct vasoprotective effects. This suggests that at least two mechanism (one of which is apparently heart-dependent) are operative in endothelial dysfunction. One component comprises downregulation of eNOS expression in blood vessels. The close relationship between cardiac and vascular dysfunction is well-documented in experimental animals and human surveys (for review, see ) and might therefore also exist in AKO mice. Moreover, experimentally-provoked chronic heart failure was reported to result in endothelial dysfunction due to downregulation of vascular eNOS transcription . However, in AKO mice, eNOS mRNA levels were not decreased but rather tended to slightly increase which excludes a transcriptional effect. It has been reported that TNFα causes a substantial decrease in eNOS mRNA stability , and TNFα mRNA expression is indeed increased in several tissues of AKO mice (this study ). Since plasma TNFα levels were beyond the detection limit of the assay in both experimental groups (data not shown), we cannot judge the contribution of circulating TNFα to vascular eNOS downregulation. However, our data point to an alternative explanation involving proteasomal degradation of eNOS protein in AKO vessels. It has been reported recently that selective inhibition of the 26S proteasome caused upregulation of eNOS in cultured endothelial cells and improved endothelial function of isolated aortas . This finding agrees well with our observations showing the inverse effect decreased eNOS protein expression in AKO vessels accompanied by a significant loss of ubiquitinated proteins indicating enhanced proteasomal activity. Moreover, the proteasomal 20S core subunit (which comprises the protease-like catalytic sites of the 26S proteasome machinery) was significantly upregulated in vessels of AKO mice. So far, we have been unable to identify the mediator(s) that trigger(s) upregulation/activation of the proteasome in ATGL-deficient blood vessels. An obvious culprit that should be considered is oxidative stress. It has been proposed that mild oxidative challenge leads to activation of the 26S proteasome by as yet unknown mechanisms (for review, see ). In contrast, prolonged exposure of cells to severe oxidative stress is thought to induce biosynthesis of proteasomal proteins and their assembly to functional degradating units in order to cope with accumulating misfolded proteins (for review, see ). Our observation that AKO mice suffer from pronounced NADPH oxidase-driven oxidative stress in the heart supports this hypothesis . Moreover, the fact, that the 20S core protein was significantly upregulated in AKO aortas, strengthens this concept. However, endothelial function was not improved upon preincubation of ATGL-deficient rings with either SOD/cat or the NADPH oxidase-specific inhibitor gp91ds-, questioning a significant contribution of NADPH oxidase-derived superoxide. Nonetheless, chronic exposure of the vasculature to oxidative stress may cause irreversible damage of the endothelium, precluding effects of short-term interventions. To investigate if endothelial dysfunction originates from disturbed endothelial cell homeostasis we studied the effects of ATGL deficiency on NO signaling in a microvascular endothelial cell model. Cells obtained from WT mice expressed small amounts of functionally active ATGL, but the biochemical parameters of NO signaling were identical in ATGL-deficient cells. In particular, the eNOS expression level was not affected by ATGL deficiency, indicating that proteasomal activation in the vasculature is not caused by an intrinsic endothelial process. To test for a potential role of circulating factors that might be missing in the cell culture model, we challenged WT endothelial cells for 48 h with plasma from AKO mice but did not observe any effect on eNOS activity (Mussbacher M; unpublished observation). Phosphorylation of the protein kinase G target VASP was virtually abolished in ATGL-deficient blood vessels. This finding agrees well with the relaxation data and impressively demonstrates impaired NO signaling in this pathology. Surprisingly, however, the VASP protein was also significantly downregulated in AKO aortas. VASP plays a crucial role in the regulation of actin filament dynamics and is regulated by differential phosphorylation . Endothelial VASP deficiency was found to result in compromised integrin- and cadherin-mediated cytoskeletal anchorage . Therefore, we reasoned that reduced VASP expression in ATGL-deficient aortas might result in compromised integrity of the endothelial cell layer. However, scanning electron microscopic experiments revealed comparable integrity of aortic . Thus, loss of aortic VASP protein appears to be a consequence rather than a cause of endothelial dysfunction and may reflect enhanced proteasomal activity of ATGL-deficient aortas. PVAT represents another potential source of pathogenic mediators that provoke endothelial dysfunction. Inflammation and oxidative stress in PVAT have recently been linked to endothelial dysfunction in obese experimental animals and adipose humans . In particular, it has been suggested that oxidative and inflammatory mediators blunt the anti-contractile effect of PVAT that is generally regarded as beneficial physiological contribution to vascular tone . In AKO mice, aortic PVAT mass was drastically increased. Moreover, we observed pronounced upregulation of NADPH oxidases and several inflammatory markers. Upregulation of HO-1 mRNA expression together with reduced SOD-1 mRNA and protein abundance are further indicators of a pro-oxidative scenario in PVAT of AKO mice. Upregulation of Mac-2 protein, a lectin that is expressed and secreted by macrophages and monocytes and that induces chemotactic, phagocytic, and lipid scavenging processes points to severe chronic adipose tissue inflammation. The fact that Wy 14,643 treatment failed to protect AKO mice from PVAT inflammation suggests that heart-independent pathological processes are operative in PVAT of AKO mice. In functional studies, contraction of WT and AKO aortas to the thromboxane mimetic U46619 was identical in the absence of PVAT. However, PVAT-coated vessels of AKO mice surprisingly showed a significantly attenuated response as compared to WT. In previous studies, decreased vascular contractility in the presence of PVAT has been interpreted as beneficial effect and efforts have been made to identify the adipose tissue-derived relaxing factor . Our results differ from those of a recent study showing that attenuated contractility in the presence of PVAT is abolished in a mouse model of human metabolic syndrome . The apparent discrepancy may arise from a quite different metabolic profile of the experimental animals used. While AKO mice show increased insulin sensitivity, improved glucose uptake and utilization, and physiological serum triglycerides , classical animal models of obesity are characterized by hyperglycemia, hyperinsulinemia, and increased serum triglycerides . It is therefore conceivable, that significant differences in perivascular adipocyte and/or vascular smooth muscle cell metabolism lead to opposite functional effects of PVAT. In summary, we demonstrate that global ATGL deficiency leads to pronounced vascular endothelial dysfunction which is partially due to downregulation of vascular eNOS expression, presumably upregulation/activation of the 26S proteasome. Moreover, we have demonstrated local PVAT inflammation in AKO mice. More work is needed to clarify the molecular mechanisms behind these unexpected findings and to further characterize the local vascular inflammatory processes that might compromise endothelial function. Our results reveal a hitherto unrecognized link between disturbed lipid metabolism, obesity and cardiovascular disease. Murine ATGL deficiency is regarded as rodent pendant of NLSDM in humans. This rare genetic disorder is characterized by excessive lipid accumulation in multiple tissues and becomes clinically evident most notably as severe dilated cardiomyopathy. To our current knowledge, vascular function of these patients has not been studied, yet. On the basis of the results we obtained with AKO mice it seems obvious that characterization of vessel function of diseased humans should be included into clinical studies. The following are the supplementary data related to this article. Supplementary data to this article can be found online at .

Damage to peripheral nerves often results in abortive or inadequate regeneration due to inappropriate or missing connections between the injured nerve stumps. Various factors are required for successful regeneration in the peripheral nervous system, including the re-establishment of continuity of the peripheral nerve pathways, the fast coaptation of nerve stump endings, and the ability of axons, microglial and Schwann cells to react to signals that initiate regeneration . Moreover, the closely regulated system of secreted proteases and protease inhibitors modifies the extracellular matrix and, thereby, allows axons to regenerate along newly assembled glial scaffolds which guide them to their targets . Endogenous and pharmacological inhibitors of proteases have long been known to be potent modulators of neurite outgrowth. Among these inhibitors, the small peptide leupeptin (N-acetyl--leu--leu-arginal) inhibits the activity of calcium-activated neutral proteases (CANPs or calpains), and serin proteases such as thrombin as well as proteasomal trypsin-like activities . Calpains are enzymes with high affinity for cytoskeletal proteins such as neurofilaments . They have also been shown to cleave α-spectrin, collapsin response mediator protein-2, and voltage-gated sodium channels . Direct administration of leupeptin to the sciatic nerve results in increased glial proliferation, but demyelination of axons and axon sprouting are observed, too . Furthermore, this tripeptide promotes neurite outgrowth in neonatal and in adult sensory neuron culture . Leupeptin also improves morphological regeneration and functional recovery following a median nerve lesion if injected into target muscles combined with repeated systemic intramuscular administration over 6 months in primates after median nerve injury . However, these studies did not provide an unequivocal answer to the clinically relevant question whether local inhibition of calpains at the lesion site is able to improve axonal regeneration. Therefore, the aim of this study was to analyze possible pro-regenerative effects of leupeptin locally applied to a nerve conduit bridging the gap between the endings of a transected sciatic nerve in rats. In experimental and control animals ( = 10 for each group) the right sciatic nerve was exposed through a mid-thigh incision and repaired by inserting the transected ends of the nerve into a 8 mm silicone conduit filled with a collagen solution (10 μg/ml type I rat tail collagen, Sigma–Aldrich) containing leupeptin (2 mg/ml, Sigma–Aldrich) or vehicle as a control. The distance between the stumps was adjusted to 6 mm. The internal diameter of the tube measured 1.5 mm. In another group of animals a 10 mm conduit with a gap size of 8 mm was used ( = 5 for each group). The nerve stumps were fixed without tension by suturing each end into the open ends of the conduit by using 8-0 epineurial sutures (Ethilon 8-0/BV-2, Ethicon-Johnson & Johnson) under an operating microscope (Leica M651). The wound was closed and animals were housed in normal cages (two animals/cage). In control animals ( = 10), the same procedure was performed but the conduits were filled with collagen only. The concentration of leupeptin used here was in the same range as in other studies , and biological activity was confirmed by measuring neurite outgrowth and receptor tyrosine kinase fluorescence changes in cultured adult sensory neurons as described before . Functional analysis of the locomotor pattern was performed weekly through the use of the CatWalk automated gait analysis system (Noldus) starting 4 weeks after surgery. At every time point, three successful runs produced by each animal were recorded and the results of these were averaged. The following parameters were assessed: footprint intensity (the maximum pressure exerted by one paw, expressed in arbitrary units, a.u.), footprint area (the mean area of each footprint of the affected hind limb, in mm), stance duration (the duration of the stance phase of the hind limb, in s), swing duration (the duration of the swing phase of the hind limbs, in s) and swing speed (the speed of the swing phase, in cm/s). At the end of the survival period, electrophysiological analysis (NeuroMax-XLTEK) was carried out during the terminal operations in all animals to assess the extent of reinnervation in the various groups. Stimulation electrodes were placed 2 mm proximal and 2 mm distal to the graft for calculation of the nerve conduction velocity. A needle electrode was placed as a recording electrode into the tibialis anterior muscle, and the sciatic nerve was stimulated for 0.05 ms first proximally and then distally to the graft in order to achieve the supramaximal stimulation amplitude. The compound action potential, the normalized amplitude and the nerve conduction velocity were determined. All measurements were carried out at a body temperature between 38 and 39 °C. After completing the electrophysiological recordings, the common peroneal nerve on the operated side of animals in both groups was cut at the level of the tensor fasciae latae muscle and Fast Blue crystals (Illing) were applied to the proximal stump. The stump was then thoroughly covered with two layers of 1 mm thick Spongostan sheets to prevent diffusion of the tracer. Five days were allowed for retrograde transport of the dye, then the animals were re-anesthetized and perfused transcardially with ice-cold 0.9% heparinized saline solution followed by 4% phosphate-buffered paraformaldehyde (pH 7.4). The lumbar spinal cord was carefully removed, postfixed in the same fixative overnight and cryo-protected in a 30% sucrose solution at 4 °C until further use. The conduits containing the regenerated nerve were explanted and postfixed in 2.5% phosphate-buffered glutaraldehyde for 24 h. Remnants of fixative were carefully washed out from the nerve, and the tissue was next immersed in 1% OsO (Agar Scientific) for 1 h, dehydrated in a graded ethanol series and in propylene oxide and then embedded in Durcupan (Fluka). Semithin sections (0.4 μm) were cut from the middle of the graft on a Leica Ultracut-R ultramicrotome and stained according to Rüdeberg. Morphometric analysis was performed in a blind manner. Randomly selected semithin section were used to assess the total cross-sectional area of the whole nerve, the total fiber number, the circle-fitting diameter of the fiber, the axon myelin thickness and the g-ratio through the use of MetaMorph (Visitron). The statistical analysis was carried out with Graph Pad Prism statistical software. Groups were compared by use of ANOVA, followed by Tukey's test. Functional evaluations were analyzed with the Mann–Whitney U test. All data in this study are given as means ± standard error (S.E.M.). Detailed analysis of hindlimb function through the use of the automated gait analysis system CatWalk indicated moderate return of function of hindlimb muscles throughout the 12 week observation period in both experimental groups. Parameters indicating return of hindlimb function began to improve 6 weeks after injury and reached levels of typically over 50% of the pretraining values (). Animals with conduits containing leupeptin revealed slightly limited recovery in some of the parameters such as print area and maximum intensity, without showing statistically significant differences relative to the control animals (collagen only). Twelve weeks after axotomy, conduits in both experimental groups contained a regenerated segment of axon bundles connecting the 6 mm gap between the proximal and distal nerve stumps (A). The cross sectional area at the middle of the regenerate was compared. The area of control regenerates (collagen-filled tubes) was slightly, but not significantly greater relative to the leupeptin-treated regenerates (0.24 ± 0.02 0.20 ± 0.01 mm, B). Retrograde tracing by applying the fluorescent tracer Fast Blue to the common peroneal nerve revealed considerable numbers of reinnervating motoneurons (C) in the control and leupeptin-treated groups (587 ± 116 569 ± 66, D) without significant differences between the two groups. The numbers of myelinated axons were also determined in the regenerates (A and B), and these data correlated with the motoneuron counts. Leupeptin-treated regenerates had fewer myelinated axons as compared with control animals (7389 ± 853 5774 ± 848, C) indicating a non-significant trend toward reduced axon numbers in the presence of leupeptin. Morphometric analysis demonstrated no differences in myelin thickness (D) or axon diameter between control and leupeptin-treated regenerates (E). However, the g-ratio (the ratio of the inner axonal diameter relative to the outer diameter) was slightly, but significantly increased (F) suggesting a minor negative effect of leupeptin on remyelination of axons as reported before . The trend toward smaller regenerates supports this assumption, too. Electrophysiological recordings were made from the tibialis anterior muscle 3 months after surgery. Stimulating electrodes were placed either proximal or distal to the nerve graft, and the conduction velocity within the grafted nerve segment was calculated. At survival time of 3 months, considerable amplitude (19.7 ± 3.8 17.6 ± 6.4 mV) and compound nerve action potential area values (CNAP, 31.4 ± 5.7 27.4 ± 9.8 mV ms) were observed in the control leupeptin-treated animals (). These values did not differ significantly between the two experimental groups. More striking but still non-significant differences were detected in nerve conduction velocity values between the leupeptin-treated and the control animals (40.2 ± 3.3 m/s 30.4 ± 6.7 m/s). The results of the present study suggest that a single application of leupeptin into an artificial nerve conduit placed between transected nerve stumps does not promote nerve regeneration and re-innervation of target muscles. We even observed a trend toward reduction in number of regenerating motoneurons and in number of myelinated axons within the conduit as well as in myelin thickness (without reaching statistical significance at  < 0.05). The rationale of this study was based on previous findings that leupeptin strongly promotes axon outgrowth if applied directly to growth factor stimulated primary adult sensory neuron cultures . These cultures are nearly devoid of Schwann cells, however. Considering the effects of leupeptin on Schwann cell proliferation and myelin disruption in sciatic nerve branches with intact axons , the absence of effects on axon regeneration in the sciatic nerve bridging model may have been caused by this inhibitory effect of leupeptin on axon remyelination. It has to be pointed out, however, that a -ratio of 0.6 as observed here is still in the regular range of sciatic nerve axons (healthy or regenerated). Methodological differences to the study by Alvarez et al. may explain why myelin thickness only slightly decreased and the g-ratio correspondingly increased following a single application of leupeptin at the time of nerve transection as performed here. Alvarez et al. carried out repeated subperineurial injections or continuous infusions of leupeptin ( a mini-osmotic pump) into the intact tibial nerve which may have caused more prominent effects on non-neuronal cells. The inhibitory effects of leupeptin on myelination could be successfully avoided by repeated intramuscular injections resulting in increased numbers of axons distal to the lesion site which was accompanied by improved motor and sensory conduction velocities and reduced muscle atrophy . Since leupeptin has been shown to maintain neuromuscular contacts if directly applied to the muscle following nerve crush at birth , it appears likely that the primary site of action in the primate study was within the denervated muscles and not within the regenerating nerve. However, chemoattractive effects of muscle-derived factors on regenerating axons may also underlie the improved morphological outcome and enhanced conduction velocities, because intact myofibers are expected to release a plethora of trophic factors after denervation . The median nerve lesion in Badalamente's study was relatively close to the denervated muscles, which further supports this hypothesis. The main pharmacological targets of leupeptin are calcium-activated neutral proteases (calpains). Calpain activation plays a key role not only in traumatic nerve injuries or stroke lesions, but also in neurodegenerative diseases such as Alzheimer's and Parkinson's as well as in amyotrophic lateral sclerosis . Calcium influx, as observed after nerve injury, leads to calpain activation, resulting in the cleavage of a variety of cellular substrates in neuronal and non-neuronal cells. Considering the results of this study, the effects of local calpain inhibition within a nerve conduit appear to be minor and mainly involve Schwann cells that migrate into the conduit, but not axons. In contrast, the effects on preventing muscle denervation atrophy appear to be more significant and may warrant intramuscular injection of leupeptin as adjunctive treatment for peripheral nerve repair.

Dysphagia is a common complication in stroke patients, with a reported incidence of approximately 55% during the acute phase of a stroke. Dealing with dysphagia is clinically important because it can affect the activities of daily living, quality of life, and prognosis of stroke patients. Using rehabilitation as treatment for dysphagia is a relatively recent development, and at present, effective techniques are limited to the Shaker exercise [], lingual exercise, pronunciation training, and expiratory muscle strength training [], among others. Recent studies have described the usefulness of repetitive transcranial magnetic stimulation (rTMS) for poststroke paralysis and neurobehavioral impairment [] as well as intervention research reports on dysphagia (table ). The effectiveness of high-frequency rTMS [, ], low-frequency rTMS [], and comparison of the two techniques [] for unilateral supratentorial stroke dysphagia have been reported. Recently, the effectiveness of low-frequency rTMS applied to the unaffected cerebral hemisphere in poststroke dysphagia has been reported []. However, the study had certain limitations with regard to interventional difficulties in targeting cerebral lesions of either hemisphere, cerebellum or brain stem. On the other hand, Khedr and Abo-Elfetoh [] described a generalized technique of high-frequency rTMS, which is applied to the entire cerebral area, implementing it for dysphagia during the acute phase of brain stem and medulla oblongata infarctions (within 6 months of stroke), and reported the effectiveness of their method in improvements of swallowing. To our knowledge, there is no report that describes the effectiveness of this technique for stroke patients in the chronic phase (after 6 months). Based on our experience, the application of rTMS alone without rehabilitation is not sufficiently effective. For this reason, we devised a protocol that combines rTMS with intensive rehabilitation for treatment of upper limb paralysis []. However, there are no studies that used the combination of rTMS applied to both cerebral hemispheres and rehabilitation for treatment of chronic stroke dysphagia. The main hypothesis tested in the present study was that bilateral rTMS combined with an intensive swallowing rehabilitation program is safe and feasible for chronic stroke dysphagia caused by bilateral cerebral lesions. The subjects were 4 patients with dysphagia associated with chronic cerebral infarction (table ). They included 2 females and 2 males, aged 56–80 years at the time of intervention. The time between onset of stroke symptoms and intervention ranged from 24 to 37 months. MRI taken within 30 days was used to determine the type and location of the stroke: all patients had bilateral cerebral infarctions. The criteria used for inclusion in this protocol were: 20–80 years of age; greater than or equal to 6 months since the appearance of dysphagia; epilepsy waveforms not present on the electroencephalogram; a single digit score on the Japan Coma Scale; ability to respond to verbal commands; absence of infection requiring medical treatment; willingness to participate in rehabilitation; ability to sit for 2 h or more, and not requiring major assistance to perform activities of daily living. The exclusion criteria were based on the guidelines related to rTMS safety []: history of an epileptic seizure in the past year, and the use of intracranial metal (e.g., clips), or cardiac pacemakers. In addition, tracheostomy, use of oxygen, depression, and artificial dialysis were additional exclusion criteria used in this study. Subjects who had severe dysphagia (with repeated salivary aspiration) and subjects who had only mild dysphagia (with possible normal diet intake) were also excluded. Food intake ability was scored on the Functional Oral Intake Scale (FOIS; explained below); the scale in our patients ranged from levels 5–6. The treatment schedule is described in fig. . Treatment was applied over 6 days as hospitalization therapy. Treatment sessions began in the afternoon on the day of hospitalization and were repeated twice daily thereafter every morning and afternoon. They consisted of 10 min of rTMS followed by a 20-min session of individualized swallowing rehabilitation. We evaluated swallowing function upon admission and discharge, using the Modified Barium Swallow (MBS) study with thickening agent three times, taking the worst scores of both the Penetration Aspiration Scale (PAS) [] and laryngeal elevation delay time (LEDT) []. The PAS determines the severity of laryngeal penetration and tracheal aspiration, and is scored out of eight points with a high score corresponding to severe tracheal aspiration. LEDT was defined as the delay between the time when the bolus head reaches the basal part of the piriform recess and when the laryngeal elevation reaches its maximum. Patients were scored using the FOIS (where level 1 indicates inability to eat and level 7 indicates ability to eat a regular diet) [], Modified Mann Assessment of Swallowing Ability (MMASA; where a lower score indicates severe dysphagia) [], a 100-point clinical evaluation scale of swallowing function derived from 12 items of physical observations that identify the validity of stroke, and the Repetitive Saliva-Swallowing Test (RSST), a count of swallows over a 30-second period []. This test involves placing the patient in a resting position, and wetting the patient's mouth with cold water. The patient is instructed to repeatedly swallow air, and the number of swallows are monitored. Swallows are identified either visually or by palpation, as laryngeal elevation. #text Our results confirmed the safety and feasibility of rTMS combined with swallowing rehabilitation for poststroke dysphagia, based on the completion of the treatment protocol by all patients with no obvious adverse effects. The usefulness of the combination of rTMS and intensive rehabilitation in functional recovery of motor function in patients with upper limb paralysis has been reported previously []. However, there was no study that used the combination of bilateral rTMS with swallowing rehabilitation for treatment of poststroke dysphagia during the chronic stage. Although swallowing function is considered to be under the control of both cerebral hemispheres, there are also reports of hemispheric dominance []. However, clinical identification of the dominant hemisphere is frequently difficult. Our bilateral stimulation method has the advantage of high generalization because it can be implemented without regard to dominance, unlike most other rTMS methods (table ). In the present study, the combination of bilateral cerebral rTMS and intensive swallowing rehabilitation resulted in improvement of swallowing function. It is hypothesized that rTMS induces plasticity and neuromodulation of the motor cortex. In addition, our results are compatible with those of Khedr and Abo-Elfetoh [], who also applied bilateral high-frequency stimulation of the cerebral motor areas in patients with acute poststroke dysphagia and reported improvement in swallowing function. Improvements of the swallowing reflex were seen in all patients in the present study. Verin and Leroi [] also reported improvement in the swallowing reflex delay time after rTMS, although they used low-frequency stimulation of the unaffected hemisphere. We did not measure pharyngeal constrictor muscle activity or swallowing pressure in the present study. Since our method does not require the direct use of food, the intervention is safe for patients who have difficulties with direct oral intake, compared with traditional rehabilitation. Although this study did not examine these outcomes adequately, the results suggest that the combination treatment seems to improve pharyngeal constrictor muscle function, prevent aspiration pneumonia by decreasing nocturnal saliva aspiration, improve tongue pressure and mastication coordination, and reduce gastroesophageal reflux. The present study has certain limitations. First, it was a case series lacking a control group, highlighting the need for future comparative studies. Second, the subtype of stroke, the lesion size, and the degree of dysphagia in the subjects were heterogeneous. It is desirable to perform the analysis after statistical corrections for these clinical factors. Third, the period between the onset of stroke and treatment varied among the subjects. By clarifying what kind of pathophysiology our therapy is most effective against, we can begin to discuss more appropriate rehabilitation programs. e c o m b i n a t i o n t h e r a p y o f b i l a t e r a l c e r e b r a l r T M S a n d i n t e n s i v e s w a l l o w i n g r e h a b i l i t a t i o n w a s s a f e l y c o m p l e t e d i n 4 p a t i e n t s w i t h c h r o n i c p o s t s t r o k e d y s p h a g i a . T h e t h e r a p e u t i c p r o t o c o l r e s u l t e d i n i m p r o v e m e n t o f s w a l l o w i n g f u n c t i o n i n a l l p a t i e n t s , s u g g e s t i n g t h a t o u r m e t h o d i s f e a s i b l e a n d s a f e f o r c h r o n i c s t r o k e d y s p h a g i a . e a u t h o r s h a v e n o c o n f l i c t s o f i n t e r e s t t o d i s c l o s e .

Metastatic castration-resistant prostate cancer (mCRPC) is uniformly fatal: in 2008, more than a quarter of a million deaths worldwide were attributed to this disease []. Nevertheless, progress has been made in extending the survival and improving the quality of life of men with mCRPC as improved therapies have become available [, ]. These improvements have been guided by a limited number of tools (imaging, serum tumor markers, and clinical signs and symptoms) for ongoing assessment of mCRPC. Additional tools that can contribute to accurate and timely measurement of disease status would improve patient care, quality of life, and potentially survival. Circulating tumor cells (CTCs) are rare cells that can be found in the peripheral blood of patients with many different types of cancer, but not in healthy controls []. Numerous prospective studies have demonstrated their prognostic utility in prostate and other cancers []. Patients with ≥5 CTCs/7.5 ml of peripheral blood have been shown to have a shorter time to relapse and a shorter survival time than patients with <5 CTCs/7.5 ml [, ]. In addition, certain properties of CTCs, such as high specificity for malignant disease [] and prompt changes in concentration with changes in disease state [], may lend themselves to accurate evaluation of metastatic disease status. An analytically validated test cleared by the United States Food and Drug Administration is commercially available for enumeration of CTCs in metastatic prostate cancer (CELLSEARCH, Janssen Diagnostics, LLC; Raritan, N.J., USA). One challenge to integrating any new assessment into patient care is determining the optimum use of the information provided by that assessment. Here, we discuss the application of CTC enumeration to assist in the monitoring of the disease status of a patient with metastatic prostate cancer in conjunction with preexisting tests to illustrate how CTC information might be useful in the clinical setting. The patient was a 54-year-old male with a 6-month history of hip discomfort. Imaging was ordered and lumbosacral films demonstrated multiple rounded and sclerotic foci over the visualized bony pelvis, which were considered suspicious for metastatic prostate cancer. The patient's prostate-specific antigen (PSA) level was 34.2 ng/ml. Based on these findings, the patient was referred for a prostate biopsy. The biopsy revealed prostate adenocarcinoma with a Gleason score of 7 (3 + 4) involving all cores from the right side. The patient was treated with complete androgen blockade. His PSA level reached a nadir of 3.6 ng/ml after approximately 3 months of therapy, after which it began to rise. By the sixth month of therapy, the patient's PSA had risen to 16 ng/ml (fig. ). An initial CTC measurement taken at this time returned a value of 36 CTCs/7.5 ml of peripheral blood using the CELLSEARCH system. Based on the elevated PSA and CTC levels as well as progression of pain due to osseous metastatic disease, the patient was placed in a clinical trial of docetaxel plus bevacizumab therapy. After 3 cycles of treatment (approximately 8 months after initial diagnosis) the patient's CTC level had risen to 145 CTCs/7.5 ml, while the PSA level dropped to 2.3 ng/ml. Computed tomography (CT) imaging demonstrated stable disease. At approximately 11 months after diagnosis, the patient's PSA level had dropped to 1.0 ng/ml and his CTC level had dropped to 13 CTCs/7.5 ml. Clinically, the patient reported worsening pain, which was attributed to diffuse osteoblastic metastases. CT imaging revealed progressive disease with nodal involvement. The patient was switched to oral cyclophosphamide. Within 1 month of initiating the new therapy, the patient reported that his pain was lessened. By 13 months after diagnosis, the CTC level had reached zero, while the PSA level increased to 3.4 ng/ml. After 16 months of therapy, the CTC level was 2.0 CTCs/7.5 ml and his circulating PSA level had fallen to 1.8 ng/ml; CT imaging showed a partial response. The patient continued on cyclophosphamide treatment for an additional 4 months, during which time both CTC and PSA levels slowly increased. By 19 months after diagnosis, his CTC level had risen to 5 CTCs/7.5 ml, while his PSA level was 2.4 ng/ml. Although CT imaging at this time showed stable disease, the patient reported an increase in pain. Considering the increasing pain and elevated CTC concentration as evidence of progression, cyclophosphamide treatment was discontinued and alternative treatment through clinical trials was pursued as a possible avenue for this patient. Two assessments commonly used in mCRPC, imaging and PSA concentration, are known to have properties that in some situations may reduce confidence in disease assessment []. Bony lesions frequently occur in mCRPC; however, CT imaging, radionuclide imaging, or other imaging modes often do not reveal responses to treatment in a timely fashion. Frequently, 2 rounds of imaging and 3 or more months of observation are needed to determine if there is progression or response to therapy. PSA levels are frequently unrelated to disease status due to factors such as previous therapy and tumor grade. In addition, both of these assessments are subject to ‘flare’ phenomena that can mask a response to therapy [, ]. When few assessment options are available, discordance between them can diminish confidence in treatment decision making []. CTCs have been shown in multiple prospective studies to be prognostic of both disease-free survival and overall survival in mCRPC []. In a manner similar to that described by others, this case illustrates how the prognostic value of the measured CTC concentration in the peripheral circulation can help resolve assessment discrepancies and increase confidence in treatment decisions []. In the first instance, after 6 cycles of docetaxel plus bevacizumab, this patient's PSA level had dropped from 16.1 to 1.0 ng/ml, suggesting a therapeutic response. However, the patient reported worsening pain which suggested the possibility of disease progression. His CTC level was measured at 13 CTCs/7.5 ml, well above the 5 CTCs/7.5 ml cutoff for poor prognosis mCRPC. The increasing pain and elevated CTC level prompted repeat imaging, which confirmed new nodal disease and progression. On this basis, the patient's therapy was switched to cyclophosphamide. Subsequently, the patient's CTC level diminished to zero, his pain resolved, and imaging 5 months later demonstrated a partial response. The decision was ultimately based on the specificity of CTCs for malignant disease and the high prognostic value of CTCs in mCRPC. Subsequently, 19 months into treatment the patient again reported worsening pain, although imaging suggested stable disease. The patient's PSA concentration had stayed consistently low, ranging from 1.0 to 3.4 ng/ml. The patient's CTC level, however, was measured at 5 CTCs/7.5 ml, which supported the conclusion that the patient's disease was progressing on cyclophosphamide therapy despite his low PSA concentration. The decision was made to discontinue cyclophosphamide and evaluate clinical trial options for the patient. Metastatic prostate cancer is difficult to evaluate, and therefore treatment decisions are challenging. The two most frequently used evaluation methods, imaging and PSA level, in some cases do not yield a clear answer on disease status and prognosis and are often discordant. This case illustrates how CTC enumeration, with information properties that complement other assessments, can compensate for some of the inconsistencies of other evaluation methods, thereby improving confidence in treatment decisions.

xref #text A 28-year-old man experienced upper respiratory symptoms and presented with photophobia 5 days later. Examination on day 4 of photophobia onset revealed that he was afebrile and fully alert. He had no eye pain. His distance visual acuity, intraocular pressure, and funduscopic findings were normal. His near visual acuity was not tested. His pupils were isocoric but remarkably mydriatic and 6.5 mm in diameter under the normal light of the room. There was no limitation to ocular movement, including accommodation. Light and accommodation reflexes were absent. There was no evidence of facial or oropharyngeal palsy. There was no limb weakness or ataxia, but the patient's deep tendon reflexes were decreased in the upper extremities and absent in the lower extremities. His plantar responses were flexor. His sensations of touch, pain, and vibration were normal. Instillation of 0.1% pilocarpine on the right side caused minimal pupillary constriction, whereas instillation of 2% pilocarpine caused pupillary constriction to 3.0 mm. His pupillary response to epinephrine was not tested. Routine hematological examinations were unremarkable. The serum IgG anti-GQ1b antibody titer was increased to 7.5 (normal: <1.0), while the serum IgG anti-GM1 antibody titers were not increased. Screening for autoantibodies, antinuclear antibodies, anti SS-A, and anti SS-B was negative. The cerebrospinal fluid showed 23 mg/dl of protein (normal: 10–40 mg/dl), and the white cell count was normal. Brain magnetic resonance imaging (MRI) showed no abnormalities. The patient was treated with a 3-day course of intravenous methylprednisolone, which was followed by oral prednisolone (40 mg/day). His pupil size gradually diminished and returned to normal on day 18. A 29-year-old man experienced diarrhea and presented with photophobia a week later. Neurological examination on day 5 of photophobia onset revealed dilated pupils, which were 7.5 mm in diameter, on both sides but without limitations of ocular movement, including accommodation. His distance visual acuity was normal, and his near visual acuity was not tested. Both light and accommodation reflexes were absent. The funduscopic findings were normal. He showed no limb ataxia. The tandem gait test revealed slight ataxia, but the patient's gait was almost normal. His deep tendon reflexes were symmetric and normal in the upper extremities and slightly exaggerated in the lower extremities. The plantar responses were flexor. His sensations of touch, pain, and vibration were normal. Instillation of 2% of pilocarpine caused pupillary constriction to approximately 3.0 mm. Diluted pilocarpine was not used. The pupillary response to epinephrine was not tested. Routine hematological examinations were unremarkable. The serum IgG anti-GQ1b antibody titer was not determined. Brain MRI showed no abnormalities. The patient was treated with a 3-day course of intravenous methylprednisolone (1,000 mg/day), which was followed by oral prednisolone (40 mg/day). The gait ataxia disappeared within a week. The photophobia gradually improved, and the pupil size returned to normal, with normal light reflex noted on day 98. The main clinical feature of our patients was postinfectious bilateral internal ophthalmoplegia without external ophthalmoplegia. Patient 2 demonstrated no other neurological symptom, while patient 1 showed mild gait ataxia. MRI revealed no abnormality in the brain or brainstem. Botulism was excluded because there was no history of causative food intake and no cranial nerve involvement, other than in the pupils. Based on these findings, a postinfectious autoimmune etiology was suggested. In patient 1, an assay for antiganglioside antibodies revealed an increased titer of IgG anti-GQ1b (7.5, normal: <0.4). In the literature, we found five cases of patients with presumed autoimmune isolated bilateral internal ophthalmoplegia (table ) [, , , , ]. We analyzed the clinical features of all 7 patients, including our 2 patients. Their ages ranged from 21 to 53 years (mean, 33.9 years), and the male-female ratio was 5:2. The male preponderance was in contrast to Adie's syndrome in which the majority of patients are female []. Light-near dissociation of the pupils was recognized in only 1 of 6 patients examined. Supersensitivity to dilute pilocarpine was noted in 2 of the 3 patients assessed. Light-near dissociation results from either afferent pupillary pathway dysfunction or a posterior ciliary ganglion lesion, while supersensitivity to dilute pilocarpine suggests damage to the ciliary ganglion or to the postganglionic parasympathetic fibers. These findings suggest that the responsible lesion sites may be located in the ciliary ganglion and surrounding areas and that the degree of postganglionic fiber damage may have varied. Deep tendon reflexes were decreased or absent in 4 patients, exaggerated in 2, and normal in 1. The 2 patients with exaggerated tendon reflexes did not demonstrate extensor plantar responses. Mild ataxia was present in 3 of 7 patients. An increased titer of the IgG anti-GQ1b antibody was revealed in 6 patients. High sensitivity of anti-GQ1b antibodies has been confirmed in FS [, ], while an increased titer of IgG anti-GQ1b has been reported in BBE, GBS, and acute ophthalmoparesis []. It has been proposed that these diseases fall under the category of anti-GQ1b IgG antibody syndromes []. Among the symptoms of these diseases, ophthalmoplegia and ataxia have been shown to be closely correlated with the IgG anti-GQ1b antibody [, ]. Internal ophthalmoplegia with increased anti-GQ1b IgG antibody titers has been reportedly observed in 7% of patients with acute ophthalmoparesis, 37% of patients with FS, and 42% of patients with BBE []. Internal ophthalmoplegia has also been observed in a few patients with GBS, especially in the severe cases []. These findings suggest that isolated internal ophthalmoplegia may be a variant of anti-GQ1b IgG antibody syndrome. Abundant anti-GQ1b antibodies exist in the paranodal regions of the extraocular cranial nerves [], and internal ophthalmoplegia has been speculated to be caused by ciliary ganglionic involvement []. It remains elusive whether isolated internal ophthalmoplegia occurs in association with negative IgG anti-GQ1b antibody. The different deep tendon reflex responses observed in the 7 patients suggest that internal ophthalmoplegia associated with hyporeflexia or areflexia is more like FS, while internal ophthalmoplegia associated with hyperreflexia is more like BBE. The natural course of isolated ophthalmoplegia is benign and self-limited. Four patients who underwent steroid pulse treatment showed recovery after 13 days to 3 months. On the other hand, the 3 patients who underwent no treatment showed recovery in 20 and 22 days and 4 months. This small difference in the recovery periods suggests that steroid therapy is not beneficial, which is also the case in FS, BBE, and GBS. Because internal ophthalmoplegia could lead to severe photophobia and blurred vision for some patients, the efficacy of other immunological strategies, such as plasmapheresis or intravenous immunoglobulin, should be investigated. e a u t h o r s h a v e n o c o n f l i c t s o f i n t e r e s t t o d i s c l o s e .

Hemangioblastoma (HB) is a benign tumor (WHO grade 1) that comprises 2% of all intracranial tumors []. The risk of spontaneous hemorrhage was reported by Gläsker et al. [] as having a very low probability (0.0024% per patient per year), and the majority of hemorrhagic events are subarachnoid and intracerebral bleedings []. Particularly, dorsal medulla oblongata HB with fourth ventricular hemorrhage is quite rare, and only 2 cases have been previously reported [, ]. The brainstem plays an important role in mediating the autonomic nervous system. Baroreflex failure is a neurovisceral disorder that selectively affects the network from the carotid sinus and aortic arch to the solitary tract nuclei, which regulates blood pressure and heart rate variability. Baroreceptors located in each carotid sinus, the aortic arch, and the great vessels of the thorax send information about distention of the vessel wall via the glossopharyngeal and vagal nerves to the solitary tract nuclei in the brainstem. In addition, the blood volume in the thorax is sensed by low pressure receptors linked by the vagal nerves to the solitary tract nuclei. Therefore, brainstem damage in the region of the solitary tract nuclei may result in baroreflex failure. This entails the loss of buffering of blood pressure and sympathetic activity, and is reported to be related to tako-tsubo cardiomyopathy (TTC) []. Here, we report a case of dorsal medulla oblongata HB presenting with fourth ventricular hemorrhage in a 23-year-old woman with no history of trauma or Von Hippel-Lindau (VHL) disease. Severe neurogenic pulmonary edema (NPE) and TTC occurred in the perioperative period. We present the clinical course of this rare case in detail and discuss some pathophysiological issues derived from this observation. A 23-year-old woman with no medical antecedents was admitted to our service because of a sudden headache, vomiting, and disturbance of consciousness while she was working. Initial physical examination revealed disturbance of consciousness (Glasgow Coma Scale E3V4M5), without any deficits of brain stem function. A cranial CT revealed hemorrhage in all cerebral ventricles, acute hydrocephalus, and a hyperdense mass in the cisterna magna (fig. ). Emergent angiography revealed tumor staining and several feeding vessels originating from the left posterior inferior cerebellar artery. According to these radiological findings, HB presenting as intraventricular hemorrhage was presumed as a preoperative diagnosis. Because her consciousness rapidly became worse (Glasgow Coma Scale E1V2M3), she underwent emergency surgical intervention immediately after an angiography. An urgent surgical removal of the tumor and external ventricular drainage were performed. The patient was placed in the prone position. After suboccipital midline incision, suboccipital craniotomy was performed. The reddish tumor measuring 3 × 2.5 × 2.5 cm was located in the dorsal medulla oblongata. The tumor feeders were carefully selected and sectioned, avoiding injury of pial passing arteries, and finally the tumor was removed in en bloc fashion. During the operation, a large amount of secretions were suctioned through the endotracheal tube and refractory hypotension was recorded. The tumor was composed of a large number of microvascular dilated vessels and a rich population of stromal cells. The nuclei were hyperchromatic, but no prominent pleomorphism, nucleoli, or other atypical features were evident. Histologically, the tumor was diagnosed as HB. Postoperative neurological examination showed dysphagia and ataxia from disturbance of deep sensibility derived from brain stem damage. After rehabilitation for dysphagia, ataxia, orthostatic hypotension and aglutition, she returned to normal status 12 weeks after surgery. Postoperative MRI showed no residual tumor (fig. ). She had no family history of VHL disease, and a gadolinium MRI study of the whole neuraxis ruled out any other HBs. Abdominal CT showed no mass in the kidney, and ophthalmological examination denied retinal hemangiomas. Spontaneous hemorrhage is a very uncommon event among central nervous system HB. With respect to the fourth ventricular hemorrhage, only 2 cases have been previously reported. Interestingly, one of them also presented TTC and NPE, as in our case. This fact suggests that medulla oblongata HB potentially induces TTC/NPE by its hemorrhage and provides us with an important clue for understanding the trigger mechanism of TTC and NPE. NPE and TTC may share a common phenotype, but have different etiologies. Although TTC has been acknowledged by the American Heart Association and the American College of Cardiology as a form of reversible cardiomyopathy, its exact pathophysiology has been unclear. The most accepted theory is myocardial stunning caused by a catecholamine-mediated mechanism. Recently, TTC has been reported as an important pathophysiology secondary to subarachnoid hemorrhage, ischemic stroke, epileptic seizure, and severe neurological injury []. NPE is defined as an acute pulmonary edema occurring shortly after various injuries to the central nervous system (stroke, intracranial hemorrhage, seizures, etc.). NPE also remains poorly understood because of its complex pathophysiology, but a close connection is presumed between NPE and sympathetic activity []. It has been reported that TTC and NPE occasionally occur simultaneously in subarachnoid hemorrhage, as in this case []. In our patient, HB arose from the dorsal medulla oblongata, in which solitary tract nuclei are located. Solitary tract nuclei take on the important role of baroreflex. Increases in sympathetic activity are restrained by baroreflexes, which are classic negative feedback loops. Damage to the solitary tract nuclei causes insufficiency in this negative feedback loop and results in baroreflex failure. Baroreflex failure entails the loss of regulation of the excess sympathetic activity characterized by volatility of blood pressure and heart rate, which could lead to TTC. Uncontrollable sympathetic activity may also cause NPE. r e , w e p r e s e n t e d a c a s e o f d o r s a l m e d u l l a o b l o n g a t a H B w i t h f o u r t h v e n t r i c u l a r h e m o r r h a g e . T h e p a t i e n t s u f f e r e d f r o m s e v e r e T T C a n d N P E i n h e r p e r i o p e r a t i v e p e r i o d . D a m a g e t o t h e s o l i t a r y t r a c t n u c l e i w o u l d b e p r e s u m e d a s a c a u s e o f t h i s u n u s u a l p a t h o p h y s i o l o g y . A f t e r r e m a i n i n g i n i n t e n s i v e c a r e f o r 1 2 w e e k s f o l l o w i n g s u r g e r y , s h e w a s d i s c h a r g e d w i t h o u t a n y n e u r o l o g i c a l o r r a d i o l o g i c a l d e f i c i t s .

Metastatic breast cancer continues to be almost uniformly fatal; however, improvements in survival in developed countries have been documented []. This improvement can be attributed to better therapeutic and diagnostic tools for disease management. Yet, there is a limited array of tools for a noninvasive assessment of metastatic breast cancer, which includes imaging [computed tomography (CT) scans, bone scintigraphy, positron emission tomography (PET), and magnetic resonance imaging] and measurement of serum tumor marker concentration in the peripheral blood. Additional tools for managing metastatic breast cancer are needed. One challenge to the introduction of new clinical tools is to determine their best use in clinical decision making. In other words, facilitating the integration of clinical information from these new assessments into the clinical workflow and decision making is critical. Circulating tumor cells (CTCs) are useful as an indicator of prognosis both initially and after therapy []. Multiple studies have shown that patients with ≥5 CTCs/7.5 ml of peripheral blood have a worse prognosis for survival than patients with <5/7.5 ml. The concentration of CTCs shed by solid tumors and detected in the peripheral circulation correlates with relapse and survival in multiple types of cancer [, , , , , ]. A system for measuring CTC concentration in peripheral blood to monitor metastatic breast, colon, and prostate cancer has been cleared by the United States Food and Drug Administration and is now commercially available for clinical use (CELLSEARCH, Janssen Diagnostics, LLC). However, how to best integrate this new information on disease status with existing measurements of disease prognosis and progression in clinical decision making remains empiric. Here we present a case of metastatic breast cancer in which CTC information was used to help resolve discrepancies between more conventional assessments to improve patient care. The patient was a 47-year-old Caucasian female. She was diagnosed with infiltrating ductal carcinoma of the right breast in 1994. The tumor was staged as T1N0M0. Pathology demonstrated estrogen-receptor-positive and progesterone-receptor-positive disease. At that time, she was treated with breast-conserving surgery, followed by radiation therapy. The patient refused adjuvant tamoxifen therapy. In March 1998, the patient was diagnosed with distant recurrence of her disease localized to the right femur. She was treated with radiation therapy, followed by paclitaxel and doxorubicin. After an initial response, the chemotherapy was discontinued and the patient was placed on maintenance letrozole and pamidronate. The patient was diagnosed with progressive disease based on imaging done in November 2006. Her therapy was switched to fulvestrant plus zoledronic acid based on the imaging study (table ). An initial CTC measurement using the CELLSEARCH System resulted in a determination of 1/7.5 ml (fig. ). A repeat CTC measurement in February 2007 again returned a value of 1/7.5 ml. In April 2007, PET/CT imaging revealed metastatic deposits in the liver and bone, suggesting progressive disease; however, based on the low CTC count in February the decision was made to not change treatment. Repeat imaging in July 2007 showed a partial response (PR) in the liver and bone lesions (fig. ). Thus, although the patient's CTC count had risen to 6/7.5 ml and initial tumor marker measurements were elevated (497 U/ml for CA 27.29 and 58 ng/ml for CEA), therapy with fulvestrant plus zoledronic acid was continued based on a lack of changes in imaging studies and continued good performance status (table ). In October 2007, the patient's CTC count remained at 6/7.5 ml, while her CA 27.29 had risen to 520 U/ml. In December 2007, the CTC count had declined to 0 and tumor marker levels were stable. PET/CT imaging demonstrated improvement in the liver lesions and a mixed response in the bone lesions (fig. ). The following month, the patient experienced increasing lower back pain. Radiation therapy was given to the metastatic sites identified as active by increased standardized uptake values from the PET/CT imaging in December 2007. The following February, CTC levels remained below 5/7.5 ml and tumor markers were elevated and stable. CTCs were absent from the patient's peripheral blood in a measurement in April 2008. In May 2008, PET/CT imaging revealed progressive disease, both in the liver and bone. Her CTC level had risen from 0 in April to 9/7.5 ml, and CA 27.29 had risen to 1,371 U/ml, confirming progressive disease (fig. ). The CEA level was up slightly from February. Biopsy of the liver lesions confirmed progressive metastatic breast cancer. The patient's therapy was switched to Abraxane plus bevacizumab (table ). In July 2008, after two rounds of chemotherapy with the new agents, her CTC level had again dropped to 0. Repeat PET/CT imaging at the end of July confirmed a PR to therapy. Over the summer, the patient experienced significant bevacizumab toxicity. Based on the positive response observed with imaging and CTC levels, the decision was made to discontinue treatment with the bevacizumab component of her treatment regimen. Her CTC level remained at 0 upon repeat measurement in September 2008. Based on PR on imaging and negative CTC counts, in September the decision was made to discontinue all chemotherapy due to progressive toxicity experienced by the patient, including new onset neuropathy (table ). Assessment of tumor activity in this case was difficult using conventional tumor markers and PET/CT imaging due to a lack of concordance between these assessments, which ordinarily would diminish confidence in treatment decisions. The use of CTC enumeration information to support clinical decision making in a setting of conflicting assessments has been suggested previously []. The specificity and responsiveness of the serum tumor markers, CEA and CA 27.29, are reported to be fairly low []. Radiographic assessment may have interreader variability and may not reflect changes in disease status in a timely manner []. CTC concentration has been reported to be specific for cancer and to respond to changes in disease state promptly [, ] and so may compliment other assessments. The initial response of CTC counts to therapy was complex. In the months after the initiation of fulvestrant plus pamidronic acid therapy in November 2006, the patient's CTC count rose to 6/7.5 ml, then stabilized. Although the CTC count had risen, imaging studies showed response to treatment and the patient's performance status was good, so therapy was continued. By December 2007, the CTC count had reached 0, which brought it into agreement with the PET/CT imaging studies. In contrast, the serum tumor markers remained elevated. Based on the imaging studies in July and December showing response to therapy and the absence of CTCs, the decision was made to continue therapy with fulvestrant and pamidronic acid. In this example, CTCs may have been more reflective of disease state than the serum tumor markers. At the May 2008 visit, both CTC and CA 27.29 levels were elevated, which supported imaging results that suggested progressive disease. CEA concentration was unchanged. This was an unusual instance, where all assessments were in agreement. The decision was made to start a new line of therapy with Abraxane plus bevacizumab. The patient responded to this change in therapy as assessed by CTC concentration in July 2008, which decreased to 0. The response was confirmed by imaging, which showed a PR. Although CTC count often responds to changes in disease state fairly quickly, in some instances, changes may not be seen in the first measurement [unpubl. observations, ]. In this case, the CTC count increased in the first half of 2007 following initiation of fulvestrant plus zoledronic acid therapy, while imaging suggested a PR. The CTC count stabilized at 6/7.5 ml from the July and October measurements, then decreased by the third measurement in December 2007. In our experience, CTC count responses following hormonal therapy in breast cancer may require 3–4 months or more to show a significant change. In contrast, the decrease in CTC concentration observed in the first measurement following change in therapy to Abraxane plus bevacizumab in July 2008 closely tracked the PR determined by imaging, which is typical in our experience for response of CTC counts to chemotherapy. Despite the differences in time to response, in both of these examples from this case the CTC count was ultimately concordant with imaging. The specificity of CTCs for breast cancer [] was important in considering the use of CTC enumeration information in this case. The patient experienced adverse effects attributed to bevacizumab [] in the summer of 2008, and the decision to discontinue bevacizumab was supported by the favorable imaging results and negative CTC levels following the change in therapy. Subsequent negative tests for CTCs in July 2008 and September 2008 gave us additional confidence that a discontinuation of paclitaxel therapy could be allowed so that the patient could recover from its adverse effects, using CTC tests as an option to monitor for disease progression. The use of CTC information in this context is consistent with recommendations to limit the use of imaging to monitor for cancer recurrence []. Management of metastatic breast cancer is challenging under any circumstances. This case illustrates how CTC assessments can corroborate imaging and clinical data. In addition, the type of therapy may influence the time to see a CTC response in breast cancer, with hormonal therapy often taking longer than chemotherapy. Finally, in this instance, we found CTC measurement a useful adjunct to imaging for monitoring for disease recurrence to give the patient a needed drug holiday. T . M . h a s r e c e i v e d r e s e a r c h f u n d i n g f r o m J a n s s e n D i a g n o s t i c s , L L C . T h e J o n B l o c k G r o u p i s a p a i d c o n s u l t a n t f o r J a n s s e n D i a g n o s t i c s , L L C .

Anthracyclines are active agents in the treatment of a wide variety of malignancies. For decades, the conventional anthracyclines have arguably been the most active agents against breast cancer in both the adjuvant and metastatic settings. However, the use of anthracyclines has been limited due to cumulative dose-related cardiotoxicity, in particular in the metastatic setting where a substantial proportion of patients have previously received an anthracycline as adjuvant chemotherapy in the modern era. Pegylated liposomal doxorubicin (PLD) is doxorubicin encapsulated in liposomes and sterically stabilized by the binding of methoxy polyethylene glycol to the surface. As a result, it has a different pharmacokinetic profile than conventional doxorubicin []. Both prospective studies and a retrospective analysis have demonstrated that PLD has equivalent efficacy, but a significantly lower risk for cardiotoxicity in women with metastatic breast cancer [, ]. Thus, PLD is commonly used to treat women with metastatic breast cancer, even in the setting of a previous anthracycline exposure, without substantially increasing the risk for cardiotoxicity. As compared with conventional doxorubicin, PLD is associated with an increased incidence of hand-foot syndrome and stomatitis. Here we report a case of a 57-year-old woman who developed acute transient encephalopathy during the course of receiving the very first dose of PLD. Fortunately, prompt discontinuation of PLD infusion resulted in complete recovery of her encephalopathy. Interestingly, she tolerated conventional doxorubicin well without any neurological symptoms in the following cycles of anthracycline therapy. To our knowledge, this is the first reported case of acute encephalopathy induced by PLD. A 57-year-old Caucasian woman was originally diagnosed with invasive ductal carcinoma in her right breast in February 2011 (ER-positive, PR-positive and HER2-negative). She was also diagnosed as carrying a mutation of BRCA 2. The patient underwent bilateral mastectomy and right-sided sentinel lymph node biopsy with 1 of 6 lymph nodes being found to be positive for metastasis. Unfortunately, she declined adjuvant chemotherapy and radiation recommended by her treating physicians, but only received adjuvant hormonal therapy with letrozole. In February 2012, she presented with renal failure and severe bony pain, and was found to have hypercalcemia with extensive osseous metastasis. CT-guided biopsy of one of the pelvic lesions revealed metastatic adenocarcinoma, consistent with her ER-positive primary breast cancer. The patient received aggressive hydration and denosumab for hypercalcemia. She also received radiation to her sacrum and bilateral sacroiliac joints to palliate her pain. The patient was enrolled in a clinical trial, receiving hormonal therapy with the combination of tamoxifen and metformin. Her monthly denosumab injection for bone metastasis was also continued. Unfortunately, her disease continued to progress, and she was found to have extensive lymphadenopathy involving the cervical, mediastinal and pelvic area. In January 2013, the patient was transferred to our center. As breast cancer in BRCA mutation carriers has been previously shown to respond to platinum-based chemotherapy [], treatment with single-agent carboplatin (AUC 5) was initiated. Three days after starting carboplatin, the patient developed a severe headache and projectile vomiting. An MRI of her brain revealed a large, dura-based, contrast-enhancing extra-axial mass, approximately 3.3 × 4.3 cm in size, causing severe vasogenic edema in the right frontotemporal region, resulting in a significant midline shift. She was seen by a neurosurgeon, and an emergent decompressive craniotomy was performed. The pathology of the resected mass was consistent with metastatic breast cancer. Postoperative brain MRI showed marked improvement, but unfortunately it also demonstrated some small dura-based masses over the left cerebral hemispheres. The patient recovered quickly and subsequently received whole-brain radiation therapy to treat dural metastases. Despite the delay of systemic therapy for almost 2 months due to craniotomy and radiation, her extra-cranial disease responded well radiographically to the first dose of carboplatin, and thus this agent was continued until June 2013. At this time, PET-CT showed a progression of the disease in the cervical, mediastinal and retroperitoneal lymph nodes. Carboplatin was discontinued and PLD was initiated as a second-line chemotherapy. For the first cycle, a total of 85 mg (40 mg/m) of liposomal doxorubicin in 250 ml of D5W (5% glucose solution) was prescribed with the same premedications used for the prior carboplatin. PLD was infused at a rate of 1 mg/min for the first 20 min. As no infusion-related adverse effects were observed, the rate was increased to 1.6 mg/min in order to complete the infusion over 1 hour according to our standard protocol. Twenty minutes later (approximately 50 mg PLD in total was given), the patient was noted to develop confusion. She had some tangential thoughts, started to make nonsensical comments to the people around her and began to tell stories from the past. The infusion was held and she was observed for 30 min, but her symptoms did not improve. An on-call physician was contacted to assess her. She was found to be alert and oriented and also able to answer questions appropriately. There were no neurological deficits. As the patient had an MRI earlier that day, no further imaging studies were performed. The infusion was discontinued due to the mental status change, and the patient was observed closely. Her symptoms persisted for 18 h and then resolved spontaneously. The patient's acute transient encephalopathy was deemed secondary to PLD. When she returned for the second cycle of chemotherapy, she was not rechallenged with PLD; instead, she was being administered conventional doxorubicin. This agent was tolerated well without any mental status change for another 5 months. Unfortunately, the patient developed a disease progression, requiring further palliative therapy with an eventual transfer to a hospice service, where she died 2 months later. Hand-foot syndrome, stomatitis and myelosuppression are the most common side effects of PLD, whereas, to the best of our knowledge, CNS toxicity induced by PLD has not been reported previously. Drug-induced CNS toxicity is a well-recognized but uncommon adverse effect of cancer therapy due to the presence of the blood-brain barrier (BBB), which separates the brain from the circulation, both physically and functionally. Physically, the BBB is essentially formed by special tight junctions between the epithelial cells that surround the brain tissue to prevent larger molecules from passing through. Functionally, the barrier actively excludes, effluxes and metabolizes potential neurotoxic compounds such as cytokines, antibodies, drugs, etc. []. Consequently, only small and hydrophilic molecules such as glucose can easily cross the BBB. Under physiological conditions, the BBB protects the brain's internal milieu against the toxic substances. Conversely, the very same mechanism significantly impairs the delivery of many chemotherapeutic agents to treat primary or secondary brain tumors []. Other than the permeability of the BBB, the efficacious drug delivery in the CNS also depends on the fraction free of plasma protein binding and the extent of active efflux transport from the brain []. One strategy to improve the delivery of chemotherapeutic agents to the CNS is to encapsulate the small-molecule drugs in liposomes to circumvent the BBB []. Liposomes are artificially prepared vesicles with an aqueous core, surrounded by a lipid bilayer which confers more resistance of doxorubicin to hydrolysis []. Polyethylene glycol coating (pegylation) causes sterical hindrance for the uptake by the reticuloendothelial system, avoids interaction with plasma components and reduces renal filtration. As a result, PLD has a circulation half-life of approximately 74 h, whereas the conventional doxorubicin has a half-life of less than 10 min []. These pharmacokinetic properties including prolonged circulation and extended extravasation through leaky vasculature of the tumor certainly facilitate the delivery of PLD to cross the BBB. Indeed, it was reported that there was up to a 30-fold higher accumulation of PLD in the cerebrospinal fluid and a 9- to 14-fold increased level in the tumors of rats bearing an inoculated brain sarcoma as compared to the concentration achieved with its counterpart, conventional doxorubicin []. Interestingly, in patients with metastatic brain tumors, the accumulation of PLD was 7–13 times higher in the metastatic lesions than in the normal brain tissue, suggesting a more effective delivery of PLD via a partially disrupted BBB []. It is generally believed that the BBB is selectively disrupted at the sites of malignant tumors, and radiation may further enhance this effect. In a study of 14 patients with primary brain tumors, it was demonstrated that the perilesion permeability was 22% higher than the adjacent normal brain tissue, and it increased to 76% after 30–40 Gy of radiation. Radiation also increased the permeability of normal brain tissue by 25% []. This concept is also supported by the fact that brain metastases have been reported to respond to systemic chemotherapy, although the response rate is much lower than that of the primary tumor or the extracranial metastatic sites [, ]. It can be difficult to sort out a cause and effect relationship between a chemotherapeutic agent and mental status change since many metabolic abnormalities could lead to altered mental status. Further, a large percentage of patients receive regimens comprised of multiple chemotherapeutic agents, making it difficult to indict a particular drug. However, the temporal association with PLD and a lack of known precipitant factors for encephalopathy supports our hypothesis that PLD indeed induced acute transient encephalopathy in this case. Moreover, that retreatment with a conventional doxorubicin with exactly the same premedications did not induce a mental status change seems to further lend support for this hypothesis. A Medline search found no other reports associating this drug with mental status change, and to the best of our knowledge, this case appears to represent the first report of this kind. In our case, the development of encephalopathy was rather acute. Infusion of PLD (the only chemotherapy agent administered) resulted in a transient encephalopathy, which resolved gradually by discontinuation of PLD. Therefore, the cause and effect are quite evident. PLD has been studied quite extensively in multiple clinical trials, yet no mental status change has been reported as a direct side effect of PLD. As discussed above, PLD does not cross the intact BBB effectively to reach the normal brain tissue, but rather accumulates at a very high concentration in the metastatic tumor, suggesting at least a partial disruption of the BBB is required for the effective delivery of PLD. Our patient had developed dural masses, requiring surgical intervention and whole-brain radiation before she was treated with PLD. We postulate that all these 3 factors could have collectively contributed to the partial disruption of the BBB, with a unique pharmacokinetic profile, PLD rapidly accumulated in normal brain tissue, resulting in acute encephalopathy. s u m m a r y , t o o u r k n o w l e d g e , w e r e p o r t h e r e t h e f i r s t c a s e o f P L D - i n d u c e d a c u t e t r a n s i e n t e n c e p h a l o p a t h y s o t h a t c l i n i c i a n s c a n b e m a d e a w a r e o f t h i s p o t e n t i a l s i d e e f f e c t , p a r t i c u l a r l y i n p a t i e n t s w h o h a v e r e c e i v e d w h o l e - b r a i n r a d i a t i o n f o r b r a i n m e t a s t a s i s .

xref #text A 35-year-old Japanese male presented to the Emergency Department of Okinawa Chubu Hospital with right hemiparesis. He had awakened from sleep with severe, sharp chest pain that was not accompanied by dyspnea. The chest pain subsided within 1 min without treatment, but medical evaluation was sought due to obvious dysarthria and weakness of the right upper and lower limbs. The patient was previously healthy, with no prior hospital admissions, surgeries, medications, or allergies, but bilateral pedal edema had developed 3 months prior to presentation. He had no dyspnea or ambulatory dysfunction and did not seek medical intervention. He worked as a house painter and lived with his wife and children. He had 15 pack-years of exposure to tobacco, and consumed 400 ml of Okinawan spirits nightly. There was no family history of cardiovascular disease, thromboembolism, or chronic kidney disease. Physical examination revealed that the patient was alert with no distress. He was not obese (BMI 21.4 on admission, when he was edematous), and he was afebrile with a blood pressure of 140/90 mm Hg, a regular pulse of 85 beats/min, and a respiration rate of 25 breaths/min. Oxygen saturation in the room air was 100%. An examination of the head revealed a marked, right-sided facial droop, but was otherwise normal. Carotid upstrokes were symmetric without bruits. The heartbeat was regular without gallops or murmurs, and the lungs were clear; the abdominal examination was also normal. Bilateral pitting edema was present to the knees. There were no rashes or petechiae. Neurological examination revealed intense dysarthria, which made it difficult for him to communicate with others, and right-sided central facial nerve palsy. Both the right arm and leg were at Brunnstrom stage 1, with complete flaccidity and no voluntary movement. Pain and light touch sensation were absent on the right side of his body. Table contains initial laboratory data. Blood counts revealed leukocytosis and hemoconcentration. Serum albumin was markedly low at 1.8 g/dl. Serum cholesterol, triglyceride, and low-density lipoprotein cholesterol were elevated. The urine protein to creatinine ratio was 7.5 g/g Cr, indicative of high-grade proteinuria. The examination of the urine sediment revealed oval fat bodies, and testing for anti-nuclear antibodies, anti-neutrophil cytoplasmic antibodies, and anti-phospholipid antibodies were all negative. Hepatitis B and C serologies were negative. Diffusion-weighted magnetic resonance imaging showed high-intensity areas consistent with acute infarction in the left basal ganglia, left corona radiata, and left cerebral cortex (fig. ). Contrast-enhanced computed tomography of the neck revealed collateral blood flow around a large embolus in the left carotid artery (fig. ). Ultrasound of the left carotid revealed the embolus without any plaques or ulcers at the vessel wall (fig. ). There were no aortic dissections, pulmonary emboli, renal vein thromboses, or deep vein thromboses on the computed tomography. A transthoracic echocardiogram showed normal contractility without dilated chambers, valvular disease, vegetations, intraluminal thrombi, or any findings suggesting pulmonary embolism, such as pulmonary hypertension or right ventricular stress. A presumptive diagnosis of ischemic cerebrovascular accident caused by a left carotid thromboembolism was attributed to a hypercoagulable state due to NS. Because of the lack of any findings of atherosclerosis or plaques at the left carotid, we believed that embolism was more likely than thrombosis. The origin of the embolus was not detected despite a thorough cardiovascular evaluation. Immediate anticoagulation with unfractionated heparin was employed, and the renal biopsy was deferred. Intravenous methylprednisolone was administered empirically at 1,000 mg/day for 3 days, followed by oral prednisone at 60 mg/day. Cyclosporine was added 30 days later in response to persistent nephrotic-range proteinuria (5.5 g/day on the 28th day). The patient was transferred to a rehabilitation hospital 47 days after first admission. However, the blood examination performed after transfer revealed abnormal liver function on the 74th day from the first admission, the results of which are detailed in table . Serological studies and abdominal ultrasound excluded viral hepatitis or biliary obstruction. He was immediately readmitted under suspicion of drug-induced hepatotoxicity. Medications on admission included prednisolone (50 mg/day), warfarin (2.75 mg/day), cyclosporine (70 mg b.i.d.), sulfamethoxazole/trimethoprim (400/80 mg daily), eicosapentaenoic acid (900 mg b.i.d.), atorvastatin (10 mg/day), lansoprazole (30 mg/day), alfacalcidol (0.25 μg/day), andronate (35 mg/week), and calcium lactate (1 g b.i.d.). All medications except for prednisone were subsequently withheld, and warfarin was replaced by intravenous heparin. The liver test results normalized, but they deteriorated upon rechallenge with warfarin. At this time, heparin therapy was briefly interrupted to permit a renal biopsy to evaluate refractory NS, with hypoalbuminemia (2.1 g/dl) and proteinuria (5.7 g/day). The biopsy showed MN at stage III of the Ehrenreich and Churg classification. Continued anticoagulation was deemed necessary due to severe persistent hypoalbuminemia and the severe cerebrovascular accident. Warfarin appeared to be clinically intolerable due to idiopathic hepatotoxicity despite a negative lymphocyte stimulation test. Intravenous heparin therapy was incompatible with outpatient rehabilitation. We discussed the indication of dabigatran, the only available novel oral anticoagulant in Japan at that time, with the patient and also with cardiologists, a neurologist, and the vice-principal of our hospital, all of whom were responsible for the prescription of dabigatran, and we decided to initiate treatment. We also explained and discussed the risks and benefits of dabigatran with the patient and obtained his written and informed consent in advance. Oral dabigatran was administered at a dose of 110 mg b.i.d., and MN was treated with oral prednisone and cyclophosphamide according to Jindal's regimen []. Proteinuria decreased from a ratio of 5.1 to 1.6 g/g Cr, and serum albumin rose from 2.3 to 3.7 g/dl over 7 months. He was transferred to the rehabilitation hospital 137 days after stroke onset. At the outpatient clinic, his renal function remained stable, and he did not experience any episodes of edema, bleeding, or thromboembolism. We monitored the activated partial thromboplastin time (aPTT) to predict the risk of bleeding due to excessive anticoagulation. The aPTT values taken 4 h following administration of dabigatran in the morning were stable at around 40 s (standard aPTT was 30 s). A carotid echogram performed 2 years after the initiation of dabigatran revealed a reduced embolus, although it did still occlude the internal carotid. The PubMed database was searched for related literature. The search parameters were ‘nephrotic syndrome’, ‘membranous nephropathy’, ‘stroke’, and ‘infarction’. Twenty-one prior cases have been reported [, , , , , ] and are detailed in table , along with our case. The age of onset ranged from 19 to 59 years; 16/22 (72.7%) were male. Histopathology was MN in 5 cases (22.7%), minimal change in 4 cases (18.2%), membranoproliferative glomerulonephritis in 3 cases (13.6%), focal segmental sclerosis in 2 cases (9.0%), diabetic nephropathy in 1 case (4.5%), and IgA nephropathy in 1 case (4.5%). Pathologic diagnosis was undetermined in 6 cases (27.2%). The middle cerebral artery territory was most frequently involved; the left and right middle cerebral artery areas were involved in 8 cases (36.4%) and 5 cases (22.7%), respectively. Carotid occlusion, as in our patient, was reported twice. Hypercoagulability contributes to the predisposition to thromboembolism in NS. Hypercoagulability of NS seems to be caused by an imbalance of prothrombotic and antithrombotic factors []. The loss of low molecular weight coagulation factors (factor IX, XI), antithrombin III, plasminogen, and free protein S in the urine, along with inverse increases in high molecular weight procoagulant cofactors (factor V, VII, VIII, and X), fibrinogen, alpha 2-antiplasmin, alpha-2-macroglobulin, diphosphate, and platelet aggregation have been reported as causes of this predisposition []. Risk factors for thromboembolic complications include a history of thromboembolism, pre-existing coagulation disorders, genetic predisposition, severity of hypoalbuminemia, volume depletion, use of diuretics or glucocorticoids, venous stasis, immobilization, and underlying renal pathology []. The role of conventional atherosclerotic risk factors in the promotion of arterial thromboembolism is not well defined. At any rate, our patient sustained a major stroke with relatively few conventional risk factors. MN is considered to present a particularly high risk for hypercoagulable states, but venous or arterial thromboembolism has also been reported in membranoproliferative glomerulonephritis and minimal change. As with our patient, most of the reported cases sustained stroke at earlier ages than patients with atherosclerosis and atrial fibrillation – this suggests that NS may independently predispose individuals to arterial and venous thromboembolism. Before we will get down to the discussion of anticoagulation with dabigatran, we would like to explain our management of two controversial issues: the use of glucocorticoids and the switching of the immunosuppressants. First, because the use of glucocorticoids is a well-known risk factor for thromboembolic complications of NS, our early administration of a high-dose glucocorticoid may be somewhat controversial []. However, we believed that the early initiation of a glucocorticoid would contribute to a better outcome because the patient might develop further thromboembolic complications as long as he remained nephrotic. The fact that an arterial embolus had developed without the existence of a glucocorticoid seems to support our supposition. Second, switching cyclosporine to cyclophosphamide may also be considered controversial. Although it may have been too early to regard cyclosporine as ineffective, we thought that the rapid remission of NS was essential for the patient because the efficacy and safety of anticoagulation with dabigatran for an extended period has not been established. We therefore initiated the strongest available treatment option for MN. The optimal, standardized approach to the prophylaxis and management of thromboembolic complications associated with NS has not been established. Anticoagulation with sequential heparin and oral warfarin may represent the de facto standard of treatment due to the traditional frequency of use []. Experience with subcutaneous heparin is limited due to practical issues (e.g., patient inconvenience, difficulty with monitoring), and no alternative oral anticoagulants have yet been established. Dabigatran is a direct competitive thrombin inhibitor that can be given orally. Dabigatran has been a substitute for warfarin in the prophylaxis of stroke associated with nonvalvular atrial fibrillation [] and has been used for postoperative thromboprophylaxis in orthopedic patients in Canada and Europe []. A recent study showed the noninferiority of dabigatran compared to warfarin for treatment of acute venous thromboses []. The dosage of dabigatran is an important point of discussion. Dabigatran is generally used at 150 mg b.i.d. A lower dosage of 110 mg b.i.d. is indicated for patients with a higher risk of bleeding, such as elderly patients, patients with renal impairment (more than 30 ml/min of creatinine clearance), and patients with a previous history of gastrointestinal bleeding. Although our patient was only 35 years old and without any risk for bleeding, we treated him with 110 mg b.i.d., the dosage indicated for patients with a higher risk of bleeding. Maximal caution was taken because of the lack of previous experiences with dabigatran, the limited information on drug interactions (especially between immunosuppressants), and the lack of health insurance coverage available in Japan. While it might be better to use a regular dose (150 mg b.i.d.) of the agent, we considered safety to be the first priority due to the reasons discussed above at the time of initiation. Given that the embolus persists, an increase in the dosage of the agent should be considered. Usability without regular monitoring is an outstanding feature of novel anticoagulants such as dabigatran. However, the necessity of monitoring has been discussed recently because fatal hemorrhagic complications associated with dabigatran have been reported, especially in elderly patients and patients with renal impairment. A value of aPTT is reportedly well correlated with the risk of bleeding associated with anticoagulation due to dabigatran, although it is not correlated with the efficacy of the agent. An aPTT value of more than 70–80 s measured at the dabigatran trough is associated with major bleeding []. In an outpatient situation, the measurement of aPTT at the trough might be difficult to accomplish. In fact, we measured aPTT 4 h following the administration of dabigatran instead of at the trough. We believed that measurement at any time could be tolerated because the difference between the values of aPTT measured at the peak (2 h following oral administration of dabigatran) and the values of aPTT measured at the trough was reportedly less than 10 s []. Thus, an aPTT value of less than 80 s at any time would be, to some extent, indicative of safety. Nevertheless, a more effective parameter of excessive anticoagulation is warranted because of the low specificity and the lack of standardized reagents of aPTT measurement []. Our patient was safely treated for carotid thromboembolism with dabigatran rather than warfarin. Although the embolus persisted, we believe that dabigatran worked to diminish the embolus and, at the very least, contributed as thromboprophylaxis without any complications. This indicates the potential utility of dabigatran in patients with thromboembolic complications associated with NS. We need to carefully consider the indication of dabigatran for thromboembolic complications associated with NS because the indication is currently off-label in all countries. Appropriate explanation and discussion with the patients and careful monitoring for the risk of hemorrhagic complications due to excessive anticoagulation such as regular aPTT measurement will also be required in clinical settings. Although warfarin will remain the first-line anticoagulant for this situation, dabigatran offers a good treatment option for patients who are intolerant of warfarin. Further research is needed to clarify the safety and efficacy of dabigatran for patients with NS. b e h a l f o f a l l a u t h o r s , t h e c o r r e s p o n d i n g a u t h o r s t a t e s t h a t t h e r e i s n o c o n f l i c t o f i n t e r e s t .

Membranous glomerulonephritis accounts for 20% of all cases of adult lupus nephritis []. Lupus membranous nephritis (MN) is relatively rare in children [, ]. Histologically, it is characterized by subepithelial immune deposits along the peripheral capillary loops leading to uniform thickening of the glomerular capillary wall. Immunofluorescence shows subepithelial and often concomitant mesangial immune deposits. MN presents with various clinical signs ranging from nephrotic syndrome (NS) to asymptomatic proteinuria. In most cases, proteinuria is nonselective and associated with microscopic hematuria. Hypertension is present in a small subset of patients []. In children, MN is responsible of 5% of cases of primary NS, while in adults it is considered a main cause of NS [, ]. Histologically, MN is characterized by the uniform thickening of the glomerular capillary wall on light microscopy. The latter thickening is associated with subepithelial immune complex deposits that appear as granular deposits of immunoglobulin G on immunofluorescence. Recently two target antigens have been discovered, neutral endopeptidase [] and type-M phospholipase A2 receptor (PLA2R) []. PLA2R is the first autoantigen identified in idiopathic membranous nephropathy in adults. This provides new tools for monitoring disease activity and should help designing new antigen-driven therapeutic strategies in the future. MN can manifest in a clinical setting of lupus nephritis, hepatitis B, Epstein Barr virus and others [, , , ]. Other rare causes have been described including C4 complement deficiency and antitubular basement membrane antibodies []. The treatment algorithm for managing MN in adults relies on assessing the prognostic factors at illness onset and trying to achieve a balance between the probability of renal failure and the risk of immunosuppression. Since MN is rare in the pediatric age group, no standardized approach to therapy in children has been identified [, ]. Patients with lupus MN present with proteinuria and hematuria up to NS. Patients are frequently treated with angiotensin-converting enzyme inhibitors (ACEi) and angiotensin receptor blockers (ARB), and often with a low-salt diet or thiazide diuretics. Other protocols have been proposed including short steroid therapy, more potent immunosuppressive drugs like cyclophosphamide, mycophenolic acid, calcineurin inhibitors, and B-cell depleting agents, but controlled studies are rare [, , , , , , , ] despite existing guidelines from the KDIGO [], ERA/EDTA [] and ACR []. Specific pediatric recommendations do not exist. The use of immunoadsorption has been considered in several autoimmune diseases, but still studies are lacking in the pediatric and adolescent age group. We report the case of an 11-year-old previously healthy girl (36 kg, 151 cm) who presented to the emergency room for nephrotic proteinuria and microscopic hematuria found on routine dipstick examination. The patient was afebrile, without edemas. Initially analysis showed a serum creatinine of 42 μmol/l, with a total serum protein of 62 g/l. Three weeks later, the patient had palpebral edema, initially considered as an allergic manifestation and treated by antihistamine medication for 2 weeks. Therefore, total serum protein levels decreased to 46 g/l and albumin was 11 g/l, with a proteinuria of 12 g/l. Vital signs were normal with a blood pressure of 123/76 mm Hg. The patient was initially treated as idiopathic NS with daily oral prednisone therapy (60 mg/m) for 1 month. Immunological investigations showed elevated antinuclear antibodies (>1/640), positive anti-Smith antibodies, and positive anti-ribonuclear antibodies, with a normal complement including C3 (1,090 mg/l), C4 (321 mg/l), and CH50 (145%). Serology for hepatitis B, C and HIV returned negative. Renal ultrasound showed well-differentiated kidneys of normal size. Kidney biopsy revealed histological lesions and immunofluorescence deposits compatible with membranous lupus nephritis. No vascular or tubulointerstitial fibrosis was found. The patient was started on ACEi (enalapril 20 mg once daily), ARB (losartan 50 mg once daily), mycophenolic acid (540 mg twice daily), and hydroxychloroquine (200 mg daily). Five months later, nephrotic proteinuria (8 g/l) and hypoalbuminemia (11 g/l) persisted. Therefore, we decided to perform ten sessions of daily immunoadsorption (TheraSorb Ig flex adsorbers, LIFE 18; Miltenyi Biotec GmbH, Teterow, Germany). Proteinuria decreased significantly over these ten sessions from 8 to 0.12 g/l after session 8 (fig. ). After the tenth immunoadsorption session, the patient received a first rituximab (RTX) infusion (375 mg/m). The initial CD19 and CD20 levels were 28% and became 0% at 6 days after the RTX injection. The patient was maintained on ACEi and thiazide diuretics associated with hydroxychloroquine and mycophenolic acid. Three RTX reinjections were performed at 375 mg/m after 3, 5 and 7 months, respectively, when CD19-positive cells recovered in peripheral blood (13, 12 and 17%, respectively). Despite complete B-cell recovery and positive anti-dsDNA-Ab, the patient remained in complete remission 24 months after the initial diagnosis; she has negative proteinuria and a normal serum creatinine of 37 μmol/l. During the whole follow-up period, the patient was maintained on ACEi, mycophenolic acid and hydroxychloroquine. Lupus nephritis remains the most common severe manifestation of systemic lupus erythematosus characterized by the presence of autoantibodies (Abs) that are believed to play a central role in its pathogenesis. Among more than 100 Abs reported in systemic lupus erythematosus, only a few display a direct glomerular binding capacity. Such antiglomerular Abs are detected at the onset of the disease generally before the detection of antinuclear Abs. Antiglomerular Abs encompass anti-α-actinin, anti-laminin-1, antifibronectin, antimyosin and anticollagen Abs. Extracorporeal immunoadsorption is a method to remove such circulating antibodies mainly, thus potentially reducing the antibody-kidney deposition and proteinuria []. Data on membranous lupus nephritis in children are rare. Long-term prognosis in class 5 lupus nephritis patients depends on treatment response [, ]. Corticosteroid treatment seems to be of relatively low efficiency and its indication in pure class 5 lupus nephritis is strongly questioned today as long as there is no proliferative lesion associated to MN. Our patient had initially normal complement C3 and C4 levels, but anti-nuclear Abs were initially present and anti-dsDNA-Abs were initially negative and were positive 1 month later. They remained positive during the whole B-cell depletion period. However, proteinuria changed from nephrotic range to negative after ten daily immunoadsorption sessions. If specific lupus antibodies are believed to be involved in the pathomechanism of proteinuria in membranous lupus nephritis, it is surprising that proteinuria became rapidly negative after introduction of immunoadsorption while anti-ds-DNA Abs were still present during and after immunoadsorption and during B-cell depletion. Therefore, one may hypothesize that other Abs not related to anti-DNA might have played a role in disease activity. In conclusion, it seems that immunoadsorption can help to reduce proteinuria safely in patients with membranous lupus nephritis and persistent nephrotic range proteinuria despite several months of ACEi/ARB, mycophenolic acid and hydroxychloroquine treatment. Negative proteinuria at the time of RTX injection may increase RTX bioavailability.

Adenosquamous carcinoma (ASC) of the stomach is a rare malignancy, accounting for <1% of all gastric carcinomas [, , , ], and is characterized by a mixture of two components: adenocarcinoma and squamous cell carcinoma. In the adenocarcinoma component, the differentiated type is more frequently observed than the poorly differentiated type [, , ], and the clinicopathological features of this tumor are dependent on the histological type of the adenocarcinoma component []. On the other hand, lymph node and liver metastases are frequently observed in ASC, and these metastases also tend to be found in advanced stages at diagnosis [, , , , , , ]; hence, this malignancy seems to a have a poorer prognosis than conventional gastric adenocarcinoma [, ]. Human epidermal growth factor receptor-2 (HER2), a membrane-associated receptor with an intracellular tyrosine kinase domain, dimerizes with other HER family members and mediates signal transduction pathways linked to cell growth and survival. HER2 is overexpressed in approximately 20% of gastric adenocarcinoma cases and is considered a key therapeutic target for HER2-positive gastric adenocarcinoma. In the Trastuzumab for Gastric Cancer (ToGA) trial, trastuzumab, a monoclonal antibody targeting HER2, significantly improved overall survival when combined with chemotherapy in the treatment of advanced HER2-positive gastric adenocarcinoma []. However, to date, there are no reports regarding immunoreactivity for HER2 and its role as a therapeutic target in gastric ASC. Here, we report a patient with gastric ASC with HER2 overexpression who achieved a dramatic durable response with trastuzumab-based chemotherapy, presumably because of strong HER2 immunoreactivity in the tumor. The findings of the present report warrant further investigation to clarify the role of HER2 in this rare tumor. A 66-year-old man was referred to our hospital with a diagnosis of gastric adenocarcinoma. Upper gastrointestinal endoscopy revealed type 3 advanced gastric cancer of the lesser curvature of the upper to lower gastric body (fig. ), and histological analysis of biopsy samples showed poorly-differentiated adenocarcinoma. Serum concentrations of carcinoembryonic antigen (CEA) and carbohydrate antigen 19–9 (CA19–9) were highly elevated (86.8 ng/ml and 6,970 U/ml, respectively). An abdominal CT scan revealed thickening of the gastric wall and enlargement of the abdominal lymph nodes, but no evidence of distant metastasis. A total gastrectomy with lymph node dissection (D2) was performed with a curative intent. In the postoperative period, the patient developed a pancreatic fistula with a subphrenic abscess, which was subsequently drained. A macroscopic examination revealed a type 1 protruded lesion occupying the lesser curvature of the gastric body, measuring 87 × 82 mm at its largest dimensions, which invaded beyond the serosal layer. A pathological diagnosis of the resected ASC specimens showed that it was composed of a mixture of adenocarcinoma and squamous cell carcinoma components (fig. ). Both components were moderately differentiated; the adenocarcinoma component showed tubular structures and the squamous cell carcinoma component showed partly differentiated keratinizing cells. The individual components constituted nests adjacent to one another. Venous and lymphatic invasion were identified (v3 and ly2, respectively). Metastatic lesions were identified in 6 of 49 dissected lymph nodes, in which only an adenocarcinoma component was observed. According to the 14th edition of the Japanese Classification of Gastric Carcinoma [], the cancer was graded as T4aN2M0 (stage IIIB). Immunohistochemical staining for the membrane-bound HER2 protein using a polyclonal antibody (HercepTest; Dako A/S, Glostrup, Denmark) showed that both the squamous carcinoma and adenocarcinoma components of the primary tumor were strongly positive (score, 3+) for HER2 (fig. ). A high level of gene amplification in both components was also detected by dual-color chromogenic in situ hybridization (INFORM HER2 Dual ISH; Ventana Medical Systems Inc., Oro Valley, Ariz., USA) (fig. ). About 2.5 months after curative surgery, an abdominal CT scan showed multiple metastatic lesions in the bilateral lobes of the liver (fig. ). The serum concentrations of CEA and CA19–9 increased to 669.6 ng/ml and 7,380 U/ml, respectively. Systemic treatment with capecitabine (2,000 mg/m, days 1–14), cisplatin (80 mg/m, day 1), and trastuzumab (8 mg/kg dose-loading followed by 6 mg/kg, day 1) was initiated every 21 days. After 3 treatment cycles, all metastatic liver lesions had regressed (fig. ) and a partial response (PR) was confirmed after 6 cycles (fig. ). After confirmation of a PR, the patient was maintained on combination chemotherapy with capecitabine and trastuzumab. The levels of all tumor markers were within normal limits 9 months after chemotherapy initiation. PET and CT scans performed 13 months after chemotherapy initiation revealed no uptake in the metastatic liver lesions (fig. ). Thereafter, maintenance therapy with trastuzumab alone was started and the PR was maintained for 16 months after initiation of chemotherapy. To our knowledge, this is the first report of HER2-positive ASC successfully treated with trastuzumab-based combination chemotherapy. Several hypotheses for the origin of a squamous cell carcinoma component in ASC have been proposed: squamous metaplasia of a pre-existing adenocarcinoma [, , , ]; oncogenic transformation of metaplastic or ectopic squamous cells [], and stem cell differentiation into both adenocarcinoma and squamous cell carcinoma [, ]. Accumulating evidence supports the first hypothesis. First, although the occurrence of metaplastic or ectopic squamous epithelium is extremely rare, neither can explain the coexistence of an adenocarcinoma component. Second, ASC is most often diagnosed at an advanced stage of disease [], and the squamous cell carcinoma component is often located in a deeper layer than the adenocarcinoma component []. In a study by Mori et al. [], ASC was exclusively found in 9 (0.9%) of 976 patients with advanced disease, whereas it was not found among 1,028 patients with early-stage disease. Third, independent ultrastructural studies revealed the existence of a single malignant cell containing both secretory vesicles and tonofibrils in ASC [, ]. Moreover, independent immunohistochemical studies demonstrated that both components expressed identical levels of the tumor suppressor gene [, ]. In our patient, there was no normal squamous epithelium in the surrounding mucosa and both components positively stained for HER2, supporting this hypothesis. Previous studies indicated that both components can metastasize into a variety of patterns. Lymph node metastasis frequently occurs with an adenocarcinoma pattern [, ] and occasionally with both components [, , , ]. Lee et al. [] reported that metastatic lymph nodes were composed of only the adenocarcinoma components in 9 (64.3%) of 14 cases, whereas both components and only the squamous cell carcinoma component were found in 3 and only 1 patient, respectively []. Consistent with this observation, metastatic lymph nodes in our patient consisted of only the adenocarcinoma component. Recently, Saito et al. [] reported that the Ki-67 index in the adenocarcinoma component was higher than that in the squamous cell carcinoma component in all 8 patients examined, further supporting these findings. Regarding other metastatic sites, some previous studies reported that the adenocarcinoma component was predominant [, ]; however, others found both components [, , ]. Mori et al. [] found that both components existed in almost all metastatic lesions at autopsy in 9 patients. In the present case, the tumor was strongly positive for HER2 in both components; therefore, it was not of therapeutic significance to examine which component type had metastasized to the liver. ASC is often diagnosed as advanced or recurrent disease; therefore, the majority of patients may be candidates for systemic chemotherapy. In several case reports, systemic chemotherapy, such as S-1 [], paclitaxel [, ], or irinotecan plus cisplatin [], has been reported as an effective treatment for advanced ASC; however, no standard chemotherapy has been established for ASC because of its rarity. We selected trastuzumab-based chemotherapy due to the fact that this tumor was clinicopathologically similar to classical adenocarcinoma, even though the clinical prognosis is different between these two types of tumors []. The durable response achieved in our patient can be attributed to the strong immunoreactivity of HER2 and high-level amplification in both the adenocarcinoma and squamous cell carcinoma components. Considering that the differentiated type is more common in the adenocarcinoma component [, , ], and that HER2 overexpression is more frequently observed in the intestinal type of gastric adenocarcinoma [], further studies to evaluate the rate of HER2-positivity and its clinical significance in ASC are warranted. In summary, we reported a patient with HER2-positive ASC who achieved a durable PR after administration of trastuzumab-based combination chemotherapy. Our results indicate that trastuzumab is an effective treatment for ASC as well as gastric adenocarcinoma; in addition, they indicate that HER2 status should be examined in ASC. e a u t h o r s d e c l a r e t h a t t h e y h a v e n o p o t e n t i a l c o n f l i c t s o f i n t e r e s t .

xref #text xref #text xref #text

Native kidney biopsy is a useful tool to establish a diagnosis, treatment and prognosis of glomerular and tubulointerstitial diseases. It reveals a diagnosis different than anticipated in 50% of cases, and its result modifies treatment in 20-50% of cases []. Yet, because of bleeding complications [,,], physicians are at times reluctant to request a native kidney biopsy [,,]. Events related to the procedure usually occur within the first 24 h. Some studies have concluded that the majority manifest within 8 h [], while others maintain that a short observation time misses more than a third of complications and recommend a 24-hour waiting period []. Whether a selected group of patients can be safely discharged the same day following a kidney biopsy is still debated [,,,,,]. Doing so, while insuring patient safety, using a valid risk assessment would positively impact their quality of life and also reduce health care costs. This study addressed the rate and risk factors of symptomatic hematomas following native kidney biopsy. We also evaluated if same-day discharge is safe. This was a retrospective study designed for an internal quality project to evaluate renal biopsies at our institution. It was approved by our institutional review board, and as so, was exempted from our ethics committee approval. All native kidney biopsies performed at the Centre Hospitalier de l'Université de Montréal (CHUM), Montreal, Que., Canada, between January 2007 and July 2011 were included. Native kidney biopsies were performed by radiologists using an automated or semi-automated needle under ultrasound or CT scan guidance. The procedure was usually done at the lower pole of the kidney unless performed for investigation of renal mass. Patients stopped anticoagulation therapy appropriately and antiplatelets use at least 7 days prior to biopsy. All patients had a complete blood count, international normalized ratio (INR) and partial thromboplastin time (PTT) prior to the procedure. Platelet (PLT) function tests (PFA-100 test or bleeding time) were not systematically performed. After the biopsy, the patients maintained bed rest for 6 h. Vital signs and urine aspect were checked regularly. Postbiopsy imaging was done when clinically indicated at the discretion of the attending physician or following a location protocol. Information reviewed from charts included demographic data, history of liver disease, type of renal presentation, blood pressure within the week prior to biopsy, serum creatinine, eGFR (using the MDRD formula), hemoglobin (Hb), PLT, INR, PTT and bleeding time or PFA-100. We obtained information on kidney size, needle size, number of needle passes and number of glomeruli obtained. We recorded the administration of fresh frozen plasma (FFP), PLTs and red blood cell (RBC) transfusions as well as the use of desmopressin. Uncontrolled hypertension was defined as >50% of systolic and diastolic readings of >140/>90 mm Hg within the week prior to biopsy. We noted the occurrence and timing of symptomatic hematoma (hematoma with abdominal pain warranting radiologic assessment, hypotension, a drop in Hb of ≥10 g/l or macroscopic hematuria), urinary infection, the need for RBC transfusion or angio-intervention. Inpatients are defined by a preexisting hospitalization prior to biopsy. According to local practice, outpatients were observed for either 24 or 8 h. We analyzed risk factors of symptomatic hematoma and compared inpatients to 8- and 24-hour outpatients. Normally distributed variables are expressed as mean ± standard deviation and compared using t test or one-way ANOVA. Non-normally distributed variables are expressed as median with interquartiles (Q1-Q3) and compared using Mann-Whitney U test or Kruskal-Wallis test. Categorical data are compared using χ test. All p values were 2-tailed, and values <0.05 were considered statistically significant. Analyses were carried out using SPSS software (version 20; IBM, North Castle, N.Y., USA). A total of 312 native kidney biopsies were performed in 287 patients. The mean age was 54 ± 15 years, 51% of patients were females, median eGFR was 37 ml/min/1.73 m, 10% were on dialysis, 8% had liver disease and 17% had uncontrolled hypertension. Fifty-three percent of biopsies were done in inpatients, 16 and 31% in outpatients scheduled for a 24- or 8-hour observation period, respectively. Information was missing in <5% of cases for all variables except for PLT function tests, drop in Hb and kidney size, missing in 60, 17 and 42% of cases, respectively. Imaging was in fact available in 84% of patients prior to biopsy, but kidney size was not always specified, other than presence or absence of atrophy. Seven percent of biopsies were performed for the diagnostic workup of renal masses, 19% for nephrotic range proteinuria, 9% for rapidly progressive renal insufficiency, 18% for acute kidney injury, 11% for a chronic kidney disease, and the remaining 36% for non-nephrotic proteinuria and/or hematuria. Most biopsies were done under ultrasound guidance using a 16-gauge needle with three needle passes (table ). Eleven percent of the available bleeding times were elevated. Overall, 33% of patients received desmopressin, 4% PLTs, and/or 4% FFP. The incidence of symptomatic hematoma was 15%, 9% of patients needed RBC transfusion and 3 inpatients required an angio-intervention (table ). Individuals requiring RBC transfusion had an initial Hb of 92 ± 14 g/l as opposed to 115 ± 22 g/l (p < 0.001) in those who did not. Twenty percent of transfused patients had a drop in Hb of <10 g/l. Among the transfused patients, only 55% had postbiopsy imaging, of these 20% had no hematoma. There was no nephrectomy or death. At 8 h, 84% of patients who developed complications had clinical manifestations. This increased to 86% at 12 h and 94% at 24 h (table ). The PLT count prior to biopsy was highly predictive of symptomatic hematoma (fig. ). Among those with a low PLT count (<140 × 10/l, n = 30), 7 received PLT transfusion prior to biopsy and 29% had a symptomatic hematoma as opposed to 39% in those without a PLT transfusion (p = 0.61). Although eGFR was not predictive of symptomatic hematoma, individuals receiving hemodialysis were more likely to bleed (29 vs. 14%, p = 0.02). Finally, outpatients experienced fewer events (table ). We found no statistical association between bleeding complications and age, sex, uncontrolled hypertension, hepatic disease, biopsy by ultrasound or CT scan, Hb, INR, PTT or abnormal PLT tests. The use of desmopressin and FFP did not translate into fewer complications although patients who received these treatments had lower PLTs and eGFR, and a higher INR (data not shown). Interestingly, there was no association with the number of needle passes with a median of three passes in individuals with and without a symptomatic hematoma. There was a trend toward fewer symptomatic hematomas with 18-gauge needles (fig. ) and statistically more glomeruli when a 16-gauge needle or larger was used (fig. ). Overall, 148 biopsies were performed in outpatients, 99 had an 8-hour observation period and 49 a 24-hour stay. Inpatients differed with regard to comorbidities, eGFR, preventive treatments and complications (table ). The outpatients group more frequently received desmopressin despite a lower rate of abnormal PLT tests. This paradox is created by the 24-hour hospital protocol in which PLT function tests are routinely measured and desmopressin is proposed. Overall, 27% of inpatients experienced any complications as opposed to 14% of outpatients (p = 0.002). The decision to observe patients 8 or 24 h was based on each hospital's protocol. These two subgroups did not differ in eGFR, mean Hb or coagulation studies prior to biopsy. The incidence of complications was similar in both groups and all happened within the first 8 h of observation (table ). This is a cohort of 312 kidney biopsies of inpatients (53%) and outpatients (47%) in our institution. A total of 15% of patients developed a symptomatic hematoma. Hematoma was not regarded as significant unless it was associated with a clinical complication (abdominal pain warranting radiologic assessment, hypotension, a drop in Hb of ≥10 g/l or macroscopic hematuria). Radiologic hematomas without any repercussion were not included for several reasons. Silent perinephric hematomas are less clinically relevant since they can occur in >85% of patients after percutaneous biopsy and they are not predictive of major complications [,]. Moreover, not all patients had a systematic routine ultrasound examination postbiopsy. It must be noted that arteriovenous fistulas were not reported because they were not systematically looked for. In fact, according to the previous literature these are common but rarely have a clinical impact [,]. We found that we had a higher rate of symptomatic hematomas (15%) compared to the literature (7.8%) []. This is probably due to our definition of symptomatic hematoma that includes several clinical events. Another reason may be the inclusion of a large proportion of hospitalized patients. Indeed, there were more symptomatic hematomas in inpatients (18%) compared to outpatients (12%), although it was not statistically significant. The inpatient population had more comorbidities including dialysis (18 vs. 1%), a lower Hb at baseline (101 ± 18 vs. 125 ± 20) and more PLT transfusion (5% vs. none). A higher transfusion rate was also found when compared to previously reported studies (9 vs. 0.4-6%) [,,,]. Indeed, a large number of patients had a low Hb concentration prior to biopsy as a mild decrease in Hb can lead to transfusion and a low Hb itself might be a risk factor for bleeding []. However, of the transfused patients who had a postbiopsy imaging, 20% did not have a hematoma. The decrease in Hb without the finding of a radiologic hematoma can be explained by hemodilution from a saline infusion before and after the biopsy. It can also depend on the modality of imaging, since CT scans are more sensitive in detecting hematoma than echography. We found that the PLT level was a statistically significant risk factor for symptomatic hematoma. There was also a non-significant trend for less symptomatic hematomas when patients with thrombocytopenia received PLT transfusion prior to biopsy. We did not find that age, uncontrolled hypertension, and a decreased GFR were associated with an increased risk of hematoma or blood transfusion [,]. Major events did not correlate with neither the needle size nor the number of passes as found in the study by Tondel et al. [], although there was a non-significant trend for more hematomas with larger needles. In our whole cohort, 16% of complications appeared after the first 8 h. Outpatients had fewer complications and these manifested within 8 h, whether they were observed for 8 or 24 h, and 14% were hospitalized for a longer period than planned. Only 1 outpatient returned to the emergency room (with unrelated abdominal pain), and no further complications were noted on follow-up notes in the other patients' charts. These results are in line with Lin et al. [] who found that there is no difference in the rate of complications between patients who are admitted and those observed for a 6-hour period, the latest being acceptable. By contrast, Whittier and Korbet [] found that 42% of complications following native kidney biopsy manifested at ≤4 h, 67% at ≤8 h, 85% at ≤12 h, and 89% at ≤24 h. According to this study, the optimal observation period should therefore be 24 h. Our study has limitations, it is a retrospective study and our population is not homogenous but still represents our daily practice. By including only clinically significant events in the definition of clinical hematoma our goal was to include only events that had a real impact on the patients. In conclusion, in our study symptomatic hematomas occurred in 15% of kidney biopsies and were strongly associated with PLT count and hemodialysis. Patients chosen for a biopsy on an outpatient basis had less comorbidities than those who were hospitalized, and they experienced fewer complications all observable within the first 8 h. Therefore, same-day discharge with an 8-hour observation period is a medically adequate procedure in carefully selected patients, a significant finding, since outpatient biopsies are economically advantageous. e a u t h o r s h a v e n o c o m p e t i n g f i n a n c i a l i n t e r e s t s t o d i s c l o s e .

xref #text The patient was a 55-year-old female who presented for evaluation of incoordination and gait disturbance. There were no issues during birth or early development. She was able to speak at 10 months and walked at 12 months. She had some learning disabilities, especially concerning visuospatial tasks, but was able to finish high school and earn a college degree with special education accommodations. At age 32, she developed ‘head-bobbing’ stereotypies and mild facial chorea. Ataxic gait developed at age 37, at which time she was noted to walk as if she were intoxicated. She began to use a rolling walker at age 50 and required a wheelchair at age 52. Family history is significant for a second cousin (i.e. with shared great-grandparents) with ‘amyotrophic lateral sclerosis’, which in retrospect could have been DCS progressing to quadriparesis []. On initial examination, she was microcephalic and exhibited dwarfism at less than 150 cm tall. She weighed about 40 kg. There were numerous facial scars from her 10 basal cell carcinoma excision surgeries. She had diffuse skin freckling. On mental status examination, she was alert and oriented to person and doctor's office, but not to date. There was significant cognitive impairment with ability to follow only one-step commands. Her small stature and overall demeanor were particularly childlike. She was very anxious and perseverated on statements such as being afraid of falling out of her wheelchair or requesting to go to the bathroom. She was able to perform the Luria sequence only by directly copying the examiner, and even those attempts were partially complicated by motor perseveration. On eye movement examination, saccade initiation and velocity were diminished. There was no facial chorea; in fact, she had hypomimia. There was bilateral hearing loss. There were intermittent side-to-side and up-and-down head movements which were most likely titubation secondary to cerebellar dysfunction. In addition, there was moderate finger-to-nose dysmetria and bilateral upper extremity dysdiadochokinesis as well as involuntary movements likely due to a combination of ataxia and possible proprioceptive sensory loss (for online suppl. video , see ). Unfortunately, she could not cooperate enough for a detailed sensory examination. Sensation was grossly intact to light touch. She was able to protrude her tongue for 10 s, demonstrating a lack of motor impersistence. Deep tendon reflexes were diminished throughout. There was severe postural instability; hence, she was able to stand up only with assistance. Bilateral Achilles tendon shortening was present and contributed to difficulty in standing. Commercially available laboratory testing was negative for the Huntington's disease gene as a cause of chorea. A paraneoplastic antibody panel for anti-Ri, Yo, cancer-associated retinopathy, Zic4, amphiphysin, CV2, Hu, Ma, Ta, voltage-gated potassium channel, P/Q type voltage-gated calcium channel, glutamic acid decarboxylase, NMDA receptor (NR1), and ganglionic nicotinic acetylcholine receptor (Athena Diagnostics, Worcester, Mass., USA) was also negative. Additional commercially available genetic testing was negative for spinocerebellar ataxia and , dentatorubral-pallidoluysian atrophy as well as ataxia with oculomotor apraxia type 1 (aprataxin/) and type 2 (senataxin/), Marinesco-Sjögren syndrome , sensory ataxic neuropathy, dysarthria, and ophthalmoparesis (SANDO/), ataxia with isolated vitamin E deficiency (AVED/), and Friedreich's ataxia (Athena Diagnostics). Neuroacanthocytosis is a concern in the setting of mental retardation, possible peripheral neuropathy, and chorea, but a blood smear was negative for acanthocytes. There were no intracranial calcifications on computed tomography of the head, arguing against Cockayne syndrome (CS). MRI at age 54 revealed severe generalized atrophy (fig. , fig. , fig. ). Clinical diagnosis of XP was made by a dermatology consultant. Genetic testing for causative genes has not been performed because commercial testing is not available in the USA. At age 55, the patient developed dysphagia to solids, resulting in aspiration pneumonia. She recovered after appropriate antibiotic therapy and now receives nutrition via a gastrostomy tube. Anxiety improved after starting escitalopram, but this medication had to be stopped after an episode of liver enzyme elevation. Given that an attempt to install a coating on her home windows to block UV light was unsuccessful for technical reasons, she was instructed to spend as much time as possible in the interior rooms of the house which do not have direct sunlight. DNA repair problems were identified as a cause of XP by Cleaver [] in 1969. There is a defect in nucleotide excision repair – removing pyrimidine dimers produced by UV light []. About 20% of XP cases may have associated neurological symptoms [, ]. Decreased deep tendon reflexes, hearing loss, ataxia, and chorea can occur as in our case. XP complementation groups A, B, C, D, E, F, G, and V exist. Small stature and childlike demeanor suggesting sexual immaturity makes DCS likely []. DCS may be considered a severe subtype of XP complementation groups A or D, with mutations in or []. Older descriptions of DCS also include features of microcephaly, choreoathetosis, ataxia, sensorineural deafness, and progression to quadriparesis with shortening of the Achilles tendons []. These features have drifted into the modern definition of XP. The current definition of DCS includes ‘cutaneous photosensitivity, microcephaly, mental retardation, short stature, hypogonadism, spasticity, peripheral neuropathy, and sensorineural deafness’ []. Our patient appears to fit both the modern and classic definitions of DCS. This case does not have CS phenotypic features. In contrast to XP and DCS, classic clinical CS phenotype includes intracranial calcification, normal to increased deep tendon reflexes, and an absence of cutaneous cancer. The gene was initially discovered in CS, but identical mutations can, peculiarly, also cause XP and DCS []. Hence, there is considerable phenotypic heterogeneity. In addition, there is a genetic and clinical overlap between XP, trichothiodystrophy (TTD) and CS. TTD is in the differential diagnosis, but less likely given the absence of brittle hair and ichthyosis. Other TTD symptoms include photosensitivity, intellectual impairment, short stature, microcephaly, brain demyelination, protruding ears, and micrognathia []. Global cortical, brainstem, and cerebellar atrophy similar to this case were demonstrated in a case report by Mittal et al. []. While hyperostosis frontalis interna may be a benign incidental finding, interestingly it was also present on images in that case report []. Supportive treatment and prevention of further damage from UV light is the mainstay of treatment for dermatological manifestations of XP and DCS. Effective treatment for neurological manifestations of these disorders is not available. n d r e l a t e d s y n d r o m e s s h o u l d b e c o n s i d e r e d i n t h e s e t t i n g o f n e u r o l o g i c a l d i s o r d e r a n d m u l t i p l e s k i n c a n c e r s .

Adrenocortical carcinoma (ACC) is a rare, aggressive malignancy that features a correspondingly poor prognosis. Its pathogenesis is poorly understood, especially at the molecular level, as the rarity of the disease renders comprehensive study difficult [, ]. As a result, therapeutic options are currently limited, with medical and radiation therapy complementary to surgery, which is currently the only curative modality []. The disease accounts for ≤0.2% of all malignancies and despite multimodal therapies, its prognosis remains poor, with a mean survival of <30 months []. An overall incidence of 0.5–2 per 1 million cases has been reported annually worldwide [, ]. The disease shows a slight female gender preference and a bimodal age distribution, with the first peak in children <5 years of age and the second peak in the fourth to fifth decade of life []. A 63-year-old female patient presented left flank pain for 1 year associated with a palpated mass in this topography. In the previous 2 months, she had experienced nausea without vomiting and weight loss (not measured). Computerized tomography was performed for staging which revealed a large mass of 20.8 × 16.5 × 10.6 cm (1,902.6 cm) in size with multiple areas of central necrosis and significant neovascularization in the left adrenal topography without a cleavage plane with pancreas and left kidney and thrombus in the inferior vena cava (fig. , fig. ). No other lesions were visualized. The patient was submitted to surgery with en bloc resection of the mass, body and tail pancreatectomy, splenectomy, left nephrectomy and thrombectomy of the inferior vena cava (fig. , fig. ). She was discharged from hospital on the fourth postoperative day with no complications. Histopathology revealed an adrenal carcinoma, a solid pattern, associated with low grade, 20 × 18 cm in size, and Ki67 of approximately 5%. We observed capsule infiltration, an extensive necrosis area, clear margins and no lymph node involvement – pT4N0M0 – pathologic staging IV, American Joint Committee on Cancer (AJCC) 2010, European Network for the Study of Adrenal Tumors (ENSAT) stage III. Adjuvant therapy was conducted with mitotane on an initial low-dose scheme. After 8 months of follow-up after surgery, the patient remained without any signs of recurrence on computerized tomography and magnetic resonance scans of the abdomen. Written informed consent was obtained from the patient for publication of this case report and any accompanying images. ACCs arise from cells of the adrenal cortex, which are specialized steroidogenic cells that produce glucocorticoids, mineralocorticoids, and androgens. Tumorigenesis may lead to abnormal hormone function, in approximately 60–70% of adult patients [], and result in excess production of steroid hormones that may clinically manifest as Cushing's syndrome, Conn's syndrome, virilization or feminization []. However, a proportion of ACCs may be nonfunctional, and patients may present with nonspecific symptoms such as abdominal pain or fatigue []. Although ACC is usually sporadic, it may be associated with familial cancer susceptibility syndromes including the Li-Fraumeni syndrome, Beckwith-Wiedemann syndrome, multiple endocrine neoplasia type 1, and familial adenomatous polyposis []. These tumors are classified as either nonfunctional or functional depending on whether they produce corticosteroids, androgen, estrogen or mineralocorticoids. Although early studies reported that up to 50% of these were functional, more recent series have noted hormone secretion in up to 79% of ACCs []. Surgery is of the utmost importance in the treatment of these tumors. Open surgery with transperitoneal access is the standard treatment of all patients with localized (stage I–II) and local advanced stage (stage III) when complete resection can be achieved. Laparoscopic adrenalectomy is a safe and effective procedure for pheochromocytoma and for patients with small ACCs (<8 cm) without preoperative evidence of invasiveness, and adrenal masses that are judged to be only potentially malignant []. The resection status (R0, R1, R2) is a major predictor of prognosis for ACC. A margin-free complete resection (R0 resection), in fact, provides the only means to achieve long-term survival. In order to obtain such resection it is often mandatory to resect adjacent organs such as the wall of the vena cava, liver, spleen, colon, pancreas and/or stomach []. Clinical stages I and II with tumors have a 5-year survival rate of 84 and 63%, respectively. Stage III patients have a 5-year survival rate of 51% and stage IV drops to 15% at 1 year. It is important to know that most patients surviving at 5 years are not cured but living with the disease and 85% of patients resected for cure will develop recurrence or distant metastasis. Other factors negatively influencing the outcome are a size of >12 cm, high mitotic activity, necrosis, high expression of Ki67 and TP53 gene mutation positivity []. In 2009, a paper proposed a revision of the AJCC TNM classification, further called the ENSAT staging system []. The major finding of their evaluation of the proposed International Union Against Cancer (UICC) system is the observation that patients with stage II disease do not differ considerably in their disease-specific survival from patients with stage III disease. Furthermore, patients who have stage IV disease with documented distant metastases have a poorer survival than patients who have UICC stage IV disease without distant metastases, thus clearing the improving prognostic potential. Mitotane has been the mainstay of systemic ACC treatment since the 1960s. Studies suggest that adjuvant mitotane can delay and possibly prevent a recurrence of the disease []. In 2008, a panel of international experts unanimously recommended adjuvant mitotane in patients with potential residual disease or a Ki67 positivity on pathologic examination of >10%. Similarly, the same panel did not consider mitotane mandatory for patients with stage I or II disease who underwent histologically proven total resection with clean margins (R0 resection) and a Ki67 index of <10%. The panel was undecided on whether to offer adjuvant therapy to stage III ACC patients following a R0 resection [, ]. s a r a r e d i s e a s e w i t h p o o r p r o g n o s i s . A l t h o u g h m o s t r e c u r r e n c e s i n t h e a d j u v a n t s e t t i n g o c c u r a t < 6 m o n t h s p o s t o p e r a t i v e l y , t h i s p a p e r r e p o r t e d o n a p a t i e n t s u b m i t t e d t o s u r g i c a l m u l t i o r g a n r e s e c t i o n ( R 0 r e s e c t i o n ) , p a t h o l o g i c s t a g e I V ( A J C C ) a n d E N S A T s t a g e I I I a s s o c i a t e d t o a d j u v a n t c h e m o t h e r a p y w i t h o u t s i g n s o f r e c u r r e n c e i n a n o n g o i n g f o l l o w - u p o f 8 m o n t h s . e a u t h o r s h a v e n o c o n f l i c t s o f i n t e r e s t t o d i s c l o s e .

Mucopolysaccharidosis type VI (Maroteaux–Lamy syndrome, MPS VI, OMIM 253200) is an inherited metabolic disease caused by a deficient activity of -acetylgalactosamine-4-sulfatase (4-sulfatase, arylsulfatase B, ARSB, EC 3.1.6.12), a lysosomal enzyme involved in the degradation of dermatan sulfate (DS) [, ]. The clinical presentation of MPS VI varies greatly with respect to age of onset and rate of disease progression. Descriptive classification systems have described patients’ phenotypes as severe (with early onset of symptoms and fast progression), attenuated (with later onset, slower disease progression, and variable clinical presentation), and intermediate [, ]. Especially in attenuated phenotypes, a definite diagnosis may be delayed for years because early symptoms are difficult to recognize for physicians not familiar with the disease, since the disease progresses silently over decades. The incidence rates for this rare disease vary in the literature between 0.05 [] and 2.3 [] diagnosed MPS VI patients per 100,000 live births. Allele frequencies of the different mutations are very low, and most mutations are unique to individual families, except for a high prevalence of p.R152W mutation in Eastern European population []. This report focuses on the less severe form of MPS VI. The objective of this article is to show the existence of significant differences between so-called attenuated patients and to highlight the need of close cooperation of different specialties in order to recognize the disease early. The knowledge of natural history and genotype–phenotype correlation may also help in developing a tailored therapy. The protocol was approved by the Human Subjects Institutional Review Board at the Children’s Memorial Health Institute. Written informed consent had to be provided by the parents or legal guardians. All patients and/or their families provided written consents about using their photos. The main demographic and clinical characteristics of all patients in our series are shown in Table . All of the patients were Caucasian, and no sex predominance was seen. No consanguinity between parents was recorded. The results of the literature review are presented in Table , which includes only reports with clinical data ( = 36). The review of the literature allowed distinguishing two types of attenuated MPS VI phenotypes: osteoarticular and cardiac. In a majority of reported patients, a relatively attenuated phenotype meant an essentially osteoarticular phenotype. These patients initially presented with bone and joint symptoms, especially pain and stiffness in the joints, joint contractures, and hip and back pain. At some point, most of these patients developed serious manifestations of the disease including joint degeneration, sleep apnea, a decrease in pulmonary function, reduced endurance, cardiac valve disease, and skeletal complications including carpal tunnel syndrome and hip disease. Unlike the majority of reviewed patients, patients homozygous for p.R152W mutation showed a significantly different clinical phenotype with predominance of cardiovascular manifestations [, ]. Mutations associated with an attenuated MPS VI phenotype are presented in Table . Apart from the p.R152W and p.Y210C mutations, other mutations have been reported as associated with attenuated disease progression: p.C192R [] when present in homozygous state and p.D83Y [], p.C405Y [], and p.R434I [] when present in compound heterozygous states. Osteoarticular attenuated phenotype is predominantly associated with a missense mutation p.Y210C, while cardiac with p.R152W in homozygosity. So far, only one patient homozygous for p.Y210C mutation has been described in the literature, while in the majority of patients, this mutation is present with other mis- or nonsense mutation []. One of the first descriptions of mucopolysaccharidosis type VI was probably by the neurologist Nonne []. After several investigators indicated heterogeneity of MPS VI based on radiological findings, the patients’ size, and longevity [, ], McKusick suggested separating a severe form (mucopolysaccharidosis type VIA) from a mild variant (type VIB) []. Based on McKusick’s classification, the longevity, size, lack of cardiac insufficiency in association with mild cardiac murmurs, lack of abnormality of sella turcica, and the absence of umbilical or inguinal hernia, marked hepatosplenomegaly, and marked corneal opacities warranted the diagnosis of the mild B variant of MPS VI []. Apart from severe and attenuated phenotypes, descriptive classification systems have also described an intermediate disease form. Other authors suggested other classification systems based on height and urinary glycosaminoglycan (uGAG) levels, the age at the onset of symptoms, patient’s height, and the age of death [, ]. In reality, there are no fixed parameters to ascribe a particular patient to a single category, and the decision is subjective depending on physician’s experience and knowledge. The relatively attenuated disease form is generally characterized by later onset of symptoms which may not at first appear in a recognized pattern, but when apparent, the milder symptoms may be observed by an alert physician and lead ultimately to diagnosis usually after 5 years of age, but it may be delayed until the second or third decades. Results from our study and review of the literature allow for distinguishing two types of attenuated MPS VI phenotypes: osteoarticular and cardiac. It is likely that patients with osteoarticular symptoms will be found in either rheumatology or orthopedic clinics. The similarity of attenuated MPS VI to the more commonly seen rheumatological conditions means that patients are often misdiagnosed and there is a delay before the patient’s symptoms are attributed to MPS. Patients with a cardiac variant of MPS VI are much more probable to be found in cardiology clinics [, ]. In these patients, cardiac disease progresses silently and ultimately leading to heart failure and does not correspond with the other typical MPS features which are very mild or absent []. An advanced valve defect is an indication for valve surgery, which may be beneficial in these patients at an earlier stage of the disease. In both phenotypes, the pathological process seems to be restricted at first to one system only, either osteoarticular or cardiovascular. In the cardiac phenotype, however, it tends to have more serious complications leading to fast disease progression and abrupt death []. Despite the utility of communicating with these descriptive categories, it is important to recognize that the symptoms of the disease manifested along a continuum. Using a descriptive classification is very helpful for clinicians; however, it is important to bear in mind its implications. The term attenuated (or used by some slowly progressing) implies a slower disease progression, and it may be perceived that these patients do not require treatment as urgently as severe patients. The truth is that these patients may remain asymptomatic for years with silently (but not necessarily slowly) progressing disease and be recognized in an advanced disease stage when it is too late for any intervention []. For this reason, we previously suggested using a term to add a sense of urgency as these patients require treatment to be administered prior to the onset of valve disease []. The awareness among cardiologists and rheumatologists should be raised so they can play an important role, not only in the management but also in the diagnosis of these patients []. The extent of cardiac involvement may be underestimated in patients with mucopolysaccharidosis because of restrictive pulmonary disease and skeletal abnormalities that limit patients’ activities []. We have previously presented a diagnostic algorithm, suggesting uGAG analysis in any patient with valve disease even in the presence of very mild or untypical disease symptoms []. In cases with a high index of suspicion such as those with a positive family history or those with other characteristic features of MPS VI, enzymatic activity should be determined even if uGAG excretion is low. As attenuated patients may still be very difficult to recognize, the delay in diagnosis may make it difficult to influence valve disease with available treatment. Apart from this, we have to bear in mind that the usefulness of enzyme replacement therapy is limited due to the fact that a given enzyme preparation does not have beneficial effects on all aspects of a disorder in the same degree. The effect of ERT alone on cardiac structure and function in MPS patients has been documented in only a few studies [–] and larger studies with longer follow-up are still needed. Additionally, clinical studies have shown that many symptoms of mucopolysaccharidoses even after long-term treatment are not anymore reversible. It seems probable that in the future, a tailored combination therapy using ERT with novel therapeutic options such as application of small molecules that either inhibit a key enzyme which is responsible for substrate synthesis (substrate deprivation) or act as a chaperone to increase the residual activity of the lysosomal enzyme (enzyme-enhancing therapy) will be the most effective []. By identifying patient’s genotype, it may be possible to predict the course of the disease and establish more tailored treatment plan. Patients with the p.Y210C mutation should be covered by a special care team of orthopedists, physiotherapists, and rheumatologists with a plan of rehabilitation, proper early use of orthoses and other support devices, the best determination of time for bone and joint surgery, and application of drug treatments. Patients with the p.R152W should be referred to a cardiologist before the appearance of symptoms from the circulatory system. The mechanism why the p.R152W mutation seems to have a special affinity for the heart valves remains unknown. Perhaps this stems from the specific structure of the valves, and each of these mutations causes different residual enzyme activity. Detecting these differences would explain the process of affecting different organs dependent on the flow dynamics of the substrate. list

Mock communities were prepared as previously described () by mixing seven representative oral bacteria ( 34, NCTC 10449, LR1, T14v, ATCC 10953, ATCC 33277, and PK 1910). Bacteria grown in liquid cultures were quantified using a Petroff-Hausser counting chamber, diluted in PBS and mixed in equal proportions to a final concentration for each species of 10 cells µL. Cell mixtures (1 µL) were then centrifuged (3,300×g), pellets resuspended in 100 µL of TE buffer (10 mM Tris-HCl pH 7.4, 1 mM EDTA) and stored at −80°C. Seven subjects participated in this study. Subjects were enrolled at the Dental Clinic of the Faculty of Dentistry at the University of Chile, under an approved protocol. The individuals were systemically healthy, with no antibiotic use in the previous 3 months and were periodontally healthy as determined by no site with probing depths >3 mm and<10% of sites presenting bleeding on probing. A supragingival plaque sample was collected using a sterile curette from the lingual aspect of a first mandibular molar, placed in a vial with 100 µL of TE buffer and stored at −80°C until processing. Four DNA extraction methods, described below, were used in this study. Amplicon libraries of 16S rRNA gene V1-V2 hypervariable regions were prepared in triplicate from each extracted sample, combined and sequenced using 454 Titanium chemistry (Roche, 454 Life Sciences, Branford, CT) according to protocols previously described (). Mothur was used for processing of sequences (), following the pipeline developed by Schloss et al. (), as modified by our group (). Individual sequences were assigned a taxonomy using mothur's version of the Ribosomal Database Project (RDP) classifier () and the Human Oral Microbiome Database (HOMD) (, ) and RDP database (version 9) as templates, with an 80% bootstrapping cutoff. For mock community analysis, sequences were binned according to their taxonomical assignment. For plaque samples, sequences were clustered into operational taxonomic units (OTUs) (at 97% similarity) and each OTU was assigned a taxonomy, which corresponded to the taxonomic assignment for the majority of sequences within the OTU. When a consensus assignment at the species level was not possible, the highest taxonomical order in which a consensus was reached is reported. In this case, the representative sequence for each OTU (middle sequence) was also compared to the HOMD and its taxonomy reported in parentheses if this comparison resulted in >97% homology to a HOMD Oral Taxon (OT). Sequences were submitted to the Short Reads Archive (SRP038999 for supragingival plaque samples and SRP039007 for mock communities). Differences between the Q and C protocols when applied to supragingival plaque samples were evaluated using paired -tests for α-diversity metrics and with Analysis of Molecular Variance (AMOVA) () for β-diversity comparisons. Differences in the relative abundance of OTUs, genera, and phyla were assessed with Wilcoxon Signed Rank tests with significance thresholds adjusted using the Benjamini-Hochberg false discovery rate method. DNA yield from mock communities varied according to the method used. DNA yield of samples processed with the C protocol could not be determined due to the nature of the product (crude lysate with no DNA purification step). The yield of DNA was 215–295 ng for the Q method, 210–330 ng for the QB method, and 75–95 ng for the BB method. These results are in agreement with those of Yuan et al. (), who generally observed higher DNA yields from defined species using chemical and enzymatic lysis prior to DNA isolation than when these methods were supplemented with bead beating. Samples extracted with all methods yielded PCR amplicons, which were sequenced using 454 technology with an average of 5,657±930 sequences per library. As expected, bacterial species representation varied according to DNA extraction procedure. As shows, an over-representation of was observed with the C protocol, while the rest of the species, with the exception of , were under-represented with this method. The Q method resulted in over-representation of , while other Firmicutes such as , , and were under-represented, as was . The addition of a prolonged boiling step to the Q method (Q+B) had the most noticeable effect on , which increased after boiling, and , which decreased in comparison to Q alone. Importantly, the method that included bead beating (BB) was the only one able to detect all species in the mock community ( only appeared with BB). These results are in agreement with other studies, which have observed that species proportions vary according to DNA extraction procedures (, , ). Use of lysozyme is thought to improve accuracy of community profiles, due to the ability of the enzyme to disrupt peptidoglycans in cell walls, thereby enhancing nucleic acid recovery from Gram-positives. Indeed, inclusion of lysozyme in our study (Q and Q+B methods) generally improved species representation compared to chemical lysis and Proteinase K treatment alone (C), although some Gram-positive species such as and , and also the Gram-negative , remained greatly under-represented. Use of additional enzymes may therefore be necessary to improve accuracy, as suggested by Yuan et al. (), who found that a cocktail containing lysozyme, mutanolysin, and staphilysin performed better than lysozyme alone. Despite low DNA yields, the only method that recovered all species was the BB protocol, which was designed by our group for efficient isolation of fungal DNA from oral samples (). This method, however, also yielded a high proportion of contaminant sequences, all of them classified as (see ‘other’ column in ). Contamination issues have been previously reported in sequenced mock communities and are attributed to reagent impurity (). This result highlights the importance of including reagent controls in every run. Nevertheless, the inclusion of a bead beating step seems to be beneficial in improving accuracy in species representation. Our data are again in agreement with Yuan et al. (), who reported that although the DNA yield of methods that included bead beating tended to be low, this procedure improved accuracy of community portrayals. Seven supragingival plaque samples were split and processed with two DNA extraction methods (C and Q protocols), commonly used in the oral microbiology literature (, , , , ). This dataset was comprised of 99,883 sequences (after processing), with an average of 7,135±2,710 sequences per sample. A total of 436 OTUs (defined at 97% homology level) were found across all samples, with a range of 96–193 OTUs per sample. Richness coverage according to CatchAll (), ranged from 54.8 to 84.4%. Pairwise comparisons of α-diversity metrics between samples processed with the C and Q methods showed no significant differences (data not shown). When samples were compared based on a β-diversity metric that evaluates distances among communities based on the presence/absence of OTUs (Jaccard metric), DNA extraction was shown not to be an influencing factor on community composition (AMOVA, =0.968), with samples clustering by subject rather than by method (A). This result agrees with previous findings from studies evaluating the effect of DNA extraction in stool and human colon specimens demonstrating that inter-subject differences are greater than differences introduced by DNA extraction protocols (, ). On the contrary, comparison of the distance among samples based on the θ metric (B), which takes into account species proportions, showed a tendency for clustering according to DNA extraction method, although AMOVA was still not significant (=0.19). It is evident, however, that a trend existed for sample separation along axis 2, with C samples located towards the positive end. We then determined which taxa showed a significant correlation (Spearman) with axis 2, therefore driving separation of samples along this axis. The most significantly correlated OTUs are depicted in C. Surprisingly, OTUs that drove samples towards the positive end of axis 2 belonged to the Firmicutes and were Gram-positive species. Additionally, OTUs that drove samples towards the negative end of axis 2 included Gram-negative species from the Bacteroidetes and Proteobacteria and expectedly a Gram-positive OTU from the genus . To further evaluate bias introduced by employing the C and Q methods on supragingival plaque microbial profiles, differences in the relative abundance of individual taxa were determined. First, however, we acknowledge that this study has a low sample size (seven subjects), which, in combination with the great inter-subject variability of the human microbiome, could understate differences. With awareness of this limitation, we present data on 33 OTUs that showed a value of less than 0.05 when their relative abundances in both groups were compared (A). No OTU, however, remained significant after multiple testing adjustment, and therefore these data only indicate trends. In agreement with mock community results, A shows that the Q method improved the recovery of spp. Interestingly, Gram-negative species from the genera and were also better recovered after DNA extraction using the Q protocol. Moreover, in contrast with the over-representation of in mock communities by the C method, was seen at greater abundance after Q treatment in the more diverse supragingival samples. B shows the mean averages for the phyla detected, confirming the results from OTU data in that the Firmicutes were greatly over-represented by the crude lysis method (C), while the Bacteroidetes, Spirochaetes, and Actinobacteria were more efficiently disrupted by the method that included lysozyme treatment and column-based DNA isolation (Q). The cumulative proportions of TM7 also appeared to be higher in the C group. Our results are in agreement with other studies of the gut microbiome reporting Firmicutes as the phylum with the greatest variability according to DNA extraction procedures (, ). In the studies cited, however, Firmicutes recovery was improved by utilizing harsher extraction methods, while in our study their relative abundance was decreased with the harsher protocol, which also included lysozyme (Q). This result may be due to increased representation of more difficult to lyse species after using the Q method (e.g. Actinobacteria), rather than an actual change in lysis of Firmicutes, a suggestion that dominant oral Firmicutes (e.g. Mitis-group spp. and spp.) may not be as difficult to lyse as Firmicutes of the lower intestinal tract (, ). It is also worth noting that a great number of oral Firmicutes species, such as , ; and , are Gram-negative and in theory better lysed by Q. These results highlight the importance of understanding bias introduced by DNA extraction protocols in samples specific to the niche of interest. In conclusion, we have shown that DNA extraction has an impact on microbial profiling, supporting the concern that this step may introduce bias in the portrayal of community structure. Although the use of lysozyme and a column-based extraction procedure improved the recovery of certain species over a crude lysis protocol, additional steps such as bead beating, or inclusion of an enzymatic cocktail as recommended by others (), may be necessary to maximize accuracy. No protocol, however, is completely unbiased; therefore, consistency among laboratories studying similar sites is required. Our results also raise a cautionary note regarding the possibility that some methods introduce high proportions of contaminant sequences, and therefore appropriate controls should be part of standard operating procedures in every laboratory.

A cross-sectional, questionnaire-based survey was conducted among dentists working in Benghazi, Libya, between May and June 2012. Benghazi is the second largest city in Libya, with a population size of around 620,000 and a dentist-to-population ratio of six dentists for every 10,000 inhabitants (). The list of all dentists registered with the Dental Association of Benghazi, the official body which provides practising licences to dentists, was used as the sampling frame for the study. All 221 dentists on the registry with 2 or more years of practice were invited to participate in the survey. Recently graduated and dentists not in practice were excluded. Of the 221 dentists who fulfilled the selection criteria, 175 returned the questionnaires (response rate: 79%). The present analysis is based on 166 participants who had complete information on all the variables selected for analysis (75% of the study population). A minimum sample size of 141 subjects was required to estimate a population mean (score for barriers) with standard deviation of 10 units, absolute precision of 1 unit, 80% statistical power, and 95% confidence level. Participants were approached at public and private dental care centres where they worked and were invited to participate by the main researcher (AA). After acceptance, a copy of the self-administered questionnaire, written in simple English, was handed out and the main researcher returned the day after for collection. Participants provided information on their demographic characteristics (sex and age), practice sector (public, private, or mixed), and years of service. They also stated their perceptions of barriers to providing preventive dental care using an instrument developed for a previous study among Iranian dentists (). The original instrument consisted of 12 items enquiring about dentists’ perceptions of practice- (4 items), dentist- (4 items), and patient-related (4 items) barriers to applying preventive measures for their patients. The 12 statements are presented in . The only difference between the Iranian and Libyan version of the instrument is that one of the four practice-related statements originally included in the instrument was rephrased during the validation process to be compatible with dental services in Libya where there are no dental auxiliaries. The rephrased item read ‘there are no dental auxiliaries available to provide preventive care’. For each statement, dentists answered the following question: ‘How much does this item preclude you from carrying out preventive measures for patients?’ The answers were given on a 5-point Likert scale ranging from ‘not at all’ (indicating no impediment, scored as 0) to ‘very much’ (indicating a very strong impediment, scored as 4). Scores of the four statements within each barrier were summed up to serve as an indicator of the dentist's perceived extent of practice-, dentist-, and patient-related barriers to the provision of preventive measures, each ranging from 0 to 16. Higher scores indicated higher perceptions of barriers. The scores for each type of barrier were compared by sex using the -test for independent sample, and by age groups (23–34, 35–44, and 45–56 years), practice sector (public, private, or mixed), and years of service (0–5, 6–10, and >10 years) using one-way Analysis of Variance (ANOVA). Multiple linear regression models were fitted to compare scores for patient-, practice- and dentist-related barriers by demographic and professional characteristics in a multivariate context. Data from 166 Libyan dentists were analysed for this study. Their characteristics are described in . The majority were females (70%), between 23 and 34 years of age (85%), working in the public health sector (43%), and had up to 5 years of service (46%). reports the barriers to preventive dental care. The patient-related barriers had the highest score (mean: 12.47, SD: 3.10), followed by practice- (mean: 10.96, SD: 2.90), and dentist-related barriers (mean: 10.08, SD: 3.66). Patients’ poor knowledge of the potential of caries prevention was the statement with the highest score among patient-related barriers and all barriers assessed (mean: 3.22, SD: 0.92), whereas the lack of dental auxiliaries available to provide preventive care (mean: 2.81, SD: 1.31) and the traditional reliance of dentistry on treatment, not prevention (mean: 2.89, SD: 1.27) were the dentist- and practice-related barriers with the highest scores, respectively. reports comparison of barriers by to preventive dental care by demographic and professional characteristics. There were differences between practice sectors in the scores for patient- and practice-related barriers but not in those for dentist-related barriers. Dentists working in mixed practice reported lower patient- and practice-related scores than those working on public or private practice exclusively. No differences were found by participants’ sex, age group, or years of service. Differences by practice sector remained significant after adjusting for sex, age group, and years of service (). This study shows that dentists in Benghazi perceived patient-related barriers as the most prominent. Poor patient knowledge of caries prevention, unwillingness to pay for preventive dentistry, and lack of knowledge about dental visits were ranked high by Libyan dentists. This finding is in agreement with studies which showed that dentists perceived patients’ poor appraisal of preventive treatment as a major barrier to the provision of preventive dental care (, , ). Although participants perceived dentist- and practice-related barriers as less prominent, the lack of dental auxiliaries and the low priority given to preventive dentistry in the dental curriculum as well as the traditional reliance on treatment, the difficulty to access preventive dental materials, and the lack of printed material for dental health education were the most highly recognised dentist- and practice-related barriers. Dental services have focused for a long time and are still focusing on restorative treatment or tooth extraction for the management of existing disease despite the fact that most oral diseases are highly preventable (–). Similar trends have been found reflecting the attitudes of patients and providers, availability and accessibility of care, and philosophies of dental treatment (, ). The findings of this study regarding the role of dental education in preventive dentistry are in line with other studies (, ) which have concluded that current undergraduate dental curricula do not adequately prepare dentists for prevention-oriented treatment, and the public health role and continuing dental education may be insufficient to change clinical practice. Participants’ opinions on practice-related barriers are consistent with others expressed by dentists in earlier research in Iran () and Mongolia () and may support the idea that that informed and motivated dentists are lacking the support from policy makers to enhance preventive dental programmes (). A second interesting finding was that dentists with mixed practice (working in both private and public sectors) showed lower perception of the impact of patient- and practice-related factors than those with exclusive practice in the public or private health care sectors. Such finding can be attributed to the nature of the working environment; considering their working hours and duties, mixed practice practitioners are working part time in both sectors with limited role in administration and organisation processes and less communication with patients. Hence, they would not be familiar with work place issues and customer needs, and have less control at work, which is considered a key job characteristic that satisfies higher needs and contributes to job satisfaction (). In addition and contrary to our expectations, this study did not find sex differences in the perception of barriers to preventive care. A previous study had shown that male dentists reported significantly higher scores for both practice- and dentist-related barriers than the female dentists (). However, females are more positive and interested in practicing preventive dentistry than males (, ), which in turn could lead to more awareness of barriers to preventive dentistry. Cultural factors may explain the different results found in this study compared to other groups of dentists. These findings enhance our understanding of the factors hindering the practice of preventive dentistry in Libya and raise a number of questions. Future research on the barriers to preventive dental care as perceived by patients and policy makers would help to validate dentists’ views and identify areas of mutual concern. In addition, reviewing the contents of the dental curriculum in Libya would help in establishing a greater degree of accuracy on this matter. Our findings suggest several courses of action for enhancing the practice of preventive dentistry in Libya. There is, therefore, a definite need for greater emphasis on dental health education and public health programmes to increase patients’ awareness of the importance and value of preventive dentistry. They also have important implications for developing an approach, including the public, dental care providers, and governmental sectors, to eliminate barriers to accessing preventive dental services in Libya. Some limitations of this study need to be discussed. The first limitation is related to the selection of the study group – from one Libyan city only. As such, participants’ views are not representative of the entire population of dentists in Libya. A second limitation relates to the use of quantitative methods for data collection (i.e. using a self-administered questionnaire). The use of qualitative methods would provide more in-depth exploration of the barriers as well as facilitate validation of views from different stakeholders. r t i c i p a n t s i n t h i s s t u d y w e r e g e n e r a l l y a w a r e o f t h e b a r r i e r s t o p r o v i d i n g p r e v e n t i v e d e n t i s t r y t o t h e i r p a t i e n t s a n d p e r c e i v e d t h e b a r r i e r s a s b e i n g m o r e r e l a t e d t o t h e i r p a t i e n t s r a t h e r t h a n t o t h e i r p r a c t i c e s o r t h e m s e l v e s . H o w e v e r , t h e s e p e r c e p t i o n s v a r i e d b y p r a c t i c e s e c t o r . T h e m u l t i p l e d i m e n s i o n s a n d d i f f e r e n t r o o t s o f t h e c u r r e n t s i t u a t i o n o f p r e v e n t i v e d e n t i s t r y i n L i b y a n e e d t o b e t r a c k e d a n d s u i t a b l e s o l u t i o n s a n d p l a n s a p p l i e d .

Mice used in these studies were 2/3-month-old and 6-month-old littermates, maintained on a standard chow diet and kept with free access to food and water. All experiments were approved by the animal ethical committee of the University of Torino (Italy). Heme content in tissues and bile was quantified by the oxalic acid method. Tissue nonheme iron content was determined by a colorimetric method using 4,7-diphenyl-1, 10-phenantroline disulfonic acid (Sigma, St Louis, MO) as chromogen. HO activity was measured by spectrophotometric determination of bilirubin produced from hemin added as substrate. Lipid peroxidation from tissue extracts was measured using the colorimetric assay kit Bioxytech LPO-586 from Oxis International (Portland, OR). Total RNA was extracted using Pure Link RNA Mini Kit (Ambion, Life Technologies Italia, Torino, Italy). One microgram total RNA was reverse transcribed using M-MLV reverse transcriptase and random primers (Life Technologies Italia). Quantitative real-time polymerase chain reaction was performed on a 7300 Real Time PCR System (Applied Biosystems, Life Technologies Italia). Primers and probes were designed using the ProbeFinder software (). Tissue and cell proteins were extracted as reported previously and concentration was determined using the Bio-Rad protein assay system (Bio-Rad, Munich, Germany). Fifty micrograms total protein extracts were separated on 8%−12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and analyzed by Western blotting using antibodies against HO-1 (Stressgen, Victoria, Canada), L- and H-ferritin (kindly provided by Sonia Levi), ferroportin (Fpn; Alpha Diagnostic Intl. Inc, San Antonio, TX), CYP1A1, CYP3A, CYP2E1, and actin (Santa Cruz Biotechnology, Inc., Dallas, TX). Tissues were fixed in 10% formalin overnight at room temperature and embedded in paraffin. Microtome sections, 5-μm thick, were stained with Perl's reaction followed by methanol 3,3-diaminobenzidine (Boehringer Mannheim, Germany) development. ALAS activity was assayed by measuring ALA formation in liver homogenates after glycine addition. CYP1A1 activity was assessed by measuring ethoxyresorufin-O-deethylase activity in liver microsomes using 7-ethoxyresorufin as a substrate. CYP3A activity was assessed by measuring conversion of the substrate proluciferin-PFBE to luciferin (V8901 P450-Glo CYP3A4 Assay; Promega, Madison, WI). CYP2E1 activity was determined by assaying the hydroxylation of p-nitrophenol to 4-nitrocatechol in the liver microsomal fraction. Results were expressed as mean ± SEM. Comparisons between 2 groups were performed with 2-sided Welch tests and among more than 2 groups with 1- or 2-way analysis of variance followed by Bonferroni post test. values <.05 were regarded as significant ( <. 05; < .01; < .001;  < .0001). See also . To study the function of the heme exporter FLVCR1a in the liver, we generated a liver-specific knockout mouse (). Liver-specific knockout () mice were born at the expected Mendelian ratio and were viable and fertile. mice showed the recombinant allele only in the liver () and a strong reduction of hepatic expression ( and ). As expected, mRNA could not be detected in primary hepatocytes isolated from mice (), demonstrating that this mouse is a liver-specific knockout model for . mice showed no gross liver abnormalities (). Blood analysis did not reveal any difference between Flvcr1afl and mice (). To evaluate if the deletion of alters hepatic heme homeostasis, we analyzed the livers of 2- and 6-month-old compared with those of an counterpart. Hepatic heme and iron content were comparable at 2 months of age, but were significantly higher in 6-month-old than in mice ( and ). Iron accumulation in 6-month-old mice was further confirmed by Perl's staining on liver sections (). Consistently, mice showed an enhanced HO activity as well as an increased bilirubin excretion in the bile compared with mice (). In addition, mice showed increased lipid peroxidation in the liver (). The analysis of hepatic gene expression revealed that mice up-regulated genes that encode for proteins involved in heme metabolism (),, iron export (), and storage ( and ), and antioxidant response (), compared with mice ( and ; for gene expression analysis of 2-month-old mice). On the other hand, expression of the other known heme exporter was not increased in the liver of mice (), indicating that no other heme exporter was able to compensate for the lack of . The phenotype of liver-specific knockout mice suggests that FLVCR1a-mediated heme export prevents hepatic heme accumulation. To further address this point, mice were injected with hemin, the substrate of FLVCR1a. One hour after heme injection, heme accumulated in the liver of both and mice at the same extent, but bilirubin production was significantly higher in mice than in mice, likely because of the enhanced HO activity ( and ). Consistently, if animals were pretreated with the heme analog Tin-Protoporphyrin IX that inhibits HO, before heme injection, mice showed a significantly higher hepatic heme content 1 hour after heme infusion compared with control mice (). When we injected mice with Tin-Protoporphyrin IX alone, we found it accumulated more in the liver of mice than in that of controls (), strengthening the FLVCR1a export function. Measurement of heme content in the bile at 1 hour after heme injection demonstrated that it was excreted at the same extent in both and mice (), suggesting that Flvcr1a did not export heme in the bile but likely vs the bloodstream. Accordingly, the analysis of a human hepatocarcinoma cell line, HepG2, overexpressing Flvcr1a-myc, showed that FLVCR1a localized at the plasma cell membrane, along the sinusoidal surface (). Data shown in indicate that the enhanced HO activity was able to compensate for the lack of FLVCR1a to maintain heme content in the normal range on transient heme accumulation. This was further demonstrated by the analysis of gene expression. On heme treatment, mice showed a strong induction of in the liver, as well as an up-regulation of , , and mice that were unable to induce showed a stronger induction of the heme degradation and iron storage/export pathways, as an attempt to compensate for the lack of heme export ( and ). This was not sufficient to control oxidative stress, as demonstrated by the significantly higher induction of the antioxidant genes in the liver of -deleted mice after heme injection (). These data demonstrate that FLVCR1a is a heme exporter in hepatocytes that works in close association with the heme degradation pathway to maintain heme/iron homeostasis. The liver is, at the same time, one of the organs with the highest rate of heme synthesis and the main body site deputed to the detoxification of heme coming from the bloodstream. We asked in which of these processes is FLVCR1a mainly involved. To address this point, we treated mice with the heme precursor ALA or with the hemolytic agent phenylhydrazine, to promote heme synthesis or heme recovery from the bloodstream, respectively. Although we did not observe any difference after phenylhydrazine treatment (, ), increased heme content was found in the liver of mice compared with mice after ALA treatment, suggesting that on de novo synthesis, heme accumulated in the liver when FLVCR1a was absent (). This resulted in a marked increase in the hepatic lipid peroxidation index (). Interestingly, was strongly induced by ALA treatment in the liver of mice (). On the other hand, the genes involved in heme and iron metabolism, such as and , were up-regulated to an higher extent in the liver of e mice than in that of mice, and this was associated with a higher induction of the genes of the antioxidant response (). Conversely, we observed a reduced expression of , , and in the liver of e compared with mice (), suggesting an attenuation of the heme biosynthetic pathway in these animals. These results were confirmed in vitro on primary hepatocytes treated with ALA (−; ). These data indicate that FLVCR1a-mediated heme export function is strictly associated with heme synthesis. In the liver, most of the newly synthesized heme is committed to CYP synthesis. To test whether FLVCR1a function is linked to heme synthesis stimulation on cytochromes induction, we treated our mice with inducers of 3 distinct classes of CYPs. Firstly, we injected mice with dexamethasone, an inducer of CYP3A. Dexamethasone treatment caused an increase in heme content in the liver of e mice, that was almost negligible in counterpart (). This effect was abrogated by co-treatment with the inhibitor of heme biosynthesis, succinylacetone (). As a consequence of heme accumulation, a higher amount of lipid peroxides was generated on dexamethasone treatment in the liver of e mice compared with mice (). The analysis of gene expression demonstrated that was induced in the liver of mice after dexamethasone treatment, as occurred on ALA treatment (). On the other hand, the heme-, iron-, and stress-related genes were induced to a higher extent in the liver of dexamethasone-treated e mice compared with the counterpart (), suggesting that the higher induction of these genes compensated for the lack of . In addition, genes involved in heme biosynthesis, such as , and were found to be significantly less expressed in e mice compared with mice after dexamethasone treatment (). Similar results were obtained when mice were treated with benzo(a)pyrene (Be[a]P), an inducer of CYP1A1 and CYP1A2 (, ), and imidazole, an inducer of CYP2E1 (; ). Because the induction of 8h after Be(a)P injection was comparable in and (), the difference found at 16 hours post injection likely indicates that the heme biosynthetic pathway was switched off earlier in -deleted mice than in its wild-type counterparts, as an attempt to compensate for the excess of heme accumulated in the liver. Collectively, these data indicate that FLVCR1a-mediated heme export is associated with CYP induction. In the previous section, we showed that and mRNA levels were higher and lower, respectively, in the liver of dexamethasone-, Be(a)P-, or imidazole- treated compared with mice, suggesting that heme degradation is increased and heme synthesis is inhibited when FLVCR1a-mediated heme export is blocked. Consistently, was found up-regulated and as well as down-regulated in the liver of sickle cell anemia and β-thalassemia mice, in which levels were strongly decreased (). This observation strengthens the idea that deletion/down-regulation leads to the coordinated induction of heme degradation and down-regulation of the heme biosynthetic pathway. To evaluate this point, we analyzed HO-1 as well as ALAS1 protein and activity in the liver of e and mice, treated with dexamethasone or Be(a)P. After the stimulation of CYP synthesis, HO-1 and ALAS1 expression were induced in the liver of both e and mice ( and ). HO-1 induction was significantly higher and ALAS1 expression was markedly reduced in the liver of e mice compared with counterparts. This correlated with the enzymatic activities of HO-1 and ALAS1, which were respectively higher and lower in the liver of e mice than in that of animals ( and ). HO-1 induction as well as ALAS1 inhibition were likely mediated by heme overload occurring in e mice. Consistently, after the stimulation of CYP synthesis, heme accumulated to a higher extent in the cytosolic fraction of e mice compared with controls. On the other hand, heme content was significantly lower in the microsomal fraction of e mice than in that of animals (). As microsomal heme reflects the heme fraction contained in CYPs, we measured mRNA and protein expression and enzymatic activity of CYP3A and CYP1A1 in the livers of our mice. In agreement with heme levels, CYP3A and CYP1A1 mRNA, protein levels and activities were significantly lower in the livers of dexamethasone- and Be(a)P-treated e mice than in those of treated- animals ( and ). Similar results were obtained when mice were treated with imidazole (; ). On the enhancement of heme demand, deletion resulted in an expansion of the cytosolic heme pool that stimulates heme degradation and inhibits heme and CYP synthesis. To test whether the main determinant for CYP expression/function was the size of heme pool or the rate of heme synthesis, both impaired in -deleted liver, we treated wild-type mice with dexamethasone or Be(a)P alone or together with hemin, to mimic heme overload occurring in e mice, or with succinylacetone or DL-penicillamine, 2 inhibitors of heme biosynthesis. As expected, dexamethasone and Be(a)P treatment caused a marked increase in ALAS1 activity as well as in CYP expression/activity, and HO-1 expression/activity was only slightly induced ( and ). Hemin co-treatment significantly reduced hepatic ALAS1 activity, while increasing HO-1 expression/activity, compared with mice treated with dexamethasone or Be(a)P only ( and ). This correlated nicely with a reduced expression and activity of CYPs (). Similarly, we observed that co-treatment with Be(a)P and the ALAS-inhibitor DL-penicillamine decreased ALAS activity as well as the expression and activity of CYP1A1 ( and , ). Administration of succinylacetone, a heme synthesis inhibitor acting on 5-aminolevulinic acid dehydratase downstream of ALAS1, caused a feedback up-regulation of ALAS1 activity, as expected, but a decrease in CYP3A activity, as a consequence of reduced heme availability ( and , ). We can conclude that the effect of heme overload on cytochrome function parallels that of heme synthesis inhibition, fostering the concept that cytochrome function is strictly associated to de novo heme production rather than to heme pool size itself. As further confirmation, we observed that 6-month-old e mice showed a reduction in ALAS1 activity as well as an increase in HO activity (). This misbalance in heme synthesis/degradation resulted in a reduced CYP expression at both mRNA and protein level (CYP1A1 and CYP3A, ; CYP2E1, ) and reduced CYP activity (). These data indicate that FLVCR1a-mediated heme export in hepatocytes controls the expansion of the heme pool, which in turns determines the balance between heme synthesis and degradation and CYP activity. Here we showed that FLVCR1a is essential for the maintenance of heme and iron homeostasis in the liver and that its function is strictly associated with the heme biosynthetic process that is crucial for the control of CYP activity. Previous studies demonstrated that FLVCR1a exerts a detoxifying function in macrophages and erythroid cells, by exporting heme excess., , Our results indicate that FLVCR1a is similarly important in the liver, as its deletion leads to progressive heme and iron loading and to the compensatory up-regulation of the genes responsible for heme degradation and iron storage. Consistently with our finding in mice, was found mutated in human subjects with mild hepatic iron overload. Our data show that FLVCR1a export function is associated with heme biosynthesis in agreement with data showing that ALA treatment causes heme accumulation in -silenced HeLa cells. In addition, we observed a concerted up-regulation of and , , and in the liver of ALA-treated wild-type mice that strengthens the link between FLVCR1a function and heme biosynthesis. More than half of the hepatic production of heme is used for the formation of CYPs,, which are engaged in steroid metabolism and in the oxidative metabolism of foreign compounds, including pharmaceutical drugs., , Our data showed that is up-regulated after CYP induction, suggesting that its function is strictly associated with enhanced heme demand to support cytochrome induction. Similarly, as well as and are up-regulated to sustain newly heme synthesis in such condition. Because either a deficiency or an excess of heme is toxic to the cell, hepatic heme production has to be tightly controlled. Previous works showed that in primary cultures of adult rat hepatocytes, 20% of newly formed heme is converted to bile pigments, and 80% is used for the formation of hemoproteins, mainly CYPs. Our data indicate that not only heme degradation, but also FLVCR1a-mediated heme export, is critical to ensure that the amount of available heme matches cell requirements. The alteration of one of these pathways, heme synthesis, degradation or export, in hepatocytes leads to an imbalance in heme homeostasis. In particular, FLVCR1a deletion causes an increase in the cytosolic heme fraction, when heme demand is increased to support CYP induction. The cytosolic heme fraction contains a pool of newly synthesized heme that serves both precursor and regulatory functions. The free heme pool controls heme biosynthesis, through the regulation of ALAS1. If increased, the regulatory heme pool may repress ALAS1, and its depletion causes ALAS1 induction. Our results indicate that ALAS1 induction occurs in wild-type as well as in -null mice shortly after cytochrome stimulation, to sustain heme synthesis for cytochrome formation. Then, down-regulation occurs earlier in -null mice than in wild-type animals because of the negative feedback exerted by the expanded cytosolic free heme pool. This is in agreement with many observations, according to which the addition of heme in hepatocyte cultures inhibits the drug-induced synthesis of ALAS., , , , Although xenobiotics might have some primary inducing effect on hepatic ALAS1,, many chemical inducers are believed to increase ALAS1 by depleting the free heme pool in hepatocytes. This is in agreement with our observation in wild-type mice in which ALAS1 expression, CYP activity, and microsomal heme are increased, and cytosolic heme levels are reduced after drug treatment. Conversely, liver-specific -null mice showed an expansion of the cytosolic heme pool, suggesting that deletion promotes intracellular heme accumulation, preventing the depletion of the free heme pool as a stimulus for ALAS1 induction and on the contrary, promoting its inhibition. In liver-specific -null mice, the decreased heme synthesis well correlates with a reduction of CYP expression and activity, in line with the previous observation that the enhancement in heme synthesis is required to sustain the induction/activity of CYPs., , , Conversely, when a bolus of hemin is administered to experimental animals, the induction/activity of CYPs is greatly suppressed and this effect is considered to be the result of inhibition of heme biosynthesis by ALAS1., Short-term hemin administration is known to both increase HO1 expression and interfere with the formation of CYP. Consistently, drug-treated -null mice showed a significantly higher induction of HO1 and reduction in the expression and activity of ALAS1 and CYPs compared with wild-type animals, indicating that heme accumulation resulting from deletion resembles what occurs after hemin administration. In conclusion, the block of heme export due to deletion promotes the expansion of the cytosolic heme pool, thus leading to ALAS inhibition and HO induction. We propose that the lack of FLVCR1a causes a reduction in the newly synthesized heme, impairing both CYP expression and activity (). It appears that in the hepatocytes, heme is formed in slight excess over its metabolic needs and its levels are maintained adequate by a combination of synthetic, degradative, and export mechanisms, suggesting that they are equipped with a “sensing” system to monitor changes in the size of “uncommitted” heme pool. We can speculate that FLVCR1a is part of this sensing system and that, by sensing heme levels and exporting heme excess out of the cell, it controls the size of the cytosolic heme pool, playing a crucial regulatory role in cell metabolism and in the maintenance of a proper oxidative status. We expect that mutations in and/or pathologic situations that affect its expression can result in a reduced CYP activity, altering drug metabolism, in particular in individuals that routinely assume drugs for therapeutic purposes.

All experiments were performed according to UK Home Office regulations. Mouse models are described in . Immunoblotting and quantitative polymerase chain reaction were carried out by standard protocols (details in ; n = 3 independent experiments in triplicate). The human pancreaticobiliary tissue microarray was described previously., (see ). All statistical analyses were performed using SPSS software, version 15.0 (SPSS Inc, Chicago, IL). We used Oncomine to examine fascin and slug expression in Jimeno pancreas, Pei pancreas, Badea pancreas, and Wagner cell line. PDAC cell lines were generated from primary pancreatic tumors from KRas p53 Pdx1-Cre (KPC) or fascin-deficient KPC (FKPC) mice (see ). All experiments used cells of <6 passages. Standard methods for small interfering RNA were described previously. For staining fascin, slug, snail, and twist, cells were fixed with −20°C methanol for 10 minutes. For all other staining, cells were fixed in 4% formaldehyde as described previously. Primary antibodies were detected with Alexa 488, Alexa 594, and Alexa 647-conjugated secondary antibodies. Samples were examined using Olympus FV1000 or Nikon A1 inverted laser scanning confocal microscope. Standard methods were used. See for details. For mesenteric and diaphragm seeding experiments, 1 × 10 PDAC cells in 100 μL phosphate-buffered saline were introduced into each nude mouse (CD-1 nude females, 6 weeks old; Charles River Laboratories, Wilmington, MA) by intraperitoneal injection and tumor nodules were quantified after 2 weeks. Of 122 primary human resected PDAC, fascin was absent from normal ductal and acinar tissue, but prominent in PDAC cytoplasm (). Ninety-five percent of human PDAC expressed fascin and a high histoscore significantly correlated with decreased overall survival (), high tumor grade (; median histoscore 104.4 vs 72.8;  < .05), and vascular invasion (; median histoscore 94.5 vs 62.2; < .04). Fascin levels did not correlate with lymph node status, tumor stage, perineural invasion, and lymphatic invasion (data not shown). In a multivariate Cox proportional-hazards regression analysis, high fascin expression only reached borderline significance as an independent predictor of poor survival, with a hazard ratio of 0.663 (95% confidence interval: 0.44−1;  = .05) (). Importantly, fascin levels strongly correlated with time to recurrence, indicating potential importance as a predictor of tumor dissemination (; < .0005). To explore a functional role of fascin, we used a mouse model of pancreatic cancer (KPC mice) recapitulating both pre-invasive PanIN (grade 1−3) and invasive, metastatic PDAC. Wild-type ducts and acini and PanIN1−2 from 10-week-old KPC mice were negative for fascin (). Around 6% of PanIN3 and 100% of PDAC (both 10-week and advanced tumors) () were fascin positive () and fascin was expressed in both well and poorly differentiated areas (data not shown). Fascin null mice had normal-sized pancreata with no apparent changes in tissue structure or proliferation (). Although fascin is weakly expressed by a few cells in the islets of Langerhans (), fascin null mice had normal peripheral blood levels of several markers indicating normal pancreatic function (). Development of PanIN in Kras or Kras and p53 expressing pancreata was not changed by loss of fascin (). Loss of fascin also did not affect progression, morphology, or proliferation of cells in an acute model of pancreatitis using cerulein injection (). However, by 21 days of cerulein treatment, fascin was detected in stroma and epithelium of PanIN of KC animals (). However, loss of fascin did not affect the numbers of monocytes, lymphocytes, or neutrophils recruited to acute PanINs, revealing no gross abnormalities in the immune response to PanIN in the fascin null mice ( and ). In summary, fascin expression was detected in a minority of PanIN3 and all PDAC and loss of fascin did not detectably affect pancreas development or PanIN. Fascin expression or function has not been studied before in the context of spontaneous tumor development, so we crossed the fascin knockout mouse with KPC to make FKPC (). Pdx1-Cre−mediated recombination appeared normal in fascin-deficient mice (), which showed a significant increase in survival (). Fascin was expressed in KPC and absent from FKPC tumors (). Fascin null mice displayed similar end-point tumor histology and mass (), with no significant difference in the number of undifferentiated or sarcomatoid lesions in the cohorts (not shown). KPC and FKPC tumors showed identical proportions of cell proliferation and death ( and ). There was no detectable difference in recruitment of T cells (CD3), B cells (CD45R), macrophages (F4/80), or neutrophils (NIMP) between KPC and FKPC tumors ( and ) or difference in platelet endothelial cell adhesion molecule staining of vascularization ( and ). Together, these data suggest that cell proliferation, cell death, and fascin-deficient microenvironment do not contribute significantly to prolonged survival of FKPC mice. We next examined mice at earlier time points during PDAC onset and progression. No differences were found at 6 weeks (), but by 10 weeks, 6 of 9 KPC vs 1 of 9 FKPC mice showed tumors (). By 15 weeks, 9 of 10 KPC vs 3 of 6 FKPC mice showed tumors and FKPC showed smaller tumors (). Loss of fascin significantly delays onset of PDAC and reduces early PDAC tumor burden, a surprising effect that has not been described previously. During the development of PDAC, ductal cells undergo EMT. Fascin is principally expressed in neural and mesenchymal derivatives during mammalian embryonic development,, suggesting that fascin could be a potential EMT target. EMT involves 3 families of transcription factors, the snail, ZEB, and bHLH families., We generated 10 independent KPC mouse PDAC cell lines that showed heterogeneous expression of E-cadherin, fascin, and EMT transcription factors (Tfs) (), while normal primary ductal epithelial cells did not detectably express fascin or EMT Tfs ( and ). Co-expression of E-cadherin and EMT Tfs indicate that most of our PDAC cell lines were in an intermediate stage of EMT (, ). Fascin-deficient PDAC cells also showed a similar heterogeneous expression of E-cadherin, fascin, and EMT Tfs (). Slug, zeb1, and zeb2 were expressed in all of our PDAC cell lines, while twist and snail were expressed in a subset (). Levels of fascin and slug correlated most closely ( and ). Fascin and slug expression also correlated in a dataset of 23 human pancreatic cancer cell lines (). Epithelial-like 070669 PDAC cells expressed a low level of fascin (), which increased >2-fold on Flag-slug or snail transfection (). Expressing snail or slug also suppressed E-cadherin but up-regulated fascin ( and ). Knockdown of slug reduced fascin expression (), and stable expression of twist ( and and ) or transient knockdown of zeb1, zeb2, or E-cadherin, did not change fascin levels (). Knockdown of fascin did not affect slug expression (). These observations were confirmed in 061843 PDAC cells ( and ). Slug mediates fascin expression in PDAC cells. In addition, expression of slug or snail in human pancreatic cancer cells PANC-1 and human colon cancer cells HT29 induced fascin expression (), suggesting a general effect of slug and snail on fascin expression in both mouse and human cancer cells. We next investigated expression of fascin and slug during EMT changes in KPC PDAC tumors. Interestingly, fascin and slug were both absent from ductal and acinar cells in normal pancreas and PanIN1/2 lesions (). Slug was expressed in fascin-positive (but not negative) PanIN3 lesions (), indicating a correlation between early markers of EMT and fascin expression during PDAC progression. Fascin and slug were present in all PDACs, regardless of E-cadherin staining or differentiation status (). In addition, fascin expression significantly correlated with slug expression in 3 independent cohorts of pancreatic cancer patients (). We propose that slug-induced EMT is an important regulator of fascin expression in pancreatic cancer. Given the induction of fascin by slug and their tight association in human and mouse pancreatic cancer, we set out to determine whether fascin is a direct transcriptional target of slug. We screened the promoter and first intron region of mouse fascin for slug-binding E-box sequences (CACCTG or CAGGTG). We found a potential E-box sequence CACCTG located within the first intron of the mouse fascin gene at +2470 to +2475 bp (). This consensus E-box sequence is highly conserved among mammalian fascins (). We designed 3 sets of primers around the putative E-box sequence: primer set 1 targets the identified E-box, while primer sets 2 and 3 target adjacent regions (). Slug co-precipitated with the putative fascin E-box element (). Cotransfection of the +2345 to +2600 region of the fascin first intron in a luciferase reporter plasmid with a plasmid expressing slug into 070669 PDAC cells drove a significant increase in luciferase activity (). Mutagenesis of the E-box sequence eliminated the ability of slug to induce luciferase activity (). We propose that fascin is a direct transcriptional target of slug. We next explored the hypothesis that fascin was a driver of invasion and metastasis in PDAC. Invasive PDAC was present in around half of KPC mice, and this was histologically similar in FKPC mice ( and ). More than 80% of KPC mice, but only 30% of FKPC mice, developed abdominal distension due to hemorrhagic ascites (). On average, KPC mice harbored 1.57 mL ascitic fluid, and FKPC mice showed almost none (). Metastasis was dramatically reduced in FKPC mice ( and ). Around 95% of KPC mice and only 55% of FKPC mice had local metastasis to intestinal mesentery (, , and ). Forty-four percent of KPC mice, but only 13% of FKPC mice, developed diaphragm metastasis (). Similar to local metastasis, 52% of KPC mice and only 13% of FKPC mice showed distant liver metastasis ( and ). Both mesenteric and liver metastases of KPC mice were positive for fascin and p53 ( and ). KPC mice had shorter survival overall than FKPC with liver metastases (). We conclude that loss of fascin significantly reduces ascites and metastasis to mesentery, diaphragm, and liver. To further investigate the mechanism by which fascin promotes metastasis, we first examined the actin dynamics of PDAC cells from the FKPC mice compared with the same cell line rescued with GFP-fascin. GFP-fascin concentrated in filopodia ( and ). Fascin rescue cells showed dynamic filopodia assembly and turnover ( and ). Filopodia were significantly less frequent, shorter, and shorter-lived in fascin-deficient cells than fascin-rescued cells (). Lamellipodial dynamics were greater in fascin-rescued cells (C and ). Expression of fascin significantly enhanced protrusion frequency, distance protruded, and protrusion rate, and decreased protrusion persistence (). Fascin-rescued PDAC cells migrated faster than fascin-deficient cells ( and ). Fascin-expression status did not affect growth in 2D or 3D (), similar to PDAC in vivo. In addition, fascin-rescued cells behaved similarly to fascin-deficient cells during anoikis (). Fascin expression increases PDAC cell migration via lamellipodial and filopodial dynamics, but does not affect growth and survival. Formation of mesenteric and diaphragm metastases involves transmigration of cancer cells through the mesothelial cell (MC) layer., We tested a potential role for fascin in mesothelial transmigration by plating PDAC cells on top of a monolayer of human Met5a MCs. PDAC cells opened MC junctions and intercalated themselves between MCs (). GFP-fascin localized intensively to the filopodia at the leading edge of transmigrating PDAC cells ( and ). About 75% of fascin-rescued PDAC cells, but only 35% of fascin-deficient cells, intercalated by 10 hours (, , and ). Fascin knockdown in KPC 070669 PDAC cells also significantly reduced intercalation (). GFP-fascin−rescued cells generated protrusions that more effectively transmigrated than fascin nulls ( and ). Nude mice injected with fascin-deficient PDAC cells developed significantly fewer mesenteric or diaphragm metastatic foci than those with fascin-rescued cells ( and ). These results are consistent with our spontaneous mouse model and suggest that targeting the interaction of PDAC cells with the mesothelium through fascin depletion is sufficient to reduce metastasis in vivo. Nearly all human PDAC expressed fascin, and a higher fascin histoscore correlated with poor outcomes, vascular invasion, and time to recurrence. Similar correlations have been reported for hepatocellular and extrahepatic bile duct carcinomas., Fascin expression in smaller cohorts of human PDAC and PanIN,, and also in pancreatobiliary adenocarcinomas and pancreatic intraductal papillary mucinous carcinoma, correlated with shorter survival times and more advanced stages. Fascin expression contributes to progression of human PDAC, but is only of borderline significance as a prognostic indicator, indicating that other factors contribute to recurrence and spread. Fascin is a wnt target in colorectal cancer, where it localizes to tumor invasive fronts but is down-regulated in metastases. However, in Kras- and p53-driven pancreatic cancer, fascin is evenly expressed in tumors and remains highly expressed in liver and peritoneal metastases. Unlike colorectal cancer, the role of wnt signaling in pancreatic cancer progression is less clear, and we find that fascin is an EMT target of the Tf slug. Slug is expressed in pancreatic endocrine progenitor cells and effects EMT changes and migration during early embryonic development. We speculate that PDAC cells might reacquire slug and fascin during a partial reversion to an embryonic migratory state. There is controversy about whether gene changes that confer metastatic dissemination of pancreatic cancer (or other cancers) occur early in tumor formation or later. A recent study provided compelling evidence based on lineage tracing of cells by tumor mutation analysis that metastasis could occur even before there was a recognizable tumor. Our finding that fascin expression happens during late PanIN to PDAC transition suggest that EMT changes that promote metastasis start to happen early. EMT has been correlated with tumor-initiating (stem) cell properties and as a part of an EMT program. Fascin expression might allow tumor stem cells to thrive during initial tumor formation, as well as later during metastasis. Perhaps primary tumors and metastases first arise from small nests of fascin-positive cells in PanIN3. In this case, expression of fascin in PanINs might be predictive of tumor formation and metastasis. Fascin is not only expressed in PDAC tumor cells, but also in stroma of PDAC and of some PanIN. Because our fascin knockout is global and constitutive, loss of fascin in the stroma might have contributed to the phenotypes we observed. However, we could not detect any gross changes in the stromal immune cell component or blood vessel density of fascin knockout tumors, and we recently reported that fascin loss is dispensable for growth of transplanted tumors. Fascin has been implicated in migration and invasion in vitro, so it was surprising that fascin loss had no effect on invasion in vivo. We previously observed that only melanoma cell lines displaying elongated mesenchymal mechanisms of invasion were dependent on fascin. Collective invasion into bowel or peritoneal wall is not limited by loss of fascin and might also not be limited by matrix remodeling or invadopodia formation. Collective PDAC invasion could occur in physiological clefts between tightly packed collagen bundles or muscle strands, and fascin-mediated protrusions might not be crucial. We show that fascin null cells are less able to colonize the mesentery. Rho-associated colied-coil-containing protein kinase and myosin-mediated contractility are required for transmesothelial migration of human multiple myeloma and ovarian cancer cells., We provide mechanistic evidence that fascin drives long filopodia that cross between the mesothelial cells and make initial contact with the substratum to aid transmigration. Our study suggests that, at least for PDAC, it is not invasion of the primary tumor, but rather colonization of the new site that is most affected by fascin loss.

xref #text The evidence of a granular lymphocytosis greater than 2,000/μl lasting for more than 6 months has been generally accepted as the most relevant criteria for the diagnosis of disease [], considering that normally circulating LGL counts are 0.25 x 10/L []. This figure obviously requires additional evaluation of immunophenotyping and molecular analyses. This is particularly relevant when only some of the above criteria might be present. On blood films, the LGL nucleus is typically round with condensed, mature chromatin; the cytoplasm is pale, where randomly distributed azurophilic granules are easily detectable [,]. BM involvement by chronic LGL disorders is often subtle and difficult to identify, even when apparent in the PB []. In most cases, flow cytometry immunophenotyping defines a CD3+ LGLL, which usually express the TCR α/β+, CD2+, CD4-, CD8+, CD16+, CD57+, CD45RA+, CD122+ (p75 IL-2R), CD25- (p55 IL-2R) phenotype. CD5 and CD7 are weakly expressed or negative; CD56 is rarely positive and it has been claimed to be associated with a more aggressive clinical course []. These cells usually display a cytotoxic phenotype corresponding to that of a fully differentiated mature cytotoxic T lymphocyte (CD45RA+, CD27-, CD28-, CD62L-, CCR7) []. Most cases represent expansions of T cells bearing the TCR αβ+ while only a minority is derived from TCRγδ+ cells bearing a Vγ9+/Cδ2+ or a Vγ9-/Cδ1 phenotypic profile with TCRγ monoclonal restriction []. The expression of the inhibitory complex CD94/NKG2A, belonging to NK receptor, in these cells seems to correlate with a less aggressive behavior of proliferation []. Flow cytometry analysis with MoAb against the various Vβ regions of the TCR allows to establish the clonality of the LGLs by showing the preferential use of one or two TCR-Vβ segments []. These techniques should be applied to all suspected cases and are useful in those patients in whom the absolute LGL count is not significantly increased. Formal proof that we are dealing with a T-LGL is provided by the establishment of clonality through gene rearrangement studies [], these techniques allowing to distinguish LGL proliferations as a neoplastic disease or reactive lymphocytosis. Methods used to determine TCR gene rearrangement are polymerase chain reaction (PCR) and Southern blotting. While Southern blotting has fewer false negative and false positive results, PCR is a more sensitive technique for detection. Also, PCR is considered more user friendly in that it is less labor-intensive and does not require high-molecular weight DNA, which allows for DNA to be used from paraffin-embedded tissues when fresh or frozen samples are not available []. CD3- LGLL are characterized by the CD16+CD56+CD45RA+CD122+CD25- phenotype. CD57 antigen is usually weakly detectable. CD56 antigen is normally expressed by LGL, although some negative cases are reported. No clinical correlation with this marker has been performed, although CD56 negative cases seem to be more frequently associated to cytopenia. CD94 antigen is found at high density on patients’ NK cells; this antigen is usually associated with the inhibitory subunit NKG2A, although in some cases the association CD94/NKG2C has been reported []. Patients’ NK cells characteristically express functional β and γ chains of IL-2/IL-15 receptor, which are strictly related to the role of these cytokines in the pathogenesis of disease []. Expression of NK receptors, mostly represented by KIR, is altered in patients with CLPD-NK. A restricted pattern of KIR expression has usually been reported in these patients, which is characterized either by a dominant expression of a relevant KIR, or by a lack of KIR expression [,]. NK-LGL cells are not equipped with the TCR and therefore clonality cannot be determined by the rearrangement of TCR genes. In these cases a KIR restricted pattern of expression has been considered as a marker of clonality []. In addition, the demonstration of somatic STAT3 mutations [] may represent a useful tool in the diagnosis of disease, although not easily available in all labs (see below). The disease usually affects older people (mean 60 years). It is more common in Eastern than in Western countries. The disease runs asymptomatic in nearly 30% of cases, with lymphocytosis representing the only observed hematological abnormality []. These asymptomatic patients may have other associated conditions; among these, RA is the most commonly reported co-morbidity condition [, ] but several other connective tissue diseases such as systemic lupus erythematosus have been reported to be associated with T-cell LGL leukemia. Hematological conditions are another well represented group including monoclonal gammopathies, multiple myeloma, myelodysplastic syndromes, myelofibrosis, Hodgkin’s and non Hodgkin’s lymphomas [, ]; non-hematological neoplasms have also been reported in association with LDGL. The term of T-cell clonopathy of unknown significance (TCUS) has been suggested to designate these asymptomatic patients []. Symptomatic patients frequently present with fever due to infections or mouth lesions, often related to neutropenia. Weakness due to anemia represents another relevant finding. B-related symptoms (fever, night sweats, weight loss) are observed in nearly 25% of cases. Another intriguing association has been found between LDGL and pulmonary hypertension, with documented infiltration of the lung by GL []. Up to a half of the patients have splenomegaly, around 20% of cases present skin lesions and only a minority have hepatomegaly; lymphadenopathy is rare. Most CLPD-NK patients are asymptomatic, and the disease has a chronic indolent clinical course, similar to that reported for patients with T LGL leukemia []. Associated conditions are reported even for CLPD-NK, including pure red cell aplasia, vasculitic syndromes, solid and hematologic tumors, splenectomy, neuropathy and autoimmune disorders [,]. Recently in patients with chronic myeloid leukaemia an association between treatment with dasatinib and the development of the lymphoproliferative disease has been reported, the hypothesis having been suggested that the CLPD-NK might have a beneficial therapeutical effect on Ph+ leukemic cells []. Cytopenia (either neutropenia and anemia) are quite common. The leukocyte count may be normal or slightly elevated but in most patients there is an increase in circulating LGL, even without having an absolute lymphocytosis; some cases are lymphopenic. In discrete patients lymphocytosis develops after splenectomy. Lymphoadenopathy, hepatomegaly, splenomegaly and cutaneous lesions are uncommon []. Occasionally, patients present with a slowly progressive increase of peripheral blood NK cells and with organ involvement. In rare cases the disease transforms to aggressive NK cell leukemia and cases with EBV positive NK cells tend to evolve []. Several cases with a spontaneous complete remission have also been reported []. Disease may run asymptomatic for many years in the majority of patients, whereas in other cases therapy is needed, usually for cytopenia-related manifestations. The percentage of patients who require therapy at some time during the disease ranges from 30 to 70%, according to different series []. In one of the largest published multicenter study including 151 cases, coordinated by our institution, mortality after 4 year follow-up was 20% and a median survival greater than 10 years []. Most deaths are due to sepsis and rarely occur due to disease progression. Indications for treatment include severe and symptomatic neutropenia, transfusion dependent anemia or thrombocytopenia as far as progressive disease (i.e., appearance of organomegaly, B symptoms and rapidly LGL raising counts). Correction of cytopenias with therapy may be achieved without eradication of the clone, which often persists even after treatment. Immunomodulatory drugs, such as methotrexate (10 mg/m/weekly), cyclosporine A (5-10 mg/kg/day) or low dose cyclophosphamide (50 to 100 mg/day) have been commonly used []. Corticosteroids may be useful as a part of the initial treatment to accelerate response and growth factors are often used. Adverse events are not severe and are more common with cyclosporine A, particularly in elderly patients. Splenectomy may be considered as an adjuvant in patients with relevant splenomegaly and refractory cytopenias []. Once patients with LGL leukemia begin treatment, the regimen should not be altered for a period of 4 months, and they must be closely observed through complete blood counts []. After this time point, a hematological complete response is considered achieved when blood counts reveal platelets >150 x10/L, ANC >1.5 x 10/L, lymphocytes <4 x 10/L, and hemoglobin >12 g/dL. Complete molecular remission is reached when the T-cell clone is no longer detectable through PCR analysis []. Partial response is considered when overall blood counts improve but the ANC has not achieved levels > 500 cells/μL, still leaving the patient at potential risk for secondary infections. Should an improvement not be achieved after 4 months of continued treatment, then one of the alternative therapies described above should be taken into account. Chemotherapeutic agents currently being tested in cutaneous T-cell lymphoma (CTCL) and peripheral T-cell lymphoma (PTCL), such as gemcitabine, liposomal doxorubicin as well as the purine analogs, such as fludarabine, cladribine and nelarabine, represent possible new agents to be considered for symptomatic LGL disorders [, ]. Purine analogs have been only used in few patients with response rates of 40 to 67% for pentostatin, fludarabine alone or in combination. The use of these agents should be considered for young patients as they allow the achievement of good remissions, including the reduction of bone marrow infiltration. Monoclonal antibodies anti-CD52 (Campath-1H), anti-CD122 and anti-CD2 are being incorporated in the therapeutic scenario [,]. Good responses have been obtained in patients with symptomatic T-LGL leukemia and CLPD-NK with the use of RAS farnesyltransferase inhibitor (FTI), tipifarnib (Zarnestra®, Johnson & Johnson), according to the findings of a constitutively active signaling of the Ras/MAPK/ERK pathway []. Recently, the efficacy of extracorporeal photopheresis has been evaluated in 5 refractory/relapsed patients with LGL leukemia, with 2 of 5 patients achieving a CR []. In addition, the proteasome inhibitor bortezomib has been reported to display anticancer activity against aggressive NK leukemia and extranodal NK/T cell lymphoma and opening new therapeutical prespectives for these patients []. During infection exposure or antigen stimulation, LGLs undergo proliferation by many thousands of times upon priming by target cells, and at a later time after antigen clearance, are selectively eliminated by a process called activation induced cell death (AICD) []. The etiology of chronic LGL proliferations is largely unknown in most cases. This is consequent to the fact that not a single specific agent can establish the LGL proliferation, which instead is likely due to the expression of an erroneous management of a foreign agent. In other words, different agents are supposed to induce the disease through a common pathogenetic mechanism. Crucial cornerstones for disease development have been recently identified. A number of reports strongly support the role of a chronic/persistent antigenic stimulation by an auto- or foreign infective antigen as an initial event []. This would lead to the expansion of a fully differentiated effector/cytotoxic LGL, which is not eliminated due to an impairment on the apoptotic pathway []. Multiple cell survival pathways, including JAK2/STAT3, sphingolipid signaling, RAS/MEK/ERK, and SFK/PI3K/Akt, have been found to be constitutively activated in LGL leukemia patients (reviewed in []). Some of these altered pathways seem more correlated with T-type, others with NK cell type of proliferation, whereas others are common of both T and NK cell proliferation. A biology approach identified IL-15 and PDGF as master survival signaling switches that may have a profound effect on all known deregulations in T-LGL leukemia []. However, if both disorders share the feature of a persistent antigenic stimulation, it is reasonable to think that in the same patient both T and NK cell can be under antigenic pressure. Consequence of this finding rests on the fact that growth mechanisms shared by T and NK cells represent the cornerstone for the genesis of a LGL proliferation. Accordingly, some questions can be raised. #text xref #text xref italic #text Recently, it has been observed that recurrent somatic missense mutations of STAT3 (more often Y640F and D661Y) might be demonstrated in one third of patients with LGLL []. The same Authors updated their case study in more than 100 LGLL patients confirming that STAT3 mutations were also detectable in nearly one third of patients with CLPD-NK []. These data have also been confirmed by other groups, although the percentage of mutated cases ranged from 22 to 77% [, ]. It has been suggested that mutated STAT3 still retains its physiologic ability to stimulate some target genes. Jerez et al. also suggested that STAT3 mutation can be helpful in discriminating true leukemic from possibly reactive conditions []. This conclusion however should be viewed with caution. As a matter of fact, whereas STAT3 activation is indeed a constitutive mechanism in all T-LGLL patients [, ], STAT3 mutations are reported only in a fraction of cases, despite the presence of monoclonal rearrangement of TCR was shown in all cases [, ]. In addition, considering each single patient, STAT3 mutated LGL have been shown to account for only a minority of the entire monoclonal LGL population []. Furthermore, in the STAT3 mutated patients, consistent with unmutated cases, we observed a high expression of P-STAT3 and IL-6, associated to SOCS3 down-regulation, ruling out any specific peculiarity for these patients []. Finally, by incubating pathological LGL with the downstream STAT3 selective inhibitor STA-21 (a novel synthetic inhibitor of STAT3 dimerization, DNA binding, and STAT3-dependent luciferase reporter activity) apoptosis was induced in both CLPD-NK or T-LGLL, irrespective of the mutational status []. According with the above quoted considerations, we suggest that the acquisition of STAT3 mutations might be an event occurring late during the natural history of disease, certainly later than the establishment of clonality. This event is likely to represent a marker of the progression of disease, defining in patients with T-LGLL and CLPD-NK a common specific clinical and pathogenic pattern driven by a shared genetic lesion, irrespective of the cell lineage they originate from. #text

Monoclonal gammopathy of undetermined significance (MGUS) is an asymptomatic plasma cell disorder; it is a non malignant common condition affecting at least 3% of the population above the age of 50, with an average 1% annual risk of progression to Multiple Myeloma (MM) []. A monoclonal gammopathy can be associated with many non malignant conditions, frequently observed in common clinical practice. MGUS virtually precedes the development of MM and related disorders:, lymphoplasmacellular neoplasms, Waldenstrom Macroglobulinemia or light chain amyloidosis [,]. Differential diagnosis of symptomatic and asymptomatic monoclonal gammopathies is the determinant for starting therapy []. Over the last few years, advances in the understanding of the pathogenesis of this disease and large epidemiological studies [], allowed the design of risk models to estimate the individual risk of progression to MM. The development of individualized risk profiles, through the use of flow cytometry [], free light chain analyses and risk models [] represent an interesting ongoing challenge since the distinction of patients in low- and high-risk would allow a tailored clinical management of MGUS patients []. An early detection of the signs of progression could lead to the development of early treatment strategies. The aim of this report is to provide current information on the diagnosis, biology, risk stratification and follow-up of patients with MGUS. Most monoclonal proteins (M-proteins) are detected incidentally during routine checks, especially when investigating an increased erythrocyte sedimentation rate in older people. When a spike-like peak is first found on serum protein electrophoresis (SPEP), serum and urine immunefixation electrophoresis (IFE) should be performed additionally and the class specific immunoglobulins should be quantitatively determined to confirm the diagnosis of monoclonal gammopathy [,]. Quantitative measuring of free light chains in the serum is a new, highly sensitive, method that may be helpful in assessing the prognosis and controlling the course of the disease []. The typical laboratory investigations necessary to differentiate MGUS from other related plasma cell (PC) disorders are a complete blood cell count (CBC), serum creatinine measurement, serum calcium measurement, and a complete radiographic bone survey. Among B cells disorders, MGUS is, by definition, characterized by a serum M protein concentration of less than 30 g/L, fewer than 10% clonal PCs in the bone marrow, and the absence of end-organ damage defined by hypercalcemia, renal insufficiency, anemia, or bone lesions (CRAB) [] (). A bone marrow aspirate and biopsy are required in case of abnormalities in the blood/urine tests, when the M protein level is greater than or equal to 15 g/L, in patients with non-IgG MGUS, and/or an abnormal serum free light chain (FLC) ratio, and in any other patient with presumed MGUS in whom there is doubt about the diagnosis []. Large epidemiological and clinical studies have led Mayo Clinic investigators to define 3 distinct clinical subtypes of MGUS: non-IgM MGUS, by far the most common; IgM-MGUS; and light-chain MGUS [], each with a different mode and cumulative risk of progression to MM at 10 years (). The most well-characterized subtype is non-IgM MGUS, in which the M-component isotype can be IgG (69%), IgA (11%), or biclonal (3%); IgD and IgE are rare []. Malignant transformation of non-IgM MGUS approximates 1% per year and typically develops into multiple myeloma rather than lymphoproliferative disorders (LPDs) []. IgM MGUS occurs in approximately 11% of patients [], it has a predilection for developing Waldenstrom macroglobulinemia or other lymphomas while rarely progressing to IgM MM []. People with MGUS can occasionally present numbness or tingling in their hands and feet, or problems with their balance, due to peripheral nerves damage caused by paraproteinemia. This situation configures a disorder called Paraproteinaemic Demyelinating Neuropathy (PDN) or MGUS - associated neuropathy. The higher prevalence of neuropathy in patients with IgM MGUS may be related to the frequent reactivity of IgM M-proteins with myelin-associated glycoprotein (MAG) []. Almost 50% of patients with IgM PDN have high titres of antibodies to myelin- associated glycoprotein (MAG) , and this is the best defined syndrome of PDN, some other patients present IgM antibodies against different gangliosides. Most patients with IgM PDN have the “distal acquired demyelinating symmetrical” (DADS) clinical phenotype of predominantly distal, chronic (duration over 6 months), slowly progressive, symmetric, predominantly sensory impairment, with ataxia and relatively mild or no weakness, and often tremor. Testing for MAG-antibodies should be considered in all patients with IgM PDN. If negative, then testing for IgM antibodies against other neural antigens, including gangliosides GQ1b, GM1, GD1a and GD1b, and SGPG, may be considered []. Patients with IgG or IgA PDN usually have both proximal and distal weakness, with motor and sensory impairment. No specific antibody has been consistently associated with demyelinating neuropathy in patients with IgG or IgA paraprotein, so there is no need to test for serum antibodies to known neural epitopes in routine practice. Many patients are initially thought to have an ordinary PDN, until POEMS (Polyneuropathy, Organomegaly, Endocrinopathy, Monoclonal band and Skin changes) syndrome () is suggested by the presence of systemic features such as sclerotic bone lesions, hepatosplenomegaly, lymphadenopathy, endocrinopathy, papilloedema, skin changes (hypertrichosis, hyperpigmentation, diffuse skin thickening, finger clubbing, dermal haemangiomas, white nail beds) and edema. POEMS usually has an underlying osteosclerotic myeloma, with IgA or IgG lambda paraprotein, or sometimes Castleman’s disease. Patients with PDN must be referred to the neurologist for the specific treatment (plasma exchange, intravenous immunoglobulin, corticosteroids, immunosoppressive therapies, interpheron-alpha, Rituximab) []. MGUS has confirmed and reported associations with numerous diseases that are commonly encountered in clinical practice, such as osteoporosis [], dermatological diseases (Lichen myxoedematosus, scleroderma, pyoderma gangrenosum, necrobiotic xanthogranuloma, discoid lupus erythematosus, psoriasis, cutaneous lymphoma), rheumatologic diseases (rheumatoid arthritis, inflammatory seronegative polyarthritis, polymyositis, polymyalgia rheumatica, myasthenia gravis, angioneurotic edema) and liver diseases (chronic hepatitis, cirrhosis, primary biliary cirrhosis) []. AIDS and HIV infection, renal transplantation, bone marrow transplantation and many other conditions determining immunosuppression can be associated to MGUS. Recent observations suggest to also consider a form of MGUS of renal significance (MGRS) [] as a growing number of kidney diseases which present with renal impairment and a nephrotic range proteinuria are associated to a MGUS-like clonal pasma cell disorder. The renal impairment seems to be misdiagnosed in this subgroup of patients, leading to a great deal of morbidity and even mortality []. From a practical point of view these data suggest in case of M-protein detection and renal failure and/or proteinuria, not only a bone marrow aspirate to exclude MM, but also a kidney biopsy []. Among rare disorders, Gaucher disease can debut with the presence of a monoclonal gammopathy and anemia and it should be considered in the differential diagnosis of MGUS []. Venous thrombosis can also be associated to MGUS []. MGUS patients just like MM patients present an increased risk of Venous thromboembolic disease (VTD) and arterial thrombosis. There is no current evidence to explain this pre-thrombotic state; a high concentration of M-protein is linked to an increased risk for thrombosis, especially in patients with IgG or IgA MGUS [,,]. While guidelines for prophylactic interventions in MM patients have been published [] there is lack of a consensus about the management of MGUS patients. Studies published to date suggest to consider antithrombotic therapy for patients with IgG/IgA MGUS plus the presence of additional risk factors for thrombosis (age, obesity, inherited thrombophilia, history of VTE, comorbidities, surgical procedures ) []. The etiology of MGUS remains unclear and is a current topic of investigation. Race and ethnicity seem to play a role in the pathogenesis as the prevalence of MGUS is 2- to 3-fold higher in African-Americans and blacks from Africa compared to whites. Advancing age, male sex, family history of haematologic malignancies, immunosuppression, and exposure to certain pesticides all increase the risk of MGUS [,]. MGUS and smoldering multiple myeloma (SMM) are premalignant precursor tumors of MM that are stable and not associated with the presence of secondary clinical manifestations [,]. They both are derived from activated B- cells that have undergone several rounds of hypermutation and antigen selection in Germinal centers (GCs) and immunoglobulin heavy chain (IgH) switch recombination before differentiating into plasmoblasts (PBs). PBs from the GC migrate back to the bone marrow where they become terminally differentiated long-lived PCs. MGUS, SMM, and MM are monoclonal tumors that retain many of the phenotypic properties of healthy PBs/PCs but in contrast to their normal counterpart they maintain low proliferation rates that can increase markedly in late stages of MM [,]. The pathophysiology of the transition from normal PCs to MGUS to multiple myeloma involves many overlapping oncogenic events []. The first step in the pathogenesis is usually an abnormal response to antigenic stimulation, possibly mediated by aberrant expression of toll-like receptors, overexpression of interleukin (IL) 6 receptors and IL-1β, and dysregulation of the cyclin D gene [,,]. The development of primary cytogenetic abnormalities (the most common are t, t, t, t, and t, hyperdiploidy or immunoglobulin heavy chain (IgH) translocations are likely followed by a random second hit such as Ras and p53 mutations, p16 methylation, myc abnormalities, and induction of angiogenesis. Finally, in most advanced stages, there is increased osteoblast RANKL (receptor activator of nuclear factor κB ligand) expression and reduction in the level of its decoy receptor, osteoprotegerin, which results in osteoclast activation and increased bone resorption and turnover []. This is accompanied by increased levels of IL-3, IL-7, and dickkopf 1 that simultaneously inhibit osteoblast differentiation, leading to the pure lytic lesions typical of myeloma []. At present, there are no reliable biologic markers that predict which individual with MGUS will progress to MM or related conditions. In the absence of such markers, MGUS is currently risk stratified based on clinical variables identified through epidemiological studies. Two predictive risk models for MGUS to MM have been developed by the Mayo Clinic and the Spanish study group investigators (PETHEMA). The Mayo Clinic model is centered on serum protein abnormalities and identifies 3 major risk factors for progression: non-IgG isotype, serum M-component concentration > 1.5 g/dL, and an abnormal FLC ratio. The FLC ratio is measured using a highly sensitive serum free light chain assay that quantitates free kappa (κ) and lambda (λ) chains secreted by PCs (normal range for free κ, 0.33 to 1.94 mg/dL; normal range for free λ, 0.57 to 2.63 mg/dL).. The normal FLC ratio (free κ /free λ) is 0.26 to 1.65. Patients with a serum FLC ratio < 0.26 are defined as having monoclonal λ free light chain and those with ratios > 1.65 are defined as having a monoclonal κ free light chain () []. Patients with an abnormal serum FLC ratio, non-IgG MGUS, and a high serum M protein level (≥1.5 g/dL) had a risk of progression of 58% at 20 years (high-risk MGUS), compared to 5% when none of the risk factors were present (low-risk MGUS) (,) []. The Spanish model uses multiparametric flow cytometry of BM aspirates to differentiate aberrant (aPCs) from normal PCs. PCs characteristically express CD138 and intense (bright) CD38. The features of aPCs include decreased CD38 expression, expression of CD56, and the absence of CD19 and/or CD45. Risk factors for progression are ≥ 95% aPCs/BMPC and DNA aneuploidy []. Despite the existence of these significant predictive factors for progression, there are insufficient data on the preventative treatment of high-risk patients. In the future, additional markers may be added to risk stratification models to better define high-risk patients []. A small study, showed that PC phenotype (CD138/38/45 expression) and sFLCs provide independent and complementary prognostic information on the risk of progression []. Although most people with MGUS die from unrelated illnesses, MGUS may transform into malignant monoclonal gammopathies. Patients should therefore be monitored on a regular basis to identify early signs of progression. Once MGUS is diagnosed primary care physicians will attend patients with M-protein < 15 g/L if IgG and patients with M-protein < 10 g/L if IgA or IgM, without end-organ damage and without signs and symptoms of LPD (lymphocitosis, thrombocytopenia, lymphadenopaty, hepatosplenomegaly, constitutional symptoms, hyperviscosity, unexplained heart failure, polyneuropathy). In case of IgM MGUS, the execution of a chest X-ray and an abdomen Echo tomography may be indicated. In June 2010, the International Myeloma Working Group (IMWG) released consensus guidelines for monitoring and managing patients with MGUS and smoldering myeloma. Patients with MGUS are divided into different categories based on low risk, intermediate risk, and high risk. If the serum monoclonal protein is <1.5 g/dL, IgG type, and the free light chain ratio is normal, then the risk of eventual progression to multiple myeloma or related malignancy is low []. In this low-risk setting, a baseline bone marrow examination or skeletal survey is not routinely indicated if the clinical evaluation and laboratory values suggest MGUS. Patients should be followed with SPEP 6 months after diagnosis and if stable can be followed every 2-3 years (or sooner if symptoms suggestive of disease progression arise). Patients in the intermediate and high risk MGUS category are managed differently. They usually have a serum monoclonal protein >1.5 g/dL, IgA or IgM type, and/or an abnormal free light chain ratio. In this situation, a bone marrow biopsy should be carried out at baseline. Both conventional cytogenetics and fluorescence in situ hybridization should be performed. These patients are followed with SPEP, complete blood count, serum calcium and creatinine levels 6 months after diagnosis and then yearly for life. A bone marrow biopsy and skeletal survey is always indicated in patients with presumed MGUS with unexplained anemia, renal insufficiency, hypercalcemia, skeletal lesion or in case of increase of the M-protein by more than 25% (a minimum absolute increase of 5 g/L) []. MGUS represents an interesting pre-malignant condition. Novel biomarkers, molecular profiles, and microenvironmental interactions of interest in myelomagenesis are being investigated to better understand the underlying mechanisms of its transformation to MM. Currently, in clinical practice, MGUS patients are followed without treatment until progression. In recent years, efforts to design models based on laboratory findings to evaluate the individual risk of progression have aimed to identify high- and low-risk patients for whom a tailored clinical management may let detect early signs of progression, and, possibly, its prevention or delay through the development of early treatment strategies.

Myelodysplastic syndromes (MDS) are a group of clonal myeloid disorders which are morphologically characterized by bone marrow (BM) hypercellularity, uni- or multilineage dysplasia, and peripheral blood cytopenias. The incidence rate of MDS in the United States for the years 2003-2007 has been estimated at 4.3 per 100, 000 people which accounts for 15,000 new cases every year [,]. Statistics on incidence rates might be higher due to misdiagnosis of cases with hypocellular BM or misinterpretation of the anemia observed in MDS as a normal condition in the elderly. It is a disease more frequently diagnosed in men with the exception of MDS with 5q- syndrome, which is slightly more frequent in women. Chromosomal defects are usually clonal and recurrent. They are observed in approximately 50% of primary and 80% of cases of therapy-related MDS (t-MDS) [,]. The most commonly affected chromosomes are 5, 6, 7, 8, 11, 13 and 20 and the most recurrent chromosomal lesions are partial deletions (5, 7, 11, 13, and 20) and additional copies (6 and 8). Unbalanced translocations are also sometimes seen. Single chromosomal alterations are usually detected in MDS while a complex karyotype, defined as having ≥3 chromosomal abnormalities is usually observed in MDS patients with antecedent exposure to treatments such as chemo/ radiotherapy or to toxic chemicals. The latter condition is included in the MDS category called secondary MDS (sMDS) which includes MDS that evolved from a prior hematologic disorder. The impact of having multiple chromosomal anomalies has also been investigated and correlated with unfavorable outcome in patients with sMDS. Cytogenetics has a crucial impact on the outcome of patients with MDS and acute myeloid leukemia (AML) undergoing hematopoietic stem cell transplantation []. The accumulation of genetic defects in addition to the primary molecular mutation affecting a stem cell increases the propensity to develop more aggressive diseases like AML. The importance of cytogenetic abnormalities in MDS is also due to the fact that chromosomal regions often contain genes relevant to MDS biology and pathophysiology. Indeed, the presence of chromosomal abnormalities like deletions suggests that haploinsufficiency and/ or loss of tumor suppressor genes (TSGs) are mechanisms important in MDS biology. Conventional Sanger sequencing, high resolution whole genome scanning technologies (array-based comparative genomic hybridization (aCGH) and single nucleotide polymorphism arrays (SNP-A) genotyping) and high-throughput sequencing technologies (whole genome/ exome sequencing) have brought to light molecular alterations in genes of numerous pathways including methylation, transcriptional factors, signal transduction, histone regulators, and the RNA splicing machinery []. The diversity of these lesions and their combinations may reflect the heterogeneity in the morphologic presentations, clinical courses, and potentially response to therapeutic agents. Ultimately, the finding of genes relevant to MDS pathophysiology also opens the possibility of targeted therapy. The World Health Organization (WHO) has classified MDS into several distinct disease groups differentiated from others by BM and peripheral blood (PB) morphology (blasts, ring sideroblasts, dysplasia, cytopenias) and cytogenetic changes. Different risk stratification scoring systems have been created and revised for MDS. Metaphase cytogenetics (MC) still serves as an important weighted parameter in the risk stratification assessment (). Classically, MC is the gold standard in the determination of cytogenetic abnormalities in myeloid cancers. The advantages of MC include the simplicity of the method, the detection of unbalanced/ balanced chromosomal defects, and the feasibility in discriminating single cellular clones. However, MC reaches a sensitivity of only 10% and it is informative in only 46-59% of patients with MDS due to the limitation in achieving results when cells are unable to grow or in case of non-informative karyotypes [.]. Further, even if one-half of MDS patients have a normal karyotype by MC, this does not necessarily exclude the presence of latent genetic defects not clinically dominant which escape detection due to the low resolution of MC. A combination of chromosome painting and multi-color fluorescence called spectral karyotyping (SKY) has complemented the photographic images of condensed chromosomes by G-banding and fluorescence hybridization (FISH) for specific chromosome (5, 7, and 20) and improved the detection of chromosomal rearrangements and minimal monosomies leading to a better picture of the karyotype []. Advances in high resolution genome scanning technologies like aCGH and SNP-A have improved the detection rate of genomic lesions in MDS and other related disorders and have clarified many aspects of MDS biology []. aCGH is a technology that identifies differences in copy number between DNA of patients and healthy subjects on the basis of fluorescent hybridization signals. SNP-A has combined two techniques commonly used in the DNA microarray technologies, DNA hybridization and fluorescence. The use of SNP-A has overcome a limitation of the aCGH technology and provides the ability to detect a cryptic cytogenetic defect called acquired somatic uniparental disomy (AS-UPD) which is recurrent in 20% of patients with MDS. Several studies have reported the clinical importance of both aCGH and SNP-A on the survival settings of MDS []. However, efforts have been made towards the combination of all these approaches with MC and several multicenter studies have highlighted the worse survival outcomes of patients with MDS and other disorders carrying defects detected by MC/ SNP-A in addition to several other studies where the number of defects by SNP-A predict worse outcomes []. More recently, high-throughput sequencing, such as whole genome/ exome and deep sequencing, has been instrumental in discovering germ-line and somatic variants in a number of solid tumors and blood cancers including MDS. These technologies are able to generate a comprehensive sequence database of an individual (whole genome), a targeted genome re-sequencing which allows for the generation of specific sequences (whole exome) or a sequence of the entire genome with higher ‘’depth’’ indicating that the process of the sequencing is performed more than one time for any one region of the genome (deep sequencing). This latest approach has markedly improved the accuracy of sequencing, reducing the error output. More than a decade ago, cytogenetic defects were the foremost determinant of MDS biology. The advancement in high resolution genomic technologies helped in the identification of regions of the genome highly suspected to contain molecular mutations. This was the case for the original discoveries of , , , / , , , , ,, , and (). We will discuss the role of several of these genes and pathways for which the biological and clinical impact has been studied and associated with MDS pathophysiology. Aberrant DNA methylation has been observed in MDS. Methylation of promoters at CpG loci is one of the mechanisms that can regulate and silence TSGs. The identification of distinct methylation patterns, hypermethylation of key genes important in differentiation, and the success of using DNA-methyltransferase inhibitors (5-aza-2’-deoxycytidine and 5-azacytidine) in some MDS patients provides the rationale supporting the key role of methylation as a cru cial regulatory mechanism in MDS. Indeed, several studies have demonstrated that the increase in aberrant DNA methylation and chromosomal anomalies is directly proportional to the malignant transition of MDS to AML [,]. Genes that act as regulators of the DNA methylation have been found to be frequently mutated in MDS. SNP-A identified a region of loss of heterozygosity on chromosome 4q24 which contains a gene called which is frequently mutated in MDS. was mutated in 20-25% of MDS patients [,]. is a dioxygenase that catalyzes the conversion of the modified base 5-methylcytosine (5-MC) to 5-hydroxymethylcytosine (5-hMC) by oxidizing 5-MC. The conversion of 5-MC to 5hMC represents the first step in cytosine demethylation. Indeed, methylation at the C5 position of cytosine appears to be an epigenetic modification which plays an important role in transcriptional regulation. mutations are restricted to the C- terminus of the protein, resulting in loss of function which correlates with a decrease of 5-hMC levels and an increase of 5-MC leading to DNA hypermethylation and gene silencing [,]. Even though mutations are correlated with low 5-hMC levels in myeloid disorders, a fraction of patients with wild-type also have low 5-hMC levels. A recent report correlated a low level of 5-hMC to the over-expression of the ancestral CXXC domain of which encodes for a specific gene called []. In addition, several reports have described that low 5-hmC levels are associated with DNA hypomethylation in patients with myeloid malignancies while others have described DNA hypermethylation in AML []. A mouse model of loss of function shows increased proliferation of myeloid cells without manifesting any dysplastic changes resembling MDS []. The clinical impact of mutations has been widely studied by many groups and somehow is still under debate. () mutations do not seem to predict an increased risk for transformation to AML. Most studies looking at the prognostic value of in MDS did not show a difference in survival outcomes between mutant and wild type cases. The efficacy and effectiveness of hypomethylating therapy in specific subsets of MDS patients and the presence of molecular mutations in genes relevant to methylation also justifies the efforts in genotyping large cohorts of patients with MDS receiving hypomethylating drugs for these specific molecular changes. Itzykson and colleagues showed that high-risk MDS patients carrying mutations have better response rate to 5-azacytidine without any improvement in OS []. We demonstrated in a cohort of 92 MDS patients that the presence of and mutations confers better response to both azacitidine and decitabine []. Whole genome sequencing was instrumental in the identification of a somatic mutation in a DNA methyltransferase gene called located on chromosome 2 p23.3. catalyzes the addition of a methyl group to the cytosine of the CpG dinucleotides. The amino terminus of the human gene contains various motifs that recruit transcriptional repressors. The role of is extremely important since this enzyme acts as a check-point of DNA replication by keeping methylation mechanisms partially methylated. The methylation of the CpG islands induces repression of downstream genes. The first genetic alteration identified in was a frameshift mutation found in a patient with AML []. has been found to be mutated in 8% of MDS cases [,]. The interplay between and has captured the attention of many groups, especially for their role in altering the cytosine methylation and for the fact that current treatments for MDS heavily rely on hypomethylating therapy. murine embryonic stem cells deficient for have a competitive advantage compared to cells expressing normal , indicating that mutations might be clonally dominant []. The role of in somatic cells is still unknown. Data from mouse models has also suggested a role for in epigenetic silencing. Hematopoietic stem cells deficient for show differential methylation and up-regulation of multipotency genes. The clinical impact of has been correlated with worse OS []. Moreover, MDS is usually associated with a hypermethylation and DNMT-inhibitors are associated with increased survival in MDS. In 2008, parallel massive sequencing identified mutations in the isocitrate dehydrogenase 1 () gene in gliomas. mutations alter the catalytic activity of the enzyme producing a toxic oncometabolite called -2-hydroxyglutarade which affecting the redox state of the cells, blocking the production of NAPDH. The modality of how promotes the transformation of the normal cells is still unclear. Several studies have postulated that mutations (either by loss of the normal allele or as a result of a dominant-negative effect) might alter the mitochondrial function and lead the cells to use glycolysis. On the other hand, mutations lead to a hypermethylation phenotype with a change in the oxidative metabolism. Mutations in two isoforms of this metabolic enzyme ( and ) have been found in many solid and blood cancers, including in MDS at a low frequency. This finding suggests that malignancies can be caused by dysfunction in cellular metabolism. A small proportion of late stage MDS cases (5-10%) have mutations. In addition, a slightly higher frequency of mutations in this gene is found in sAML patients that evolved from a prior MDS (10-20%). The clinical impact of these mutations is still controversial and varies in different cancers []. The higher frequency in patients with higher risk MDS suggests a predisposition to develop AML. () It has recently reported that serum measurement of -2-hydroxyglutarade can predict clinical outcome in mutant patients []. Several studies have indicated an increased risk for relapse in AML patients carrying mutations while others have not found any statistical correlation. IDH1/2 proteins are interconnected with TET2 since TET2 seem to be a target of -2-hydroxyglutarate []. In addition, and mutations are mutually exclusive. () is a gene located in chromosome 20q11.21. This mutation appears to be independent of the deletion of 20q found in patients with MDS, as mutations were found in 28% of patients carrying isolated del(20q). is a member of the Polycomb family which includes genes implicated in chromatin remodeling and gene repression. Indeed, several structural similarities have been identified in genes of the Drosophilidae where interacts with chromosomal elements. The function of the ASXL1protein is required for the activation and repression of homeotic loci. The protein is believed to disrupt chromatin in localized areas of certain genes while repressing the transcription of other genes. Indeed, mutations lead to the disruption of activating domains (PDH, RARalpha, and SRC1). Monoallelic mutations in have been found in 16% of high-risk MDS patients and in ~30% of patients with AML and a prior MDS diagnosis. mutations have been associated with a worse OS in MDS []. () Mutational analysis has also revealed the co-occurrence of mutations with , , and mutations, indicating that the epigenetic mechanisms in total are highly dominant in MDS pathophysiology []. The effect of mutations is still unclear with some studies pointing towards a gain of function and dominant negative effect rather than loss of function. (), also known as , maps to chromosome 21q22 and belongs to a family of DNA core binding factors. regulates the transcription of genes important in hematopoietic stem cell formation during embryogenesis. Indeed, knock-out mice die few days after birth without achieving complete hematopoiesis. translocations produce chimeric proteins, and is usually highly mutated in AML (M0, M2, and M1 types), while mutations are found in 20% of MDS cases, mainly t-MDS and radiation exposure []. mutations occur near DNA-binding domains altering the DNA core-binding capacity and appear to be independent prognostic factors of worse OS. The mutations induce loss of trans-activation. An elegant study conducted in mice reported that mice transplanted with human cells carrying a mutant allele develop dysplasia in the erythroid lineage and MDS features. RNA splicing is an evolutionary mechanism important in maintaining genomic variability. Splicing mutations lead to hereditary diseases, such as X-linked disorders of copper metabolism and retinitis pigmentosa []. Somatic mutations in components of the spliceosome machinery were discovered by several groups using whole genome/ exome sequencing in MDS with ring sideroblasts (RS) and MDS/myeloproliferative overlap syndromes (MDS/ MPN) and later in lymphoid malignancies like chronic lymphocytic leukemia (CLL). mutations range in frequency, occurring in 68-75% of cases of refractory anemia with ring sideroblasts (RARS) and 81% in RARS associated with thrombocytosis (RARS-T) [] while being rare in other diseases []. has been linked to the pathogenesis of RARS and RARS-T. We associated mutations to the presence of RS [,]. In terms of clinical significance, mutations have been associated with better OS (P=.01), leukemia-free survival (P=.05), event free survival (P=.008) and with a lower risk of progression to AML []. Better OS was noted in RARS/ RARS-T carrying mutations [] (). No difference in OS and AML transformation was found in a cohort of 317 patients with MDS. Patnaik et al. determined that the prognostic value of mutations was completely accounted for the WHO morphologic grouping []. Pharmacologic inhibitors of the spliceosome machinery are currently available [,]. We described functional data on Meayamycin, which specifically targets the splicing factor 3b (SF3b) complex []. Other pharmacologic compounds including spliceostatin, FR901464, E7107, pladienolide and Sudemycins are currently being investigated. Interestingly, the clinical significance of in MDS is different from that observed in CLL. The other disease where is highly mutated is CLL (15%) []. It has been reported that mutations predict worse outcome in CLL patients, and they are commonly associated with deletion of long arm of the chromosome 11, an abnormality present in 5-10% of CLL patients. These findings suggest that different targets might be involved and also that the clonal nature of the two diseases is regulated by different drivers. Our laboratory is actively working in investigating the molecular mechanisms responsible for the good outcomes of patients carrying mutations focusing attention on DNA damage differences, iron accumulation, mitochondrial targets, and response to hypomethylating agents. Our preliminary data suggests that the presence of mutations confer better response rate to erythropoiesis stimulating agents and hypomethylating agents []. Mammalian U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) is a heterodimer composed of a 65-kDa subunit (U2AF) and a 35-kDa subunit (U2AF). U2AF contacts the pyrimidine tract while U2AF interacts with the AG splice acceptor dinucleotide of the target intron at the 3′ splice site. U2AF is also known as U2AF1. Recurrent somatic mutations (S34 and Q157) in were found in 8.7% of patients with primary MDS and were associated with progression to sAML [,]. mutations result in a gain of function. Indeed, a significant increase in exon skipping was observed when the mutant p.Ser34Phe cDNA was transiently expressed []. Pattern of splicing for has recently been elucidated []. encodes a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors with an RNA recognition motif (RRM) and a RS domain. is believed to be a key element in the acetylation/ phosphorylation network and an important regulator of the DNA stability. The first report describing mutations in CMML found mutational frequencies ranging between 28.4-47% []. The most common alteration occurs at amino acid position Prolin95 between the RRM motif and the RS domain. has been indicated as a new diagnostic target in CMML. The presence of mutations correlate with higher age, anemia, and normal karyotyping and do not seem to impact survival. Other studies associated mutations with poor outcomes (). The impact of baseline spliceosomal mutations were investigated in a cohort of patients that underwent allogeneic hematopoietic cell transplantation, finding that mutants had similar outcomes to wild type patients, suggesting that transplant can compensate for the adverse impact of this gene []. xref #text Gene mutations can be associated with specific classes of MDS patients carrying distinct chromosomal anomalies. Mutations in , a TSG, have been correlated with anomalies of chromosome 5 (isolated del5q, -5/5q-), 17p-, and complex karyotypes, suggesting different biological and driving mechanisms. Mutations were detected early in the MDS presentation, suggesting a primary event in the manifestation of the disease. Associations of mutations and t-MDS have been reported. Moreover, mutations have also been correlated with response to therapy (5-azacytidine) and seemed to disappear upon response []. The discovery of the haploinsufficiency of and its somatic deletion in patients with 5q- syndrome associated MDS to other ribosomopathies and correlated this ribosomal protein to the pathogenesis of 5q- patients. In addition, seems to be a major player in the anemia of patients with 5q- and a marker of good prognosis []. xref #text H i g h - r e s o l u t i o n g e n o m i c t e c h n o l o g i e s h a v e d i s c o v e r e d a m y r i a d o f s o m a t i c a l t e r a t i o n s i n d i f f e r e n t g e n e s w i t h a v a r i e t y o f f u n c t i o n s i n M D S a n d o t h e r h e m a t o l o g i c m a l i g n a n c i e s . E v e n i n t h e e r a o f g e n o m i c t e c h n o l o g i e s , M C s t i l l r e p r e s e n t s t h e g o l d s t a n d a r d i n t h e i d e n t i f i c a t i o n o f c h r o m o s o m a l a b n o r m a l i t i e s i n M D S a n d s t i l l h o l d s a f u n d a m e n t a l r o l e i n t h e p r o g n o s t i c s c o r i n g s y s t e m s . M o l e c u l a r m u t a t i o n s r e p r e s e n t a n e w p a r a m e t e r t o t a k e i n t o a c c o u n t i n t h e r i s k s t r a t i f i c a t i o n s m o d e l s . W h o l e g e n o m e / e x o m e s e q u e n c i n g r e p r e s e n t s a p l a t f o r m o f d i s c o v e r y f o r n e w m a r k e r s o f M D S , b u t t h e r o l e a n d t h e m e c h a n i s m s e x p l a i n i n g t h e h e t e r o g e n e i t y o f t h e c l i n i c a l / m o r p h o l o g i c m a n i f e s t a t i o n s o f M D S i s s t i l l u n k n o w n . O n t h e o t h e r h a n d , e v e n w i t h t h e a d v e n t o f a l l t h e s e s o p h i s t i c a t e d t e c h n o l o g i e s c o n v e n t i o n a l S a n g e r s e q u e n c i n g s t i l l r e p r e s e n t s t h e m o s t r e l i a b l e a n d c o s t a f f o r d a b l e t e c h n i q u e . P i t f a l l s i n c l u d i n g a r t e f a c t s / f a l s e n e g a t i v e s a r e a l s o c o m m o n l y f a c e d u s i n g t h e n e x t g e n e r a t i o n t e c h n o l o g i e s a s m e n t i o n e d a b o v e . L o w e r - f r e q u e n c y m o l e c u l a r m u t a t i o n s a r e a l s o i m p o r t a n t i n M D S , b u t h a r d e r t o s t u d y i n t e r m s o f p r o g n o s t i c a n d p r e d i c t i v e s i g n i f i c a n c e . N o n e t h e l e s s , t h e y m a y p r o v i d e i m p o r t a n t i n s i g h t i n d i s e a s e b i o l o g y u n i q u e t o t h e s p e c i f i c i n d i v i d u a l c a r r y i n g t h e r a r e m u t a t i o n . R e c u r r e n c e o f s o m a t i c a l t e r a t i o n s i s a p r e - r e q u i s i t e t o d e f i n e a s p e c i f i c g e n e a s a p o s s i b l e c a n d i d a t e i n t h e p a t h o g e n e s i s o f a d i s e a s e s u b t y p e . W e h a v e i n t e r r o g a t e d h u n d r e d s o f p o s s i b l e c a n d i d a t e s s e l e c t e d a f t e r p e r f o r m i n g w h o l e e x o m e s e q u e n c i n g i n M D S a n d o t h e r r e l a t e d d i s o r d e r s , f i n d i n g s p o r a d i c s o m a t i c a l t e r a t i o n s w i t h n o d e t e c t a b l e f r e q u e n c y i n l a r g e c o h o r t o f s a m e d i s e a s e t y p e . G e r m - l i n e s o u r c e s ( l y m p h o c y t e s a n d / o r b u c c a l s w a b s w h e n p o s s i b l e ) , s c o r i n g o f t h e g e n e t i c v a r i a n t s b a s e d o n a n a c c e p t a b l e c o v e r a g e , s t r i n g e n t b i o i n f o r m a t i c s a l g o r i t h m s , s e a r c h i n g i n p u b l i c d a t a b a s e f o r S N P s e x c l u s i o n , a b s e n c e o f v a r i a n t s i n h e a l t h y i n d i v i d u a l s , a n d f u r t h e r c o n f i r m a t i o n o f t h e e v e n t u a l a l t e r a t i o n s w i t h b i d i r e c t i o n a l s e q u e n c i n g a r e a l l u s e f u l t a s k s t o g e n e r a t e v a l i d r e s u l t s .

Myelodysplastic syndromes (MDS) are a heterogeneous group of diseases characterized by impairment of cellular differentiation (also defined as ineffective hematopoiesis) progressive peripheral cytopenias and increased risk of developing acute myeloid leukemia (AML) []. Although the French-American-British (FAB) and World Health Organization (WHO) classification systems do not take into account hypoplastic or hypocellular myelodysplastic syndromes (HMDS) as a defined category of MDS, being HMDS probably considered the expression of a transitional status of other MDS categories, they appear to be a distinct clinicopathologic entity []. HMDS accounts for 10–15% of all MDS [] and are characterized by the following features: age-corrected bone marrow hypoplasia (ie cellularity less than 30% under age of 60 years or cellularity less than 20% for older than 60 years) [], marked dyserythropoiesis, both dysgranulopoiesis and dysmegakariopoiesis [,], macro-cytosis, severe neutropenia and thrombocytopenia [], frequent abnormal karyotype [], low rate of progression to acute leukemia, and poor response to conventional therapeutic approach for MDS []. Recently, Bennett and Orazi described several others marrow morphological criteria, detectable by bone biopsy histological analysis, useful to help HMDS diagnosis, such as the presence of dysplastic megakaryocytes [] within the disorganized microarchitecture of MDS marrow [], the detection of fibrosis [,], and the immunohistochemical identification of aggregates or clusters of blasts in the central intertrabecular region of marrow, also defined as abnormally localized immature myeloid precursor cells (ALIP) [,,]. According to FAB and WHO classification systems, the majority of HMDS cases fall into refractory anemia (RA) and refractory cytopenias with multilineage dysplasia (RCMD) categories []. In comparison to RA and RCMD, HMDS patients typically are younger, more frequently display a severe neutropenia and thrombocytopenia and a lower percentage of blasts, as well as even less frequently show karyotypically abnormal dysplastic marrow cells. Although Tuzuner et al. documented no difference in prognosis between HMDS and normo-/hypercellular MDS [], several other studies have reported a more favorable overall survival in the subgroup of HMDS patients [,,]. The distinction between HMDS and AA is even more problematic than that with RA and RCMD when marrow is sparcely cellular with an overall cellularity less than 20% and when these findings are associated with the presence of mast cells and reactive lymphocytes, sometimes organized in small lymphoid clusters, similar to those observed in AA bone marrow biopsies [,]. The presence of a clear dysmegakaryopoiesis and dysgranulopoiesis, but not of a mild isolated dyserythropoiesis, usually also found in AA, the detection of karyotypic and fluorescent in situ hybridization (FISH) abnormalities, as well as the identification of any sideroblast, of clusters of blasts, and of an increased number of marrow fetal hemoglobin (HbF)-positive erythroblasts, distinctly address toward a diagnosis of HMDS []. However, recognized HMDS karyotypic and FISH abnormalities, such as trisomy 8, trisomy 1q, 20q deletion and monosomy 7, can be also be found, although less frequently, in AA patients in particular throughout their clinical course []. Additional clonal molecular defects such as mutations in the RNA component of telomerase () or in the telomerase reverse transcriptase enzyme () genes and several other microdeletions, assessed by single nucleotide polymorphism (SNP) array–based karyotyping, have been documented in both HMDS and AA patients []. The separation of AA and HMDS is even more difficult when clonal cytogenetic markers are absent. Quantification of marrow CD34 cells by immunohistochemistry and flow-cytometry has been reported to help in distinguishing between AA and HMDS []. Matsui et al. have demonstrated that the mean percentage of CD34 cells in AA patients is significantly lower than those of HMDS patients []. Noteworthy, we previously documented that, in addition to the defect in more mature committed progenitor cells, also most immature hematopoieitic stem cells, measured as secondary colony-forming cells (CFC) after 5 weeks of long-term bone marrow culture (LTBMC), were affected by disease process in HMDS [,]. However, although marrow and circulating CD34 cells and secondary CFC numbers were significantly higher in HMDS than in AA, we found that there was a high degree of overlap between these two diseases, clearly demonstrating that secondary CFC numbers in either marrow and peripheral blood could not help to distinguish AA from HMDS in an individual patient [,]. Recently, Tripathi et al. also reported that circulating blood lymphocytes of AA patients had significantly lower S-phase fraction (SPF) and aneuploidy in comparison to HMDS patients, suggesting that SPF and aneuploidy could be a further parameter to differentiate AA from HMDS patients []. In addition, we documented that HMDS and RA patients show a severe deficit in marrow and circulating committed (CD34 cells and primary CFC), and immature progenitor cells (such as secondary CFC), compared to normal donors, implying that immature hematopoietic stem cell compartment is affected by disease process in HMDS. However, despite the dramatic difference in marrow cellularity, both more committed and immature progenitor cells showed no significant differences between HMDS and RA patients () []. i s w i d e l y r e c o g n i z e d t h a t g e n e t i c , e p i g e n e t i c , a p o p t o t i c a n d d i f f e r e n t i a t i o n a b n o r m a l i t i e s c h a r a c t e r i z i n g M D S h e m a t o p o i e t i c p r o g e n i t o r s m a y b e i n i t i a t e d a n d / o r s u p p o r t e d b y a s i g n i f i c a n t d e r a n g e m e n t o f i m m u n o l o g i c a l m i c r o e n v i r o n m e n t i n s o m e M D S p a t i e n t s . T h e i m m u n e e f f e c t o r m e c h a n i s m s i n v o l v e d i n t h e c o m p l e x p h y s i o p a t h o l o g y o f M D S i n c l u d e n o t o n l y m a r r o w a n d c i r c u l a t i n g i m m u n e c e l l c h a n g e s , b u t a l s o d y s r e g u l a t i o n i n t h e i r c y t o k i n e e x p r e s s i o n a n d r e l e a s e . T h e r o l e o f t h e m a i n c h a n g e s i n t h e i m m u n e c e l l c o m p a r t m e n t a n d i n t h e c y t o k i n e p r o f i l e i n M D S , i n c l u d i n g H M D S , i s d i s c u s s e d b e l o w . Immunosuppression with horse antithymocyte globulin (ATG) and cyclosporine A (CyA) is the standard of care for AA patients lacking a low-risk transplant procedure, resulting in a durable overall response rate (ORR) in about 60-70% of patients []. Immunosuppression was first used with some success in HMDS patients and then also applied to normo- or hyper-cellular MDS [,]. Since about half of all deaths in low-risk MDS are related to complications of cytopenia rather than leukemic evolution, immunosuppression in such studies has been widely used in these subtypes of MDS patients [,]. Main studies with current immunosuppressive treatments in MDS patients are summarized in . However, as a complete discussion on the results of the immunosuppresssion in MDS patients is beyond the scope of this article, the reader is referred to others extensive review on this topic [,,]. CyA-based treatment studies have documented that CyA induces, both in hypocellular and normo-/ hyper-cellular MDS patients, fast (cumulative time to response 2 months) and sustained (about 2 years) hematological improvement in about 60% of MDS (cumulative ORR: 62%, range 8-82%) with an estimated overall survival (OS) of 28 months. In addition, CyA allows to achieve transfusion independence in 58% of MDS patients. CyA was generally well tolerated, requiring drug withdrawal in a minority of patients, most of whom due to renal toxicity. However, we and others documented even higher hematological responses in hypocellular MDS [,,]. Various clinical trials have investigated the role of horse (h) or rabbit (r) ATG alone [,,] and in combination with CyA in MDS [,]. Approximately 30% of younger patients with lower risk MDS, expressing the HLA-DR15 allele and showing hypocellular bone marrow, achieved a rapid (time to response about 2.8 months) and prolonged hematological response with an estimated OS of 41 months [,,]. As reported by the largest ATG-based treatment study of National Institutes of Health (NIH) on MDS, combination therapy of ATG with CyA, in comparison to ATG alone, is able both to further improve hematological responses allowing to achieve approximately 44% of ORR and to decrease the relapse rate []. In this and other ATG-based treatment study it has been reported that MDS patients relapsing post-ATG may be again responsive to CyA treatment [,]. In contrast to AA, although the comparative efficacy of hATG versus rATG has not been formally studied in MDS, it seems that there is no significant difference between the two sources of ATG in terms of hematological responses or adverse effects [,]. In addition, both CSA- and ATG-based treatments appeared do not increase progression to acute leukemia. Alemtuzumab is an anti-CD52 monoclonal antibody, which has been successfully used in the treatment of AA patients failing initial immunosuppression with ATG and not eligible for transplant []. Recently, alemtuzumab monotherapy was used in a pilot study of 32 MDS patients, selected on the basis of likely responsiveness to immunosuppression due to younger age, low IPSS score, and the presence of HLA-DR15. A sustained ORR was documented among 77% and 57% of patients with intermediate-1 and intermediate-2 MDS, respectively, with a median time to response of about 3 months. Noteworthy, four of seven patients with karyotypic abnormalities at diagnosis had complete cytogenetic remission, including one patient with monosomy 7 []. In addition, we should mention that the therapeutic TNF-α blockade with anti-TNF-α monoclonal antibodies, soluble TNF-α receptors, and chemical inhibitors of TNF, such as thalidomide, have been disappointing when used as monotherapy []. More recently, combination of thalidomide with CyA [,], as well as of soluble TNF-α receptor etanercept with ATG [,] in MDS patients seems to increase hematological responses in MDS patients. Distinguishing HMDS from AA is clinically relevant since the incidence of progression to acute leukemia is higher in HMDS. Differential diagnosis between these two diseases is still challenging, especially when dysplastic cells are difficult to detect due to marked hypocellularity of specimens and karyotipic abnormalities are not found. Also the more advanced SNP technology do not help to differentiate between these two diseases given that similar molecular abnormalities may be detected both in AA and MDS, including HMDS. The autoimmune pathogenesis of MDS, including HMDS, is multifactorial and still unraveled. Several laboratory and clinical studies have provided evidence that some MDS seem likely to be related to derangement in the complex cross-talk between immunological microenvironment and marrow hematopoietic stem cells, resulting on one side in ineffective hematopoiesis related to immune-mediated apoptosis of normal hematopoietic progenitors, and on the other side in triggering clonal expansion of dysplastic progenitor cells leading to acute leukemia development. Mechanisms of immune damage of hematopoietic progenitors, mediated by increased numbers of CTL, IFN-γ producing CD4 cells and Th17 cells, increased levels of pro-apoptotic cytokines, as well as by decreased numbers of Treg, are predominantly involved in HMDS and low-risk MDS. By contrast, mechanisms developing an immunosuppressive marrow microenvironment favoring MDS clone escape, mainly associated with increased numbers of TregEM, MDSCs and anti-apoptotic cytokines, as well as with NK cell dysfunction, may contribute to high-risk MDS and acute leukemia progression. Clinically, the best evidence for immune-mediated impairment of hematopoietic progenitor cell compartment in MDS patients is the improvement of peripheral cytopenia and survival after CyA- and ATG- based regimens, or alemtuzumab. Although the response to immunosuppression has been documented more often in HMDS patients, it may occurs also in lower-risk MDS patients. Other predictive factors recognized for response to immunosuppression in MDS include mainly younger age, HLA-DR15 expression, shorter duration of red cell transfusion dependence [] and trisomy 8. Based on the mechanisms described above, such better understanding of innate and adaptive immune responses involved in MDS pathophysiology, may pave the way for the development of novel immunotherapeutic approaches. Indeed, therapeutic strategies interfering with immune-mediated apoptosis of hematopoietic progenitor cell compartment in lower risk MDS and with immune-evasion of MDS clone in higher risk MDS, are already under evaluation in phase I/II clinical trials and are available for investigation in MDS patients [,].

PNH is a rare and puzzling hematological disorder clinically characterized by the triad of bone marrow failure, severe thrombophilia and complement-mediated intravascular hemolysis []; the most evident sign of this latter manifestation (namely the hemoglobinuria resulting from intravascular hemolysis) accounts for the picturesque name of the disease. A part from its clinical manifestations, PNH is a unique disease of the hematopoiesis characterized by the expansion of a few (or even one) mutated hematopoietic stem cells (and progeny mature blood cells) carrying the bizarre phenotype of the lack of several proteins from their surface []. All the proteins missing from the PNH cell surface share a unique biochemical feature []; in fact, they are not trans-membrane proteins, rather are linked to the cell membrane via a glycolipidic anchor – the glycosyl phosphatidyl-inositol (GPI)-moiety [,]. In the ‘90s, it has been documented that the reason accounting for this aberrant phenotype is a mutation in the X-linked gene [,], which is necessary for the biosynthesis of the GPI-anchor. PNH is therefore an acquired genetic blood disorder, that cannot be transmitted to the progeny; however, a number of observations supports the concept that the mutation itself is not sufficient to cause PNH as a disease. It has been demonstrated that a few PNH-like cells carrying inactivating mutations may be detected even in normal individuals (without any sign or symptom of PNH) []. On the other hand, the mutation does not reproduce the human disease in murine models; even if mice having a substantial proportion of PNH cells can be generated by using a complex technology (a conditional inactivation of the murine gene implemented using Cre recombinase specifically targeted to the hematopoietic stem cells [], they do not really mimic the disease phenotype seen in humans, because PNH hematopoiesis tends to decrease over time []. This background raised the hypothesis of a dual pathophysiology for PNH (also known as the “relative advantage” [] or “escape” theory []: the mutation is not sufficient to cause the disease, and requires a second, independent event []. According to this view, a mutation in the gene might be a fairly common phenomenon, with no major biological consequences, because in physiological conditions the mutated cell has no reason for expanding in the presence of a vast majority of normal cells. However, additional factors may alter this equilibrium, creating the conditions for the expansion of PNH clone(s); the most likely second event(s) is thought to be an (auto)-immune attack against hematopoiesis, as supported by the well-known clinical overlap between PNH and aplastic anemia (AA, which is in most cases immune-mediated) [], as well as by direct demonstration of immune abnormalities in PNH patients []. It has been recently demonstrated that the GPI-anchor itself could be the target of such autoimmune attack, which would clearly spare PNH cells accounting for their relative expansion over normal hematopoiesis []. This pathogenic mechanisms accounts also for the one of typical manifestation of PNH – the moderate-to-severe bone marrow failure. The complement system is a key component of innate immunity evolved to recognize and to protect the host from both exogenous pathogenic microorganisms as well as injured self tissues. The complement system uses a number of plasma proteins , which may activate in the fluid phase along three distinct functional pathways – classical, alternative or lectin –, all finally merging into the a common final effector mechanism usually playing at a tissue level, the cytolytic membrane attack complex (MAC). Fluid-phase components (such as complement factor I [FI] and factor H [FH]) and membrane-bound proteins (such as complement receptor 1 [CR1], membrane cofactor protein [MCP], CD55 and CD59) have evolved as regulatory mechanisms tuning the complement system in specific conditions; it is now understood that possible derangements of these physiological regulatory mechanisms may lead to specific human diseases [,]. Historically, PNH is maybe the first disease in whom the complement cascade has been demonstrated as the key pathogenic mechanism. As introduced above, among the several proteins lacking on PNH erythrocytes there are the two GPI-linked complement regulators CD55 and CD59. CD55, (also known as Decay Accelerating Factor, DAF; [,] is a 70-kd protein which inhibits the formation and the stability of C3 convertase (both C3bBb and C4b2a, alternative and classical pathways, respectively) []. Historically, CD55 was the first complement regulator found absent on PNH erythrocytes [,,], leading to the hypothesis that its lack could account for the increased susceptibility of PNH erythrocytes to complement mediated lysis. However, further studies demonstrated that factors other than CD55 also were involved, likely acting downstream in the complement cascade [,]. Subsequently, CD59 (or Membrane Inhibitor of Reactive Lysis, MIRL; [,]) was identified as the key complement inhibitor which was found deficient on PNH cells []. CD59 interferes with the terminal effector complement, blocking the incorporation of C9 onto the C5b-C8 complex, thus preventing MAC formation []. The hierarchical contribution of CD55 and CD59 to hemolysis suggests that CD59 is the pivotal molecule which, if absent, results into lysis []. This is also supported by the observation that subject with isolated deficiency of CD55 (the so-called Inab phenotype) usually do not show any clinical or laboratory hemolysis (this may be due to redundant regulatory mechanisms, including CD59 itself) [,], whereas anecdotic cases of inherited CD59 deficiency harbor a clinical phenotype undistinguishable from PNH [,]. The susceptibility of PNH erythrocytes has been initially described by Dr. Ham in his seminal studies started almost a century ago. Dr. Ham demonstrated that erythrocytes from PNH patients lyse in autologous serum upon complement activation by acidification, using a hemolytic assay which take his own name (the Ham test, also known asthe acidified serum assay []). This feature of PNH erythrocytes was subsequently described more in depth by Dr. Rosse and Dr. Dacie, who showed that distinct phenotype of PNH erythrocytes may exist, according to their specific sensitivity to complement-mediated lysis [,]. In fact, in PNH one may find erythrocytes with a dramatic hypersensitivity to complement-mediated lysis (15-25 times the normal one), or just a moderate hypersentivity (3-5 times normal). These phenotypes are referred now as PNH type III and type II, respectively [,], which by flow cytometry correspond to a complete (type III) or partial (type II) deficiency of GPI-APs respectively []. While the susceptibility of PNH erythrocytes has been extensively elucidated, the actual mechanisms leading to complement activation and subsequent hemolysis have not been definitely demonstrated. However, it is conceivable that chronic hemolysis of PNH is due to a continuous steady-state complement activation coming from the low-grade spontaneous C3 , with subsequent continous activation of the complement alternative pathway (CAP) on PNH erythrocyte surface [,]. Infections or inflammatory status usually result in hemolytic crises (the so-called paroxysms), eventually as a result of massive complement activation. At the moment, it is not clear which pathway accounts for complement activation in each of these specific conditions, even if it is conceivable that all the three pathways may co-operate, possibly with some hierarchical dominance of the CAP, which is specifically uncontrolled due to CD55 deficiency, and may amplify any initial complement activation. Eculizumab (h5G1.1-mAb) is a humanized monoclonal antibody (mAb) [] derived from the murine anti-human C5 mAb; it binds to the complement component 5 (C5) and inhibits its further cleavage into C5a and C5b, disabling the progression to the terminal effector complement MAC []. Initial translation plans for eculizumab (Soliris®, Alexion Pharmaceuticals) started in autoimmune diseases; however, given its well-proven complement-mediated pathophysiology, PNH was subsequently identified as the best disorder for investigating this first complement inhibitor in humans. The prediction was that eculizumab in PNH, by preventing MAC assembly, could compensate for the absence of CD59 on PNH erythrocytes, preventing their intravascular lysis upon complement activation. The initial phase II pilot study conducted on eleven heavily transfusion dependent PNH patients showed that eculizumab treatment was safe and well tolerated, and provided the proof-of-principle of effective blockade of intravascular hemolysis, as shown by substantial reduction of LDH level []. Eculizumab was administered intravenously dosed at 600 mg weekly for four weeks (loading phase), followed one week later by 900 mg fortnightly (maintenance phase); all patients were vaccinated against at least two weeks before starting the treatment. The subsequent study was a large double-blind, placebo-controlled, multinational randomized trial which enrolled 86 transfusion-dependent PNH patients []. Treatment with eculizumab resulted in a dramatic reduction of intravascular hemolysis, as measured by LDH, leading to hemoglobin stabilization and transfusion independence in about half of the patients. Control of intravascular hemolysis was found in all patients, and even cases not achieving transfusion independence showed a reduction of their transfusional needs and the disappearance of most clinical symptoms of hemolysis (painful abdominal crises, smooth muscle dystonia, erectile dysfunction). The effects of eculizumab on hemolysis were evident since the initial administration, and lasted for the whole study period. In comparison to placebo, eculizumab also resulted in a significant improvement in fatigue and quality of life, as measured by validated questionnaires. The study also showed that eculizumab treatment was extremely safe, with negligible side effects and incidence of adverse events comparable to that of the placebo. These data were confirmed in another large open-label phase III study SHEPHERD, which enrolled a broader PNH population including patients with moderate marrow failure and minimal transfusion requirement []. Based on the 96 patients enrolled in the study, treatment with eculizumab resulted in a remarkable control of intravascular hemolysis, regardless of the pretreatment transfusion requirement; transfusion independence was achieved in about half of the patients, with significant improvement in fatigue and quality of life in all treated patients []. These two initial studies were continued in a common open-label Extension study, which included a total of 187 patients who have previously completed one of the parent clinical trials []. The Extension study confirmed the efficacy and the safety of eculizumab with a longer follow up, demonstating that the effects of eculizumab treatment on intravascular hemolysis were retained over time, and long-term safety remained excellent. The Extension study also looked to additional clinically relevant endpoint, such as the incidence of thromboembolicevents. By comparing the rate of thrombosis between the pretreatment and treatment periods in the same patients, the Extension study showed a 85% reduction of the incidence of thrombosis in comparison to the pre-treatment period []. Whether eculizumab exerts its effect on thrombophilia of PNH directly (the pathophysiologyof thrombosis in PNH is still debated), or through the blockade of intravascular hemolysis (e.g., by reduction of nitric oxyde consumption or reduced release of procoagulant microvesicles), is still unknown. However, the effects of eculizumab on thrombophilia of PNH seem quite specific, given that distinct biomarkers of coagulation pathway activation, reactive fibrinolysis and endothelial cell activation decrease during eculizumab treatment []. Sustained safety and efficacy of eculizumab was confirmed again in a recent report which ruled out the risk of cumulative toxicity []. Given that nowadays the median survival of PNH patients not receiving specific treatment is estimated in 22 years, it is not yet time for a robust analysis assessing the effect of eculizumab on survival. However recent data in a limited cohort of patients provid evidence that continuous eculizumab treatment may result in an improvement of survival of PNH patients [], at least as compared to historical data []. The availability of eculizumab represented a remarkable breakthrough in PNH therapy, which has dramatically impacted the natural history of the disease. Rarely in medicine a single agent has changed so quickly and so effectively the treatment of a disease, especially of such a rare disease; however, as always in medicine, there are still clinical needs which remain unmet in PNH regardless of eculizumab. In fact, even if eculizumab results in an adequate control of intravascular hemolysis in most (if not all) PNH patients for whom anti-hemolytic treatment is indicated (eculizumab is not indicated in PNH patients with bone marrow failure, where anemia is mostly due to impaired red cell production rather than to hemolysis), the majority of patients continue to harbor mild-to-moderate anemia. Eculizumab also represented a unique opportunity for a better understanding of PNH pathophysiology in absence and in presence of clinical anti-complement (anti-C5) inhibition, allowing the dissection of the pathogenic contribution of the different phases of complement cascade which remain uncontrolled in PNH. We have demonstrated that additional mechanisms of disease may account for residual anemia seen in PNH patients during eculizumab treatment. Indeed, PNH erythrocytes survive to complement activation because of the sustained inhibition of the terminal effector complement – C5 cleavage and subsequent MAC assembly; however, they may progressively become decorated on their surface by C3 fragments, which may eventually work as opsonins with subsequent entrapment of C3-bound PNH erythrocytes in the hepatosplenic macrophages. We have documented the phenomenon of C3 deposition by flow cytometry in all of our initial 41 PNH patients on eculizumab, whereas 15 untreated PNH patients do not show any C3+ erythrocyte []. The proportion of C3+ PNH erythrocytes is heterogeneous among patients, and in some way may correlate with the hematologic response during eculizumab treatment, as subsequently confirmed by another group []. In fact, we have also observed that most PNH patients on eculizumab remain anemic, regardless of an adequate control of intravascular hemolysis (as shown by normal or almost normal LDH levels), and all of them continue to have substantial reticulocytosis []. Thus, we came to the conclusion that eculizumab treatment may result in a complete control of the intravascular hemolysis typical of PNH, but in some patients may unmask a novel mechanism of disease, which is C3-mediated extravascular hemolysis. This working hypothesis was supported by the observation that these patients also have persistent reticulocytosis, hyperbilirubinemia and anemia, and it was definitely confirmed by an erythrocyte survival study by Cr labeling, which in paradigmatic cases showed reduced survival and hepatosplenic Cr uptake []. The observation of clinically remarkable C3-mediated extravascular hemolysis in PNH patients on eculizumab was for sure disappointing, but it is not necessarily detrimental to eculizumab. The reasons underlying this phenomenon are not related to eculizumab itself, rather they are linked to the absence of CD55 on PNH erythrocytes, accounting for persistent uncontrolled C3 convertase activation even regardless of the terminal complement inhibitor eculizumab (which acts downstream in the complement cascade). Indeed, it is only when eculizumab prevents MAC-mediated intravascular hemolysis that PNH erythrocytes survive longer enough to become susceptible to C3-fragment opsonization, and possible subsequent hemolysis through the C3-specific receptors expressed on reticuloendothelial cells (because even massive C3 activation does not lead to MAC assembly and lysis) [,]. It is not entirely clear why this mechanism of disease remains subclinical in some patients (who only have minimal residual anemia and persistent reticulocytosis) and led to a remarkable anemia in other cases; preliminary data suggest that genetic heterogeneity in other physiological modulators of complement activity (e.g., CR1) may account for higher risk of residual anemia during eculizumab treatment []. Nevertheless, it is conceivable that continuous uncontrolled complement activation through the alternative pathway is the ultimate cause of this phenomenon. In fact, CAP is physiologically in a state of continuous activation because of the C3 tick-over (a low-grade, spontaneous hydrolysis of the internal thioester bond of C3) generating a C3b-like molecule, C3(HO); nascent C3(HO) is able to recruit factor B in forming (in the fluid phase) an unstable pro-C3 convertase. Once cleaved by factor D (generating C3(HO)Bb), this complex will in turn cleave additional C3 molecules to generate C3b, which binds predominantly to glycophorin A and activates (now in a membrane-bound phase on erythrocytes) the CAP amplification loop [,,]. As stated above, this process is finely regulated by CD55, which is absent on PNH erythrocytes; thus, early complement activation is self-limiting on normal cells, but it eventually leads to progressive CAP-mediated amplification on PNH erythrocytes, regardless of the presence of eculizumab (which acts downstream C3). The reasons why only a fraction of PNH erythrocytes has membrane-bound C3, and why the proportion varies among patients, are not fully understood, even if data support the concept that PNH erythrocytes are all susceptible to C3 deposition once exposed to conditions causing complement activation []. Our current understanding is that each individual erythrocyte has to reach a specific threshold needed to start CAP activation, and that only a small fraction of erythrocytes is exposed to such a threshold, possibly as a result of specific microenvironmental conditions generating in particular vascular districts (this may open a possible similarity with the site-specific risk of thrombotic events), or simply stochastically. However, even assuming as well-established the mechanism leading to C3 decoration on PNH erythrocytes, their subsequent clearance through the reticuloendothelial system remains to be elucidated. In fact, it is not clear why some patients do not show clinically relevant extravascular hemolysis regardless of a large proportion of C3-bound PNH erythrocytes []. Neverthless, residual anemia during eculizumab treatment is an emerging clinical need in PNH, which so far has no adequate treatment option. In fact, steroids are not useful and should be avoided [], and splenectomy may represent an option [], but it is not routinely recommended given its considerable medical risks, such as intra- or peri-operatory thrombotic complications and life-long infectious events []. Furthermore, long-lasting continuous extravascular hemolysis might lead to additional long-term complications such as gallstone formation or iron overload [], possibly requiring further medical intervention. The observation that early phases of the complement cascade, and in particular C3 activation, represent a common biological event possibly resulting in clinical consequences remarks the need of novel strategies of complement modulation. Thus, investigators have started to think about alternative strategies to target early events of the complement cascade, possibly directly at the initial C3 activation (). Neverthless, it has to be acknowledged that a broad C3 inhibition would carry substantial safety concerns, given that inherited C3 deficiency is associated with a remarkable risk of developing both severe infectioins and autoimmune diseases []. Ideally, one would like delivering a complete inhibition of the complement activation occurring on erythrocyte surface due to the lack of the complement inhibitors CD55 and CD59, possibly retaining at least part of the physiological role of the complement in the clearance of microorganisms and injured tissues. In keeping with the terrific clinical results of the anti-C5, different anti-C3 mAb have been initially considered, aiming to bind native C3 in the fluid phase preventing its activation along all the three pathways; however, this approach was abandoned because of the high plasmatic concentration of C3, which makes this approach quite problematic and expensive. In additional, it would carry several concerns because of the risk of possible infectious and autoimmune complications secondary to a complete disabling of the complement cascade. Another antibody-based anti-C3 strategy was developed, aiming to target activated C3 (C3b/iC3b) rather than the native C3 in the fluid phase. Indeed, the anti-C3b/iC3b murine mAb 3E7 and its chimeric-deimmunized derivative H17 were shown to selectively inhibit the activity of C3 and C5 convertases of the CAP only, providing the opportunity for a selective inhibition of different complement pathway []. These antibodies were tested on PNH erythrocytes, and were shown effective in preventing complement-mediated hemolysis of CD55/CD59 deficient erythrocytes []. This finding was elegant and conceptually innovative, but likely still far from a clinical translation, because given that in PNH C3 and C5 convertases localized on erythrocyte surface, these antibodies would finally work as additional opsonins which should even increase PNH erythrocyte clearance by the reticuloendothelial cells, through both the C3- and Fc-specific macrophage receptors. Indeed, before being tested in the clinic these antibodies should be modified by removing their Fc moiety; however, according to available information, such engineered anti-C3 mAb (or Fab fragments) are not available yet. More recently, we and others have developed a novel strategy of complement inhibition, which aims to deliver a selective (for the CAP) and targeted (on PNH erythrocytes) inhibition of early phases (C3 activation) of the complement cascade, while retaining intact the functioning of the other two complement pathways. This strategy is based on the use of an anti-complement activity deriving from the endogenous complement FH, modified by recombinant DNA technologies. FH is a physiological complement inhibitor that modulates the initial CAP activation in the fluid phase by preventing C3 convertase activity and by promoting C3b inactivation into iC3b []. Indeed, FH defuses the CAP amplification loop (which starts regardless the initial pathway of complement activation), and it has been demonstrated protective from lysis for PNH erythrocytes []. At least two different FH-derived agents have been developed. The first one has been designed by creating a recombinant fusion protein between complement FH and another complement-related protein, complement receptor 2 (CR2). In the aim to deliver FH activity locally at the site of complement activation, FH was fused with the iC3b/C3d-binding domain of CR2. Using C3 fragments as target seem quite appropriate given our observation that complement activation in PNH starts with surface C3-deposition, eventually leading to intravascular hemolysis or, in presence of eculizumab, to possible extravascular hemolysis. This novel compound named TT30 was recently investigated by our group in an model based on exposure of PNH erythrocytes to CAP-activated serum. We have demonstrated that TT30 completely inhibits complement-mediated hemolysis of PNH erythrocytes; in addition, it effectively prevents initial C3 activation and further C3 deposition on PNH erythrocytes []. We were able to demonstrate the presence of TT30 on PNH erythrocyte surface, as well as the reversion of the protective effect if anti-CR2 antibodies are added, consistent with the initial assumption that TT30 mainly work at the surface level, and cell membrane targeting is required for full inhibitory effect. Mechanistically, as a FH derivative, TT30 is able to act as a cofactor for FI to convert nascent C3b into iC3b, thus generating more of its own target and disabling the CAP amplification loop. At the same time, TT30 serves a CD55 surrogate on PNH erythrocytes, preventing the formation and promoting the decay of the CAP C3 convertase by displacing factor B and factor Bb, respectively, from the C3b-bound state. These data support the concept that TT30 could be useful to prevent both intravascular and extravascular hemolysis of PNH erythrocytes. Based on this robust background, a phase I clinical trial has just started to enroll PNH patients in a study []. This initial trial will also be useful to rule our possible concerns about this more intensive strategy of complement inhibition: the hope is that physiological immune-complex clearance and microorganism elimination may be preserved because of the CAP-selective and membrane-preferential action of TT30. If this anticipation will be confirmed, one may hypothesize that TT30 will be extensively investigated in PNH, given that based on the data it is very likely that the anti-hemolytic action on PNH erythrocytes should be extremely effective. The second FH-derived recombinant protein follows the same idea of TT30, thus aiming to maximize FH activity at the sites of complement activation. Here the surface-recognition domain does not come from a different protein (e.g., CR2); rather, the FH domains SCR19-20 (which have a strong affinity for the opsonins C3b, iC3b and C3d) are utilized, in a recombinant protein which is called “mini-FH”. Mini-FH is an engineered 43kDa protein that retains both convertase decay acceleration and cofactor activities typical of endogenous human FH, combined with an increased surface-recognition activities, resulting in a potent and selective inhibition of activation and amplification of the complement alternative pathway, without affecting the classical and the mannose/lectin pathway. This compound too was investigated by our group : mini-FH showed a dose-dependent inhibition of hemolysis, with an IC of 0.05 µM and full inhibition at 0.1 µM. Mini-FH also prevented surface deposition of C3 fragments on PNH erythrocytes. on exposure of PNH erythrocytes to CAP-activated serum. Notably, mini-FH was far more potent of TT30, with full inhibition achieved at concentrations about 1 log lower than TT30 []. Thus, the spectrum of complement inhibitors moved from monoclonal antibodies to recombinant proteins, which yet may carry elevated production costs (that hopefully will not lead to treatment cose as outrageous as that of eculizumab). However, C3-targeted complement inhibition also include strategies based on small peptide inhibitors, which potentially are more easy and more cheap to develop. Compstatin is a 13-residue disulphide-bridged peptide that selectively binds to C3 and its active fragment C3b []. Compstatin prevents the conversion of C3 to C3b and thus it impairs all initiation, amplification, and terminal pathways of the complement cascade []. As a result, compstatin and its derivatives are considered highly promising candidate drugs for treating different complement-mediated diseases []. We have recently investigated the effects of different compstatin analogs; preliminary data showed that, similarly to FH-based proteins, compstatin analogs inhibit complement activation on PNH erytrocytes preventing both hemolysis and C3-deposition on their surface []. Further preclinical investigations are currently ongoing to collect all the information needed to support translational plans for this class of agents in human diseases, including PNH. The list of candidate agents for novel complement therapeutics might be even longer, if one wish to include inhibitors of complement FB or FD, or of properdin, as well as other recombinant proteins able to tune complement activity (e.g., recombinant complement FI). As for C3 inhibitors, all these candidate agents share the concept that targeting early events in the complement cascade may be a worthy option, especially in medical conditions where the terminal complement blockade by eculizumab may result in pharmacological leaks that leads to clinical consequences. Of course the second generation complement inhibitors will require careful initial clinical investigations to assess whether such a more profound or broader complement inhibition will replicate the excellent safety profile seen with eculizumab. In fact, it will be only when all concerns about increased infectious and autoimmune risks will have been ruled out that the efficacy of this promising strategies could be extensively studied in PNH and other complement-mediated human diseases. e r a p e u t i c c o m p l e m e n t i n h i b i t i o n h a s l e d t o r e m a r k a b l e c l i n i c a l r e s u l t s i n P N H i n t h e l a s t d e c a d e . A s l o n g a s t i m e p a s s e s , t h a t t h e l e s s o n f r o m P N H b e c o m e s m o r e c l e a r : t h e c u r r e n t a n t i - C 5 a g e n t e c u l i z u m a b i s s a f e a n d e f f e c t i v e , b u t r e s i d u a l c o m p l e m e n t a c t i v i t y r e s u l t i n g f r o m u p s t r e a m c o m p l e m e n t c o m p o n e n t s m a y a c c o u n t f o r s u b o p t i m a l c l i n i c a l r e s u l t s . C o m p l e m e n t i n h i b i t i o n t a r g e t i n g t h e C 3 i s a n e m e r g i n g o p t i o n t o d e v e l o p n o v e l c o m p l e m e n t t h e r a p e u t i c s , a n d h o p e f u l l y w i l l b e u s e f u l t o h a n d l e c u r r e n t u n m e t c l i n i c a l n e e d s i n P N H . D i f f e r e n t s t r a t e g i e s a r e c u r r e n t l y u n d e r d e v e l o p m e n t , a n d a n u m e b e r o f c a n d i d a t e a g e n t s a r e i n p r e c l i n i c a l o r e v e n c l i n i c a l s t u d i e s ; t h e w i n n e r w i l l r e s u l t n o t o n l y f r o m o b j e c t i v e d a t a , b u t a l s o o n t h e e f f o r t s p u t b y t h e i n v e s t i g a t o r s a n d o n t h e i n v e s t m e n t s p u t b y t h e c o m p a n i e s ( t r e a t m e n t c o s t r e m a i n s a r e m a r k a b l e i s s u e i n a l l C o u n t r i e s ) . A n o v e l e r a f o r c o m p l e m e n t m o d u l a t i o n h a s j u s t s t a r t e d ; t h e c h a l l e n g e i s t o e s t a b l i s h t a r g e t e d a n d s p e c i f i c t r e a t m e n t f o r P N H a n d o t h e r c o m p l e m e n t - m e d i a t e d d i s e a s e s .

xref italic #text the discovery of mutations in the Janus kinase 2 (JAK2) signalling pathway opened a new perspective in the pathophysiology and treatment of MF []. The frequency of JAK2V617F mutation ranges between 43-59% in MF. The most commonly detected mutation results in a guanine to thymine change at nucleotide 1849 []. JAK2 is a member of JAK family (JAK1, JAK3 and TYK2) proteins which are cytoplasmic non-receptor tyrosine kinases with a significant function in cell proliferation and survival of hematopoietic stem cells (HSC). The JAK2V617F mutation is essential for self-reprogramming properties of HSC and it has been associated with some phenotypes of MF. Experiences in transgenic mice showed that, a low level of JAK2V617F load can induce essential thrombocytosis (ET)-type features, while the higher levels of mutant alleles can cause polycythemia vera (PV) and MF-like phenotypes []. However, the presence of this mutation cannot consolidate all other MF related findings including cytopenia and the tendency of MF to transform to acute myeloid leukemia (AML) which is observed in 5-10% of patients with MF []. Determination of the molecular basis for the constitutive activation of JAK2V617F is crucial for understanding its clinical implication. It has been elucidated that the position at amino acid 617 it is important for protein-protein interaction. Mutations at position 617 induce autophosphorylation, gene transcription and in vitro kinase activity of JAK2 []. Recently, it was reported that activation of JAK2 can promoting the activation of three homodimeric myeloid receptors like EPO-receptor, MPL (TPO-receptor), and GM-CSF ()[]. Beside its role in mediating the signalling pathways of EPO and MPL, JAK2 signal can induce the over-expression of several oncogenes like LIM domain only 2 (LMO2) by an epigenetic regulation. JAK2 signal can re-model the chromatin structure by phosphorylating the histone H3Y41 and consequently blocking the recruitment of the repressor heterochromatin 1α leading to over-expression of LMO2 []. a gain-of-function mutation in exon 12 is detected in a small proportion (3-5%) of wild type (WT) MF patients. Murine studies have shown that mutations in this exon impacts erythrocyte proliferation []. New alterations (deletions, insertions, substitutions) were found in positions 537 through 543. However, it is still unclear how these mutations can alter the function of []. It has been elucidated that exon 12 links to SRC homology 2 (SH2) and JH2 domains of . Compared to mutation, molecular alterations in exon 12 produce higher ligand-independent signaling and phosphorylation through JAK2 []. In humans, these mutations are associated with younger age, lower level of erythropoietin, and lower predominance of erythroid myeloproliferation []. Patients with polycythemia vera (PV) harboring mutations in exon 12 seem to be predisposed to transformation to MF. the absence of V617F in some MF patients suggests the presence of alternative mechanism(s) that can activate the JAK/STAT pathway ()[]. W515L/K can be detected in 5-10% in MF patients and appears to be a gain-of-function mutation []. The gene encodes a 635 amino acid protein called CD110. CD110 has 4 functional domains including a putative signal peptide, an extracellular domain, a transmembrane domain, and an intracellular domain []. The ligand, thrombopoietin (TPO) can lead to dimerization of CD110 and subsequent downstream activation of the JAK-STAT pathway. The CD110-TPO is important in renewal of HSC and in the development and proliferation of megakaryocytes and platelets []. The relationship between W515L/K and the pathogenesis of MF are based on several important disease observations: 1) W515L/K are found in the amphipathic KWQFP motif of CD110 which is important in preventing spontaneous activation of CD110, 2) Nude mice injected with -transduced Ba/F3 cells developed subcutaneous tumors and splenomegaly [], and 3) BM transplantation assays conducted by injecting murine cells with W515L mutation led to features of ET and tendency of rapid evolution to MF []. is a tumor suppressor gene located in a small region (0.35 Mb) of chromosome 4 (4q24). Mutations of this gene are frequently detected in various myeloid malignancies. In MPN, has a frequency of 15-25% in PMF, 15-20% in post-PV MF, 10-15% in post-ET MF and 20-25% in MF that have progressed to AML []. This molecular mutation can occur in conjunction with V617F mutation leading to a bi-clonal model or can precede the mutational event during disease formation []. mutations can lead to truncated proteins resulting in a total or partial loss-of-function. It has been postulated that molecular alterations in this gene may have been one of the first events in early hematopoiesis []. In addition, the epigenetic role of has been studied []. catalyzes the conversion of the 5-methylcytosine (5-MC) to 5-hydroxymethylcytosine (5-hMC) by oxidizing 5-MC. In patients carrying mutations the level of 5-hMC is lower than WT with variability across diseases (lower in myelodysplastic syndromes (MDS) and higher in AML)[]. In human hematopoiesis, knock-down of resulted in increased monocytes differentiation and decreased erythroid proliferation []. In a study conducted in our laboratory, mutations were not present in WT MF patients in comparison to mutant counterpart []. This observation was also reported by other investigators ()[]. is a polycomb gene required for long-term repression of the HOX genes. Genetically, in Drosophila, gene behaves like an inducer of the trithorax complex. In general, polycomb genes are important in the manifestation of the bidirectional homeotic phenotypes suggesting their roles in the activation and silencing of genes []. is a potential epigenetic modifier, and mutations of this gene cam cause the loss of polycomb repressive complex 2 (PRC2)-mediated histone H3 lysine 27 (H3K27) tri-methylation which results in the transcriptional repression in hematopoietic cells []. Loss of can lead to the depletion of PRC2 and H3K27 involvement in myeloid leukemic cells which can cause the perturbation of polycomb-mediated gene silencing. It was elucidated that dysregulation of this interaction can make the cells prone to leukemia transformation []. In addition, it has been shown to down-regulate the retinoic acid receptor signaling which can alter the transcription of particular genes []. The frequency of mutations in MF is about 15-20% albeit, in overlap syndromes particularly in chronic myelomonocytic leukemia (CMML) half of the patients acquire those mutations []. It was reported that mutations are usually mutually exclusive with V617F even though in one study mutations were noted in conjunction with V617F or mutations rather than []. mutations are usually seen in exon 12 and are missense, frame-shifts, and duplications in the case of the controversial variant (p.Gly646TrpfsX12)[]. gene is located in the long arm of chromosome 11 (11q23.3) and encodes for a cytosolic protein with dual functionality; 1) down regulates tyrosine kinase signaling trigged by E3 ubiquitin ligase which leads to internalization and lysosomal/ proteosomal degradation and 2) modulation of downstream signaling of and []. In cell culture studies, a mutation induces oncogenic phenotype and proliferation with activating the RAS-pathway in the absence of growth factor stimulation []. knockout mice manifested splenomegaly, HSC proliferation, and sensitivity to growth factors []. The mutations of this gene were first described in AML as MLL-CBL fusion (MLL, exon 6 and CBL, exon 8) resulted in induction of the signaling. has been considered a tumor suppressor gene. The frequency of mutant is about 15-20% and 3-6% in CMML and PMF, respectively []. The mutations are mainly missense or in-frame deletions and usually coexist with , , and mutations []. However, some studies have shown that at the time of disease progression, mutations can occur after V617F mutation suggesting that two different cell lineages harbor these mutations []. are homodimeric NADP dependent enzymes involved in the conversion of isocitrate to α-ketoglutarate by oxidative decarboxylation prior to NADPH synthesis []. Heterozygous mutations of these genes were first described in gliomas and secondary glioblastomas and then in AML []. Mutations in can lead to an increase in NADPH-dependent reaction of α-ketoglutarate resulting in over production of α-hydroxyglutarate which is a potential toxic substance and conversely have a negative effect on the function of the TET2 protein ()[]. mutations usually involve the amino acid R132 and R172, respectively. The frequency of mutation is about 3-5%, 1-2%, and 10-20% in PMF, post-PV/ET MF and in MF cases evolving to AML []. Furthermore, mutations in these genes are usually observed to be mutually exclusive from mutations of , , and []. In addition, in gliomas the presence of mutations correlated to treatment response to chemotherapy. A study conducted in MPN has correlated the presence of a panel of molecular mutations including with a failure to response to treatment with PEG-interferon-α []. Ultimately, mutations have been associated with transformation to AML even though it is not clear at this time where it falls in the hierarchy of mutational events in clonal evolution []. the heterozygous mutations were initially described in AML and MDS with a frequency of 5-22% []. However, in MF its frequency is lower (5 -12%)[]. This gene encodes a DNA methyltransferase that is essential in methylation. Acquisition of mutations can cause loss-of-function resulting in homo-dimerization and activation of the protein, reduction of the activity of methyltransferase, and consequent increased cell proliferation []. This gene can play a significant role in progression of MPN to AML in the presence of and mutations. It has been showed that the time of mutational event acquisition reflects the disease course []. In order to further dissect the role of this gene in MPN, a study described the isolation of different cellular lineages and the successive assessment of the cell type harboring high frequency of mutations. Mutations were identified with high frequency in CD14 (monocytes) enriched fraction and with low frequency in CD3 and CD19 (T and B lymphocytes, respectively) suggesting that the aberrant clone does not occur in lymphoid lineages []. Indeed, mutations are associated with over expression of other relevant genes in advanced myeloid malignancies []. the lymphocyte ( or ) adaptor protein is a member of the SH2B family and plays an important role in hematopoiesis and cytokine regulation. The protein encoded by this gene is a plasma adaptor component which binds to and inhibits the JAK/STAT signal transduction pathway []. In addition, negatively regulates the EPO receptor and signaling resulting in the inhibition of the JAK-STAT pathway []. In V617F mutant patients, expression may increase which contributes to the developing of myeloproliferative phenotype []. -deficient mice showed a phenotype similar to MPN patients like splenomegaly, thrombocytosis, leukocytosis, abnormal megakaryocytes, and BM fibrosis []. The prevalence of mutations is low (<5%) in MPN; however it is slightly higher (10-13%) in leukemic transformation of MF patients []. Concomitant mutations in V617F and were associated with disease evolution []. In another study, LNK deficiency in mice increased cytokine independent- JAK-STAT signaling and also cooperates with activation in the development of a MPN like phenotype []. : this gene is located in chromosome 7 (7q36.1) and belongs to the complex 2 of Polycomb, a mediator of transcriptional silencing and a regulator of multiple cellular process like proliferation, maturation, aging and hematopoietic cell plasticity []. over-expression is noted in a variety of solid tumors like prostate and breast cancer and it has been reported to contribute to tumor aggressiveness and poor cellular differentiation []. mutations appear to be a gain-of-function genetic change acting as a repressor by methylating the histone H3 on lysine 27 (H3K27) and consequently inactivating the chromatin []. The frequency of mutations is approximately 12% in MF; however, mutations are not exclusively found in MPN since they are more frequent in MDS (2-6%) and MDS/MPN (~15%). Clinically, mutations have been associated with poor prognosis []. the recurrent mutations in genes encoding for different members of the RNA spliceosome machinery (, , and ) have been reported in myeloid malignancies in relatively high frequency (MDS with ring sideroblast ~86%, MDS without ring sideroblast ~44%, and in CMML ~55%)[]. All of the previously identified spliceosome genes are involved in the 3´-splice site recognition of a premature RNA. The U2 small nuclear RNA auxiliary factor 1 (, establishes a substantial interaction with the serine/ argentine domain of another splicing factor called resulting in the exposure of the 3´-splice site and adjacent polypyrimidine tract. This synergism provides the possibility of actively recruiting also in the formation of the splicing A complex and in the formation of a mature RNA (). Molecular alterations in these genes can cause defect in splicing of downstream targets. and have been associated with leukemogenesis []. The role of in genomic stability has also been studied. Indeed, perturbation of the function of this gene resulted in double-strand DNA breaks []. mutations have been associated with good clinical outcomes and ring sideroblast formation in MDS [,]. We reported the presence of an mutation (K700E) in a patient with MF whose BM erythroid precursors also showed occasional ring sideroblast further supporting the role of mutation on the pathogenesis of ring sideroblast formation even in non-MDS myeloid neoplasms []. The clinical relevance of remains unclear due to the low frequency (3.1%) of mutations in MDS []. In our laboratory we have been actively working in defining the frequency of the three most prevalent spliceosome genes in MDS (, , ) in a cohort of 130 patients with MF, finding a frequency of (2%), (8%), and (17%)(Unpublished data). summarizes the frequency of all the genes discussed above. MF usually affects patients with advanced age (>65 years old) and usually experience constitutional symptoms (90%), splenomegaly (90%), fatigue (70%), anemia (60%), circulating blasts (50%), thrombocytopenia (30%), pulmonary hypertension (30-40%) and higher risk of thrombosis (10%)[]. - There are many proposed mechanisms on the cause of anemia in MF patients and includes decrease bone marrow production due to decreased hematopoietic production sites in the BM due to fibrosis, splenic sequestration and consequent destruction of red cells in spleen, bleeding and autoimmune hemolysis. Yet, no distinctive molecular mutation has been proven to be the causative factor in the development of anemia in MF. Various studies that have looked at the clinical phenotypes of patients with MF with various molecular mutations have shown some some correlation between specific molecular subtypes and anemia. For example, patients with and mutations have lower Hgb levels [,]. Conversely, observations from our laboratory showed that mutant patients who also harbor spliceosome mutations have lower Hgb levels (8.98 vs 10.5 g/dL) and slightly higher leukocyte counts (27.5 vs 20.5 x10/L) compared to WT cases without spliceosome mutations (Unpublished data). Leukocytosis and thrombocytosis are other hematologic features of MF patients, the higher allele burden of V617F mutation has been associated with leukocytosis, reticulocytosis and splenomegaly while [] mutations has been associated with thrombocytosis []. Splenomegaly is the most common type of extramedullary hematopoiesis (EMH) in MF; however the definitive mechanisms involved in the development of splenomegaly remains elusive. The prevailing hypothesis for the development of splenomegaly includes cytokine stimulation of the spleen, deposition of BM erythroid precursors in the spleen and extramedullary hematopoietic compensation to sustain blood production. Little is known regarding the effects of molecular mutations in the causation of splenomegaly. Among various molecular mutations, patients with MF who carry V617F and mutations have enlarged spleens although the mechanisms whereby these mutations lead to EMH remain unclear []. - In MF, BM fibrosis is one of the important disease features and represents one of the major criteria for diagnosis. Fibrotic deposition can be detected using reticulin and/ or trichrome stains. It was alluded that fibrosis is the result of a reactive process of normal fibroblasts stimulated by aberrant cytokine activation resulting in the deposition of BM stromal fibers. Cytokines like transforming growth factor beta (TGF-β), platelet derived growth factor (PDGF,) and fibroblast growth factor (FGF) have been linked to the formation of fibrosis in BM []. Disruption of function can cause over-activation of the thrombopoietin-receptor, that can over-stimulate megakaryocytes to release several cytokines that can then contributes to fibrosis []. A number of molecular mutations and genetic modifiers like single nucleotide polymorphisms have been described in MPN with some associated with poor prognosis and leukemia transformation []. For instance, it has been shown that the presence of the A3669G polymorphism in an MF patient with V617F mutation is associated with shorter overall survival and blast transformation free survival []. It has also been suggested that low V617F allele burden is associated with pancytopenia and higher susceptibility to infections which can result in lower overall survival []. Additionally, presence of mutations in molecular markers like or can independently predict shorter overall survival []. Some of these mutations (eg, and ) have also been associated with inferior leukemia-free survival []. Despite the high frequency of V617F and mutations in MF, both genetic changes do not appear to affect survival outcomes [,]. Conversely, MPL mutations are not associated with inferior outcomes. The existence of mutations in MDS was associated with poor overall survival and complex cytogenetic abnormalities. However, the same finding has not been established in MF []. In our studies, the presence of mutations contributed to a significant increase in the percentage of BM blasts and a higher incidence of progression to AML in MF patients (Unpublished data). The presence of molecular mutations can alter the response to therapies in MDS, MDS/MPN, and secondary AML []. It was suggested that the presence of mutations could have negative impact on response to inhibitors []. However, in other myeloid malignancies like MDS and AML, patients carrying and mutations responded better to therapies specifically hypomethylating (HMA) agents []. In MF, the presence of V617F mutation has been shown to be a predictor of better response to lenalidomide []. #text

In 1869, Nettleship and Tay described the first case of a “rare form of urticaria that result in a brownish discoloration” []. In 1878 Paul Ehrlich first described the mast cells “metachromasia”, along with the tendency for mast cells to be associated with blood vessels, glandular ducts, and nerves. Further in 1949, Ellis detailed an autopsy report of a 1-year-old child where mast cell infiltration was found in numerous organs (bone marrow, lymph nodes, spleen and liver) []. In 1957 mast cell leukemia was reported for the first time. In 1991 Metcalfe proposed the first classification of mastocytosis. In 2001 a WHO () classification was published (). The current WHO classification discriminates cutaneous mastocytosis (CM) and systemic mastocytosis (SM) []. The CM is a benign disease confined to the skin, while SM is a clonal hematological disease and is classified in indolent (ISM), aggressive (ASM) and SM with an associated clonal hematologic non-mast cell lineage disease (SM-AHNMD). Mast cells are an important effectors cells of the immune system and are found in all vascularized tissue, especially in the skin and mucous membranes of the respiratory and gastrointestinal tracts. These cells release a variety of inflammatory mediators whose biological effects lead the heterogeneous symptoms in patients with mastocytosis. Mast cells derive from CD34+ hematopoietic stem cells of the bone marrow and differentiate into mast cell precursors that are distributed via blood to tissues. Growth, differentiation and proliferation of mast cells are controlled by the tyrosine kinase receptor (CD117) and its ligand stem cell factor (SCF), also of key importance in the development of mastocytosis. Mast cells can be identified by cell surface markers FcεR1, CD13, CD34, CD68, and KIT (CD117) []. A wide array of proinflammatory mediators is secreted by mast cells after IgE-receptor cross-linking by allergens or other stimuli. The preformed vasoactive and immunoregolatory mediators, contained within mast cells granules, include histamine, heparine, serotonin, neutral proteases (tryptase, chymase, carboxypeptidase A, cathepsin G), major basic protein and phospholipases. Tryptase and chymase are the most abundant protein components of mast cell granules. After cell activation, mast cells are also able to synthesize protein and lipid mediators, including lipoxigenase and cyclooxygenase metabolites of arachidonic acid. These include leukotrienes (mainly LTC), prostaglandins (mainly PGD) and platelet-activating factor (PAF). Mast cells also produce cytokines, growth factors including IL-5, IL-6, IL-13, IL-16, SCF, GMCSF, NGF, VEGF and various chemokines and possess numerous membrane-bound receptors []. In the bone marrow mast cells have four distinct morphological stages of maturation: the non-granulated blast cell (tryptase+), the matachromatic blast cell, the promastocyte (also called atypical mast cell type II), and the mature mast cell []. The stages of differentiation are of particular interest in that immature forms of mast cells are often seen in the more severe forms of systemic mastocytosis. Mastocytosis is a rare disease. In various studies an incidence of 5 to 10 new cases per one million population per year was calculated. The prevalence (evaluated by epidemiologic study conducted in Europe and in United States) is 1/60.000. The most frequent variants are cutaneous and indolent systemic mastocytosis, the rarest is probably mast cell leukemia. While children almost exclusively have cutaneous mastocytosis forms, in adults urticaria pigmentosa and indolent systemic mastocytosis, is much more likely. In adults mastocytosis often manifests between age 20 and 40 years, sometimes even later. On the other hand, as signs and symptoms of mastocytosis are unspecific and overlap with many other diseases, the correct diagnosis may be overlooked and there is an unusually long latency period between the first symptoms and the correct diagnosis. The clonal nature of mastocytosis can be established through the demonstration of gain-of-function mutations involving the tyrosin kinase domain of receptor in skin and/or bone marrow cells. KIT (CD117) is a type III tyrosine kinase (TK) receptor that is characterized by an extracellular domain with five immunoglobulin-like loops, a transmembrane domain, an juxtamembrane autoinhibitory domain and a TK domain. The first three immunoglobulin (Ig)-like loops of the extracellular domain form the binding site for stem cell factor (SCF) or KIT ligand, while the fourth and fifth loops play a role in stabilizing the SCF-induced KIT dimer. The autoinhibitory juxtamembrane domain is essential for the downregulation of tyrosine phosporylation. The kinase portion of KIT is composed of two domains which are separated by a kinase insert: the TK1 domain is constituted by the small N-terminal lobe that expands from amino acids 582–684 and contains the ATP binding site, and the TK2 domain is formed by the large C-terminal lobe containing the phosphotransferase site and the activation loop (amino acids: 810–839). The interaction between KIT and its ligand, SCF, plays a key role in regulating mast cell proliferation, maturation, adhesion, chemotaxis, and survival. In over 90 % of adults with mastocytosis the somatic activating point mutation on exon 17 at codon 816 (substitution of aspartate by valine in the tyrosine kinase domain of the receptor or Asp-816-Val or D816V) can be detected. This mutation leads to autophosphorylation of the receptor resulting in endogenous-autonomous mast cell proliferation. However, have been reported other forms of mutations, not only on exon 17: these mutations affect several different domains of the receptor, such as the extracellular domain, transmembrane domain, juxtamembrane domain and activation loop domain []. In children mutagenesis is much less homogeneous as in adults. In a recent study, Bodemer et al. analyzed cutaneous biopsies of 50 children with mastocytosis (aged 0-16 years): the mutation at codon 816 on exon 17 was detected in 42 % of cases, while in 44% in of cases mutations were observed in the extracellular domain of on exon 8 and 9 []. All mutations were somatic and led to activation. Other oncogenic mutations recently identified in mastocytosis patients include TET2 (TET oncogene family member 2) and N-RAS []. These mutation are not specific of mastocytosis and their pathogenetic role and/or prognostic impact is currently uncertain. TET2 is a putative tumor suppressor gene. In one study, the frequency of TET2 mutations in SM was 29% and its presence was associated with monocytosis. Further, TET2 mutations cosegregated with KITD816V but did not appear to affect survival in SM. #text In both CM and SM the clinical picture is often dominated by local and systemic symptoms generated by the acute or chronic release of mast cell-derived mediators. These linical signs and symptoms are highly variable inter- and intra-individually. These symptoms depend on the release of mediators, such as histamine, heparin, tryptase, leukotrienes and cytokines. Related clinical findings are often unspecific symptoms: headache attacks, fatigue, pruritus, flushing, often in combination with hypotensive crises, syncope and tachycardia, gastrointestinal complaints (nausea, abdominal pain, diarrhea, vomiting, gastritis, peptic ulcers), bone pain and rarely even neurologic-psychiatric symptoms. Such symptoms can occur in all patients with mastocytosis, but in patients with SM these symptoms are often recurrent, severe and require continuous medical treatment. Almost all patients report variable worsening of symptoms after intensive physical activity, consumption of alcohol, infections, nonsteroidal anti-inflammatory drugs but also during emotional stress. In cutaneous mastocytosis flushing, pruritus, erythema and swelling are frequent signs and symptoms and they may occur spontaneously or be induced by specific triggers. The intensity of skin involvement can be variable. In majority of patients the typical maculae and plaques develop primarily on the trunk and limbs; the head, palms and soles are usually spared. In children, in contrast, typically the head and lateral face are involved. Gastrointestinal symptoms can be prominent in patients with mastocytosis and these symptoms can be caused by mast cell proinflammatory mediators and/or mast cell organ infiltration. The mediator related symptoms are diarrhea, abdominal pain, peptic ulcer disease and gastrointestinal bleeding; while in ASM patients mast cell tissue infiltration caused severe malabsorption, chronic diarrhea, weight loss, organomegaly (spleen, liver) with dysfunction, ascites due to periportal fibrosis up to hepatic failure. Patients can also develop osteopenia or osteoporosis with bone pain and possible pathologic fractures. Pathologic fractures are considered a marker of advanced mastocytosis specially when they are associated with high levels of serum tryptase; while osteoporosis usually depend on the intensity of mast cell mediator release. Indeed, heparin, tryptase and IL-6 can be activated RANK-L ) []. Patients with mastocytosis have an increased risk of anaphylaxis. In adults with mastocytosis, the cumulative prevalence of anaphylaxis has been reported to be 22% to 50%, and in children 6% to 10% []. have been reported in all forms of mastocytosis, but patients with systemic disease have an increased risk of anaphylaxis as compared with patients with only cutaneous disease. The most frequently reported elicitor of anaphylaxis is hymenoptera venom (wasp stings) []. Other factors that caused anaphylaxis are some drugs (opiates, including morphine and codeine), food, radiological contrast media containing ionic iodine and substances administered during general anesthesia (e. g. muscle relaxants). These factors can be activate mast cells directly by non immunologic mechanisms. The diagnosis of cutaneous mastocytosis can usually be made based on history and clinical criteria with careful skin inspection. The diagnosis is based on the demonstration of characteristic skin lesions (major criterion) and on the presence of one minor or two minor criteria: a) demonstrate on the skin biopsy of (multifocal or diffuse) aggregates of mast cells in the papillary dermis extending into the reticular dermis; b) presence of D816V mutations. The sign with urticarial swelling after mechanical rubbing of macules or papules is almost always positive. Inspection of the skin is supplemental by palpation of peripheral lymph node stations and abdominal organs. In children bone marrow study is recommended only if there is suspicion of progression of disease: in case of organomegaly or significant lymphadenopathy, abnormalities on peripheral blood counts, elevated serum tryptase levels, severe recurrent systemic mast cell mediator-related symptoms or persistence of skin lesions after puberty. For the diagnosis of systemic mastocytosis should be fulfilled the WHO criteria proposed in 2001 (). These consist of one major and four minor criteria. In order to satisfy the diagnosis of systemic mastocytosis, either one major criterion and one minor criterion or at least three minor criteria should be present. The WHO major criterion as well as 2 of 4 WHO minor criteria are morphological criteria, so that both careful collection of samples (especially bone marrow biopsy and aspirates) as well as sufficient experience in the histo- and molecular pathological evaluation of the material are essential for making the diagnosis. The recommended method of evaluation of mast cells in bone marrow biopsy is immunohistochemical staining with tryptase. Neoplastic mast cell generally express CD25 and/or CD2, and the abnormal expression of at least one of these two antigens counts as a minor criterion toward the diagnosis of SM []. Recently, CD30 was detected in mast cells in aggressive (advanced) systemic mastocytosis. Specifically, it has been described that CD30 is preferentially expressed in the cytoplasm of neoplastic mast cells in ASM and MCL, but not in ISM. Notably, strong expression of CD30 in the cytoplasm of most neoplastic mast cells is in favor of the diagnosis ASM or MCL. Thus, CD30 may be a forthcoming gradingand prognostic marker in systemic mastocytosis. The determination of serum tryptase levels (normal value under 11.4 μg/l) is in principle a good diagnostic and differential diagnostic parameter, also in evaluation of the disease course. The level correlates with the mast cell proliferation and its activation. Elevated serum tryptase levels are therefore not pathognomonic for SM, as elevated levels can be detected also in patients with acute (40 % of patients have elevated levels) or chronic myeloid leukemia and more rarely also in myelodysplastic disorders. In patients with elevated tryptase levels after questionable anaphylactic reactions, determining the course after 4 to 8 weeks is recommended for a differential diagnosis of SM. When SM is suspected and serum tryptase is elevated, bone marrow biopsy should always be performed. Even with only slightly elevated tryptase levels and unclear complaints, bone marrow biopsy is recommended. SM without skin involvement is rare and is then also often difficult to recognize. In face of the often diffuse complaints of patients many diseases must be included in the differential diagnosis. Patients who present a severe anaphylactic reaction, e. g. after an insect sting – even without the detection of specific IgE – or who develop an unclear (idiopathic) anaphylactic reaction are diagnostically problematic. Here in every case further mastocytosis diagnostics should be performed. A lack of skin involvement is more often associated with aggressive forms (ASM, mast cell leukemia). Extremely rare and therefore difficult to diagnose routinely are mast cell sarcoma, mastocytosis of the spleen and benign extracutaneous mastocytoma. A careful internal medicine work-up is always recommendable. Organ-related symptoms e. g. of the gastrointestinal tract result in specific diagnostics (e. g. endoscopy with step-by-step biopsies and mast cell-specific immunohistochemical and molecular pathological processing). Differentiation between symptoms due to mast cell infiltrates and symptoms due to massive mediator release can be problematic in the individual case. With strict observation of the major and minor criteria and a standardized step-by-step diagnostic approach mastocytosis can almost always be clearly identified and subtyped []. In ISM with a stable course only annual Laboratory controls (routine serology, differential blood count, serum tryptase) and more invasive studies only in case of clinical/ laboratory chemical alterations are recommended. The variants and subvariants of mastocytosis, with their wide range of clinical manifestations, have relatively defined prognosis. Most forms of CM in children spontaneously remit by puberty []. The prognosis of patients with mastocytosis depends on the degree of organ infiltration by mast cells, the evolution of associated hematologic disorders, the occurrence of anaphylaxis and the associated osteoporosis with pathological fractures. In adults, the prognosis of indolent systemic mastocytosis is generally good and these patients usually have a normal life expectancy; while advanced systemic mastocytosis and mast cell leukemia are associated with a severe prognosis. Several different clinical, sierological, cytomorphological and immunological variables have been described as a prognostic findings in SM. Clinical prognostic variables include absence of skin lesions, large osteolyses, weight loss, malabsorption, enlarged liver with portal hypertension and splenomegaly with hypersplenism []. The absence of a skin lesion is typical for an aggressive disease variant. Low levels of albumin can be caused by hepatopathy or malabsorption. Hepatomegaly with elevated liver enzymes and/or signs of portal hypertension (such as ascites) is indicative for progressive destruction of the liver by MC infiltrates. Both progressive hepathopathy and malabsorption are markers of poor prognosis in SM. In patients with indolent systemic mastocytosis, the β2-microglobulin level is a prognostic marker predicting an unfavorable outcome []. SM with eosinophilia was found to be predictive for a significantly reduced overall and event-free survival compared with patients without eosinophilia []. Another prognostic factor in patients with mastocytosis is the percentage of mast cells in the bone marrow smear. The majority of patients with ISM present with ≤ 5% MCs in bone marrow smear. Patients with a percentage of MCs in the bone marrow smear greater than 5%: have a lower survival []. As previously mentioned, CD30 is preferentially expressed on neoplastic MCs in ASM and MCL, but not ISM. The strong expression of CD30 in the cytoplasm of neoplastic MCs correlates with a poor prognosis. Recently, a number of therapeutic approaches for the treatment of mastocytosis have been reported []. Management of patients within all categories of mastocytosis includes:1) a careful counseling of patients and care providers; 2) avoidance of factors triggering acute mediator release; 3) treatment of acute mast cell mediator release; 4) treatment of chronic mast cell mediator release, and if indicated; 5) an attempt to treat organ infiltration by mast cells. Complete information about the disease, including guide-lines for avoidance of triggering factor, and risks associated with massive mast cell mediator release may be given to the patients and/or their parents in case of children. The first arm of therapy is to avoid mast cell degranulation. Triggering factors are various: physical stimuli (heat, cold, friction of skin lesions, pressure, excessive sunlight); emotional factors (stress, anxiety, sleep deprivation); infection disease with fever; drugs (aspirin and other non steroidal anti-inflammatory drugs, morphine and derivatives, polymyxin-B, amphotericin B). Skin lesions represent a problem in many patients. A treatment for skin lesions is oral psoralen plus UV-A (PUVA). In response to PUVA, most patients show a substantial regression of skin lesions. However, due to the limited duration of responses, long-term treatment with repeated cycles of PUVA is necessary []. The primary objective of all clinical forms of mastocytosis (both cutaneous and systemic mastocytosis) is the treatment of mediator-related symptoms. Non sedating histamine H receptor antagonists (rupatadine, levocetirizine and desloratadine) have been shown to be useful in the treatment of flushing, pruritus, wheals, swelling and the sensation of burning of the skin. Additional administration of histamine H receptor antagonists, such as ranitidine is suggested in cases where H-receptor antagonists monotherapy is inadequate. Corticosteroids, administered over a short period of time, may be considered in case of recurrent and severe mediator-related symptoms. Patients with gastrointestinal complaints such as pain, vomiting, diarrhea or meteorism profit from therapy with chromolyn sodium, antacids, proton pump inhibitors and H receptor antagonists and depending on the degree of indirect histamine release-induced symptoms also with combinations of H and H receptor antagonists. Adults with mastocytosis and children with extensive cutaneous involvement are at increased risk of anaphylaxis and should carry an emergency kit for self-medication that includes epinephrine and, as warranted, antihistamine and corticosteroids. Treatment with omalizumab (anti- IgE) can be successful in selected patients with otherwise uncontrolled idiopathic anaphylaxis and in those with anaphylaxis during the initiation of specific immunotherapy []. Due to the increased perioperative risk, patients, anesthesiologists and surgeons should discuss comprehensively the procedure to lower the risk of anaphylaxis. As premedication antihistamines and corticosteroids in a sufficiently high dosage should be selected. Only selected drugs that are proven not to be relevant histamine releasers and do not provoke mast cell activation should be administered perioperatively. In patients with advanced systemic mastocytosis (with the presence of “C-findings”) the prime goal is to inhibit further mast cell proliferation with cell infiltration and cell activation. In cases of SM-AHNMD the hematologic disorder must be treated. Interferon (IFN)-α is considerate the first-line cytoreductive therapy in aggressive systemic mastocytosis. Prednisone (30-60 mg/day) is commonly added at the start of treatment to improve tolerability and response. Several studies have shown IFN-α to improve symptoms of MC degranulation, decrease bone marrow MC infiltration, and reduce mastocytosis-related ascites/hepatosplenomegaly, cytopenia, skin lesions and osteoporosis. The frequency of major response (complete resolution of one or more baseline C findings) is approximately of 50%. IFN-α treatment is frequently complicated by toxicities, including flu-like symptoms, bone pain, fever, cytopenia, depression and hypothyroidism. Cladribine or 2-chlorodeoxyadenosine (2-CdA) has activity in all SM subtypes. 2-CdA can be used in patients who are refractory or intolerant to IFN-α. A reduction of the mast cell load could be demonstrated, but controlled studies are urgently needed. Potential toxicities of 2-CdA include myelosuppression and lymphopenia with increased risk of opportunistic infections. In recent years various tyrosine kinase (TK) inhibitors have also been employed for SM. Imatinib mesilate (IM) inhibits a series of receptor TK including , abl, bcr-abl, platelet-derived growth factor receptor. Due to steric interaction of the D816V mutation at the receptor imatinib is effective only in patients with SM lacking this mutation. Indeed it demonstrates in vitro efficacy against wild-type KIT and certain transmembrane (F522C) and juxta-membrane (V560G) KIT mutants, but not the common kinase (D816V) domain mutants. Furthermore, imatinib showed efficacy in patients with one of subvariant of ASM, lymphadenophatic systemic mastocytosis with eosinophilia: this particular subset has a FIP1-like-1(FIPL1)/platelet-derivated growth factor receptor alpha (PDGFRα) fusion gene defect. New tyrosine kinase inhibitors under clinical investigation for blocking KIT are dasatinib, nilotinib, masatinib mesilate and PKC412 (midostaurine). However, it is currently not clear which patients with SM will benefit from such treatments and more studies are needed to clarify the advantage of tyrosine kinase inhibitors over IFN-α or cladribine, which are currently considered first line treatment in ASM. A possible treatment option in the future is the combination of multiple cytoreductive drugs with potential synergistic effects.

Monoclonal B-cell lymphocytosis, or MBL for short, is an asymptomatic condition characterized by the presence of a circulating small clonal B-lymphocyte population in persons who do not have chronic lymphocytic leukemia (CLL), other B-cell lymphoproliferative disorder, or underlying conditions such as infectious or autoimmune disorders []. Despite the fact that the majority of subjects diagnosed with MBL does not develop CLL, a large population-based cancer study suggests that MBL may precedes CLL by several years in some cases []. Efforts are on-going to identify at molecular level patients with MBL at higher risk of developing CLL in order to design intervention approaches able to delay or prevent CLL progression. MBL has been defined as an asymptomatic condition characterized by an expansion of circulating clonal B-cell lymphocytes (less than 5 x 10/L) in patients with no symptoms or signs of lymphoproliferative disorders, such as lymph-node enlargement a and/or hepato-splenomegaly (). Moreover, MBL may be classified as follows, according to the immunophenotypic profile of clonal cells: The differential diagnosis includes small lymphocytic lymphoma (SLL), where the number of circulating neoplastic B-cells may be less than 5 x 10/L. However, the presence of lymph nodes, liver or spleen enlargement is a typical feature of SLL (). Gibson et al. have also proposed the definition of ‘nodal MBL’ to indicate a subsets of patients with fewer than 5x10/L circulating clonal B-lymphocytes and a focal/subtle abnormal CLL-like infiltration []. Based on the observation that the absolute number of B-cells identifies those patients who will require treatment from those patients who will not better than the absolute lymphocyte count, in 2008 the diagnostic criteria of CLL have been revised setting the diagnostic threshold of neoplastic B-cells in peripheral blood to higher than 5 x 10/L []. As a matter of the fact, a significant number of patients previously recognized as having Rai stage 0 CLL have been re-classified with CLL-like MBL. Thus, the distinction between MBL and Rai stage 0 CLL resides only on the number of absolute neoplastic B-cells. Moreover, Landgren et al. demonstrated that virtually all patients with CLL have a CLL-type MBL phase several years before the CLL diagnosis []. Several researchers have tried to compare the outcome of the two forms of lymphoproliferative disorders. Fung et al. showed that Rai stage 0 CLL patients and CLL-type MBL patients had a similar overall survival, but also that CLL-type MBL group displayed a lower probability of early progression []. No difference was found by Faguet et al. in terms of disease progression []. Shanafelt et al. observed no difference in overall survival; however, these authors found that fewer MBL patients required treatment and time to treatment was found to be directly correlated with the absolute B-cell count []. Rawstron et al. also did not find any Association with overall survival or time to first treatment; in this study, however, the B-cell count at the time of MBL diagnosis was the only independent predictive factor of progression in terms of lymphocytosis []. More recently, Rossi et al reported a longer treatment-free survival in MBL patients than in Rai stage 0 CLL []. Finally, an absolute B-cell count ranging from 10 to 11 x 10/L was demonstrated to better predict the clinical outcome (time to first treatment), thus suggesting that the threshold of 5 x 10/L B-cells might be inadequate. Taken together, these data indicate that the number of circulating B-cells is a strong predictor of outcome for MBL patients and that “clinical” MBL, with respect to “low count” MBL, is closely related to CLL and may be considered as an early-stage CLL []. MBL are more common than CLL (see section IV) and, as above reported, it is thought that almost always they precede CLL []. Therefore, it is evident that only a small population of MBL patients evolve into overt CLL overtime. Ghia and Caligaris-Cappio very recently reviewed this topic and proposed that the encounter of a B-cell carrying intrinsic abnormalities with an appropriate external stimulus (i.e., antigen/B-cell receptor interaction) may trigger the clonal development of MBL []. On the other hand, the possibility that external stimuli may precede and favors the appearance of genetic abnormalities also exists. Finally, the persistence of an antigenic stimulus inducing enhanced clone proliferation could favors the acquisition of additional genetic abnormalities with the possibility that some MBL may progress into overt CLL. Interestingly, in hepatitis C-virus (HCV) infected patients MBL has been detected in 28,5% of subjects []. Moreover, its frequency was found increased in patients with more advanced disease. Either clinical and population-screening studies indicate that MBL, mimicking what observed in monoclonal gammopathy of undetermined significance (MGUS), display the same chromosomal abnormalities and a mutated IgVH status usually seen in low-risk CLL. The biological indolent behavior of MBL is also documented by the rare occurrence of genetic lesions predicting poor prognosis in CLL, such as TP53, ATM, NOTCH1 and SF3B1 mutations. These mutations are, in fact, more frequently detected in the later stages of CLL and in Richter syndrome transformation []. Regulatory T-cells (Tregs) constitute a small subset of cells involved in antitumour immunity and are generally increased in patients with CLL []. Tregs have been found higher in ‘clinical’ MBL patients with respect to healthy subjects, but lower than in CLL patients []. It has been hypothesized that the progressive increase of Treg numbers might contribute both to the clinical evaluation of MBL to overt CLL and to CLL progression. The prevalence of MBL in general population has been extensively investigated in large population-based studies. As showed in , the reported prevalence varied widely, ranging from 0.6% to 12%. This very large variability is closely related to the methodology used to detect MBL cells, in particular the number of monoclonal antibodies used (the higher number is employed, the higher incidence of MBL is found) and that of cells evaluated. In fact, the highest incidence was found by Salamanca group study in which eight-color staining panels were utilized and a greater number of cells analyzed (5 million per case versus 200.000 to 500.000 in the other studies) []. Interestingly, in a study performed to investigate the potential health effects of living around hazardous waste sites in the United States [], the authors suggested that MBL may be a potentially useful biomarker for investigating environmental exposures potentially associated with chronic lymphoproliferative disorders, such as CLL. Furthermore, the highest prevalence of CLL-like form of MBL was found in first-degree relatives of CLL patients, thus suggesting a higher risk of developing CLL in these subjects []. Whether CLL needs of a MBL preceding phase before to develop is still matter of debate. Landgren et al, analyzing data from 77,469 healthy adults enrolled in the nationwide, population-based Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial, identified 45 subjects who were diagnosed with CLL up to 6.4 years later []. By evaluating stored peripheral blood samples, these authors were able to demonstrate that 44 out of 45 patients with CLL had a preceding MBL phase, thus suggesting that CLL is almost always preceded by a precursor condition, such as MBL. Thus, MBL may progress to overt CLL and several investigators tried to estimate the frequency of this phenomenon. However, the risk of transformation to CLL requiring therapy is very low in ‘clinical’ MBL, accounting for 1-2% per year, and extremely rare in research population-screening MBL []. Moreover, no specific therapy is established for MBL to date and only watch and wait approach for clinical MBL is required due to the above mentioned very low possible evolution to overt CLL overtime. For that reasons, physical examination, patient history, whole blood cell count and flow cytometry of peripheral blood are mandatory to establish the diagnosis of MBL. The majority of investigators recommend a clinical and lab (physical examination for lymphadenopathy and complete blood cell count with differential) evaluation every 6 to 12 months for patients with ‘clinical’ MBL, according to the number of circulating clonal B.cells (). In fact, Rawstron et al showed that more than 90% of subjects with CLL-like MBL and a cell count below 1900 x 10/L will have a stable lymphocytosis over a 5-year period []. On the other hand, subjects with more than 1900 x 10/L clonal B.cells show no disease progression Kaplan-Meier curves plateau over time, suggesting the need of continue monitoring in these MBL. Progresses in flow cytometry with developing of more and more highly sensitive techniques have make possible to detect abnormal small B-cell clones in otherwise asymptomatic subjects. In the so-called ‘low- count’ MBL the risk of progression to overt CLL/SLL is very low and the disease remains stable over time. On the contrary, in ‘clinical’ MBL the risk of progression is estimated to be approximately 1-2% per year. No prognostic parameter able to identify subjects more prone to evolution compared to subjects with more stable lymphocytosis has been so far identified. For that reasons, a monitoring of lymphocytosis and/or lymphadenopathy at least annually is recommended.

Psoriasis is a chronic, non-infectious inflammatory skin disease of genetic basis, characterized by excessive proliferation of the epidermis. It affects approximately 2–3 % of European population (Schafer, ). Numerous literature reports and clinical observations suggest that this condition has significant influence on the functioning of people affected by it. The impact of psoriasis on the quality of life is comparable to the impact of other diseases, including life- threatening ones such as cancer, heart attack, diabetes, and hypertension (Rapp et al., ; Schafer, ). Therefore, van de Kerkhof described it as a ‘life-ruining disease’ because, although it does not lead directly to death, it makes life unbearable (van de Kerkhof, ). Persons suffering from psoriasis experience difficulties in the physical (e.g., desquamation, pain, itching), psychological and social domains, leading to disturbances of normal, daily routines like bathing, dressing, sleep, and work. Patients also feel embarrassed and ashamed because of the presence of skin lesions. They lack confidence, experience anxiety or low mood, and sometimes have suicidal thoughts (Gupta & Gupta, ; Russo et al. ; Li and Armstrong ). Often persons suffering from psoriasis also experience feelings of guilt and hopelessness. They worry about the anticipated reaction of their families and colleagues to their illness, feel ashamed and angry, and have distorted self images (Choi & Koo, ; Vladut & Kallay, ). Many patients experience social rejection and are often asked to leave public places (e.g. a swimming pool) (Choi & Koo, ; Schmid-Ott et al., ). Therefore, they often decide to limit or abandon altogether their social activities in order to avoid stubborn and/or disgusted glances. Psoriasis also impairs functioning in intimate relationships. In the study of Gupta and Gupta () 40.8 % of patients with psoriasis admitted the disease affected their sexual life. Sixty percent of them felt that the appearance of the skin was directly responsible for reduced sexual activity. Physical symptoms such as joint pain, desquamation, itching also adversely affect sexual life (Gupta & Gupta, ). Professional activity is closely connected with social functioning of individuals. Unfortunately, due to physical symptoms alone, repeated hospitalizations and, finally, the rejection at the workplace, patients lose their sources of income. That is how the ‘life-ruining disease’ ruins also the material sphere of life (Vladut & Kallay, ). Subjective-well being is frequently used to assess how individuals cope in different (including difficult) situations. It is believed to derive from the conscious experience of an individual and is expressed in the form of cognitive satisfaction. In order to determine the level of well-being experienced by an individual, one needs to refer to what s/he thinks about their life in the context of the adopted life standards (Diener & Suh, ). Quality of life (QoL) is an important source of information about the functioning of patients, an indicator of how they experience and evaluate their own lives, and a valuable addition to clinical data. Current professional literature devotes much attention to the QoL of persons with psoriasis but the vast majority of research deals only with health-related quality of life (HRQOL). In addition, there is no comparative analysis between groups of patients and healthy controls. HRQOL is a narrower concept than the general quality of life, because it is focusing on the effects of illness and treatment on the sense of the patient’s well-being (Bączyk et al. ; Dziurowicz-Kozłowska, ). Nevertheless, ill-health should not be necessarily equate with a low QoL- some person are able to adapt to the disease and to achieve their goals. Hence, this study aimed to determine and compare the overall quality of life of psoriatic patients and healthy people. Internal factors that motivate a person to act constructively and encourage self-realization play an important role in the subjective assessment of the quality of life. Therefore, this study also examined selected psychological variables, potentially modifying the quality of life, which could be treated as a resource when coping with the disease. These factors are basic hope and trait hope. The former is a concept introduced by Erik Erikson () describes a belief in two basic features of the world: its higher order and benevolence. Basic hope is formed very early in psychosocial development (Erikson, ; Cutcliffe, ) and reaching that state allows a person to respond adequately to new situations and those when the existing order has been disturbed (Trzebiński & Zięba , ). The latter—trait hope—is an element of hope theory developed by Snyder (Snyder, ). In this approach hope is viewed as a positive motivational state based on two beliefs: strong will (agency) and the ability to solve problems (pathways). In the first case people see themselves as ‘active agents’ who are able to initiate actions that lead to achievement of goals and who persevere despite obstacles. The second refers to the perception of oneself as a resourceful person, able to invent or learn more than one way of achieving the intended purpose. It is a conviction about one’s intellectual abilities and knowledge that enables to realize one’s plans. People with higher hope deal with diseases and pain better and create more strategies of coping with them (Snyder, ). Also, they are more likely to engage in preventive activities, such as taking care of their physical condition and, additionally, are more consequent and thorough when following their doctor’s recommendations. Hope allows to set new goals when the old ones are no longer feasible because of the disease, and also to come up with alternative ways of achieving them, when the illness hinder their chances of reaching them through traditional means (Shorey et al., ). The study included 42 patients from the Clinic of Dermatology, Poznan University of Medical Sciences, with a confirmed diagnosis of psoriasis vulgaris, and 42 healthy controls. The mean duration of the disease was 16.36 years ( = 14.21). Among the 42 persons with psoriasis (21 men and 21 women), with an average age of 42 years (min 20, max 73), the most common level of education was secondary, and the least common was higher education (47.6 % and 23.8 % respectively). The remaining 28.6 % of the respondents had vocational education. The main criterion for inclusion was health status: only people suffering exclusively from psoriasis vulgaris (excluding patients with a history of other diseases) were tested. In order to obtain an adequate control group, purposive sampling was used which resulted in the inclusion of healthy participants that were matched to psoriatic patients by gender, age (+/− 5 years; an average age of 41 years, min 19, max 69), and education. Prior to testing, all participants gave their informed consent. The study was approved by the from the Institute of Psychology, at Adam Mickiewicz University in Poznań. The surveys were conducted from October 2010 to April 2011. Quality of life—according to Flanagan (Flanagan, ; Brzezińska et al., ) is a subjective feeling of satisfying needs that are important to a given individual. These needs have been divided into five categories of ‘Physical and Material Well-being’ (WB), ‘Relations with other People’ (RP), ‘Social, Community, and Civic Activities’ (SA), ‘Personal Development and Fulfillment’ (PD), ‘Recreation’ (RE). Flanagan Quality of Life Scale (QoLS) consists of two questionnaires: ‘Importance of needs’ and ‘Needs met’, each containing 15 items (list of 15 needs), and a 7-point scale. Originally, a 5-point scale was used (Flanagan, ) but in our study an extensive scale was used to get a more subtle variation in response. At first, participants were asked to determine the importance of the needs, then the degree of needs met. The difference between importance and meeting of needs is an indicator of quality of life. Overall quality of life and quality of life in distinguished areas were calculated. The smaller the difference between the importance of needs and needs met (the result closer to zero) the higher the quality of life. The results are within the following ranges: overall quality of life: 0–6, WB: 0–12, RP: 0–24, SA: 0–12, PD: 0–30, RE: 0–12. Test reliability (measured with Cronbach’s alpha) is good and ranges from 0.809 for the “Importance of needs” scale to 0.835 for the ‘Needs met’ scale. Basic Hope Inventory (Trzebiński & Zięba, , ) consists of 12 statements, three of which are buffer items. Subjects are asked to determine to what extent they agreed with the statement. Respondents indicate their answers on a 5-point scale. The result, which is an indicator of the general level of basic hope, was a sum of the points obtained by the respondent with 9 statements. The results ranged from 9 to 45 points. The higher the score the higher the level of basic hope. Reliability of the questionnaire (measured with Cronbach’s alpha) is 0.537 and is relatively low. The Trait Hope Scale (Łaguna et al., ) consists of 12 statements - 4 relate to the agency subscale, 4 to pathway subscale, and 4 of them are buffer positions. Subjects are asked to determine the extent to which the statement describes them, taking into account different situations occurring at different times. Respondents indicate their responses on an 8-point scale. The level of trait hope was calculated by adding up the points obtained by a respondent in 8 statements. It varies between 8 and 64 points. The result for the individual components of trait hope was calculated by adding up the points obtained by test-specific statements attributed to subscales (from 4 to 32 points). The higher the score the higher the level of the factor tested. Reliability of the questionnaire (measured with Cronbach’s alpha) is satisfactory and is 0.834. Psoriasis Area and Severity Index (PASI) is an observational scale, on which severity of three typical symptoms of psoriasis skin (desquamation, erythema and induration) is assessed. The results are documented on a 5-point scale from 0 (no symptoms) to 4 (very severe). Severity of skin lesions on the head, trunk, arms and legs is assessed separately. Additionally, percentage of the body surface area occupied by lesions is estimated for each of these body parts. The results range from 0 to 72 points. The higher the score the greater clinical severity of the lesions (Schmitt & Wozel, ). To diminish subjectivity of this scale, PASI was always evaluated by the same dermatologist. Statistical analysis was performed using the SPSS statistical package (SPSS Inc., Chicago, Ill, USA). The normality of data was assessed using the Kolmogorov-Smirnov test. Student’s t-test, Mann–Whitney U test and Kruskal-Wallis test were used to assess the significance of differences between the groups. r-Pearson and r-Spearman correlation size measure were used to determine the strength of the statistical relationship between the variables. In the group of persons with psoriasis, the average level of the overall quality of life was 1.16 ( = 0.69). In the specific components the results were: ‘Physical and Material Well-being’ 3.21 ( = 2.20), ‘Relations with other People’ 4.43 ( = 4.16), ‘Social, Community, and Civic Activities’ 1.91 ( = 1.62), ‘Personal Development and Fulfillment’ 4.98 ( = 3.95), ‘Recreation’ 2.83 ( = 2.59). In the control group the mean overall quality of life was 0.88 ( = 0.63), and in the specific components the results were: ‘Physical and Material Well-being’ 2.12 ( = 2.11), ‘Relations with other People’ 3.79 ( = 3.44), ‘Social, Community, and Civic Activities’ 1.93 ( = 2.27), ‘Personal Development and Fulfillment’ 3.33 ( = 3.55), ‘Recreation’ 1.95 ( = 2.40). As shown in Fig. , persons suffering from psoriasis have a significantly lower quality of life in some of the specific areas: ‘Physical and Material Well-being’ ( = 0.01), ‘Personal Development and Fulfillment’ ( = 0.03), ‘Recreation’ ( = 0.04). In the group of psoriatic patients, the average value of trait hope was 46.17 ( = 7.05). The component results were: pathways 24.14 ( = 3.02), agency 22.02 ( = 4.69), and basic hope 28.86 ( = 5.33). In the control group the average value of trait hope was 49.21 ( = 6.56), pathways 25.81 ( = 3.06), agency 23.21 ( = 3.97), and basic hope 30.45 ( = 3.42). As shown in Fig. , persons with psoriasis have lower levels of trait hope ( = 0.04) and its pathways component ( = 0.01). No statistically significant difference was found between the group of patients and healthy controls regarding the level of basic hope ( = 0.106) and agency component of trait hope ( = 0.149). This study indicate that gender does not differentiate the quality of life in people suffering from psoriasis. There are however significant differences in the level of trait hope ( = 0.02) and its components: agency ( = 0.04), pathways ( = 0.01) and in the quality of life in the area of ‘Physical and Material Well-being’ ( = 0.01) between ill and healthy males. Sick men have a lower quality of life in the area of ‘Physical and Material Well-being’, and lower levels of trait hope, agency and pathways. No statistically significant difference was found in overall quality of life and in its specific areas according to the education level, both in patients and control group. On the other hand, Kruskal-Wallis test demonstrated that among examined persons with psoriasis, young adults (20–34 year of age) experienced more difficulties in the area of ‘Physical and Material Well-being’ ( = 0.027) than middle-aged adults (35–54 years of age). No differences were detected in the control group. For 42 patients the average PASI score was 20.26 ( = 14.94). PASI was correlated only with one of the examined psychological factors - the dimension of the quality of life scale known as ‘Social, Community, and Civic Activities’ ( > 0.01,  = 0.45,  = 0.20). Once again it is worth noting that due to the method chosen for calculating the quality of life (the higher the score, the lower the quality of life), positive correlations are interpreted as indicators of a negative connection between the quality of life and a correlating factor. No statistically significant association was found between the level of basic hope and quality of life in the study group ( = 0.09). However, there were moderate, negative significant correlations with basic hope and components of quality of life: ‘Physical and Material Well-being’ ( = 0.03,  = − 0.34,  = 0.12) and ‘Relations with other People’ ( = 0.02,  = − 0.35,  = 0.12). What is interesting, no correlations were found in the control group. Correlation analysis showed no statistically significant association between the level of trait hope and the quality of life and its areas in the study group. Also, the subscale of trait hope did not correlate with the quality of life and its components. Interestingly, in the control group a statistically significant correlation between the pathways and quality of life ( = 0.05,  = −0.31,  = 0.10) and quality of life in the area of ‘Recreation’ ( = 0.05,  = −0.310,  = 0.10) was found. The present study blends into the mainstream of scientific research on people suffering from psoriasis to evaluate the quality of life, functioning areas in which patients face particular difficulties and, what is especially important, to determine factors modifying the quality of life. In most studies the HRQOL questionnaires are used, measuring health-related quality of life. This is a narrower concept than the general quality of life because it focuses particularly on deficits in functioning, while general quality of life refers to human potential, which allows him to achieve the important aspirations (Dziurowicz-Kozłowska, ). The use of the Flanagan QoLS in this study has enabled us to compare of the overall quality of life of psoriatic patients and healthy controls. This would be impossible or difficult using other tools, particularly those designed to measure HRQOL in dermatological diseases. The analyses of the collected data allow us to unequivocally conclude that people suffering from psoriasis have a lower quality of life than healthy individuals in some of the specific areas. This conclusion is consistent with clinical observations. Psoriasis significantly impairs the functioning of the affected people in many spheres of life. Our results indicate that the reduction of the quality of life relates to the following particular areas: ‘Physical and Material Well-being’, ‘Personal Development and Fulfillment’, ‘Recreation’. Taking into account that health and personal safety are elements of the Flanagan’s ‘Physical and Material Well-being’ component, smaller needs met in this particular sphere of functioning seem to be justified. This is consistent with the reports stating that psoriasis is a physical problem (skin lesions, pain, pruritus, necessity to apply ointments and use medication), but also causes the feelings of anxiety, fear, shame or guilt (Gupta & Gupta, ; Choi & Koo, ; Russo et al. ; Vladut & Kallay, ). Experiencing such feelings is the opposite of “enjoying freedom from sickness”, which is a component of quality of life in the area of ‘Physical and Material Well-being’ according to Flanagan (Flanagan, ). The definition of the component of ‘Personal Development and Fulfillment’, as well as ‘Recreation’ (which include categories such as: intellectual development, personal understanding and planning, professional activity, creativity and personal expression, socializing, passive and observational recreational activities, active and participatory recreational activities) further suggests that our results are consistent with literature data. As mentioned in the introduction, numerous publications report impeded social functioning of people suffering from psoriasis, what results in avoidance of public places, including those where you can relax passively and actively (beach, swimming pool, gym) (Choi & Koo, ; Schmid-Ott et al., ). Moreover, often due to absenteeism in the workplace or explicitly formulated rejection patients lose their source of income and satisfaction, feel ill at ease and lack conditions for creative self-expression. Some works in the field of quality of life in somatic patients used the Flanagan Quality of Life Scale modified by Burckhardt. It is a questionnaire examining satisfaction in 16 areas (one position—independence—was added) (Burckhardt & Anderson, ). Due to the different design of the questionnaire (the validation of has been omitted), these results cannot be compared directly. In our opinion, however, assessing the importance of the needs is essential. Brickman has already demonstrated (cf. Brzezińska et al., ) that it is not possible to draw conclusions about the quality of life assuming that there are universal needs, equally important to everyone. Flanagan (Flanagan, ) has also argued that the ideal approach to measuring the quality of life has to include subjective assessment of the validity of each area given by the respondent. Our study clearly shows that healthy people and persons with psoriasis do not differ significantly in the level of basic hope. Yet, differences in the level of trait hope and its component pathways were found between the groups. Presumably, being affected by psoriasis cannot influence the beliefs about the world (basic hope) formed in the early childhood. However, long and usually futile struggle with psoriasis can significantly reduce the level of trait hope and its pathway traits, which are formed both during childhood and later in life. Our results also indicate that there is no connection between the PASI score and the overall quality of life. These results are consistent with studies of Wahl et al. (), conducted using a modified Flanagan QoLS, which also showed no connection between overall quality of life and PASI score. However, there are different reports indicating the existence of such correlations (Vardy et al., ; Reich & Griffiths, ). It should be mentioned, though, that these results are obtained using other questionnaires, usually measuring HRQOL. It should also be noted that the quality of life is a subjective indicator of how people evaluate their life. Therefore, there are situations in which clinical evaluations do not go hand in hand with the self-reports made by patients. We found a relationship between PASI and the quality of life in the area of ‘Social, Community and Civic Activities’ such as the greater severity of the disease, the fewer satisfied needs in this area (and vice versa). It can be assumed that, with considerable skin lesions or joint pain, people are far more focused on themselves, following mainly doctor’s recommendations and fighting with the illness, than on working to achieve the common good. Moreover, severe symptoms may foster the feelings of shame and fear of the reaction of the environment, which causes withdrawal from social life. Our findings allow us to conclude that the higher the level of basic hope, the higher the quality of life in the areas of ‘Physical and Material Well-being’ and ‘Relations with other People’, in the experimental group. This correlation has not been found in healthy controls. It is therefore possible that basic hope is activated in the situation of disease and serves as a defense mechanism with adaptive function. In the situation of struggling with psoriasis the world may seem an unfriendly place, not allowing the patients to satisfy many of their essential needs and not subject to change. Perhaps patients begin to reinterpret the surrounding reality, finding there harmony, order and meaning. Basic hope may be treated as a resource in the difficult experience of coping with the disease. Similar findings have been reported earlier in the works of Chmielewska-Hampel and Wawrzyniak (), who noted the regulatory role of basic hope against fear of people receiving a prison sentence. The current study also indicates that there is no connection between trait hope (and its agency component) and the overall quality of life and its components in the experimental and the control groups. The connection between trait hope and its two components and the overall sense of quality of life and its dimensions referred to as ‘Physical and Material Well-being’, ‘Relations with other People’, ‘Personal Development and Fulfillment’ has been demonstrated among all individuals. This indicates the existence of general psychological mechanisms according to which trait hope is a resource conducive to well-being. Such a conclusion is consistent with earlier literature reports. For example, Snyder (Snyder, ) indicates that high level of hope is associated with greater social competence, feeling more social support, less loneliness, higher sense of satisfaction in life, greater self-esteem, better coping with physical discomfort such as pain and improved learning achievements. The results of our study are also consistent with the works of Gupta and Gupta () or Fortune et al. (), who showed that men and women with psoriasis did not differ in their quality of life. Nevertheless, there are studies in which such differences were found (Steuden & Janowski, ). Men suffering from psoriasis have lower quality of life in the area of ‘Physical and Material Well-being’, and lower levels of trait hope and its components than their healthy counterparts. It can be assumed that a long struggle with the disease affects perception of oneself as a person able to reach certain goals regardless of difficulties and/or to find alternative solutions. Interestingly enough, such correspondence was not found among the women. Perhaps in the case of women the state of health influences the perceived subjective well-being and self-beliefs less than in men. It should also be remembered that the Flanagan QoLS used in our study measures other aspects of the quality of life than the HRQoL scales used in the cited works. Based on the results basic hope can be seen as resources in coping with psoriasis. Although basic hope is formed early during development, it is possible to change its level as a result of life experience. The change is fostered by experiences disturbing the existing order. Basic hope may also increase as a result of encountering people with an attitude of confidence in benevolence and higher order of the world (Trzebiński & Zięba , ). Our results also indicate that trait hope is a resource conducive to well-being. Therefore, it is beneficial to work with patients on their perception of themselves as people who can initiate action, who are persistent in achieving their goals and resourceful, especially since struggle with the disease is likely to adversely affect those beliefs. It is also important to emphasize that objective clinical assessment of the disease severity often does not coincide with the assessment of the quality of life of the patient. Especially in this context, psychological help for people suffering from dermatological disorders is of great importance.

Demographic data shows that growing process of population ageing will cause increased participation of people aged over 45 in the labour force. Older adults are becoming increasingly important labour market reserves. It is important to maintain a good state of health and quality of life within that group and to counteract possible negative effects of prolonged professional life, including periods of unemployment and long – term unemployment, which is most health threatening. The phenomenon of unemployment remains the focus of attention for many psychologists, economists, sociologists as well as experts in public health, as this phenomenon results in various negative effects. Work is not only a source of financial income; it plays many other roles, such as the maintenance and control of social contacts as well as serving to organize time. It develops some skills and provides certain rights. Initially, lack of work inevitably leads to worsening of the financial situation of the household and prolonged unemployment – even poverty. Financial problems, stress and loss of social identity might result in various negative social and health consequences (Jonge and Schaufeli ; Scanlan and Beltran ). The term “quality of life” is multidimensional and depends on many factors, both subjective and objective. The quality of life (QL) reflects the level of satisfaction regarding health, material and spiritual aspects. QL comprises experiences of success and failure throughout life. It depends on individual’s chosen life goals and the sense of their achievement (Glatzer ; McGregor et al. ). According to the WHO, the term is identified with the individual’s position in life, in the context of the environment in which he/she lives, the system of values he/she believes in and his/her objectives, expectations, standards and fears (The WHOQOL group ). The quality of life has become a subject of studies of many scientific fields. The Medline database, one of the most comprehensive in the word, has gathered professional texts for more than 40 years. While in 1973, the entry “quality of life” displayed only 5 publications (Kulczycka et al. ), nowadays there are as many as 150,000. Although the problem is quite common and widely discussed, not many works exist on the quality of life and the state of health of unemployed people at the age of 45 or older. From the demographic point of view, people above the age of 45 are said to be at immobile production age. This age is associated with a specific status on the labour market. In western civilization, youth is one of the most appreciated qualities. It is associated with vitality, creativity, and willingness to work. Old age is in turn associated with many negative features such as difficulty to adapt to society and culture, inability to keep up with technological changes, and remaining far from reality. People at the age of 45, although not old yet, are somehow perceived as old. They have stopped being young (Straś-Romanowska and Frąckowiak ). In the opinion of some employers, such people are potentially worse employees than young people. There are huge differences in the work potential of that group in terms of psychophysical and environmental aspects. Some employees are skilled, committed to work and efficient; some others – are hardly willing to work and ineffective, mentally awaiting professional deactivation (pension, allowance). In many cases a psychological barrier deprives them of their self-esteem and prevents them from gaining new knowledge and adapting to changing conditions. People at the older production age are more susceptible to dismissal. If they lose their work, it is more difficult for them to get a new job (Urbaniak ). Unemployment may cause ill health, especially poor mental state, a higher death rate, greater drug use and use of medical services than found among the employed (Claussen et al. ; Mathers and Schofield ; Przewoźniak ; Novo et al. ; Nylén et al. ; Hintikka et al. ). Studies conducted so far have not clearly explained the relationship between unemployment and health, and factors influencing the effects of unemployment. Research conducted over many years has led to alternative findings that indicate that the relation between unemployment and health is much more complicated than expected (e.g. the model proposed by Claussen, Bjørndal and Hjort; Graph ). On the one hand, one body of evidence indicates that the health effects of unemployment are caused by stress and income reduction, which may lead to adverse behavior and poor health. On the other hand, there is evidence that persons with bad health, underestimated self-esteem and predisposition for depression are more vulnerable to job loss and may become unemployed by the selection process (Kalbarczyk ; Worach-Kardas ). Some research has even suggested that bad health and socio-economic factors existing for a long time before unemployment may increase the risk of job loss. Such disadvantageous factors include low parental socio – economic status, known as poverty “inheritance”; social inadequacy in school-age which is manifested in increased nervousness, depressive tendencies, fear of lack of parental acceptance; or short stature in childhood (Montgomery et al. ; Przewoźniak ). Additionally, both the nature and degree of the influence of unemployment on health may be varied. Unemployed men have a poorer state of health than unemployed women, receiving unemployment benefit or other forms of social help, as well as having a high level of education, may favourably affect health. Although marriage seems to have a positive influence on the effects of unemployment on health in women, in unemployed men it can even intensify the bad effects (Artazcoz et al. ; Eliason and Storrie ). The precise influence of unemployment on health depends on the social role and the individual perception of one’s life position. A fundamental question is still open: whether unemployment leads to bad health or if simply lack of health causes unemployment. It seems that the casual relationship between state of health and unemployment is bidirectional: bad health may cause unemployment, because the employer needs a healthy and efficient worker, and any disabilities in mental or physical health may conduct to job loss. At the same time, unemployment, especially long-lasting unemployment, may contribute to the generation of new health problems and the aggravation of existing ones. Though the implications of unemployment are mostly financial, it is important to consider other associated aspects of existence, especially state of health and health- related quality of life. The aim of the study was to evaluate the impact of the period of unemployment on the quality of life and state of health in unemployed people at the age of 45 and older, as well as to evaluate social and demographic factors that may have influence on the quality of life and state of health of the unemployed. The study also assessed the following aspects: The study was conducted during the years 2009 and 2010. A group of 454 unemployed people at the age of 45 and older, were included in the study. Both the main group and the reference group were recruited from unemployed persons living in the city of Łódź , a large city located in central Poland. The main group consisted of people aged 45 and older who had remained unemployed for longer than 12 months, the so- called long-term unemployed (in total = 230), registered in labour offices in the city of Łódź. Every third unemployed person aged of 45 and older, registered in a labour office, was randomly studied. A group of 224 people affected by short-term unemployment (i.e. those being out of work for up to 6 months, adjusted to the main group in terms of the sex and age) was formed to allow a comparative analysis. The demographic characteristics of the examined groups , age and sex, was similar to the distribution of those of the general population – both in the city and the voivodeship. The study was conducted with the use of a diagnostic survey and the application of a questionnaire interview technique. Three research methods were used in order to carry out the study. The authors’ questionnaire addressed social and demographic features (marital status, education, number of children supported) as well as the period of unemployment, the financial situation of the household and the occurrence of chronic diseases in the period of unemployment. The WHOQOL-BREF questionnaire was used to evaluate the general state of health and the quality of life in general and in 4 dimensions: physical and psychological health, social relationships, and the environment of the respondent. The QL (quality of life) dimensions consists of 24 sub-dimensions, measuring individual approach to particular aspects of person’s life. The General Health Questionnaire (GHQ – 12) was used to evaluate the physical and mental state of the studied subjects. According to the questionnaire, those who received more than 2 points were considered mentally disturbed (Makowska and Merecz ). In order to evaluate the gathered data, descriptive methods and inductive statistics were used. The chi-square test for independence was applied to compare the frequencies of occurrence of the particular features in the analyzed groups. The intensity of the dependence was evaluated with the use of the Pearson correlation coefficient. When the distributions differed significantly from a normal distribution, the Mann–Whitney Test was used to compare the results of the two groups. To compare many groups, the Kruscal-Wallis Test was applied. The probability of error was  < 0.05. While conducting the study it was assumed that many demographic, social, economic and health variables will affect the evaluation of the quality of life, self-evaluation of the state of health and the mental state of the unemployed. Hence, both single- and multi-factor logistic regression analysis was applied. The analysis made it possible to calculate the odds ratio (OR) of the occurrence of the event presented by the dichotomic variable (the evaluation of the quality of life, self-evaluation of the state of health and the occurrence of mental disturbances) depending on various independent variables. The confidence interval was 95 % and the significance level -  < 0.05. In the single-factor logistic regression model, the authors used 22 variables analyzed with the authors’ questionnaire as well as some questions taken from the WHOQOL-Bref questionnaire. The potential influence of demographic variables was analyzed with the following criteria: sex, age, marital status and education. An influence of social aspects was analyzed by considering the following factors: the size of the household, the presence of children or unemployed members of the household, satisfaction with personal relationships and support. The economic variable reflected self-evaluation of the economic state of the household. The authors evaluated also the influence of variables referring to activity and professional activation, multiple registration in a labour office, satisfaction with ability to work, attempts to find paid employment, the type of work: permanent, temporary, participation in courses and professional training. An influence of variables referring to health and health care was analyzed with the following factors: self-evaluation of health, experiencing negative feelings (sadness, depression, melancholy), diagnosis or exacerbation of chronic diseases in the period of unemployment, satisfaction with access to health care. Certain behaviours and lifestyle, such as being a smoker or non-smoker and doing regular physical exercise, also contributed to self-rated health. The application of the single-factor analysis allowed the elimination all variables which were statistically insignificant. The multi-factor logistic regression analysis facilitated an analysis of how much the variables contribute to an overall positive quality of life, a negative self-evaluation of health and mental disturbances. The STATISTICA 8 package was used for statistical purposes. Two hundred and thirty long-term unemployed subjects (the main group) and 224 short-term unemployed subjects (the comparative group) were included in the study. Having applied the research methodology, the groups were made homogenous in terms of sex and age. In both groups, the proportions of women and men were similar: 50.4 % vs. 49.6 %. The average age of long-term unemployed subjects was 52.,7 ± 4.,7 years and short-term unemployed 51.8 ± 5.1 years. (Table ). The results confirm the presence of a statistically significant, but not particularly strong, relationship between the period of unemployment and global satisfaction with the quality of life ( < 0.001;  = 0.20). The percentage of positive opinions was significantly lower in the group of the long-term unemployed subjects than in the group of the short-term unemployed subjects (23.5 % vs. 42.4 %). Moreover, it was more common for the subjects from the main group to be unable to state explicitly whether the quality of their life is either positive or negative compared with those from the comparative group (44 % vs. 33.9 %). More than one third of the long-term unemployed subjects considered the quality of their life negative, whereas in the comparative group, the percentage of negative opinions was smaller and made up only one fourth of the studied subjects. (Table ). The quality of life of the unemployed was analyzed in four dimensions: physical health, mental health, social relationships and the environment (Table ). The analysis showed that long-term unemployed people consider the quality of their life worse in all the four dimensions. The greatest difference between the studied groups was in the environment (−0.84), followed by physical health and social relationships (−0.81 each) and finally, the smallest – in mental health (−0.69). While analyzing the quality of life in according to the 24 sub-dimensions of the quality of life given in the WHOQOL-BREF questionnaire, the authors identified 14 aspects in which there are significant differences between the studied groups (Table ). It was concluded that long – term unemployed persons more often: The authors did not observe any differences between the studied groups (Table ) regarding the remaining 10 sub-dimensions of the quality of life in the WHOQOL-BREF questionnaire. In other words, no relationship was observed between the period of unemployment and: The multi-factor logistic regression analysis showed that four factors mostly contribute to a positive evaluation of the quality of life. The financial situation of the household was found to be the most important factor. If it was average, the probability of making a positive evaluation of the quality of life grew by 4.5 times (OR = 4.511). The quality grew more than five times if the financial situation was very good (OR = 5.081). Satisfaction with health resulted in a double increase in a positive evaluation of the quality of life (OR = 2.331). If the satisfaction was extremely high, the evaluation grew by almost four times (OR = 3.990). The social factor, i. e. satisfaction with personal relationships raised the evaluation 2.5 times (OR = 2.620). If there were no more unemployed people in the household, the evaluation grew by more than two times (OR = 2.296) (Graph ). The authors did not note a statistically significant difference between the long-term and short-term unemployed subjects with regard to satisfaction with their state of health ( > 0.05). Almost half the studied subjects (45 %) were satisfied with their health, whereas in the comparative group the satisfied subjects made up 55 %. Those who were long-term unemployed also slightly more often expressed their dissatisfaction with their state of health (21.3 % vs. 17.4 %) (Table ). In the multi-factor logistic regression analysis, the most important feature remains the sense of dissatisfaction with ability to work. In the study it appeared to have a negative impact and resulted in a negative self-evaluation (OR = 5.043). Physical inactivity and dissatisfaction with personal relationships were another significant factors contributing to increase negative self-evaluation of the state of health: 2.7 and 2.5 times, corresponding to OR = 2.777 and OR = 2.517 (Graph ). For the purpose of the analysis of the impact of long-term unemployment on the mental state, the General Health Questionnaire (GHQ – 12) was used. Out of the whole group of the studied subjects, as many as 48 % demonstrated a risk of developing mental disorders. A statistically significant dependence between the period of unemployment and the result of the GHQ – 12 survey ( < 0.01) was observed. GHQ – 12 results higher than 2 points, indicating worsened mental state and a risk of developing symptoms such as depression or anxiety, were significantly more common in the group of long-term unemployed subjects (55.2 % whereas 41.1 % in short-term unemployed subjects) (Table ). Dissatisfaction with the ability to work turned out to be a factor seriously contributing to a negative self-evaluation. The risk of expressing such a view grew by more than ten times (OR = 10.752). Inability to assess the state of health resulted in a five times higher risk of expressing a negative self-evaluation (OR = 5.698) and in the event of dissatisfaction with personal relationships, the risk of developing mental disorders was more than four times higher (OR = 4.236) (Graph ). The nature of chronic diseases was also analyzed. More than half of the long-term unemployed subjects (52.2 %) admitted that they had been diagnosed with a chronic disease during their period of unemployment, or if the disease had already existed, it was exacerbated during that period. In the comparative group the percentage was 45 %. Disorders of the cardiovascular system were the most common in both groups. The incidence of disease in the study and comparative groups was not significantly different ( > 0.05) with the exception of diseases of the respiratory system, which were significantly more common in long-term unemployed people ( < 0.01) −7.8 % and 1.8 % (Table ). Generally women complained about chronic disorders more often than men. Only diseases of the respiratory system in the study group and diseases of the cardiovascular system in the comparative group were more often noted in men. No statistically significant relationship was observed between the incidence of chronic disease and sex – both in the main and the reference group. However it was indicated that women more often suffered from mental disorders than men – the difference was statistically significant ( > 0,05) (Tables  and ). The period of unemployment seems to influence the sense of well – being of unemployed people. In the group of long – term unemployed, 23.5 % of subjects considered the quality of life positive while in the reference group, 42.2 %. That evaluation is worse than the evaluation made by the young unemployed (aged 20 – 25) where 67 % subjects considered their quality of life positive (Axelsson et al. ). However, studies conducted on a representative group of Polish inhabitants show that quality of life of the unemployed subjects presented in this study is much worse: the evaluation of positive quality of life for Poland is around 70 % (Wciórka ; Czapiński and Panek ). Some other studies also indicate that the employed consider the quality of their life better than those who are unemployed (Martella and Maass ; Bernklev et al. ; Jiang and Hesser ; Zagożdżon and Ejsmond ; Vanassche et al. ). One of the most important factors influencing the general evaluation of the quality of life was the financial situation of the household. A good financial situation significantly increased the chance of positive opinion of quality of life of the unemployed. This confirms the findings from previous studies in which financial condition, especially low – income, is a significant factor of low quality of life (Zahran et al. ; Powdthavee ; Rojas ). However, financial state is not the only factor which defines quality of life, social relationships also play a vital role in the level of quality of life of the unemployed. Satisfaction with personal relationships and living in a household with no other persons without a job may lead to a good perception of quality of life: this confirms the results of other studies that emphasize the role of social environment and the variety and extent of social relations in modifying the health effects of unemployed (Leeflang et al. ; Béland et al. ). Unemployment-related stress results in lower self-evaluation of the state of health. The results are similar to the previous studies (Blaxter ; Latalski et al. ; Kostrzewski and Worach-Kardas ). In comparison to the whole population, the long-term unemployed subjects consider their state of health more negative. Only 45 % of long-term unemployed subjects claim it to be good, but the average percentage for the whole Polish population is 72 % (Czapiński and Panek ). One clear indication of the findings is that unemployment-related stress results in a worsened mental state and the appearance of negative emotions (Leeflang et al. ; Claussen et al. ; Bjarnason and Sigurdardottir ). The authors concluded that long-term unemployment is highly stressful and in the group of the subjects remaining without work for more than 12 months, apathy and depression symptoms appeared. Those remaining out of work for a period up to 6 months more often developed mental disorders. In the opinion of some researchers, some serious psychological disorders might sometimes appear within the period of 6 months following the loss of work. Although this psychic instability wears off after the this 6-month period, they are still threatened with anxiety, fears, lack of self-confidence and depression (Rowley and Feather ; Warr ). Population studies, both retrospective and prospective, indicate that in the period of unemployment, the probability of developing somatic diseases is higher. The longer the period, the more episodes of somatic disease are noted (Martikainen and Valkonen ; Leeflang et al. ). This study only partly confirms these observations. Long-term unemployed subjects admitted suffering from chronic diseases more often than short-term subjects did. The difference was not statistically significant. According to previous studies, unemployed people more often develop and die of cardiovascular diseases (Geyer and Peter ; Eliason and Storrie ). The present study shares the same observation : the most common diseases or were most often exacerbated in the period of unemployment were cardiovascular diseases. However, the study confirms that diseases of the respiratory system are related to length of unemployment. The results of studies conducted on the Finnish labour market and studies by L. Fagin, S.V. Kasl turned out to be similar (Przewoźniak ; Linkola ; Bańka ). Unemployment induces stress and can be treated as a negative environmental factor. According to the scale created by American psychologists T.H. Holmes and R. Rahe showing the relationship between life events and stress, loss of work is placed in the top ten most stressful life events. Unemployment is only less stressful than a disease or any other injury or the death of a relative. It is more stressful than a relative’s deterioration of health, retirement or sexual problems (Holmes and Rahe ). Results of the loss of work are not the same for all unemployed people. They depend on the age of the person and their time on the labour market. For people at medium- and late-productivity age, unemployment might often mean the end of their professional career, decreased pension benefits and further health disorders, which grow in number with age. Multi-factor logistic regression analysis confirmed that the effect of unemployment depends not only on the economic situation of the household but also on other accompanying factors. In order to maintain a good sense of well-being, it is important that unemployed, as well as unemployed care institutions, should be aware that factors other than noneconomic ones are also significant. It is important to take action aimed at maintaining both a good state of health and the individual’s sense of good health through physical activity and a healthy diet. Also efforts to counteract social exclusion , maintain diverse social relationships and promote integration and participation in the community may have an important positive influence on the sense of well-being of the unemployed. Although differences in health self-evaluation between long-term and short-term unemployed were observed, these were not statistically significant. The casual relationships between health and unemployment seem to be sufficiently unclear to make a clear identification of the deterioration of the state of health during prolonged unemployment impossible. Long- term unemployment seems to have more influence on subjective quality of life, in all dimensions, and health self-evaluation was an important factor increasing the chance of positive evaluation of quality of life. A multi - analysis conducted by Veenhoven () shows that happiness can foster physical health and protect from ill health. Happiness and a sense of well – being of the unemployed should be seen not only as an outcome of their life situation, but as prediction of their health potential, which is essential for re – employment. The research outcomes show that further studies on the relationship between health and unemployment should consider the modifying role of various socio – economic factors on the effects of unemployment, not only from the perspective of the physical health of the unemployed, but also that of quality of life and their subjective sense of well – being.

Choroideremia (CHM) is an X-linked eye disorder affecting 1 in 50,000 men []. The condition is caused by a mutation in the gene that encodes Rab escort protein 1 (REP-1) []. Males with CHM suffer from progressive vision loss beginning with night blindness at a young age, leading to complete blindness later in life. Female carriers are generally asymptomatic; however, occasionally a heterozygous female experiences mild symptoms []. The gene encodes the protein REP-1, an essential component of an enzyme complex formed with Rab geranylgeranyltransferase (GGT) []. A deficiency of GGT function caused by a mutation in leads to insufficient transfer of geranylgeranylpyrophosphate groups onto Rab proteins. Rabs cannot participate in pathways of intracellular vesicular transport in the absence of REP. REP-1 is normally expressed ubiquitously, and the loss of functioning REP-1 appears to be compensated by REP-2 in all tissues, except in the eye []. REP-1 function is particularly crucial for the function of the retinal pigment epithelium and photoreceptors []. Ultimately, lack of REP-1 results in the degeneration of these cells, as well as associated choroidal tissue. The gene spans 186,382 bp on the X chromosome. The mRNA is made up of 15 exons and is 5,442 bp long. All exons are fewer than 400 bp long, with the exception of exon 15, which is 3,642 bp []. The open reading frame is 1,962 bp and produces a 653 amino acid long protein (95 kDa). A wide variety of CHM-causing mutations have been identified: small deletions, nonsense mutations, missense mutations, frameshifts, splice site defects, retrotransposon insertion and deletion of the entire gene have been reported []. Thus, sequencing of the gene supplemented with immunoblot analysis has emerged as a diagnostic tool used to identify mutations causing CHM []. Due to the large size of the gene’s introns, amplifying them with PCR and sequencing the entire gene region for every patient is time-consuming and technically impractical. Thus, only exons and intron–exon boundaries are amplified and sequenced from the genomic DNA. Analysis of RNA can also identify mutations in exons and may provide insights into splice defects and exon deletions and duplications. However, although is expressed in all tissues, blood is most commonly used as the sample for analysis due to ease of collection and transport. The technical limitation in RNA extraction from blood samples that may not be fresh and the lack of availability of other tissues for analysis means that patient RNA is not always available for diagnostic testing. Immunoblot analysis using patient fibroblast cells reveals the presence or absence of the REP-1 protein []. If a fibroblast cell line cannot be obtained or when identification of the genetic mutation is required, a genomic DNA sample can be used to amplify the exons of the gene followed by sequencing to detect a mutation. Additionally, if no mutation is found in the genomic DNA, RNA can be extracted from patient cells, and cDNA of the CHM transcript can be created. The cDNA can be sequenced to verify any splice variations that cannot be predicted based on the sequencing results from the exon analysis. To detect copy number variation of exons in a patient, MLPA can be performed on genomic DNA, or an RNA analysis could be performed based on the availability of patient cells. Primers suitable for PCR amplification and subsequent sequencing have been designed by Bokhoven et al. []. Multiple protocols were required to amplify all 15 exons, so we sought primer designs for a more efficient procedure. The labor-intensive process of screening all exons can be streamlined to have one PCR reaction formulation and one uniform PCR condition that can be applied for all primers and can be processed at once on a single thermal cycler block. In addition, not all of these previously designed PCR primers work efficiently as sequencing primers; some exons can be sequenced in only one direction, which is suboptimal if the entire amplicon sequence is to be analyzed. In addition, the original method used two primer pairs to amplify the largest coding exon, exon 5. Through redesign, the reaction can be reduced to one primer pair resulting in a larger amplicon that can be sequenced using one primer pair []. Protein was extracted from a confluent fibroblast culture from one 10 cm cell culture dish (1–2 × 10 cells) in 500 µl of lysis buffer containing 0.05 M Tris pH8, 0.15 M NaCl, 1% Triton X, and protein inhibitor cocktail (, Basel, Switzerland). The cell debris was precipitated at 16,000 ×g for 15 min at 4 °C after 20 min incubation on ice. Aliquots were denatured in a 5× denaturing buffer containing 60 mM Tris pH 6.8, 25% glycerol, 2% sodium dodecyl sulfate, 5% β-mercaptoethanol, and 0.1% bromophenol blue, and boiled at 95 °C for 5 min. Proteins were separated via electrophoresis: 40 µl of denatured lysate was separated on a 10% sodium dodecyl sulfate-polyacrylamide gel with a PageRule Plus Prestained Protein Ladder ( Scientific, Waltham, MA). Proteins were transferred onto a nitrocellose membrane (, Hercules, CA) by electroblotting (2.5–3 h at 80 V). The membrane was blocked with 2% skim milk, 0.05% Tween-20 in 150 mM Tris pH 7.6, and 730 mM NaCl (TBS) and then incubated overnight at 4 °C with primary mouse monoclonal anti-REP-1 antibody (2F1, sc-23905; Santa Cruz Biotechnology, Dallas, TX) diluted 1:500 in blocking buffer or with 1:2,500 monoclonal anti-beta-actin-horseradish peroxidase conjugated antibody (Clone AC-15; Sigma-Aldrich, St. Louis, MO). Blots were washed twice for 10 min with TBS containing 0.05% Tween-20 followed by two 10 min washes with TBS. The 2F1 incubated blots are then probed with secondary goat anti-mouse immunoglobulin 1-horseradish peroxidase conjugated antibody (sc-2060; , Dallas, TX) diluted 1:1,000 in blocking buffer for 2.5 h and then washed as described above. The membranes were then incubated with Amersham ECL Plus Western Blotting Detection System (, Fairfield, CT) according to the manufacturer’s instructions, and protein bands were detected using KODAK BioMax MR Film in a Kodak X-OMAT 2000 X-ray film processor (, Rochester, NY). For a 50 µl reaction, the following reagents were included: 10 µl of 10X Pfx Amplification Buffer (, Burlington, ON), 1.5 µl of 10 mM dNTP mix, 0.75 µl of 50 mM MgSO, 1.5 µl each of 10 µM sense and antisense primer (, Coralville, IA; ), 0.4 µl of Platinum Pfx DNA polymerase (Invitrogen), 100 ng of genomic DNA template, and sterile HO. The PCR product was gel extracted with the QIAEX II Gel Extraction Kit according to the manufacturer’s directions (Qiagen, Germantown, MD). The concentration of gel purified DNA was determined with a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific). Samples were sequenced ( MWG Operon, Ebersberg, Germany) using sense and antisense PCR primers. Sequence chromatogram files were edited and aligned with NCBI reference sequence NC_000023.10 by ChromasPro (, South Brisbane, Australia). The MLPA analysis was performed as described by Chi et al. []. The data were analyzed with Coffalyser.Net software (MRC-Holland, Amsterdam, Netherlands). Fibroblasts were cultured from skin biopsies obtained with consent from patient and control subjects. Written informed consent was obtained from all research participants. The protocols were approved by the Health Research Ethics Board of the University of Alberta and adhered to the tenets of the Declaration of Helsinki and the ARVO statement regarding research on human subjects. The skin biopsies were finely minced with a sterile scalpel blade and placed in Cascade Biologics attachment factor (Invitrogen) coated wells of a six-well culture dish and incubated in a high-glucose DMEM (Sigma-Aldrich Co., catalog number D5671, St. Louis, MO; supplemented with 20% fetal bovine serum, penicillin-streptomycin, non-essential amino acids, L-glutamine, and sodium pyruvate; Invitrogen) at 37 °C, 5% CO. The cultures received fresh medium every 3 days, were observed for outgrowth of fibroblasts, and were transferred to a 6 cm culture dish at confluence. Fibroblasts were subsequently cultured in 10 cm culture dishes. The NetPrimer applet (PREMIER Biosoft International) was used to evaluate the predicted efficiency of primer sequences flanking the open reading frame of the CHM cDNA () and to determine features of the primer pair, including hairpins, self-dimers, and cross-dimers. For a 20 µl reaction, the following reagents were included: 4 µl of 5× Phusion HF Buffer (Thermo Fisher Scientific), 0.4 µl of 10 mM dNTP, 1 µl of 40 µM sense primer (Integrated DNA Technologies), 1 µl of 40 µM antisense primer (Integrated DNA Technologies), 0.2 µl of Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific), 1 µl of 1/3 diluted cDNA template, and sterile HO. The PCR products were gel extracted, and the concentration of DNA was measured according to the same procedure followed for products derived from genomic DNA (see above). Samples were sequenced using specific primers covering the entire range of PCR products (). Sequence chromatogram files where edited and aligned with NCBI reference sequence NM_000390.2 by ChromasPro (Technelysium). Currently, 133 unique mutations have been reported and catalogued (, Retinal and Hearing Impairment Genetic Mutation database). Missense mutations have rarely been identified in affected patients, with four noted in the database. Three-dimensional structures of the complexes REP1/RGGTase and REP1/Rab7 from Rattus norvegicus , Immunoblot analysis of the control and patient samples demonstrates the detection of REP-1 in the control patient and the absence of REP-1 in this patient with CHM (). The absence of REP-1 protein detected by an immunoblot assay is the most direct method for molecular diagnosis of CHM (). If REP-1 is present, it may be necessary to analyze the size of the protein product detected. Truncated REP-1 proteins have been reported []. If a protein of expected size is present, this suggests the patient may not have choroideremia, but it cannot be ruled out yet; further testing such as a genomic DNA analysis will provide more insight. If the protein is larger or smaller than expected, this suggests CHM. A larger protein suggests a large insertion within an exon or large duplication of an exon or a splice defect. The difficulty in obtaining cells (other than from peripheral blood) from which proteins are extracted for the immunoblot assay limits the use of this method. In practical terms, protein obtained from peripheral blood cells has proved to be a problem in allowing clear differentiation of bands when probed with anti-REP1 antibody. Although most clinical laboratories have the capability of drawing blood or extracting genomic DNA, a fibroblast culture from skin fibroblasts (or a lymphoblastoid cell line) is not always practical to set up. Since we receive patient samples from all over the world, practical issues related to shipping the samples and concerns in timely sample processing must be considered. This may limit the type of specimen available for diagnostic purposes, and immunoblotting is not always initially performed. In addition, this assay does not determine the nature of the mutation, only whether the REP-1 protein is present, absent, or abnormal in size. A normal protein product would be expected when analyzing a potential female carrier with immunoblot analyses. In the case of a large deletion or insertion, a secondary protein band of improper size may be detected, indicating a female carrier. If no secondary band is detected, the immunoblot results would be inconclusive, as it cannot distinguish whether there are one or two functional copies of . An additional complication arises because each female cell has only one active X chromosome attributable to lyonization [], a process that occurs early in embryonic development and is random, resulting in a mixed cell population of cultured skin fibroblasts or lymphocytes. expression analysis in cell cultures derived from heterozygous females could therefore be skewed. A portion of the cells in culture would be expected to express intact REP-1 and could produce immunoblot results representative of a healthy individual lacking mutations []. Moreover, if a mutated and consequently misfolded REP-1 protein was produced, it would likely undergo degradation by the proteasome and go undetected. Therefore, in most cases no conclusion can be drawn about the results of the immunoblot analysis of protein from a presumed female carrier, and the assay is generally not used to diagnose these individuals. PCR-based single-strand conformation polymorphism (PCR-SSCP) analysis was a method traditionally used in molecular genetic diagnosis to identify exons with mutations []. The mutated exon was sequenced afterwards. The accessibility and cost of sequencing have decreased dramatically, and thus, it has become more efficient to sequence all exons without performing PCR-SSCP. When combined with the newly designed primers for exons 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 15, all primer pairs produced an amplicon of expected size with no nonspecific products. A gel picture was created of all 15 exons after capillary electrophoresis with the QIAxcel DNA Screening Kit (Qiagen; ). Forward and reverse primers successfully sequenced the respective exons. Amplification and purification of exons from genomic DNA primarily identify small mutations such as transitions, transversions, and small deletions that account for approximately 70% of mutations detected through sequencing [] (). It is therefore possible to draw conclusions regarding the absence of a PCR product. The absence of multiple sequential exons suggests a large deletion, whereas the absence of a single exon may indicate a deletion or large insertion (which prevents amplification of the targeted template under the chosen PCR conditions). A mutation detected at the intron–exon boundary, especially changes to the invariant GT and AG sequences at the 5′ and 3′ exon and intron junctions, respectively, can be presumed to result in aberrant splicing. The effect of mutations situated elsewhere in the extensive consensus sequences spanning 5′ and 3′ splice sites, however, can be confirmed only with RNA/cDNA analysis []. Sequencing cannot rule out CHM, even if no mutations are found in the exon sequences, because in this analytic approach the introns and control regions (such as the promoter and 3′ untranslated region [UTR] likely involved in translational control) are not considered. This method is non-quantitative and may not detect increased copy numbers of exons or inversions of exons. The mutation spectrum of is dominated by changes that result in the absence of REP-1 due to a premature stop codon and subsequent degradation of the inappropriately folded protein or truncated mRNA. Few disease-causing amino acid substitutions have been reported; the pathogenicity of these missense mutations may be confirmed with immunoblot analysis []. MLPA is a quantitative assessment of genomic DNA. The presence or absence of amplicons and their relative amount indicates the copy number of the region being tested [] (, ). If, after data normalization, the dosage quotient of amplicons from a patent sample is less than 0.7 times that of the control, the assay suggests a mutation is present at the binding site of the probe, including a deletion or possibly an insertion. If the dosage quotient for an amplicon from a patient sample compared to a control sample is at least 1.3 times greater, this indicates a duplication or multiplication of the probe binding site, which leads to a non-functional REP-1 protein resulting in CHM []. If the MLPA amplicons produced from the patient sample are detected at levels within the acceptable range (0.7–1.3 times) of a control sample, duplication or deletion of the probe binding site and an insertion within the binding site can be ruled out. This result alone cannot rule out or diagnose a patient with CHM; the case requires further testing as no mutations would be detected outside the probe-binding region. Therefore, this test is generally performed only when no other mutations have been identified in previous analyses. MLPA is also invaluable as the assay can detect copy number variations or deletions in heterozygous female carriers due to its quantitative nature. However, MLPA can detect mutations in male and female patients only if the mutations are within or contain the probe-binding region. In addition, although this method can detect duplications, deletions, and insertions in the region, the specific location of the breakpoints remains unknown. MLPA is not appropriate for detecting the insertion direction of a duplicated copy or its exact location in the genome. Primers designed to amplify the open reading frame (ORF) of RNA produce a PCR product of the expected size on a control sample (). The forward and reverse sequencing primers produce sequences spanning the full length of the amplicon. The process of isolating RNA and reverse transcribing it into cDNA may identify a patient with CHM in whom no mutation has been detected with genomic analysis. The absence of cDNA suggests the patient is affected by CHM. This absence may be due to a complete or partial deletion of the gene (which could also be detected in genomic analysis), a mutation in a regulatory region, or a mutation resulting in an unstable and readily degradable RNA molecule []. If a transcript is detected, its size and sequence can lead to further conclusions. By analyzing the cDNA sequence, it is possible to confirm base substitutions, deletions, and insertions and detect splice variants. Similar to performing an immunoblot analysis, this method is selected on a limited basis, as samples appropriate for isolating high-quality RNA are not always available. In addition, this technique relies on PCR amplification of cDNA, and only the region within the primer pairs can be fully analyzed. Although the entire open reading frame is contained, the current primer pair excludes the majority of the large 3′ UTR. Since mutations in the 3′ UTR could affect translational control [], we may want to include analysis of the 3′ UTR of the genomic or mRNA sequence in future sample analyses where no other mutations have been identified. Normal results would likely be obtained when the RNA of potential female carriers is analyzed. A second PCR product of improper size may be detected on an agarose gel indicating a female carrier. If no second band is detected, then no conclusion can be made because the woman could either have no RNA from one copy of the gene or have two normal copies of the gene producing normal RNA. Additionally, as with immunoblotting, a mixed population of cells arising from lyonization skews expression. RNA analysis of cell cultures may not show any mutations, especially if mutated mRNA species go undetected due to nonsense-mediated RNA decay. It would be possible to sequence the cDNA product and find a point mutation; however, the same mutations can also be detected with a genomic DNA analysis. Consequently, RNA analysis is of limited utility in diagnosing female carriers; genomic DNA analysis and MLPA are the most reliable methods for identifying a female carrier. The availability of fibroblast samples from patients and the challenges related to shipping and maintaining the samples limit the potential of diagnostic techniques for proteins and mRNA. Fibroblast cells have a finite life span; a cell culture can be maintained for only a limited number of passages []. As an alternative to fibroblast cells, lymphoblastoid cells can be immortalized through transformation with Epstein-Barr virus []. Lymphocytes for transformation are present in the blood, which is more easily obtained than fibroblast cells from a skin biopsy. Lymphocytes can be isolated and transformed even after sample shipping or long-term cryopreservation of blood samples. Patient cells can also be obtained in the form of buffy coat leukocytes from peripheral blood samples for direct use in immunoblots []. This method is more time efficient than creating a cell line. However, to avoid protein degradation, the blood sample must be fresh (same day preferable). This cannot always be guaranteed due to transit times required to move the blood sample to the analyzing laboratory. In addition, serum components from the buffy coat may interfere with REP-1 detection on the immunoblot. Interpreting an immunoblot derived from buffy coat lysates relies on ascertaining the absence of a band in a background of non-specific protein bands. This presents a challenge that can be overcome by using lysates from a more homogenous source such as cell culture, where REP-1 blots show one clean distinctive protein band around 90 kDa. Various techniques provide many tools for confirming a diagnosis in patients and carriers of choroideremia and providing molecular evidence to families. Streamlining the genomic analysis protocol improves the efficiency in diagnosing and detecting sequencing mutations. Each analysis method discussed (immunoblot, genomic analysis, MLPA, and RNA analysis) has benefits and limitations, but when combined, the methods are quite effective at detecting mutations considering the availability of sample materials for analysis. We hope that this manuscript will help guide molecular genetic diagnostic testing for families affected by this condition.

Retinoblastoma (RB; OMIM ) is the most frequent primary intraocular malignant tumor in children, probably arising from cone precursor cells []. RB mainly affects children under 6 years old, with an incidence rate of 1 case per 15,000 to 20,000 live births [,]. According to the “two-hit” hypothesis, RB includes hereditary and nonhereditary forms, resulting from the mutation of both alleles of the gene (Gene ID: 5925) [,]. Approximately 40% of the cases (including all bilateral and 15% of unilateral RB) are heritable, carrying a germ-line mutation transmitted as an autosomal dominant trait with 90% penetrance [,]. The other 60% of cases are non-heritable RB (85% unilateral RB), caused by the inactivation of both alleles in the developing retina []. The gene was the first tumor-suppressor gene found, located in 13q14.2, and the whole DNA length is 183 kb. Mutations in the gene are highly heterogeneous and scattered in the promoter and the 27 coding exons. . In developed countries, gene testing has already been applied as a routine examination in RB probands [,], since the detection of mutations provides evidence for genetic counseling and clinical management. However, molecular diagnosis is still in its early stages in China. A search of the PubMed and Chinese databases, including CNKI () and , revealed several studies regarding alterations in Chinese patients with RB [-]. However, these studies mainly focus on pedigree or have a small sample size, with no definitive analysis of mutational characteristics and the correlation between genotype and phenotype. Therefore, our cooperative group, which is based on encouraging treatment outcomes of patients with RB reported in a previous article [], developed the molecular detection project to further enhance the level of clinical management of retinoblastoma. We have already reported several alterations by using DNA sequencing with a detection rate of 78.6% in bilateral RB [], which had not been capable of screening all variations. Here, we demonstrate that combining DNA sequencing and multiplex ligation-dependent probe amplification (MLPA) for detecting the mutation spectrum of allows for the preliminary exploration of genotype–phenotype correlations. This study recruited a total of 85 unrelated RB probands, including 37 (43.5%) boys and 48 (56.5%) girls, who were diagnosed between January 2012 and October 2013 in a Chinese cooperative group consisting of the Children’s Hospital of Fudan University and the Eye & ENT Hospital of Fudan University. The genetic testing results, using Sanger sequencing, of 35 of these patients were reported in a previous paper published in Chinese [], but new findings emerged using the complementary MLPA method. The combined results are discussed in the present paper. The patients included 39 cases of bilateral RB and 46 cases of unilateral RB. Clinical features, including laterality, age at diagnosis, and International Classification of Intraocular Retinoblastoma (ICRB) staging at diagnosis (Appendix 1), were recorded. After the study protocol was approved by the Institutional Review Board of Fudan University, informed consent for genetic testing was obtained from the guardians of children affected with RB. The study protocol was in accordance with the provisions of the Declaration of Helsinki and the ARVO (the Association for Research in Vision and Ophthalmology) statement on human subjects. Peripheral blood samples (3 ml) were collected from the probands in EDTA (EDTA) anticoagulant tubes. Blood samples were stored at −20 °C until DNA was extracted. Primers were designed according to a previous study by Abouzeid et al., with some modifications, using the Oligo software (National Biosciences, Plymouth, MN) []. Twenty-four pairs of primers were generated, which covered all coding exons and at least 50 bp flanking intronic sequences of each exon. PCR reactions were performed in a thermal cycler (ABI 2700), in a total volume of 10 µl containing 40 ng of genomic DNA, 2 picomoles of each primer, 0.2 µl of Taq DNA polymerase, and 1 µl of 10× buffer. Dimethyl sulfoxide (DMSO, 10%) was added to the exon 1 amplification system. Reactions were performed for the first 14 cycles of denaturation at 95 °C for 30 s, annealing at a specific temperature gradient (65 °C, −0.5 °C per cycle) for 30 s, extension at 72 °C for 40s; the second 20 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 40 s, and a final extension step at 72 °C for 5 min. The PCR products were qualified with agarose gel electrophoresis. After the unincorporated deoxynucleoside triphosphates and primers were removed using Exonuclease I and shrimp alkaline phosphatase, the PCR products were directly sequenced using the ABI BigDye Terminator v 3.1 Sequencing Standard Kit (Carlsbad, CA) and run on an ABI 3500 Genetic Analyzer. The sequence data were analyzed by comparison to the consensus sequence of the gene (), using Mutation Surveyor (V 4.0) software (SoftGenetics; State College, PA). Additional information was obtained from the literature, the (LOVD, 2010), the Human Gene Mutation Database (, 2007), and the Thousand Genomes Project (). The functional consequences of the mutations were predicted by bioinformatics tools, , and . MLPA analysis was applied in bilateral probands who did not show germ-line mutations in DNA sequencing and in unilateral probands whose guardians demanded additional genetic examinations, considering the earlier age at diagnosis, which was less than 1 year old, although the DNA sequencing results had been negative. Gross deletion and duplication of were examined using methylation-specific (MS)-MLPA analysis, the commercially available SALSA MLPA P047 RB1 probemix (MRC-Holland, Amsterdam, The Netherlands). This P047-C1 RB1 probemix contains probes for 26 of the 27 exons and 13 reference probes. This method was used to detect loss of heterozygosity (LOH) status of the gene located on 13q14. The procedure was based on the manufacturer's protocol. Each MS-MLPA reaction was subjected to further analysis on an ABI 3730 automated sequencer (Applied Biosystems). The data were analyzed with GeneMarker v1.91 (SoftGenetics) according to the manufacturer’s instructions. The relative value of probes compared to the reference control was calculated. Threshold ratios for deletion and duplication were set at 0.75 and 1.35, respectively. The peak ratios for all target loci in a 1:1 ratio indicated normal copy numbers. The reduced or amplified signal of probes with <0.75 or >1.35 indicated loss or gain, respectively, of the copy number in these probe loci. Data were analyzed using SPSS software (version 16.0, Chicago, IL). Statistical analysis was performed with one-way ANOVA, the chi-square test, and Fisher’s exact test. p<0.05 was considered to indicate statistical significance. #text In our study, all mutations were classified based on the prediction whether the transcripts harbored a premature translational-termination codon. Transcripts from alleles of the gene with null mutations have been shown to be subject to degradation by nonsense-mediated decay (NMD) [-], resulting in no detectable protein. Therefore, a null mutation is a comparatively more severe mutation than an in-frame mutation. Of the 31 probands with null mutations, 96.8% had bilateral RB, while only 66.7% of the probands with in-frame mutations developed bilateral RB (). Early onset retinoblastoma was seen more with null mutations (average age at diagnosis was 10.7 months) than in-frame mutations (average age at diagnosis was 13.5 months). These results are consistent with reports from Canada and India [,], and confirm that null mutations tend to the severe phenotype (early onset and bilateral RB). However, ICRB staging, an additional clinical feature, did not seem to be correlated with genotype. Group E was the most frequent staging at diagnosis in our study, which had no remarkable differences between patients with null mutations and in-frame mutations. We believe that tumor staging might be more related to access to care rather than the type of mutation. Interestingly, cases with negative genetic testing results, which were mostly non-hereditary (42 unilateral and 3 bilateral probands), seemed to present with more serious clinical staging at diagnosis, with 16 (33.3%) extraocular extension tumors. The finding that advanced tumors tend to occur in non-hereditary cases might be explained by two hypotheses. First, most of the hereditary cases were bilateral RB, and the growth of the retinoblastoma tumors in the two eyes was not completely synchronous. The first-discovered eye disease in bilateral probands likely contributed to early diagnosis of another eye disease. Second, the growth processes of retinoblastoma tumors might have certain differences between patients with and without germ-line mutation, resulting in faster tumor growth in probands with negative genetic testing. A recent study reported that a previously unrecognized subtype of retinoblastoma tumor with intact alleles had high-level v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN) oncogene amplification, which might initiate retinoblastoma with intact alleles []. This suggests that the underlying mechanism involved in the initiation or development of retinoblastoma tumor could be investigated in future studies. Our mutational distribution results revealed that mutations were scattered along the genomic sequence (), lacking hot spots clustered in the important functional domains—A/B pocket regions. Richter et al. reported that 13 of 15 missense mutations of the gene gathered in the A/B pocket and the intervening spacer region, confirming that in-frame mutations favored the critical regions []. However, only five of the nine missense mutations appeared in the A/B pocket domains in our study. All five missense mutations that appeared in the A/B pocket domains were identified in bilateral probands, while only one of the four missense mutations that appeared in other regions were identified in bilateral probands, suggesting that in-frame mutations in A/B pocket domains could be considered to have more complete penetrance. Mutations occurring in different regions along the gene still need to be investigated in a study with an expanded sample size. We reported a detection rate of 78.6% in our previous paper by using single DNA sequencing. Here, a method combining DNA sequencing and MLPA increased the detection rate to 92.3% in bilateral RB, which is consistent with an earlier study that reported that the mutation detection rate was 92.6% via a combination of full sequencing and deletions/duplication analysis of []. The remarkable enhancing of the effectiveness of detecting gross deletions attributable to MLPA was 20% (8/40)), which is slightly higher than in previous studies []. However, defects can also result from hypermethylation of the promoter region and different levels of mosaic mutations, as evidenced by reports that highly sensitive allele-specific PCR increased the sensitivity from 92.6% to 94.8% for detecting mosaic mutations []. Detecting methylation and mosaic mutations of would be interesting in future studies. In conclusion, we developed the molecular detection project to optimize the clinical management of all patients with retinoblastoma. This study reports our results involving 31 patients who had been identified with null mutations and nine patients identified with in-frame mutations. The different groups had different clinical outcomes, and the type of mutations was related to age of onset and laterality, but not related to staging of the tumor, which has implications for genetic counseling. In addition, 20% of the total mutations were detected with MLPA, which confirms that combining sequencing and MLPA is a convenient, reliable, and powerful method for evaluating gene mutations in patients with retinoblastoma.

The RPE is a monolayer of nondividing cuboidal cells that are critically important for the nourishment and overall integrity of photoreceptor cells []. Thus, RPE cells are a primary target of studies that aim to understand the fundamental mechanisms of cell survival. Failure in sustaining RPE cell viability is a key event in the early pathophysiology of age-related macular degeneration and in the expression of mutations that lead to retinitis pigmentosa [,]. Moreover, there are still numerous voids in our knowledge regarding endogenous events that sustain RPE cell survival. Several models attempt to investigate degeneration of RPE cells, including the model of intravenous injection of sodium iodate (SI) []. While it has been shown that SI exerts toxic effects on RPE cells [-], the mechanisms by which the damage occurs are poorly understood. The complexity of cell survival is obvious and the understanding limited by the multiple pathways being involved. However, some pathways are increasingly being recognized as important in the maintenance of cells. One of these involves phospholipases A (PLA), which have been shown to participate in cell survival and death [-]. Generally, PLA consists of a superfamily of enzymes with the shared ability to catalyze hydrolysis of the -2 fatty acyl ester bond of glycerophospholipids, resulting in the production and release of both lysophospholipids and free fatty acids. PLA is commonly divided into four groups: 1) calcium-independent (i)PLA including mammalian groups VIA1(iPLA), VIA2(iPLAβ), VIB(iPLAγ), VIC(iPLAδ), VID(iPLAε), VIE(iPLAζ), VIF(iPLAη); 2) cytosolic (c)PLA including mammalian groups IVA (cPLAα), IVB (cPLAβ), IVC(cPLAγ), IVE(cPLAε), IVF(cPLAζ); 3) calcium-dependent secreted (s)PLA [-];and 4) platelet activation factor-specific PLA (PAF) also known as PAF-acetylhydrolases [-]. Previously, we identified various PLA in RPE cells and suggested that iPLA-VIA participates in RPE homeostasis [-]. Our studies have revealed the highest concentration of iPLA-VIA in RPE cells and have shown a role of iPLA-VIA in RPE phagocytosis of photoreceptor outer segments [,] and in RPE cell migration []. Strokin et al. demonstrated an increased expression and activity of iPLA-VIA in triggering a damaging neuroinflammatory response [], and other studies have demonstrated a role of iPLA in cell death [,]. In most cases, the proliferative phenotype of RPE is seen during pathological conditions in which proliferation is enhanced and cell survival is at risk. In line with this, we demonstrated an increased expression and activity of iPLA-VIA in proliferating RPE [], and it is plausible that iPLA-VIA tilts the balance from RPE survival to cell death. The present study examines the toxicity of SI on RPE cells and uncovers a potential role of iPLA-VIA and cPLA-IVA in RPE cell survival. All materials used and methods performed in the present study are in compliance with the Declaration of Helsinki and the ARVO animal declaration. The human cell line ARPE-19, an immortal RPE cell line from a 19 year-old donor (purchased from ATCC, LGC Promochem AB, Borås, Sweden) was maintained at 37 °C in a humidified chamber of 5% CO in Dulbecco’s modified Eagle’s medium-F12 (DMEM; Product number 31966, Life Technologies, Paisley, UK) containing 5 mM glucose, supplemented with 15% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin (Product number 15140-122, GIBCO, Life Technologies). Experiments were performed using ARPE-19 cells from passages 20 through 24. Cells were grown in 96-well or six-well plates, and the culture medium was replaced with fresh medium twice a week. Cells were harvested after 5 days (nonconfluent) or after 3 weeks (confluent) and kept at –80 °C until use. Primary mouse RPE cultures were set up from eyes of 12- to 14-week-old mice as briefly described below []. The iPLA-VIA transfection studies were performed with B6 wild-type mice (WT; Taconic Europe, Ejby, Denmark), whereas the knockout studies were done with iPLA-VIA knockout (KO) 129/SvJ x C57BL/6 mice. WT and KO mice were identified through genotyping before inclusion in the iPLA-VIA knockout studies. Primary RPE cultures were grown as previosuly described []. Briefly, mouse eyes were enucleated and left in HEPES Hanks Balanced Salt Solution (HBSS, Product number BE10-527F, Lonza, BioWhittaker, Vallensbæk, Denmark) buffered (pH 7.4) with Ca and Mg for 3 h on ice to facilitate separation of the neural retina from the RPE layer. Eyes were cut circumferentially along the limbus, and the anterior segments and the lens were removed. The remaining eye cups were incubated in a 0.2% trypsin solution without EDTA (pH 8.0; Product number T4799, Sigma, Copenhagen, Denmark) for >1 h at 37 °C, after which they were transferred to HEPES buffered HBSS for the isolation of RPE cells. RPE cells were carefully scraped off using a needle, and the cells were collected into an attached syringe. Cells were then transferred to a tube and centrifuged at 560 ×. Finally, the cells were resuspended in DMEM containing 0.5 mM L-arginine and supplemented with 20% heat-inactivated fetal calf serum, L-glutamine (Product number 25030-024, Lifetechnologies, Nærum, Denmark) 2 mM, MEM nonessential amino acid solution 0.1 mM, and gentamycin (Product number 15710-049, Lifetechnologies) sulfate 10 µg/ml. Cells were grown in 96-well plates and incubated at 37 °C in a humidified chamber with 10% CO, and two-thirds of the culture medium was replaced with fresh medium twice a week. Eighty percent confluent ARPE-19 cells in 96-well plates were transfected with the pGL3-basic vector (a luciferase reporter vector; Promega, Roskilde, Denmark) containing a human iPLA-VIA promoter driving luciferase, using the ExGen 500 (Product number R051; Fermentas, Copenhagen, Denmark) transfection kit. In short, a mixture of the vector-DNA and ExGen 500 was prepared of which 20 µl was added to each well containing the adherent ARPE-19 cells and 200 µl culture medium with serum. The plates were centrifuged at 280 ×g for 5 min. to enhance the transfection process and subsequently incubated for 48 h at 37 °C in a humidified chamber with 10% CO. Finally, the cell were exposed to 1 mM SI for 24 h before analysis. Nonconfluent and confluent ARPE-19 cells were harvested, and RNA was converted into cDNA using a RevertAid First Strand Synthesis kit (Fermentas) according to the manufacturer’s instructions. iPLA (forward: 5′-GCA ATG CTC GGT GCA ACA T-3′, reverse: 5′-ACA CCC CTT CTG AGA GAA CTT CA-3′) and cPLA (forward: 5′-ACT GCA CAA TGC CCT TTA CC-3′, reverse: 5′-GAG CCT CTG CTT TGT GAA CC-3′) primers were purchased from MWG Biotech. Quantitative PCR (qPCR) was run in 96-well plates using the Brilliant SYBR Green qPCR Master Mix (Product number 600882, Stratagene, Hørsholm, Denmark) in a Stratagene Mx3000P qPCR system. The PCR program was: 95 °C for 10 min, 40 cycles of 95 °C for 30 s, 60 °C for 1 min, and 72 °C for 30 s. A dissociation curve was generated for each gene, and a standard curve for both the test gene and the housekeeping gene (GAPDH) was run to monitor PCR efficiency. Data were analyzed using MxPro software version 3.20 (Stratagene) and the ΔCt method, by which an algoritm (Qty=10-ΔCt/slope) is used to calculate relative changes in the gene expression. Nonconfluent and confluent ARPE-19 cells were collected and homogenized in 500 μl lysis buffer (20 mM HEPES, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Triton X-100, 1 mM Na-ortho-vanadate, protease inhibitor cocktail; Sigma Aldrich, St Louis, MO). Samples containing 25 μg protein were loaded onto the gels, and blotting was performed according to the manufacturer’s instructions (Invitrogen). Blots were blocked over night with Tris buffered saline (TBS; 0.2 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% Tween-20) containing 5% nonfat dry milk and incubated with iPLA-VIA (CAY-160507, 1:500; Cayman Chem.,), cPLA-IVA (SC-438, 1:500; Santa Cruz), and iPLA-VIB (1:100) in TBS-1% skimmed milk and 25 µl sodium azide over night at 4 °C. Blots were washed in TBS and incubated with goat anti-rabbit immunoglobulin G alkaline phosphatase secondary antibody (TriChem ApS; Interkemi, Skanderborg, Denmark) followed by visualization using 5-bromo-4-chloro-3-indoyl phosphate-nitroblue tetrazolium substrate (VWR International ApS, Product number 8118, VWR, Herlev, Denmark). Protein samples were purified using a Cayman cPLA assay kit. Briefly, nonconfluent and confluent ARPE-19 cells were collected and homogenized in 150 μl lysis buffer (50 mM HEPES, 1 mM EDTA, 1 mM Na-ortho-vanadate, protease inhibitor cocktail 1:100; Sigma). Samples were centrifuged at 2,000 × for 30 min at –4 °C. Supernatants were collected and subsequently spun through 30 kDa cut-off filters (Microcon YM-30; Millipore) for 12 min at 14,000 ×. PLA activity was determined in the supernatants using a cPLA assay kit (Cayman Chem., Ann Arbor, MI) in the presence and absence of bromoenol lactone, a specific inhibitor of Ca-iPLA. Activity was calculated by measuring the absorbance at 405 nm, using the 5,5′-dithiobis(2-dinitrobenzoic acid) extinction coefficient of 10.66 per mm and reported as nmoles per minute per gram cytosolic protein. Lactate dehydrogenase (LDH) release was used to quantitatively access cell injury in cells exposed to SI. Inhibitors of PLA were used to identify their influence on RPE cell survival. The iPLA-VIA-specific inhibitors included bromoenol lactone (BEL; BioNordika, Herlev, Denmark, Cayman Chemicals, Product number 13179) and 1, 1, 1, 2, 2- pentafluoro- 7- phenyl- 3- heptanone (FKGK; Cayman). Additionally, the cPLA-IVA inhibitor CAY 10502 (Cayman) as well as the combined cPLA-IVA and iPLA-VIA inhibitor arachidonyl trifluoromethylketone (AACOCF3; Sigma) were used. LDH-release was assayed using a MWG Discovery HT-R spectrophotometer. In addition, cell viability was determined by the colorimetric assay 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) according to the manufacturer's instructions. Quantitative results are expressed as the mean ± standard deviation. One-way analysis of variance and Tukey’s multiple comparison post-test were used to evaluate the statistical significance of differences between other experimental groups. Paired Student test was used to evaluate the statistical significance of differences between some experimental groups. p<0.05 was considered statistically significant. ARPE-19 cell death was induced gradually by SI in a dose-dependent manner. Hence, after 24 h of SI exposure in nonconfluent cells, 0.5 mM of SI induced 34% cell death ±9% (n = 5), 0.75 mM induced 39% cell death ±8% (n = 3), 1 mM induced 46% cell death ±12% (n = 5), 2 mM induced 50% cell death ±11% (n = 3), and 5 mM induced 99% cell death ±57% (n = 2). In confluent cells exposed to SI for 24 h, cell death was generally less prominent. Hence, 0.5 mM of SI induced 31% cell death ±6% (n = 5), 0.75 mM induced 29% cell death ±6% (n = 2), 1 mM induced 26% cell death ±4 (n = 5), 2 mM induced 39% cell death ±16% (n = 5), and 5 mM induced 86% cell death ±9% (n = 2; ). Nonconfluent ARPE-19 cells were more vulnerable to SI treatment compared to confluent ARPE-19 cells when exposed from 2 to 48 h. A significant difference between nonconfluent cells (n = 3) and confluent cells (n = 3; p = 0.05) was found when ARPE-19 cells were exposed to 1 mM of SI for 24 h (). The same tendency was found after SI exposure for 2 and 48 h. Moreover, a significant increase in SI-induced toxicity was found at longer exposure periods. In nonconfluent cells, 20±12% cell death was seen after 2 h of exposure to SI (n = 3), whereas a 47±11% cell death and a 56±11% cell death were seen after 24 (n = 3) and 48 (n = 3) hours, respectively. In confluent cells the degree of cell death was consistently lower compared to nonconfluent cells. Hence, 3±19% cell death was seen after 2 h of SI exposure (n = 3), and 19±19% cell death and 29±18% cell death were seen after 24 h (n = 3) and 48 h (n = 3), respectively (). In primary mice RPE cultures a dose-dependent toxicity of SI exposure was found. Cells were exposed to 0.5, 1.0, 2.0, 5.0, and 10.0 mM SI, which resulted in 7±1%, 17±2%, 32±11%, 46±7%, and 54±3%, cell death, respectively (n = 3; ). To investigate the significance of iPLA2-VIA activation in RPE cell survival, ARPE-19 cells were transfected with pGL3-basic vector containing the human iPLA2-VIA promoter luciferase and subjected to 1 mM SI. After 24 h of exposure, luciferase activity was detected using the Luciferase Assay Freezer Pack (Promega). The results showed an increase in luciferase activity for cells exposed to SI when compared to controls (p<0.05, n = 3; ) reflecting transcriptional activation by SI. Furthermore, quantification of iPLA-VIA mRNA expression revealed a threefold induction after exposure to 1 mM SI for 24 h in nonconfluent ARPE-19 cells (p = 0.01, n = 3). Similarly, 1 mM of SI exposure induced a threefold induction of cPLA-IVA mRNA (p<0.0001, n = 3; ). The control levels of iPLA-VIA were sixfold higher in confluent cells compared to nonconfluent cells (p = 0.003, n = 3). A tendency toward downregulation of iPLA-VIA mRNA was observed when confluent ARPE-19 cells were exposed to SI (p = 0.08, n = 3; ). No change was found in either iPLA-VIA nor cPLA-IVA expression when confluent cells were exposed to SI (n = 3; ). Upregulation of the 85-kDa iPLA-VIA protein was 1.6 fold (p = 0.01) in nonconfluent ARPE-19 cells exposed to 1 mM of SI (). No upregulation was found in confluent cells exposed to SI (). A similar upregulation was seen for cPLA-IVA after exposure to 1 mM of SI. Hence, cPLA-IVA was upregulated 2.6 fold (p<0.01). Furthermore, iPLA-VIA-specific activity was found to be significantly higher in nonconfluent ARPE-19 cells after exposure to 1 mM of SI for 24 h compared to its respective control. The results revealed a 2.5-fold enhancement in activity after SI exposure in nonconfluent cells (p<0.05; ). The same tendency was seen for confluent RPE cells (1.89-fold induction); however this was not significant (p = 0.06). Cell death of mice RPE cells was increased in WT mice compared to KO mice. Exposing WT RPE cells to 2 mM of SI for 24 h revealed a toxic effect of SI resulting in 56±13% cell death compared to 15±9% cell death in iPLA-VIA KO mice RPE cells (p<0.001, n = 8; ). To investigate the effect of iPLA and cPLA inhibition on RPE cell death, more iPLA-, and cPLA-specific inhibitors were added, respectively, to nonconfluent and confluent cells exposed to SI. To determine the concentrations of the inhibitors, a preliminary experiment was conducted to measure the toxic effect of different concentrations of inhibitors on nonconfluent ARPE-19 cells. The inhibitors were not significantly toxic until reaching concentrations of 10 µM or higher (data not shown). Treament with both iPLA2-VIA- and cPLA2-IVA-inhibitors generally increased cell survival in ARPE-19 cells exposed to SI. Over all, the protective effect of the inhibitors was more pronounced in nonconfluent cells compared to confluent ARPE-19 cells. Hence, BEL (10 µM) and FKGK (10 µM) treatment resulted in increased survival of 40% (p<0.0001, n = 3) and 8% (p<0.05, n = 3), respectively. In confluent cells, BEL and FKGK inhibition did not protect against SI-induced cell death. The cPLA-inhibitor CAY10502 (10 µM) inhibited SI-induced cell death in nonconfluent ARPE-19 cells by 45% (p<0.0001, n = 3) and 7% (p<0.01, n = 3) in confluent ARPE-19 cells. After treating ARPE-19 cells with AACOCF3 (20 µM) to inhibit iPLA and cPLA, an 80% increase in survival was found in nonconfluent cells (p<0.0001, n = 3), whereas a 20% increase in survival was observed after SI exposure in confluent cells (p<0.0001, n = 3; ). Retinal degenerations compromise RPE cell survival, thus an improved understanding of the mechanisms involved is needed to help increase our knowledge of these conditions and lead to improved clinical therapies. SI is toxic to RPE cells [-], and doses below 20 mg/kg have little effect on the RPE cells in vivo, but doses of 25 mg/kg and above result in toxic effects to the retina [,]. In the present study a similar dose and time dependent SI toxicity was seen in ARPE-19 cell cultures. Furthermore, a general tendency towards more vulnerability in nonconfluent ARPE-19 cells compared to confluent cells was found (). Since RPE cells are known to proliferate early in diseased stages [,], it is tempting to suggest that their regenerative proliferative stage may be more vulnerable compared to their nonproliferative stable stage. In line with this, Kiilgaard and colleagues have shown that older confluent ARPE-19 cells were more resistant toward indocyanin green compared to nonconfluent cells []. We previously showed that increased amounts of iPLA-VIA are present in proliferating ARPE-19 cells []. Furthermore, other studies have identified the roles of iPLA-VIA and cPLA-IVA in RPE cell death [-]. Based on the previous evidence regarding the involvement of PLA in cell death and the findings that iPLA-VIA induction occurs in the more vulnerable proliferating RPE cells, the present study elucidated a possible role of iPLA-VIA and cPLA-IVA in RPE cell survival. To study RPE cell death, ARPE-19 cells were exposed to SI and the levels of iPLA-VIA and cPLA-IVA were explored. Overall, the general mRNA and protein levels of iPLA-VIA and cPLA-IVA were increased in confluent ARPE-19 cells and induction due to SI exposure was evident in nonconfluent ARPE-19 cells. Upregulation of iPLA-VIA after SI exposure was found in the high molecular 85-kDa band, which is comparable to the higher band expressed in proliferating ARPE-19 cells [] (). Expression of the low-molecular 70-kDa iPLA-VIA was confirmed to be higher in confluent cells (), which may explain the increased total mRNA expression of iPLA-VIA in confluent cells compared to nonconfluent ARPE-19 cells (). To confirm the role of iPLA-VIA in RPE cell death, primary RPE cells were exposed to SI. Consistent with ARPE-19 cell death, mouse RPE cell death was dose dependent (). Primary RPE cultures from iPLA-VIA KO mice were exposed to SI, and the induced cell death was compared to RPE cultures isolated from WT mice. Primary RPE cells from the KO mice were more resistant to SI exposure compared to RPE cells isolated from WT mice, thus confirming the role of iPLA-VIA in RPE cell death (). By means of commercially available inhibitors against iPLA and cPLA, we finally elucidated their ability to decrease SI-induced ARPE-19 cell death. When nonconfluent ARPE-19 cells were treated with the inhibitors against iPLA (BEL and FKGK), SI-induced cell death was decreased accordingly. Moreover, an apparent reduction in nonconfluent ARPE-19 cell death was seen by inhibiting cPLA through CAY10502. Selective inhibitors of iPLA did not prevent SI-induced cell death in confluent ARPE-19 cells (). The inhibitor studies indicated a dominant involvement of iPLA and cPLA in RPE homeostasis in nonconfluent cells compared to confluent cells. Since RPE proliferation is limited in the normal retina and since RPE proliferation occurs during pathological conditions in the retina, our findings suggests a potential role of PLA inhibition in RPE-related diseases. In line with the inhibitor studies, our present results showed decreased RPE death in mice deficient in iPLA, further implying a role of PLA in RPE death. Future studies are needed to confirm if iPLA and cPLA inhibition impedes RPE death in primary mice RPE and to further evaluate the importance of PLA in RPE homeostasis. The involvement of PLA in cell death has been reported in several studies [,,]. The present findings identify a potential pathway in RPE cell death involving induction of iPLA and cPLA. As mentioned previously, the function of RPE is essential for visual functioning, and various retinal diseases lead to RPE differentiation and proliferation; however, there is insufficient understanding regarding the underlying mechanisms that lead to RPE cell death. The present data suggest that iPLA and cPLA may be targets to consider in future treatments of RPE-related diseases. However, the involvement of iPLA is complex since it also has been shown to play a role in RPE phagocytosis of photoreceptor outer segments []. This process is essential for the normal retina. Hence, iPLA may be an important molecule in normal RPE, whereas iPLA-induction may cause RPE damage in diseased proliferating RPE cells. The role of cPLA may be more important in diseased RPE cells since the present study found a pronounced induction of cPLA, indicating that it may take part in the cascade reactions that lead to RPE cell death. In conclusion, the data presented here provides evidence for the involvement of iPLA-VIA and cPLA-IVA in SI-induced RPE cell survival. These studies could lead to future pharmaceutical targets involving PLA to help protect RPE cells from retinal degenerative diseases.

Hereditary retinal dystrophies (RDs) are a large group of clinically and genetically heterogeneous retinal diseases that constitute a major cause of vision handicap in the global population []. They are typically characterized by the progressive loss of rod and cone photoreceptor cells often leading to severe blindness. There are similar fundus appearances among different RDs, including retinal pigment epithelium (RPE) changes, attenuated retinal vessels, and waxy optic disc. To date, more than 100 genes associated with various RDs have been identified and partially characterized at the genetic and molecular level (). These gene functions involved diverse biologic pathways, including phototransduction, visual cycle, photoreceptor structure and morphogenesis, cell adhesion, cellular metabolism, vesicle and protein trafficking, synaptic function, cilium structure and transport, ion and small molecular transport, chaperones, RNA splicing, transcription factors associated with photoreceptor development, protein folding and subunit assembly, and posttranslational protein modification, among others. Some RDs associated with different pathogenic genes show the same phenotypes while patients with RDs with the same causative gene can present different phenotypes. Therefore, accurate and comprehensive molecular diagnosis is critical for confirming the clinical diagnosis, providing a disease prognosis, and in the long run providing the basis for novel therapeutic approaches and personalized medicine. However, molecular diagnosis of RDs is made challenging by the large number of disease genes. Recently, next-generation sequencing (NGS) technology has provided a high-throughput and cost-effective method for identifying causative genes for RDs that could sequence the candidate gene rapidly and accurately [-]. The causative mutations of approximately 50% to 80% of RD cases could be detected successfully using this method [-]. In this study, we identified four mutations in three unrelated Chinese pedigrees diagnosed with RDs: the known mutation c.942_944delGAA in a family with autosomal dominant retinitis pigmentosa (adRP), the novel mutation c.1924T>A in a family with Stargardt disease (STGD), and the novel mutation c.272A>G and the known mutation c.196C>T in a family with Leber congenital amaurosis (LCA). These variants were identified with the combined approach of target region sequencing–based NGS and candidate mutations validation with Sanger sequencing. They segregated with the disease phenotype in the respective families and were not detected in the normal controls database. All three pedigrees (Family-012, Family-024, and Family-035) described in this study were from Sichuan province in China. A detailed medical history was obtained by interviewing family members. The patients from the respective families underwent comprehensive ophthalmological examinations at the Southwest Eye Hospital, including best-corrected visual acuity (BCVA), dilated fundoscopic indirect ophthalmoscopy, and full-field electroretinograms (ERGs). ERGs were also performed and recorded according to the standards of the International Society for Clinical Electrophysiology (ISCEV). The normal controls database was from BGI, including 840 unrelated individuals, who were more than 50 years old and had no symptoms of night blindness, vision reduction, and any personal or family history of known inheritance disease. This research followed the tenets of the Declaration of Helsinki and received approval from the Ethic Committee of Southwest Hospital. Informed consent was obtained from all participants included in this study. A custom-made capture array (Roche NimbleGen, Madison, WI), from Beijing Genomics Institute-ShenZhen, was designed to capture the coded exons of the 100 RD genes (Appendix 1). Genomic DNA of the probands (Family-012 III:4, Family-024II:6, and Family-035II:2) was extracted from peripheral blood according to the manufacturer's standard procedure using the QIAamp DNA Blood Midi Kit (Qiagen, Hilden, Germany). Then the genomic DNA was fragmented to 200–300 bp by Covaris S2 (Woburn, MA). The library was pooled and hybridized to the custom capture array for 72 h at 42 °C. After hybridization, the array was washed and eluted according to the manufacturer's instructions (Roche NimbleGen). The captured library was sequenced on Illumina HiSeq2000 analyzers for 90 cycles per read to generate paired-end reads (following the manufacturer's standard sequencing protocols). Image analysis and base calling were performed using the Illumina Pipeline to generate raw data. To detect the pathogenic variants of the probands, we applied filtering criteria to generate clean reads (with a length of 90 bp) for further analysis, and then aligned the clean reads against the human genome reference from the (version hg19) using the BWA (Burrows Wheeler Aligner) Multi-Vision software package. Single-nucleotide variants (SNVs) and indels were identified using SOAPsnp software and the Samtools Indel Genotyper, respectively. All SNVs and indels were determined using the NCBI , project, , and the database of healthy Chinese adults from BGI. The candidate variations in known causative RD genes were validated with PCR and Sanger sequencing. PCR primers were designed via Primer6.0 as shown in . The PCR reactions were performed as follows: denaturation at 94 °C for 3min, followed by 30 cycles of 94 °C for 30s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1min, ending with a final extension step of 72 °C for 5min. The PCR products were sequenced using a BigDye terminator v3.1 cycle sequencing kit (ABI, Foster City, CA) and analyzed on an ABI 3730XL Genetic Analyzer. To predict the influence of these variants on protein function, we analyzed evolutionary conservation of these mutations using the ClustalW tool and examined the possible impact of the amino acid substitution with SIFT and PolyPhen tools available online. The pedigree Family-012 was consistent with autosomal dominant inheritance (). There were six affected individuals out of 20 members in this four-generation Chinese family. All the patients in the family had visual disabilities but no history of systemic abnormalities. Night blindness was always the presenting symptom, and the age of onset was about 12 years old (mean age of onset=11.6 years). Affected members also reported palpable peripheral visual field loss and mild visual acuity decline in their 30s. Funduscopic examinations revealed similar clinical manifestations among affected individuals, including waxy-pale discs, attenuation of retinal arterioles, bone spicule-like pigmentation in the periphery, and atrophy of the RPE (). ERGs showed non-recordable responses (). Family-024 had autosomal recessive macular dystrophy (). Affected individuals typically experienced significant reduction in central visual acuity in their second decade of life. The patients also showed a delay in dark adaptation in their 40s. Fundus photographs showed extensive atrophic-appearing RPE changes and pigmentation in the posterior pole of the retina (). Abnormal cone function (assessed with light-adapted 30 Hz and light-adapted 3.0) and rod ERG abnormality (assessed using dark-adapted 0.01 to dark-adapted 10.0) were observed on ERG (). Family-035 was a small recessive inheritance family with only two affected individuals (). They had horizontal nystagmus and poor vision but otherwise normal physical and mental health at 3 months of age. At 6–8 years of age, ophthalmological examinations showed that BCVA were about HM/30 cm in the both eyes, severe central atrophy with an appearance of macular coloboma. The remainder of the retina presented pigmentary changes, attenuated retinal blood vessels, and optic disc pallor (). All ERGs responses were nearly extinct (). In the respective probands of the three pedigrees, we first identified SNVs and indels in the coding regions and introns that may affect splicing. Since RDs are rare disorders but have a clear phenotype, the probability of patients with RDs sharing casual mutations with the healthy population is low. Therefore, we compared these variants in the proband with that of dbSNP132, HapMap project, 1000 Genome Project, and the healthy Chinese adults database from BGI. After filtering against these databases, four variants that might be associated with RDs diseases were left: The first was a heterozygous nucleotide deletion variation c.942_944delGAA in which was predicted to result in lysine deletion at position 314 (p.Lys314del p.K314del) in the proband of Family-012; the second was a homozygous single-nucleotide-polymorphic site c.1924T>A in leading to amino acid substitution of phenylalanine for isoleucine at position 642 (p.Phe642Ile p.F642I) in the proband of Family-024; the third and fourth were compound heterozygous mutations of c.272A>G and c.196C>T in that caused glutamic acid substitution for glycine at position 91 (p.Glu91Gly p.E91G) and amino acid substitution of arginine for tryptophan at position 66 (p.Arg66Trp p.R66W) in the proband of Family-035. The mutations of c.1924T>A and c.272A>G were novel and were first identified as associated with RDs, while c.942_944delGAA and c.196C>T have been previously reported to be pathogenic mutations that cause RP and LCA [,]. The Sanger sequencing results confirmed these variants (), and they cosegregated with respective RDs phenotype in the families (). The prediction analysis indicated that these variants were highly conserved across species (). In addition, SIFT and PolyPhen2 were performed to predict the effect of the novel missense mutation: c.1924T>A was possibly damaging according to SIFT, and c.272A>G was possibly damaging according to PolyPhen2 (). We reported four mutations associated with different RDs in three Chinese families: c.942_944delGAA with adRP, c.1924T>A with STGD, and c.272A>G and c.196C>T with LCA. To the best of our knowledge, our study is the first to describe the mutations of c.1924T>A and c.272A>G are associated with RDs. Target regions of known RD gene sequencing–based NGS was used to identify these variations, and Sanger sequencing of candidate mutations verified these mutations cosegregated with the disease phenotypes in the respective families, which were absent in the BGI normal controls database. Prediction analysis of evolutionary conservation and human nsSNPs functional effects suggested that this mutation might be highly deleterious. encoding inosine monophosphate dehydrogenase 1 widely expressed rate-limiting enzyme of the de novo pathway of guanine nucleotide biosynthesis and was identified in 2002 as associated with RP by linkage mapping []. might account for 5% to 10% of adRP cases among Americans and Europeans [,]. Patients with mutations presented severe autosomal dominant degenerative retinopathy, while it was interesting that null mice displayed a slowly progressive form of retinal degeneration [,]. Therefore, IMPDH1 misfolding and aggregation, rather than reduced enzyme activity, were the likely cause of the severe phenotype in the human form. c.942_944delGAA was first identified as an adRP mutation in a European family in 2013 []. All affected members in Family-012 carried this mutation and presented relatively earlier onset of symptoms and similar disease severity compared with American and European patients with mutations. We analyzed the RP phenotype associated with c.942_944delGAA and confirmed the pathogenicity of the mutation. The  gene produces a photoreceptor-specific ATP-binding cassette transporter involved in clearance from photoreceptor cells of the byproduct of the retinoid cycle of vision []. The spectrum of retinal dystrophies caused by mutations in the gene is broad, and includes severe RP, STGD, cone-rod dystrophy, age-related macular degeneration, and so on. Diverse phenotypes related to might perplex the clinical diagnosis sometimes. Fundus manifestations of patients in Family-024 seemed similar to RP, and all patients had complained of night blindness; however, atrophic-appearing RPE concentrating in the region around the macular and delayed and reduced ERG responses were in accordance with STGD Group 3, which had macular and generalized cone and rod system dysfunction [,]. Therefore, the diagnosis of Family-024 was corrected for STD, and c.1924T>A was identified as the causative mutation for this family. LCA is the most severe human form of inherited photoreceptor-neuron degeneration resulting in congenital blindness, with an incidence of approximately 1 in 80,000 []. Seventeen genes have been implicated in the LCA. was first mapped to 1p36 through linkage analysis in a large consanguineous Pakistani family with LCA in 2003; however, it was not accurately identified until 2012 []. encodes the nuclear isoform of nicotinamide mononucleotide adenylyltransferase, a rate-limiting enzyme in nicotinamide adenine dinucleotide (NAD) biosynthesis [,]. It was suggested that  mutations could cause severe and rapid macular degeneration, in addition to the typical LCA phenotype of nystagmus, severe loss of vision, and abnormal ERGs. The phenotype associated with mutations was classified in LCA9. Patients with LCA9 presented a peculiar, prominent retinal feature termed macular coloboma that consists of an atrophic lesion in the central retina with a pigmented border, and the remainder of the retina was abnormal as well, with pigmentary changes, attenuated retinal blood vessels, and optic disc pallor []. The symptoms and fundus manifestations of the two affected individuals in Family-035 were exceedingly compatible with LCA9, including early onset of nystagmus, severe loss of vision, macular coloboma, and so on. The compound heterozygous variants in , c.196C>T and c.272A>G, cosegregated with the phenotypes of Family-035. c.196C>T has been detected in a Pakistani LCA9 pedigree and was proved to decrease NMNAT1enzyme activity []. c.272A>G is a novel mutation, which was absent in previous reports of the pathogenic mutations spectrum causing LCA9. Thus, in total, we have identified four mutants in three Chinese families associated with adRP, STGD, and LCA, including a deletion mutation encoding p.K314del in and three missense mutations encoding p.F642I in p.E91G, and p.R66W in with gene panel–based NGS. All mutations were validated with directed PCR and Sanger sequencing. Identification of these mutations reaffirms the clinical and genetic heterogeneity of RDs, and further expands the mutation spectrum of RDs.

The limbus is anatomically located between the cornea and the conjunctiva on the ocular surface. The basal layer of the limbal epithelium is enriched with a special cell population, named limbal epithelial stem cells (LSCs) []. The cornea contains a stratified squamous epithelium that turn overs rapidly. Renewal of the corneal epithelium is supported by the transient amplifying cells (TACs) generated from asymmetric division of LSCs [,]. LSC deficiency may arise following injuries including chemical or thermal burns and through diseases such as aniridia, chronic infection (e.g., trachoma and mycotic keratitis), and Stevens–Johnson syndrome. Partial or total loss or dysfunction of LSCs (clinically termed LSC deficiency) leads to corneal neovascularization, recurrent erosions, stromal scarring, and ulceration, thus causing vision loss. Currently, transplantation of the ex vivo expanded limbal epithelial sheet has become the most widely used therapy for LSC deficiency []. This ex vivo expanded limbal epithelial sheet generally involves placing a small limbal biopsy removed from either the patient or a donor on transplantable carriers such as the denuded human amniotic membrane to support limbal cells migrating out from the biopsy and outgrowth to form a limbal-like epithelial sheet [,]. The failure of limbal transplantation often arises from the depletion of LSCs in culture [-]. Continuous culture of LSC leads to gradual loss of cell proliferation and induction of terminal differentiation [-]. A recent study indicated that a better prognosis after limbal transplantation is associated with cultures in which LSCs constituted more than 3% of the total number of clonogenic cells []. Evidence suggests that epithelial–mesenchymal transition (EMT) may be involved in LSC senescence. When rabbit limbal explants were cultured at the air–medium interface to induce corneal epithelium formation, LSC intrastromal invasion also occurred due to a mechanism involving EMT, which led to the LSC population decrease []. This EMT-mediated loss of LSCs is also shown in ex vivo expansion of human LSCs on the intact amniotic membrane []. Prolonged culture of a murine corneal/limbal epithelial progenitor at low density in a serum-free medium leads to irreversible EMT []. EMT is a transdifferentiation process in which markers of epithelial cells, such as cytokeratins and E-cadherin, are gradually replaced by mesenchymal markers, such as alpha smooth muscle actin (α-SMA) and vimentin []. Transforming growth factor (TGF)-β is a major EMT inducer []. TGFβ binds TGFβ receptor type II (TGFβRII) inducing the association of TGFβRII with TGFβRI. TGFβRI is then phosphorylated by TGFβRII. Hereafter, the intracellular signaling transducer Smad2 and Smad3 are phosphorylated by TGFβRI, form complexes with Smad4, and translocate into the nucleus, where they activate transcription of the target genes []. However, Smad7 is a negative regulator of TGF-β intracellular signaling by recruiting protein phosphatase to dephosphorylate TGFβRI [,]. LSCs express two types of TGFβ (TGFβ1 and TGFβ2), and the levels of spontaneous EMT that occur in culture can be partially blocked with a TGFβ1-neutralizing antibody [,], supporting the notion that blocking the TGFβ signaling pathway benefits the expansion of LSCs in vitro. Here, the irreversible EMT is at last in part triggered by Smad-mediated TGFβ signaling []. As an inhibitory cytokine, TGFβ1 suppresses the growth of cultured LSCs induced by epidermal growth factor or acidic fibroblast growth factor []. The TGFβ-induced EMT has been proposed to be the mechanism responsible for LSC loss in continuous culture. However, the discrepancy of TGFβ-induced EMT between freshly isolated LSCs and serially passaged cells is still unclear. It is also uncertain whether Smad7 can suppress EMT development during LSC expansion in culture. Identifying the intrinsic molecules in LSCs that modulate TGFβ activation can increase our understanding of the mechanism by which EMT develops and can also lead to an improved culture technique for LSC expansion for therapeutic applications. Previous reports indicated that Notch-mediated cell-to-cell signaling is vital in maintaining stem cell living, including the regulation of stem cell maintenance, cell differentiation, and cellular homeostasis []. Notch proteins are transmembrane receptors (Notch 1–4). Notch signaling is initiated by the interaction between the ligand (delta/jagged family) on one cell and the receptor on a neighboring cell []. After ligand binding, γ-secretase-dependent proteolytic cleavage of the Notch receptor is triggered to release the Notch intracellular domain (NICD) to the nucleus and then target genes such as (; OMIM: and OMIM: ) are induced []. Recent evidence suggested Notch signaling is involved in maintaining the undifferentiated status of LSCs. Notch-1 protein diminished in dividing cells in culture [] and in the proliferating limbal epithelium in response to corneal wounding []. Activated Notch signaling in cardiac myocytes has proved to be crucial for inhibiting TGFβ-mediated cardiac fibrosis induced by pressure overload []. However, whether Notch activation in LSCs may also suppress TGFβ-mediated EMT remains elusive. The gradual loss of proliferation potential of LSCs and TGFβ-facilitated EMT in late stage cell culture implies a mechanism that may be exercised in early stage LSC culture to shield the cells from the effect of TGFβ. We therefore looked into early stage LSC culture for such a mechanism and found Notch activation may assume this role. Notch activation marker Hes1 and TGFβ signaling inhibitor Smad7 are highly expressed in early LSC culture. Treatment with Notch inhibitor N-(N-[3,5-difluorophenacetyl]-l-alanyl)-S-phenylglycine t-butyl ester (DAPT) reduced Smad7 expression and caused LSCs to become susceptible to TGFβ-mediated cell proliferation arrest and EMT. These findings suggest Notch signaling may inhibit EMT by upregulating Smad7. HEPES-buffered Dulbecco’s modified Eagle’s medium (DMEM), Ham’s/F12 medium, trypsin-EDTA, fetal bovine serum (FBS), antibiotic-antimicotic solutions, and trypsin were purchased from Invitrogen (Carlsbad, CA). DAPT, IWR-1, cyclopamine, hydrocortisone, dimethyl sulfoxide (DMSO), insulin-transferrin-sodium selenite (ITSE) media supplement, mitomycin C (MMC), bovine serum albumin (BSA), 5-bromo-2'-deoxyuridine (BrdU), Triton X-100, Hoechst 33,258 dye, and formalin were all from Sigma-Aldrich (St. Louis, MO). Dispase II and epidermal growth factor (EGF) were obtained from Roche (Indianapolis, IN). Jagged-1 peptide (CDDYYYGFGCNKFCRPR) was synthesized by GenScript Corporation (Piscataway, NJ). LSCs were isolated from 6-month-old New Zealand white rabbits and used for cell-suspension culture by modifying a previously described method []. The experiments were approved by the Mackay Memorial Hospital Review Board for Animal Investigation. Briefly, rabbit limbal tissues were washed in PBS (1X; 137 mM NaCl, 2.7 mM KCl, 8 mM NaHPO, 1.5 mM KHPO, pH 7.4) containing 50 μg/ml gentamicin. After the iris, and excessive sclera, was carefully removed, the limbal rings were exposed to dispase II (1.2 IU/ml in Hanks’ balanced salt solution free of Mg and Ca) at 4 °C for 16 h. The loosened epithelial sheets were removed with a cell scraper and separated into single cells by treating with 0.5 ml trypsin (0.25% and 0.01% EDTA) for 15 min at 37 °C with gentle shaking. Cells were transferred to 9 ml of 10% FBS/DMEM/F-12 medium and then collected by centrifugation (400 for 5 min). Approximately 1×10 cells were seeded on each well of a six-well plate and incubated with a DMEM/F-12 basal medium (10 mM HEPES, 5 ng/ml human EGF, 1% ITSE, 1% antibiotic-antimicotic solutions, 0.5% DMSO, and 0.5 μg/ml hydrocortisone) supplemented with 10% FBS for 2 days, and then shifted to serum-free DMEM/F-12 basal medium for 3 more days until they reached confluence (passage 0; P0). Cultures were incubated at 37 °C under 5% CO. LSCs were cocultured with MMC-treated NIH-3T3 fibroblast feeder cells located within Transwell (0.4 μm pore, BD Biosciences, Bedford, MA) []. For passage, near-confluent cells were harvested with 0.25% trypsin, and then 1 × 10 subcultured cells were cultured in the DMEM/F-12 basal medium, and sub-cultured three times at 4-day intervals (P1 to P3). Cell lysis, fractionation, and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) were performed as previously described []. For rat corneal and limbal tissue preparation, the rat limbal rings were exposed to dispase II (1.2 IU/ml in Hanks’ balanced salt solution free of Mg and Ca) at 4 °C for 16 h, and then the loosened limbal epithelial sheets were obtained using a cell scraper. Subsequently, the intact corneal epithelial sheet was harvested and dissolved in sample buffer. A total of 20 μg of protein was loaded per well and separated on SDS–PAGE. Samples were probed with anti-∆Np63α body (fold dilution, 1:1,000; BioLegend, San Diego, CA), anti-Bmi-1 antibody (1:1,000; Millipore, Bedford, MA), anti-ABCG2 antibody (1:1,000; Abcam, Cambridge, MA), anti-Smad7 antibody (1:1,000; GeneTex, San Antonio, Tex), anti-Hes1 antibody (1:1,000; GeneTex), anti-NICD antibody (1:1,000; Cell Signaling Technology Inc., Beverly, MA), anti-phospho-Smad2 antibody (1:1,000; S465/S467, Upstate Biotechnology, Lake Placid, NY), anti-phospho-Smad3 antibody (1:1,000; S423/S425, R&D Systems, Minneapolis, MN), anti-Smad2 antibody (1:1,000; Abcam), Smad3 (1:1,000; Zymed Laboratories, San Francisco, CA), anti-TGFβ1 antibody (1:1,000; GeneTex), anti-TGFβRI antibody (1:1,000; GeneTex), or anti-TGFβRII antibody (1:1,000; GeneTex). β-actin (1:1,0000; Sigma-Aldrich) were used to verify equal loading of protein. Proteins of interest were detected using the appropriate immunoglobulin G-horseradish peroxidase (IgG-HRP) secondary antibody (Santa Cruz Biotechnology) and enhanced chemiluminescence (ECL) reagent (Amersham, Arlington Heights, IL). X-ray films were scanned on a model GS-700 imaging densitometer (Bio-Rad Laboratories, Hercules, CA) and analyzed using Labworks 4.0 software. For quantification, blots of at least three independent experiments were used. Values were normalized to β-actin content and expressed as a percentage or fold of control. 2 × 10 LSCs were seeded on a slide coated with FNC solution (Athena Enzyme Systems, Baltimore, MD) and incubated in culture medium with or without 10 ng/ml TGFβ1 for 1 day. BrdU (final, 10 μM) was added to the culture for 6 h. After being fixed with 4% paraformaldehyde, the cells were exposed to cold methanol for 2 min, and then treated with 1 N HCl at room temperature (RT) for 1 h before immunofluorescence was performed. Immunocytochemistry for BrdU labeling of proliferative LSCs was performed as in our previous study []. Deparaffinized mouse eye sections were blocked with 10% goat serum and 5% BSA in PBS containing 0.1% Tween-20 for 1 h at RT. The eye sections were double-stained with antibodies to rabbit polyclonal anti-ΔNp63α antibody (1:100; BioLegend) and monoclonal anti-mouse Hes1 antibody (1:100; ab87395; Abcam) or monoclonal anti-mouse Smad7 antibody (1:100; sc-365846; Santa Cruz Biotechnology) at 37 °C for 2 h. The sections were then incubated with rhodamine-conjugated donkey anti-mouse IgG antibody and fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG antibody (1:500; Santa Cruz Biotechnology) for 1 h at RT. Nuclei were monitored by counterstaining with Hoechst 33,258 for 7 min. Images were captured using a Zeiss epifluorescence microscope(Oberkochen, Germany) with a charge-coupled device (CCD) camera and photographs taken using the Axiovert software. Experiments were performed as previously described []. The sequence of specific PCR primers was rabbit Ki67 sense, 5′-ATG TTC CAT TTC ATC AGC CA-3′; antisense, 5′-TTT AAA TCG CTC CTC CAT CC-3′ (accession number: XM_002723010; PCR product: 95 bp), rabbit Hes1 sense, 5′-AAT AAA TGA AAG CCT GAG CCA-3′; antisense, 5′-GGT CAT CTC CAG GAT ATC GG-3′ (XM_002716517; 106 bp), rabbit Smad7 sense, 5′-CCT TCT GCT GTG CAA AGT GT-3′; antisense, 5′-GAT TCA CAG CAA CAC AGC CT-3′ (XM_002713526; 78 bp), and rabbit GAPDH sense, 5′-TCT GGC AAA GTG GAT GTT GT-3′; antisense, 5′-GTG GGT GGA ATC ATA CTG GA-3′ (NM_001082253; 87 bp). Results are expressed as the mean±standard error of the mean (SEM). One-way ANOVA was used for statistical comparisons. p<0.05 was considered significant. The extent of TGFβ1-induced EMT on early isolated LSCs (P0) and first passage LSCs (P1) was assayed with western blotting of mesenchymal markers including α-SMA and vimentin. Exposure of P1 cells to 5–20 ng/ml TGFβ1 for 48 h increased the protein levels of α-SMA and vimentin in a dose-dependent manner (). However, TGFβ1 considerably decreased the protein levels of LSC marker ABCG2 and ∆Np63α compared with the untreated cells. Importantly, western blotting results further revealed that P0 cells treated with TGFβ1 caused only a moderate induction of mesenchymal markers, compared with P1 cells (; α-SMA: 2.2±0.15 versus 4.3±0.29-fold; vimentin: 1.4±0.13 versus 4.7±0.42-fold). Likewise, P0 cells were more resistant to TGFβ1-induced reduction of LSC markers compared to P1 cells (ABCG2: 83.8±7.6% versus 22.3±4.5%; ∆Np63α: 89.5±3.4% versus 17.3±3.1%). These results indicate that EMT induced by exogenous TGFβ1 is more pronounced in P1 cells than P0 cells. To determine the effect of TGFβ1 on the cell proliferation of LSCs (labeled with ∆Np63α), LSCs were pulse-labeled with BrdU (6 h; ) and then analyzed with immunostaining. The proliferating ratio for P0 cells was higher than that of P1 cells (16.5±2.1% versus 11.8±1.7%; , white columns), indicating that P0 cells have higher proliferative potential than P1 cells under the cell culture condition. Notably, TGFβ1 diminished cell proliferation of P0 and P1 LSCs by a factor of 1.5 and 6.7, respectively, which indicates that P0 cells are more resistant to TGFβ1-mediated growth arrest. This result was confirmed with qPCR analysis of the Ki67 transcript, a proliferation-associated nuclear antigen. The Ki67 transcript was downregulated almost fourfold in the P1 cells, whereas the level of the Ki67 transcript in the P0 cells remained relatively the same in the presence or absence of TGFβ1 (about 1.4-fold; ). Western blot analysis of protein extracts from P0 cells confirmed the expression of LSC markers including ∆Np63α, Bmi-1, Hes1, and β-catenin, whereas protein expression gradually decreased following the serial passages (). We also noted that all LSC marker protein expression within the P3 cells was obviously reduced compared to that of the P0–P2 cells, suggesting that the P3 cells entered senescence. Next, the protein expression of TGFβ signaling components including TGFβ1, TGFβ receptor I/II (RI and RII), and Smad2/3 at serial passaged LSCs was determined. Western blotting results revealed the expression of the TGFβ signaling components was relatively similar among LSCs throughout the P0 to P2 passages. This suggests that LSC might sustain a TGFβ autocrine in culture. Importantly, the level Smad7 protein, a TGFβ signaling antagonist, was closely related to how many times LSCs were subjected to subculturing; the expression of the Smad7 protein was the highest at P0, but decreased at P1 and almost disappeared at P2 (). We also observed that the expression of Hes1, a major Notch signaling target, was very similar to that of Smad7. Collectively, the decrease in Smad7 protein in the passaged cells may benefit TGFβ1 signaling transduction, thus facilitating induction of EMT in later passage cultures. Wnt/β-catenin, hedgehog, and Notch signaling pathways are known to participate in maintaining stem cells. The involvement of these signaling pathways in Smad7 expression was evaluated with inhibitors, including IWR-1 (inhibitor of Wnt/β-catenin signaling), cyclopamine (inhibitor of hedgehog signaling), and DAPT (inhibitor of Notch signaling). As depicted in , western blot analysis of the cell extracts from the P0 cells treated with DAPT (10 μM, 48 h) revealed that Smad7 protein expression was attenuated, whereas treatment with IWR-1 and cyclopamine did not change the protein level of Smad7. To further confirm that DAPT affects Notch signaling, we examined the levels of the Hes1 protein. Western blot revealed that DAPT effectively blocked Hes1 expression. In contrast, DAPT (10 μM) had no significant effect on the expression of TGFβ, TGFβ RI/RII, or Smad2/3 (data not published). Western blot result also confirmed that the Smad7 protein level was significantly downregulated at DAPT concentrations above 5 µM (). qPCR showed that Hes1 and Smad7 mRNA were downregulated with the DAPT treatment, compared with the untreated P0 cells (8.3-fold and 6.5-fold, respectively; ). Collectively, these results suggest that Smad7 is a downstream target of Notch signaling. We investigated whether Smad7 is also expressed by LSCs in vivo. Immunofluorescent staining of corneal limbal tissue revealed Smad7 was intensively expressed in the cytoplasm of certain basal cells and a few suprabasal cells of the limbal epithelium, but not in the entire corneal epithelium (). Immunofluorescent staining also showed that Hes1 was predominantly expressed in the limbal basal epithelium. Preimmune serum did not possess immunoreactivity toward Hes1 and Smad7 (data not shown). The accumulation of Smad7 and Hes1 proteins in the limbal epithelium (marked by ∆Np63α) devoid of the corneal epithelium was also evaluated with western blotting (). The results confirmed that levels of Smad7 and Hes1 proteins in limbal epithelium were significantly higher than that in the full corneal epithelium. TGFβ1-induced phosphorylation of Smad 2/3 is an essential step leading to induction of EMT components [,]. As illustrated in , TGFβ1 induced the time-dependent phosphorylation of Smad2 and Smad3 in the P1 cells. The peak phosphorylation of Smad2 and Smad3 occurred between 30 and 40 min and 20 and 40 min, respectively. There was no obvious change in total Smad2 or Smad3. It has been demonstrated that Smad7 can block TGFβ-induced Smad2/3 phosphorylation by forming stable complexes with activated TGFβ RI [,]. Therefore, we investigated the importance of Smad7 in protecting LSCs from TGFβ1-induced EMT. First, we examined whether Smad7 expressed at P0 cells could affect TGFβ1-induced Smad2/3 phosphorylation. DAPT pretreatment (10 μM, 48 h) was used to block Smad7 expression before TGFβ1 treatment for 30 or 40 min. As depicted in the right-hand panels of , as predicted, phosphorylation of Smad2 and Smad3 in the DAPT-pretreated P0 cells was markedly higher than the DMSO vehicle-pretreated P0 cells, suggesting Smad7 plays an important role in suppressing Smad2/3 phosphorylation and following nuclear transcription regulation in LSCs. Western blot analysis also demonstrated that the DAPT pretreatment facilitates TGFβ1 effects on induction of mesenchymal markers, compared to vehicle pretreatment at P0 cells (; α-SMA: 3.8±0.78-fold versus 1.7±0.13; vimentin: 2.2±0.46-fold versus 1.4±0.13). DAPT treatment alone had no significant effect on altering the basal levels of the α-SMA and vimentin proteins, compared with those receiving DMSO treatment alone (). In addition, the TGFβ1-mediated inhibition effect on cell proliferation marker Ki67 became prominent with the DAPT pretreatment (; 69.3±10.1 versus 44.3±9.5%; DMSO vehicle alone set as 100%), indicating that DAPT pretreatment may sensitize P0 cells to TGFβ1-induced growth arrest. Next, we investigated whether the level of the Smad7 protein in the P1 cells could be induced by the Notch ligand Jagged-1. Exposure of P1 cells to 1 μM or greater Jagged-1 for 12 h increased the NICD to approximately seven-fold compared with the untreated cells (). In addition, P1 LSCs treated with Jagged-1 for further 24 h demonstrated a significant increase in Hes1 and Smad7 protein levels. Reciprocally, DAPT pretreatment (1 h) suppressed the Jagged-1-mediated induction of NICD, thus underscoring the role of Notch signaling in upregulation of Smad7. To examine whether Jagged-1 can also protect LSCs from TGFβ-mediated growth suppression, the Ki67 transcript levels were assessed with qPCR. As shown in , pretreatment with Jagged-1 for 24 h before TGFβ1 exposure suppressed TGFβ-mediated growth suppression of the P0 and P1 cells. In addition, the western blotting results revealed that Jagged-1 pretreatment displayed an inhibitory effect on TGFβ1-mediated induction of mesenchymal markers in the P0 and P1 cells compared to TGFβ1-treated alone (). Taken together, these results indicate that one Notch signaling effect on LSCs is responsible for sustaining Smad7 expression against TGFβ signaling. LSC expansion ex vivo to generate limbal equivalent is a widely accepted approach for reconstructing the ocular surface in patients with severe LSC deficiency. LSCs retain TGFβ autocrine that triggers the formation of EMT, which has been regarded as a risk factor for limbal transplantation []. The influence of other intrinsic signaling on the activation of TGFβ signaling in LSCs has not been well documented. In this study, blockage of Notch signaling with the DAPT inhibitor provides evidence that Notch signaling contributes to preventing mesenchymal marker expression induced by exogenous TGFβ1. Moreover, we demonstrated for the first time that Smad7, a TGFβ signaling negative regulator, was present in the highest amount in early isolated LSCs and dramatically diminished after cell passages or were treated with DAPT. Our results strongly imply that Smad7 is a Notch downstream target, and the physiologic role of Smad7 is critical for protecting LSCs from spontaneous EMT formation. The physiologic role of Notch signaling in the limbal epithelium remains largely unclear. Hes1 is a major Notch signaling target and is usually used as an indicator of Notch activation. Exogenously inhibiting Notch signaling by DAPT significantly suppressed Hes1 expression in the P0 cells, supporting the proposition that Hes1 expression in LSCs is at last in part regulated by Notch signaling. In addition, a recent study reported that Hes1 is expressed predominantly in the basal epithelial layer of the mouse limbus, but is not detected in the differentiated corneal epithelial cells []. By assaying murine ocular specimens, our study confirmed that Hes1 is higher in the limbal epithelium than in the corneal epithelium. In this regard, Hes1 expression plays a critical role in maintaining LSC stemness []. In the present study, we identified that Smad7 is another Notch effector target in LSCs and might play an important role in antagonizing EMT. Recent studies also found that Notch signaling in different types of cells display distinct roles in regulating EMT. For example, activation of Notch signaling in alveolar epithelial cells and corneal endothelial cells has been demonstrated to enhance TGFβ-induced mesenchymal marker gene expression as demonstrated partly by the cooperation between Notch signaling and TGFβ, which is blocked by DAPT [,]. Whether the level of Smad7 is positively correlated with Notch activation in these cells remains unknown and requires further investigation. TGFβ receptor type 1 and 2 (RI and RII) are two major TGFβ receptors expressed in LSCs in vivo []. Our in vitro data revealed that the protein levels of TGFβ signaling components including TGFβ1, TGFβR I/II, and Smad2/3 are expressed in relatively stable amounts during continuous passage of LSCs. This finding is in line with the previous notion that Smad2/3 plays an essential role in TGFβ-induced EMT and growth arrest [,]. Accordingly, LSCs might maintain a TGFβ autocrine loop in vitro. In this regard, a recent study demonstrated that TGFβ1-neutralizing antibody partially inhibits α-SMA expression in cultured LSCs [], further supporting the proposition that TGFβ autocrine is functional in LSCs. We found that exogenous TGFβ1-induced EMT and growth arrest are only slightly active in P0 LSCs, but become prominent in the later passage P1 cells. These observations lead to the hypothesis that LSC is under constant pressure for EMT and a mechanism exists that resists EMT at least in the early stage of LSC culture. This hypothesis is supported by the observation that when a DAPT inhibitor was used to block Smad7 expression in the P0 LSCs, the P0 cells became susceptible to TGFβ1-induced EMT formation. This result supports the previous notion that Smad7 plays a crucial role in antagonizing TGFβ signaling. We found that Smad7 expression in fresh isolated LSCs declined rapidly during cell passages. It seems that Notch activity and Smad 7 expression are associated, but how Smad 7 expression is regulated remained elusive. Smad 7 is reportedly induced by interferon-gamma through Janus kinase 1/signal transducers and activators of transcription 1 (JAK1/STAT1) signaling and by tumor necrosis factor (TNF)-alpha and interleukin-1beta through the nuclear factor kappa B (NF-κB) [-]. Interestingly, it has also been shown that Jagged-Notch pathway induces NF-κB and JAK/STAT signaling to trigger inflammatory responses in cultured astrocytes []. Whether Notch may induce this signaling in LSCs to upregulate Smad7 remains to be determined. Recent studies have shown that Smad7 transcription is suppressed by transcription regulators including metastasis associated 1 (MTA1) and Ski/Sno corepressor complexes [-]. However, it has also been shown that Smad7 protein degradation is mainly controlled by E3 ubiquitin ligases, including Smurf2, Arkadia, and Cbl-b [-]. Further research is necessary to delineate the involvement of the signaling mechanisms regulating Smad7 in early LSC culture. In conclusion, the decrease in spontaneous EMT during LSC culture expansion is an important subject in improving the success of limbal transplantation. Our findings demonstrate for the first time that the gradient change of expression of Smad7 in LSCs determines the extent of EMT during continuous culture. We further identify that Smad 7 expression in LSCs was associated with Notch activity. Our observation offered a mechanistic interpretation that Notch associated Smad7 may be responsible for maintaining the stemness of LSCs in the early passage of culture and thus prevent the occurrence of EMT.

Glaucoma is the third most frequent cause of blindness worldwide [], and is known to affect both humans and numerous dog breeds. Several types of glaucoma exist, including primary angle-closure glaucoma (PACG), which is three times more prevalent in humans of Asian descent than in European populations [-]. In human patients, PACG is typically caused by the collapse of the iridocorneal angle due to the anterior movement of the iris root, which in turn blocks the outflow of aqueous humor (AH) through the trabecular meshwork (TM). Conversely, clinical investigation of hereditary PACG in the basset hound (BH) has revealed progressive collapse of the ciliary cleft (CC) and TM region in association with a gradual increase in intraocular pressure (IOP), which becomes statistically significant (20–24 mmHg) by 20 months of age []. The condition is marked by retinal ganglion cell death, retinal neuroinflammation, axonal degeneration, and cupping of the optic nerve head secondary to increased IOP []. BHs display glaucomatous neuropathy similar to that observed in human PACG patients. Progressive deficits in retinal ganglion cell function are noted by pattern electroretinography (pERG) in the basset. Additionally, axonal degeneration and prominent structural changes to the optic nerve head are observed in the advanced stages of the disease. The frequent absence of early symptoms makes PACG difficult to detect and places a large proportion of both human and canine cases at risk for blindness. There is strong evidence that human PACG is a complex disease with a significant underlying genetic component [,]. Family history is one of the major risk factors for PACG and heritability estimates have shown a 3.7-fold increase in disease risk among siblings compared to the general population [,]. Despite extensive research efforts, the genetic basis of PACG is still incompletely understood. Several candidate genes for human PACG have been identified so far. A recent genome-wide association study (GWAS) has reported three susceptibility loci in an Asian population []. Association studies have also suggested the involvement of several single-nucleotide polymorphisms (SNPs) in the matrix metalloproteinase-9 (; OMIM ) in both Chinese and Caucasian populations [,]. Some of these findings were not reproducible in other ethnic populations, however, which suggests the genetic heterogeneity of PACG in human populations []. Similarly, data regarding the genetics of glaucoma in dogs is sparse. Genetic investigation of primary open-angle glaucoma (POAG) in a beagle colony revealed a single locus on chromosome 20 harboring the gene []. A GWA analysis of a late-onset form of PACG described in a Dandie Dinmont terrier cohort has also led to the identification of a novel susceptibility locus on canine chromosome 8 []. The locus shares synteny to a region on human chromosome 14q, which harbors several genes associated with POAG and primary congenital glaucoma []. BHs are among several breeds of dogs that are predisposed to developing glaucoma []. A total of 5.44% of all BHs treated in teaching hospitals presented with glaucoma, representing a significantly higher fraction than most breeds []. Unfortunately, treatment options are limited and affected animals often develop bilateral blindness. Other breeds likely to be affected include the American cocker spaniel, wire fox terrier, and Boston terrier []. The observation of multiple breeds at risk for developing the same form of the disease may possibly indicate that a shared founder mutation has been preserved with selective breeding. If true, the identification of a significant PACG risk-conferring variant in the BH may serve to determine the risk of disease in other breeds sharing the same mutation. We have identified several BH pedigrees, as well as unrelated dogs with characteristic PACG that closely recapitulates the phenotype observed in human patients. All affected dogs present with a comparable disease phenotype. Our goal was to identify valid genetic associations that confer risk to PACG by using the BH as a genetic model. The findings of this study are anticipated to provide valuable insight into the pathophysiology and genetic mechanisms underlying canine PACG. The identification of genetic risk variants in dogs can assist in reducing the incidence of PACG in susceptible breeds using selective breeding. All animal studies were conducted in accordance with the Association for Research in Vision and Ophthalmology (ARVO) statement for use of animals in ophthalmic and vision research. The procedures conducted were approved by the respective University of Iowa and Iowa State University Committees on animal care and use. Our GWA investigation of PACG in cases versus controls included unrelated as well as related animals derived from six pedigrees with clinically confirmed PACG. All animals included were examined by a veterinary ophthalmologist as described previously []. Whole blood was collected from 37 clinically confirmed glaucoma cases and 41 unaffected controls with the owners’ consent. Genomic DNA was extracted from EDTA-stabilized whole blood samples using the Qiagen DNeasy blood and tissue kit (Qiagen, Hilden, Germany). DNA samples were eluted with deionized water and stored at −20C. Seventy-eight samples were genotyped using the Illumina CanineHD BeadChip (Illumina, San Diego, CA), which contains 172,000 markers placed on a CanFam2.0 reference sequence. Prior to GWA analysis, preliminary quality control assessment of genotyped SNPs was conducted using [] to remove genotype errors and uninformative data. All SNPs were subjected to strict quality control (QC) criteria: SNPs with a minor allele frequency <1%, a call rate <95%, a rate of missing genotype >10%, and those that departed from Hardy–Weinberg equilibrium ( value <0.001) were excluded from the analysis. All samples had less than a 5% missing genotype rate. Pairwise clustering based on the GWA proportion of alleles shared identical by state (IBS) between any two individuals was performed to account for increased relatedness. All sample pairs were ensured to display an IBS relatedness value (pi-hat) <0.9. Population stratification was assessed using a multidimensional scaling analysis (MDS), with three-dimensional components extracted using PLINK []. MDS cluster analysis included a selected number of individual animals from each pedigree. To our knowledge, our pedigrees do not share a recent common ancestor and have not been recently interbred. A logistic regression test for GWA was performed. GWA testing was conducted with the inclusion of MDS-based covariates to correct for increased relatedness and population stratification by clustering individual samples based on their pedigrees of origin. The genomic-control inflation factor (λgc) was applied to the test statistic following MDS adjustment by three components. The odds ratio (OR) and 95% confidence interval (CI) were estimated for an additive effect model of allele dosage in the context of logistic regression. The threshold for genome-wide significance was set by permutation testing using 1,000 permutations. For haplotype definitions we performed linkage disequilibrium (LD)-clumping (settings; r2=0.8, p1=0.001, p2=0.01, distance-kb=500) using PLINK v1.07 []. Quantile-quantile (Q-Q) and Manhattan plots of −log p values were constructed using . Eyes derived from affected and unaffected animals were fixed immediately following enucleation in 4% paraformaldehyde. Tissues were dehydrated then subjected to paraffin embedding using standard procedures. Globes were embedded and 4 µm sagittal sections were made using a rotary microtome. Tissue sections were deparaffinized in xylene for 20 min then hydrated in decreasing ethanol concentration for 5 min at each concentration. Heat-assisted antigen retrieval was performed using 10mM citrate buffer (pH 6.0) for 10 min at 95–100 °C. Blocking of endogenous peroxidase activity was achieved by treating sections with 2% HO-methanol solution for 20 min at room temperature. Sections were blocked in 5% normal goat serum/1% bovine serum albumin (BSA) solution in 1X Tris-buffered saline (TBS) for 1 h at room temperature then incubated overnight at 4 °C in primary rabbit anti- (1:100) or rabbit anti-RAB22A (1:100) in 1X TBS (Proteintech, Chicago, IL). Sections were treated with biotinylated secondary anti-rabbit immunoglobulin G (IgG) antibody (1:100; Vector, Burlingame, CA). Color development was achieved using an Avidin/Biotinylated–peroxidase Complex VECTASTAIN ABC kit (Vector, Burlingame, CA) by direct application to tissue sections for 2 min. Sections were dehydrated, cleared in xylene and mounted using Permount mounting media (Thermo Fisher Scientific Inc., Waltham, MA). Immunohistochemical staining was evaluated at the light microscopic level. We previously described that the development of elevated IOP and subsequent vision loss is correlated to the gradual narrowing of the iridocorneal angle, resulting in complete angle closure in all affected animals. In concordance with these findings, all cases included in this study displayed completely collapsed iridocorneal angles and CCs confirmed using high-resolution ultrasound (HRUS) and gonioscopy examination. Angle collapse was observed in association with notable IOP elevation of at least 25 mmHG. All unaffected control animals displayed normal IOPs, and had normal appearing iridocorneal angles and CCs by gonioscopy and HRUS, respectively. All samples analyzed for the presence of excess proportion of alleles shared IBS revealed a pi-hat value <0.9 and were therefore included in the analysis. To account for population stratification and reduce the confounding effect of subject relatedness, an MDS analysis of all 78 samples was conducted. The utilization of pedigree-based MDS clustering of samples as a test statistic covariate has proven successful at reducing the confounding effect of relatedness in other research studies and as such was adopted in our analysis [,]. A scatter plot revealing pedigree-based clusters was generated for 3 MDS components (). The MDS plot illustrates the formation of six clusters, which appeared to be influenced by the samples’ pedigrees of origin, as follows: pedigree 1: 21 samples, 14 unaffected, 7 affected; pedigree 2: 5 samples, all affected; pedigree 3: 2 samples, all unaffected;, pedigree 4: 5 samples, 2 unaffected, 3 affected; pedigree 5: 3 samples, 2 affected, 1 unaffected; pedigree 6: 17 samples, 8 unaffected, 9 affected; and unrelated samples: 25 samples, 13 unaffected, 12 affected. Overall, our samples comprised 28 males (14 unaffected, 14 affected) and 50 females (27 unaffected, 23 affected). The group of unrelated samples appeared randomly distributed among the six-pedigree-derived sample clusters. Logistic regression GWA testing was conducted with the inclusion of MDS-generated covariates. An inflation factor (λ=1.30, χ=1.33) was calculated before covariate adjustment. Q-Q scatter plots of the −log10 (p values) expected under the null hypothesis of no genetic association versus the observed −log10 (p values) are shown for all subjects before (A) as well as following correction for sample relatedness (B; ). In the absence of covariate correction, significant deviation from normal distribution was observed for the generated p values, which demonstrates the strong effects of population stratification that is commonly observed when sampling from a founder population (). Conversely, covariate adjustment by the third MDS dimensional component resulted in a corrected inflation factor (λ=1, χ =0.93). The scatter Q-Q plot in reveals significant improvement in the initially observed deviation from normal distribution of all p values generated following covariate correction and illustrates the validity of the method used here to correct for relatedness and population stratification. We identified two regions in association with PACG in the BH following multiple hypothesis testing correction of raw p values by permutation. The first and most statistically significant association (=0.00036, OR=3.35, CI=1.73–6.51) was identified for marker BICF2P31912 on chromosome 14, residing in an intronic region of (). The marker is part of a four SNP locus (Chr14:19,911,001–20,161,348bp) spanning 0.25Mb. The four markers constituting the haplotype displayed complete linkage disequilibrium (LD; =1, =1). Notable difference in allele and genotype frequency distribution for BICF2P31912 was observed among cases and controls, (58.1% “G”) in cases versus (29.3% “G”) in controls (). The allele and genotype distribution of BICF2P31912 is representative of all SNPs within the locus identified. To define the associated haplotypes, we performed an LD-based clumping analysis with an LD value of =0.8. Using a threshold value of significance (0.0001 < p<0.001), the four previously identified markers of BICF2P31912, BICF2S2309101, TIGRP2P188010_rs8723846, and BICF2P316805 were validated for constituting an LD-haploblock while reaching the highest values relative to all statistically significant markers identified in our GWA analysis. An additional marker (BICF2P1279787) was identified in association with this haploblock (2=0.87) with a reduced p value (=0.00134). The 0.25 Mb locus on Chr14 contains 20 SNPs and 2 CanFam2.0 annotated protein-coding genes, corresponding to the human genes and . A second statistically significant association was identified (=0.00049, OR=3.93, CI=1.78–8.66) for marker BICF2P893476 on chromosome 24 (). The marker is part of a two-SNP locus (Chr24: 43,091,222–43,595,979bp) spanning 0.5 Mb. , a member of the rat sarcoma (RAS) oncogene family is located within the locus bracketed by the two markers, which display complete LD (=1, =1). A notable difference in allele and genotype frequency distribution for BICF2P893476 was observed among cases and controls, at 37.8% “G” in cases versus 13.4% “G” in controls (). The allele and genotype distribution of BICF2P893476 is representative of all SNPs within the locus identified. In addition, five isolated SNPs displaying statistically significant values were identified (). All variants identified are located in noncoding regions and were not further investigated. Immunohistochemical expression of the two statistically significant PACG-associated genes, and was assessed in the dog eye. Staining of COL1A2 and RAB22A in sagittal sections of paraffin-embedded eyes revealed localization of both proteins in various substructures when compared to a negative control where the primary antibody was omitted (). Prominent COL1A2 localization was noted in the ciliary body (CB) as well as the apical epithelial cell surface of the ciliary processes (). RAB22A similarly localized to the ciliary processes, but revealed faint staining in the CB, indicating reduced localization here. Both proteins displayed minimal localization in the CC and TM (). Localization of COL1A2 was further noted in close proximity to the pigmented epithelium at the apical surface of the iris, whereas RAB22A staining was mostly observed in the stromal region (). In the cornea, COL1A2 was found predominantly located in the stromal regions, whereas, RAB22A staining revealed strong localization in the epithelial layer at the apical surface (). Both proteins revealed localization throughout the retina. COL1A2 showed a slight increase in staining in the outer nuclear layer and retinal ganglion cell layer. RAB22A revealed a strong staining signal in the outer segment and outer plexiform layer (). COL1A2 and RAB22A were also found to localize in the optic nerve when compared to the negative control (). No obvious differences were noted in COL1A2 or RAB22A localization or intensity in tissue derived from affected versus unaffected dogs. To assess collagen localization and discriminate between type I and type III collagens in ocular tissue, Picrosirius red staining of paraffin-embedded BH eye sections was conducted (). Type I collagen indicated by orange, pink, and red hues was the predominant collagen type observed in all structures of the eye. When compared to a negative control stained with Mayer’s Hematoxylin only, abundant localization of relatively thick, red-colored, type I collagen fibers was noted in the CB and the epithelial apical surface of the ciliary processes (). Similarly, strong type I collagen staining, appearing in red, was noted throughout the iris, cornea, and optic nerve (). On the other hand, reduced abundance in collagen deposition and fiber thickness were noted in the CC and TM, as indicated by the apparent orange-pink-colored fibers (). This finding validates the observed reduction in COL1A2 staining and localization in the TM shown above. Despite the absence of obvious differences in the localization or intensity of collagen staining in affected versus unaffected derived tissue, an overall widespread localization of collagen was noted in all eye structures, thereby confirming its prominent expression in the eye. Despite recent discoveries, the underlying genetic and environmental factors that contribute to the development and progression of glaucoma have not been fully elucidated. The condition may result in debilitating outcomes, including complete loss of vision in the absence of effective treatment. The identification of genetic variants that determine risk for developing glaucoma can not only be used to genetically identify dogs at low disease risk for breeding purposes, but may also provide insight into the pathophysiology of PACG. GWA analysis of clinically confirmed BHs with PACG cases versus controls has led to the identification of two associated regions, which supports the role of a genetic component in modifying risk for PACG in the BH. The highest value was achieved for a susceptibility locus on chromosome 14 containing the genes and . A second locus containing the gene was identified on chromosome 24. SNPs marking both loci achieved values in the order of 10, which indicates significant despite the modest sample size used. The observed pattern of haplotype distribution and allele frequency of markers within the loci identified does not support an additive effect of allele dosage in cases versus controls at multiple loci ( and ). Based on these results, it appears that variation in multiple associated regions determines risk for canine PACG rather than a single, major locus. These observations highlight the complex nature of the genetic and environmental effects underlying PACG inheritance. One shortcoming of this study is that in an effort to identify a sufficient number of clinically well-characterized dogs, animals from multiple PACG pedigrees were used. Additionally, cryptic relatedness is particularly common for dogs; a certain amount of relatedness is almost always detected, particularly in purebred dogs [-]. Sample independence is one of the main assumptions of most GWA test statistics [,], and thus the degree of relatedness among animals is a common concern in GWAS. However, a large number of animal studies were able to come to valid conclusions despite the discovery of cryptic relatedness among their study samples following the investigation of population stratification [,,]. Herein, sample relatedness was addressed by selecting cases and controls that were as distantly related to each other as possible and by using statistical approaches to correct for confounding relatedness. Our results reveal the effectiveness of the statistical methods used here to resolve the confounding effects of cryptic relatedness initially observed among our samples. Our findings also demonstrate that significant phenotype-genotype associations can be achieved with a modest sample size when using a closed and purebred population, such as the BH population used here. When compared to human populations, studies of the canine genome have shown that genetic homogeneity is much greater within individual dog breeds (94.6%) than within distinct human populations (72.5%) []. In some breeds, genetic variation has even been additionally reduced by extensive inbreeding and bottleneck events. The vast reduction in haplotype diversity in the dog genome facilitates mapping the genetic basis of phenotypic variation using GWAS [,]. Genetic associations can therefore be identified more efficiently using fewer markers and samples in canine versus human genetic studies []. With that in mind, the small sample size used in this study may be considered too modest to provide sufficient statistical power for detecting small genetic effects. This is particularly true if the risk variant is a rare allele with a small OR []. Human-based studies have demonstrated that when the causal SNP is rare (minor allele frequency [MAF]<10%), a sample size of 3,000 may still be underpowered to detect small genetic effects []. These findings may not be applicable to canine-based genetic studies considering the architecture of the canine genome, which could provide greater statistical power for the identification of risk variants with small effects using a smaller sample size relative to human-based studies []. It has been shown that many loci harboring common risk alleles for complex diseases will have effect sizes in the range of 1.1–1.2, which cannot be detected using the conventional study designs and sample sizes currently adopted, but rather using empirical analyses and significantly large sample sizes [,]. As such, our inability to detect small genetic effects with the sample size used here is expected considering that larger GWAS remain statistically underpowered to detect common variants with small effects. Our results reveal the strong association of two loci, containing promising candidate genes, to PACG. These findings support our expectation of detecting variants with large effects in association with a complex disease when using a small sample size. Several research studies have provided convincing evidence of the potential role of collagen in glaucoma, making a highly promising PACG candidate gene. Of particular interest is that a variant in the collagen gene has been recently identified in a GWAS of human PACG []. Central corneal thickness (CCT) is a known and proven risk factor of glaucoma []. In a GWA study investigating CCT and brittle cornea syndrome in association with glaucoma, significant associations in the collagen genes and were identified []. These findings suggest a possible involvement of collagen genes in the pathogenesis of PACG. Moreover, analysis of AH collected from patients with POAG revealed increased fibroblast proliferation and collagen synthesis in POAG versus unaffected derived AH []. The increased rate of fibroblast activity is speculated to contribute to excess deposition of collagen and subsequent loss of the TM cells during the development of glaucoma []. In addition, this locus contains a second gene—. Little is known about this gene, but studies in the mouse demonstrate that it is an imprinted, retrotransposon-derived gene. knockout mice showed early embryonic lethality, which indicates its critical role in mouse development []. Ras-related Protein , a member of the RAB family of small GTPases was identified within the second PACG associated locus in the BH. The protein encoded by this gene has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of molecules between endosomal compartments []. Neither nor has been discussed in relation to the pathology of glaucoma in the past. In conclusion, we have identified two loci associated with PACG in the BH. Our findings indicate the possible involvement of a collagen-related mechanism in the development of glaucoma in the BH. This finding is in accordance with emerging data that support the role of collagen in human PACG. Additional functional studies will be required to investigate the role of and possibly other collagen-encoding genes in PACG. This GWA analysis of genetic associations has demonstrated the complexity of PACG by implicating several genetic loci in association with the disease. Sequencing of candidate genes within the identified disease-associated loci will possibly lead to the identification of PACG-causing mutations in the BH. In addition to identifying the genetic variants underlying the disease, understanding the environmental factors that potentially modify risk to glaucoma is crucial for characterizing the pathophysiology of PACG. Ultimately, we anticipate the utilization of our findings in estimating disease risk in susceptible BHs and possibly other dog breeds susceptible to PACG. This finding may contribute to the reduction of disease incidence in the BH by selectively breeding animals following genetic testing for risk variants. With further research, findings in this study may shed light on important molecular mechanisms that contribute to PACG in the canine and potentially human patients.

Vitelliform macular dystrophy (VMD; ), also called Best disease [], is a clinically heterogeneous and pleomorphic disease, in most cases showing an autosomal dominant pattern of inheritance with extremely variable penetrance and expressivity. (chromosome 11q12-q13) [], the only gene virtually involved in all dominant Best VMD cases, encodes a 68 kDa protein called bestrophin-1 [] that is localized to the basolateral plasma membrane of the retinal pigment epithelium (RPE) and appears to exhibit properties of Ca-activated Cl channels []. Recently, several diseases have been linked to mutations in the gene, including autosomal recessive VMD, autosomal recessive bestrophinopathy, adult-onset foveomacular vitelliform dystrophy, autosomal dominant vitreoretinochoroidopathy, and retinitis pigmentosa [-]. Autosomal dominant Best VMD has a bimodal onset distribution with one maximum peak before puberty and a second following puberty and extending through the fifth decade of life [,]. The previtelliform stage represents the first of five progressive stages defined based on fundus examination, and is characterized by absence of symptoms and normal macula or subtle RPE alterations [,]. The second stage of Best VMD, the vitelliform stage, is characterized by a well-circumscribed 0.5- to 2-disc-diameter “egg-yolk” lesion within the macula, and by symptoms of metamorphopsia, blurred vision, and a decrease of central vision [,]. This disease stage is followed by the third stage, which involves pseudohypopyon (the yellow material accumulated inferiorly), the vitelliruptive fourth stage (partial resorption of the material, scrambled-egg lesion) and the atrophic/fibrotic fifth stage (final macular atrophy or fibrosis) [,]. With the advent of optical coherence tomography (OCT), it has been possible to anatomically examine the vitelliform lesion in vivo. We recently reported on high-definition spectral-domain (SD)-OCT findings in all of the progressive stages of the disease, including the previtelliform stage [], and proposed that early changes in Best VMD may involve the layer between the RPE and the inner segment and outer segment (IS/OS) interface, first with accumulation of material beneath the sensory retina, and then with disruption and loss of the IS and OS. The RPE is also affected in the disease course, with hypertrophy, disruption, and attenuation []. These findings are in agreement with a knock-in mouse model of Best VMD revealing accumulation of lipofuscin in the RPE and debris thought to be unphagocytosed photoreceptor OS and lipofuscin granules in the subretinal space []. Unfortunately, to date, no histopathological analyses have sampled the vitelliform lesion because patients examined postmortem had largely progressed beyond this stage. In fact, histopathological findings in Best VMD donor eyes only revealed abundant accumulation of lipofuscin in the RPE [,], and photoreceptor degeneration over a morphologically intact RPE layer [,]. For these reasons, in vivo OCT imaging currently represents the best way to assess the morphological changes in the different stages of Best VMD with a view to gaining insight into the physiopathology of disease progression. Interestingly, histopathological findings suggest that Best VMD may affect a more diffuse region than that of the ophthalmoscopically visible lesion, as extrafoveal diffuse macular accumulation of lipofuscin has been observed in the RPE [,,]. Blue fundus autofluorescence (FAF) is a useful tool to assess the extent of lipofuscin accumulation in the RPE in vivo [-]. However, in Best VMD, macular autofluorescence may originate not only from lipofuscin accumulation in the RPE, but also from debris (unphagocytosed photoreceptor OS) and lipofuscin accumulation in the subretinal space []. In this context, when associated with FAF imaging, OCT imaging may be extremely useful in determining the origin of macular autofluorescence in the different stages of Best VMD, together with the changes over time, by showing accumulation of material either in the RPE or in the subretinal space. In this study, we investigated the multimodal morphological features of the different stages of Best VMD in subjects harboring mutations in gene, and their changes during the progression of the disease. This analysis will give insights into the physiopathology of the disease by showing how the vitelliform material accumulates and reabsorbs, accompanied by changes in the outer and inner retinal layers. We longitudinally reviewed FAF and SD-OCT images of 21 Best VMD subjects from eight families with mutation followed at the Créteil University Eye Clinic between January 2007 and December 2012. At least one subject from each family was diagnosed with one of the progressive stages of Best VMD, on the basis of fundus examination and electrooculography, by two observers (GQ, EHS) [,,-]. In each family, affected subjects were screened for the mutation identified in the Best VMD proband by exome sequencing [-]. Informed consent was obtained according to an approved protocol of the Paris Est Créteil University Institutional Review Board, in agreement with the Declaration of Helsinki. All patients underwent multiple ophthalmological examinations during follow-up, which included assessment of best-corrected visual acuity (BCVA) measured at 4 m with standard Early Treatment Diabetic Retinopathy Study charts, fundus biomicroscopy, blue FAF (Spectralis HRA+OCT, Heidelberg Engineering, Heidelberg, Germany), and SD-OCT (Spectralis HRA+OCT, Heidelberg Engineering). Macular FAF findings and outer retinal layer structures observed in SD-OCT images were analyzed, interpreted, and measured independently GQ and EHS. The following features were recorded for each follow-up visit (from study entry to last follow-up visit): 1) stage of the disease [a) previtelliform stage; b) vitelliform stage; c) pseudohypopyon stage; d) vitelliruptive stage; e) atrophic or fibrotic stage] [,], as evaluated based on fundus biomicroscopy, FAF, and SD-OCT; 2) macular blue FAF features (hyperautofluorescence, hypoautofluorescence, or isoautofluorescence); 3) overall lesion area on FAF images measured using the Heidelberg software (Spectralis Acquisition and Viewing Modules; version 5.6.1.0, Heidelberg Engineering; ); 4) size of the inhomogeneously hyperautofluorescent and hypoautofluorescent components (areas) of the lesion; 5) status of the inner segment ellipsoid portion (ellipsoid zone, EZ), also known as the photoreceptor IS/OS interface [,] [a) almost normal—no detectable EZ changes; b) disrupted; c) absent] on central-fovea (within 500 μm from the foveal depression) SD-OCT scan; 6) reflectivity of the lesion [a) hyperreflective; b) hyporeflective; c) mixed hyperreflective/hyporeflective] as evaluated based on different SD-OCT scans (i.e. central-fovea, superior, and inferior horizontal scans, ± vertical scans passing through the fovea); 7) central macular thickness (CMT) measured using a 19-horizontal-lines protocol (6×6-mm area), each consisting of 1,024 A-scans per line (Spectralis Acquisition and Viewing Modules; version 5.6.1.0, Heidelberg Engineering); 8) thickness of the neurosensory retina at the fovea and maximal thickness and width of the lesion, measured using the caliper provided with Spectralis SD-OCT software (Spectralis Acquisition and Viewing Modules; version 5.6.1.0, Heidelberg Engineering). The values of the measurements were averaged for analysis. In case of disagreement regarding interpretation of the different features, or if the difference in the two readers’ (GQ, EHS) measurements was greater than 15% of the mean of two values, there was open adjudication. Statistical calculations were performed using Statistical Package for Social Sciences (version 17.0, SPSS Inc., Chicago, IL). The paired test was used to assess changes in mean BCVA converted to the logarithm of the minimal angle of resolution (LogMAR), mean overall lesion area on FAF images, mean size of the hyper/hypoautofluorescent components (areas) of the lesion, mean CMT, mean maximal thickness and width of the lesion, and mean thickness of the neurosensory retina at the fovea. Changes in mean measurements and in specific features were analyzed as a whole and by categorizing the stage of the disease at study entry. Pearson’s coefficient was used to measure the strength of correlations among variables. The chosen level of statistical significance was p<0.05. For correlations with BCVA, the significance level was adjusted to take the number of correlations into account (α = 0.0167; Bonferroni’s adjustment for multiple correlations). The screening of the 11 exons encoding in eight unrelated families resulted in the identification of seven previously reported different missense mutations clustered in exons 2, 4, and 7 [-] (). We examined 42 eyes of 21 patients harboring mutations (10 male, 11 female; ). The mean age of patients was 26.3±17.4 years. Age of onset (at time of diagnosis) varied between 2 and 71 years (median = 20). At study entry, LogMAR BCVA ranged between 0 and 1 LogMAR (mean, 0.34±0.34 LogMAR); significant correlation was found between BCVA and EZ status at fovea (Pearson’s correlation −0.4, p<0.001). All patients had typical bilateral macular lesions, except one who had unilateral macular lesion (Case 20), and one that presented with multifocal bilateral lesions (). Early stage lesions were characterized by the accumulation of yellowish material within the macula or outside the macular area (multifocal lesions), giving an aspect of foveal granularity (previtelliform lesions) or a typical, well-circumscribed yellow “egg yolk” (vitelliform lesions). This material showed no or only slight autofluorescence in the previtelliform stage (), but was highly autofluorescent in the vitelliform stage (). On SD-OCT scans, the previtelliform stage was characterized by a slight thickening of the hyperreflective band located between the hyperreflective EZ and the hyperreflective RPE/Bruch’s membrane complex (representing a thickening of the RPE/OS junction, also known as the interdigitation zone, IZ) [,] (), while it appeared as a hyperreflective dome-shaped lesion located in the subretinal space between the EZ and the RPE/Bruch’s membrane complex (representing a further thickening of the IZ; ). Later stages included pseudohypopyon (, , and ) and vitelliruptive lesions (; scrambled-egg aspect with dispersion of the vitelliform material without sign of atrophy or fibrosis), characterized by partial/complete reabsorption of the yellowish material and replacement by a fluid component showing no increased fluorescence on FAF or reflectivity on OCT examination (, , , and ). Late lesions were characterized by reduced fluorescence on FAF due to partial/complete atrophy (with or without residual dispersed material; ) or fibrosis (with no detectable active choroid neovascularization) within the area previously occupied by the yellowish material (). It is noteworthy that all of these late lesions were characterized by the presence of a hyperautofluorescent ring. Based on fundus biomicroscopy, blue FAF, and SD-OCT at study entry, the macular lesions were counted as follows (): 1) no lesions: one eye of one patient; 2) previtelliform lesions: 11 eyes of six affected patients; 3) vitelliform lesions: one eye of one affected patient; 4) pseudohypopyon: six eyes of six affected patients; 5) vitelliruptive lesions (scrambled-egg aspect with dispersion of the vitelliform material without sign of atrophy or fibrosis): eight eyes of seven affected patients; 6) atrophic lesions (atrophy with or without residual dispersed material): four eyes of two patients; and 7) Fibrotic lesions: 11 eyes of eight patients. A patient with unilateral macular lesion at study entry (Case 20) still showed no lesion in the fellow eye at last follow-up visit. Eleven eyes of six affected patients (Cases 9, 12, 14, 15, 17, and 19) showing previtelliform lesions still exhibited previtelliform lesions at the last follow-up visit (). One eye of one patient (Case 2) showing vitelliform lesions at study entry still showed vitelliform lesions at the last follow-up visit (). Three eyes of three patients (Cases 1, 12, and 18) showing pseudohypopyon lesions at study entry still showed pseudohypopyon lesions at the last follow-up visit (). Five eyes of four patients (Cases 1, 10, 11, and 21) showing vitelliruptive lesions at study entry still showed vitelliruptive lesions at the last follow-up visit (). Four eyes of two patients (Cases 4 and 7) showing atrophic lesions at study entry still showed atrophic lesions at the last follow-up visit (). Eleven eyes of eight patients (Cases 3, 6, 8, 11, 13, 16, 20, and 21) showing fibrotic lesions at study entry still showed fibrotic lesions at the last follow-up visit (). Three eyes of three patients showing pseudohypopyon lesions at study entry progressed to vitelliruptive lesions at the last follow-up visit (). Interestingly, three eyes of three patients showing vitelliruptive lesion at study entry reverted to pseudohypopyon lesion with overall enlargement of the lesion size (). Moreover, one eye of one patient with pseudohypopyon lesion at study entry, and pseudohypopyon lesion at the last follow-up visit, reverted to vitelliruptive lesion during follow-up (). Based on fundus biomicroscopy, blue FAF, and SD-OCT at study entry, the macular lesions were counted as follows (): 1) no lesions: one eye of one patient; 2) previtelliform lesions: 11 eyes of six affected patients; 3) vitelliform lesions: one eye of one affected patient; 4) pseudohypopyon: six eyes of five affected patients; 5) vitelliruptive lesions: eight eyes of seven affected patients; 6) atrophic lesions: four eyes of two patients; and 7) fibrotic lesions: 11 eyes of eight patients. Changes in mean measurements (mean BCVA, mean overall lesion area on FAF images, mean size of the hyper/hypoautofluorescent components of the lesion, mean CMT, mean maximal thickness and width of the lesion, and mean thickness of the neurosensory retina at the fovea) and in specific features (macular FAF features, status of the EZ, reflectivity of the lesion on SD-OCT scans, presence/absence of focal RPE thickenings (“RPE bumps”), and presence/absence of retinal pseudocysts), evaluated as a whole, and by categorizing the stage of the disease at study entry are reported in , , , and . In this study, we investigated the multimodal morphological features of Best VMD in subjects harboring mutations in gene, and their changes during the progression of the disease. Due to the paucity of histopathological data on the natural course of the disease, this analysis represents a unique opportunity to gather insights into the physiopathology of Best VMD. Overall, we found that the previtelliform lesions (characterized on blue FAF by absence or only slight autofluorescence and on SD-OCT by a slight thickening of the hyperreflective band located between the hyperreflective EZ and the hyperreflective RPE/Bruch’s membrane complex [i.e., the IZ]) did not progress to a different disease stage over a mean period of 34.3±19.7 months in all 11 eyes (six patients; and ). Patients presenting the previtelliform stage of the disease were generally younger than patients presenting more advanced stages (). In the current series, this may have accounted for the absence of progression of all previtelliform lesions and does not exclude the possibility that this stage might progress to advanced stages later in life. The vitelliform lesion (characterized on blue FAF by well-circumscribed high autofluorescence within the macula and on SD-OCT by a dome-shaped hyperreflectivity located in the subretinal space [between the EZ and the RPE/Bruch’s membrane complex]) was found in only one eye (one patient; ), and after 61 months, we did not observe a progression to a more advanced stage of the disease ( and ). However, on FAF, the vitelliform lesion showed an enlargement of the hyperautofluorescent lesion (from 0.28 mm to 0.36 mm), and on SD-OCT, an increase of both CMT (from 278 μm to 310 μm) and the hyperreflective subretinal lesion was observed (thickness: from 175 μm to 210 μm; width: from 601 μm to 687 μm; ). Pseudohypopyon lesions (characterized on blue FAF by a well-circumscribed high autofluorescence within the inferior-macula and on SD-OCT by a hyperreflectivity located in the inferior-macula subretinal space [between the EZ and the RPE/Bruch’s membrane complex]) were possibly due to partial reabsorption of the hyperautofluorescent (FAF) and hyperreflective (SD-OCT) material (replaced by a fluid component, showing no increased fluorescence on FAF or reflectivity on SD-OCT examination) and sedimentation of residual material according to the laws of gravity. Pseudohypopyon lesions did not progress to a different disease stage over a mean period of 45.3±28.9 months in three eyes (three patients; and ). In these eyes, the pseudohypopyon lesion showed a slight enlargement of the overall lesion area (from 6.93±3.8 mm to 7.24±4.6 mm, p = 0.6) and a decrease of the hyperautofluorescent lesion (from 3.19±1.2 mm to 2.64±1.6 mm, p = 0.07; –) on FAF. On SD-OCT, a slight decrease of both CMT (from 450.4±41.4 μm to 423.0±60.8 μm, p = 0.1) and the mixed hyper/hyporeflective subretinal lesion (thickness: from 321.4±71.8 μm to 293.5±88.4 μm, p = 0.2; width: from 2,925.4±320.6 μm to 2,815.0±331.8 μm, p = 0.1) was recorded (–). On the other hand, pseudohypopyon lesions progressed to vitelliruptive lesions in three eyes (three patients) after 32.3±25.5 months ( and ). In these eyes, the overall lesion area decreased slightly (from 5.32±2.9 mm to 5.16±3.3 mm, p = 0.6) and the hyperautofluorescent lesion disappeared (–). On SD-OCT, a modest decrease of both CMT (from 332.0±13.7 μm to 323.0±21.1 μm, p = 0.1) and the hyper/hypo-reflective subretinal lesion (thickness: from 226.5±13.2 μm to 215.6±15.4 μm, p = 0.1; width: from 2,110.5±895.9 μm 2056.0±648.4 μm, p = 0.3) was recorded (–). Vitelliruptive lesions, characterized by no increased autofluorescence and reflectivity on blue FAF and SD-OCT, respectively, were possibly due to complete reabsorption of the material and replacement by a fluid component. Vitelliruptive lesions did not progress to a different disease stage over a mean period of 52.8±4.6 months in five eyes (four patients; and ). In these eyes, the vitelliruptive lesion showed a minor enlargement of the hypoautofluorescent lesion (from 5.15±4.0 mm to 5.5±4.0 mm, p = 0.1; and ). On SD-OCT, a slight increase of CMT (from 361.4±52.2 μm to 365.6±33.9 μm, p = 0.8) and a modest decrease of the hyporeflective subretinal lesion (thickness: from 233.6±99.6 μm to 188.8±120.4 μm, p = 0.02; width: from 2283.0±822.6 μm 1818.8±592.0 μm, p = 0.07) were recorded ( and ). On the other hand, after a mean of 45.1±17.6 months, we did not find a progression to a more advanced stage of the disease in any case ( and ). Interestingly, vitelliruptive lesions reverted to pseudohypopyon lesions in three eyes (three patients) after 53.0±25.5 months ( and ). In these eyes, the overall lesion area showed a modest increase (from 4.57±2.7 mm to 5.36±3.0 mm, p = 0.1) and a hyperautofluorescent lesion appeared (mean 1.87±1.5 mm; and ). On SD-OCT, a slight increase of both CMT (from 397.2±61.4 μm to 417.0±52.3, p = 0.1) and the hyporeflective subretinal lesion (thickness: from 285.2±44.2 μm to 291.5±51.6 μm, p = 0.1; width: from 2,289.2±382.1 μm to 2,329.5±457.5 μm, p = 0.3) was recorded ( and ). It is noteworthy that one eye of one patient with a pseudohypopyon lesion at study entry first reverted to vitelliruptive lesion and then progressed to pseudohypopyon lesion once more (). Atrophic lesions, characterized by decreased autofluorescence on blue FAF and by diffuse loss of photoreceptor and other sensory retina layers on SD-OCT, did not progress to a different disease stage over a mean period of 31.0±8.0 months in all four eyes (two patients; and ). In these eyes, we did not find an enlargement of either the overall lesion area (from 3.72±2.5 mm to 3.70±2.9 mm, p = 0.2) or the hypoautofluorescent lesion (from 2.23±2.2 μm to 2.21±2.8 μm, p = 0.3; ). On SD-OCT, no change of CMT (from 168.0±34.5 μm to 163.5±39.5 μm, p = 0.5) was recorded (). Fibrotic lesions were characterized by inhomogeneous areas of absolute hypoautofluorescence mixed with hyperautofluorescence (due to some residual dispersed autofluorescent material) on blue FAF and by a prominent, highly hyperreflective thickening at the RPE level. This induced a marked anterior bulging, accompanied by diffuse loss and thinning of the sensory retina on SD-OCT, and did not progress to a different disease stage over a mean period of 41.7±16.8 months in any of 11 eyes (eight patients; and ). In these eyes, we did not find an enlargement of either the overall lesion area (from 8.59±5.3 mm to 8.57±6.2 mm, p = 0.7) or the hypoautofluorescent lesion (from 3.18±1.0 μm to 3.15±1.2 μm, p = 0.8; ). On SD-OCT, no change in CMT (from 458.3±249.7 μm to 457.2±245.2 μm, p = 0.2) was recorded (). Taken together, the current findings suggest that Best VMD should be considered as a dynamic disease-alternating phases of material accumulation and reabsorption in its progression: This is characterized by centrifugal expansion (mainly downward due to gravitation) and contraction, at least until development of the end-stage form of the disease (atrophic lesions do not appear to expand over time). All of these elements together favor the concept that RPE-mediated changes in the ionic environment of the subretinal space may lead to aberrant interaction between photoreceptors and the RPE, resulting in the continuous accumulation of fluid and OS debris in the subretinal space [,-,,]. In turn, multimodal imaging features in the different stages of Best VMD, and their changes during the progression of the disease, suggest that although the abnormal protein encoded by gene is expressed in the RPE, its primary anatomic impact should be at the photoreceptor level [,-,,]. In the current series, we were not able to identify any factors related either with the bimodal onset of autosomal dominant Best VMD [,] or with the disease progression through different stages. Particularly, if we look at Family 1 (), while Case 1 presented as early as at the age of 18 years old with pseudohypopyon and vitelliruptive lesions in the right eye (RE) and left eye (LE) respectively (third and fourth stage, respectively) [,], while Case 2 presented at the older age of 44 years with vitelliform and pseudohypopyon lesions in the RE and LE, respectively (second and third stage, respectively) [,]. Interestingly, while in the older family member(Case 2), the vitelliform lesion did not progress over 61 months, the pseudohypopyon lesion (a more advanced stage) did progress to the vitelliruptive lesion; on the other hand, in the younger family member (Case 1), neither the pseudohypopyon nor the vitelliruptive lesions (i.e., more advanced stages) progressed over 61 months. This study had several limitations, including its retrospective design, the relatively short duration of follow-up, and the small number of patients included. However, our analysis provides valuable information on the modalities of Best VMD progression, and on the rate of material/fluid accumulation until the development of the end-stage atrophic form of the disease, which may be used not only in the counseling affected patients, but also in the planning of therapeutic clinical trials for this dominantly inherited macular dystrophy. In conclusion, we documented a continuous material accumulation and reabsorption in Best VMD progression. Blue FAF and SD-OCT are important noninvasive imaging techniques to monitor Best VMD.

Hepcidin is a small polypeptide hormone, consisting of 25 amino acids, that is obligatory for iron regulation [,]. Hepcidin is expressed predominantly in the liver. The peptide exhibits bactericidal activity at high non-physiologic concentrations; this coupled with the peptide’s hepatic origin was the basis of the name “hepcidin” for the peptide and hepatic antimicrobial peptide ( HGNC ID: 15595; OMIM: ) for the gene []. However, at physiologic concentrations, the sole function of this peptide is to regulate iron homeostasis. The iron export transporter ferroportin, expressed on the basolateral membrane of intestinal cells and on the plasma membrane of macrophages, is the target for hepcidin [,]. Upon interaction with hepcidin, ferroportin undergoes proteosomal degradation, consequently resulting in decreased delivery of dietary iron from the intestinal cells into the blood and decreased release of iron from macrophages that originate from degradation of hemoglobin and other heme-containing proteins. Thus, elevated levels of hepcidin in the circulation cause systemic iron deficiency whereas decreased levels of hepcidin cause iron overload. The expression of hepcidin in the liver is under strict regulatory control; three proteins, namely, HFE (histocompatibility antigen associated with iron [Fe] regulation or high Fe), hemojuvelin (HJV or HFE2), and interleukin-6 (IL-6), have robust control of the transcription of , all facilitating hepcidin expression [,,-]. Inactivating mutations in HFE and HJV lead to decreased circulating levels of hepcidin, resulting in the genetic iron-overload disease, known as hereditary hemochromatosis [,]. The same is true with inactivating mutations in hepcidin [,]. HJV is a membrane-bound protein anchored to the lipid bilayer via glycosylphosphatidylinositol []. HJV also exists in a soluble form as a result of proteolytic cleavage by the enzyme furin []. When present in the membrane-bound form, HJV serves as a coreceptor for bone morphogenetic proteins, particularly BMP6, and induces hepcidin expression via phosphorylation of Smads 1/5/8 [,]. The soluble form of HJV traps BMPs by binding to them, and consequently blocks BMP signaling, phosphorylation of Smads, and transcription of [,]. IL-6 induces transcription through phosphorylation of STAT3 []; this activity is responsible for elevation of circulating levels of hepcidin during inflammation, causing inflammation-associated anemia []. The mechanism by which HFE induces expression remains unknown. Iron is obligatory for normal function of the retina. Since excess iron can cause oxidative damage whereas iron deficiency would compromise retinal function, iron levels in the retina must be tightly regulated. Until recently, it was assumed that the retina is immune to changes in circulating levels of iron because of the presence of the blood–retinal barrier. However, recent studies have shown that retinal iron levels are drastically altered in diseases associated with disruption of systemic iron levels [,]. However, this is not because the retinal iron levels respond passively to circulating levels of iron but because almost all iron-regulatory proteins that are expressed in the liver and other tissues are also expressed in the retina. Importantly, evidence has emerged in recent years to indicate that the retina maintains significant autonomous control in iron homeostasis [,]. Various cell types within the retina actively participate in maintaining iron homeostasis. HFE is expressed exclusively in the RPE where the presence is restricted to the basolateral membrane []. HJV is expressed in all cell retinal cell types, and its expression in RPE is restricted to the apical membrane []. Hepcidin is expressed throughout the retina [,]. Dysregulation of retinal iron homeostasis in humans and mice resulting in increased accumulation of iron within the retinal tissue is associated with a phenotype resembling age-related macular degeneration [-]. More recently, a new regulator of systemic iron status has been discovered. The serine protease matriptase-2 (also known as TMPRSS6; transmembrane protease serine 6), has emerged as a critical regulator of iron homeostasis. Matriptase-2 is a membrane-bound enzyme that cleaves membrane-associated HJV and thus blocks the ability of HJV to induce hepcidin production [,]. The soluble form of HJV that is produced by furin-mediated cleavage is not a substrate for matriptase-2 []. Inactivating mutations in lead to elevated levels of membrane-bound HJV, increased BMP signaling, and abnormally high levels of hepcidin [,]. The consequence of such mutations is systemic iron deficiency and the disease is called iron-refractory iron-deficiency anemia (IRIDA) [,]. Since we have shown recently that HJV is expressed robustly in all retinal cell types and plays an important role in retinal iron homeostasis [], we asked whether the newly identified iron regulator matriptase-2 has any role in retinal iron status. No information is available in the literature on the expression or function of this enzyme in the retina. The purpose of the present study was to examine the expression of matriptase-2 in the retina and investigate the relevance to retinal iron homeostasis using the matriptase-2 knockout mouse (known as mouse because of the characteristic loss of hair in the body trunk but preservation of facial hair) []. In this mouse, matriptase-2 is synthesized as a truncated protein that has no catalytic activity due to the deletion of the entire serine protease domain located in the C-terminal domain [,]. Reagents were obtained from the following sources: reagent for RNA preparation (TRIzol; Invitrogen-Gibco, Grand Island, NY); Dulbecco’s Modified Eagle Medium:Nutrient Mixture F-12 (DMEM/F12) culture medium (Invitrogen, Carlsbad, CA), RT–PCR kit (Applied Biosystems, Foster City, CA), polymerase kit (TaKaRa, Tokyo, Japan), normal donkey serum (Jackson ImmunoResearch, West Grove, PA), and JB-4 solutions (Polysciences, Warrington, PA). The following antibodies were used: chicken anti-MCT1 (Alpha Diagnostic International, San Antonio, TX), goat anti-neogenin and rabbit anti-IL-6 (Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-hepcidin (Abcam, Cambridge, MA), rabbit anti-Smad5 and rabbit anti-pSmad1/5/8 (Cell Signaling, Danvers, MA), rabbit anti-hemojuvelin (GenScript, Piscataway, NJ), mouse monoclonal anti-pSTAT3 (Cell Signaling), and rabbit anti-transferrin receptor 1 (Alpha Diagnostic International). Two different rabbit polyclonal antibodies specific for matriptase-2 (Abcam) were used: one (catalog # ab28287) targeted against the stem region of the protein, which is present in the truncated matriptase-2 expressed in the mouse, and the other (catalog # ab42463) targeted against the C-terminal catalytic domain of the protein, which is absent in the truncated matriptase-2 expressed in the mouse. Rabbit anti-H-ferritin and rabbit anti-L-ferritin antibodies were a generous gift from Dr. Paolo Arosio, University of Brescia, Brescia, Italy. Goat anti-chicken immunoglobulin G (IgG) coupled to Alexa Fluor 568, donkey anti-goat IgG coupled to Alexa Fluor 568, and donkey anti-rabbit IgG coupled to Alexa Fluor 568, 555, and 488 were purchased from Molecular Probes (Carlsbad, CA). Breeding pairs of heterozygous mice () on a C57BL/6 background were purchased from the Scripps Research Institute (La Jolla, CA). The homozygous knockout females () are sterile because of the profound iron deficiency that cannot support pregnancy. Therefore, we generate the mice for our studies by crossing males with heterozygous females; even with this breeding scheme, the litter size is always small, indicating significant prenatal lethality. Genotyping was performed to identify wild-type, heterozygous (), and homozygous () mice in the litters. Age-matched wild-type and knockout () mice were selected from the same litters for comparison studies. The knockout mice have a homozygous mutation in induced by -ethyl--nitrosourea, which results in a truncated matriptase-2 with no proteolytic active site located at the C-terminal tail (matriptase-2 null) []. All procedures involving mice were approved by the Institutional Committee on Animal Use for Research and Education at the Georgia Regents University and were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Cryosections of mouse eyes were fixed in 4% (v/v) paraformaldehyde for 10 min, washed with 0.01 M Dulbecco’s PBS (1X; 1.5 mM KHPO, 8.1 mM NaHPO, 137 mM NaCl, 2.7 mM KCl)/0.1% Triton X-100 (pH 7.4), and blocked with 4% normal donkey serum for 1 h. Sections were then incubated overnight at 4 °C with one or more of the following primary antibodies: chicken anti-MCT1 (1:1,000), goat anti-neogenin (1:100), rabbit anti-matriptase 2 (1:50), rabbit anti-H-ferritin (1:2,000), rabbit anti-L-ferritin (1:2,000), rabbit anti-hemojuvelin (1:100), rabbit anti-hepcidin (1:100), rabbit anti-Smad5 (1:50), rabbit anti-pSmad1/5/8 (1:50), and rabbit anti-IL-6 (1:200). Negative control sections were treated identically, but in the absence of the primary antibody. Sections were rinsed and incubated for 1 h with the corresponding secondary antibody, either independently or together as needed, at a dilution of 1:1,000. Coverslips were mounted after staining with Hoechst nuclear stain, and sections were examined with a fluorescence microscope (Leica DM5500B, Leica Microsystems, Buffalo Grove, IL) or laser-scanning confocal microscopy (Carl Zeiss Meditec). H&E-stained sections of retinas from 5-month-old  mice along with age-matched wild-type mice were used for systematic morphometric analysis with a fluorescence microscope (Leica DM5500B, equipped with a DFC450 camera and the LAS AF program). Measurements included the thicknesses of the total retina, RPE, inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), outer nuclear layer (ONL), and the photoreceptor inner/outer segments. The number of cell bodies in the ganglion cell layer (GCL) was quantified by counting cells from the temporal ora serrata to the nasal ora serrata, and the data are expressed as number of cells per 100-μm length of retina. Three measurements were made on each side (temporal and nasal) of the optic nerve at 200- to 300-μm intervals, resulting in six measurements per eye. Two measurements on either side of the optic nerve were taken as the central retina, and the remaining four measurements from that eye were considered the peripheral retina. Both eyes were analyzed in each mouse. Statistical analysis was performed with the Student paired test (wild-type versus knockout); p<0.05 was taken as significant. Cultures of RPE, Müller, and ganglion cells from mouse retinas were established as described previously [-]. Total RNA was isolated from these primary cultures for analyzing mRNA levels for matriptase-2, hemojuvelin, and neogenin. RNA was isolated from the wild-type and  mice by TRIzol extraction, and RT–PCR was performed using the GeneAmp RT–PCR kit. PCR primers were designed based on the sequence information available in GenBank for mouse cDNAs. The primer sequences are given in . PCR was performed using a commercially available Taq polymerase kit. The sizes of the PCR amplicons were as follows: matriptase-2, 842 bp; neogenin, 621 bp; hemojuvelin, 551 bp; HFE, 142 bp; hepcidin, 188 bp; TfR1, 633 bp. All experiments were repeated three to five times with independent cell or tissue preparations and samples run in duplicate. Data are presented as mean±standard error of the mean (SEM). Statistical significance was determined with the Student t test and one-way ANOVA with Tukey-Kramer’s post-hoc tests for comparisons between two groups or multiple groups, respectively. Differences were considered statistically significant at p<0.05. We first used RT–PCR to examine the expression of matriptase-2 and its substrate hemojuvelin in the mouse retina and in primary cultures of mouse RPE, Müller cells, and ganglion cells. Matriptase-2 mRNA was present in the neural retina as well as in RPE/eyecup and was detected in primary cultures of RPE, Müller cells, and ganglion cells (). Similarly, hemojuvelin was also expressed in the neural retina, RPE/eyecup, and primary cultures of all three retinal cell types examined (RPE, Müller cells, and ganglion cells). Neogenin is a receptor for the repulsive guidance molecules (RGMs), and hemojuvelin, also called RGMc, is a member of this group. Recently, neogenin has been shown to be a regulator of hepcidin expression in the liver; deletion of neogenin leads to reduced BMP signaling, decreased hepcidin expression, and enhanced accumulation of iron in the liver []. Neogenin is required for the control of hepcidin expression by hemojuvelin; it interacts with matriptase-2 and hemojuvelin in a ternary complex and facilitates the cleavage of membrane-bound hemojuvelin by matriptase-2 []. Therefore, we monitored the expression of neogenin in the mouse retina with RT–PCR and found the expression pattern of neogenin mRNA to be as ubiquitous as that of matriptase-2 mRNA and hemojuvelin mRNA (). Immunofluorescence analysis of matriptase-2 protein paralleled its mRNA expression pattern (). The protein was detected in ganglion cells, Müller cells, and RPE. It was also present in various other neuronal cells, including the photoreceptor cells. We then focused on RPE, a polarized cell with its apical membrane facing the subretinal space and the basolateral membrane facing the choroidal circulation, for the expression of matriptase-2. Since we have previously shown that hemojuvelin is expressed only on the apical membrane of RPE [], it was important to know if matriptase-2 and its proteolytic substrate hemojuvelin are colocalized in the same membrane. It was indeed the case (). The apical membrane localization of matriptase-2 was further confirmed by its colocalization with MCT1, a marker for RPE apical membrane. In contrast, there was no evidence of colocalization for matriptase-2 and , an iron-regulatory protein that is present only in the basolateral membrane of RPE. Neogenin was also found in the RPE apical membrane (). To determine the specificity of the matriptase-2 staining in the retina described in , we wanted to compare the immunostaining between the retinal sections prepared from wild-type mice and matriptase-2 knockout () mice. However, the antibody we used initially to generate the data in was not suitable for this purpose. This particular antibody was raised against a peptide sequence located in the stem region of matriptase-2; but the mice () express a truncated matriptase-2 protein that still contains the stem region []. Therefore, we used another antibody that was targeted against the protease catalytic site located in the C-terminal domain of the protein; this region is absent in the truncated protein generated in the mouse. With this antibody, we compared the matriptase-2 immunostaining in retinal sections between wild-type mice and mice. Again, the expression of matriptase-2 was evident in all layers of the retina when examined with the retinal sections from wild-type mice, but the staining was completely absent in retinal sections from the knockout mice when processed under identical conditions (). These data confirm the specificity of the matriptase-2 antibody and thus the specificity of the immunostaining observed in the wild-type mouse retina. We have shown previously that deletion of and in mice leads to excessive iron accumulation in the retina and iron-induced oxidative stress, resulting in significant retinal degeneration [,]. Deletion of matriptase-2 in mice causes systemic iron deficiency [], but the retina has not been evaluated in these mice. Therefore, we examined the retinal morphology in matriptase-2-knockout mice. When examined with 3-month-old or 5-month-old mice, the gross morphology of the retina was not different between the mice and the age-matched wild-type mice (). However, an in-depth morphometric analysis revealed small, but significant, differences in specific parameters in 5-month-old wild-type and mice (). This included an increase in the thickness of the whole retina as well as various individual nuclear and cell layers in the mouse. This difference was more prominent in the peripheral retina than in the central retina. Such changes, however, were not detectable in 3-month-old mice (data not shown). These results suggest that the changes in retinal morphology in the mouse represent an age-dependent phenomenon. Since the mice die prematurely due to severe iron deficiency, we were not able to analyze the retinal morphology in these mice beyond 5 months of age. Systemic iron deficiency has been demonstrated in mice []. Here we examined the iron status in the retina in the mouse. We used the expression levels of H-ferritin and L-ferritin to monitor the iron status. Ferritin is an intracellular iron-storage protein, and its levels go up in iron overload but go down in iron deficiency. With immunofluorescence analysis, we found the levels of the heavy (H) and light (L) chains of ferritin were lower in the mouse (5-month-old) retina than in the age-matched wild-type mouse retina (). RT–PCR analysis revealed marked upregulation in the expression of the iron-regulatory genes , (the gene coding for the iron-regulatory hormone hepcidin), and (the gene coding for the transferrin receptor 1 that mediates iron uptake in most tissues; ). Quantitative PCR confirmed the upregulation of these three genes. The steady-state levels of mRNAs for HJV, hepcidin, and transferrin receptor 1 increased in the knockout mouse retina sixfold, threefold, and fivefold, respectively. The expression of HFE was reduced in the knockout mouse retina slightly. The increased expression of TfR1 is a strong indicator of iron deficiency. We confirmed this finding by monitoring the TfR1 protein levels with immunofluorescence (). The upregulation of HJV and hepcidin at the mRNA level was also confirmed at the protein level with immunofluorescence (). Since hepcidin is the hormone that most other iron-regulatory proteins converge upon to elicit their control over iron homeostasis, we examined the changes in the mRNA levels of hepcidin specifically in the neural retina versus the RPE/eyecup (). Interestingly, the upregulation of expression observed in the mouse retina was confined to the neural retina. There was no change in hepcidin mRNA levels in the RPE/eyecup between wild-type mice and the mice. These studies clearly demonstrate that the defective function of matriptase-2 causes iron deficiency in the retina. Hemojuvelin induces the expression of the through BMP signaling [-]. It has also been shown that BMP signaling is upregulated in the mouse liver, which links the increased expression of hemojuvelin and the increased expression of hepcidin []. Based on these findings in the mouse liver, we predicted a similar mechanism for the upregulation of hepcidin in mouse retina. To test the validity of this prediction, we analyzed BMP signaling in the retinas from the 5-month-old wild-type and mice. Contrary to our prediction, BMP signaling was decreased in the mouse retinas compared to the wild-type mouse retinas as evidenced from the decreased phosphorylation of Smad1/5/8 with no difference in total Smad5 protein levels (). The decreased BMP signaling in the mouse retinas was confirmed by the downregulation of the expression of , a target for BMP signaling (). These data demonstrate that hepcidin expression in the mouse retina is upregulated despite the decreased BMP signaling, suggesting some other mechanism. The proinflammatory cytokine IL-6 is a potent inducer of hepcidin expression []; therefore, we compared IL-6 expression in the retina between the wild-type and mice. We found significant upregulation of IL-6 expression at the protein level (immunofluorescence; ) and at the mRNA level (qPCR; ). We also examined the changes in IL-6 signaling by monitoring the phosphoform of the transcription factor STAT3 by immunofluorescence. We found an increase in the levels of the phosphorylated form of STAT3 in the knockout mouse retinas compared to the wild-type mouse retinas (). These data show that the upregulation of hepcidin expression observed in the mouse retina occurs not through BMP but most likely through IL-6. In the present study, we report for the first time on the expression of matriptase-2 in the retina. The protein is expressed widely in the retina, with evidence of expression seen in the RPE, Müller cells, and ganglion cells. We recently reported that hemojuvelin, a substrate of matriptase-2, is expressed in the retina and that mice lacking hemojuvelin develop iron overload and retinal degeneration [,]. Matriptase-2 along with neogenin is known to cleave GPI-anchored HJV into a soluble form and thus block the ability of HJV to induce hepcidin production [,]. Thus, we wanted to understand the role of matriptase-2 in hemojuvelin-mediated retinal iron homeostasis. We found that in the RPE, the expression of matriptase-2 is restricted to the apical membrane that faces the neural retina. The specific colocalization of matriptase-2 in the apical membrane of the RPE along with hemojuvelin and neogenin is particularly exciting, given that all these three proteins interact together to regulate hepcidin expression []. The RPE is involved in the handling of iron arising from the continuous phagocytosis of outer rod segments. Thus, the RPE must have mechanisms to export iron to protect against the risk of excessive iron accumulation and consequent oxidative stress and tissue damage. The same is true also for heme, and RPE expresses two different heme transporters in a polarized manner []. Iron export in other cell types is mediated almost exclusively by ferroportin, and the expression of this transporter has been reported in the RPE []. In our previous studies, we have demonstrated that hepcidin, which regulates ferroportin, is also expressed in the RPE []. We have also shown that the expression of hepcidin in the RPE is controlled by HFE and HJV during iron overload [,]. Hepcidin expression is also regulated during inflammation independent of HFE and HJV []. Thus, matriptase-2, neogenin, and hemojuvelin together may play a vital role in regulating the retinal iron homeostasis by regulating local production of hepcidin within the retina by the RPE and other retinal cell types. In humans, matriptase-2 mRNA is detected almost exclusively in the liver []; in contrast, the expression is much more widespread in the mouse, with expression detectable not only in liver but also in other tissues such as the kidney and the uterus []. However, none of the reported studies has examined the retina for matriptase-2 expression. The present study provides the first evidence for the expression of this important iron-regulatory protein in the retina. This finding strengthens the currently emerging view that the retina is equipped with all the mechanisms necessary for local control of iron homeostasis independent of systemic iron status. The present study showing the widespread expression of matriptase-2 in the retinal cells prompted us to examine the retina in matriptase-2 knockout mice. For this purpose, we used mice, lacking a functional matriptase-2 protein, that has been reported to have elevated levels of membrane-bound HJV, increased BMP signaling in the liver, and abnormally high levels of hepcidin resulting in systemic iron deficiency []; however, the retina has not been examined in this mouse. In line with what was expected, we found that the mice had iron deficiency in the retina marked by a decrease in H-ferritin and L-ferritin levels and drastic upregulation of hepcidin expression. Interestingly, despite the convincing evidence for iron deficiency within the retina in mouse, there are no profound changes in retinal morphology and architecture. It is possible that iron deficiency in this mouse model is not severe enough to cause significant alterations in retinal morphology. Alternatively, the retinal changes that occur in response to iron deficiency might be an age-dependent phenomenon; since mice succumb to death at an early age due to systemic iron deficiency, retinal changes promoted by iron deficiency may not become noticeable at such a young age. We noticed a small, but significant, increase in the thickness of various cell layers in the knockout mouse retina, but how iron deficiency causes these changes remains to be determined. Inactivating mutations in matriptase-2 lead to iron-deficiency anemia that does not respond well to iron therapy because of the inability to decrease hepcidin production in the liver during iron deficiency []. Iron-deficient animals have enhanced expression of matriptase-2 in the liver, suggesting that downregulation of hepcidin expression in response to acute iron deficiency is mediated by an increase in matriptase-2 protein levels []. Matriptase regulates hepcidin expression in the liver through the suppression of BMP/Smad signaling by cleaving the BMP coreceptor HJV [,,]. Livers from mice deficient in matriptase-2 have decreased iron stores and markedly increased mRNA for , a target gene of BMP6 signaling []. Loss of BMP6 decreases hepcidin levels, increases hepatic iron, and, importantly, rectifies the abnormalities in matriptase-2 mutant mice []. Unlike in the liver, the BMP/Smad signaling was downregulated in the mouse retina as evidenced from decreased expression, a downstream target of BMP signaling. However, , another target gene of BMP signaling, was upregulated many-fold in the mouse retina, indicating alternative mechanisms for hepcidin upregulation independent of BMP signaling. Interestingly, earlier studies using double knockouts of matriptase-2 with either HFE or HJV have shown that hepatic hepcidin upregulation in mice occurs irrespective of the presence or absence of HFE or HJV [,]. All these studies show that hepcidin can be upregulated in mice independent of HFE and HJV; however, future studies should be aimed at understanding the reason for downregulation of BMP signaling in the retina opposite of the effect reported in the liver of mice. Hepcidin upregulation occurs either by BMP signaling or through inflammation mediated by IL-6 [,]. The elevated IL-6 expression coupled with decreased BMP signaling in the mouse retina shows that the upregulation of retinal hepcidin expression in this mouse model is due to the proinflammatory cytokine IL-6 and not due to BMP. IL-6 influences gene expression through its cell-surface receptor, which ultimately leads to activation of JAK1/2 and consequent phosphorylation of the transcription factor STAT3. The phosphoform of STAT3 translocates to the nucleus to facilitate the transcription of IL-6 target genes such as [,]. In the present study, we have shown not only the upregulation of IL-6 at the mRNA and protein levels but also the increased expression of the phosphoform of STAT3 in the matriptase-2 knockout mouse retina. Although these studies convincingly show that the upregulation of hepcidin expression in the matriptase-2 knockout mouse retina occurs most likely via IL-6, the relationship between iron deficiency observed in this mouse and increased IL-6 production in the retina remains to be explored at the molecular level.

xref #text A relatively brief course of antenatal GCs administration (dexamethasone or betamethasone) improves survival and appears to protect against brain damage,,,,. In clinical trials and observational studies, antenatal administration of GCs has been associated with a decreased risk of intraventricular hemorrhage and CP in preterm infants, and confers protection against periventricular leukomalacia,,. The protective effect on the white matter appears to be greater among infants who show evidence of a fetal inflammatory response, such as chorioamnionitis,. In one retrospective study, antenatal exposure to betamethasone, but not dexamethasone, was associated with the decreased risk of cystic periventricular leukomalacia in premature infants of 24 to 31 weeks gestation. With regard to neurodevelopmental outcomes, a single course of antenatal GCs is generally thought to be beneficial,,,,,,. However, the use of repeated courses of antenatal GCs has been more controversial, despite some evidence for neonatal benefit if the mother remains at risk of preterm labor. Several nonrandomized studies concerning repeated courses of antenatal GCs have reported adverse effects on fetal growth and head circumference, suppression of the fetal HPA axis, and abnormal neurodevelopment,,. Repeated betamethasone injections, given to the mother at weekly intervals, have resulted in improvements in postnatal lung function, but also a reduction in birth weights. In studies using volumetric MRI, repeated antenatal GC treatments have been associated with a decreases in brain surface area, in the whole cortex convolution index, and in a measure of cortical surface complexity in preterm infants. A study by the Australasian Collaborative Trial of Repeat Doses of Steroids reported that repeated administration of antenatal GCs to mothers at risk of preterm birth reduced neonatal morbidity, without changing either survival free of major neurosensory disability or body size at 2 years of ages, although -scores for weight and head circumference were lower at birth in the repeated-dose group compared with the single-dose group. One systematic review reported that repeated administration of betamethasone weekly or biweekly restricted intrauterine growth, which has raised concerns about long-term consequences on neurodevelopment and metabolism. Endogenous GCs are essential for many aspects of normal brain development. However, dexamethasone and betamethasone readily cross the placental barrier, potentially exposing the fetus to excess GCs, which can suppress the HPA axis and endogenous cortisol production,,,. Overexposure of the fetus to corticosteroids by using synthetic GCs during certain stages of pregnancy can profoundly affect the development of the neuroendocrine system which may lead to life-long effects on endocrine, behavioral, emotional, and cognitive function. These life-long effects on neuroendocrine function are associated with increased risks of developing a wide range of metabolic, cardiovascular, and brain disorders in later life,. In summary, a single course of antenatal GCs administered to mothers at risk of premature labor has major benefits for infants born before 34 weeks gestation,,,,,,,,,,,. However, there is limited information available on the long-term effects of antenatal GCs on neurodevelopment in humans. Repeated courses of antenatal CGs may be associated with reduced birth weight and fetal head growth. Fetal exposure to excess GCs can affect the development of the neuroendocrine system, potentially leading to life-long effects on endocrine, behavior, emotional, and cognitive function. More studies including long-term follow-up of exposed children are needed to confirm the efficacy and safety of antenatal GCs use, especially of repeated courses of treatment. Since the first report in 1974, a number of studies have showed that use of postnatal GCs to treat or prevent CLD increases the risk of neurodevelopmental disability and CP in preterm infants,,,,,,,,,,,,,,,,,,,,,,,,,,,,. Among systemically administered postnatal GCs, dexamethasone has been extensively studied and has proven to be effective in the management of BPD because of its anti-inflammatory effects. Dexamethasone is a potent, long-acting steroid with exclusively glucocorticoid effects. Its use has been studied during the early (<7 days), moderately early (7-14 days) and late/delayed (>14 days) postnatal periods at doses ranging from 0.1 mg/kg/day to 0.5 mg/kg/day, and durations ranging from 3 to 42 days,,,,,,,,,,,,,,,,,,,,,,,. In recent systematic meta-analysis reviews, early postnatal treatment with dexamethasone within the first week of birth was shown to induce neurodevelopmental disability and increase the risk of CP, despite its short-term beneficial effects on the lung function. In contrast, one extensive systematic review showed that treatment with dexamethasone after the first week of postnatal life may actually reduce mortality rates or the incidence of long-term neurodevelopmental disability although long-term follow-up data remains limited. In addition, it has been suggested that high dosage (0.5 mg/kg/day) and long duration of treatment may be the factors responsible for delays in brain growth and poor neurodevelopmental outcomes. Follow-up data reported by Wilson-Costello et al. in 2009 has suggested that every for every 1 mg/kg increase in the cumulative dose of dexamethasone, the risk of developing disabling CP increased by 40% at every gestational age. However, in a systematic review of placebo-controlled trials, Onland et al. reported that higher cumulative dexamethasone doses after the first week of life decreased the risk of BPD without increasing the risk of neurodevelopmental disability in ventilated preterm infants, and had no effect on neurodevelopmental outcomes after the third week of life. The severity of CLD can modify the effect of steroids on CP. One meta-analysis by Doyle et al. showed that postnatal treatment with GCs increased the likelihood of death or CP in infants whose risk of CLD was below 35%, but reduced the likelihood of death or CP if the risk of CLD exceeded 65%. The results of randomized controlled trials (RCTs) that have been performed to evaluate long-term neurodevelopmental outcomes from postnatal dexamethasone use are summarized in . The results vary. Some studies did not reveal adverse effects on neurodevelopmental outcomes at various ages. In particular, the results from two RCTs using lower doses of dexamethasone (0.15 mg/kg/day for 3 days, then tapering over 7 days) did not show a significant increase in CP and neurodevelopmental impairment when compared with placebo,. Hydrocortisone is the second most commonly used postnatal GC in premature infants. Extremely premature infants have developmental immaturity of the HPA axis during the first few weeks of life, predisposing them to relative adrenal insufficiency and inadequate anti-inflammatorty defenses against acute illness. Consequently, early physiological replacement of cortisol may be needed in extremely premature infants. Retrospective studies and RCTs of early hydrocortisone replacement for CLD within the first week of life have been performed on the basis of this relative adrenal insufficiency,,,,,,,,,,,. Hydrocortisone is also being used increasingly for the treatment or prevention of vasopressor-resistant hypotension in extremely premature infants. In contrast to postnatal dexamethasone, the long-term follow-up studies for hydrocortisone therapy have not revealed adverse effects on neurodevelopmental outcomes,. In a retrospective study, van der Heide-Jalving et al. reported that no differences in neurodevelopment outcomes at 5-7 years of age were found between the hydrocortisone-treated group (n=25) and control subjects (n=25). Watterberg et al. evaluated a total of 252 infants from 291 survivors with birth weights of 500-999 g at 18 to 22 months corrected age. Low doses of hydrocortisone treatment (1 mg/kg/day for 12 days, followed by 0.5 mg/kg/day for 3 days) was not associated with increased rates of developmental delay and CP in surviving infants. However, hydrocortisone significantly increased the risks of spontaneous gastro-intestinal perforation. This complication was also observed with early dexamethasone treatment and may result from interactions with indomethacin/ibuprofen,. Low (1 mg/kg/day) or relatively high doses (3-6 mg/kg/day) of hydrocortisone treatment in neonates has had no discernible effect on brain lesions and total or regional brain volumes measured using MRI in short-term or long-term follow-up studies continued until school age. In a recent meta-analysis of eight RCTs enrolling a total of 880 infants, postnatal treatment with low (1-2 mg/kg/day) or high dose (3-6 mg/kg/day) hydrocortisone has not shown any adverse effects on neurodevelopment. This study has demonstrated that there is little evidence for a direct effect of hydrocortisone on the rates of BPD, mortality, or the combined outcome of BPD or mortality. The results of long-term outcome studies of postnatal hydrocortisone use are summarized in . There are several possible explanations for these differences between the effects of dexamethasone and hydrocortisone on brain growth and neurodevelopment,,. Hydrocortisone has almost equal glucocorticoid and mineralocorticoid actions, and its half-life is only 8 hours. When compared to hydrocortisone, dexamethasone has exclusive glucocorticoids action, is 25-50 times more potent, and its half-life is 36-54 hours. High-dose dexamethasone (0.5 mg/kg/day) is equivalent to at least a 15-20 mg/kg/day dose of hydrocortisone, far higher than the range of doses of hydrocortisone given in the studies discussed above (1-6 mg/kg/day). Even low-dose dexamthasone (0.1-0.15 mg/kg/day) may be equivalent to a 3-6 mg/kg/day dose of hydrocortisone, but has a longer half-life,,. Therefore, dexamethasone may have a much higher relative potency than hydrocortisone, predisposing recipients to an increased risk of neurodevelopmental disability. Dissimilar effects of these two agents on the hippocampus have also been reported in animal studies. The hippocampus contains high densities of both mineralocorticoid and glucocorticoid receptors (GRs),. Dexamethasone, which binds only to GRs, has been shown to induce neurodegeneration within the hippocampus,. In humans, neonatal treatment with dexamethasone, but not hydrocortisone, has been shown to alter hippocampal synaptic plasticity and associative memory formation in later life. Dexamethasone exposure has also been linked to decreased hippocampal volume, but cohort studies of infants treated with hydrocortisone have not revealed a decrease in hippocampal volume,,,,. In summary, when considering postnatal GCs use, the least toxic GC should be given at the lowest effective dose for the shortest possible time. Use of postnatal CGs should be limited to those who are expected to need prolonged ventilation, and have a higher risk of development of CLD,. Particularly, dexamethasone should not be given in the first week of life unless the treatment is life-saving, and after the second week of life, its use should be restricted to those infants whose ventilator requirements suggest that they are at high risk of developing severe CLD. The follow-up studies tend to favor hydrocortisone as a safer alternative to dexamethasone. However, follow-up studies on postnatal dexamethasone treatment were placebo-controlled randomized studies, whereas most of hydrocortisone follow-up studies were retrospective cohort studies (, ). The use hydrocortisone as a safer alternative to dexamethasone requires more evidence to confirm that hydrocortisone is safer in term of long-term neurological outcomes. Corticosteroids are essential for normal brain development. Two types of corticosteroid receptor: mineralocorticoid receptors (MRs) and GRs. MRs are predominantly expressed in the limbic structures (primarily the hippocampus), whereas GRs are more diffusely distributed with highest levels in the limbic system, hypothalamic paraventricular nucleus, and the cerebral cortex. Endogenous GC (cortisol in humans, corticosterone in rats) binds to MRs with a higher affinity than to GRs,,. Under basal conditions, MRs are predominantly occupied, while, in the stressed condition, in which the level of cortisol is increased, the occupation of GRs increases,. Within the developing brain, the limbic system is particularly sensitive to endogenous and exogenous GCs. A study using guinea pigs has demonstrated that fetal exposure to exogenous GCs modified the expression of GR and MR mRNA in the hippocampus and dentate gyrus. Synthetic GCs (dexamethasone and betamethasone) bind predominantly to the GRs. Therefore, the impact of exogenous synthetic GCs on brain development is likely mediated by modification of GR expression in the brain, and may be dependent on the level of expression of GRs at the time of exposure,. Changes in the expression of GRs and MRs in the hippocampus can result in long-term modification of the HPA axis,. Fetal exposure to exogenous GCs during the critical periods of brain development may exert a profound influence on the limbic system (primarily the hippocampus), resulting in long-term changes in cognition, behavior, memory, co-ordination of the autonomic nervous system, and regulation of a number of endocrine system functions later in adult life,,. Exposure to synthetic GCs in utero results in hyperactivity of the HPA axis in adults, which will have a long-term impact on health,,,,,. There is growing evidence that prenatal exposure to GCs may be linked to the premature onset of cardiovascular and metabolic diseases, such as hypertension and diabetes,,. Animal studies have shown that GCs, especially dexamethasone, impaired neurogenesis and induced neuronal apoptosis,. Repeated administration of dexamethasone to neonatal rats has resulted in dose-dependent decrease in the neurogenesis in the subventricular zone, subgranular zone and cortex, and also resulted in a decrease in the brain weight. Exposure of the immature mouse brain to clinically relevant doses of GCs has been shown to cause apoptosis of neural progenitor cells in the external granular cell layer of the developing mouse cerebellum, and leads to permanent decreases in the number of cerebellar neurons,. Dexamethasone treatment in neonatal rats has led to significantly decreased brain weights and increased cleaved casepase-3 levels in the cortex, thalamus, hippocampus, cerebellum, dentate gyrus and subventricular zone. These findings suggest that the decrease in brain weight and the accompanying neurodevelopmental impairment may be due to impaired neurogenesis and/or degeneration of neurons by GCs. The involvement of corticosteroids in myelin biosynthetic pathways is well known,. Dexamethasone affects myelin basic protein (MBP) synthesis by modulating gene expression, or by acting on GRs. Repeated administration of dexamethasone has been shown to adversely affect the myelination of the developing rat brain, and disturbs myelin synthesis in fetal sheep. Several studies have suggested that GCs affect the maturation of oligodendrocytes (OLs) and impair the formation of myelin,,,. Other studies have reported that corticosteroids enhance the expression of genes related to the synthesis of MBP and exert trophic and protective effects in the nervous system,. A study using cultured cells from rat brain has shown that dexamethasone alters oligodendroglial differentiation and myelination depending on the stage: early in the myelination process, dexamethasone has a stimulatory effect, whereas at later stages, it causes marked inhibition. In addition, administration of GCs during critical periods of brain development may impair neurogenesis and myelination,,,,,. However, the precise mechanisms behind the adverse effects of GCs on myelination in the developing brain are not well understood. A recent study has shown that administration of dexamethasone during critical periods of brain development induces degenerative morphological changes in OL progenitors, suggestive of apoptosis, and subsequently resulting in hypomyelination (). This finding suggests that dexamethasone-induced hypomyelination may be, at least partially, due to injury to OL progenitors during specific stages in the maturation of OLs, as well as inhibition of myelin formation. t h o u g h G C s h a v e b e e n w i d e l y u s e d d u r i n g t h e a n t e n a t a l a n d p o s t n a t a l p e r i o d , m a n y i s s u e s r e l a t i n g t o n e u r o d e v e l o p m e n t r e m a i n u n c l e a r . A b o d y o f c l i n i c a l a n d e x p e r i m e n t a l e v i d e n c e s s u g g e s t s t h a t e x p o s u r e t o e x o g e n o u s G C s d u r i n g c r i t i c a l p e r i o d s o f b r a i n d e v e l o p m e n t m a y e x e r t p r o f o u n d e f f e c t s o n s u b s e q u e n t b r a i n d e v e l o p m e n t a n d t h e r e g u l a t i o n o f a n u m b e r o f n e u r o e n d o c r i n e s y s t e m s f u n c t i o n i n l a t e r a d u l t l i f e . T h u s , b a s e d o n t h e s e c l i n i c a l a n d e x p e r i m e n t a l s t u d i e s , t h e r e i s e n o u g h e v i d e n c e t o a d v i c e c a u t i o n i n t h e u s e o f G C s i n t h e p e r i n a t a l p e r i o d . A n d w h e n c o n s i d e r i n g p o s t n a t a l G C s u s e , t h e l e a s t t o x i c G C s h o u l d b e g i v e n a t t h e l o w e s t e f f e c t i v e d o s e f o r t h e s h o r t e s t p o s s i b l e t i m e . F u r t h e r r e s e a r c h i s r e q u i r e d d e t e r m i n e t h e p o t e n t i a l l o n g - t e r m e f f e c t s a n d m e c h a n i s m s o f a c t i o n o f G C s o n b r a i n d e v e l o p m e n t .

xref #text Since Broxmeyer had suggested that CB could be a source of transplantable hematopoietic stem cells (HSCs), a lot of experimental studies have been performed for clinical applications. The scientific findings revealed that HSCs in CB have an extensive proliferative capacity, which exceeds that of bone marrow (BM) HSC, and that the number of HSCs in a single CB collection was within the range of HSC numbers associated with successful bone marrow transplant (BMT). These studies led to the first SCT in a child with Fanconi anemia using the CB from a sibling and >30,000 CBSCTs (CBTs) have been performed so far,,,. Over the last 25 years since the first successful CBT, a lot of progress has been made to overcome the limitations of CBT. The previous experiences of BMT showed that the infused cell dose was critical for engraftment after SCT. Therefore, the volume of BM to be collected should be adjusted according to the recipients' body weight. On the contrary, SCT using CB was impossible in relatively heavy patients when cell dose from a single collection of CB was insufficient. The first strategy to overcome the low cell contents in a single CB unit was to increase the infused stem cell dose using double unit of CB or expanded CB. Other efforts for enhancing the engraftment kinetics to overcome the limitations of low cell dose were intraosseous injection of CB, and cotransplantation of third-party MSCs. Currently, double CBT has become the most popular method to overcome the limitations of cell dose. Increasing cell dose with cotransfusion of 2 partially human leukocyte antigen (HLA)-matched units revealed some advantages and disadvantages in outcomes. Compared to single CBT, double CBT was accompanied by a higher incidence of grade II acute graft-versus-host disease (GVHD). However, treatment-related mortality (TRM) or chronic GVHD were not higher but a higher graft-versus-leukemia effect was anticipated,,,,,. When 2 units of CB were transplanted, very interesting engraftment kinetics were revealed: early after double CBT (day +21) both CB units contributed to hematopoiesis in 40%-50% of patients, but by day +100 one unit predominated in the vast majority of the patients,. The unit predominance may be influenced by postthaw viability, length of time interval between the infusion of the two CB units and expansion,. The importance of T cells to establish chimerism and to ensure stem cell engraftment has been widely documented,,,,,. Because donor selection is more important in unrelated CBT compared to BMT or peripheral blood SCT, several factors in addition to cell dose and HLA mismatch should be considered to select the best CB units: combined effect of HLA disparity and cell dose, HLA antibodies, and noninherited maternal antigen (NIMA). In HLA-mismatched CBT, the greater HLA-mismatch exists, the more total nucleated cell (TNC) dose is required. The 4/6 HLA-matched units to the recipient required a TNC >5.0×10/kg to achieve a similar TRM as 5/6 units with a TNC >2.5×10/kg. Another important factor is the presence of HLA antibodies against the CB units, which has a negative prognostic impact in both single and double CBTs,,. Two recent studies pointed out the importance of NIMA, demonstrating a survival advantage (5-year overall survival of 55% vs. 38%) by choosing CB units in which maternal typing of the CB donor showed a match of the noninherited maternal allele to the patient,. Since the first successful CBT in 1998 and double CBT in 2004, about 500 cases of CBT have been performed in Korea. Recently, CBT Working Party of The Korean Society of Hematology has performed a retrospective, multicenter study to reveal the clinical outcomes, including relevant risk factors of CBT, in Korea. Data of 381 patients who received unrelated CBT were collected retrospectively from 19 medical centers in Korea between 1996 and 2011. Transplant characteristics were as follows (): median age, 7.2 years (range, 0.5-65.4 years); median weight, 23.4 kg (range, 6.1-89.7 kg); 58.0% male; 40.9% double-unit CBT; 83.1% hematologic malignant disease; and myeloablative regimen in 68.5%. The patients received a median of 2.08×10/kg CD34+ cells and a median of 5.10×10/kg nucleated cells. There were no significant differences between single- and double-unit CBT regarding the numbers of infused CD34+ cells and nucleated cells. Pre-engraftment syndrome (pES), a distinctive clinical syndrome which occurs during the engraftment process, developed in 102 patients (26.8%) at a median of 6.5 days. Median times for leukocyte and platelet engraftment were 18 and 44 days, respectively. Graft failure occurred in 20.5% of total patients. Factors associated with graft failure were nonmalignant disease (<0.01), infused CD34+cells ≤1.0×10/kg (<0.01), and absence of pES (<0.01). Cumulative incidence (CI) of grade II-IV acute GVHD by day +100 and chronic GVHD at 1 year after transplantation were 40.25% and 20.9%, respectively. Cytomegalovirus (CMV) reactivation was found in 176 patients (46.2%) and 61 patients (16.0%) developed CMV disease. With a median follow-up of 74 months, 184 patients are alive with a predicted 5-year overall survival of 49.2% () and event-free survival of 37.7% (). In multivariate analysis, adverse risk factors for survival included older age (=0.002), salvage transplantation (=0.04), CMV disease (=0.03) and infused CD34+cells ≤1.0×10/kg (=0.02). CI of TRM by 1 year after transplantation was 35.2%. Infection was the main cause of death with estimated infection-related mortality of 20.6%. Conclusively, the outcomes after CBT were comparable to those of other countries. Since CB contains HSCs as well as a mixture of multipotent stem cells, CB has the ability to give rise to hematopoietic, epithelial, endothelial and neural tissues (). Recently, the application of cell-based therapy using CB has expanded its clinical utility, particularly, by manufacturing MSC and iPS. However, CB MNCs before any manipulation could also be a good cellular source for tissue regeneration, because CB MNC contains immunomodulatory lymphocytes expressing various cytokines as well as progenitor cells including MSCs. Some researchers also demonstrated that intralesional or intravenous administration of MNCs without any manipulations could also have a potential role for tissue regeneration,. Based on the recent clinical experiences,,,, CB MNCs would be an ethically helpful therapeutic tool in a variety of diseases such as hemato-oncologic diseases, autoimmune diseases and diabetes, and neurologic diseases. In contrast to conventional SCT using CB, nonhematopoietic applications such as cardiovascular or neurological indications do not require permanent graft survival because the therapeutic activities of the CB are believed to be mediated in many cases by immunomodulatory mechanism, such as the secretion of neuroprotective, angiogenetic, and anti-inflammatory cytokines,,. Although most clinical trials using BM- or CB-derived MSC have involved adult patients with degenerating neurologic diseases or spinal cord injuries, nonhematologic therapeutic application using CB MNC for children have been performed to restore damaged tissue functions in patients with diabetes, neonatal hypoxic-ischemic encephalopathy, autism, and cerebral palsy (CP),,,. A clinical trial using autologous CB for children with type 1 diabetes reported the enhanced blood glucose control and management, with retention of endogenous insulin production as assessed by stimulated C-peptide secretion, although another report failed to preserve C-peptide. The mechanism of action is not yet known, but recent clinical trials suggest that infused CB may support both islet maintenance and regeneration as well as restoring the aberrant immune system. Kurtzberg et al. tried to use intravenous infusion of autologous CB to reveal the safety and the improvement of neurologic dysfunction in children with CP, and they are performing a randomized controlled study as well. My colleagues also conducted a pilot study of the infusion of intravenous autologous CB in children with CP to assess the safety and feasibility of the procedure as well as its potential efficacy in countering neurological impairment. Twenty patients who received autologous CB infusion were evaluated. Infusion was generally well-tolerated, although 5 patients experienced temporary nausea, hemoglobinuria, or urticaria during the intravenous infusion. Diverse neurological domains improved in 5 patients (25%) as assessed with developmental evaluation tools and fractional anisotropy values in brain magnetic resonance imaging-diffusion tensor image. The neurologic improvement occurred significantly in patients with diplegia or hemiplegia rather than quadriplegia. We concluded that autologous CB infusion is safe and feasible, and has yielded potential benefits in children with CP. Another group in Korea recently reported that the intravenous infusion of allogeneic CB MNCs has a therapeutic potential for CP. They suggested that allogeneic CB MNC infusion could be a good source for amelioration of motor and cognitive dysfunction in children with CP, accompanied by structural and metabolic changes in the brain. The mechanism of action in these studies has not been explored yet, but many investigators believe that cytokines contained in CB may exert their neuroprotective, angiogenetic, and anti-inflammatory effects to improve neurologic functions. In conclusion, cellular therapy using CB MNC could be another good option for tissue regeneration because it is more safe and ethical compared to BM- or CB-derived MSC. Further studies are needed, particularly, in the field of non-hematologic application. CB is donated by healthy mothers after an uncomplicated pregnancy and after written informed consent. In Korea, the guidelines and criteria for collection and processing of donated CB are presented in the "Cord Blood Management and Research Act" (CB Act) which has taken effect since 2011. Collected CB is processed to isolate MNCs with automatic or semiautomatic process using centrifugation. The red blood cells and plasma are discarded into the satellite bag, leaving a mean volume of about 20-25 mL of MNCs and plasma in the bag. The whole process is performed in a closed system with the use of a sterile connecting device. Dimethyl sulfoxide/dextran (10% dimethyl sulfoxide in 5% dextran) is added as a cryoprotectant and the product is cryopreserved by controlled-rate freezing in a 25 mL double-compartment cryopreservation bag. Cryopreserved CB units are stored under liquid nitrogen until using them. Recently, Broxmeyer et al. reported the efficiency of long-term cryopreservation of CB, showing that the recovery of functional hematopoietic progenitor cells cryopreserved as MNCs for upto 23.5 years was comparable to prefreeze values of the same CB units. There are two types of CB banks around the world: government or community-funded public banks and for-profit private banks. Public CB banks store donated CB for public access, and are analogous to volunteer BM donor registries. In contrast, private CB banks commercially preserve a child's CB for personal or family use under the agreement with contractor. A global CB banks network, NetCord, is being operated to use donated CB for public purposes, and more than 300,000 units are currently registered as of 2013. In Korea, we established the networking system of 7 public CB banks in October 2006 and more than 30,000 units are currently registered as of July 2012. Since the enactment of CB Act in 2011, all CB data are affiliated with the Korean Hematopoietic Stem Cell Donor Registry which is nationally coordinated. On the other hand, the need for private banking business is controversial, but millions of units were estimated to have been preserved around the globe already and more than 300,000 units are preserved in Korea. The clinical applicability of CB has been widened and is expected to be a good source for unrelated SCT as well as cell therapy. However, there is still much to be resolved to increase the utilization of banked CB, especially for physicians who have to select optimal unrelated stem cell donors or try cell therapy using autologous CB units. The utilization rate of private CB is extremely low (0.04%-0.0005%). In addition, the utilization rate of banked public CB is approximately 3%-4% in World Marrow Donor Association, 3% in National Marrow Donor Program (until 2010), 29% in Japan (until 2012), and 1.3% in Korea (until 2012). Therefore, the strategy to promote the utilization of banked public and private CB should be considered. n c e C B i s u s e d a s a n i m p o r t a n t s o u r c e f o r s a v i n g l i f e a n d r e g e n e r a t i n g h u m a n t i s s u e , w o u l d - b e w a s t e d C B h a s t o b e c o n t r o l l e d s t r i c t l y . B a s i c a n d c l i n i c a l r e s e a r c h e s t o i m p r o v e t h e c l i n i c a l o u t c o m e s o f S C T u s i n g C B w o u l d b e w a r r a n t e d . I n a d d i t i o n , e x p e r i m e n t a l a n d c l i n i c a l t r i a l s u s i n g C B M N C o r C B - d e r i v e d M S C f o r c e l l t h e r a p y w o u l d b e e n c o u r a g e d , b e c a u s e a l o t o f C B i s s t o r e d i n p r i v a t e C B b a n k s a r o u n d t h e w o r l d a n d t h e i r u s e i s v e r y s a f e a n d e t h i c a l .

It is estimated that more than 1,800 babies worldwide contract human immunodeficiency virus (HIV) from their mothers every day. Many of these cases occur in Africa,. The probability of infection from mothers who do not receive treatment is higher in Africa (25%-52%) than the United States (US) or Europe (12%-30%). HIV progresses more rapidly in babies, with approximately one-quarter of newborns dying within 1 year and two-thirds within 2 years after birth. In addition, since babies present with many initial symptoms as well as nonspecific symptoms, HIV infection is quite different in babies compared to adults. Accordingly, since there are many cases in which there is no prevention for mother-to-child transmission, HIV in newborn babies is diagnosed late; the rapid progress of the disease can lead to death. Therefore, prompt diagnosis and preventive measures are critical. The pediatric acquired immune deficiency syndrome (AIDS) clinical trial group 076 was established in the US in 1994 and uses a 3-step preventive chemotherapy: zidovudine administration to mothers starting from the 14th week of pregnancy, zidovudine intravenous injection during delivery, and administration of zidovudine syrup to the newborn for 6 weeks after birth. The level of mother-to-child HIV transmission in the administration group was 8.3% vs. 25.5% in the control group (a 68% difference). In addition, by reducing the time the baby is exposed to mother's body fluids owing to Caesarian section and by prohibiting breastfeeding, which is another a route of mother-to-child HIV transmission, the infection rate decreased to less than 1%. However, although the 3-step prevention significantly lowers the probability of mother-to-child HIV transmission, pregnancies of mothers with HIV are still considered high risk; this is not only because of HIV itself, but also because the risks of preterm birth, low birth weight, and infant mortality due to the administration of antiretroviral drugs have not yet been eliminated. This study aimed to investigate the mother-to-child HIV transmission with zidovudine prevention therapy, Caesarian section, and prohibiting breastfeeding. In addition, this study also described the characteristics of mothers who were diagnosed with HIV and received preventive treatment and their babies' characteristics. The study subjects included 9 pediatric patients born from HIV-positive mothers at Korea University Ansan Hospital, between March 1, 2003 and May 31, 2013. Mothers were diagnosed with HIV on the basis of positive test results for HIV antibodies and Western blot during prenatal or preoperative tests in other hospitals and were referred to the Department of Infectious Diseases for treatment and counseling. No mothers had a history of smoking, drinking alcohol, or using medication during pregnancy. The method included a retrospective analysis of medical records of the mother-newborn dyads, including the mother's age; HIV diagnosis date; CD4+ count; HIV RNA copy numbers at the time of the first hospital visit, and first and third trimesters of pregnancy; presence of syphilis, hepatitis, or other associated diseases; history of antiretroviral therapy; type of medicine used in antiretroviral therapy and administration period; blood test results during delivery and obstetrical history; and anthropometry and blood test results of the child at birth, growth, and development as well as administered drugs. The number of HIV RNA copy and HIV antigen/antibody test results for children were analyzed within 48 hours after birth, 1-2 months, 3-6 months, and after 7 months. e n u m b e r o f w e e k s o f p r e g n a n c y w a s d e t e r m i n e d o n t h e b a s i s o f t h e m e n s t r u a l c a l e n d a r a n d u t e r i n e f u n d a l h e i g h t t h r o u g h u l t r a s o u n d e x a m i n a t i o n s a t t h e D e p a r t m e n t o f O b s t e t r i c s a n d G y n e c o l o g y . A b i r t h e a r l i e r t h a n 3 7 w e e k s w a s c o n s i d e r e d p r e t e r m , a n d b i r t h w e i g h t l o w e r t h a n 2 , 5 0 0 g w a s c o n s i d e r e d l o w b i r t h w e i g h t . T h e s t u d y w a s p e r f o r m e d 4 h o u r s b e f o r e a n d a f t e r a m n i o r r h e x i s . H e i g h t b e l o w t h e 5 t h p e r c e n t i l e w a s c o n s i d e r e d a f o l l o w - u p g r o w t h d e l a y . B a b i e s w i t h a b o d y w e i g h t b e l o w t h e 1 0 t h p e r c e n t i l e f o r t h e i r a g e w e r e c o n s i d e r e d s m a l l f o r g e s t a t i o n a l a g e . I f H I V p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) r e s u l t s w e r e n e g a t i v e 3 c o n s e c u t i v e t i m e s w i t h i n 6 m o n t h s , t h e n e w b o r n w a s c o n s i d e r e d H I V n e g a t i v e . f o r e J u l y 2 0 0 9 , t h e p l a s m a H I V R N A o f n e w b o r n s w a s t e s t e d t h r o u g h t h e K o r e a C e n t e r s f o r D i s e a s e C o n t r o l a n d P r e v e n t i o n . T h e r e a f t e r , t h e t e s t s w e r e p e r f o r m e d d i r e c t l y b y t h e h o s p i t a l . T h e c o p y n u m b e r o f H I V R N A i n m o t h e r s a n d n e w b o r n s w e r e e s t i m a t e d u s i n g a q u a n t i t a t i v e P C R a s s a y ( A m p l i c o r H I V - 1 M o n i t o r T e s t , R o c h e D i a g n o s t i c S y s t e m s , B r a n c h b u r g , N J , U S A ) . e a b s o l u t e C D 4 + c o u n t s a t t h e t i m e o f t h e m o t h e r s ' h o s p i t a l v i s i t , a n d f i r s t a n d t h i r d t r i m e s t e r s o f p r e g n a n c y w e r e d e t e r m i n e d b y a f l o w c y t o m e t e r ( C y t o m i c s F C 5 0 0 , B e c k m a n C o u l t e r , F u l l e r t o n , C A , U S A ) t h a t u s e s m o n o c l o n a l a n t i b o d i e s t o c a l c u l a t e t h e t o t a l n u m b e r o f l e u k o c y t e s a n d n u m b e r s o f e a c h t y p e o f l y m p h o c y t e . n t i b o d y t e s t s w e r e u s i n g a c h e m i l u m i n e s c e n t m i c r o p a r t i c l e i m m u n o a s s a y ( A b b o t t A r c h i t e c h i 2 0 0 0 , A b b o t t L a b o r a t o r i e s , L a k e F o r e s t , I L , U S A ) u s i n g t h e H I V A g / A b C o m b o ( A b b o t t L a b o r a t o r i e s , S l i g o , I r e l a n d ) r e a g e n t . During the study period, 8 HIV-positive mothers gave birth to a total of 9 children. For 2 out of 9 children, follow-up was discontinued after release from the hospital. All 8 mothers were foreigners originally from other countries including Vietnam, Thailand, Myanmar, South Africa, Nigeria, Ghana, and Côte d'Ivoire. At the time of childbirth, 4 out of 8 mothers (50%) were aged under 30 years, while 4 (50%) were aged over 30 years; the average was 32 years, ranging from 23-38 years. Two out of 8 mothers did not receive prenatal care, while 6 received prenatal care at our hospital-2 of them after 27 weeks of pregnancy (i.e., 27 weeks 4 days and 30 weeks 4 days, respectively) (). Six mothers (75%) were diagnosed with HIV on the basis of their prenatal test results. One of the remaining 2 mothers was diagnosed on the basis of a test performed before surgery for cyst removal from the skin of the buttocks and received HIV treatment at out hospital prior to pregnancy. Another mother was already aware of the diagnosis in her home country but received irregular antiretroviral treatment and did not receive treatment after entering the Republic of Korea. All 8 mothers were administered antiretroviral drugs immediately after visiting our hospital. The period of administration ranged from 1 day before delivery to starting before pregnancy, with an average of 14 weeks. One of the mothers (12.5%) was administered antiretroviral treatment before pregnancy, and 3 were administered the drugs from the second trimester (37.5%). Meanwhile, 4 mothers (50%) started treatment after 27 weeks of pregnancy (defined as late diagnosis hereafter). Three mothers (37.5%) received only zidovudine and lamivudine, which are nucleotide reverse transcriptase inhibitors (NRTIs); one of them was receiving nelfinavir, a protease inhibitor (PI), but her hemoglobin according to the blood count dropped from 11.2 to 8.4 g/dL, indicating anemia. Therefore, at 25 weeks, nelfinavir was discontinued and she received only NRTI medication. The other 5 mothers (62.5%) were administered highly active antiretroviral therapy that included zidovudine, lamivudine, and PI. Two of the 8 mothers had coinfection caused by syphilis and hepatitis C virus (). The average CD4+ count and HIV viral load of the mothers at the time of their hospital visits were 325/µL (92-729/µL) and at 2,320 HIV RNA (undetectable up to 115,280 copies/mL), respectively. For 5 mothers, viral load was confirmed before delivery and remained below 1,000 copies/mL (undetectable up to 187 copies/mL). Two mothers who did not receive prenatal care had low viral loads directly before delivery (220 and 390 copies/mL, respectively). The viral load of the remaining mother 1 month before delivery was high (2,320 copies/mL) (). All 8 mothers received antiretroviral therapy including zidovudine prior to delivery. All 9 newborns were delivered via Caesarian section. Two newborns (22.2%) experienced early rupture of membranes; in one, this lasted over 50 hours, and another emergency Caesarian section was performed within 3 hours after membrane rupture in the other. Seven newborns were delivered via scheduled Caesarian section. Four out of 9 newborns (44.4%) received intravenous zidovudine during delivery. The remaining newborns did not receive zidovudine during delivery because it was not available in Korea until 2007. All newborns were administered zidovudine syrup at 2 mg/kg every 6 hours for 6 weeks after birth and were not breastfed by their mothers. Two babies were preterm at 31 weeks 5 days (22.2%), and 7 babies (77.7%) were full-term born after 37 weeks of pregnancy. The average number of weeks was 37 weeks 5 days (31 weeks 5 days to 39 weeks). Three out of 9 babies (33.3%) had low birth weight; 2 of them (22.2%) were born preterm, and 1 (11.1%) was small for gestational age. The average birth weight of all babies was 2,800 g (1,728-3,400 g). All babies but one had average Apgar scores of 8±0.5 and 9.5±0.5 at 1 and 5 minutes, respectively. The remaining baby had Apgar scores of 4 and 7 at 1 and 5 minutes, respectively; it exhibited respiratory distress syndrome and required mechanical ventilation. Since congenital syphilis was suspected in the newborn whose mother was diagnosed with syphilis during prenatal care, the newborn was administered penicillin intravenously for 10 days. Pediatric patients were further monitored through the outpatient department of our hospital; except for one, none had special growth or development problems. One baby had congenital ptosis, ventricular septal defect, and growth failure and was monitored through the outpatient department (). The HIV antigen, HIV reverse transcription-PCR, and HIV antibody tests were performed for all babies within 24 hours after birth as well as from 1-2, 3-6, and 7-12 months. Besides 2 babies (22.2%), who either returned to their home countries or for whom follow-up documents could not be retrieved from other hospitals, all babies (7, 77.7%) tested negative for HIV. This study demonstrated that it is possible to substantially prevent HIV transmission from HIV-positive mothers to their babies by preventing intrauterine transmission through administering antiretroviral drugs to the mother, decreasing the risk of transmission during birth by performing elective Caesarian section, and encouraging giving up breastfeeding to decrease the spread of HIV through breast milk. The follow-up observation based on babies' development and blood test results show that most newborns exhibited no specific deviations in blood test results or developmental impairments. Encouraging antiretroviral therapy and preventing early membrane rupture through scheduled Caesarian section considerably decreased the HIV transmission level to children from mothers, who at the time of their first hospital visit had different HIV viral loads and CD4+ lymphocyte counts and in some cases had other accompanying diseases. According to American statistics, between 1985 and 1998, the percentage of HIV infection in women among all cases increased from 7% to 23%, which in turn led to more infected pregnant women. Between 1993 and 1997, up to 15,000 babies born to HIV-infected mothers were themselves infected. According to the reports of the Korea National Institute of Health, in April 2003 and 2005, 2 and 5 babies were infected via mother-to-child transmission, respectively; a total of 7cases of mother-to-child HIV transmission in Korea were reported between 1985 and 2011. In addition, 58% of women with infection were in their 20s to 40s. The continuing development of drug treatments will increase lifespan and improve quality of life. Therefore, the number of infected pregnant women is expected to increase, which in turn will result in the gradual increase of the number of newborns infected with HIV via mother-to-child transmission. In the US, HIV infection in children occurs via mother-to-child transmission, transfusion, and the transfusion of clotting factor in 81%, 11%, and 5% of cases, respectively. Meanwhile, according to Korean data, 81% of children with HIV were infected via mother-to-child transmission and more than 80% of children with AIDS are under 5 years of age,,. Accordingly, the mother-to-child route of transmission is the most common route of HIV transmission in small children and the main reason why pediatric patients worldwide contract AIDS. Mother-to-child HIV transmission can occur inside the uterus, during delivery, or through breast milk. In 30%-50% of cases, transmission occurs at the end of pregnancy, immediately before labor starts and immediately before the separation of the placenta. In approximately 30% of cases, transmission occurs after the desquamation of the placenta, when the baby is passing through the birth canal. There is a 40% risk of infection when consuming contaminated breast milk. Preventive measures according to the Pediatric AIDS Clinical Trials Group (PACTG) protocol 076 test are reported to reduce the risk of infection by 70%, lowering the risk of mother-to-child transmission to 2%. Thus, it is possible to prevent more than two-thirds of mother-to-child transmission with appropriate preventive measures. The most important factor is early discovery through screening. Another study shows that antiretroviral treatment during pregnancy, labor, and delivery as well as administration of drugs to the newborn and scheduled Caesarian delivery, it is possible to decrease perinatal HIV transmission to less than 2% for mothers with high viral load (i.e., >1,000 copies/mL). It is reported that even if antiretroviral treatment is started only during labor and delivery, it is possible to decrease the risk of transmission to 10%,. Recent reports indicate that, unrelated to antiretroviral therapy, Caesarian section performed before labor starts and membrane rupture reduces the risk of transmission by 50% compared to natural delivery and emergency Caesarian section,. Among the various theories about how antiretroviral therapy decreases perinatal transmission, the most important theory is that if the drugs are administered during pregnancy, they decrease the viral load in mother's blood and vaginal discharge, which decreases transmission to the newborn. However, perinatal transmission has been reported even in cases with a very low or undetectable HIV viral load; this suggests there are other factors besides HIV RNA,. Accordingly, the US Centers for Disease Control recommends antiretroviral therapy for all HIV-positive pregnant women regardless of HIV viral load. In this study, all mothers except one had low HIV RNA viral loads (i.e., <1,000 copies/mL) close to delivery. Besides 2 babies for whom follow-up was not possible, all babies tested negative for HIV. The transmission rate could have been low because of the decrease in viral load due to treatment in cases in which the viral load was initially high during the first hospital visit or initially low when visiting the hospital close to delivery. Only one mother had a high viral load (2,320 copies/mL) and began antiretroviral therapy after 28 weeks. In this case, emergency Caesarian section was performed because of membrane rupture; therefore, antiretroviral treatment lasted only 1 month, viral load was not measured immediately before delivery, and intravenous zidovudine was not administered. However, the newborn tested negative for HIV. This lowering of transmission risk can be attributed to the performance of emergency Caesarian section within 3 hours of membrane rupture, administration of zidovudine syrup to the newborn for 6 weeks, and absence of breastfeeding. Therefore, even if the mother tested positive for HIV, and the viral load is unregulated, other preventive methods can prevent mother-to-child transmission. Another theory about why antiretroviral therapy in mothers decreases the risk of infection in newborns is that antiretroviral drugs administered to the mother pass through the placenta to the fetus, which is exposed to HIV, providing the fetus a certain amount of the drugs (i.e., pre-exposure prophylaxis). Many studies report that zidovudine in particular passes through the placenta and prevents the virus from proliferating in the fetal blood, thereby decreasing mother-to-child transmission,. Accordingly, NRTIs that cross the placental barrier are mandatory. According to the American guidelines, starting antiretroviral is more beneficial therapy when the CD4+ count is <350 cells/µL or 350-500 cells/µL than not starting it at all. If the count is >500 cells/µL, it is difficult to observe the clinical benefits of antiretroviral therapy and the adverse effects due to the toxicity of the drugs are more concerning; therefore, the treatment of pregnant women is not recommended. However, recent studies report that administering combined antiretroviral drugs in pregnant women can lead to unfavorable outcomes in pregnancy. The European Collaborative Study and the Swiss Mother + Child HIV Cohort Study compared the rate of preterm labor between women who received antiretroviral drugs and those who did not, and corrected for CD4+ lymphocyte count and the use of illegal drugs; the results show that newborns subjected to combined antiretroviral drugs were twice as likely to be preterm. Preterm delivery was twice as likely to occur in women who received combined antiretroviral drugs before pregnancy than women administered drugs in the third trimester of pregnancy. Single medication (mainly zidovudine) is reported to have no impact on preterm labor. In a European collaborative study of 2,279 mothers and their newborn children, 767 mothers received combined antiretroviral drugs during their pregnancy; the risk of preterm birth before 34 weeks was 2.5 times higher in the group that received treatment during pregnancy than the group that did not and 4.4 higher in the group of women who received antiretroviral drugs both before and during pregnancy. In contrast, the results of a study about transmission from mothers to infants show that receiving multiple antiretroviral drugs does not affect preterm labor, low birth weight, low Apgar score, or mortality ratio compared to receiving a single drug or not receiving any treatment. Another study shows that receiving combined therapy including PI significantly increases the risk of preterm labor compared to receiving treatment that does not include PI. However, receiving treatment from the first trimester of pregnancy may be linked to disease severity, making it difficult to completely exclude this possibility. Two out of the 9 newborns in this study were preterm. The mother of the baby who received oxygen treatment because of respiratory distress syndrome was diagnosed late and only received the drugs for 1 month. In one case, a mother received drugs from the 19 weeks of pregnancy and had preterm labor with her first child, and subsequently received drugs from before the pregnancy and her second baby was born full-term. No follow-up was possible for the children of 2 mothers who received single-drug treatments, and their infection status was not confirmed. The mother who switched from combined drug treatment to single-drug treatment at 25 weeks had a baby who was small for gestational age and had growth impairment. Taken together, these findings indicate the increased risk of preterm labor when administering multiple drugs needs to be acknowledged. However, if there is a high risk of mother-to-child transmission, there is no need to stop medication because of the possibility of preterm labor. On the contrary, the mother's immunity, as well as higher mortality and morbidity caused by infection in newborns, need to be considered. It is rather difficult to diagnose babies born from mothers who have HIV on the basis of the presence of immunoglobulin G antibody against HIV, which crosses the placental barrier. Although most babies born from infected mothers have HIV antibodies when they are born, only 15%-30% becomes infected. In babies who do not become infected, these antibodies disappear by 9 months; in some rare cases, they remain until 18 months. Accordingly, it is impossible to determine whether a baby is infected on the basis of HIV antibody tests until the baby is 18 months of age. The most accurate method is to test not for antibodies, but for the virus itself. PCR and virus culture tests are accurate, and it is possible to diagnose 30%-50% of infected children at birth and 100% by 3-6 months. In order to determine whether a child born from an HIV-positive mother is infected, PCR and virus culture tests need to be performed at birth, 4-6 weeks, 3 months, and 6 months. If the result of the test performed at approximately 1 month is negative, the repeat test is performed from 3-6 months. However, if the baby exhibits AIDS symptoms, HIV infection can be diagnosed even if the test results are negative. If the virus test performed at 6 months is negative, HIV antibodies tests are negative after 6 months, and there are no symptoms of HIV infection, it can be concluded that the baby did not contract HIV. Besides 2 patients for whom follow-up was not possible, all HIV PCR tests before 6 months and HIV antigen tests were negative; consequently, all 7 children were not diagnosed with HIV. Infants infected via mother-to-child transmission initially present with nonspecific symptoms. Accordingly, children must be observed continuously until HIV infection is proven negative through examination and virus tests during follow-up. In this study, antiretroviral drugs were administered before birth, during delivery, and to children after birth as suggested by the PACTG protocol 076. The 30%-50% HIV transmission rate during delivery was reduced by performing Caesarian section. Finally, the 40% rate of transmission via the breast milk was established by discouraging breastfeeding. The possibility of transmission via all possible routes was decreased. Consequently, it was possible to decrease the transmission rate of HIV from mother to child. In addition, the influences of the mother's infection status, accompanying diseases, type of antiretroviral drug, and drug administration period on the decrease in transmission rate as well as on the newborn were analyzed. No mothers in the present study were Korean, 7 were diagnosed with HIV before delivery, and 2 were already aware of their HIV infection status but were not managing the disease properly. Meanwhile, 5 mothers had foreign citizenship and were temporarily residing in Korea; they did not receive prenatal care and were diagnosed with HIV when they underwent prenatal tests in the third trimester of pregnancy for the first time. Accordingly, the biggest problem of perinatal infection is that many mothers do not know their HIV status and/or the exact degree of infection. If fertile women are tested in their first trimester, prompt treatment is possible; this not only benefits the health of the mother, but also decreases the risk of infection to their baby. In addition, the recent increases in the number of foreign workers and international marriages in Korea have increased the number of foreign residents to over 300,000; more than 50 HIV new cases are confirmed annually,. The number of infected foreigners is continuing to increase, with 64 and 71 new cases in 2010 and 2011, respectively; a total of 958 people were infected with HIV by the end of 2011. Among all patients, 29.1% are women and 70.9% are men. Meanwhile, among Korean patients, 8% are women and 92% are men. Therefore, foreign women have an exceptionally higher infection rate than Korean women. This may increase the probability of giving birth to a child infected with HIV via mother-to-child transmission. Furthermore, if counseling and screening for HIV infection prior to delivery and prevention using appropriate antiretroviral drugs are not performed, the number of children infected with HIV is expected to increase gradually. The present study used the data of HIV-positive mothers who were foreign workers or foreign women married to Korean men and their children to confirm that antiretroviral preventive therapy, scheduled Caesarian section, and avoiding breastfeeding considerably lower the risk of their children contracting HIV via mother-to-child transmission. A limitation of this study is that it did not include a substantial amount of data on infected mothers, because there are not many people who suffer from the disease in Korea. Furthermore, the study did not confirm significant associations between many variables. However, considering the number of babies infected with HIV via mother-to-child transmission may gradually increase, similar studies in more varied regions using more varied variables should be conducted continuously.

Fanconi anemia (FA) is a rare autosomal and X-linked recessive disorder, characterized by physical abnormalities, progressive bone marrow failure (BMF), hypersensitivity to DNA cross-linking agents and predisposition to malignancy. It was first described in 1927 by Fanconi, who described a family in which three children had pancytopenia and birth defects, such as short stature, hypogonadism and skin disorder. Since then, 1,075 patients were registered in the International Fanconi Anemia Registry (IFAR) between May 1982 and August 2008. FA is considered the most common inherited cause of BMF, which is usually apparent between 6 and 8 years of age. Most patients with FA have birth defects including skin hyperpigmentation and/or cafe au lait spots, skeletal malformations, short stature and urogenital abnormalities. However, one-third of the patients have few or none of these features, which makes it difficult to diagnose. FA patients may develop myelodysplastic syndrome (MDS), or acute myeloid leukemia (AML), with relative risk of developing AML being 800-fold higher than that of the general population. There is also a strong predisposition to specific solid tumors, including head, neck, gynecological squamous cell carcinoma (SCC) and liver tumors,. Hematopoietic stem cell transplantation (SCT) is currently the only treatment to restore normal hematopoiesis because of nonresponse to immunosuppressive therapy, such as antilymphocyte globulin, antithymocyte globulin (ATG) and cyclosporine, which is usually given to treat idiopathic aplastic anemia (AA). Moreover, because of hypersensitivity to chemotherapeutic agents or radiation, higher risk of developing malignancies, and potential recurrence in the siblings, the approach to SCT should be different from that of idiopathic AA in terms of the donor selection, optimal timing of SCT, and the choice of conditioning regimen. Also, the prognosis after SCT is quite different,. Therefore, FA should be sought carefully in any patients with AA or BMF syndromes in children and young adults. A screening study with DNA cross-linking agents in patients with BMF and clinical manifestation of 6 FA patients was published from our institution in 1997 and 1998, respectively,. The present study represents an update and long-term follow-up study of 12 patients diagnosed with FA at the Chonnam National University Hospital over the last 20 years. Clinical presentations, laboratory findings, diagnostic methods, treatment modalities, outcomes and long-term sequelae of patients were retrospectively analyzed to increase awareness of this rare but very challenging genetic disease. This study included 12 FA patients seen at the Department of Pediatrics, Chonnam National University Hospital and Chonnam National University Hwasun Hospital between January 1991 and December 2012. The patients were diagnosed on the basis of family history, physical findings in addition to hematologic abnormalities, and chromosomal breakage tests induced by diepoxybutane (DEB) or mitomycin-C (MMC),. Chromosome breakage tests with DEB and MMC were carried out according to the technique described by Auerbach et al. with minor modifications. Two patients (cases 11, 12) with negative blood results underwent chromosomal breakage tests on cultured skin fibroblasts. Gene analysis for FANCA was performed in case 12 using a multiplex ligation-dependent probe amplification (MLPA). The gene dosage assay for FANCA to detect deletion/duplications was carried out using a SALSA MLPA Kit P031-P032 FANCA (MRC-Holland, Amsterdam, the Netherlands) according to the manufacturer's instructions. A retrospective analysis of the patients' clinical manifestations, diagnostic methods, treatment modalities, outcomes and long-term sequelae was performed. Height and weight were standardized for age and gender using data from the Korea Center for Disease Control and Prevention. Short stature was designated when height was lower than 2 standard deviation score. The following were the criteria for the response to the treatment. Complete response was defined when hemoglobin level ≥age-adjusted level, and absolute neutrophil count (ANC) ≥1.5×10/L, and platelet count ≥100×10/L. Partial response was defined when there is no requirement for red cell transfusion or reticulocyte count increase ≥30×10/L, ANC increase ≥0.3×10/L, and no platelet transfusion and platelet increase ≥20×109/L. Survival was assessed on the date of last patient contact and analyzed as of December 2012. Statistical analysis was performed using SPSS ver. 19.0 (SAS Institute Inc., Chicago, IL, USA). The probability of overall survival (OS) was estimated according to the Kaplan-Meier (K-M) survival method. Failure-free survival (FFS) was defined as survival with response. Death, transfusion-dependency, disease progression to MDS or AML, a second course of SCT, and relapse were considered treatment failures. Statistical significance was defined as <0.05. The study was approved by the Ethics Committee of the Chonnam National University Hospital (CNUH-2013-107). Of 12 patients with a diagnosis of FA, 9 were males and 3 were females. Their age at first evaluation ranged from 5 months to 14.3 years (median, 6.2 years). Characteristics of the patients are summarized in . One patient (case 2) had a family history in which his elder brother died of AA. Low birth weight was observed in 7 patients (63.6%), with the median body weight of 2.8 kg. All patients had at least one of the following associated anomalies: skin pigmentation including spots, hyperpigmentation or hypopigmentation (100%), skeletal abnormality (50.0%), microophthalmia (33.3%), cardiac anomaly (16.7%), microcephaly (16.7%), and short stature (8.3%). Other findings included developmental delay, congenital dislocation of hip, and polydactyly (). Laboratory findings of the patients at diagnosis are summarized in . All patients had evidence of BMF at the time of their first visit. The median blood counts were: white blood cell, 3,420/mm; hemoglobin, 6.0 g/dL; and platelets, 22,500/mm. Most patients had macrocytosis with median mean corpuscular volume of 95.8 fL. A bone marrow exam showed hypocellular marrow with loss of hematopoietic cells, and fatty replacement in all patients except one. The 3-month-old patient (case 7) had a normocellular marrow with macrocytosis, erythroid hyperplasia and significant dyserythropoiesis which was compatible with MDS. According to the classification of AA by severity, 7 patients (63.6%; cases 1, 2, 4, 5, 8, 10, and 12) among 11 patients diagnosed as AA had severe AA including 2 very severe diseases (cases 1, 2). Chromosomal breakage tests with DEB and MMC have successfully discriminated the two groups among 104 subjects: FA patients with hypersensitivity to both DEB and MMC, and non-FA patients with no hypersensitivity. The FA patients showed increased chromosomal breaks/cell of 1.51±1.45 (mean±standard deviation) (range, 0 to 4.25) to DEB (<0.01), and 1.11±0.85 (range, 0 to 2.5) to MMC (<0.01) (). Nine cases were found to have increased chromosomal breakage to DEB and MMC, confirming the diagnosis of FA. The remaining 3 patients (cases 4, 11, and 12) were diagnosed on the basis of characteristic physical stigma in addition to hematologic abnormalities. Case 4 died before the availability of the tests. Breakage tests on skin fibroblasts failed unfortunately in case 11 and were negative in case 12. FANC-A mutation was not detected in case 12. Even though the treatment modalities varied with time, FA patients received a combination of supportive treatment, oxymetholone, prednisolone, immunosuppressive treatment with ATG, and SCT (). In earlier years, 8 patients were treated with oxymetholone and prednisolone initially for 3 to 76 months. Oxymetholone and prednisolone treatment was partially beneficial in 3 patients (37.5%) (cases 2, 6, and 10), although peliosis hepatis (case 10) and masculinization (case 3) developed as side effects. All 4 patients (cases 2, 3, 4, and 7) treated with oxymetholone and prednisolone alone eventually died of invasive fungal infection, pneumonia, sepsis and development of AML, respectively. The conditioning regimens varied over 2 decades. In earlier years, low-dose cyclophosphamide (Cy), ATG with or without low-dose irradiation were mainly used (n=5; ). Recently, fludaradine (Flu)-based containing regimen without irradiation was used (n=4). Among 12 FA patients with the median age of 189.5 months (range, 20 to 356 months) at last follow-up, six patients (50%) are alive at a median follow-up of 69.5 months (range, 17 to 247 months) with the median age of 198 months (range, 96 to 356 months) at last follow-up. The K-M probability of OS was 83.3% at 10 years and 34.7% at 20 years for the entire group. Median survival was 18.3 years (range, 14.9 to 21.6 years) after diagnosis (). The median survival of non-SCT group was 15.6 years (range, 4.0 to 27.1 years), while that of the SCT group was not reached (=0.07). For the SCT group, the K-M probability of survival after diagnosis was 85.7% at 10 years and 68.6% at 20 years, respectively (). Among 7 who underwent SCTs, 5 are alive with the K-M 10-year OS of 71.4% after SCT with the median follow-up of 3.4 years. The K-M probability of FFS at 10 years was 57.1% after SCT (). Case 1 who underwent mismatched related donor transplant died of grade IV acute graft-versus-host disease (GVHD) at 40 days after transplant, while another patient (case 8) who developed AML (M2) died at 12 months after initial transplant. Because of the small number of cases, the survival was not different by the conditioning method no matter whether the patients received Cy-based, Flu-based, or radiation containing regimens. Also, the use of oxymetholone and prednisolone prior to SCT was not associated with poor outcome as 3 of 4 patients (cases 1, 5, 6, and 10) are surviving. Among the 6 patients who are alive, 3 patients are suffering from short stature with less than 2 standard deviation score in height (). The median standard deviation score was -2.03 in height and -1.49 in body weight, respectively. No surviving patient showed symptoms of hypothyroidism and 2 patients evaluated for thyroid function revealed normal values. Case 10, who received huge amounts of transfusions after the initial graft rejection, developed an insulin-dependent diabetes mellitus secondary to iron accumulation in the pancreas with elevated ferritin level of 5,961 ng/mL, requiring insulin treatment. FA is a genetic disorder characterized by multiple congenital anomalies, hematological abnormalities and predisposition to a variety of cancers. Approximately two-thirds of FA patients present with a combination of various congenital abnormalities such as short stature, Fanconi facies with microophthalmia, skeletal deformities, skin hyperpigmentation, and cardiac, renal, genitourinary, and/or other malformations,. Skin abnormalities have been described in the literature in 55% of cases of FA. However, all patients in this study had skin hyperpigmentation and/or spots. Skeletal abnormalities, found in 43% of cases of FA, were hypoplasia or absence of the thumbs, bifid or supernumerary thumbs, and hypoplasia or absence of the radius. One third in this study had skeletal abnormalities. Other less common abnormalities were 2 cardiac anomalies and 1 gastrointestinal defect. Physical abnormalities can be subtle or absent as 3 patients (cases 2, 5, and 8) in the present study showed cafe-au-lait spots only. Hematologic abnormalities are the most important clinical features of FA. BMF develops at a median age of 7 years (range, birth to 41 years),. For the majority of patients, the suspicion of FA is made only after the onset of pancytopenia. Initial hematologic findings are diverse. At birth, blood count is usually normal and macrocytosis is commonly the first detected abnormality followed by thrombocytopenia and anemia. During the first decade of life, about 75%-90% of FA patients develop BMF. In some patients, the underlying diagnosis of FA is not known until MDS or AML occurs. The relative risk of developing AML is approximately 800 fold higher than that of the general population, with the median onset of 14 years. In this study, 2 patients (cases 2 and 8) developed AML at 15.4 and 18.1 years of age, respectively. MDS was detected in 23 cases among 119 FA patients cohort at a median of 12 years (range, 2 to 44 years) in a recent study. The presentation of MDS at the age of 3 months (case 3) in this study should be extremely rare. In addition to hematologic malignancy, solid tumors develop at markedly higher rates in FA patients. Most of the solid tumors in FA patients are SCC, particularly of the head and neck, esophagus and anogenital regions. Hepatic tumors may also be found at higher rates, which may be related to androgen use. Approximately one-third of FA patients were known to develop a solid tumor by the fourth decade of life. However, not a single case of solid tumor has thus far been identified in this study. With wider application of SCT and improved survival, long-term survivors will have a particularly high risk of developing solid tumors. Because of the heterogeneity on clinical features and recessive mode of inheritance FA can not be diagnosed with certainty by careful history and physical examination in patients with BMF. The biologic diagnosis of FA is primarily based on the exquisite sensitivity of FA cells to the cytotoxic and clastogenic effect of DNA cross-linking agents such as DEB or MMC. The chromosomal breakage test with these agents is the technique of reference for diagnosing FA,,. The incidence of FA has been reported to represent 25% to 30% of pediatric AA. In Korea, however, the frequency of FA among patients with AA has not been systematically evaluated and has probably been underestimated as DEB and MMC tests have not been routinely incorporated in the evaluation of patients with AA in every institution. In accordance with the previous study, the chromosomal breakage of FA cells to DEB and MMC was distinguishable from non-FA group in this study. Spontaneous chromosomal breakage was not effective in distinguishing FA from non-FA patients because of overlap of breakage ranges. In the current study, 5 FA patients did not show spontaneous chromosomal breakages. Other blood tests such as cell-cycle analysis and evaluation of FANCD2 mono-ubiquitination may also be used to diagnose FA. However, all of these tests can be ambiguous or even falsely negative in patients who develop somatic mosaicism and hematopoietic reversion. Because these phenomena have not been demonstrated in fibroblasts, primary fibroblast cells can be tested for chromosomal breakage tests or other tests for FA diagnosis. In the current study, 2 patients (cases 11 and 12) with peculiar physical characteristics along with BMF showed negative results for chromosomal breakage tests on blood. Attempts on skin fibroblasts were unfortunately not successful in case 11 and negative in case 12. The possibility of somatic mosaicism or hematopoietic reversion should be contemplated in those cases. Since the first FA gene was demonstrated in 1992, 16 FA complementation groups (FANCs) have been identified (FANC-A, -B, -C, -D1, -D2, -E, -F, -G, -I, -J, -L, -M, -N, -O, -P, and -Q) so far. The majority of FA genes are located on autosomes except FANCB, which is on the X chromosome. Among the 15 complementation groups, FA-A (60%-70%), FA-C (up to 14%), and FA-G (up to 10%) collectively accounts for more than 90% of the FA groups in the western population. However, considerable variation in the frequency of each complementation group has been reported according to ethnicity. FA-A and FA-G mutations were detected in 70%-80% and 10%-22% in Japanese population. A recent study from Korea identified 6 FA-A (46%), 7 FA-G (54%) and no FA-C among 13 FA patients using MLPA and direct sequencing. Unfortunately, 1 patient (case 12) who underwent gene analysis was not able to be subtyped in the present study. It is crucial to identify patients with FA in the management of BMF patients. Patients with BMF who happen to have underlying undiagnosed FA will not respond to the immunosuppressive therapy that is used to treat patients with idopathic AA. Moreover, patients with FA will often die of toxicity due to hypersensitivity to chemoradiotherapy when given conventional conditioning for SCT, and therefore reduced intensity conditioning regimens should be used for FA patients. Also, human leukocyte antigen (HLA)-matched sibling donors should also be screened for FA as the recurrence rate for FA in a sibling is 25% for autosomal recessive disease. In FA patients, hematological complications are the most life-threatening event. According to the IFAR report, the risk of developing BMF and hematological malignancies by 40 years is 90% and 33%, respectively. Hematopoietic SCT remains the only treatment to correct the hematologic manifestations in FA patients. Because of high sensitivity to radiation and conditioning agents (alkylating agent), alternative conditioning regimens using lower dose Cy, using Flu and avoiding irradiation have shown hopeful results so far. Recently, a promising outcome using Flu (120-180 mg/m), low-dose Cy (40 mg/kg) and ATG based regimens was reported in 8 FA patients. Donors were either related (n=4), or unrelated (n=4). All patients achieved hematopoietic recovery and were alive at median follow up of 72 months (range, 4 to 117 months). In the United Kingdom, a similar nonradiation conditioning regimen consisting of Flu 125-150 mg/m, Cy 20-30 mg/kg and ATG was used for 7 FA patients. They were transplanted from unrelated umbilical cord blood (UCB) (n=4), HLA matched unrelated (n=2) and haploidentical (n=1) peripheral blood grafts. All patients were alive at median follow-up of 37 months (range, 13 to 54 months), although 2 rejected their grafts initially, but were rescued by a second transplant. In the present study, however, the survival was not different according to the conditioning method possibly secondary to the small number of cases. SCT from HLA-matched sibling donor generally gives the best outcome, if performed early prior to the development of MDS or leukemia. The data from the International Bone Marrow Transplant Registry showed that, among 209 patients transplanted from matched siblings between 1994 and 1999, the 3-year survival was 81% in patients <10 years of age (n=109) and 69% in older patients (n=100). However, the majority of FA patients do not have a HLA matched sibling donor. Until recently, SCT from an alternative donor (i.e., unrelated or HLA mismatched related) has been markedly less successful due to the high rate of graft failure, regimen related toxicity, GVHD and opportunistic infections. In the present study, among 2 transplanted from partially matched related donors case 1 died of grade IV acute GVHD and sepsis. Since the first successful transplant in 1989 for a FA patient, UCB has been increasingly used as a donor source. Although the engraftment after UCB transplant (UCBT) was slower, engraftment and survival have been comparable to bone marrow transplant and the incidence of GVHD was reduced. In the present study, 2 patients received unrelated UCBT, but both of them rejected initial grafts. Thus, caution should be taken to perform UCBT, especially if the cell number of the UCB unit is marginal or if the patient had received lots of transfusions (case 9). There are no nation-wide data on FA incidence in Korea, but a recent retrospective study from 9 centers of Korea reported preliminary data on 41 FA patients who underwent SCT between 1996 and 2009. Thirty patients (73.2%) were alive with a median of 35 months after transplantation. Flu-based regimens were used in 28 patients (68.3%), and radiation in 21 patients (51.2%). Event-free survival differed by donor types with the best outcome of HLA-matched unrelated donor (79%, n=20), followed by matched sibling donor (67%, n=7), haploidentical parental donor (50%, n=2), and UCB (25%, n=12). The incidence of acute grades II-IV and chronic GVHD was 39% (n=16) and 19% (n=7), respectively. Many patients who develop BMF initially respond to supportive care such as blood transfusions, androgens, and cytokines (e.g., G-CSF and GM-CSF). Synthetic androgens, such as oxymetholon and danazol, are often considered to be effective for treating BMF in FA patients, although long-term androgen use has side effects that include masculinization, acne, hyperactivity and increased liver tumor incidence. In this study, a female patient (case 3) treated with androgen suffered from masculinization and one (case 10) developed peliosis hepatis. Three out of 8 patients treated with androgen showed partial responses. However, all 4 patients who received androgen therapy alone because of the lack of a suitable donor or before the availability of SCT at the institution eventually died. Among 4 patients who finally underwent a SCT, 3 are alive with a median follow up of 173.5 months. Growth and endocrine abnormalities are clinically important aspects of FA as well. They are often either secondary to hormonal deficiencies, including pituitary hypofunction with hypogonadism, growth hormone deficiency, hypothyroidism and abnormal glucose or insulin metabolism, or treatment-related, such as hemochromatosis with repeated transfusions, or transplant-related complications. A thorough baseline and annual endocrine evaluation should be performed in every FA patient to reduce morbidity and improve quality of life. Despite the small sample sizes and without complementation grouping, the current study provides information on clinical manifestation and long-term outcome of Korean FA patients from a single institution. A nation-wide screening and registry for FA along with genetic subtyping should be initiated to understand the possible ethnic differences in the frequency of subtypes, to unravel genotype-phenotype correlation, to further refine techniques of HSCT, to develop potential future therapies, such as improved gene therapy, or antioxidant compounds, and to establish guidelines for long-term follow-up.

End-stage renal disease (ESRD), the terminal stage of chronic kidney disease (CKD), is a growing health problem worldwide. According to the United States Renal Data System (USRDS), the annual incidence of ESRD increased from 13 per million of the age-related population (MARP) in the 1988 to 15 per MARP in the 2003. European Dialysis and Transplant Association (EDTA) registry from 3,184 patients less than the age of 20 years showed that the incidence of ESRD rose from 7.1 per MARP in the 1980-1984 to 9.9 per MARP over the next 15 years, and the prevalence of patients on renal replacement therapy (RRT) increased from 22.9 per MARP in 1980 to 62.1 per MARP in 2000. In Korean children, according to the data from the Korean Health Insurance Review & Assessment Service in 2009, 435 children were on RRT, and the incidence and the prevalence of ESRD were 10.5 and 38.5 per MARP respectively (unpublished data). In these data, 52% of patients (141/271) on chronic dialysis were registered in the Korean Pediatric CKD (KPCKD) Registry. Although the expected outcome of ESRD has improved substantially over the past 40 years, the overall 10-year survival remains approximately 80%, and the mortality rate (MR) is still 30-150 times higher than that of children without ESRD. The 2011 annual report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS) group reported 3-year survival rates of 93.4% and relatively poorer survival in younger patients. Cardiopulmonary problems and infection were the major causes of death. In Korea, data on the outcomes of children on chronic dialysis have not been sufficiently reported. Adult Korean patients on chronic dialysis were reported by the Committee of the Korean Society of Nephrology in 2009 to have a 5-year survival rate of approximately 65% and a 9-year survival rate of 50%. The most common cause of death was cardiovascular problems. In this study, we reviewed the KPCKD registry data to assess the outcomes of Korean children on chronic dialysis. Data from the KPCKD registry were reviewed for the period from January 2002 to December 2010. This web-based registry (), launched in 2004 by the Korean Board of Collaboration for Pediatric CKD, has collected clinical data for patients with CKD. Patients who had initiated either peritoneal dialysis (PD) or hemodialysis (HD) before the age of 20 years were selected for this study. The follow-up duration was defined as the period from the initiation of dialysis to the date of renal transplantation, death, the date of transfer to internist or the last data entry. To analyze the difference in outcome by the patient's age at the initiation of dialysis, the study population was divided into four subgroups: <2 years, 2-5 years, 6-11 years, and ≥12 years of age at the initiation of dialysis. Patient survival data from the registry were reviewed, and for deceased patients, additional data were collected from the patient's medical records, including the age of death, the modality of RRT, the total duration of RRT and the cause of death. When multiple causes of death were identified, the most direct or the most significant causative factor was designated as the cause of death. Patient survival rates were calculated by the Kaplan-Meier method using PASW ver. 18.0 (SPSS Inc., Chicago, IL, USA) as the cumulative survival probability at the 1st, 3rd, 5th year of chronic dialysis and were described as 1-, 3- and 5-year survival. To evaluate differences in the modality of dialysis (HD or PD), Pearson chi-square test or Fisher exact test was used. The MR was calculated by dividing the number of deaths by the total patient follow-up time (i.e., the sum of the duration of chronic dialysis for all patients) in years and multiplying by 1,000, which shows the number of deaths per 1,000 patient years. values less than 0.05 were considered to be statistically significant. Three hundred seventy-eight patients had initiated chronic dialysis before their age of 20 years at the time of data collection (January 10th, 2011). Their median age at the initiation of chronic dialysis was 9.7 years (range, 0-19.7 years), and the median duration of chronic dialysis was 41.0 months (range, 3.0-240.0 months). The number of patients on PD was 304 and that of patients on HD was 74. The overall patient survival rate was 98.4% at 1 year, 94.4% at 3 years, and 92.1% at 5 years (). The overall 1-, 3-, and 5-year survival rate for PD patients was 98.3%, 94.3%, and 92.3%, and that for HD patients was 98.6%, 94.6%, and 91.1%, respectively (). There was no significant difference of survival between the patients on PD and those on HD (=0.908). The 5-year survival of patients who initiated dialysis at an age less than 2 years (n=40) was 70.6%, at 2 to 5 years (n=52) was 91.1%, at 6 to 11 years (n=140) was 94.4%, and at or over 12 years (n=146) was 96.5% (). The 5-year survival of children less than 2 years of age was significantly lower than those of other age groups (0-1 year vs. 2-5 years, =0.115; 0-1 year vs. 6-11 years, =0.001; 0-1 year vs. ≥12 years, =0.001). The 1-, 3-, and 5-year survival rate for patients who started dialysis earlier than 2 years of age were 92.5%, 82.0%, and 70.6%, respectively. During the period from 2002 to 2010, a total of 26 patients (male:female, 15:11) died while on chronic dialysis (HD:PD, 8:18), at a median age of 9.3 years (range, 0.3-25.7 years). The MR of this study was 19.9 per 1,000 patient years. The median age at the initiation of RRT was 7.3 years, and the median duration from the initiation of dialysis to death was 35.4 months. The most common cause of death was infection (n=6); 5 from sepsis, 1 from pneumonia. Of 6 patients, 3 patients were on HD. Five patients died due to the progression of an underlying malignancy (brain tumor, neuroblastoma, rhabdomyosarcoma, Wilms tumor, and leukemia) and 2 patients with hepatic fibrosis died from varix bleeding. Another 2 patients died from intractable seizure associated with Kearns-Sayre syndrome and nephronophthisis. Hemorrhages of the lung (n=2) and the central nervous system (CNS) (n=2) were also significant causes of death. One patient with pulmonary hemorrhage was on HD and both patients who died from CNS hemorrhages were on HD. Two of the patients died from a traffic accident and suicide. The causes of death of the other 5 patients were unknown. The causes of death between patients on HD and PD were not significantly different (). To the best of our knowledge, this is the first report on the outcomes of chronic dialysis in Korean children. The MR of our study population was 19.9 per 1,000 dialysis patient years. This rate is comparable to USRDS data from 2006 reporting an adjusted MR of 56.5 per 1,000 patient years for pediatric dialysis patients (aged 0-19 years, with treatment initiated between 1995 and 1999), Dutch data from 2002 reporting an MR of 15.7 per 1,000 patient years and Japanese data from 2002 reporting an MR of 15.6 per 1,000 dialysis patient years (in patients aged 0-19 years). Longer-term patient survival data are available from the Australia and New Zealand Dialysis and Transplant (ANZDATA) registry (n=1,634), which has the longest longitudinal follow-up period. The ANZDATA results show a 10-year survival of 79% and a 20-year survival of 66% for children under 20 years of age who started RRT between 1963 and 2002. Although the length of observation was relatively short in the present study, the 5-year overall patient survival (92.1%) was slightly better than that of ANZDATA (86%). Our study found that there was no significant difference of survival between the patients on PD and those on HD (=0.908). This result corresponds with a report from Taiwanese renal registry which showed no difference of survival between chronic HD and PD in patients less than 20 years of age (=0.4878). Our study also found that younger patients, especially those patients who started dialysis at less than 2 years of age, had poorer survival. The 2011 annual report of NAPRTCS group also reported significantly lower survival rate in children younger than 2 years of age at the beginning of dialysis. Additionally, the ANZDATA registry identified a younger age at the initiation of dialysis as a risk factor for poor survival. The poorer outcome in younger patients can be explained by the higher incidence of life threatening complications of chronic dialysis and more serious comorbidities frequently found in this age group in addition to the shortage of medical equipments and experienced personnel necessary to care them,. The most common cause of death in this study was infection in which dialysis-related sepsis to be most frequent. Wood et al. reported that infection was the most common primary cause of death, accounting for 15 of 51 deaths (29.4%). ESRD is an immunologically compromised condition, and the accesses for chronic HD or PD make the patients highly vulnerable to infectious complications. The second most common cause of death in our study was malignancy. All 5 patients who died from the progression of malignancy had obtained their ESRD because of chemotherapeutic agent-induced nephrotoxicity. Comorbidities including malignancies, hepatic fibrosis and CNS diseases lead to death in 9 patients (34.6%). Shroff et al. reported that in a cohort of 98 children on chronic dialysis, 76% of the mortalities was associated with comorbidities. Additionally, NAPRTCS data have identified comorbidities such as pulmonary hypoplasia and severe developmental delay, oliguria/anuria, and a younger age at the initiation of dialysis as risk factors for increased mortality in infants and young children. Just like in adults patients,, cardiovascular disease is one of the most significant causes of death in children on chronic dialysis; cardiac arrest is the most commonly reported cause of death in children. ANZDATA reported that the most common cause of death in children on dialysis was cardiovascular disease (45%), with the second most common being infection (21%). And the rate of cardiovascular death in pediatric patients with ESRD in USRDS was up to 37%. In this study, pulmonary hemorrhage, a common manifestation of severe congestive heart failure, was the cause of death in 2 children, but this incidence was lower than those reported elsewhere. Mortality by cardiovascular origin in this study was lower than that of adults or other pediatric studies. The difference could be originated by the fact that pediatric ESRD patients undergo renal transplantation earlier than adults before severe uremic cardiomyopathy develops. In addition, relatively shorter follow-up duration of this study could be another reason. Furthermore, the patients with unknown causes of death might have died from cardiovascular diseases. It is assumed that the CNS Hemorrhage, which was the cause of death in 2 children on HD, is associated with uncontrolled hypertension or accompanying cerebrovascular diseases. A limitation of our study is that it is based on the data from the KPCKD registry, which were input by the participating centers, and the registration rate was only 52%. It is speculated that internists who do not participate in the KPCKD registry are treating many adolescent patients with ESRD. Because all patients are eventually transferred to the internist, we, the authors, cannot know the accurate number of the dead patients. Additionally, the follow-up durations were not long enough to provide data for a long-term survival. To obtain long-term survival data, cooperation with internists is indispensible. In conclusion, the outcomes of chronic dialysis in Korean children were better than those of adults, and comparable to pediatric studies of other countries as well. To improve the outcomes of children on chronic dialysis, prevention of dialysis-related complications, such as infection or congestive heart failure or CNS hemorrhage due to uncontrolled hypertension, and more aggressive management of treatable comorbidities are necessary.

Lowe syndrome (OculoCerebroRenal syndrome of Lowe) is an X-linked, recessive disorder characterized by congenital cataracts, mental retardation, and proximal renal tubular dysfunction (Fanconi syndrome). It is a rare disease with an estimated prevalence of 1-2 in 1,000,000 patients. The clinical manifestations vary among affected individuals and also according to their age. Bilateral cataracts are present at birth and are associated with glaucoma in approximately half of the affected males, often resulting in progressive visual loss. Global hypotonia is also noted soon after birth, and many patients exhibit mental retardation, stereotypic behavior, and seizure disorder. During infancy and midchildhood, affected males have a variable spectrum of renal tubular dysfunction which causes aminoaciduria, metabolic acidosis, phosphaturia, and hypercalciuria. Later in life, some patients develop chronic renal insufficiency and end-stage renal disease between the second and fourth decades. Renal rickets and osteomalacia due to renal dysfunction may lead to fractures, bone pain, and limited range of motion. Other clinical manifestations include facial dysmorphisms (frontal bossing, deep-set eyes, and protruding ears), dental malformation, superficial cysts, and failure to thrive,,. This syndrome is caused by mutations in the gene on Xq25-q26, which contains 24 exons and encodes an inositol polyphosphate-5-phosphatase at the Golgi network as well as early endosomes,. has an essential role in cellular processes such as intracellular signaling, protein trafficking, and polymerization of the cytoskeleton actin. Its defect causes the several cellular defects underlying Lowe syndrome. Since 1952, when this disease was first recognized by Lowe et al., clinical and genetic studies have been reported in various populations. However, there have been a few studies in Korean patients and these reports only described the clinical characteristics of a few patients or mutations of the gene. In this study, we describe the detailed clinical features as well as the genetic characteristics in Korean patients with Lowe syndrome. The clinical diagnosis of Lowe syndrome was based on the presence of all three of the following: congenital bilateral cataracts; renal Fanconi syndrome; and involvement of the central nervous system, such as hypotonia and mental retardation. Standard deviation scores (SDS) for height, weight, and body mass index (BMI) were calculated based on the data presented in the 2007 Korean Children and Adolescents Growth Standard. Mutation analysis was carried out using genomic DNA from peripheral blood using a QuickGene DNA whole blood kit (Fujifilm, Tokyo, Japan). Twenty-three exons, including coding sequences of the gene and their intronic flanking sequences, were amplified by polymerase chain reaction (PCR) with 20 sets of primers. After PCR amplification with Go Taq polymerase (Promega, Madison, WI, USA), DNA sequencing was performed using the same primers as those in PCR and a BigDye Terminator V3.1 Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). The first presenting sign of Lowe syndrome in all 12 patients was bilateral congenital cataracts. The mean age at presentation was 2.2±1.8 months (0 to four months of age). However, clinical diagnosis of Lowe syndrome was delayed until 51.3±61.9 months of age (four months to 18 years of age). The interval from presentation to diagnosis was 34.1±34.8 months (0 to 116 months). At diagnosis, delayed development was seen in six patients (50%). In addition, proteinuria, nystagmus, seizure or sensorineuronal hearing loss were seen in the remaining six patients (). A total of nine different mutations, including three novel mutations, were identified in 11 patients (91.7%), although we could not find a mutation in the remaining patient (subject 12) (). Point mutations were one missense (p.Arg483Gln in subjects 3 and 8) and three nonsense (p.Arg483 in subject 1, p.Arg793 in subjects 4 and 6, and p.Arg678 in subject 11). Two, splicesite mutations, c.1551+1G>A and c.889-11G>A, were detected in subjects 5 and 7, respectively. The frameshift mutations, p.Leu723Trpfs4 and p.Arg596fs10, are expected to produce a prematurely terminated protein. c.2408_5164inv refers to gross inversion of exons 21-23, which is also predicted to produce premature terminated protein. Three, novel mutations were c.2167_2174delTGGATGAA (p.Leu723Trpfs4), c.1787_1788insGAAC (p.Arg596fs10), and c.2408_5164inv. The mutations were identified in exons 15 (three patients), 21 (three patients), and 17/18/19 (one patient each) in the order of frequency. All 12 patients survived during the follow-up period of 9.0±5.6 years (0.6 to 16.7 years). All patients presented with profoundly short stature (). The mean height SDS were -3.8±3.1 (-11.3 to -0.1) at diagnosis and -4.1±3.1 (-4.8 to 1.4) at the last follow-up visit, respectively. The mean BMI SDS was -0.8±1.7 (-4.8 to 1.4) at the last evaluation. Cataract removal surgery was performed in 11 patients at 3.6±1.6 months of age (one to seven months of age), and an intraocular lens was implanted in six (6/11, 55%) of these patients (). Nystagmus (9/12, 75%) and glaucoma (5/10, 50%) were also seen. Despite therapy, visual impairment worsened in all patients, and corneal keloid was found in three patients (3/10, 30%). All patients experienced neonatal hypotonia with motor and cognitive developmental delay as well as mental retardation (). Six patients (50%) had clinical or electrical seizure disorders for which antiepileptic medication was needed. Brain magnetic resonance imaging was performed in seven patients. Patchy, white matter abnormalities were detected which were hyperintense on T2-weighted imaging (5/7, 71%), and those lesions were located in bilateral peritrigonal white matter in three patients (3/7, 43%; ). Five patients whose urinary β-microglobulin had been measured had albuminuria including low-molecular weight proteinuria (). In addition, proximal renal tubular acidosis or Fanconi syndrome was documented in all patients. Their estimated glomerular filtration rate (eGFR) was 82±24 mL/min/1.73m (47 to 144 mL/min/1.73m), whereas one of these patients (subject 4) had renal insufficiency of eGFR 47 mL/min/1.73m at the age of 16 years,. Hypercalciuria (9/12, 75%), phosphaturia (6/12, 50%), renal rickets (9/12, 75%), hypokalemia (4/12, 33%), and nephrocalcinosis (7/12, 58%) were noted (). Sodium bicarbonate, citric acid, potassium, and phosphate replacement were required for metabolic and/or electrolyte disturbances, and calcitriol was given for renal rickets. Six patients (50%) experienced repeated pathologic bone fractures (). Pamidronate therapy was required for two patients (2/12, 17%) with severe osteoporosis seen on bone densitometry. Twelve patients in our study manifested the constellation of clinical features of Lowe syndrome. Bilateral congenital cataract is the earliest sign and requires surgery during infancy, although visual impairment can be reaggravated. Hypotonia, developmental delay, profoundly short stature, proximal renal tubular dysfunction or Fanconi syndrome and its complications such as renal rickets and nephrocalcinosis, were invariably seen in most of our study patients. However, only one patient had renal insufficiency. The small proportion of renal insufficiency in our patients is related to the short duration of the follow-up period as in Lowe syndrome chronic renal failure usually develops between the second and fourth decades of life,. However, its progression can occur even in early childhood, depending on tubular and glomerular dysfunction, as seen in nephropathic cystinosis. Recurrent pathologic bone fracture (50%), cutaneous cysts (42%), and cryptochidism (42%) were often observed in our patients. None of our patients had a bleeding tendency, in contrast to that seen in previously published reports. All of our patients survived during the study period, although the survival rate remains to be re-estimated as the average life expectancy of patients with Lowe syndrome is approximately 40 years. More than 200 different mutations in have been identified since the gene was discovered by Bailey Jr et al. in 1992. In our study, mutations were detected in 92% (11/12 alleles) of the patients, and which comparable to that seen in previous studies ,,,,,,,,. Meanwhile, the most mutations, including nonsense, splice-site and frameshift mutations, are expected to produce prematurely truncated protein (10/11 alleles, 90.9%). This proportion of the truncating mutation is higher than that (63.6%) reported by Hichri et al.. According to previous studies, the most frequent mutation site was exon 15 and the mutations were distributed in coding regions from exon 8 to exon 24, not in the first seven exons. In the present study, mutations were found in exon 15, 21, and 17/18/19, in order of frequency. The findings related to mutation sites are quite a contrast to those found in Dent-2 disease which was exclusively identified in the first seven exons of the gene and selectively shows renal proximal tubular dysfunction. It is known that the exons 1-7 of the coding region include the Pleckstrin Homology (PH) domain encoded by exons 2-5. Although the PH domain has a role as a major clathrin binding site, this suggests that the PH domain is not critical for the development of Lowe syndrome. Meanwhile, three novel mutations were detected in our study. Two frameshift mutations, p.Leu723Trpfs4 and p.Arg596fs10, were identified in the ASH (ASPM, SPD-2, Hydin)/Rab binding domain spanning exons 17-19. The third novel mutation, c.2408_5164inv, was gross inversion of exons 21-23 which mapped to a region in close interaction with the ASH domain. The ASH-RhoGAP (Rho GTPase activating) module regulates the majority of the protein-protein interactions for and has an important role in membrane recruitment. Therefore, the frameshift or gross inversion mutations in this module that affect its interactions with binding partners, impair cellular localization and the stability of and are sufficient to cause disease. All patients with Lowe syndrome present in infancy with congenital cataract. However, the clinical diagnosis is established about two or three years later in most patients. Congenital bilateral cataract, neonatal hypotonia, and/or delayed development accompany other congenital syndromes due to chromosomal anomalies or prenatal infections. In addition, the characteristic facial appearance and renal tubulopathy might not be obvious in the infantile or early childhood periods. Therefore, it is important to include Lowe syndrome in the differential diagnosis of a male infant with congenital cataract and hypotonia. When it is suspected, tubular proteinuria and elevation of aspartate transaminase, lactate dehydrogenase or creatine kinase are useful markers. For confirmation of Lowe syndrome, the activities of the inositol polyphosphate-5-phosphatase can be measured in skin fibroblasts or genetic testing can be performed for the gene. As for prenatal identification of Lowe syndrome, increased fetal nuchal translucency and the presence of bilateral lenticular opacities during the second trimester, as identified by detailed anomaly, are the important signs suggesting Lowe syndrome,. In these cases or in an informed family, prenatal testing can be performed by enzyme deficiency analysis and/or DNA analysis in fetal cells obtained by either chorionic villus sampling or by amniocentesis. We could not obtain the information regarding prenatal ultrasonography in all of our patients. Meanwhile, in one case, the patient's mother planned another pregnancy and chorionic villus sampling was performed at 11 weeks and two days of gestation for antenatal exclusion of Lowe syndrome after the parent's prenatal consent (subject 11). As the mutational analysis showed that the fetus had a normal sequence of the gene, the parents decided to deliver the baby. Profound short stature and delayed puberty were both evident in our patients. Chronic renal failure and metabolic acidosis along with renal rickets are supposed to contribute to a patient's short stature and delayed puberty. Growth impairment is also a common feature in children with Fanconi syndrome. In this respect, early identification and intervention for metabolic acidosis and renal rickets are important so as to deter growth impairment in children with Lowe syndrome. However, despite this aggressive therapy begun at an early age, growth retardation is inevitable in Lowe syndrome. However, there might be other elusive factors underlying the growth impairment. Although most of the clinical features of Korean Lowe syndrome patients did not differ from those reported in other countries, there are some differences in our study. According to Lasne et al., an abnormal rate of hemorrhagic events was found according to a retrospective clinical survey and prolonged closure times (CTs) were observed in the Platelet Function Analyzer-100 system, despite normal coagulation tests in six patients with Lowe syndrome. Our patients had the normal ranges of platelet counts, prothrombin time, and activated partial thromboplastin time, and no severe bleeding episode was experienced during their daily life activities or surgeries through the variable follow-up periods. As they may often need multiple surgeries, such as scoliosis reduction, hip surgery or eye surgery, bleeding diathesis should be thoroughly evaluated. Despite the extensive studies, it remains elusive how the gene mutations result in a variety of phenotypes of Lowe syndrome. As in our patients, most mutations are private. Sometimes clinical spectrum differs among patients with the same mutation (subjects 3 and 8 in ). The underlying molecular mechanisms of these phenotypic heterogeneities are mainly elusive, although INPP5B, type II 5-phosphatase with an homolog with approximately 45% sequence homology and a similar structure, might have a role. In the study of Bothwell et al., the knockout mice did not present phenotypes similar to those seen in Lowe syndrome, and the :INPP5B double knockout resulted in embryonic lethality, and leading to the hypothesis that INPP5B may compensate for in the mouse model. INPP5B shares a great portion of the interacting proteins with , except for clathrin and the endocytic clathrin adaptor AP-2. Differential expression of INPP5B in the relevant tissues may be related to the severity of the loss of the function phenotype. Therefore, further investigation regarding the compensatory role of INPP5B for in Lowe syndrome, will be needed and it will be helpful for developing potentially successful treatment of Lowe syndrome. Although we comprehensively reviewed the clinical and genetic findings of Korean patients with Lowe syndrome, our study has some limitations. First, the number of patients we reported in this study was too small to represent the general clinical and genetic features of Korean patients with Lowe syndrome and their genotype-phenotype correlations. In addition, the follow-up period was too short and variable among patients in order to assess the long-term natural course of Lowe syndrome in each patient. Because there is not a standardized, follow-up monitoring protocol, the clinical evaluation might have been incomplete in some patients. Until now, a few studies have been reported on Korean Lowe syndrome. Kim et al. provided a description of the clinical characteristics in two patients and other studies have focused on renal or integumental systems,. Meanwhile, our study first investigated the clinical features and genetic backgrounds of Korean patients with Lowe syndrome, as well as their heterogeneities. Long-term follow-up evaluations in a large number of patients will be needed in order to further investigate the clinical and genetic spectrum of Lowe syndrome in Korean patients.

xref italic #text xref italic #text Typical clinical features of MDC1A or merosin deficient congenital muscular dystrophy include severe floppiness at birth, elevated serum CK, delayed motor milestones, white matter changes as seen on brain MRI, and normal intelligence. However, merosin-positive CMD generally presents with less severe clinical features and without any abnormalities on brain MRI,. Initially, MDC1A was thought to be a homogenous disease; however, case reports of atypical phenotypes and some cases showing only partially reduced merosin expression contributed to classifying the disease as a heterogeneous group,. There have been MDC1A patients who show late-onset weakness, mental retardation, seizures, subclinical cardiac involvement, or neuronal migration defects. In particular, cases with residual merosin expression have more variable phenotypes than cases with absolute merosin deficiency. According to previous reports, patients with residual merosin tend to have milder phenotypes,. With regards to ambulation, a previous study showed that eight out of 12 patients with residual merosin achieved independent ambulation, whereas, out of four patients with absent merosin, none could walk independently. Another study presented similar results: five out of 13 patients with residual merosin and two out of 33 patients with absent merosin could walk independently. In our case, the onset of symptoms was 4 months after birth, rather than during the neonatal period. Usually, merosin deficient patients present with symptoms within 7 days of birth, while patients with residual merosin have a later onset of symptoms. The other symptoms of this patient, such as hypotonia, normal intelligence, elevated serum CK, and the absence of seizures, are typical presentations of MDC1A patients. At present, she is 14 months old, and can sit without support but cannot get into a sitting position. We estimate that she has about a 50% probability of walking independently later in her life. Brain MRI of this patient showed typical hyperintensity in the T2-weighted image. However, the patient's site of lesion is in the external capsule, which is an unusual area for this disease. A study of 25 Brazilian patients with MDC1A reported that bilateral white matter involvement in the parietal, frontal, and temporal regions was frequent, and brain stem, cerebellum, and internal and external capsules were also affected in a minority of cases. However, there were no correlations with sites of white matter abnormalities and clinical status or merosin status. To confirm mutation of the gene, we sequenced exons 14, 25, 26, and 27. This technique, while able to screen for point mutations in above 4 exons, is limited in its ability to detect large deletions or insertions or point mutations in the other sites. We did not further evaluate other possible mutations in the gene because of her parents' refusal. According to a previous report, a majority of mutations in the residual merosin group are splice site mutations, and frameshift mutations are less frequent. This patient may have mutations in her gene, although we could not confirm the specific mutations because of incomplete study. MDC1A is very rare in Asia, and the cases reported thus far are typically those without merosin, and have mostly been severe forms of MDC1A. In our study, the patient showed a typical phenotype of MDC1A, including features such as hypotonia, elevated serum CK, delayed motor development, and T2 hyperintensity on brain MRI. However, immunohistochemical staining of the muscle fibers showed partially decreased merosin levels and some atypical findings, such as a somewhat later age of disease onset and involvement of the external capsule. From our experience, performing immunohistochemical staining to assay the extent of merosin expression is an important procedure, and may be helpful in predicting the clinical course of the disease.

Toxic epidermal necrolysis (TEN) is a life-threatening cutaneous reaction associated with 30% mortality. Inappropriate immune activation is triggered in response to certain drugs or their metabolites. Numerous medications have been implicated as causes of TEN, the most frequently associated drugs include aromatic anticonvulsants, sulfonamide antibiotics, allopurinol, oxicam nonsteroidal anti-inflammatory drugs, and nevirapine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Lamotrigine is a relatively new anticonvulsant. It is used for different types of epilepsy and also effective in treating and preventing bipolar depression. The risk of TEN with combination lamotrigine and valproate is greater than with monotherapy. Children are more susceptible to lamotrigine-rash than are adults. TEN is rare disease with incidence of approximately 1.9 cases per million inhabitants annually based on all cases reported to the Food and Drug Administration (FDA) adverse effect reporting system databases in the USA, and is also rare disease in Korea. We report a case of TEN in a child that occurred after addition of lamotrigine to the valproic acid treatment, and who was diagnosed clinically and pathologically. An 11-year-old girl was hospitalized for erythematous maculopapular rash with an itching sensation over the entire body with fever, conjunctival injection, eye wax, and oral ulceration. The patient had experience tic disorder since the age of 8 years, and had been diagnosed with major depressive disorder about 7 months previously. The patient was initially treated with fluoxetin, valproate, risperidone, and aripiprazole in psychiatric clinic. However, because of inadequate control, lamotrigine (25 mg/day) was added to the regimen about 3 weeks before hospitalization. After 2 weeks use of lamotrigine, the patient developed an erythematous rash, starting from the face and gradually spreading over the whole body. The patient transfered to Soonchunhyang University Hospital with a diffuse, confluent erythema, which covered over 90% of the total body surface area, conjunctival injection, eye wax, vesicle, and clot on lips and oral ulceration (). The patient also had a fever and skin tenderness, and could not eat properly because of oral pain. During the hospitalization, the skin lesion progressed to a purpuric rash with bullae (). Hemorrhagic crust on the lip was aggravated and Nikolsky's sign was positive. There was no history of food or drug allergy. Laboratory examination revealed normal complete blood count and serum biochemistry, normal erythrocyte sedimentation rate, and elevated C-reactive protein (7.56 mg/dL). Urinalysis showed pyuria (leukocyte 3+), but urine culture was negative. Chest x-ray was normal. Skin biopsy revealed necrotic keratinocyte in the epidermis with spongiosis and exocytosis, and lymphohistiocytic infiltration in the upper dermis, which suggested TEN (). Consultations with a dermatologist, a plastic surgeon, a psychiatrist, an ophthalmologist and an otorhinolaryngologist were conducted. We stopped all the psychiatric medications and started intravenous (IV) antibiotics, suspecting secondary infection, intravenous immunoglobulin (IVIG;1.5 gm/kg/day for 3 days), and other conservative management including IV hydration, aseptic dressing, topical ointment, nasal irrigation using normal saline, oral humidification, and eye drops. After a week of hospitalization, the skin lesion showed desquamation and was improving (). The tic symptom recurred 2 weeks after we stopped the psychiatric medication, so we used aripiprazole. After 19 days of hospitalization, the lesion became much improved and the patient was discharged. TEN is an unpredictable and severe adverse drug reaction. Although several theories exist, the innate immune system is now favored as a significant contributor to the initiation and propagation of this devastating reaction. TEN is heralded by the abrupt onset of fever; systemic toxicity; a generalized, dusky, and erythematous rash; bullae; separation of large sheets of epidermis from the dermis; purulent conjunctivitis; and mucositis of the mouth and genital area. In our case, the patient had oral, nasal mucosa and conjunctival involvements along with fever. Complete death of the epidermis leads to sloughing similar to that seen in large burns. TEN includes denudation of >30% of the total body surface area. Stevens-Johnson syndrome (SJS) affects <10% of the body surface, whereas involvement of 10%-30% of body surface area is called SJS/TEN overlap. The estimated mortality rate for SJS is approximately 10%, while that for TEN is as high as 45%, with death mainly due to sepsis and hemodynamic failure. The prompt withdrawal of the suspected drug, fluid and electrolyte replacement, and topical wound care are the first line therapies. Administration of corticosteroids in TEN is controversial and even can be contraindicated. The role of immunosuppressants, despite some success, is not well defined and is not considered as a standard. On the contrary, good results are reported in terms of decreasing mortality and morbidity or improving clinical conditions of the use of human IVIG. Although some studies have shown no benefit from IVIG, the wealth of clinical experience supporting its therapeutic value cannot be dismissed. IVIG has minimal toxicities and, considering the gravity of the condition being dealt with, the risk/benefit ratio is quite favorable. We started IV antibiotics and other conservative treatment at first, and on the day 2 of hospitalization commenced IVIG treatment because of aggravated skin lesion. We used IVIG for 3 days, and continued conservative treatment including aseptic dressing and topical ointment. The lesion showed improvement after a week of hospitalization. Lamotrigine has been reported as having the potential to cause serious cutaneous reactions. Concomitant use of valproic acid with lamotrigine significantly increases the risk for development of adverse cutaneous reactions. Valproic acid interacts with lamotrigine metabolism, leading to a reduced total clearance, and therefore to an increased elimination half-life of lamotrigine, resulting in higher serum concentrations. Risk of serious rash may possibly be lessened by strict adherence to dosing guidelines. Children aged 2-12 years taking concomitant valproate and lamotrigine should be initiated at a dosage of 0.2 mg/kg once daily for the first two weeks, followed by 0.5 mg/kg once daily for the next 2 weeks, and increased thereafter by 0.5-1 mg/kg every other week to a maximum of 200 mg/day. Unfortunately, in our case the patient initiated at the dosage of 25 mg (0.75 mg/kg) once daily. It would be important, if lamotrigine is added to valproic acid treatment, to initiate at a low dose and then increase slowly. The use of lamotrigine in psychiatry has increased significantly after its approval by the FDA. Therefore not only pediatricians but also psychiatric clinicians should keep the strict dose regimen when they use lamotrigine especially in children.

Heart transplantation remains the treatment of choice for patients with end-stage heart failure refractory to medical or surgical management []. Early graft dysfunction often occurs after implantation for various reasons including ischemia-reperfusion injury and failure of donor heart preservation [,]. Mechanical circulatory support for early graft dysfunction has been performed easily with a low complication rate since the introduction of peripheral cardiopulmonary support [,,]. The purpose of this study was to evaluate the efficacy and safety of percutaneous veno-arterial extracorporeal membrane oxygenation (ECMO) in patients who developed early graft dysfunction after heart transplantation. From January 2006 to December 2012, 65 patients (44 males and 21 females) underwent heart transplantation at our institution. Thirteen patients (group I) needed peripheral ECMO support to be weaned from cardiopulmonary bypass (CPB). Fifty-two patients (group II) could be weaned from CPB without mechanical support. The mean patient age at the time of operation was 54.4±13.6 years. Diabetes (n=16, 24.6%) and hypertension (n=16, 24.6%) were the most common co-morbidities. There were no differences in the preoperative characteristics between the two patient groups (). Early mortality was defined as any death within 30 days after surgery. In-hospital mortality was defined as death during the same hospitalization. The occurrence of any short runs (>30 seconds) of atrial fibrillation during the hospital stay was considered to represent the development of atrial fibrillation. Respiratory complications included postoperative pneumonia or prolonged ventilator support of >48 hours. Acute renal failure was defined as an increase of >50% in the serum creatinine level from the preoperative value or a need for renal replacement therapy irrespective of the serum creatinine level. A risk factor analysis was performed for identifying the predictors of graft dysfunction requiring ECMO support. Donor heart was preserved using a single flush of 10 to 20 mg/kg histidine-tryptophan-ketoglutarate solution. During transportation, the heart was immersed in a cold saline bag packed with ice. The immunosuppressive protocols included the following: a calcineurin inhibitor (cyclosporine before 2009 and tacrolimus after 2009), an antiproliferative agent (azathioprine before 1999 and mycophenolate mofetil after 1999), and corticosteroids. In addition to these so-called triple regimens, interleukin-2 has been used since 2009. Intravenous methylprednisolone (500 mg) was administered just before releasing the aortic cross clamp, followed by three additional doses (150 mg q8h). Statistical analyses were performed using the PASW SPSS ver. 18.0 (SPSS Inc., Chicago, IL, USA). A univariate analysis was performed using the χ test or Fisher's exact test for categorical variables and the Student t-test for continuous variables. A multivariate analysis was performed using a logistic regression analysis. Variables with a p-value of <0.2 in univariate analyses were entered into the multivariate analysis. A p-value of <0.05 was considered statistically significant. The mean cardiopulmonary bypass and donor ischemic times were 271±73 minutes and 154±53 minutes, respectively. There were no differences in the CPB time and the donor ischemic time between the two groups, with the exception of donor age; group I donors were older than group II donors (41.3±9.2 years vs. 34.0±11.3 years, p=0.036) (). Heparin-induced anticoagulation was initiated 25±16 hours postoperatively. All patients were successfully weaned from ECMO after 53±9 hours of support. No patient suffered from ECMO-related complications such as vascular injury, lower leg ischemia, or thromboembolic complications. Early mortality occurred in four patients (1 [7.7%] in group I vs. 3 [5.8%] in group II, p>0.999). Three patients died of pneumonia on postoperative days 13, 22, and 28, and one patient died of sudden cardiac arrest on postoperative day 30. Postoperative morbidities included bleeding reoperation (n=11, 16.9%), respiratory complication (n=9, 13.8%), and stroke (n=4, 6.2%). A greater proportion of group I patients underwent reoperation for bleeding than group II patients (5 [38.5%] in group I vs. 6 [11.5%] in group II, p=0.035). All bleeding reoperations were performed before anticoagulation was re-initiated. There were no differences in other postoperative complications between the two groups (). Univariate analyses revealed that high donor age and preoperative mechanical support (ECMO and intra-aortic balloon pump) were significant factors. In the multivariate logistic regression analysis, preoperative mechanical support and longer CPB time were the risk factors of ECMO requirement (). The present study revealed two main findings. First, percutaneous ECMO could be a useful option for rescuing patients suffering from early postoperative graft dysfunction after heart transplantation. Second, preoperative mechanical support and longer CPB time are risk factors of ECMO requirement. Primary graft failure after heart transplantation is a rare but catastrophic complication; it is responsible for one-third of the deaths in the early post-transplantation period []. The prevalence of graft failure was reported to be 2.4% to 20% [,,,,], and the survival rate after primary graft dysfunction varied from 3.7% to 40% [,,]. The wide variability in outcomes is explained by the differences in the definitions of graft dysfunction and risk profiles of the study patients []. The etiologies of early graft dysfunction are believed to be multifactorial and include ischemia-reperfusion injury, failure of donor heart preservation, acute rejection, and pre-existing high pulmonary vascular resistance [,]. When a failed graft is refractory to medical management, including maximal inotropic support and the use of inhaled nitric oxide, mechanical circulatory support could be an option for rescuing patients with early graft dysfunction [,,]. In the current study, the proportion of patients requiring ECMO application was higher than that in previous studies. We applied peripheral ECMO early upon discovering any sign of graft dysfunction to ensure that percutaneous mechanical circulatory support could be offered easily with minimal complications [,]. Furthermore, all patients were weaned from ECMO 53±9 hour after application without vascular injury and thromboembolic complications. Early mortality in the ECMO group occurred in one patient and was not related to ECMO application. The high ECMO weaning and survival rates probably resulted from the prevention of irreversible deterioration of the transplanted heart owing to early ECMO application. One of the major complications in the ECMO group was the higher rate of bleeding reoperation than that in the non-ECMO group. In the present study, protamine was administered for normalizing the prolonged activated clotting time after CPB weaning, and heparin was restarted after the cessation of surgical bleeding was confirmed in the intensive care unit. However, bleeding reoperation before restarting anticoagulation occurred in 38.5% of the patients. Longer CPB times and ECMO circuit-induced coagulopathy might have elevated the risk of bleeding. Previous studies suggested preoperative mechanical circulatory support, high donor age, and long ischemic time as the risk factors of early graft dysfunction [,]. The risk of graft failure increased by 43% with the passage of every hour of ischemic time after hour 4 []. In the present study, preoperative mechanical circulatory support and longer CPB time were the risk factors of ECMO support. A greater inflammatory response, which might have resulted from preoperative mechanical circulatory support and longer CPB times, could have influenced the occurrence of primary graft failure []. The ischemic time was not a significant risk factor probably because it did not exceed 4 h in a majority of the patients. Given that the causes of primary graft dysfunction were known to be multifactorial, efforts to decrease the incidence of organ dysfunction should be made, including the following: 1) appropriate donor selection, 2) optimal donor heart preservation, 3) minimization of the CPB and donor ischemic times via co-ordination between the donor procurement and recipient operation teams, and 4) effective immunosuppressive therapy. There are certain limitations of the present study that must be recognized. First, the study was a retrospective observational study conducted in a single institution. Second, the number of enrolled patients was relatively small to draw a definite conclusion. Third, ECMO indications were not precisely defined because of the retrospective nature of this study. In conclusion, when graft dysfunction after heart transplantation is refractory to medical management, percutaneous ECMO insertion might be a valuable option for rescuing patients. Strict coagulopathy control seems to be necessary for avoiding bleeding complications.

Coronary artery revascularization for multivessel disease can be managed through various modalities, and the patency of left internal thoracic artery (LITA)-to-left anterior descending artery (LAD) anastomosis is the best among the options. Recent reports have noted a 10-year patency rate of 95% to 98% [,]. The patency of percutaneous coronary intervention (PCI) is enhanced by using drug-eluting stents (DESs). In the Randomized Comparison of a Sirolimus-Eluting Stent with a Standard Stent for Coronary Revascularization trial, PCI using DESs yielded free rates from target lesion revascularization at 1, 3, and 5 years of 99%, 93.8%, and 89.7%, respectively []. Hybrid coronary revascularization (HCR) for multivessel disease was introduced in the mid-1990s []. HCR is a combination method of grafting surgery using LITA of the LAD lesion with PCI of the remaining lesions. Because the procedure-related morbidity and mortality are lower than those with conventional coronary artery bypass grafting (CABG), interest in HCR has recently increased. Previous studies reported that the mortality rate associated with HCR was low. In particular, for high-risk patients, HCR was found to be safer and more effective [,]. Minimally invasive direct coronary artery bypass grafting (MIDCAB) is usually performed through a 5- to 10-cm left anterolateral thoracotomy. There are advantages of this procedure compared with conventional CABG, which are better cosmetic outcomes, no morbidity of cannulation or cardiopulmonary bypass, and faster recovery [,]. However, in the cases wherein patients were hemodynamically unstable during the operation, switching to conventional CABG was difficult. The conversion rate to conventional sternotomy during MIDCAB was 1.8%, and the risk of morbidity and mortality increased with the conversion []. Therefore, we began with the safer minimally invasive coronary artery bypass surgery of limited incisional full sternotomy coronary artery bypass surgery (LIFCAB). LIFCAB involved LITA-to-LAD anastomosis through a sternotomy with a minimal skin incision. The surgeon could create a classic view through the sternotomy, and it was easy to convert to conventional CABG when the patient was hemodynamically unstable. We have used LIFCAB since 2010 and performed HCR using LIFCAB. Therefore, in this paper, we report the short-term results of HCR using LIFCAB. From May 2010 to June 2013, 78 patients were treated with LIFCAB, whereas 38 multivessel disease patients underwent treatment with HCR. The medical records of these 38 patients were analyzed retrospectively. They included 29 males and 9 females. The mean values of the EuroSCORE and left ventricular ejection fraction were 3.71%±2.73% and 58.50%±8.88%, respectively. The demographic data are summarized in . HCR was defined as LITA-to-LAD grafting and PCI to a non-LAD lesion during the same hospitalization period. We included patients with high risk for PCI of LAD lesions because of diffuse stenosis or severe calcification. PCI was possible in lesions other than LAD. LIFCAB involved off-pump CABG surgery through a full sternotomy and small skin incision (range, 5 to 7 cm) (). A long sternal blade was used for performing full sternotomy under the small incision (). A Swan-Ganz catheter was inserted via the right internal jugular vein, and the cardiac output was monitored continuously. In the supine position, a midline incision was made from the point of 1 to 1.5 cm above the internipple line to about 6 cm lower, around the xyphoid process. The subcutaneous tissue was softly separated from the muscle layer with electrocautery until the sternal notch, thus making it easier to perform a full sternotomy. The sternal notch was dissected easily with a right-angled clamp without the fear of bleeding. After the entire sternum was exposed, sternotomy was performed as the second step. First, after marking the median line of the sternum with electrocautery, usual sternotomy was performed from the xyphoid process to the upper end of the skin incision. A small separation of the sternum was retracted with an Army-Navy retractor, and upper sternotomy was performed with an oscillating saw (). The fibrous band in the sternal notch was incised for achieving full separation of the sternum. A full pericardiotomy was performed to evaluate the gross state of the heart. With the help of an ordinary retractor, the LITA was harvested as pedicled graft by using a harmonic scalpel, and in some cases, the proximal LITA was harvested using a 5-mm thoracoscope. After harvesting the LITA, off-pump coronary artery bypass grafting to the LAD was performed in the usual manner. A small (24Fr) chest tube and a hemovac drain were sufficient for the postoperative drainage. Five or six sternal wires (one or two on the manubrium) were placed for stabilizing the sternum. The subcutaneous tissue was fixed to the pectoralis muscle with one or two interrupted sutures, while not allowing for the stagnation of tissue fluid or blood, which could lead to tissue swelling. The wound was closed considering cosmesis (). PCI was performed before the operation for 34 patients and after the operation for 4 patients. The patency of the revascularization procedure was confirmed with postoperative coronary angio-computerized tomography (CT) or coronary angiography before discharge. The short-term outcomes with respect to patency were determined in the outpatient department at 6 or 12 months after HCR or when new onset symptoms developed. In addition, occurrences of mortality and perioperative morbidities were surveyed. All data were collected retrospectively, and this study was approved by the institutional review bard of Seoul St. Mary's Hospital. All cases except one were performed electively. In one emergency case, PCI was performed on the right coronary artery before the operation due to acute myocardial infarction. In all cases, HCR was completed without major complications or mortality, but there were two superficial wound infections and one case of wound dehiscence. The target vessels for PCI are listed in . The mean number of DESs used for PCI was 1.34±0.71, and the diameter and the length of the lesion were 3.08±0.65 mm and 21.66±8.13 mm, respectively. The conversion to CABG using CPB was unnecessary. The mean operation time was 135.66±33.44 minutes. Antiplatelet agents aspirin (100 mg) and clopidogrel (75 mg) were continued before the operation for patients who underwent PCI first. The medication was stopped only on the operative day and was restarted immediately after extubation. Most patients could be weaned from mechanical ventilation within 6 hours postoperatively. There were no mortalities or complications such as bleeding, arrhythmia, acute kidney injury, and mediastinitis, but there were occurrences of superficial wound infection and dehiscence (). All patients were successfully followed up for 18.3±10.3 months (range, 1 to 37 months) after HCR. All of the LITAs were patent in the follow-up coronary angio-CT or angiography. However, for three patients who suffered from newly developed chest pain during the follow-up, one in the left circumflex artery and two in the right coronary artery, restenosis was confirmed within a year. These patients were retreated with PCI as soon as possible (). In patients with multivessel disease, conventional CABG was one of the standard treatments []. The 5-year patency rates of the LITA-LAD were between 92% and 99%, and the 10-year patency rates were between 95% and 98% [,,]. The recent PREVENT IV (project of ex-vivo vein graft engineering via transfection IV) and PRAGUE-4 (primary angioplasty in patients transferred from general community hospitals to specialized PTCA units with or without emergency thrombolysis-4) trials reported vein graft patency rates of 50% to 75% after 1 year [,,]. Despite the improvement in various aspects of conventional CABG, it carries the risk of peri- and postoperative complications and mortality concerning cannulation and CPB [,,]. Elderly patients with comorbidities were at greater risk, so HCR was introduced as an alternative treatment. Angelini et al. [] reported the first HCR of 6 cases of MIDCAB to LITA-LAD combined with PCI to non-LAD vessels. Many centers now perform HCR for multivessel disease, and the American College of Cardiology Foundation and the American Heart Association have recommended HCR for selected patients on level of evidence B for limitation to traditional CABG, lack of suitable graft conduits, or unfavorable LAD artery for PCI []. MIDCAB offers the advantage of not needing a greater amount of anticoagulant than conventional CABG with CPB [], but the surgeon has to work within limited fields, and it is difficult to convert MIDCAB to conventional CABG when the patient is hemodynamically unstable []. In a previous study, the conversion rate to sternotomy was approximately 2% in MIDCAB []. In contrast, the conversion to conventional CABG in LIFCAB is easier than in MIDCAB through just extending a wound. In fact, one case of LIFCAB converted to on-pump beating CABG, but we simply extended the skin incision and then performed the procedure without any problems. Because the operative field of LIFCAB is similar to that of conventional CABG, the learning curve for beginners is shorter and they can properly perform a classical view for the anastomosis. In addition, mobilizing the LITA is convenient in LIFCAB, so the time required for harvesting the LITA is reduced. We have performed HCR using LIFCAB since 2010. Our short-term mortality and morbidity outcomes have been satisfactory. The patency of the LITA-to-LAD anastomosis was confirmed, and our results did not differ from those of MIDCAB, which are reported to be 93% to 100% []. We performed this operation with a 7-cm skin incision in the first few cases and were able to gradually reduce the length of the skin incision with experience. We now operate with a 5- to 6-cm skin incision without difficulty. Sternotomy is associated with a greater risk of bleeding and mediastinitis than thoracotomy, but in this study, complications such as bleeding or mediastinitis did not occur. The operation time was not too long, and all patients could be weaned from mechanical ventilation within 6 hours postoperatively. Despite sternotomy, we believe that LIFAB is a minimally invasive surgery procedure and is suitable for HCR. Due to the small size of our sample, we cannot compare the results with those of conventional CABG. In this paper, we reported the short-term results of HCR using LIFCAB. In future, we intend to report long-term results and conduct a study comparing it with conventional CABG for multivessel disease. In conclusion, HCR using LIFCAB is a safe and feasible new technique.

In 1961, Jarvi and Saxen [] first described an uncommon, non-encapsulated, benign tumor in the subscapular region characterized by the proliferation of elastin fibers in a stroma of collagen and fatty connective tissue. Elastofibroma dorsi (ED) is a relatively rare soft-tissue pseudo-tumor localized in the infra- or periscapular area (under the rhomboid and serratus anterior muscles). It usually occurs between the fourth and the seventh decade of life and is more common in females [,]. Further, it is a degenerative pseudo-tumor with the clinical appearance of a malignant tumor because clinically, the lesion is firmly attached to the rib cage. Recognition of the lesion is important because the differential diagnosis includes malignant tumors. Less common elastofibroma sites include the olecranon, orbits, greater trochanter, deltoid muscle, foot, inguinal region, tricuspid valve, stomach, greater omentum, axilla, and the intraspinal space []. In this study, we retrospectively describe a series of 76 patients with ED and discuss its clinical and radiological findings as well as its pathologic and therapeutic features. In addition, we present an algorithm to diagnose and treat this lesion while avoiding the use of unnecessary medical, radiological, or surgical interventions to establish the diagnosis. Our retrospective study was from January 2008 to December 2012. We admitted 79 patients with a subscapular mass, and only 76 patients had ED (54 females and 22 males). The mean age was 49 years (range, 38 to 70 years). Among the others, 2 patients had a high associated risk of anesthesia and were managed with a medical treatment, and 1 patient had a subscapular sclerotic hemangioma. We proceeded with the diagnostic and treatment protocols that we usually follow for patients with thoracic tumors: clinical history, physical examination with special attention to clinical signs of the tumor, chest X-ray, ultrasound (US) of soft tissue, and computed tomography (CT) () of the thorax or magnetic resonance imaging (MRI) (). We did not use preoperative histological evaluation, and we suggest biopsy only when the mass has enlarged rapidly within a few months or presents atypical features. All patients were operated on under general anesthesia in a lateral decubitus position, thus enabling free movement of the affected arm. The lesion was totally excised via a posterior thoracotomy. All patients were followed-up once in a month for at least six months, and at intervals of 3 months subsequently. Repetitive professional microtrauma was found in 19 cases (25%), and only 1 patient had a history of recent chest trauma. The dominant clinical symptoms noted in the physical exam were pain in movement and the mass. ED was bilateral in 20 cases (26%). The results are summarized in . Surgical treatment was performed if the lesion was symptomatic. In the case of bilateral lesions, we begin from the most painful, function-limiting side or from the biggest lesion's side. In surgery, the lesion was evident underneath the latissimus dorsi muscle, adhering tenaciously to the deeper planes, but cleavable from the overlying muscle plane. Macroscopically, it was un-capsulated and relatively ill defined compared with its surroundings, rubbery, and contained grayish white fibrous tissue with small interposing areas of adipose tissue. In 5 cases (6.5%), partial detachment of the rhomboids was obligatory for enabling resection. The clinical diameter () of the mass ranged from 6 to 18 cm in the greatest dimension. The real diameters of the excised lesions were 10 to 22 cm. Synchronic bilateral resection was not performed in any case. We performed sequential surgery to allow free activity of the non-operated shoulder. A majority of patients (85.5%, n=65) were discharged with the removal of a drain on the third day following surgery. Eleven patients underwent anticoagulant therapy; therefore, we maintained the drain for 5 days after surgery to prevent postoperative seroma of the wound site. Postoperative seroma requiring needle aspiration developed in 8 patients, infections of the wound site developed in 4 patients, and 1 patient had textiloma. In fact, the textiloma was not postoperative but occurred during the management of an infected wound site. No patient had residual symptoms or local recurrence. The histological study conducted with standard staining (hematoxylin-eosin) revealed the presence of islets of fatty tissue and a scantly cellular component (fibroblasts and myofibroblasts) associated with intensely eosinophilic bands composed of collagen and elastic fibers that define this type of lesion (). Elastic stains (Weigert) showed that the large branched or unbranched fibers had a dense core and irregular serrated margins. Although the elastin-like material was removed by prior treatment of the sections with pancreatic elastase, it was more resistant to digestion than the control skin (). In one case where the patient had recently suffered chest trauma, the pathologic diagnosis showed a tumor with various amounts of hemangiomatous components and focal hemorrhagic areas suggestive of a sclerotic hemangioma. The literature on ED consists mostly of isolated case reports and small series, furthering the misconception that ED is a rare condition. The etiology of ED remains to be fully understood, but most researchers believe that ED results from reactive hyperproliferation of fibroblastic tissue rather than a degenerative process, while others have suggested that it may be a consequence of collagen degeneration due to repeated mechanical friction between the chest wall and the scapular tip []. However, a lack of association between trauma and tumor growth has been reported by several authors [,]. Based on the discovery of 'pre-elastofibroma changes' in their autopsy series, Giebel et al. [] speculated that ED might be the result of a physiologic aging process secondary to vascular insufficiency as opposed to abnormal elastogenesis or degeneration. The few published cases of multiple familial occurrences supported the possibility of a genetic enzymatic defect, as proposed by Fukuda et al. [], Nagamine et al. [], and Enjoji et al. []. Recently, cytogenetic analyses of elastofibroma have revealed significant chromosomal instability manifested as both clonal and nonclonal structural alterations []. In asymptomatic patients, the estimated prevalence of ED is 2% []. In an autopsy series, individuals over the age of 50 presented a prevalence of subclinical ED, reaching 24% in women and 11% in men []. Although the prevalence of bilaterality reached (7%) in the autopsy series [,], ED is unilateral in most cases, and bilateral occurrence is very rare; we found very few cases reports on the latter in the English and French literature. ED is usually asymptomatic and is incidentally discovered by patients with the development of a mass in the subscapular region. The symptoms are often mild and include pain, snapping, clicking, or scapular clunking with movement. Occasionally, clinical signs can vary, and ED can be misdiagnosed as a rotator cuff tear or subacromial bursitis. Radiographs are usually normal and may show elevation of the scapula and a soft-tissue mass without calcification in the subscapular region. Therefore, imaging-based diagnosis is usually commenced with US, and a sub- or periscapular, inhomogeneous, fasciculated pattern is most frequently seen in addition to the highly characteristic location of the lesion []. On CT (), ED is a poorly circumscribed mass, isodense with the surrounding musculature, and with characteristic hypodense striations suggestive of dense fat. Bone erosion and invasion are rare, having been reported in only one case of an intra-articular elastofibroma []. MRI (), which is considered the main imaging technique for its diagnosis, clearly shows a heterogeneous ill-defined lesion with an alternating pattern of fibrous tissue and fatty tissue []. On T1-weighted MRI, EDs are isointense with the muscle tissue, which explains why these tumors are often overlooked. Both T1- and T2-weighted images show alternating linear and curvilinear, hyperintense areas representing fat []. Lastly, in positron emission tomography-CT images, ED is seen as a non-encapsulated mass with low-grade, diffuse 18F fluorodeoxyglucose uptake []. In our opinion, incomplete radiological investigations (US, CT, and MRI) can succeed in clarifying the nature of the lesion because the differential diagnosis is with other soft tissue neoplasms (sarcoma, metastases, fibromatosis, and so on). Our diagnostic strategy is always based on US and less frequently on CT. According to some authors, only CT and MRI can rule out malignancy. In contrast, several authors have reported that US is a useful diagnostic adjunct for this lesion []. Preoperative biopsy is not our standard practice. We believe that biopsy is necessary only when the mass has enlarged rapidly within a few months or the clinical or radiological signs are atypical. The treatment of ED remains controversial. Excision may be offered to symptomatic patients, with curative marginal resection proving to be sufficient and preferred over radical resection; conservative treatment is recommended in elderly, asymptomatic patients because malignant transformation has not been reported []. In general, surgery is suggested depending on the severity of symptoms and patient preference. Our own approach is simple: In the case of a single asymptomatic mass at the typical location, clinical follow-up is sufficient. However, if the mass is symptomatic, marginal excision is prescribed. Therefore, we insist that resection be R0 (negative macroscopic and microscopic margins) to enable free follow-up of the disease. Furthermore, the few reported recurrences in the literature resulted from incomplete excision []. Postoperative complications such as seroma or hematoma were reported []. The use of postoperative tube drainage and compressing bandage reduces the incidence of these complications. Considering that the patients are usually of an advanced age, to avoid immobilization with the risk of residual stiffness in the shoulder girdle, we proceeded with the punctuation of the seroma. The size of the lesion at presentation was usually inferior to the real diameter obtained by surgery (clinical/surgical diameters=0.53) (), and we ascribe this difference to the involvement of the lesion between the scapula and the chest wall. A few anecdotal reports mentioned good results with radiotherapy as well []. Histologically, fibrous collagenous strands with eosinophilic, plump, elongated elastic fibers are seen. The lesion is hypocellular, and it contains entrapped islands of adipose tissue with benign fibrocytic and fibroblastic cells without atypia or mitotic activity [,]. The differential diagnosis of subscapular ED includes tumors with dominant fibrous composition signal in low MRI (fibroma, desmoid tumor, neurofibroma, and malignant tumors) because the mass is uncapsulated and poorly circumscribed, tumors with fatty tissue (lipoma, liposarcoma, and differentiated hemangioma), or collections containing hemoglobin degradation products (subacute hematoma and tumors with necrosis) []. In conclusion, ED is not a rare condition, but a benign lesion of the sub- and periscapular area. Its clinical and radiological diagnosis based on the typical location and very suggestive preoperative biopsy. Surgery, if indicacharacteristics allowed a majority of the authors to abandon ted, yielded good results. We propose our diagnostic strategy in the form of the algorithm in .

Implanted venous access devices or permanent central venous access systems (PCVASs) have been routinely used in oncologic patients since the 1980s []. They are made of a central venous catheter connected to a chamber or reservoir surgically implanted in a subcutaneous pocket []. The most common insertion sites are the internal jugular, subclavian veins, and, more rarely, the cephalic veins, external jugular, and brachial and femoral veins []. These implantable chambers ensure the possibility of direct, repetitive central venous access with a lower risk of infection [] by sparing the patients' venous integrity, which can be compromised by drug toxicity []. Additionally, parenteral nutrition, blood transfusion, and blood sampling can be performed via PCVAS []. A few authors have reported the benefit of PCVAS use in refractory ascites and pleural effusions for avoiding morbidity and patients' anxiety related to repeated puncture and aspiration []. Nevertheless, the presence of an intravascular catheter could lead to 4 major complications: infection, thrombosis, catheter rupture, and extravasations of fluid around the reservoir []. Although rare, these complications could be severe and life threatening. We aim to report retrospectively the prevalence and management of perioperative incidents and complications associated with PCVAS. Our retrospective study comprised 1,460 cases with PCVAS implanted between January 2002 and February 2013, including 810 women and 650 men with an average age of 45.2 years. Radiopaque polyurethane catheters were the most commonly used, whereas silicone catheters were used less frequently. These catheters had an internal diameter of 1 mm and a reservoir capacity of 0.3 or 0.5 mL. The chambers were made of metallic (titanium) or plastic material. The insertion site was selected on the basis of clinical data. In patients with lung cancer, we used the same side to perform a vessel puncture, while the opposite side was preferred in cases of breast cancer. The cephalic and subclavian veins were our most common insertion sites. We used a direct approach toward the cephalic vein if the patient presented with subclavian lymph nodes or hematological diseases, or had undergone a pneumonectomy previously. This approach could prevent arterial puncture in the case of hematological disease with a probable coagulation disorder, was easier than performing percutaneous puncture in the case of subclavian lymph nodes, and protected the pneumonectomy cavity from septic puncture. In this report, we call any perioperative problem an 'incident' and any medium- or long-term problem a 'complication.' The procedures were direct surgery of the cephalic or the jugular vein in 452 cases and percutaneous subclavian or jugular vein puncture in 1,008 cases. All patients underwent radioscopic control on the operating table or a chest X-ray after surgery. Perioperative incidents () included a technical difficulty in 64 cases, subcutaneous hematoma in 37 cases, pneumothoraces in 15 cases, and accidental intrapleural catheter placement in 1 case (). We considered the case of intrapleural catheter as an accidental displacement because the catheter was not located inside a vessel but was free in the pleural space. Short- and medium-term complications developed in 14.2% of the cases (). Subclavian vein thrombosis was not observed in our patients, either uniquely or in association with another complication. Catheter distortion and rupture was noted in the costoclavicular area (pinch-off syndrome) (n=5) (). The 5 noted cases of catheter migration were into the jugular vein (n=1), superior vena cava (n=1), and heart chambers (n=3) (). The treatment of these complications consisted of PCVAS removal in the cases of catheter infection, sepsis, occlusion, disconnection, or associated vein thrombosis. Skin necrosis () was repaired surgically if possible or if not infected. Migrated catheter extraction was performed by venous catheterization or via catheterization of the femoral artery in the case of migration into the cardiac chambers. In 13 cases, device occlusion was successfully treated without PCVAS removal by tunneling the catheter and injecting heparin into the reservoir. None of the patients included in our study died of a complication arising from PCVAS insertion. We observed no complications related to inadvertent arterial puncture during percutaneous PCVAS insertion. The mean operation time was 34.7 minutes (median, 30; range, 19 to 92 minutes). The cephalic vein () was not detected in 10 cases, and the cephalic vein was too narrow to insert the catheter in 5 cases. About 1,100 cases (75%) underwent surgery by in-training surgeons, and 360 patients were operated on by expert surgeons. Perioperative incidents occurred in 33% and 12%, respectively, of the patients in these groups. The use of ultrasound for locating and puncturing a vein involves delicate operator coordination between the hand holding the needle and syringe, the hand holding the probe over the vein, and the eyes watching the image on the screen of a portable ultrasound machine. These skills are naturally developed over time. We used ultrasound in just 52 cases (3.5%). We consider direct venous aboard to be indicated after three missed punctures. PCVASs are now routinely used for facilitating the care of chronically ill patients. A PCVAS contains a chamber covered by a silicone membrane and with a lateral opening to which a catheter tube is connected. The catheter tube is tunneled subcutaneously or by using the open venous cut-down technique, usually under local anesthesia. Vein dissection and pouch creation for the portal can be performed through the same 4-cm-long incision, and the catheter is introduced by way of the subclavian or jugular vein to a position just above the right atrium. The port can be used directly after implantation. Port punctures must be performed with a strictly aseptic technique []. Depending on the particular model, ports can be punctured 1,000 to 8,000 times []. When palpated, the port membrane can be punctured easily. The port membrane and the skin should be punctured at a site different from that of the last puncture []. Redness, swelling, or discharge at the implantation site should be noted before any puncture. Technical difficulties include difficult venous puncture. A few risk factors are known to be associated, such as obesity, female gender, previous local surgery or radiotherapy, and lack of operator training. A few intraoperative complications are slightly related to the chosen procedure. Pneumothorax is more frequently associated with subclavian rather than jugular vein puncture []. The direct vein cut-down ensures a safe procedure because it preserves the pleural space. The intrapleural catheter placement was accidental. Therefore, we insist that PCVAS surgery should be performed by experienced personnel or under supervision at training hospitals. Subcutaneous hematoma or bleeding complications must be anticipated. Management of antiplatelet agents and anticoagulants should be subject to the same rules as any other surgery, particularly in patients with hematological diseases or in the case of probable arterial puncture. Intraoperative heart rhythm disorder principally induced by the presence of the catheter in the cardiac cavities is a classical sign for confirming that the catheter is in the right direction before radiological control. The catheter length should be reduced just above the right atrium. PCVAS infection is a relatively common complication (frequency of up to 6.5%) []. In our series, infection or PCVAS-related sepsis was almost 7.8%. Gram-negative bacilli and gram-positive cocci were the most commonly isolated microorganisms (60% and 31%, respectively). A meta-analysis of 14 prospective studies reported a 3.6% prevalence of infection in hemato-oncological patients and an incidence density of 0.1/1,000 catheter-days []. The main risk factors are neutropenia, parenteral nutrition, young age, difficulties during insertion, and poor general status. Recent guidelines have defined intravascular catheter-related infections []. A strict clinical and microbiological work-up, including simultaneous culture of blood drawn from the catheter and a peripheral vein, should be performed. More recently, an observational study showed an association between the frequency of complications and the time of first use: 10.6%, 6.7%, and 2%, respectively, when the PCVAS was used within 3 days, between 4 and 7 days, and 7 days after the placement []. We allowed device use 24 hours after its implantation. Device removal was mandatory when an infection was documented. The use of prophylactic antibiotics is controversial. A few investigators use them, but many do not. We chose to not use them initially and have stuck to our original choice. We insist on prevention by the strict aseptic handling of the PCVAS. Only special needles with a 'Huber tip' should be used for puncturing the device: conventional needles punch holes in the membrane, and once the needle is removed, the port is unusable because the membrane is no longer reliably sealed. Venous thrombosis has been described as an early complication of PCVAS []. The literature contains only a few reports of the complete thrombosis of the superior vena cava and the development of a superior vena cava syndrome []. In our study, the occurrence of venous thrombosis is 1.5%, and the majority of the occurrences were recorded in the second month after implantation. In the literature, it is higher and ranges from 6% to 61% due to different clinical and radiologic diagnostic criteria. We performed Doppler ultrasonography only in the presence of clinical phlebitis symptoms and differentiated central venous catheter thrombosis (1.9% in our series) from venous thrombosis. Doppler ultrasonography has low sensitivity in the diagnosis of PCVAS, particularly in the detection of subclavian vein thrombosis []. However, in our study, no case of subclavian thrombosis was detected. A recent study recommended the combination of venography and echography for the diagnosis of asymptomatic thrombosis []. In the literature, several risk factors have been studied, such as large bulky cervical or mediastinal tumors. Silicone and polyurethane catheters are less thrombogenic than polyvinylchloride and polyethylene catheters []. Catheter heparinization was not proven to prevent thrombosis []. There is no consensus concerning therapy for the vein thrombosis of PCVAS. The catheter tip must be placed at the level or under T4 using radioscopic guidance. Luciani et al. [] have demonstrated an association between the positioning of the distal catheter tip and thrombotic complications. There is no study on the role of the insertion method (percutaneously versus direct surgery) and the choice of vein (jugular or subclavian). The patient's age, primary tumor type, and chemotherapy were not considered specific risk factors []. Systematic prophylactic treatment with low-molecular-weight heparin did not show any benefit in the treated patients []. We typically heparinize the catheter after any perfusion to prevent fibrin adhesion to the catheter wall and distal end occlusion. The pinch-off syndrome (POS) has been reported as a PCVAS complication. This syndrome is caused by the compression of the catheter by the clavicle and the first rib [], which leads to catheter obstruction and fracture. The cut-down technique seems to have a lower association with the pinch-off syndrome in a number of studies [,]. In our study, 2 of the 5 cases with POS were asymptomatic and incidentally discovered. The other cases were diagnosed with luminal narrowing or complete catheter fracture on a chest radiograph. In our opinion, the use of the subclavian route and polyurethane catheters seems to have a greater association with this complication. POS treatment involves careful catheter removal. If the catheter tip is embolized, it can usually be retrieved percutaneously with a transvenous snare. POS can be prevented by using the internal jugular vein for access rather than the subclavian vein. This complication can be ascribed to forceful injections or to intrathoracic pressure changes generated by coughing or intrathoracic disorders []. Catheter migration was secondary to the total rupture of the catheter, which warrants percutaneous retrieval. Transvenous retrieval was successful in 4 cases. In the fifth case of catheter migration, there was a high risk of surgery, therefore the catheter was retained in place and the patient died six months later by an advanced lymphoma. In summary, PCVAS provides a safe and inexpensive means of venous access and patient comfort. The exclusion criteria for PCVAS installation are infected areas, major coagulation disorders, skin metastasis, previously irradiated areas, and thrombosis of the superior vena cava or the subclavian vein. Appropriate handling is of crucial importance so that complications such as port thrombosis and infections can be avoided. Clinicians should carefully watch for the evidence of central venous line dysfunction that usually accompanies these complications.

xref #text Sixty-seven patients underwent pleural biopsies over an 18-month period. The criterion for patient inclusion was that their pleural effusion remained undiagnosed after thoracentesis. Patients were randomized into two groups. Group A contained 36 patients with hydrothorax who underwent closed pleural biopsies. Group B contained 31 patients with hydrothorax who underwent pleural biopsies via needle thoracoscopy under local anesthesia. A pre-procedural workup included chest radiography, chest computed tomography (CT), thoracentesis for pleural fluid analysis, a bacteriological study, and cytological evaluation (). In group A patients, closed pleural biopsies were performed aseptically using Abrams biopsy needles after administering local anesthesia (via infiltration of 5 to 10 mL of 1% [w/v] lidocaine) at the bedside. Oxygen was provided continuously via a facial mask, and pulse oximetry, electrocardiogram (ECG), and blood pressure monitoring were conducted throughout the procedure. A pleural biopsy was considered adequate if at least three specimens containing pleural tissue were obtained. Chest radiography was performed immediately after each procedure for identifying any iatrogenic pneumothorax. Group B patients were subjected to video-assisted thoracoscopic pleural biopsy in a fully equipped operating room, under local anesthesia, and by using a thoracoscope and biopsy forceps, each having a diameter of 2 mm (Auto Suture, Norwalk, CT, USA), introduced via a trocar of the same diameter (Miniport; Auto Suture). Oxygen was provided continuously via a facial mask, and pulse oximetry, ECG, and blood pressure monitoring were conducted throughout the procedure. The procedure was usually performed with the patient in the lateral decubitus position, but the supine or semi-lateral decubitus positions were occasionally employed. Local anesthesia was administered via the infiltration of 1% (w/v) lidocaine (range, 10 to 15 mL) at the site of the thoracoscopic port's placement. The entry point was selected according to the location of the fluid and the biopsy site. A small skin incision was usually made along the anterior-to-mid-axillary line between the fourth and the seventh intercostal space. The 2-mm-diameter port was inserted through this incision, and the pleural fluid was aspirated. The needle thoracoscope was introduced through the same port. If the lung was over-inflated, CO was infused through a port having a diameter of 2 mm. A second skin incision was made, and a 2-mm-diameter port was inserted in it for carrying the small biopsy forceps. Biopsy was rather easy to perform because we could directly visualize the parietal and visceral pleura (). After biopsy, hemostasis was established, and a chest drain was placed through the 2-mm port. SPSS ver. 17.0 (SPSS Inc., Chicago, IL, USA) was used for the statistical analysis. The independent samples t-test was employed to evaluate the significance of inter-group differences among continuous variables, all of which were expressed as mean±standard deviation. The chi-square test was used to evaluate the significance of differences in the non-continuous variables. A p-value<0.05 was considered to reflect statistical significance. #text Adequate treatment of patients with pleural effusion not diagnosed via prior thoracentesis requires the use of a tool that yields accurate diagnosis. Usually, to this end, a blind closed pleural biopsy is performed. However, this technique is associated with a low and variable diagnostic yield (range, 29% to 70%) [,,]. Prakash et al. reported that closed pleural biopsy failed to yield adequate tissue samples from 13.3% of the patients, thus explaining the low diagnostic yield in our group A patients []. Although the technique is simple and easy to perform, the associated low diagnostic yield is problematic. Thus, the technique is being gradually superseded by imaging modalities, including video-assisted and medical thoracoscopy, ultrasound, and CT guidance [,]. Thoracoscopic or image-guided pleural biopsy is superior to blind pleural biopsy when used for exploring patients with suspected malignant pleural effusion, and closed pleural biopsy is diminishing in popularity [,,]. However, this technique continues to be used when other facilities are not available. Furthermore, closed pleural biopsy is simple, can be performed even by inexperienced clinicians, and costs less than thoracoscopy [,]. The diagnostic accuracy of VATS, a procedure for diagnosing pleural effusion, approaches 100%. This is true even when prior thoracentesis and closed pleural biopsy have failed in diagnostic terms [,,,,,,]. Although conventional thoracoscopy conducted using a 5- to 10-mm-diameter instrument under general anesthesia affords high diagnostic accuracy, the patient must assume the risks associated with general anesthesia and a high medical cost. Thus, we hypothesized that needle thoracoscopic pleural biopsy performed under local anesthesia would be valuable. Conventional thoracoscopy performed under local anesthesia is poorly accepted by patients because of the pain and discomfort caused by the passage of relatively large instruments through narrow intercostal spaces. However, needle thoracoscopy is not associated with such problems. In addition, the latter technique affords increased angular movement, reduction in the torque applied to narrow intercostal spaces upon tube insertion into the pleural cavity, and better cosmetic effect (small incision). It is vital to minimize patient discomfort when thoracoscopy is performed under local anesthesia. If a patient tolerates pain poorly or a relatively large specimen is required, 1% [w/v] lidocaine may be injected locally into the parietal pleura of the biopsy site using a spinal needle. Then, an adequate biopsy sample can be obtained easily. The diameter of the visualizing instrument is critical in terms of the image quality obtained during surgery. In general, instruments having smaller diameters are considered inferior. Janssen et al. [] reported that a 7-mm-diameter thoracoscopy set afforded image quality superior to that of 3.5- and 2.0-mm-diameter sets. However, the histopathological diagnostic yield was maximal when 3.5- and 5-mm-diameter biopsy forceps were used and suboptimal when 2-mm-diameter forceps were employed. When using a modern instrument, we did not experience any problem with image quality and achieved a high diagnostic yield (93.5%) with video-assisted thoracoscopy performed using a 2-mm-diameter biopsy forceps. Recently, it has become clear that more invasive and sophisticated investigation of pleural effusions is required because the etiology of such effusions remains unknown in 20% to 40% of the cases []. In such situations, performing needle thoracoscopic pleural biopsy under local anesthesia yields valuable information. Furthermore, the procedure is simple and safe, and exhibits high diagnostic accuracy. Thus, useful data are delivered to both the patient and the referring physician. However, a number of patients continue to be vaguely diagnosed with 'idiopathic pleural effusion' even after complete workup, and several studies have found that 5% to 15% of such patients develop malignant effusions on long-term follow-up [,,]. Physicians must be aware of this and exercise great caution when following up with such patients. In conclusion, the use of needle thoracoscopy under local anesthesia for obtaining pleural biopsy samples is simple and safe, and exhibits high diagnostic accuracy without the risks and high costs associated with the use of general anesthesia. This technique is a valuable diagnostic tool when a patient with a pleural effusion has not been adequately diagnosed via thoracentesis.

Two patients were referred for an operation. They were diagnosed with an interrupted aortic arch (IAA) with ventricular septal defect (VSD) by echocardiography. Computed tomography (CT) was reviewed for further evaluation and operational planning. Prostaglandin therapy was applied, but mechanical ventilation was not required. The two patients underwent one-stage repair on days 10 and 18. One weighed 2.82 kg and was diagnosed with type A IAA with VSD. The distance between the ascending and the descending aortic segments was 17 mm. The other one weighted 2.88 kg and was diagnosed with type B IAA with VSD. The distance between the ascending and the descending aortic segments was 21 mm. Subaortic narrowing was seen in both patients owing to mild posterior malalignment of the conal septum. Both underwent nonemergency repair using cardiopulmonary bypass (CPB) under moderate hypothermia (26℃) with selective cerebral perfusion of the innominate artery using a 3.5-mm Gore-tex vascular graft shunt. This shunt, with SVC and IVC cannulation, was used as a single aortic cannula for CPB. The flow rate was 100 to 150 mL/kg/min to maintain the right radial artery pressure of 45 to 70 mmHg and diminished to 55% to 60% during selective cerebral perfusion, which was monitored using near-infrared spectroscopy. The hematocrit level was maintained above 24%, and the alpha-stat method was used for blood gas management. A patch was harvested from the anterior wall of the main pulmonary artery (MPA) after the complete resection of the ductus arteriosus. The descending aorta was mobilized for the second and the third pairs of intercostal arteries, and both pulmonary arteries were dissected to each hilar area. An incision was made at the lesser curvature of the aortic arch to the lateral aspect of the arch vessel and augmented with the harvested MPA patch by a continuous 7-0 polypropylene suture. The descending aorta was then anastomosed to the augmented aortic arch in an end-to-side manner after making an incision at the pulmonary artery patch (). For completing the aortic arch reconstruction, a Dacron patch was used for VSD closure through an incision of the right ventricle. To prevent the left ventricle outflow tract obstruction (LVOTO), we positioned the stitches with respect to the apical portion of the VSD patch on the left side of the conal septum []. The MPA was reconstructed with glutaraldehyde-fixed autologous pericardium with smooth CPB weaning. Each cardiopulmonary bypass time was 196 and 159 minutes, the cross-clamp time was 103 and 100 minutes, and the selective cerebral perfusion time was 29 and 38 minutes, respectively. The lactate level was less than 4.5 mmol/L during CPB support with no end organ damage, including acute renal failure. Peritoneal dialysis was not required since the urination was more than 1 mL/kg/hr after adequate lower body perfusion. Delayed sternal closure was performed on postoperative days 1 and 3. Extubation was possible 3 to 4 days after sternal closure, and the patient was discharged after general care. Follow-up CT and echocardiography results were reviewed before discharge (, ). Both patients did not show left main bronchus obstruction and LVOTO. Surgical outcomes in the repair of IAA have been improved by perioperative management and accumulated surgical experience []. However, interventions and additional surgical procedures are still required frequently to resolve the complications, including bronchial compression, anastomosis site stenosis, subaortic stenosis, and Gothic arch configuration [,]. Mobilization of the descending aorta allows direct anastomosis to the ascending aorta in most cases; however, tension at the anastomosis site can cause complications, particularly when anastomosis between the ascending and the descending aorta requires a long distance []. Bronchial compression, an unusual complication caused by the excessive tension between the two aortic components, is a risk factor for atelectasis, pneumonia, and prolonged mechanical ventilation. To resolve the compressed bronchus, aortopexy is considered after the primary operation [,]. Restenosis of the anastomosis site is also caused by the tension between the two aortic components after the surgical repair of IAA. Balloon angioplasty is a method of choice; however, surgical correction may be required since long-term data are still minimal and not free from complications []. Recent studies show that 'Gothic'-shaped aortic arch geometry is an independent contributor to both resting and exercise-induced hypertension []. Further, long-term follow up studies have shown that the high pressure and turbulence of the angular portion cause inelasticity and increase the intima-media thickness of the aortic wall that leads to aortic aneurysm and aortic dissection []. Since these complications are mostly associated with surgical and anatomic factors, various surgical techniques have been developed to repair IAA without anastomosis site tension and Gothic arch configuration [,,]. A prosthetic tube was introduced with the aim of tension-free anastomosis; however, it was abandoned as an alternative since reoperation was inevitable owing to restenosis. A Neville tube, an autologous tube created by rolling up the pulmonary artery patch, was introduced by Bergoend et al. [] based on the idea of growth potential, which has disadvantages since two suture lines are necessary and increase the risk of anastomotic stenosis. The use of a carotid or subclavian vessel as an autologous conduit has also been presented as an ideal solution; however, it is controversial because of the possibility of neurologic sequelae or growth disturbances []. Aortic arch reconstruction with MPA patch augmentation was introduced by Roussin et al. [], which has benefits in the case of tension-free anastomosis and growth potential. The anastomosis is performed in an end-to-end manner, and full length between the aortic segments is required as the descending thoracic aorta partially attaches directly to the ascending aorta. Our modified technique requires less length than the previous technique because the MPA patch is placed between the aortic components. Therefore, this technique is useful when aortic segments are at full length for anastomosis and when complications are predicted by the tension at the anastomosis site and the configuration of the Gothic arch. In conclusion, this modified technique is expected to reduce the risks of complications in the surgical repair of IAA by preventing the tension between the anastomosis sites with a better arch configuration. However, long-term follow-up with echocardiogram and chest CT is required for arch configurations, aneurysmal change, restenosis, airway compression, and LVOTO. A large number of studies should also be reviewed to support the results.

sup #text Cold agglutinin disease (cold antibody disease) is caused by autoantibodies that react at decreased blood temperature and produce agglutination or hemolysis of red blood cells [,,]. The causes of this situation include infections (especially mycoplasmal pneumonias or infectious mononucleosis), lymphoproliferative disorders, and idiopathic diseases (about half ofcases). Infections tend to cause acute disease, whereas idiopathic disease (the common form in older adults) tends to be chronic []. The most clinically relevant characteristic of cold agglutinins is thermal amplitude, the temperature below which the antibodies become activated (). If the screening for cold agglutinins is positive at 4℃, the thermal amplitude should be determined, and the titer determined for each temperature at which the screen is positive []. When the blood temperature drops below this threshold, cold agglutinins bind to erythrocytes, causing agglutination and binding of complement C1 complex. In turn, C1 esterase activates C4 and C2, generating C3 convertase which binds and splits C3, causing deposition of C3b on the erythrocytes []. Upon subsequent warming, immunoglobulin M is removed from the cell surface, and the agglutinated cells get detached from each other, while C3b remains bound on the cell surface. C3b activates C5, forming the membrane attack complex. This results in intravascular cell lysis. The majority of the C3b-coated erythrocytes are destroyed by reticulo-endothelial cells in the liver by C3b receptor-mediated phagocytosis, which is extravascular [] (). Cold agglutinin disease is of clinical importance for patients undergoing cardiac surgery procedures with hypothermic CPB and cold cardioplegia, or in other instances of therapeutic hypothermia [,,]. Higher cold agglutinin titers and higher thermal amplitude are more clinically significant than low titers and low thermal amplitude. Indeed, several researchers have stated that patients with low-titer, low thermal amplitude antibodies may undergo operation without any change in the routine management plan []. During a cardiac operation, the cardioplegia solution at very low temperature is infused via coronary artery for myocardial protection. Thus, the titers of cold agglutinins at 4℃ are probably the best guide to possible complications during cardiac surgery with cold blood cardioplegia. There are no widely accepted definitions of high and low titers; however, Lee et al. [] suggested that titers less than 1:32 are low, and those greater than 1:128 are high. Holman et al. [] reported a patient who developed intracoronary agglutination of the blood cardioplegia solution during coronary artery bypass surgery. The cold agglutinin had an agglutination titer of 256 at 4℃. During surgery, the heart was arrested using a 4℃ blood cardioplegia solution, and agglutinated blood was found when the coronary artery was incised []. Treatment for patients with cold agglutinins during cardiac surgery using CPB is based on the etiology and severity of the problem. In cases of cold agglutinins caused by acute infection, elective surgery should be postponed for several weeks until the antibody disappears. If the urgency of surgery precludes this approach, the most sensible alternative is to use either normothermia or mild hypothermia using blood temperatures continuously maintained above the thermal amplitude to avoid the active temperature range of agglutination [,]. Hence, the presence of cold agglutinins with a high titer may represent a reasonable indication for the use of warm cardioplegia myocardial protection techniques while maintaining normothermic systemic temperatures. The benefits and risks of 'warm heart surgery' remain controversial and uncertain. However, several studies have suggested that it may be as safe as hypothermic cardiac surgery with regard to concerns such as myocardial preservation and the protection of other organs, such as the brain and the kidneys []. To conclude, we report a patient with incidentally detected cold agglutinins with a relatively high titer who underwent normothermic cardiac surgery with warm blood cardioplegia. Cold agglutinemia in patients requiring cardiac procedures using CPB can cause severe complications due to hemagglutination and hemolysis. In these patients, the use of warm blood cardioplegia combined with normothermic extracorporeal circulation may have a successful outcome without complications of cold agglutinin after cardiac surgery.

A 50-year-old female presented to Pusan National University Hospital with a 1-month history of fatigue, loss of weight, and shortness of breath. She had poor oral hygiene and a low socioeconomic status. Her medical history was unremarkable. On examination, she presented with fever and sweating, along with marked conjunctival pallor. There was a continuous murmur with thrill over the pulmonary area and a diastolic murmur over the aortic area. Chest radiography showed bilateral lower lobe infiltrates and mild cardiomegaly (). On a chest computed tomography (CT), pulmonary edema and multiple cavitary lesions, which were surrounded by ground-glass opacity suspecting septic emboli, were observed (). Splenic infarction was detected on the abdominal CT (). No brain lesion of septic emboli was described in the brain magnetic resonance imaging. Laboratory investigations were remarkable for anemia and leukocytosis. Transthoracic and transesophageal echocardiography revealed severe aortic valve regurgitation, with highly mobile masses on the right and the left coronary cusps, which were irregularly thickened and prolapsed. Continuous shunt flow, from the descending aorta to the pulmonary artery, was noted (). The defect size was 6 mm, and the amount of shunt flow was too small to measure. Pulmonary hypertension was not suspected because the pressure and the morphology of the right ventricle remained normal. Other cardiac valves, including the pulmonary valve, were normal, and no other vegetation was observed on the chambers and the great vessels. Emergency operation was carried out due to highly mobile vegetation and severe aortic regurgitation. The patent ductus arteriosus (PDA) was isolated and identified primarily. Cardiopulmonary bypass (CPB) was commenced with aortic and bicaval cannulation. With external ligation of the duct, the patient was then cooled to a temperature of 28℃, after which the pulmonary artery was opened. Unexpected fresh vegetation was found in the pulmonary artery, at the site opposite to the ductal opening (). Blood flow was still present despite the earlier ligation. With total circulatory arrest, the pulmonary artery opening of the duct was identified. As the tissue of the ductus was infected, and thus, fragile, the ductus was removed completely. A fresh pericardial patch was used to close the opening of the aortic wall. All vegetations on the pulmonary artery were debrided and removed, and the defect of pulmonary artery was repaired directly. The aortic valve was severely destructed with a large number of mobile vegetations. All infected tissue, including the valve, was resected and replaced with a mechanical prosthetic valve (). Bacterial culture revealed Streptococcus mutans. After six weeks of penicillin injection, infection was controlled completely, including that in the lung and the spleen. In the 1-year follow-up, no recurrence was observed. The risk of infective endocarditis (IE), with a small PDA in adults, appears to be extremely low. Nowadays, IE has become treatable with advanced antibiotics. Despite appropriate medical treatment, IE occasionally needs surgical treatment []. However, there is little experience of surgical treatment []. According to the previous reports, open closure with CPB, rather than ligation, was strongly recommended, as a surgical intervention of PDA in adults, due to the risk of severe hemorrhage from the fragile ductal tissue. The risk of hemorrhage is considerably higher when combined with endocarditis, in particular []. In addition, considering pulmonary embolization from the dislodgement of vegetation and the incomplete elimination of infective foci, complete resection of PDA and closure, under direct vision, was strongly suggested []. Infected emboli are common, and the frequently involved site is the pulmonary arterial wall, opposite to the opening of PDA [,,]. To suspect the possibility of embolic vegetation on the pulmonary artery is reasonable, even if vegetation is preoperatively noticed only on the left side valve, as in our case. In conclusion, inspection inside of the pulmonary artery is essential for a complete removal of the infected material and for ensuring the safety of closing the PDA with endocarditis in adult patients.

The patient was a 55-year-old woman with a four-year history of chest pain at rest. The symptom was aggravated at night when she was lying down. She visited a cardiologist and was examined by treadmill testing, but no abnormal findings were noted. The patient subsequently developed orthopnea, for which she was medically treated at a clinic; however, this treatment was not successful. After experiencing sudden left-sided chest pain, she visited an emergency department, at which time she was examined by chest radiography and computed tomography (CT) (). The CT scan indicated the presence of a mass in the left pericardial area. The mass was located between the left superior pulmonary vein and the left atrial appendage with a pericardial tail. Therefore, the patient visited our medical center, where she was examined by magnetic resonance imaging. The size of the mass was approximately 4.4×3.5×4.3 cm with a hemorrhagic formation. The cine image showed a sliding motion between the pulmonary artery and the left atrium. We further examined the patient with two-dimensional echocardiography, which showed a mixture of high and low echogenicity, indicating the presence of a mixed echogenic mass that was 4.5×2.5 cm in size. The left ventricle was not compressed, but the mass caused a mild flow acceleration in the pulmonary artery. We believed that this was the cause of the patient's orthopnea and dyspnea. Intraoperatively, we noted that the mass was located adjacent to the left atrium (). The mass was attached to the left atrial appendage, and the stalk did not have a peduncle. We attempted to perform direct excision under cardiopulmonary bypass, but the heart was very compressed when it was moved laterally in order to achieve a secure operative field. Therefore, we clamped the ascending aorta and administered cardioplegics, and then, resected the mass. Upon macroscopic examination, we noted that the tumor was a pinkish-yellow ovoid soft tissue mass (dimensions: 4.3×4×3 cm) (). Focal necrosis and cystic changes were noted on the cut surface. Following the excision of the mass, a 3-cm defect was noted in the left atrial appendage, which was closed using bovine pericardium. Upon pathological examination, the patient was diagnosed with a schwannoma. Histologically, the tumor had the typical biphasic pattern of a schwannoma with a compact spindle cell area (Antoni A) and a loosely formed hypocellular area (Antoni B) (). Verocay bodies, formed by palisading cells, are occasionally identified in compact Antoni A areas. The loosely formed Antoni B areas generally contain thick-walled hyalinized vessels. Following surgery, the patient was transferred to the intensive care unit (ICU). Her cardiac output was 3.4 L/min, and the cardiac index was 1.8 L/min/m. We initiated the administration of dopamine followed by dobutamine, which resulted in improved cardiac function, with a cardiac output of 5.3 L/min and a cardiac index of 2.7/min/m. The patient was extubated on the day after the surgery. Thereafter, the inotropes were tapered, but her cardiac index decreased. Subsequently, we started epinephrine (0.02 mcg/kg/min) since heart traction in the operating room resulted in the failure of cardiac function to a certain extent. We monitored the patient in the ICU for 4 days. Echocardiography indicated that no remnant mass was present on postoperative day 4. The patient was discharged 9 days after surgery. She regularly visited an outpatient clinic for 1 year. Her follow-up cardiac echocardiography showed normal cardiac function and no remnant mass. Primary schwannoma is believed to originate from the cardiac plexus or the cardiac branch of the vagus nerve [,]. It is located primarily on the right side of the heart, particularly in the right atrium []. Primary cardiac schwannoma is an extremely rare disease; thus far, only 16 cases of this disease have been reported in the literature. Echocardiography is a useful tool for the diagnosis of cardiac masses, particularly transthoracic echocardiography, which is non-invasive and widely available. This modality evaluates the tumor size, shape, attachment, and mobility []. However, magnetic resonance imaging has emerged as a useful tool for a detailed evaluation of cardiac masses. It is non-invasive, has a large field of view, and allows for direct multiplanar imaging []. When surgical resection is considered, the following should be used as a guideline in the operating room, during tumor resection: 1) aim to provide an adequate operation field, while not pulling the heart excessively, 2) aim to perform a complete resection without injury to adjacent structures, and 3) consider reconstruction with bovine pericardium or autologous pericardium for post-resection defects. Pathologic findings are also important, and therefore, obtaining a frozen biopsy specimen may prove useful in the operating room for ensuring a complete resection margin and for avoiding misdiagnosis. Histological features of the schwannoma include the biphasic architecture of Antoni A and B patterns, as well as nuclear palisading (Verocay bodies) and fibrous capsules containing the cells derived from the nerves. The Antoni A pattern contains elongated fascicles in the areas of moderate-to-high cellularity with a small stromal matrix. In the Antoni B pattern, the tumor is less densely cellular with a loose meshwork of cells along with microcysts and myxoid changes []. Immunohistochemical examination is also a useful diagnostic method. The S-100 protein is a specific marker for schwannoma. It is obtained from the neural crest origin tumors from which the melanocytes and Schwann cells are derived []. Thus, we report a rare case of primary cardiac schwannoma.

xref #text Trichinellosis, also known as trichinosis, is a food-borne parasitic infection widely dispersed in various regions all over the world. Further, the disease is endemic in many areas of Asia, Eastern Europe, and Latin America. Humans are exposed to the infection by ingestion of undercooked or raw meat of animals such as pigs, wild boars, and horses contaminated with the larvae []. Reported in 55 countries across the world, human trichinellosis has become an important public health problem. There have also been quite a few outbreaks of trichinellosis in Asia, particularly in China and Thailand. Including the first outbreak in 1997, 34 cases of human trichinellosis were reported in Korea until 2010 []. A parasitic cycle can be divided into two phases: the gastrointestinal (GI; enteral) phase and the muscular (parenteral or systemic) phase, which may coexist for a certain period of time lasting from a few days to weeks. After ingestion of the contaminated meat, the larvae are released in the stomach in the GI phase; these then penetrate the mucosa of the small intestine, where they mature into adult worms 4 to 5 days after infection. After copulation in the intestine, the female worms shed newborn larvae into the lymphatic vessels. In the muscular phase, the larvae released in the GI mucosa migrate to the blood vessels by spreading throughout the body. The penetration and persistent presence of these larvae in the cells of the striated skeletal muscles lead to three major cell modifications: the disappearance of sarcomere myofibrils, the encapsulation of the larvae, and the development of a capillary network around the infected cells []. The length of the incubation period varies from 1 to 4 weeks, depending on the severity of the disease. The incubation period is generally shorter in the case of more severe forms of trichinellosis. In most cases, the predominant symptoms are GI problems such as vomiting, diarrhea, and abdominal pain, as well as fever, periorbital edema, and myalgia. Other complications such as encephalitis, ocular disease, pneumonia, and pleuritis can also be observed in some severe cases. Trichinellosis is a common infective disease, with cardiovascular complications occurring in 10% to 60% of all patients; further, most of the myocardial damage occurs during the invasive infective stage []. The abovementioned cardiovascular complications include myocarditis, thromboembolism, pericarditis, and Takotsubo cardiomyopathy. These cardiovascular problems can occur in moderate-to-severe cases of trichinellosis, usually later in the infection. Among them, myocarditis develops in 5% to 20% of all the infected patients. However, death from trichinellosis is rare. Twenty fatalities out of 10,030 cases were reported in a worldwide survey conducted by the International Commission on Trichinellosis between January 1995 and June 1997 []. At the time of detection, trichinellosis infection and leukocytosis with eosinophilic predominance is usually noticed. Eosinophilia, the earliest and the most common laboratory finding, is present in almost all cases. The serum levels of cardiac enzymes such as creatine kinase or troponin-I usually increase. Electrocardiography may display sinus bradycardia or tachycardia, right bundle branch block, atrial fibrillation, first-degree atrioventricular block, and supraventricular premature beats. Trichinellosis is definitively diagnosed by revealing the encysted larvae through a muscle biopsy, but this method cannot be applied to all patients. Thus, serologic tests may be helpful for the diagnosis, and an enzyme-linked immunosorbent assay is the most commonly used assay with 99% sensitivity and 91% to 96% specificity []. Finally, the diagnosis of an infection depends on the correlation of various clinical symptoms and the relevant laboratory results, as well as a carefully taken anamnesis. Although medical treatment during the early stages of infection has been shown to be effective, the treatment of trichinellosis with drugs has been debated for years. The medications used to treat trichinellosis include anthelmintics and glucocorticosteroids. There are several known anthelmintics such as mebendazole, albendazole, and thiabendazole. Among them, a certain study revealed that thiabendazole has certain side effects of intolerable dizziness, urticaria, generalized maculopapular rash, and tinnitus; hence, the use of thiabendazole to treat trichinellosis has been discontinued. Drug therapy is effective if it starts within 1 week (early stage) after infection, but it is difficult to discriminate whether the patient is infected or not until the occurrence of specific symptoms. Therefore, the patient is usually recommended to take medications within 4 to 6 weeks after infection, and 48 hours after ingestion of undercooked or raw meat, particularly that of wild boars or bears. The steroid treatment of glucocorticoids should be combined with mebendazole or albendazole for the protection of immediate-type hypersensitivity reactions. Additionally, albendazole should be administered with care because the administration of dexamethasone might increase the serum level of albendazole.

A 74-year-old man presented with mild dyspnea and chest discomfort for 30 months. The symptoms had deteriorated 3 months before his visit to our hospital. Trans-thoracic echocardiographic findings showed a left atrial echogenic mass (2×1.5 cm) (). A provisional diagnosis of a left atrial (LA) myxoma was made, and the patient was admitted for the surgical excision of the tumor. He was hemodynamically stable, and his laboratory results were within normal limits. Coronary angiography revealed a 50% stenosis on the mid-portion of the left anterior descending artery (LAD). We planned the concomitant operation with mass excision and coronary artery bypass. Under general anesthesia with supine position, median sternotomy was performed as usual. Conventional cannulation was performed, and the right atrial wall and the interatrial septum were incised. The cardiac mass was totally removed. Further, we anastomosed the left internal thoracic artery to the distal portion of the LAD. The resected mass was oval and was made of a white jelly-like material. We resected the mass including the myocardium, and the LA wall was closed by a prolene suture. The patient was transferred to the general ward the next day. Hemangioma of the heart presenting as a primary cardiac tumor is extremely rare; it accounts for approximately 2.8% of all primary resected heart tumors []. Its histological subtypes are as follows: 1) cavernous hemangioma, 2) capillary hemangioma, and 3) arteriovenous hemangioma or cirsoid aneurysm []. The cavernous hemangioma is composed of multiple thin- and/or thick-walled dilated vessels. The capillary hemangioma has lobules of endothelial cells forming small, capillary-like vessels. The arteriovenous hemangioma consists of dysplastic thick-walled arterioles, venous-like vessels, and capillaries. In our case, the tumor is a capillary hemangioma that shows ill-defined aggregates of closely packed, thin-walled capillaries filled with blood cells (). Cardiac hemangioma can occur at any age. Further, tumors may be located in any heart chamber, the pericardium, the endocardium, or the myocardium []. Fifty-six cases were reviewed by Han et al. [], and the localization of cardiac hemangiomas was the right ventricle in 20 cases (35.7%), the left ventricle in 19 cases (33.9%), the right atrium in 13 cases (23.2%), the interatrial septum in 6 cases (10.7%), the interventricular septum in 6 cases (10.7%), and the left atrium in 4 cases (7.1%). Multiple extensive tumors were noted in 17 cases (30.4%). Very few cases of cardiac hemangiomas have been reported to be arising from the LA wall, mimicking the classic presentation of a myxoma. In our patient, the tumor was located in the orifice of the right lower pulmonary vein. However, venous flow obstruction was not observed. The clinical symptoms depend on the tumor's location and size. Some cardiac hemangiomas are asymptomatic and are discovered during cardiac surgery or upon autopsy. In symptomatic patients, cardiac hemangiomas cause arrhythmia, pericardial effusion, congestive heart failure, right ventricular outflow tract obstruction, coronary insufficiency, and sudden death []. Diagnosis can be made by echocardiography, computed tomography (CT), or magnetic resonance imaging (MRI). CT and MRI help to evaluate the dimensions and the invasiveness of the tumor. Coronary angiography is sometimes useful in revealing how the tumor is fed and its characteristic tumor blush []. However, we cannot find any feeding vessel or tumor blush in preoperative coronary angiography. In the opinion of a cardiologist, the tumor had a myxoma-like shape and exhibited echogenicity. Therefore, myxoma was strongly suspected in the preoperative evaluation. Atrial hemangiomas, particularly those attached to the LA wall, may be erroneously diagnosed as myxomas. However, there are no myxoma cells or lepidic cells that can be found usually in cardiac myxomas, and cellular areas with numerous capillaries are usually present []. The natural history of cardiac hemangioma is unpredictable. Patients with a resectable tumor usually have a good prognosis, but those with an unresectable tumor may have a poor prognosis because of ventricular tachycardia, sudden death, local progression, or systemic dissemination of the malignant tumor []. The surgical outcome was generally favorable. A case of recurrence has not been reported thus far. Therefore, we believe that if surgical resection is possible, surgery is the best way to treat cardiac hemangioma. Cardiac hemangioma is a rare disease; furthermore, a tumor arising from the LA wall and misconceived as a myxoma is extremely rare. We removed the mass misdiagnosed as a myxoma and pathologically confirmed it to be a cardiac capillary hemangioma. In order to share our experience, we report this case, which we successfully treated.

xref #text xref #text

A 62-year-old male with a history of tobacco abuse and newly diagnosed small-cell lung cancer (T1N1M0) two months earlier was readmitted in the hospital with shortness of breath for one day. He had been on chemo-radiation for his lung cancer over the course of the previous month. Meanwhile, four days prior to this admission, he was diagnosed with acute idiopathic pericarditis for which he was started on Colchicine 0.6 mg daily and Naproxen 500 mg three times a day; the patient was discharged on the same day. In this presentation, he had a temperature of 100°F. His blood pressure was 80/40 mmHg, heart rate was 120 beats/min, and respiratory rate was 22 breaths/min. He was slightly hypoxic and was placed on 3 L/min of oxygen by nasal cannula with 96% of SpO. The physical exam was significant for marked jugular venous distension without Kussmaul's sign and pulsus paradoxus. His breath sounds were clear, but he had distant heart sounds without murmur, rub, or gallops. His peripheral extremities were cool and mottled. His labs were significant; the total white count was 1,600/µL, 61% segmented cells and absolute neutrophil count was 1,040/µL, creatinine was 2.9 mg/dL (from a baseline of 0.8 mg/dL), blood urea nitrogen was 62 mg/dL, and lactic acid was 6 mmol/L (normal lactic acid level, 0.67 to 1.8 mmol/L). An electrocardiogram showed sinus tachycardia having normal voltage with diffuse ST-segment elevations. Urgent transthoracic echocardiography (TTE) revealed large pericardial effusion causing tamponade physiology () and right ventricular collapse in diastole and dilated inferior vena cava (). Emergency pericardiocentesis was performed and substantially drained 800 mL of the green fluid (). The patient was started on vancomycin and cefepime empirically for purulent pericarditis (PP). Repeat TTE on the next day showed loculated pericardial effusion for which he underwent partial pericardiectomy. Cultures from the pericardial fluid grew and , species, and group C. His antibiotics were tailored to intravenous (IV) ertapenem. The source of the polymicrobial pericarditis was unclear despite an extensive work-up including a computed tomography scan of the abdomen and the chest. The patient also had negative blood, sputum, and urine cultures. Subsequently, his acute renal failure and sepsis resolved. He was then discharged home on the eighth day of hospitalization; later, he completed the course of IV ertapenem for two more weeks. There was no recurrence of pericardial effusion according to the TTE 4 weeks following discharge. The patient eventually resumed chemo-radiation therapy 2 months after hospital discharge. PP is rare in this modern antibiotic era [,]. It is usually caused by gram-positive cocci, mostly and , in the presence of the primary foci of infection [,]. Bacterial pericarditis is associated with considerable morbidity and death despite the advances in diagnosis and treatment []. Most of the common etiologies of acute pericarditis and pericardial effusion in developed countries are idiopathic or viral [,]. The other common causes of pericardial effusion include neoplasm (36%) and uremia (20%) []. However, in 30% of the patients of non-infectious pericardial effusion, the cause cannot be determined in spite of the pericardial fluid and tissue analysis []. Bacterial PP has become very rare since the advent of antibiotic usage, particularly in the developed world [,,]. The incidence of bacterial pericarditis accounts for less than 1% of pericarditis, the incidence of which has decreased further with the availability and widespread use of effective antibiotics [,]. Gram-positive cocci are the major causes of bacterial pericarditis. Before the introduction of antibiotics, was responsible for most cases of PP. Penicillin availability has decreased not only the rates of pneumococcus infection in general but also the rates of PP []. The other common causes of bacterial pericarditis are , , , and Group A [,]. Further, certain gram-negative anaerobic organisms such as , , , and are discussed in the literature as causes of PP []. The other rare anaerobes isolated from patients with pericarditis are , , , species, and []. Our patient developed PP due to rare polymicrobial infection with group C, and , and species. Combinations of such pathogens have never been discussed in the literature as the causes of pericardial effusion. The species and the species are predominantly gram-negative anaerobic bacteria and are indigenous flora on all mucosal surfaces predominantly of the oral cavity []. group C are facultative anaerobic gram-positive cocci that occur in pairs or chains. They are part of the endogenous microbial flora of the pharynx and are considered to be common causes of infection in several animal species. There is little information about their overall importance as a cause of human infection []. Unlike our case, bacterial pericarditis rarely occurs as a primary site of infection. The organisms usually invade as opportunistic pathogens through a break in the mucosa and cause infection. They have an opportunity to penetrate tissues and then to set up infection under certain circumstances such as surgical or other trauma or when tumors arise at the mucosal surface []. This results as a complication of an infection originating elsewhere in the body, arising by direct spread or hematogenous dissemination []. Pneumonia was the primary source of infection for a majority of the patients (72%) in the pre-antibiotic era, compared with only 22% of the patients in this modern era []. Other primary sources of infection include empyema, myocarditis, suppurative mediastinal lymphadenitis, and infective endocarditis, which cause direct bacterial seeding to the pericardial space and pericarditis []. The other known primary sources of infection causing direct infection to the pericardium are trauma and contiguous infections such as traumatic endotracheal intubation in nasopharyngeal carcinoma, cardio-thoracic surgery, or catheter drainage, by spread from an intrathoracic, myocardial, or subdiaphragmatic focus [,]. In our case, the source of polymicrobial pericarditis was unclear. The organisms retrieved were normal flora that resides inside the oropharynx as mentioned earlier. In our case, we believe that purulent pericarditis was spontaneous in the setting of an immunocompromised state via a hematogenous spread of polymicrobial agents. The most likely sequence of events to explain our patient's condition was that he developed a transient polymicrobial bacteremia from a mucosal breech in the oropharynx or proximal esophagus without frank perforation. After getting seeded into the pericardial space, it developed into a polymicrobial empyema. However, there is no report of an immunocompromised patient who developed polymicrobial pericarditis in the absence of any other primary infections. Purulent pericarditis is a life-threatening condition with a fatality rate of 100% if untreated. The mortality rate even with advance treatment varies from 40% to 75%, and death is mostly due to cardiac tamponade, systemic toxicity, cardiac decompensation, and constriction []. Therefore, it is important to recognize this condition early for urgent intervention. Unfortunately, purulent pericarditis is so rare and fulminant that in more than half of the cases the diagnosis is made postmortem []. Therefore, once purulent pericarditis is suspected clinically, TTE needs to be performed urgently for the assessment of pericardial effusion because these patients might require prompt echocardiography-guided drainage and placement of an indwelling pericardial catheter []. However, loculation with fibrin accumulation may occur resulting in a pericardial empyema, making percutaneous drainage incomplete and ineffective. In such cases, a pericardial window or extensive pericardiectomy usually through subxiphoid pericardiotomy is essential to achieve adequate drainage [,]. Constrictive pericarditis occurs over the course of purulent pericarditis in at least 3.5% of the cases, as shown in a large review []. However, there is no existing consensus on early pericardiectomy in order to prevent constrictive pericarditis. In addition, the exact timing and type of surgery is still debatable []. Moreover, few authors propose intrapericardial fibrinolysis, a less invasive procedure, as an alternative to surgery for PP management. It is believed that frequent irrigation of the pericardial cavity with urokinase or streptokinase using large catheters might liquefy the purulent exudate, but there is a lack of definitive evidence as a treatment for PP and for prevention of persistent PP and constrictive pericarditis []. Meanwhile, in retrospective studies, as compared to simple drainage, systematic pericardiectomy led to the prevention of constrictive pericarditis with a better clinical outcome [,]. Our patient underwent emergency pericardiocentesis with the placement of a pericardial drain and later underwent pericardiectomy relieving the effusion without the use of intrapericardial fibrinolysis. In addition to surgery, antimicrobial therapy is equally important for treating bacterial infection. Identification of the pathogens and determination of their antimicrobial susceptibility and beta-lactamase production are essential for adequate selection of an antibiotic therapy effective against these organisms [,]. Recent data have shown that increasing numbers of anaerobes are showing resistance to penicillin due to β-lactamase production [,]. Our patient received ertapenem, which is a broad-spectrum antibiotic for serious infection caused by both aerobic and anaerobic gram-positive and gram-negative organisms. Furthermore, because of a lack of guidelines on the duration of antibiotic therapy in the case of PP and by analogy with empyema, a treatment of at least 3 weeks seems reasonable []. Based on this review, our patient received 3 weeks of antibiotics, resulting in a complete resolution of the infection. Despite advances in diagnostic and treatment modalities, PP with its complications remains a challenging problem in clinical practice even in the developed world [,]. To conclude, oropharyngeal bacteria may seed into the pericardium and lead to acute fulminant pericarditis were the primary source of infection cannot be identified. Because of the rarity and high fatality of such a case, a high index of suspicion is needed to make an early diagnosis in an immunocompromised patient who is suspected of having acute viral or idiopathic pericarditis. The immediate surgical treatment and thoughtful selection of antibiotics can prevent the fatality. We report a case of purulent pericarditis causing cardiac tamponade due to rare polymicrobial infection in a patient with lung cancer who was recently started on chemo-radiation therapy. The patient was successfully managed in a tertiary care center with a combination of antibiotic therapy, emergency pericardiocentesis, and pericardiectomy.

A 45-year-old male patient was admitted to an outpatient clinic with blunt thoracic trauma after falling from height (work-related accident) and was referred to Kocaeli University Faculty of Medicine after the detection of ischemia on his electrocardiogram. In the physical examination, the vital signs were stable, but pain and tenderness was detected on his ribs in the thoracal examination. The other systems were found to be normal upon examination. However, it was worth noting the patient had a history of hypertension. A T inversion was detected in D1, aVL, and V3, V4, V5, V6 derivations in the electrocardiogram (ECG). There was no pathology in the chest radiographs. Further, there were no additional pathologic findings in the blood tests and the serological tests. Moreover, decreased left ventricular preload and after load were detected. The coronary angiography was normal. Echocardiography showed minimal mitral insufficiency and a cystic lesion (size: 25×27 mm) next to the left ventricle anterolateral wall (). Cardiac magnetic resonance imaging (MRI) documented a cystic lesion on the lateral wall of the left ventricle, approximately 3.5×2.5 cm in size; this lesion was initially considered to be similar to a hydatid cyst (). There were no additional cyst hydatid lesions found in the computerized tomography scan of the abdomen and the thorax. Hydatid disease is endemic in farming areas but occurs worldwide. In particular, the incidence is greater in the cattleor sheep-raising areas of the world, such as Australia, South America, South Africa, and Panama, the Mediterranean countries, and the Middle East. The most common site of the disease is the liver, followed by the lungs, kidney, bones, and brain. Other organs are very rarely affected. Any race can be affected, and this disease is common in both men and women. Its symptoms depend on the affected organ; for example, liver cysts cause jaundice and abdominal discomfort, while lung cysts cause cough, chest pain, and hemoptysis (coughing up blood). Hydatid cyst is a human parasitic disease in which multiple-visceral involvement is generally caused by the metacestode of the tapeworm or larva of the species of the genus echinococcus. It can be asymptomatic according to its localization but can cause sudden death. It can be usually detected in the liver and lungs of humans. Cardiac involvement is more seldom than other localizations []. However, the most frequently involved cardiac region is the left ventricle; the right ventricle and the interventricular septum are the less affected regions, respectively []. There is no characteristic clinical presentation of a cardiac cyst hydatid. The age of the cyst, size of the cyst, and the extent of calcification are decisive for clinical presentation in patients. Patients generally present at outpatient clinics with complaints of subjective symptoms such as palpitation, dyspnea, and atypical angina pectoris []. The rupture of cysts may cause fever, urticaria, and serious anaphylactic reactions. Diagnosis is performed using imaging techniques, examination of the cyst fluid, and serological tests. Cardiac hydatic disease was first mentioned by Williams in 1836. The first diagnosis of hydatid disease was reported by Cerne et al. []. Cysts on the ventricular wall grow toward either the epicardium or the endocardium. A cardiac cyst can lead to life-threatening consequences such as myocardial infarction caused by the compression of a coronary artery, pulmonary edema caused by a disturbance in the valvular mechanisms, or outflow tract obstruction and sudden cardiac arrest caused by a variety of conduction defects []. A cardiac cyst is a diagnostic and therapeutic challenge due to the variability of signs and symptoms at its presentation, its numerous and often unpredictable preoperative complications, and the risk of complications associated with cardiac surgery. Cardiac hydatid cysts should be removed surgically, even in asymptomatic patients. Our patient was asymptomatic for years and did not have any complaints associated with hydatid disease before the accident when a cardiac hydatid cyst was diagnosed by the thorax CT. Arrhythmia, electrical conduction system defects and bundle branch blocks, myocardial infarction, and non-specific ST segment and T-wave changes can be seen in the ECG in the cases of cardiac hydatid cysts []. A T inversion was detected in D1, aVL, and V3-V6 in the ECG of our patient; however, the patient's coronary angiography was normal. Echocardiography is used in the differential diagnosis of cardiac cyst hydatid. Cardiac cyst hydatid involves many septums and occasionally, daughter cysts. Because of the thin membrane surrounding the cyst it can be distinguished from other intracardiac masses by echocardiography. A hydatid cyst can be in the form of a solid mass or have a multiloculated cystic formation in some cases []. Cardiac MRI and thoracic CT have been utilized in the diagnosis of hydatid disease. In our case, the cardiac MRI revealed normal intensities, sizes, and wall thicknesses of the right ventricle, left atrium, and right atrium. The interventricular septum was measured to be 14 mm. Further, a hypodense mass (size: 3.5×2.5 cm) was observed in the T1-weighted sequence; the T1- and T2-weighted sequences of the cyst rim revealed hypointensity. A hydatid cyst can be managed either by nonoperative or by operative methods. The most common treatment strategy of echinococcosis is 6 months of medical treatment with albendazole or mebendazole or a combination of albendazole and praziquantel after surgical treatment []. We chose surgical excision under cardiopulmonary bypass, and the albendazole treatment was pursued after surgical cyst excision in this patient. The follow-up of the patient was performed using the imaging modalities. The echocardiography and thorax CT conducted 6 months postoperatively were normal. The patient is still being followed in the outpatient clinic of infectious diseases. In conclusion, cardiac hydatid cysts are rare. In patients with cardiac masses, the possibility of cardiac hydatid disease should be kept in mind, particularly in the endemic zones. Due to the high risk of their associated complications, cardiac hydatid cysts should be removed surgically, even in asymptomatic patients.

xref sub #text Despite advances in surgical techniques, the mortality rates of ATAAD have remained high in patients with brain malperfusion. Occlusion of the aortic arch vessels, which is propagated from the dissected aorta, commonly leads to neurological deficit []. The main factor causing malperfusion is the dynamic obstruction of the false lumen or hypotension itself. In most cases, this can be relieved by restoring sufficient true luminal blood flow via surgery. In the present case, we described a patient who had ATAAD and a right carotid artery tear. The patient was treated via stent placement at the time of the surgery, using a hybrid technique. There are three important points to understand from this case. First, whenever the patient's condition is acceptable, evaluations of the aortic arch vessels are essential for selecting the arterial approach for cardiopulmonary bypass in ATAAD involving the aortic arch. A previous study elucidated when the malperfusion occurs: 1) pre-surgery malperfusion, 2) malperfusion at the institution of cardiopulmonary bypass, 3) malperfusion occurring after aortic cross clamping, and 4) malperfusion postdistal aortic anastomotic construction []. Clamping the innominate artery for SACP may have caused injuries such as intimal tear and dissection, resulting in a reduction of carotid blood flow. This speculation is consistent with the fact that rSO dramatically decreased when SACP was initiated. Malperfusion, at the beginning of CPB, can be generated not only by retrograde perfusion via the femoral artery but also by antegrade perfusion via the subclavian artery. Therefore, precise radiographic evaluation should be performed to ensure adequate cerebral blood flow. If rSO drops at the time of CPB initiation, surgeons should promptly change the arterial cannulation site. Second, rSO monitoring is a very reliable method to detect brain malperfusion. In addition, it is important to initiate monitoring before anesthetic induction to detect problems by observing serial saturation changes. Near-infrared spectroscopy (NIRS) provides continuous rSO monitoring and is a simple noninvasive method for monitoring cerebral perfusion. NIRS-guided SACP allows a safe approach to aortic arch surgery, and a unilateral progressive discrepancy in rSO indicates the occurrence of brain malperfusion. It is recommended that additional perfusion should be addressed immediately, when major hemispheric discrepancies appear [,]. In our case, rSO did not recover at the end of the surgery. Thus, we immediately performed confirmatory angiography. Third, if rSO drops without any apparent anatomic or procedural reason, diagnostic angiography, as a hybrid technique, is strongly recommended. As for the discrepancy in rSO in our case, even though aortic replacement was completed, we ascertained the luminal integrity of the innominate artery and suspected insufficient brain perfusion due to dissection or re-dissection of the carotid artery. Angiography is needed to confirm the status of the carotid artery lumen. In our case, we found a tear on the right common carotid artery and achieved rSO recovery through prompt carotid stent placement. After an open arterial stenosis, sufficient brain perfusion was restored, and no postoperative neurological symptoms developed. There are several published experiences with acute carotid revascularization in ATAAD cases involving the aortic arch vessels. In these cases, carotid stent placement was performed to recanalize the artery or seal an intimal flap, and a high success rate was achieved [,]. In summary, in ATAAD patients with decreased mentality, preoperative evaluation of the aortic arch vessels, continuous monitoring of rSO, and the use of a hybrid technique that involves confirmatory angiography for detected problems will reduce neurologic complications from brain malperfusion. In addition, if a hybrid operation room is available, surgeons can save additional time in finding and fixing vascular complications.

A 73-year-old man visited Konkuk University Medical Center with a complaint of severe abdominal pain. He had been diagnosed with chronic renal failure and treated with hemodialysis for seven years. The patient had undergone endovascular aneurysm repair (EVAR) for abdominal aortic aneurysm (AAA) (size: 82 mm) utilizing bifurcated excluder prosthesis (W. L. Gore Associates Inc., Flagstaff, AZ, USA) at another hospital in 2006. Upon the completion of the EVAR procedure, there was no evidence of an endoleak, and the renal arteries as well as the internal iliac arteries were intact. Six years later, he had developed a type 2 endoleak sustained by several lumbar arteries; further, the maximum transverse diameter of AAA had increased to 110 mm. On his physical examination, he was found to have mild hypertension (138/95 mmHg) with a regular heartbeat of 69 beats/min and body temperature of 36℃. Mild abdominal thrill was observed upon palpation, but no other specific abnormalities were identified. A computed tomographic angiography revealed endoleaks passing posteriorly into the enlarged aneurysm sac that was measured to be 110 mm in size (). First, we performed selective angiography with left internal iliac artery catheterization for coil embolization. An angiography verified a contrast material entering the aneurysm sac via the lumbar arteries (). We subsequently proceeded to the coli embolization of the penetrating lumbar arteries. However, an attempt for the endoluminal embolization of the lumbar arteries was unsuccessful due to anatomic variations and their complex interrelations, which impeded the access to the endovascular catheter. Therefore, we adopted a surgical approach. A midline laparotomy was performed to expose the aneurysm sac after further informed consent. We cautiously dissected around both the renal arteries to secure the route for emergency aortic cross clamping. Prior to opening the aneurysm sac, a 16-gauge catheter was inserted, confirming the sac to be rather solid to the touch and the presence of a serosanguineous fluid. Upon opening the sac, old hematoma and blood clots were identified, and the endovascular graft was intact; otherwise, pulsatile backflow bleeding from several lumbar arteries and the inferior mesenteric artery was noted. We evacuated all the blood clots and thrombi, and then, the two lumbar arteries on the posterior wall of the aneurysm sac and the inferior mesenteric artery were oversewn with a 5-0 prolene suture. After confirming that there was no evidence of any other source of bleeding, we also applied autologous fibrin glue at the suture sites for hemostasis. The remnant sac was then carefully closed with an absorbable suture to protect the endograft. The patient was transferred to the general ward from the intensive care unit 2 days after the operation. A postoperative follow-up computed tomography (CT) revealed satisfactory results displaying no evidence of the endoleak and a decreased aneurysm sac size of approximately 56 mm (). The patient recovered uneventfully and was discharged on postoperative day 10. The follow-up CT at 1 month after the surgery revealed no evidence of an endoleak with a completely excluded aneurysm sac. For 12 months after surgery, the patient visited the outpatient clinic periodically in good condition. Nowadays, EVAR has been considered a safe and effective treatment for abdominal AAAs. EVAR has many benefits, which include relatively low operative mortality, morbidities, relatively short operative time, and short duration of hospitalization. In general, the early and midterm outcomes of EVAR are not poor; however, long-term durability remains elusive due to the presence of endoleaks. An endoleak is the existence of a continuous blood flow outside the endograft and within the aneurysmal sac. In general, patients get a medical check up such as the physical examination, the abdominal simple X-ray, and the contrast enhanced CTA at the 1 month after EVAR, at 6 month and yearly thereafter. There are several types of endoleaks with different causes requiring specific individual plans. Endoleaks have been reported to be up to 60% of the complications after EVAR and are responsible for more than 45% of all reinterventions []. Type 1 or type 3 endoleaks could be considered a failure of endovascular repair and require immediate reintervention because of a highly potential aortic aneurysm rupture, whereas type 2 endoleaks have been regarded as a benign condition. Some studies have reported that type 2 endoleaks occurs in 20% to 30% of the patients at some interval after EVAR but does not require further treatment because they are usually transient and resolve by themselves []. However, other researchers advocate that more aggressive management is needed to control the type 2 endoleaks persisting for more than 6 months, irrespective of the changes in the aneurysmal sac []. Although the significance of asymptomatic type 2 endoleaks has been debated, persistent type 2 endoleaks associated with an increase in the diameter of the aneurysm sac actually increase the possibility of rupture. Successful endovascular aneurysm repair has been reported to be the cause of a decrease in the aneurysm sac volume of more than 10% at intervals of 6 months with continuous regression. Aneurysm enlargement or shrinkage is generally dependent on the pressure in the aneurysm sac, and type 2 endoleaks may be responsible for the pressurization of AAA []. Persistent type 2 endoleaks are usually defined as aneurysm enlargement that remains for more than 6 months after EVAR. A more aggressive management may be suggested in patients with persistent type 2 endoleaks not resolving spontaneously within 6 months, even without aneurysm enlargement. Various methods have been proposed for the treatment of type 2 endoleaks without any universal agreement, while distinct indications of reintervention or surgical repair still remain controversial. Further treatment is usually recommended to prevent rupture if continuous endoleaks persist for more than 6 months or an aneurysm sac enlargement (>5 mm) is identified after EVAR []. The most common technique for type 2 endoleaks is the transarterial embolization of the feeding vessels with coils or glue materials. Transarterial embolization is mostly targeted at the lumbar arteries, hypogastric arteries, and inferior mesentery artery, which are directly concerned with the type 2 endoleaks. However, selective catheterization of these target vessels may be technically difficult, even when multiple small complex communicating vessels are intertwined. Although the failure and recurrence rates after the transarterial embolization can be as high as 80%, another technique that embolizes both the feeding and the draining vessels inside the aneurysm sac with a microcatheter may be challenged []. In addition, translumbar embolization, transcaval embolization, and laparoscopic ligation can be proposed. The success rate of these methods is slightly higher than that of transarterial embolization, but there is a risk of hemorrhagic complications during the translumbar and transcaval procedures because these procedures involve the penetration of the aortic aneurysmal wall. In case multiple patent feeding arteries are noted, laparoscopic ligation would be a better option. However, it requires advanced skill and is more invasive than embolization techniques. Open surgery could be regarded as an option after the failure of embolization techniques. However, it might be better to avoid a late surgical graft replacement if possible because of the higher morbidity and mortality risk due to the frequent need for aortic cross clamping, endogaft-induced inflammatory change around the vena cava, and the increase in the chances of anastomotic bleeding because the aortic wall is too thin. Recently, the idea of a surgical alternative to open endograft removal has been considered, which is sacotomy followed by the removal of the thrombus from the aneurysm sac and ligation or sutures on the collateral feeding vessels. Hinchliffe et al. [] first reported successful transperitoneal sacotomy applied to a persistent type 2 endoleak in an elderly patient with multiple patent lumbar arteries and an inferior mesenteric artery. In 2005, Ferrari et al. [] also described their surgical experience of sacotomy in four patients with sac opening and direct suturing without exposing the proximal and distal necks. More recently, Faccenna et al. [] reported two cases treated with sacotomy, one of whom is a ruptured aneurysm because of the sac expansion. There are a couple of advantages of sacotomy. This approach can allow a direct inspection of the aneurysm sac without aortic cross clamping. It also causes a regression of the aneurysm sac size by the removal of hematoma or thrombus and lowers the recurrence rate by the localization of the bleeding vessel and direct suturing on the target vessels. Furthermore, we can achieve the time-saving effect by avoiding endograft removal or reimplantation, which may cause endograft damage. In summary, transperitoneal sacotomy and direct suturing endoleaks can be a feasible and alternative method of treating patients with persistent type 2 endoleaks and increasing diameter of the aneurysm sac. It may also be performed in a case wherein multiple communicating endoleak channels are encountered or endovascular techniques are contraindicated or in dangerous situations. Although rare, persistent type 2 endoleaks after EVAR can be treated successfully if the diagnosis is confirmed in detail and sufficient information is available preoperatively.

A 48-year-old female patient visited our cardiovascular outpatient department for treatment of a mass-like dilated neck vein as a procedure concomitant with thyroid cancer surgery. We could detect the gross engorgement of the neck mass in the supine position or by using the Valsalva maneuver when the patient was in an erect position (). Preoperative contrast-enhanced computed tomography (CT) of the neck showed a venous dilatation, similar to a cystic mass (size: 2.5×2.2 cm) communicating with the left external jugular vein (). After thyroidectomy under general endotracheal anesthesia, an additional separate skin incision (length: approximately 2.5 cm) along the neck dermatome was made because of the distance from the collar incision (approximately 5 cm). We accomplished aneurysmectomy by the division of both ends of the external jugular vein and a tributary of the aneurysm in the subcutaneous layer (). No intraluminal thrombus was observed upon a gross inspection of the specimen. Pathological findings confirmed that the diagnosis was consistent with a saccular venous aneurysm. In contrast to focal thinned media with thickened intima by fibrous tissue in a varicose vein, the vascular wall thickness of a venous aneurysm is relatively homogenous with thickened media and localized thickened intima (). The patient was discharged without any complications. Acquired venous aneurysm in the neck area is a very rare disease and requires a differential diagnosis including enlarged cervical lymph node, tumor of the adjacent organs, laryngocele, and various cystic formations. According to the incidence rate, the internal jugular vein is a more frequent site of aneurysm development than the external vein, but the anterior jugular vein is the least frequent site []. Saccular aneurysm is less common than fusiform aneurysm []. Fusiform venous dilatation is frequently diagnosed in children with a congenital etiology and right-side predominance but appears in adults as an acquired form with left-side predominance; the suggested mechanism in adults is the patient's hypertensive aorta compressing the left innominate vein, resulting in venous dilatation []. In addition, the etiology of an acquired venous aneurysm can involve tumors, inflammation, trauma, or spontaneous development []. Of the aneurysms resulting from iatrogenic causes, pseudoaneurysm at the internal jugular vein appears most frequently; a case at the external jugular vein has also been reported []. However, the patient in the present case had no previous neck procedures or trauma history. Therefore, the etiology of this case is considered to be spontaneous development. Clinically, although painful swelling is associated with intraluminal thrombus, saccular aneurysm appears with painless swelling. The Valsalva maneuver, performed by moderately forceful attempted exhalation against a closed airway, usually performed by closing one's mouth and pinching one's nose shut while pressing out as if blowing up a balloon, can induce venous engorgement characteristically. However, by manual compression of an engorged neck mass in the case of the external jugular vein, the Valsalva maneuver cannot make the swelling prominent []. Ultrasonography has been the most useful diagnostic modality for this disease []. Because the patient had already undergone contrast-enhanced CT imaging for thyroid cancer, ultrasonography was not required in this case. Cosmetic concerns, painful swelling due to intraluminal thrombosis, or phlebitis of the jugular vein are all motives for surgical treatment. Otherwise, reassurance and regular follow-up can be a substitute for prompt treatment of an asymptomatic venous aneurysm. Although embolic complications have been reported at a lower incidence rate in jugular venous aneurysms, active treatment cannot be neglected. A recent report documented a pulmonary thromboembolism derived from an external jugular venous aneurysm [], and large-scale studies are needed to overcome the limitations of rare case reports []. Thus, all cases of venous aneurysm should be reported for further study. Surgical resection can minimize the risk of pulmonary thromboembolism as well as aneurismal rupture induced by growth and can confirm the histopathological diagnosis. Aneurismal resection is accomplished by excision with ligation in the saccular form, and exclusion via bypass in fusiform aneurysms [].